Improved t cell and use thereof

By overexpressing a truncated IL7Ra mutant and CD47 fusion protein (SAP protein) in T cells, combined with gene knockout of TCR and HLA molecules, the problems of short survival time and easy clearance by the host of universal CAR-T cells were solved, and enhanced proliferation and survival ability were achieved.

WO2025241665A1PCT designated stage Publication Date: 2025-11-27NANJING MIRACLE BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/082078
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-20
Filing Date
2025-03-12
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

Universal CAR-T cells lag behind autologous CAR-T cells in terms of efficacy and durability, and are easily cleared by the host immune system, resulting in a shorter survival time.

Method used

By overexpressing a truncated IL7Ra mutant on T cells and binding it to a fusion protein of CD47 (SAP protein), the proliferation capacity is enhanced and the immunogenicity is reduced. At the same time, the survival capacity is improved by knocking out TCR, HLA class I and HLA class II molecular genes.

Benefits of technology

It significantly improved the in vitro and in vivo proliferation and long-term survival of universal CAR-T cells, reduced the risk of clearance by the host immune system, and enhanced the anti-apoptotic ability in vivo.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025082078-FTAPPB-I100001
    Figure PCTCN2025082078-FTAPPB-I100001
  • Figure PCTCN2025082078-FTAPPB-I100002
    Figure PCTCN2025082078-FTAPPB-I100002
  • Figure PCTCN2025082078-FTAPPB-I100003
    Figure PCTCN2025082078-FTAPPB-I100003
Patent Text Reader

Abstract

Provided are a T cell with reduced immunogenicity, in particular a CAR-T cell having self-activation and defense capabilities, and a preparation method therefor. The T cell has reduced immunogenicity, so that the resistance thereof to NK cells and macrophage is enhanced, and the survival and proliferation capabilities of the T cell, especially the CAR-T cell, in a host are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Improved t cells and uses thereof

[0001] Related references

[0002] This application claims priority to Chinese patent application 202410626978.2, filed May 20, 2024, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present application relates to the fields of genetic engineering and cell biology, in particular to T cells with reduced immunogenicity, methods for making the same, and related uses. BACKGROUND

[0004] Chimeric antigen receptor T cell (CAR-T) therapy has achieved great success in anti-tumor treatment, especially for hematological malignancies. Nevertheless, today’s approved CAR-T therapies require “customization”, long preparation time, and high treatment cost, with a price tag of millions of dollars, which makes it unaffordable for ordinary people. Universal CAR-T therapy is considered as a key to make CAR-T therapy accessible to the general public.

[0005] Universal CAR-T is derived from T cells of healthy donors, which can generate a large number of universal CAR-T cells to provide off-the-shelf cell therapy for patients, making it a potential ideal means for the commercialization of cell therapy. In theory, universal CAR-T can perfectly solve the problems of high price and lack of off-the-shelf of autologous CAR-T. However, the gap between theory and reality is quite deep. In actual clinical practice, universal CAR-T has some problems in terms of efficacy and durability.

[0006] One problem of universal CAR-T is that the in vitro and in vivo proliferation and survival time after knockout of TCR and the like are significantly reduced, thereby resulting in reduced efficacy. Although there is no head-to-head clinical trial, according to the current data, the universal CAR-T still has a certain gap compared with autologous CAR-T in terms of efficacy and durability. Taking the universal BCMA CAR-T candidate product ALLO-715 of Allogene as an example, according to the 1a phase clinical data of ALLO-715 for treating relapsed / refractory multiple myeloma (MM) published in Nature Medicine, in a follow-up time of 10.2 months, the objective response rate (ORR) of patients was 55.8%, 34.9% of the patients achieved partial remission or better, and the median duration of response was 9.2 months. While the autologous CAR-T therapy performed by Bristol-Myers Squibb's BCMA CAR-T therapy Abecma, also for the indication of MM, the ORR reached 72%, the complete remission rate (sCR) reached 28%, and the median duration of remission was 11 months; the BCMA CAR-T therapy Carvykti of Legend Biotech, the ORR reached 98%, the sCR reached 82.5%, and in a follow-up time of 28 months, the median progression-free survival has not been reached.

[0007] Therefore, there is a need in the art for improved T cells (particularly CAR-T cells) to further reduce immunogenicity, reduce clearance by the host immune system, and thereby increase survival. SUMMARY

[0008] The present application achieves the effect of enhancing the proliferation ability of T cells, especially CAR-T cells, by overexpressing a truncated IL7Ra mutant in T cells, and reduces immunogenicity in combination with the knockout of specific endogenous genes, thereby providing more favorable conditions for the survival of T cells, especially universal CAR-T cells, in the host. Further, the present application further reduces the immunogenicity of T cells by overexpressing a truncated IL7Ra mutant in T cells and a fusion protein of CD47 protein (the fusion protein is also called SAP (self activating and protective motif) protein). In particular, the fusion protein can provide a sustained basal anti-apoptotic survival signal and a weak proliferation signal to universal CAR-T cells, and can resist the attack of macrophages and NK cells, effectively enhancing the long-term survival ability of universal CAR-T in vitro and in vivo, and reducing the in vivo loss rate.

[0009] In one aspect, the present application provides a T cell engineered to express an interleukin-7 receptor alpha (IL7Ra) variant comprising a transmembrane region and an intracellular region. In some embodiments, the IL7Ra variant comprises a mutated transmembrane region in the amino acid sequence as set forth in SEQ ID NO: 6 or 7, and a functional variant having high homology, e.g., at least 85% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) homology to the intracellular region in the amino acid sequence as set forth in SEQ ID NO: 6 or 7. In some particular embodiments, the IL7Ra variant comprises the amino acid sequence as set forth in SEQ ID NO: 6 or 7 or a functional variant having at least 90% homology to SEQ ID NO: 6 or 7.

[0010] In some embodiments, the T cell further has a knockout or inactivation of a gene encoding one or more proteins selected from the group consisting of: T cell receptor (TCR), HLA class I molecule, and HLA class II molecule, optionally, having a knockout or inactivation of a gene encoding one or more proteins selected from the group consisting of: TCRa, TCRp, beta-2 microglobulin (B2M), and HLA-DRA.

[0011] In some embodiments, the cell has a knockout or inactivation of genes encoding TCRa, B2M, and HLA-DRA.

[0012] In some embodiments, the T cell further overexpresses a CD47 protein or an extracellular region fragment thereof. In some particular embodiments, the CD47 protein or the extracellular region fragment thereof comprises the amino acid sequence of SEQ ID NO: 8 or a functional fragment thereof or a functional variant having at least 90% homology to SEQ ID NO: 8.

[0013] In some embodiments, the T cell is engineered to express a fusion protein of a CD47 protein or an extracellular region thereof and an IL7Ra variant (i.e., a SAP protein). The fusion protein preferably comprises the CD47 protein or the extracellular region thereof operably linked to the N-terminus of the IL7Ra variant. The operable linkage can be a direct linkage or via a linker. The linker can be any peptide linker known in the art suitable for linking two peptides, e.g., a GS series linker.

[0014] In some particular embodiments, the fusion protein comprises the amino acid sequence of SEQ ID NO: 9 or 10.

[0015] In some embodiments, the T cells are CAR-T cells, optionally CAR-T cells obtained by engineering donor-derived T cells with a CAR construct. The expressed CAR polypeptide can be in the form of a single chain polypeptide, comprising a VHH or scFv as the extracellular antigen binding region.

[0016] In one aspect, the present application provides a method of preparing a modified T cell, the method comprising: engineering the T cell to overexpress an interleukin-7 receptor alpha (IL7Ra) variant, wherein the variant comprises an amino acid sequence as set forth in SEQ ID NO: 6 or 7 or a functional variant having at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) homology to SEQ ID NO: 6 or 7.

[0017] In some embodiments, the engineering is performed by transforming or transfecting the T cell with an expression vector encoding the IL7Ra variant.

[0018] In some embodiments, the expression vector further comprises a nucleotide sequence encoding a CD47 protein or an extracellular region fragment thereof, the CD47 protein or the extracellular region fragment thereof comprising an amino acid sequence of SEQ ID NO: 8 or a functional fragment or a functional variant having at least 90% (e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) homology to SEQ ID NO: 8.

[0019] In some embodiments, the expression vector comprises a nucleotide sequence encoding a fusion protein of the CD47 protein or the extracellular region thereof and the IL7Ra variant. Preferably, the fusion protein comprises the CD47 protein or the extracellular region thereof operably linked to the N-terminus of the IL7Ra variant. In some particular embodiments, the fusion protein comprises an amino acid sequence of SEQ ID NO: 9 or 10.

[0020] In some embodiments, the method further comprises engineering the T cell to express a chimeric antigen receptor (CAR), thereby preparing a CAR-T cell. The CAR and the IL7Ra variant can be encoded by the same expression vector or by separate expression vectors.

[0021] In some embodiments, the expression vector comprises both a nucleotide sequence encoding a CAR and a nucleotide sequence encoding the fusion protein of the CD47 protein or an extracellular region thereof and the IL7Ra variant. Optionally, the nucleotide sequence encoding the CAR is operably linked to the nucleotide sequence encoding the fusion protein by a nucleotide sequence encoding a self-cleaving linker sequence, such as a 2A linker, a furin cleavage site, or an internal ribosome entry site (IRES).

[0022] In some embodiments, the expression vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a transposon vector, and a viral vector; optionally, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or a retroviral vector.

[0023] In some embodiments, the method further comprises knocking out or inactivating a gene in the T cell that encodes one or more proteins selected from the group consisting of a T cell receptor (TCR), an HLA class I molecule, and an HLA class II molecule.

[0024] In some embodiments, the method comprises knocking out or inactivating an endogenous gene in the T cell that encodes one or more proteins selected from the group consisting of TCRa, TCRp, B2M, and HLA-DRA, optionally, it comprises knocking out or inactivating endogenous genes in the cell that encode TCRa, B2M, and HLA-DRA. The knockouts can be performed after engineering to express the IL7Ra variant.

[0025] In some embodiments, the knocking out or inactivating of the gene is performed by contacting the T cell with a gene editing system, such as a CRISPR / Cas9 gene editing system, and introducing components of the system into the cell.

[0026] In some embodiments, the gene editing system comprises:

[0027] any combination of one or more of a sgRNA targeting a TCRa constant region-encoding gene, a sgRNA targeting a TCRp constant region-encoding gene, a sgRNA targeting a B2M gene, and a sgRNA targeting a HLA-DRA gene, or a combination of one or more vectors expressing the sgRNAs; and

[0028] a nuclease or a nucleic acid encoding the nuclease.

[0029] In some embodiments, the gene editing system comprises: a sgRNA targeting a TCRa constant region-encoding gene, a sgRNA targeting a B2M gene, and a sgRNA targeting a HLA-DRA gene.

[0030] In some embodiments, the sgRNA targeting the TCRa constant region-encoding gene has a recognition sequence as set forth in SEQ ID NO: 1. In some embodiments, the sgRNA targeting the B2M gene has a recognition sequence as set forth in SEQ ID NO: 2. In some embodiments, the sgRNA targeting the HLA-DRA gene has a recognition sequence as set forth in SEQ ID NO: 3. The sgRNA further comprises a constant sequence as a frame, for example, the sequence set forth in SEQ ID NO: 4. In some embodiments, the frame sequence is located at the 3’ end of the recognition sequence. The sgRNA targeting the TCRa constant region-encoding gene, the sgRNA targeting the B2M gene, and the sgRNA targeting the HLA-DRA gene are not limited to these disclosed herein, as long as it can effectively knock out or inactivate the corresponding target gene in T cells. Thus, the sgRNA can be one known to target the corresponding gene. For example, it can be those disclosed in Chinese patent application numbers 202410488220.7, 202410494575.7, and 202410493983.0.

[0031] In some embodiments, the nuclease is capable of inactivating the corresponding targeted gene under the guidance of each sgRNA, optionally the nuclease is a Cas nuclease, for example, a Cas9 nuclease or a Cas12 nuclease, more specifically, a spCas9 nuclease.

[0032] In some embodiments, the sgRNAs are mixed and incubated with the nuclease before the T cells are contacted with the gene editing system. The sgRNAs can be mixed and incubated with the nuclease to form an RNP complex before the contacting. In some specific embodiments, the method comprises mixing and incubating equimolar amounts of the sgRNA targeting the TCRa constant region-encoding gene, the sgRNA targeting the B2M gene, and the sgRNA targeting the HLA-DRA gene together with a Cas9 nuclease to form an RNP complex.

[0033] In some embodiments, the components of the system are introduced into the T cells by electroporation.

[0034] In one aspect, the present application provides T cells, especially CAR-T cells, prepared by the methods disclosed herein. Such CAR-T cells have improved in vivo or in vitro survival and proliferation capacity.

[0035] In one aspect, the present application provides a vector comprising a nucleotide sequence encoding a CD47 protein or an extracellular region fragment thereof operably linked to a nucleotide sequence encoding an IL7Ra variant, wherein the CD47 protein or the extracellular region fragment thereof comprises an amino acid sequence of SEQ ID NO: 8 or a functional fragment or a functional variant having at least 90% homology to SEQ ID NO: 8, the IL7Ra variant comprises an amino acid sequence as set forth in SEQ ID NO: 6 or 7. Optionally, the operable linkage is direct linkage or linkage via a linker.

[0036] In one aspect, the present application provides a vector comprising a nucleotide sequence encoding a CAR, a nucleotide sequence encoding a CD47 protein or an extracellular region thereof, and a nucleotide sequence encoding an IL7Ra variant, wherein the nucleotide sequence encoding the CAR is operably linked to the nucleotide sequence encoding the CD47 protein or the extracellular region thereof or the nucleotide sequence encoding the IL7Ra variant by a nucleotide sequence encoding a self-cleaving linker sequence or an internal ribosome entry site (IRES);

[0037] wherein the CD47 protein or the extracellular region thereof comprises an amino acid sequence of SEQ ID NO: 8 or a functional fragment or a functional variant having at least 90% homology to SEQ ID NO: 8, the IL7Ra variant comprises an amino acid sequence as set forth in SEQ ID NO: 6 or 7.

[0038] In some embodiments, the vector comprises a nucleotide sequence encoding a CD47 protein or an extracellular region thereof directly linked to a nucleotide sequence encoding an IL7Ra variant.

[0039] In some embodiments, the self-cleaving linker sequence is a 2A linker sequence, for example, a P2A linker sequence.

[0040] In some embodiments, the vector is selected from a DNA vector, an RNA vector, a plasmid, a transposon vector, and a viral vector; optionally, the vector is a viral vector, for example, a lentivirus vector, an adenovirus vector, or a retrovirus.

[0041] In one aspect, the present application provides a pharmaceutical composition comprising the T cell and a pharmaceutically acceptable carrier.

[0042] In one aspect, the present application provides a T cell (e.g., CAR-T cell) prepared by the method of the present application for use as a medicament. In one aspect, the present application provides use of a T cell (e.g., CAR-T cell) prepared by the method of the present application in the manufacture of a medicament for treating cancer, an autoimmune disease, or an inflammatory disease in a subject, optionally wherein the T cell is allogeneic or autologous to the subject. In one aspect, the present application provides a method of treating cancer, an autoimmune disease, or an inflammatory disease in a subject, wherein a T cell (e.g., CAR-T cell) prepared by the method of the present application is administered. In one aspect, the present application provides a T cell (e.g., CAR-T cell) prepared by the method of the present application for use in treating cancer, an autoimmune disease, or an inflammatory disease in a subject. The cancer can be any cancer suitable for cell therapy such as CAR-T therapy, for example, leukemia including acute myeloid leukemia (AML) and acute lymphoblastic leukemia (ALL), lymphoma, multiple myeloma (MM), glioma, breast cancer, kidney cancer, liver cancer, esophageal cancer, stomach cancer, pancreatic cancer, prostate cancer, lung cancer, ovarian cancer, colorectal cancer, head and neck cancer, gallbladder cancer, etc. The autoimmune disease or inflammatory disease includes, but is not limited to, graft versus host disease, inflammatory bowel disease, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, aplastic anemia, celiac disease, type 1 diabetes, Graves' disease, psoriasis, scleroderma, etc.

[0043] In one aspect, the present application provides use of a T cell prepared by the method of the present application in the manufacture of a medicament for organ transplantation. The cell can be a CAR-T cell.

[0044] SUMMARY

[0045] Figure 1 shows the results of CAR-T positivity rate detection.

[0046] Figure 2 shows the results of the phosphorylated STAT5 detection experiment, wherein UCAR-T-tIL7Ra*-1 and UCAR-T-tIL7Ra*-2 represent UCAR-T cells linked to IL7Ra intracellular domain by different mutant IL7Ra transmembrane domains, mock CAR-T represents a CAR T cell without overexpression of IL7Ra or CD47 and without gene knockout, and UCAR-T represents a universal CAR-T cell control without overexpression of IL7Ra or CD47.

[0047] Figure 3 shows the results of the cytokine withdrawal experiment with IL-2.

[0048] Figure 4 shows the results of the cytokine withdrawal experiment without IL-2.

[0049] Figure 5 shows one example of a CAR construct (CD8 signal peptide + anti-CD70 scFv + CD8 hinge + CD8 alpha TM + CD28 + CD3 zeta) linked with a SAP fusion protein, wherein the CAR polypeptide coding sequence targeting CD70 is linked to the SAP fusion protein coding sequence, which comprises a CD47 ECD protein fused to an IL7Ra* variant protein.

[0050] Figure 6 shows the expression of CAR on CD47 UCAR-T cells by flow cytometry.

[0051] Figure 7 shows the expression of CAR (A) and CD47 (B) on SAP UCAR-T cells by flow cytometry.

[0052] Figure 8 shows the levels of intracellular factors in CAR-T cells by intracellular flow cytometry: (A) pZAP70; (B) pSTAT5. The four bars from left to right in each case correspond to the figure legend from top to bottom.

[0053] Figure 9 shows the results of various UCAR-T cells in cytokine withdrawal experiments: (A) with cytokine; (B) without cytokine.

[0054] Figure 10 shows the tumor killing ability of CD47 UCAR-T cells in the presence of NK cells or Ml cells: (A) experimental procedure; (B) percentage of cell lysis results. The four bars from left to right in each case correspond to the figure legend from top to bottom.

[0055] Figure 11 shows the results of immune rejection of various UCAR-T cells by NK cells by apoptosis detection: (A) upregulation of CD 107a, a marker of NK cell degranulation; (B) cytotoxicity results of NK cells. The three bars from left to right correspond to the figure legend from top to bottom.

[0056] Figure 12 shows the results of immune rejection of various UCAR-T cells by macrophages by apoptosis detection: (A) ratio of phagocytosis; (B) cytotoxicity results of macrophages.

[0057] Figure 13 shows the phosphorylation levels of STAT5 and BCL2 proteins in various CAR-T cells with (A) or without cytokine (B).

[0058] Figure 14 shows the survival time of various UCAR-T cells in an immunodeficient mouse model.

[0059] DETAILED DESCRIPTION

[0060] DEFINITIONS

[0061] As used herein, "CD47", also known as integrin-associated protein, is a cell membrane protein belonging to the immunoglobulin superfamily, which is almost ubiquitously expressed on the surface of all normal cells and highly expressed on the surface of tumor cells. CD47 sends a "don't eat me" signal by binding to the signal-regulatory protein alpha (Sirpa) on the surface of macrophages, thus protecting tumor cells from being phagocytosed by macrophages and causing tumor immune escape. NK cell Sirpa is upregulated by IL-2 stimulation, interacts with target cell CD47 in a threshold-dependent manner, and counteracts other stimulatory signals, including IL-2, CD16, or NKG2D. Elevated expression of CD47 protects tumor cells against SIRPa+primary NK cells. CD47 as used herein encompasses native human CD47 protein, its extracellular domain, or a functional variant thereof.

[0062] As used herein, "functional variant" with respect to a protein refers to a variant of the protein that has variations in sequence, typically with at least 85% homology remaining, and substantially retains the biological function of the protein.

[0063] As used herein, "B2M gene" or "beta 2 microglobulin-encoding gene" in humans is a gene located on human chromosome 15 (15q21.1) that contains 4 exons. The beta 2M protein exists in membrane protein and free beta 2M forms, with the membrane protein beta 2M non-covalently associated with the heavy chain of MHC class I molecules (i.e., human leukocyte antigen class I molecules, HLA-I) on the cell surface. B2M is involved in the recognition of lymphocytes with target cell surface antigens, and thus B2M is closely related to histocompatibility. Almost all nucleated cells in the body synthesize beta 2 microglobulin, which is attached to the cell surface. The absence of beta 2 microglobulin leads to abnormal polymerization of HLA class I molecules, which cannot form complete functional molecules.

[0064] As used herein, "HLA-DRA", also known as "MHC class II DR alpha", refers to the alpha chain of the HLA class II histocompatibility antigen DR. HLA-DR is a subtype of MHC class II molecules, which is a heterodimer composed of an alpha chain and a beta chain anchored in the cell membrane. HLA DRA is a polymorphic cell surface glycoprotein that plays an important role in the intercellular interactions of the immune response. The alpha chain protein is about 33-35 kDa, and its encoding gene contains 5 exons, of which exon 1 encodes a leader peptide, exons 2 and 3 encode two extracellular domains, and exon 4 encodes a transmembrane domain and a cytoplasmic tail. The host immune system recognizes HLA mismatches on incoming or transplanted allogeneic cells, thus causing graft rejection. For example, a mismatch of HLA-II molecules, which are highly expressed on activated T cells, can activate the recipient's alloreactive CD4 +T cells. Thus, reducing or knocking out HLA-DRA expression in donor cells can reduce HLA-Class II mismatches, making it an attractive target in the field of cell therapy.

[0065] As used herein, the term "Cas9 nuclease" or "Cas9" is an RNA-guided nuclease belonging to the CRISPR / Cas9 gene editing system, including wild-type Cas9 protein or variants or fragments thereof, e.g., proteins comprising the active DNA cleavage domain of Cas9 and / or the gRNA binding domain of Cas9. As known in the art, Cas9 is a component of the CRISPR / Cas gene editing system, wild-type Cas9 is able to target and cleave DNA target sequences under the guidance of a gRNA, thereby forming a DNA double-strand break (DSB). The DNA cleavage activity of Cas9 depends on two domains: RuvC and HNH, which are responsible for cleaving the two strands of DNA, respectively, wherein the complementary strand of the guide RNA is cleaved by RuvC domain activity, while the non-complementary strand is cleaved by HNH domain activity. Either of these two domains can be artificially mutated to inactivate for single- or double-strand cleavage, as desired.

[0066] As used herein, the term "guide RNA" or "gRNA" refers to an RNA sequence comprising a guide sequence (also referred to herein as a recognition sequence) and, optionally, a tracrRNA. A common guide RNA is composed of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) sequences that form a complex through partial complementarity, wherein the recognition sequence comprised by the crRNA is sufficiently complementary to the target sequence to hybridize and target the CRISPR complex to the specifically bound target sequence. The term also includes a single guide RNA (sgRNA), which contains features of both crRNA and tracrRNA. Typically, the guide sequence of the sgRNA is complementary to the target nucleic acid sequence, responsible for the initial guide RNA / target base pairing. Preferably, the guide sequence of the sgRNA does not tolerate mismatches.

[0067] As used herein, a guide sequence or recognition sequence "specifically recognizes" a target site means that the base complementarity of the guide sequence or recognition sequence in the sgRNA to the sequence of the target site is to the extent of at least 85%, preferably at least 90%, more preferably at least 95%, most preferably 100%.

[0068] As used herein, the term "CAR-T cell" refers to a T cell that expresses any one of the CAR constructs, or that has been introduced with a nucleic acid or vector encoding a CAR construct. The polynucleotide encoding the CAR construct polypeptide can be introduced into the cell using a variety of methods, or the CAR construct polypeptide can be synthesized in situ in the cell. Methods of introducing polynucleotide constructs into cells are known in the art. In some embodiments, a stable transformation method can be used to integrate the polynucleotide construct into the genome of the cell. In other embodiments, a transient transformation method can be used to transiently express the polynucleotide construct, and the polynucleotide construct is not integrated into the genome of the cell. In other embodiments, a viral-mediated method can be used. The polynucleotide can be introduced into the cell by any suitable method, such as a recombinant viral vector (e.g., retrovirus, adenovirus), liposome, etc. Transient transformation methods include, for example, but are not limited to, microinjection, electroporation, or microprojectile bombardment. The polynucleotide can be included in a vector, such as a plasmid vector or a viral vector.

[0069] CAR-T cells

[0070] The basic principle of chimeric antigen receptor T cell technology (CAR-T) is to obtain T cells from donors and genetically engineer the T cells to express specific tumor antigen receptors in vitro, so that after recognizing tumor-associated antigens or tumor-specific antigens, the T cells can be highly activated and proliferate in large numbers, releasing anti-tumor active molecules, thereby exerting a strong tumor-killing effect. After the modified T cells proliferate in vitro, the CAR-T cells are injected into the patient's body, which in turn attacks cancer cells expressing specific antigens.

[0071] The key to CAR-T therapy is the engineering of T cells with a construct of a chimeric antigen receptor, or CAR, which generally comprises an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain. The antigen binding domain is often derived from an antigen binding fragment capable of recognizing and binding a specific antigen, such as in the form of a single-chain antibody variable region, scFv, VHH, or Fab, by selecting a suitable antigen binding domain to recognize a cell surface marker of target cells associated with a particular disease state, such as a tumor. The intracellular signaling domain is used to transmit effector function signals and direct the cell to perform specialized functions (such as cytolytic activity or helper activity, including secretion of cytokines), which generally comprises a primary signaling domain and a costimulatory signaling domain. The primary signaling domain refers to a protein portion capable of modulating the primary activation of the TCR complex in a stimulatory manner or in an inhibitory manner, with the primary signaling domain acting in a stimulatory manner generally containing a signaling motif known as an immunoreceptor tyrosine-based activation motif (ITAM). The costimulatory signaling domain refers to an intracellular signaling domain derived from a costimulatory molecule. Costimulatory molecules are cell surface molecules other than antigen receptors or Fc receptors that provide a second signal required for efficient activation and function of T lymphocytes following binding to antigen.

[0072] The present application is not particularly limited with respect to the CAR construct for engineering T cells and the antigen to which it is designed to bind. The antigen to which the CAR construct binds can be selected from a variety of tumor-associated antigens or tumor-specific antigens or other immune disease-associated antigens. By way of example and not limitation, the CAR construct can be designed to recognize any one of the antigens selected from the group consisting of CD70, CD3, CD19, CD20, 4.1 BB (CD137), OX40 (CD134), CD16, CD47, CD22, CD33, CD38, CD123, CD133, CEA, cdH3, EpCAM, epidermal growth factor receptor (EGFR), EGFRvIII, HER2, HER3, dLL3, BCMA, Sialyl-Lea, 5T4, ROR1, mesothelin, folate receptor 1, VEGF receptor, EpCAM, HER2 / neu, HER3 / neu, G250, CEA, MAGE, VEGF, FGFR, alphaVbeta3-integrin, HLA, HLA-DR, ASC, CD1, CD2, CD4, CD5, CD6, CD7, CD8, CD11, CD13, CD14, CD21, CD23, CD24, CD28, CD30, CD37, CD40, CD41, CD44, CD52, CD64, c-erb-2, CALLA, MHCII, CD44v3, CD44v6, p97, gangliosides GM1, GM2, GM3, GD1a, GD1b, GD2, GD3, GT1b, GT3, GQ1, NY-ESO-1, NFX2, SSX2, SSX4 Trp2, gp100, tyrosinase, Muc-1, telomerase, survivin, G250, p53, CA125 MUC, Lewis Y antigen, HSP-27, HSP-70, HSP-72, HSP-90, Pgp, MCSP, EpHA2, GC182, GT468 or GT512, IL-17, IL-20, IL-13, and IL-4.

[0073] In some embodiments, the CAR construct comprises an antigen binding domain in the form of a scFv. In some other embodiments, the CAR construct comprises an antigen binding domain in the form of a VHH. In some particular embodiments, the CAR construct comprises the amino acid sequence of SEQ ID NO: 11.

[0074] In some embodiments, the primary signaling domain of the CAR construct contains an ITAM derived from a TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD3 zeta, CD22, CD79a, CD79b, and CD66d.

[0075] In some embodiments, the co-stimulatory signaling domain of the CAR construct is derived from a co-stimulatory molecule selected from CARD11, CD2, CD7, CD27, CD28, CD30, CD40, CD54 (ICAM), CD83, CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD270 (HVEM), CD278 (ICOS), DAP10.

[0076] In some embodiments, the CAR construct further comprises a linker sequence between the antigen binding domain and the transmembrane domain and / or between the transmembrane domain and the intracellular signaling domain.

[0077] Engineered CAR-T cells can be obtained by transfecting T cells with a virus comprising a CAR coding sequence. In some embodiments, the viral bodies used for transfection are produced by transfecting cells with a plasmid encoding the CAR construct and a viral packaging plasmid. In some other embodiments, engineered CAR-T cells are obtained by transfecting immune cells with an expression vector of the CAR construct. CAR-T cells that can be used for CAR construct engineering are T lymphocytes, including thymocytes, immature T lymphocytes, mature T lymphocytes, resting T lymphocytes, or activated T lymphocytes. The T cells can be T helper (Th) cells, such as T helper 1 (Thl) or T helper 2 (Th2) cells. The T cells can be helper T cells (HTL; CD4 T cells), cytotoxic T cells (CTL; CD8 T cells), CD4 CD8 T cells, or any other T cell subpopulation. In some embodiments, the T cells can include naive T cells and memory T cells.

[0078] In some embodiments, the T cells used for engineering are isolated from peripheral blood mononuclear cells (PBMCs). Isolation of various cell fractions from PBMCs is well known to those skilled in the art. In some embodiments, the peripheral blood mononuclear cells are isolated from a subject in need of administration of a CAR-T cell therapy. The T cells include any type of T cells, such as cytotoxic T lymphocytes and regulatory T cells.

[0079] Universal CAR-T cells

[0080] Biological organisms typically reject xenografts or allografts, including allogeneic T cells such as CAR-T cells, primarily because the donor’s genes encode antigens that the recipient does not have, which are recognized by the recipient’s immune cells and cause rejection, a host versus graft reaction. Universal CAR-T (UCAR-T) cells have been developed that have reduced cellular immunogenicity, thereby providing support for more patients to be effectively treated by CAR-T therapy.

[0081] The general design principle of universal CAR-T cells is to destroy the TCR genes, HLA class I genes, and / or HLA class II genes of allogeneic T cells by gene editing after the CAR-T cells are generated from allogeneic donors, so that the resulting T cells cannot recognize allogeneic antigens, thereby effectively eliminating graft versus host disease.

[0082] T cells express T cell receptors (TCRs) on their membrane surface, which are responsible for recognizing antigens presented by major histocompatibility complexes (MHCs, also known as human leukocyte antigen, HLA molecules). Unlike B cell receptors, TCRs cannot recognize free antigens, but can recognize antigenic peptide fragments presented by MHC molecules. Typically, TCRs are glycoproteins on the cell membrane surface in the form of heterodimers of alpha / beta chains or gamma / delta chains. The specific binding of T cell receptors to polypeptides presented by MHCs triggers a series of biochemical reactions and activates T cells through numerous co-receptors, enzymes, and transcription factors, promoting their division and differentiation. In allogeneic transplantation, lymphocytes in the graft recognize antigens of recipient cells, trigger an immune response, attack recipient cells, and cause graft versus host disease.

[0083] In some embodiments, the genes encoding the endogenous TCRs of universal CAR-T cells are disrupted or knocked out. For example, by targeting the genomic sequence of the constant region of the endogenous alpha or beta subunit of TCR, the expression of TCR can be eliminated, so that the resulting T cells cannot recognize allogeneic antigens.

[0084] In some embodiments, the gene expression of endogenous HLA class I antigens of universal CAR-T cells is disrupted or knocked out. Cells expressing allogeneic major histocompatibility complex (MHC)-I can be recognized by CD 8 +T cells recognize and destroy, HLA class I genes (HLA-A, HLA-B, HLA-C) encode MHC-I, so knocking out HLA class I molecules helps allogeneic T cells to survive better in the host body. Beta 2 microglobulin (B2M) is a beta light chain of human leukocyte antigen class I molecule (HLA-I), its main function is to participate in the recognition of lymphocytes and target cell surface antigens, so B2M is closely related to histocompatibility. Almost all nucleated cells in the body can synthesize beta 2 microglobulin, which is attached to the cell surface. The absence of beta 2 microglobulin will cause abnormal polymerization of HLA class I molecules, so that complete functional molecules cannot be formed. In some embodiments, the expression of the B2M gene can be knocked out or disrupted. By knocking out the B2M gene, the HLA-I class molecules in the cell can no longer be expressed, reducing the immunogenicity of the cell, effectively reducing the risk of host versus graft reaction and immune rejection.

[0085] In some embodiments, the gene expression of endogenous HLA class II antigens of the universal CAR-T cells is disrupted or knocked out. HLA-II class molecules on the surface of T cells are CD4 + The important target of T helper cell recognition, HLA-II class molecules include HLA-DR, HLA-DP, HLA-DQ, HLA-DM, HLA-DO, which are also a class of targets for host cells to recognize allogeneic cells. For example, the expression of the gene encoding HLA DRA, one of the HLA II class alpha chain paralogs, can be knocked out or disrupted, and by knocking out HLA-DRA, the immunogenicity of the transplanted cell can be reduced, effectively reducing the risk of host versus graft reaction and immune rejection.

[0086] In some embodiments, the universal CAR-T cells are CAR-T cells that do not express or low express one or more proteins selected from the group consisting of TCR, B2M, HLA class I and HLA class II molecules.

[0087] In some embodiments, the universal CAR-T cells are CAR-T cells that do not express or low express one or more proteins selected from the group consisting of TCR, B2M and HLA-DRA.

[0088] In some embodiments, the universal CAR-T cells are CAR-T cells that do not express or low express TCR, B2M and HLA-DRA.

[0089] The cells to which the present application can be applied are not limited to CAR-T cells, but can be various T cells.

[0090] Expression of IL-7Rα variants or co-expression of IL-7Rα variants and CD47 fusion proteins

[0091] The improved CAR-T cells of the present application can solve the following problems: 1) the problem of significant decrease in proliferation and survival time in vivo and in vitro of universal CAR-T after TCR knockout; 2) the problem of easy elimination of universal CAR-T in vivo by the host immune system. The universal CAR-T (e.g. SAP UCAR-T) obtained by the method of the present application has significantly increased proliferation ability in vivo and in vitro and its long-term survival and anti-apoptosis ability in vivo after transplantation.

[0092] In one aspect, the present application provides a method for improving the survival and / or proliferation ability of T cells (such as CAR-T cells) by co-expressing IL-7Rα or a variant thereof in the T cells. IL-7R is the receptor for IL-7, which is composed of IL-7Rα chain (also known as CD127) and common cytokine receptor γ chain (also known as CD132, IL-2Rγ).

[0093] In some embodiments, the T cells (such as CAR-T cells) are engineered to express an IL-7Rα variant, in particular a truncated IL-7Rα variant. The truncated IL-7Rα variant comprises a truncated and mutated extracellular domain and cytoplasmic region compared to native human IL-7Rα. In some embodiments, the IL-7Rα variant comprises an amino acid sequence as set forth in SEQ ID No: 6 or 7.

[0094] Co-expression of IL-7Rα or a variant thereof can be achieved by placing the coding sequence of CAR and IL-7Rα or a variant thereof in the same or different expression vectors. In some embodiments, the nucleotide sequence encoding CAR and the nucleotide sequence encoding IL-7Rα or a variant thereof are operably linked in an expression vector, such as a lentiviral vector. The nucleotide sequences can be linked by a linker, in particular a 2A linker sequence (e.g. P2A or T2A) or an IRES sequence. The mRNA after transcription is cleaved to generate two polypeptide chains, CAR polypeptide and IL-7Rα or a variant thereof polypeptide, respectively, when translated at the ribosome.

[0095] In a further aspect, the present application further reduces the immunogenicity of T cells by overexpressing CD47 in the T cells. Allogeneic T cells, such as universal CAR-T, have the risk of being attacked by NK cells when evading the attack of host T cells, and at the same time, can be rejected by myeloid cells to allogeneic cells, i.e. the T cells, due to the possible knockout of HLA class I molecules, resulting in the enhanced reactivity of natural killer cells (NK cells) to T cells, in addition to the attack of myeloid cells including macrophages to T cells. The present application solves this problem by overexpressing CD47 in T cells, in particular overexpressing a fusion protein of truncated IL-7Rα variant and CD47.

[0096] CD47 is highly expressed in tumor cells and can cause immune escape of tumor cells through interaction with signal-regulatory-protein alpha (Sirpa) on the surface of macrophages or NK cells. The present application surprisingly found that by making universal CAR-T cells express a fusion protein of a truncated IL-7Ra variant and CD47, the immunogenicity caused by reactivity with NK cells and phagocytosis by macrophages can be further reduced.

[0097] In some embodiments, the fusion protein (also referred to herein as SAP protein) comprises a CD47 protein, an extracellular region fragment thereof, or a functional variant thereof having a highly homologous sequence, operably linked to a truncated IL-7Ra variant, the CD47 protein or extracellular region thereof comprising an amino acid sequence of SEQ ID NO: 8 or a functional variant having at least 90% homology to SEQ ID NO: 8, the truncated IL-7Ra variant comprising an amino acid sequence as set forth in SEQ ID NO: 6 or 7. Preferably, the CD47 protein, extracellular region thereof, or functional variant thereof having a highly homologous sequence is located at the N-terminus of the truncated IL-7Ra variant. The operable linkage can be direct linkage, or linkage through a peptide linker, as long as the peptide linker does not affect the function of the two-part peptide. In some specific embodiments, the fusion protein has an amino acid sequence as set forth in SEQ ID NO: 9 or 10.

[0098] In some embodiments, the CAR-T cells are engineered to overexpress a fusion protein of CD47 and a truncated IL-7Ra variant, or both. Overexpression of CD47 and the fusion protein can be achieved by placing the coding sequence of the CAR and the coding sequence of the fusion protein in the same or different expression vectors. In some embodiments, the nucleotide sequence encoding the CAR and the nucleotide sequence encoding the fusion protein are operably linked in an expression vector, such as a lentiviral vector. The nucleotide sequences can be linked by a cleavable linker, in particular a 2A sequence (e.g. P2A or T2A) or an IRES sequence. In this way, the mRNA after transcription is cleaved to generate two polypeptide chains, CAR polypeptide and fusion protein, respectively, when translated at the ribosome.

[0099] In some embodiments, the nucleotide sequence encoding the CAR is operably linked to the nucleotide sequence encoding the fusion protein via a nucleotide sequence encoding a first linker, the nucleotide sequence encoding the fusion protein comprising a nucleotide sequence encoding a CD47 protein, an extracellular region thereof, or a functional variant thereof directly linked to a nucleotide sequence encoding a truncated IL7Ra variant. In some other embodiments, the nucleotide sequence encoding the CAR is operably linked to a nucleotide sequence encoding CD47 via a nucleotide sequence encoding a first linker, and the nucleotide sequence encoding CD47 is operably linked to a nucleotide sequence encoding a truncated IL7Ra variant via a nucleotide sequence encoding a second linker. In some other embodiments, the nucleotide sequence encoding the CAR is operably linked to a nucleotide sequence encoding a truncated IL7Ra variant via a nucleotide sequence encoding a first linker, and the nucleotide sequence encoding a truncated IL7Ra variant is operably linked to a nucleotide sequence encoding CD47 via a nucleotide sequence encoding a second linker. The first linker can be selected from the group consisting of self-cleavable linkers such as 2A sequences (e.g., P2A and T2A) and IRES sequences. The second linker can be a non-self-cleavable linker, for example, a GS series of peptide linkers.

[0100] Methods of making T cells with enhanced survival / proliferation capacity

[0101] In one aspect, the present application provides a method of making a T cell, comprising:

[0102] (a) providing a donor-derived T cell;

[0103] (b) engineering the T cell to express an IL7Ra variant or a fusion protein of an IL7Ra variant and CD47; and

[0104] (c) genetically editing the CAR-T cell.

[0105] In one aspect, the present application provides a method of making a T cell, comprising:

[0106] (a) providing a donor-derived T cell;

[0107] (b) engineering the T cell to express a CAR-T cell, optionally, engineering the T cell to express a CAR-T cell expressing a CAR, CD47, and a truncated IL7Ra variant; and

[0108] (c) genetically editing the CAR-T cell.

[0109] A variety of methods known in the art can be employed to construct TCR-deficient, HLA class I and / or HLA-II deficient CAR-T cells. The most commonly used gene editing methods are zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR / Cas9, etc. In some embodiments, the T cells with TCR, HLA class I and / or HLA-II genes knocked out are constructed by CRISPR / Cas gene editing system, in particular, CRISPR / Cas9 gene editing system.

[0110] In one aspect, the present application provides a method of making a modified CAR-T cell, wherein the endogenous beta-2 microglobulin (B2M) gene in the CAR-T cell is knocked out or inactivated. The modified CAR-T cell has reduced cellular immunogenicity due to the knockout of HLA-I molecules. The target locus in B2M can be cleaved by Cas9 after the guidance of specific sgRNA, and then DNA sequence insertion or base deletion is introduced to make the B2M gene lose biological function. In some embodiments, the endogenous B2M gene is inactivated by deletion of nucleotides, making B2M not express at all. Preferably, each allele of B2M in the genome (e.g., diploid genome) is inactivated.

[0111] In one aspect, the present application provides a method of making a modified CAR-T cell, wherein the endogenous beta-2 microglobulin (B2M) gene in the CAR-T cell is knocked out or inactivated. The modified CAR-T cell has reduced cellular immunogenicity due to the knockout of HLA-I molecules. The target locus in B2M can be cleaved by Cas9 after the guidance of specific sgRNA, and then DNA sequence insertion or base deletion is introduced to make the B2M gene lose biological function. In some embodiments, the endogenous B2M gene is inactivated by deletion of nucleotides, making B2M not express at all. Preferably, each allele of B2M in the genome (e.g., diploid genome) is inactivated.

[0112] In one aspect, the present application provides a method of making a modified CAR-T cell, wherein an endogenous HLA-DRA gene in the CAR-T cell is knocked out or inactivated. The modified CAR-T cell has reduced cellular immunogenicity due to the knockout of HLA-Class II molecules. The DNA sequence insertion or base deletion that renders the HLA-DRA gene biologically non-functional can be introduced after the target locus in HLA-DRA is cleaved by Cas9 guided by specific sgRNAs. In some embodiments, the endogenous HLA-DRA gene is inactivated by deletion of nucleotides such that B2M is not expressed at all. Preferably, each allele of HLA-DRA in the genome (e.g. diploid genome) is inactivated.

[0113] In one aspect, the present application provides a method of making a modified CAR-T cell, wherein one or more genes selected from the group consisting of: a HLA-DRA-encoding gene, a gene encoding the constant region of the alpha or beta subunit of TCR, a B2M-encoding gene, is knocked out or inactivated in the CAR-T cell. For example, the DNA sequence insertion or base deletion that renders the plurality of target genes biologically non-functional can be introduced after the target sites in the respective target genes are cleaved by Cas9 guided by a plurality of specific sgRNAs. The plurality of sgRNAs can include: a sgRNA targeting the constant region of the alpha or beta subunit of TCR, a sgRNA targeting the B2M gene, a sgRNA targeting HLA-DRA, or any combination thereof. The sgRNAs can be those disclosed in Chinese patent application 202410624572.0.

[0114] The sgRNAs of the application are particularly suitable for CRISPR / Cas mediated oligonucleotide binding and / or editing, wherein the oligonucleotide binding and / or editing is mediated by a complex comprising the sgRNA of the application and a Cas enzyme, which can comprise any suitable Cas enzyme. In certain embodiments, the Cas enzyme is selected from the group consisting of Cas9, Casl2a, Casl2e, Casl2b, Casl2i, Casl2h, Casl2c, Casl2d, Casl2f, Casl2g, Casl2k, Casl2j, Casl3a, Casl3b, Casl3c, Casl3d and Casl4, including any recombinant variant thereof, in particular selected from the group consisting of Cas9, including any recombinant variant thereof. The Cas9 enzyme can be a Streptococcus, e.g. S. pyogenes or Lactobacillus Cas9 enzyme, as described in Briner et al. (2014), the contents of which are incorporated herein by reference, including any recombinant variant thereof. In some embodiments, the Cas nuclease is selected from the group consisting of a Cas9 nuclease and a Casl2 nuclease. It will be appreciated by the skilled person that the sgRNAs of the application can be used in conjunction with a variety of Cas proteins, and thus for a variety of CRISPR / Cas systems, such as a CRISPR / Cas9 system, a CRISPR / Casl2 system, a CRISPR / nCas9 system, a CRISPR / dCas9 system. The Cas9 protein is a multifunctional protein, with protein structures including a recognition region (REC) composed of alpha-helices, a nuclease region composed of a HNH domain and a RuvC domain, and a PAM binding region at the C-terminus. The two important nuclease domains RuvC and HNH can cleave the DNA complementary strand and non-complementary strand of the gRNA, respectively, to generate a blunt-ended DNA double-strand break. The Cas9 protein can be mutated as desired to form a single-stranded DNA break. Recognition of Cas9 to the target DNA depends on the tracrRNA:crRNA complex and the PAM sequence downstream of the target site. In some embodiments, the Cas9 protein is a wild-type Cas9. In some embodiments, the Cas9 protein is derived from a S. pyogenes Cas9 protein or a S. aureus Cas9 protein. Preferably, the Cas9 protein can induce a double-strand break at the target site in the target gene.

[0115] Inactivation of an endogenous target gene can be achieved by introducing a Cas nuclease and one or more sgRNAs into a CAR-T cell. In some embodiments, a complex of a Cas nuclease and a sgRNA is introduced into a CAR-T cell. For example, a Cas nuclease and one or more sgRNAs can be incubated prior to introduction into a CAR-T cell. The introduction can be performed by electroporation. In some other embodiments, a plasmid encoding one or more sgRNAs and a plasmid encoding a Cas nuclease are introduced into a CAR-T cell.

[0116] The sgRNA comprises a recognition sequence for a target site in a target gene. The recognition sequence is usually designed to be 20 nt. In addition to the recognition sequence, the sgRNA also comprises a constant part as a framework, which can comprise part of the crRNA and tracrRNA sequence. The sgRNA has the function of accurately recognizing the target gene sequence in the CRISPR / Cas9 gene editing system, and its effect can affect the efficiency of editing, whether off-target occurs, etc., and even plays a decisive role in the final effect of gene editing. Therefore, designing a reasonable and effective sgRNA is an important basis for realizing gene editing, and selecting a suitable recognition sequence is the core work of sgRNA design. For the designed sgRNA, it can be analyzed based on specificity score, cleavage efficiency score, potential off-target situation and off-target site information, etc., to select the best sgRNA.

[0117] The sgRNAs targeting TCR, HLA class I, and / or HLA class II genes are not limited to those specifically used herein, but any sgRNA known in the art that can be used to knock out or disrupt TCR, HLA class I, and / or HLA class II gene expression can be used to perform gene editing to make universal CAR-T cells.

[0118] In some embodiments, an sgRNA targeting the constant region of the alpha subunit of TCR (also referred to as a TRAC sgRNA) is used. In some embodiments, the TRAC sgRNA comprises a recognition sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the TRAC sgRNA comprises a recognition sequence as set forth in SEQ ID NO: 1 and a framework sequence as set forth in SEQ ID NO: 4.

[0119] In some embodiments, an sgRNA targeting B2M (also referred to as a B2M sgRNA) is used. In some embodiments, the B2M sgRNA comprises a recognition sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the TRAC sgRNA comprises a recognition sequence as set forth in SEQ ID NO: 2 and a framework sequence as set forth in SEQ ID NO: 4.

[0120] In some embodiments, an sgRNA targeting HLA-DRA (also referred to as HLA-DRA sgRNA) is used. In some embodiments, the HLA-DRA sgRNA comprises a recognition sequence that is a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3. In some embodiments, the TRAC sgRNA comprises a recognition sequence as set forth in SEQ ID NO: 3 and a frame sequence as set forth in SEQ ID NO: 4.

[0121] In some embodiments, one or more of a TRAC sgRNA, a B2M sgRNA, and a HLA-DRA sgRNA is used, for example, a combination of a TRAC sgRNA and a B2M sgRNA, a combination of a B2M sgRNA and a HLA-DRA sgRNA, a combination of a TRAC sgRNA and a HLA-DRA sgRNA, or a combination of all three of a TRAC sgRNA, a B2M sgRNA, and a HLA-DRA sgRNA. In some embodiments, a combination of all three of a TRAC sgRNA, a B2M sgRNA, and a HLA-DRA sgRNA is used to disrupt or knock out the TCR gene, the B2M gene, and the HLA-DRA gene in a CAR-T cell. A dual or multiple knock-out universal CAR-T cell will have lower immunogenicity compared to a universal CAR-T cell with a single knock-out, further reducing the likelihood of developing graft versus host disease.

[0122] Pharmaceuticals and formulations comprising T cells

[0123] In one aspect, provided herein is a modified T cell prepared by any one of the methods provided herein. Specifically, an improved universal CAR-T cell with reduced immunogenicity and improved survival ability in vivo is provided. The T cell provided herein can effectively provide its resistance to macrophages and NK cells and have a more persistent effect in a subject receiving cell therapy, thereby improving the therapeutic effect of the T cell.

[0124] In one aspect, provided herein is a pharmaceutical composition comprising any one of the modified T cells provided herein and a pharmaceutically acceptable carrier.

[0125] Advantages of the present application

[0126] 1) By corresponding modification, the proliferation ability of the universal CAR-T cell in vivo and in vitro and its survival and anti-apoptosis ability in vivo and in vitro are greatly increased.

[0127] 2) By adding the truncated IL7Ra mutant (mutation of transmembrane end + cytoplasmic region) into the cells, the universal CAR-T base survival and proliferation signals are increased, and the attack of macrophages and NK cells can be resisted, effectively enhancing the long-term survival ability of universal CAR-T in vivo and in vitro, and reducing the loss rate in vivo. Examples

[0128] The following examples are provided to better illustrate the present application and are not intended to limit the application.

[0129] Materials and reagents

[0130] Example 1: lentivirus preparation

[0131] Lentivirus vector 1: gene synthesis CAR-2A-tIL7Ra * Fusion gene sequence, in which the CAR polypeptide chain coding sequence is connected to the coding sequence of the truncated IL-7Rα variant tIL7Ra*-1 or tIL7Ra*-2 through a 2A cleavable linker. Compared with the truncated sequence of natural IL-7Rα SEQ ID NO: 5, tIL7Ra*-1 or tIL7Ra*-2 has additional amino acids inserted in the extracellular domain. The fusion gene sequence is connected to the PLV vector by enzyme digestion transformation, and the gene upstream is EF-1a promoter. The vector is transformed into DH5α E. coli strain, ampicillin screening, positive clones are obtained, plasmid extraction, enzyme digestion identification of clones, and CD70 CAR-2A-tIL7Ra is obtained * Lentivirus packaging vector. The specific sequence of the truncated IL-7Rα variant encoded in the fusion gene is as follows:

[0132] Table 1. Amino acid sequences of truncated IL-7Rα (tIL7Ra) and its variants tIL7Ra*-1 or tIL7Ra*-2

[0133] Lentivirus vector 2: CAR polypeptide chain coding sequence is connected to the coding sequence of the extracellular region of CD47 protein through 2A cleavable linker, and the other end of the coding sequence of the extracellular region of CD47 protein is connected to the coding sequence of the truncated IL-7Rα variant tIL7Ra*-1 or tIL7Ra*-2. The CD70 CAR-2A-CD47 ECD-tIL7Ra* fusion gene sequence is synthesized by gene synthesis, and is connected to the PLV vector by enzyme digestion and transformation, and the upstream of the gene is the EF-1a promoter. The vector is transformed into DH5α E. coli strain, and positive clones are obtained by ampicillin screening, and the plasmid is extracted, and the clones are identified by enzyme digestion, and the CD70 CAR-2A-CD47 ECD-tIL7Ra* lentivirus packaging vector is obtained.

[0134] Lentivirus vector 3: CAR polypeptide chain coding sequence is connected to the coding sequence of the extracellular region of CD47 protein through 2A cleavable linker. The CD70 CAR-2A-CD47 ECD fusion gene sequence is synthesized by gene synthesis, and is connected to the PLV vector by enzyme digestion and transformation, and the upstream of the gene is the EF-1a promoter. The vector is transformed into DH5α E. coli strain, and positive clones are obtained by ampicillin screening, and the plasmid is extracted, and the clones are identified by enzyme digestion, and the CD70 CAR-2A-CD47 ECD lentivirus packaging vector is obtained.

[0135] 293T cells for virus packaging are cultured in a cell incubator at 37°C, 5% CO2. The culture medium used is DMEM medium containing 10% Gibco fetal bovine serum. One day before formal virus packaging, the cultured 293T cells are passaged in T75 cell bottles at a cell number of 1×10 7 When the 293T cells reach 70-80% confluence and are evenly distributed in the culture bottle, lentivirus packaging is started.

[0136] Prepare the plasmid and transfection reagent diluent, and vortex to mix the PEI 40K transfection reagent. Prepare 2 centrifuge tubes, and prepare the plasmid and transfection reagent diluent in the following order, respectively. The lentivirus vector is the lentivirus vector 1 or 2 or 3 prepared above.

[0137] Table 2. Reaction composition

[0138] Mix well. Add the dilution of transfection reagent (tube 2) to the plasmid DNA solution (tube 1) and mix well immediately. Note that the order of addition is very important. Incubate the transfection mixture at room temperature for 15-20 minutes. Discard the old medium from the flask containing the 293T cells, add 9 ml of fresh DMEM medium, then add the incubated 1 ml transfection mixture, and mix the medium gently by pipetting. Incubate the cells at 37°C in a 5% CO2 incubator for 6 hours. Discard the medium from the flask and add 15 ml of fresh medium.

[0139] Collect the cell culture supernatant 48 hours after transfection, and add 15 ml of fresh medium. Collect the cell culture supernatant 72 hours after transfection, and a total of 30 ml of cell culture supernatant is obtained. Centrifuge at 1000 g for 8 min, and filter the cell debris using a 0.45 nm filter membrane. Transfer the filtrate to an ultracentrifuge tube.

[0140] Use an ultracentrifuge to centrifuge at 22000 rpm for 1.5 h at 4°C. Use a pipette to remove the supernatant and discard it. Resuspend the virus precipitate with 200 μl of X-VIVO medium, transfer it to an EP tube, and store it in a 4°C refrigerator overnight.

[0141] Example 2: Preparation of triple-knockout universal CAR-T cells

[0142] Take one vial of frozen PBMC cells (5 x 10 7 Place a new sterile cryovial in the magnetic stand in advance, and add 1 ml of X-VIVO medium. Take a 15 ml centrifuge tube, and add 4 ml of X-VIVO medium in advance. Transfer the thawed PBMC cells to the 15 ml centrifuge tube, centrifuge (500 g, 5 min), discard the supernatant, and add 50 μl of separation antibody and 800 μl of X-VIVO medium. Incubate for 5 min, add 50 μl of separation magnetic beads, mix well, and incubate for 3 min.

[0143] After incubation, take a 15 ml centrifuge tube, add 7 ml of medium, and remove the cells from the cryovial. Centrifuge at 500 g for 5 min, and count the cells. After counting, centrifuge (500 g, 5 min), discard the supernatant, and add 100 μl of activation magnetic beads and 50 μl of medium per 1 x 10 7 After incubation, take a 15 ml centrifuge tube, add 7 ml of medium, and remove the cells from the cryovial. Centrifuge at 500 g for 5 min, and count the cells. After counting, centrifuge (500 g, 5 min), discard the supernatant, and add 100 μl of activation magnetic beads and 50 μl of medium per 1 x 10 6 After incubation, take a 15 ml centrifuge tube, add 7 ml of medium, and remove the cells from the cryovial. Centrifuge at 500 g for 5 min, and count the cells. After counting, centrifuge (500 g, 5 min), discard the supernatant, and add 100 μl of activation magnetic beads and 50 μl of medium per 1 x 10

[0144] After 24h, add viral vector 1 or 2 or 3 at MOI=5 ratio, add polybrene 4ug / ml and 20ng / ml IL-2 at the same time. Change liquid after 24h viral infection, and at the same time, carry out magnetic bead removal treatment, then start the electroporation knockout operation.

[0145] Prepare electroporation solution: add all the supplement liquid into the dissolving liquid, the ratio of dissolving liquid to supplement liquid is 4.5:1. Prepare appropriate amount of medium and place in the hole plate and pre-warm in the incubator.

[0146] Dissolve TRAC-sgRNA / B2m-sgRNA / HLA-DRA-sgRNA into 100nmol / μl solution. Mix cas9 and each sgRNA at the amount of cas9:TRAC-sgRNA:B2m-sgRNA:HLA-DRA-sgRNA=60pmol:75pmol:75pmol:75pmol respectively, and incubate for 10min. The sgRNA consists of a target gene recognition sequence and a constant sequence at the 3' end as a scaffold. The constant sequence is shown in SEQ ID NO:4: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU. The recognition sequence of each sgRNA used is as follows (T is U in RNA):

[0147] Table 3: Recognition sequence of sgRNA

[0148] After centrifugation to count the cells, take 1x10 7 Centrifuge the cells again, and resuspend using 200μl electroporation solution. Add 20μl resuspended cell solution to the RNP respectively. Transfer the cell solution into the strip. Open the electroporation instrument and select the strip option, use the T cell editing program EN113 to perform electroporation knockout. Select the hole that has added the cell solution, and select the T cell editing option. Click the start button, after the end of electroporation, transfer the mixture into the prepared medium, and culture in the incubator to obtain the cultured cells.

[0149] The CAR-T cells obtained by using viral vector 1 to infect to overexpress tIL7Ra * and triple knockout are called "UCAR-T-tIL7Ra*" cells. The CAR-T cells obtained by using viral vector 2 to infect to overexpress CD47 and tIL7Ra *and the triple knock-out CAR-T cells infected using viral vector 3 are referred to herein as "CD47 UCAR-T" cells.

[0150] Figure 1 shows the results of CAR positivity testing for mock T, UCAR-T-tIL7Ra*-1 and UCAR-T-tIL7Ra*-2, respectively.

[0151] Figure 6 shows the expression of CAR and CD47 on CD47 UCAR-T cells as detected by flow cytometry 2 days after knock-out of CD47 UCAR-T cells. Figure 7 shows the expression of CAR and CD47 on SAP UCAR-T cells as detected by flow cytometry.

[0152] Example 3: Phosphorylated STAT5 testing of UCAR-T-tIL7Ra* cells

[0153] Transduced triple knock-out (tKO) UCAR-T cells were collected, resuspended in complete medium without cytokines at a density of 1.0 x 10 6 After 72 hours, the cells were harvested into FACS tubes and washed with pre-chilled flow buffer (PBS with 5% FBS).

[0154] Fixation and permeabilization reagent A (100 μΐ; Life Technologies) was added to the cells, gently swirled, and incubated for 3 minutes at room temperature, then 3 ml of cold methanol was slowly added to the tubes while continuously swirling. The tubes were then incubated for 10 minutes at 4°C. Subsequently, the methanol was removed by centrifugation and the cells were washed twice with pre-chilled flow buffer. Fixation and permeabilization reagent B (100 μΐ; Life Technologies) and 5 μΐ of anti-STAT antibody were then added to the cells. Gently swirled, incubated for 30 min at room temperature in the dark. Subsequently, the cells were washed once more with pre-chilled flow buffer and immediately analyzed on the machine.

[0155] The results are shown in Figure 2, which shows that the level of STAT5 phosphorylation in UCAR-T-tIL7Ra*-1 and UCAR-T-tIL7Ra*-2 cells is significantly higher than in UCAR-T cells not fused to express tIL7Ra*.

[0156] Example 4: Cytokine withdrawal experiment with UCAR-T-tIL7Ra* cells

[0157] After 14 days of cell culture, the number of cell proliferation was recorded, and the transduced tKO UCAR-T and CAR-T cells were collected, resuspended with complete medium without cytokines at a density of 1.0 x 10 6 The cell viability and number were recorded every 3 days until the cells died.

[0158] Figure 3 shows the results in the presence of IL-2. Figure 4 shows the results in the absence of IL-2. As can be seen from the figures, although the proliferation of UCAR-T-tIL7Ra* is still less than that of mock CAR-T in the presence of IL2, the survival ability of UCAR-T-tIL7Ra* is significantly improved in the absence of factors (the results of UCAR-T-tIL7Ra*-1 and UCAR-T-tIL7Ra*-2 are similar).

[0159] Example 5: Intracellular factor detection of universal CAR-T cells

[0160] 1 x 10 6 The knockout CAR-T cells were taken into a 1.5 ml centrifuge tube and centrifuged at 500 x g for 5 min. The culture medium was removed, and the cells were resuspended with 200 μΐ^of PBS. An equal volume of IC fixation solution was added to the cells and vortexed to fix the cells. Incubate at room temperature for 30 min in the dark. Centrifuge at 500 x g for 5 min, and discard the supernatant. Resuspend the cells with the remaining small volume of liquid in the 1.5 ml centrifuge tube, add 1 ml of pre-cooled 90%-100% methanol, vortex, and incubate at 4°C for 30 min. Wash the cells with an equal volume of PBS, and centrifuge at 1000 x g for 5 min, and discard the supernatant. Resuspend the cells with 100 μΐ^of PBS. According to the antibody instructions and the number of cells to be detected, take an appropriate amount of antibody and add it to a 1.5 ml centrifuge tube. Incubate at room temperature for 30 min in the dark. After incubation, add 900 μΐ^of PBS to the 1.5 ml centrifuge tube, and transfer the centrifuge tube to the centrifuge, centrifuge at 500 x g for 5 min. Discard the supernatant, resuspend the cells with 500 μΐ^of PBS, centrifuge again at 500 x g for 5 min, and wash away the excess antibody. Resuspend the cells with 200 μΐ^of PBS, and then use a flow cytometer for detection.

[0161] As shown in Figure 8A, the levels of intracellular phosphorylated Zap70 of various CAR-T cells were detected by intracellular flow. The phosphorylated Zap70 level of SAP UCAR-T did not change significantly compared with other groups, indicating that the SAP structure does not affect the Zap70 related signal pathway.

[0162] The transduced tKO UCAR-T cells were collected, resuspended with complete medium without cytokines at a density of 1.0 x 10 6Cells were harvested into FACS tubes and washed with pre-chilled flow buffer (PBS with 5% FBS) after 72 hours.

[0163] Fixation and membrane permeabilization reagent A (100 μΐ; Life Technologies) was added to the cells, gently swirled, and incubated at room temperature for 3 minutes, then 3 ml of chilled methanol was slowly added to the tube with constant swirling. This was then incubated at 4°C for 10 minutes. Subsequently, the methanol was removed by centrifugation and washed twice with pre-chilled flow buffer. Fixation and membrane permeabilization reagent B (100 μΐ; Life Technologies) and 5 μΐ of anti-STAT antibody was then added to the cells. Gently swirled, incubated at room temperature for 30 min in the dark. Subsequently, the cells were washed once more with pre-chilled flow buffer and immediately analyzed on the machine.

[0164] As shown in FIG. 8B, the level of STAT5 phosphorylation in SAP UCAR-T cells was significantly higher than that in other cells. “UCAR-T cells” refer to CAR-T cells that only have triple knock-out without overexpression of CD47 or tIL7Ra*.

[0165] Example 6: Cytokine withdrawal experiment of SAP UCAR-T cells

[0166] After 14 days of cell culture, the number of proliferated cells was recorded, and the transduced tKO UCAR-T and CAR-T cells were collected, resuspended with complete medium without cytokines at a density of 1.0 x 10 6 The cells were seeded at 1.0 x 10

[0167] FIG. 9A shows the results in the presence of IL-2. FIG. 9B shows the results in the absence of IL-2. As can be seen from the figures, the SAP protein does not directly promote CAR-T cell proliferation, but increases CAR-T cell persistence, that is, the survival ability of CAR-T cells is significantly improved.

[0168] Example 7: Luciferase assay

[0169] Tumor cells were seeded at 2 x 10 4Cells were seeded at 1 cell / well in 96-well plates with a volume of 60 μL per well. CAR-T cells were seeded at effector to target ratios of 1:1, 3:1, and 9:1 in 96-well plates with a final volume of 200 μL per well, and blank wells and sample maximum control wells were set up. After incubation for 6 h, the killing situation was observed under a microscope. The 96-well plate was placed in a centrifuge and centrifuged at 1000 x g for 10 min. After the 96-well plate was removed, 100 μL of the culture medium was aspirated, which can be used for subsequent cytokine detection. The remaining volume of the culture medium was discarded. 100 μL of luciferase substrate was added, and the plate was incubated in the dark for 10 min. The substrate on the 96-well plate was transferred to a white 96-well plate. The white 96-well plate was placed in an enzyme marker for data reading. The data was exported and saved for calculation of cell killing rate. The data was exported and saved for calculation of cell killing rate. Cell killing rate = [(background luminescence value - sample luminescence value) / background luminescence value] * 100%.

[0170] The results are shown in FIG. 10. CD47 UCAR-T cells still have good tumor killing ability in the presence of NK cells and M1 cells.

[0171] Example 8: NK cell CD107a degranulation detection

[0172] Apoptosis detection was performed using the Invivogen Annexin V-PE / 7-AAD apoptosis kit. 1 x 10 5 NK cells were stained with celltrace CFSE. NK cells were co-cultured with target cells at a ratio of 1:1 in 200 μL of culture medium containing anti-CD107a antibody. After 1 h of co-culture, 100 μg / ml of monensin was added to the culture medium. After 4 h of continuous culture, the cells were collected and washed twice with PBS. After washing, the cells were resuspended in PBS for flow cytometry analysis. Degranulated NK cells were identified as CFSE + CD107a + population.

[0173] The results are shown in FIG. 11. Overexpression of CD47 can inhibit the immune rejection of NK cells to UCAR-T cells.

[0174] Example 9: MΦ phagocytosis experiment

[0175] Apoptosis detection was performed using the Invivogen Annexin V-PE / 7-AAD apoptosis kit. 1 x 10 5MΦ cells and target cells were stained with different cell fluorescent dyes (such as celltrace CFSE or celltrace Far Red), respectively. MΦ cells were co-cultured with target cells in a ratio of 1:1 in 200 μL medium. After 6 h of co-culture, cells were collected and washed twice with PBS. After washing, cells were resuspended in PBS for flow cytometry analysis. Cells phagocytosed by macrophages were identified as the part that was double positive for the two cell fluorescent dyes.

[0176] The results are shown in Figure 12, overexpression of CD47 can inhibit the immune rejection of M1 macrophages to UCAR-T cells.

[0177] Example 10: Western blotting experiment

[0178] (1) Sample preparation

[0179] 5 x 106UCAR-T cells were collected and centrifuged at 500 x g for 5 min in a 1.5 ml centrifuge tube. 1 ml of RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors was added to the centrifuge tube. The protein concentration of all samples was adjusted to 2 μg / μL using a BCA kit. 6 CAR-T cells were centrifuged at 500 x g for 5 min in a 1.5 ml centrifuge tube. 1 ml of RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors was added to the centrifuge tube. The protein concentration of all samples was adjusted to 2 μg / μL using a BCA kit.

[0180] (2) Gel electrophoresis: Prepare a 12% SDS-PAGE gel. Mix 20 μg of protein sample with SDS loading buffer and heat at 100 °C for 10 min. Add the sample to the gel well and run at 92 V for about 90 min.

[0181] (3) Membrane transfer: The gel was removed and the gel was cut according to the needs of the experiment. The PVDF membrane was pretreated with methanol for 1 min, and then soaked in the membrane transfer buffer. The PVDF membrane was covered on the gel, and the wet membrane transfer system was used, 100 V for 1 h.

[0182] (4) Blocking: Block the PVDF membrane with BSA for 3 h at room temperature.

[0183] (5) Antibody incubation: Incubate the membrane with blocking solution containing primary antibody at 4 °C overnight. Wash the membrane with TBST 3 times, 5 min each time. Incubate the membrane with blocking solution containing secondary antibody at room temperature for 2 h. Wash the membrane with TBST 3 times, 5 min each time.

[0184] (6) Detection of development: The membrane was treated with ECL luminescent reagent and the signal was detected under the chemiluminescence imaging system.

[0185] As shown in Figure 13, the phosphorylation levels of STAT5 and BCL2 proteins in CAR-T cells with or without cytokines are shown. From the WB results, it can be seen that under the factor condition, the expression levels of BCL2 protein in each group of CAR-T cells are equivalent; and under the factor-free condition, only SAP UCAR-T can still maintain a certain level of BCL2 expression, indicating that it can maintain strong factor-free anti-apoptotic ability.

[0186] Example 11: Test in immunodeficient mice

[0187] Source and feeding of experimental animals

[0188] C-NKG mice are a kind of severe immunodeficient mice independently developed by SAIYEBIO by knocking out the Il2rg gene on the NOD-Scid background strain. C-NKG mice lack mature T, B, and NK immune cells, have reduced complement activity, and have weak phagocytosis of human cells by macrophages. They can efficiently transplant human hematopoietic stem cells (HSCs), peripheral blood mononuclear cells (PBMCs), patient-derived xenografts (PDXs), or adult stem cells and tissues, and are currently recognized as an excellent model for research on tumor, immune, autoimmune diseases, immunotherapy vaccines, GvHD, transplantation, safety evaluation, etc. with high degree of immunodeficiency.

[0189] The experimental animals were bred in the Experimental Animal Center of Nanjing Normal University (SPF level). The feeding environment control should meet the following requirements: temperature 18-22℃, relative humidity 40-60%, and the temperature and humidity should be relatively stable, with a daily temperature difference of not more than 3℃. The light was alternated for 12h light and 12h dark. The mice were fed with full nutritional pellet feed (treated with cobalt Gu60 irradiation), and the drinking water was treated with high-temperature sterilization. The bedding was replaced twice a week. All live animal experiments were approved by the Animal Experiment Ethics Committee of Nanjing Normal University (IACUC-20200515).

[0190] Construction of human immune system mice and injection of CAR-T

[0191] 6-week-old C-NKG female mice were purchased from SAIYEBIO and bred in the Experimental Animal Center of Nanjing Normal University. After the mice were stable, 1x107PBMC cells were infused through the tail vein, with a injection volume of 200μL. From the day of infusion, tail vein blood was taken every 7 days, 100μL to an anticoagulant tube. Through flow cytometry detection of mouse whole blood, human CD45+ antibody was used to detect the proportion of CD45+ cells in the blood to judge the construction of human immune system mice.

[0192] After the construction of the mouse human immune system was successful, 5x10 6CAR-T cells, respectively, TRAC- / -CAR-T group, UCAR-T group, CD47 UCAR-T group and SAP UCAR-T group.

[0193] Mouse whole blood flow detection

[0194] Take 100 μL blood sample from the tail vein of mice into an anticoagulant tube. Transfer the blood sample in the anticoagulant tube into a 1.5 ml centrifuge tube, centrifuge at 1000 x g for 10 min, and discard the supernatant. Add 1 ml red blood cell lysis solution to the centrifuge tube, wait for 5-10 min until the liquid in the centrifuge tube is clear. Centrifuge at 1000 x g for 10 min, discard the supernatant. Resuspend the bottom precipitate with 100 μL PBS, and add the required flow antibody for determination to it. After incubation for 15 min, do not wash the cells, directly add 400 μL PBS to resuspend the cells, and use a flow cytometer to detect.

[0195] The results are shown in Figure 14, and the SAP UCAR-T cells have the highest CAR-T cell persistence, indicating that they can prolong the survival of CAR-T cells.

[0196] It will be understood by those skilled in the art in light of the present disclosure that many changes can be made in the specific embodiments which have been disclosed and such changes are intended to be understood within the spirit and range of equivalents of the disclosed subject matter.

Claims

1. A T cell engineered to express an interleukin-7 receptor alpha (IL7Ra) variant, the variant comprising an amino acid sequence as set forth in SEQ ID NO: 6 or 7.

2. The T cell of claim 1, wherein the T cell further has a knockout or inactivation of a gene encoding one or more proteins selected from the group consisting of: T cell receptor (TCR), HLA class I molecule, and HLA class II molecule, optionally, a knockout or inactivation of a gene encoding one or more proteins selected from the group consisting of: TCRa, TCRp, beta-2 microglobulin (B2M), and HLA-DRA.

3. The T cell of claim 2, wherein the cell has a knockout or inactivation of genes encoding TCRa, B2M, and HLA-DRA.

4. The T cell of any one of claims 1-3, further overexpressing a CD47 protein or an extracellular region fragment thereof, the CD47 protein or the extracellular region fragment thereof comprising an amino acid sequence of SEQ ID NO: 8 or a functional variant having at least 90% homology to SEQ ID NO:

8.

5. The T cell of claim 4, engineered to express a fusion protein of the CD47 protein or the extracellular region fragment thereof and the IL7Ra variant; optionally, the fusion protein comprises the CD47 protein or the extracellular region fragment thereof operably linked to an N-terminus of the IL7Ra variant; optionally, the fusion protein comprises an amino acid sequence of SEQ ID NO: 9 or 10.

6. The T cell of any one of claims 1-5, which is a CAR-T cell, optionally a CAR-T cell obtained by engineering a donor-derived T cell with a CAR construct.

7. A method of making a modified T cell, the method comprising: the T cell is engineered to overexpress an interleukin-7 receptor alpha (IL7Ra) variant, wherein the variant comprises an amino acid sequence as set forth in SEQ ID NO: 6 or 7.

8. The method of claim 7, the engineering being performed by transforming or transfecting the T cell with an expression vector encoding the IL7Ra variant.

9. The method of claim 7 or 8, wherein the expression vector further comprises a nucleotide sequence encoding a CD47 protein or an extracellular region fragment thereof, the CD47 protein or the extracellular region fragment thereof comprising an amino acid sequence of SEQ ID NO: 8 or a functional variant having at least 90% homology to SEQ ID NO:

8.

10. The method of claim 9, wherein the expression vector comprises a nucleotide sequence encoding a fusion protein of the CD47 protein or the extracellular region fragment thereof and the IL7Ra variant; optionally, the fusion protein comprises the CD47 protein or the extracellular region fragment thereof operably linked to an N-terminus of the IL7Ra variant; optionally, the fusion protein comprises an amino acid sequence of SEQ ID NO: 9 or 10.

11. The method of any one of claims 7-10, further comprising engineering the T cell to express a chimeric antigen receptor (CAR), thereby making a CAR-T cell.

12. The method of claim 11, wherein the CAR and the IL7Ra variant are encoded by the same expression vector or by separate expression vectors.

13. The method of claim 12, wherein the expression vector comprises both a nucleotide sequence encoding a CAR and a nucleotide sequence encoding a fusion protein of the CD47 protein or an extracellular region fragment thereof and the IL7Ra variant, optionally, the nucleotide sequence encoding a CAR is operably linked to the nucleotide sequence encoding a fusion protein of the CD47 protein or an extracellular region fragment thereof and the IL7Ra variant by a nucleotide sequence encoding a self-cleaving linker sequence (such as a 2A linker) or an internal ribosome entry site (IRES).

14. The method of any one of claims 8-13, wherein the expression vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a transposon vector, and a viral vector; optionally, the vector is a viral vector, such as a lentiviral vector, an adenoviral vector, or a retroviral vector.

15. The method of any one of claims 7-14, further comprising knocking out or inactivating in the T cell a gene encoding one or more proteins selected from the group consisting of a T cell receptor (TCR), an HLA class I molecule, and an HLA class II molecule.

16. The method of claim 15, comprising knocking out or inactivating in the T cell an endogenous gene encoding one or more proteins selected from the group consisting of TCRa, TCRp, B2M, and HLA-DRA, optionally, comprising knocking out or inactivating in the cell endogenous genes encoding TCRa, B2M, and HLA-DRA.

17. The method of any one of claims 15-16, wherein the knocking out or inactivating of the gene is performed by contacting the T cell with a gene editing system, such as a CRISPR / Cas9 gene editing system, and introducing components of the system into the cell.

18. The method of claim 17, wherein the gene editing system comprises: any combination of one or more of a sgRNA targeting a TCRa constant region-encoding gene, a sgRNA targeting a TCRp constant region-encoding gene, a sgRNA targeting a B2M gene, and a sgRNA targeting a HLA-DRA gene, or a combination of one or more vectors expressing the sgRNAs; and a nuclease or a nucleic acid encoding the nuclease.

19. The method of claim 18, wherein the gene editing system comprises: a sgRNA targeting a TCRa constant region-encoding gene, a sgRNA targeting a B2M gene, and a sgRNA targeting a HLA-DRA gene.

20. The method of claim 18 or 19, wherein the nuclease is capable of inactivating the corresponding targeted gene under the guidance of each sgRNA, optionally the nuclease is a Cas nuclease, such as a Cas9 nuclease or a Casl2 nuclease, more specifically a spCas9 nuclease.

21. The method of any one of claims 17-20, wherein the sgRNAs are mixed and incubated with the nuclease prior to contacting the T cell with the gene editing system.

22. The method of any one of claims 17-21, wherein the components of the system are introduced into the T cells by electroporation.

23. A T cell prepared by the method of any one of claims 7-22.

24. A vector comprising a nucleotide sequence encoding a CD47 protein or an extracellular region fragment thereof operably linked to a nucleotide sequence encoding an IL7Ra variant, wherein the CD47 protein or extracellular region thereof comprises an amino acid sequence of SEQ ID NO: 8 or a functional variant having at least 90% homology to SEQ ID NO: 8, and the IL7Ra variant comprises an amino acid sequence as set forth in SEQ ID NO: 6 or 7, optionally, the operable linkage is a direct linkage.

25. A vector comprising a nucleotide sequence encoding a CAR, a nucleotide sequence encoding a CD47 protein or an extracellular region fragment thereof, and a nucleotide sequence encoding an IL7Ra variant, wherein the nucleotide sequence encoding the CAR is operably linked to the nucleotide sequence encoding the CD47 protein or extracellular region fragment thereof or the nucleotide sequence encoding the IL7Ra variant by a nucleotide sequence encoding a self-cleaving linker sequence or an internal ribosome entry site (IRES); wherein the CD47 protein or extracellular region thereof comprises an amino acid sequence of SEQ ID NO: 8 or a functional variant having at least 90% homology to SEQ ID NO: 8, and the IL7Ra variant comprises an amino acid sequence as set forth in SEQ ID NO: 6 or 7, optionally, the nucleotide sequence encoding the CD47 protein or extracellular region thereof is directly linked to the nucleotide sequence encoding the IL7Ra variant.

26. The vector of claim 24 or 25, wherein the self-cleaving linker sequence is a 2A linker sequence, e.g., a P2A linker sequence.

27. The vector of any one of claims 24-26, which is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a transposon vector, and a viral vector; optionally, the vector is a viral vector, e.g., a lentivirus vector, an adenovirus vector, or a retrovirus.

28. A pharmaceutical composition comprising the T cell of any one of claims 1-5 and 23 and a pharmaceutically acceptable carrier.

29. Use of the T cell of any one of claims 1-5 and 23 in the manufacture of a medicament for treating cancer, an autoimmune disease, or an inflammatory disease in a subject.

30. Use of the T cell of any one of claims 1-5 and 23 in the manufacture of a medicament for allogeneic organ transplantation.

Citation Information

Patent Citations

  • Amplification enhancer and application thereof

    CN115066433A

  • Universal chimeric antigen receptor T cell and application thereof

    CN115348870A

  • Methods and compositions for modulating CAR-T activity

    CN117157096A

  • Engineered CD47 proteins and uses thereof

    WO2023158836A1

  • Chimeric cytokine receptors

    WO2023192948A1