Glycosyltransferase UGT76g1 and UGT91c1 mutants and method for catalytic synthesis of rebaudioside a, d, and m by using same

Abstract

Glycosyltransferase UGT76G1 and UGT91C1 mutants and a method for catalytic synthesis of rebaudioside A, D, and M by using same, pertaining to the technical field of biocatalytic synthesis. The glycosyltransferase UGT76G1 mutant can effectively synthesize rebaudioside A using stevioside STV as a substrate. The glycosyltransferase UGT91C1 mutant is obtained by mutation screening of wild-type glycosyltransferase UGT91C1, has higher enzyme activity and catalytic rate, and can effectively synthesize rebaudioside D using rebaudioside A as a substrate. The glycosyltransferase UGT76G1 mutant can also be obtained by mutation and subsequent screening of glycosyltransferase UGT76G1, has higher catalytic activity, and can effectively synthesize rebaudioside M using rebaudioside D and UDPG as substrates.

Description

A glycosyltransferase UGT76G1, UGT91C1 mutant and method for catalyzing synthesis of rebaudioside A, D and M

[0001] The present application claims priority to the Chinese patent application No. 202410682554.8, filed on May 29, 2024, entitled “A glycosyltransferase UGT76G1 mutant and method for catalyzing synthesis of rebaudioside A”, the Chinese patent application No. 202410682592.3, filed on May 29, 2024, entitled “A glycosyltransferase UGT91C1 mutant and method for catalyzing synthesis of rebaudioside D”, and the Chinese patent application No. 202410682588.7, filed on May 29, 2024, entitled “A glycosyltransferase UGT76G1 mutant and method for catalyzing synthesis of rebaudioside M”, all of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0002] The present application relates to the technical field of biocatalytic synthesis, in particular to a glycosyltransferase UGT76G1, UGT91C1 mutant and method for catalyzing synthesis of rebaudioside A, D and M. BACKGROUND

[0003] Rebaudioside A is a natural sweetener extracted from the leaves of Stevia rebaudiana plants, which contains no calories and does not participate in human blood glucose metabolism, and is friendly to diabetic patients. International food safety agencies have approved it as a food additive, considering it safe within the specified usage range. Compared with other steviol glycosides in stevia extract, rebaudioside A is known for its taste closer to sucrose. It has no obvious aftertaste or metallic taste, and its taste is purer and sweeter, and it has good stability at high temperatures, making it suitable for use in hot-processed food and beverage formulations without significant changes in sweetness or degradation due to heating.

[0004] Rebaudioside A has very high sweetness, usually considered 200 to 450 times sweeter than sucrose. Due to its extremely high sweetness, only a small amount is needed to achieve a sweetness effect comparable to sucrose, thereby significantly reducing the caloric intake of food or beverages. Because of the low-calorie properties of rebaudioside A, rebaudioside A is widely used in the development of various low-sugar, sugar-free, and reduced-sugar products, such as beverages, candies, baked goods, condiments, and table sugars, to meet the needs of consumers for healthy diets.

[0005] Generally, rebaudioside A is extracted from the leaves of Stevia rebaudiana using separation and purification techniques, but the yield of rebaudioside A obtained by this method is relatively low, which cannot meet the high demand of the market.

[0006] Rebaudioside D is a natural, non-nutritive sweetener, one of the many steviol glycosides in Stevia rebaudiana, with very low calories and high sweetness. Compared with other steviol glycosides in Stevia rebaudiana extract, such as Rebaudioside A, Rebaudioside D has relatively higher sweetness and less aftertaste, and is closer to the taste of sucrose.

[0007] In the food and beverage industry: As a zero-calorie sweetener, Rebaudioside D is widely used in various low-calorie and sugar-free foods such as beverages, baked goods, candies, dairy products, jams, condiments, etc. to reduce the sugar content of products without affecting their sweet quality. And because Rebaudioside D does not cause blood sugar levels to rise, it is particularly suitable for diabetics and consumers who need to control their blood sugar, and can be an ideal choice for sugar substitutes. At the same time, with the increasing attention of consumers to a healthy lifestyle, more and more sugar-reduced and fat-reduced products use Rebaudioside D as a source of sweetness to meet the market demand for low-calorie foods.

[0008] However, Rebaudioside D is generally extracted from Stevia rebaudiana leaves by separation and purification technology, and the yield of Rebaudioside D obtained by this method is relatively low, which cannot meet the high demand of the market.

[0009] Rebaudioside M is a natural sweetener extracted from Stevia rebaudiana, which belongs to the family of steviol glycosides. Compared with other common steviol glycosides, such as Rebaudioside A, Rebaudioside M also has high sweetness and relatively good taste, close to sucrose, with low to almost zero calories, and is often used as an additive for healthy and weight loss foods.

[0010] Rebaudioside M has undergone strict food safety evaluation and is considered a safe food additive that can be used in the food and beverage industry to replace traditional sugar, reduce the calories of products without affecting the sweetness, and help diabetics and people controlling their weight to reduce sugar intake. In addition, Rebaudioside M can to some extent avoid some bitter or aftertaste, so it is used in high-end food formulations to optimize taste and flavor.

[0011] However, the yield of Rebaudioside M in the prior art is relatively low, which cannot meet the high demand of the market.

[0012] SUMMARY

[0013] Therefore, the purpose of the present application is to provide a glycosyltransferase UGT76G1, UGT91C1 mutant and a method for catalyzing the synthesis of Rebaudioside A, D, M to overcome the problem of low yield of Rebaudioside A, Rebaudioside D and Rebaudioside M in the prior art.

[0014] In a first aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, wherein the UGT76G1 mutant is any one of the following (A)-(C):

[0015] (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0016] The amino acid at position 109 is mutated from L to Q;

[0017] The 113th amino acid is mutated from S to C;

[0018] The 424th amino acid is mutated from I to F;

[0019] (B) is a protein with more than 95% identity to the amino acid sequence defined by (A) and has the same function;

[0020] (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

[0021] Compared with existing technologies, the glycosyltransferase UGT76G1 mutant provided by this invention exhibits higher enzyme activity than the wild-type glycosyltransferase UGT76G1, enabling efficient synthesis of rebaudioside A using steviol STV as a substrate. The optimal mutant, 68S, can convert 60 mM steviol STV into 60 mM rebaudioside A within 18 hours, effectively converting all steviol STV into rebaudioside A, demonstrating excellent application prospects in industrial production.

[0022] Furthermore, the amino acid sequence of the glycosyltransferase UGT76G1 mutant is shown in SEQ ID NO.3.

[0023] In a second aspect, the present invention provides any of the following biomaterials:

[0024] (A) An expression gene that encodes the above-mentioned glycosyltransferase UGT76G1 mutant;

[0025] (B) A recombinant plasmid having the expression gene described in (A) linked to it;

[0026] (C) A recombinant cell containing the recombinant expression plasmid or the expression gene of the UGT76G1 mutant.

[0027] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0028] In SEQ ID NO.2, bits 325-327 are replaced by CAG instead of CTG;

[0029] In SEQ ID NO.2, bits 337-339 are replaced by TGC;

[0030] Bits 1270-1272 of SEQ ID NO.2 are replaced with TTG;

[0031] Preferably, the nucleotide sequence of the expressed gene is shown in SEQ ID NO.4.

[0032] Thirdly, the present invention provides an enzyme composition comprising: a glycosyltransferase UGT76G1 mutant and a sucrose synthase AtSUS;

[0033] Sucrose synthase AtSUS is either (B1) or (B2) as follows: The amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0034] Proteins whose amino acid sequences defined by (B2) and (B1) are more than 95% identical and have the same function.

[0035] Fourthly, the present invention provides a complete set of recombinant strains expressing the above-mentioned enzyme composition, comprising recombinant strain A and recombinant strain B: recombinant strain A contains recombinant plasmid A, which is obtained by constructing the coding gene of the mutant glycosyltransferase UGT76G1 as described in claim 1 or 2 into an expression vector; recombinant strain B contains recombinant plasmid B, which is obtained by constructing the coding gene of sucrose synthase AtSUS into a plasmid; the sequence of the coding gene of sucrose synthase AtSUS is shown in SEQ ID NO. 6.

[0036] Furthermore, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

[0037] Fifthly, the present invention provides a method for synthesizing rebaudioside A using a glycosyltransferase UGT76G1 mutant, comprising the following steps:

[0038] Stevioside STV, UDPG, sucrose, and the enzyme combination or the induced expression enzyme product of the above-mentioned recombinant strains are added to the catalytic reaction system. The reaction is carried out, the enzyme is inactivated, and the supernatant is obtained by centrifugation. The supernatant contains rebaudioside A.

[0039] Compared with existing technologies, this invention uses steviol glycosides STV, UDPG, and sucrose as reaction substrates, and couples the glycosyltransferase UGT76G1 mutant with sucrose synthase AtSUS to catalyze the reaction. This not only enables the recycling and regeneration of the substrate UDPG to efficiently generate rebaudioside A, but also allows for the indirect measurement of glycosyltransferase activity based on the quantitative analysis of fructose in the product, thereby screening out superior mutants with high enzyme activity.

[0040] Furthermore, the inducible expression enzyme products of the above-mentioned complete set of recombinant strains include inducible expression enzyme product A and inducible expression enzyme product B;

[0041] The method for obtaining the induced expression enzyme product A includes the following steps:

[0042] The seed culture of the above recombinant strain A was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was measured. 600 When the concentration reaches 0.6–0.8, add L-arabinose and continue induction culture for 8–40 h. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product A; the inoculum size is 1 v / v%; the final concentration of kanamycin sulfate is 10–100 μg / mL; and the final concentration of L-arabinose is 0.1–15 mM.

[0043] The method for obtaining the induced expression enzyme product B includes the following steps:

[0044] The seed culture of the above recombinant strain B was inoculated into a medium containing kanamycin sulfate and cultured at 30–40°C and 200–300 rpm until OD500. 600 When the concentration reaches 0.6–0.8, add L-arabinose and continue culturing for 8–40 h. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product B. The inoculum size is 1 v / v%. The final concentration of kanamycin sulfate is 10–100 μg / mL. The final concentration of L-arabinose is 0.1–15 mM.

[0045] Furthermore, the concentration of steviol glycoside STV in the catalytic reaction system is 10–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 50–800 mM, the amount of induced expression enzyme product of recombinant strain A is 0.1–50 mL, and the amount of induced expression enzyme product of recombinant strain B is 0.1–50 mL.

[0046] Furthermore, in the above catalytic reaction system, the pH value is 5.0–8.0, the temperature is 25–60℃, and the reaction time is 5–30 h.

[0047] Sixthly, the present invention provides a glycosyltransferase UGT91C1 mutant, wherein the UGT91C1 mutant is any one of the following (A)-(C):

[0048] (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.20:

[0049] The 89th amino acid is mutated from N to Y;

[0050] The 155th amino acid was mutated from M to L;

[0051] The 274th amino acid is mutated from S to T;

[0052] The 361st amino acid was mutated from N to S;

[0053] (B) Proteins that have 95% or 98% or more of the same amino acid sequence as defined in (A) and have the same function;

[0054] (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

[0055] Compared with the prior art, the glycosyltransferase UGT91C1 mutant provided by the present invention is obtained by mutation screening of wild-type glycosyltransferase UGT91C1. It has higher enzyme activity and catalytic rate. The optimal mutant 2-12E can convert 27.4 mM rebaudioside A into 25.8 mM rebaudioside D within 15 hours, with a rebaudioside A conversion rate of 94.2%, which greatly improves the yield of rebaudioside D.

[0056] Furthermore, the amino acid sequence of the glycosyltransferase UGT91C1 mutant is shown in SEQ ID NO.22.

[0057] In a seventh aspect, the present invention provides a biomaterial comprising any one of the following:

[0058] (A) An expression gene that encodes the above-mentioned glycosyltransferase UGT91C1 mutant;

[0059] (B) A recombinant plasmid containing the expression gene described in (A);

[0060] (C) A recombinant cell containing the above-mentioned recombinant plasmid or the gene expressing the glycosyltransferase UGT91C1 mutant.

[0061] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.21:

[0062] The 89th bit of SEQ ID NO.21 is replaced with TAT instead of AAC;

[0063] The 155th bit of SEQ ID NO.21 is replaced by TTG;

[0064] The 274th bit of SEQ ID NO.21 is replaced by ACG instead of TCC;

[0065] The 361st bit of SEQ ID NO.21 is replaced with AGC by AAC;

[0066] Preferably, the nucleotide sequence of the expressed gene is shown in SEQ ID NO.23.

[0067] In an eighth aspect, the present invention provides an enzyme composition comprising the above-mentioned glycosyltransferase UGT91C1 mutant and sucrose synthase AtSUS;

[0068] Sucrose synthase AtSUS is either (B1) or (B2) as follows: The amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0069] Proteins whose amino acid sequences defined by (B2) and (B1) are 95% or 98% identical and have the same function.

[0070] In a ninth aspect, the present invention provides a complete set of recombinant strains for use in the above-mentioned enzyme composition, comprising recombinant strain A and recombinant strain B:

[0071] Recombinant strain A contains the aforementioned recombinant plasmid;

[0072] The recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid; the encoding gene of AtSUS is shown in SEQ ID NO.6.

[0073] Furthermore, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

[0074] In a tenth aspect, the present invention provides a method for synthesizing rebaudioside D using a glycosyltransferase UGT91C1 mutant, comprising the following steps:

[0075] Add rebaudioside A, UDPG, sucrose, and the enzyme combination or the induced expression enzyme product of the above-mentioned recombinant strain to the catalytic reaction system. After the reaction is completed, inactivate the enzyme, centrifuge, and collect the supernatant, which contains rebaudioside D.

[0076] Compared with existing technologies, the glycosyltransferase UGT91C1 mutant can catalyze the synthesis of rebaudioside D and UDP via glycosylation using rebaudioside A and UDPG as substrates, while sucrose synthase AtSUS can catalyze the reaction of UDP and sucrose to produce UDPG and fructose. Therefore, this invention uses rebaudioside A, UDPG, and sucrose as substrates, and employs a two-enzyme coupling reaction of the glycosyltransferase UGT91C1 mutant and sucrose synthase AtSUS. On the one hand, the activity of the glycosyltransferase can be indirectly measured by quantitative analysis of the reaction product fructose, thereby screening for the glycosyltransferase UGT91C1 mutant with higher catalytic activity. On the other hand, the introduction of sucrose synthase AtSUS enables the recycling and regeneration of UDPG, further increasing the yield of rebaudioside D.

[0077] Furthermore, the inducible expression enzyme products of the above-mentioned complete set of recombinant strains include inducible expression enzyme product A and inducible expression enzyme product B;

[0078] The method for obtaining the induced expression enzyme product A is as follows:

[0079] The seed culture of recombinant strain A from claim 5 was inoculated into a culture medium containing kanamycin sulfate. The OD of the culture medium was... 600 When the concentration reaches 0.6–0.8, isopropyl-β-D-thiogalactoside is added for induction culture for 8–40 h. The cells are then centrifuged and collected. Lysozyme solution is added to the cells to disrupt them, or the cells are disrupted by sonication. After centrifugation, the supernatant is collected as the induced expression enzyme product A. The final concentration of kanamycin sulfate is 10–100 μg / mL; the final concentration of isopropyl-β-D-thiogalactoside is 0.01–1 mM.

[0080] The method for obtaining the induced expression enzyme product B is as follows:

[0081] The seed culture of recombinant strain B from claim 5 was inoculated into a culture medium containing kanamycin sulfate and cultured at 25–40°C and 200–300 r / min until OD. 600 When the concentration reaches 0.6–0.8, L-arabinose is added and the culture is continued for 8–40 h. The cells are then centrifuged and collected. Lysozyme solution is added to the cells to break them up or the cells are broken up by sonication. The cells are then centrifuged again and the supernatant is collected as the induced expression enzyme product B. The final concentration of kanamycin sulfate is 10–100 μg / mL, and the final concentration of L-arabinose is 0.1–15 mM.

[0082] Furthermore, the concentration of rebaudioside A in the catalytic reaction system is 5–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 40–800 mM, the amount of induced expression enzyme product A added is 0.1–50 mL, and the amount of induced expression enzyme product B added is 0.1–50 mL.

[0083] Furthermore, the pH value of the catalytic reaction system is 5.0–8.0, the temperature is 25–60℃, and the reaction time is 5–30 h.

[0084] In one aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, wherein the UGT76G1 mutant is any one of the following (A)-(C):

[0085] (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1:

[0086] The 89th amino acid was mutated from M to H;

[0087] The 380th amino acid was mutated from L to M;

[0088] The 411th amino acid is mutated from A to Y;

[0089] (B) Proteins that have 95% or 98% or more of the same amino acid sequence as defined in (A) and have the same function;

[0090] (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

[0091] Compared with the prior art, the glycosyltransferase UGT76G1 mutant provided by the present invention is obtained by screening for mutations of glycosyltransferase UGT76G1, and has higher catalytic activity, enabling efficient synthesis of rebaudioside M using rebaudioside D and UDPG as substrates.

[0092] Furthermore, the amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.30.

[0093] In a twelfth aspect, the present invention provides a biomaterial comprising any one of the following:

[0094] (A) An expression gene that encodes the above-mentioned glycosyltransferase UGT76G1 mutant;

[0095] (B) A recombinant plasmid containing the expressed gene described in (A);

[0096] (C) A recombinant cell comprising the recombinant plasmid described in (B) or the expressed gene described in (A).

[0097] The above-mentioned expressed gene is obtained by one or more of the following mutations in SEQ ID NO.2:

[0098] The 89th bit of SEQ ID NO.2 is replaced with CAT by ATG;

[0099] The 380th bit of SEQ ID NO.2 is replaced by ATG instead of CTC;

[0100] The 411th bit of SEQ ID NO.2 is replaced with TAT by GCA;

[0101] Preferably, the sequence of the expressed gene is as described in SEQ ID NO.31.

[0102] In a thirteenth aspect, the present invention provides an enzyme composition comprising the above-mentioned glycosyltransferase UGT76G1 mutant and sucrose synthase AtSUS;

[0103] Sucrose synthase AtSUS is either (B1) or (B2):

[0104] The amino acid sequence of (B1) is shown in SEQ ID NO.5;

[0105] Proteins whose amino acid sequences defined by (B2) and (B1) are 95% or 98% identical and have the same function.

[0106] In a fourteenth aspect, the present invention provides a method for synthesizing rebaudioside M using glycosyltransferase UGT76G1, characterized in that rebaudioside M is synthesized using the above-mentioned enzyme composition as substrates, including rebaudioside D, UDPG, and sucrose.

[0107] Furthermore, in the catalytic reaction system, the concentration of rebaudioside D is 5–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 40–800 mM, the amount of glycosyltransferase UGT76G1 mutant enzyme solution added is 0.1–50 mL, and the amount of sucrose synthase AtSUS enzyme solution added is 0.1–50 mL.

[0108] Furthermore, the preparation method of the glycosyltransferase UGT76G1 mutant enzyme solution includes the following steps:

[0109] (1) The coding gene of the glycosyltransferase UGT76G1 mutant was constructed into an expression vector to obtain recombinant plasmid A. Recombinant plasmid A was transformed into host bacteria to obtain recombinant strain A.

[0110] (2) The seed culture of recombinant strain A was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the concentration reaches 0.6–0.8, L-arabinose is added and the cells are induced and cultured at 25–40°C for 8–40 h. After centrifugation, the bacterial cells are collected and lysed. The supernatant is the glycosyltransferase UGT76G1 mutant enzyme solution. The inoculum size is 1 v / v%. The final concentration of kanamycin sulfate is 10–100 μg / mL. The final concentration of L-arabinose is 0.1–15 mM.

[0111] Furthermore, the preparation method of sucrose synthase AtSUS enzyme solution includes the following steps:

[0112] (1) The AtSUS encoding gene of sucrose synthase was constructed into an expression vector to obtain recombinant plasmid B. The recombinant plasmid B was transformed into a host bacterium to obtain recombinant strain B. The AtSUS encoding gene is shown in SEQ ID NO.6.

[0113] (2) The seed culture of recombinant strain B was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600When the concentration reaches 0.6–0.8, add L-arabinose and continue induction culture at 25–40℃ for 8–40 h. Centrifuge, collect the bacterial cells and lyse the cells. Centrifuge again, and the supernatant is the sucrose synthase AtSUS enzyme solution. The inoculum size is 1 v / v%. The final concentration of kanamycin sulfate is 10–100 μg / mL. The final concentration of L-arabinose is 0.1–15 mM.

[0114] Furthermore, the host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

[0115] Furthermore, in the catalytic reaction system, the pH value is 5.0–8.0, the temperature is 25–60℃, and the reaction time is 5–30 h.

[0116] Compared with existing technologies, this invention couples the glycosyltransferase UGT76G1 mutant with sucrose synthase AtSUS dienzyme, using sucrose, UDPG, and rebaudioside D as substrates to catalyze the synthesis of rebaudioside M. In this process, UDPG is recycled, reducing substrate consumption. Furthermore, the fructose generated in the reaction can be quantitatively analyzed, indirectly measuring the activity level of the glycosyltransferase UGT76G1 mutant. Based on this characteristic, the glycosyltransferase UGT76G1 can be targeted for evolutionary modification to improve its catalytic activity. Attached Figure Description

[0117] Figure 1 shows the yield of rebaudioside A (RA) under the catalysis of different glycosyltransferase UGT76G1 mutants in Example 3.

[0118] Figure 2 shows the trend of rebaudioside A (RA) yield with conversion time in Example 4.

[0119] Figure 3 shows the yield of rebaudioside D (RD) under the catalysis of different glycosyltransferase UGT91C1 mutants.

[0120] Figure 4 shows the trend of rebaudioside D (RD) yield with conversion time.

[0121] Figure 5 shows the yield of rebaudioside M (RM) under the catalysis of different glycosyltransferase UGT76G1 mutants.

[0122] Figure 6 shows the trend of rebaudioside M (RM) yield with conversion time. Detailed Implementation

[0123] To make the technical problems to be solved, the technical solutions, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the present invention.

[0124] Example 1

[0125] Preparation of recombinant bacteria expressing sucrose synthase AtSUS

[0126] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers, and with cDNA of the Arabidopsis-derived sucrose synthase AtSUS as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The sequence of the encoding gene for sucrose synthase AtSUS is shown in SEQ ID NO.6. The amino acid sequence of sucrose synthase AtSUS is shown in SEQ ID NO.5.

[0127] Inf-pYB1k-atsus-F:GCTAACAGGAGGAATTAACCATGGAAAATAAAACGGAGACC(SEQ ID NO.7)

[0128] Inf-pYB1k-atsus-R:CCAGATCTACCCTCGAGTTACAACGATGAAATGTAA GAAAC (SEQ ID NO.8)

[0129] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1):109. This pYB1k vector has been disclosed.)

[0130] pYB1k-F:CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0131] pYB1k-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0132] The Gibson assembly method was used to ligate the above-mentioned atsus gene fragment and pYB1k expression vector fragment.

[0133] The Gibson ligation product was added to *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then incubated in a 42°C water bath for 90 s, and then placed on ice for 2 min. *E. coli* was then added to 1 mL of LB medium, and the cells were incubated at 37°C on a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Multiple single clones were cultured, and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected, cultured, and plasmids were extracted to obtain the positive clone plasmid pYB1k-atsus.

[0134] pBAD-F:GATTATTTGCACGGCGTCAC(SEQ ID NO.11)

[0135] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0136] The plasmid pYB1k-atsus was transformed into E. coli BW25113 competent cells, then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing the pYB1k-atsus plasmid were selected, which were the recombinant E. coli expressing sucrose synthase AtSUS.

[0137] Example 2

[0138] Preparation of recombinant bacteria expressing wild-type glycosyltransferase UGT76G1

[0139] Using Inf-pRB1k-ugt76g1-F and Inf-pRB1k-ugt76g1-R as primers, and with cDNA of the glycosyltransferase UGT76G1 from wild-type stevia as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ugt76g1 gene fragment.

[0140] Inf-pRB1k-ugt76g1-F:

[0141] Inf-pRB1k-ugt76g1-R:

[0142] Using pRB1k-XhoI-F and pRB1k-NcoI-R as primers and the empty pRB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.) to obtain the correct pRB1k expression vector fragment. (This pRB1k vector has been disclosed in Qun Liu, Baixue Lin, Yong Tao. Improved methylation in E. coli via an efficient methyl supply system driven by betaine. Metabolic Engineering, Volume 72, 2022, 46-55).

[0143] pRB1k-XhoI-F:CTCGAGGGTAGATCTGGTAC (SEQ ID NO.15)

[0144] pRB1k-NcoI-R:GGTTAATTCCTCCTGTTAGC (SEQ ID NO.16)

[0145] The ugt76g1 gene fragment and the pRB1k expression vector fragment were ligated using the Gibson assembly method. The Gibson ligation product was added to *E. coli* DH5α competent cells (Beijing TransGen Biotech Co., Ltd.), incubated on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. The mixture was then added to 1 mL of LB medium and incubated at 37°C for 1 h in a shaker. Finally, it was plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Multiple single-clone strains were cultured, and PCR verification was performed using primers pBAD-F and ugt76g1-F300-R. Positive clones with the correct target sequence size were selected, cultured, and plasmids were extracted to obtain the positive clone plasmid pRB1k-ugt76g1.

[0146] pBAD-F:GATTATTTGCACGGCGTCAC(SEQ ID NO.11)

[0147] ugt76g1-F300-R:CTGCAGTTCCAGTTCACGAC(SEQ ID NO.17)

[0148] The plasmid pRB1k-ugt76g1 was transformed into Escherichia coli BW25113 competent cells, then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. The next day, positive clones containing pRB1k-ugt76g1 were selected, which were the recombinant Escherichia coli expressing the wild-type glycosyltransferase UGT76G1.

[0149] Example 3

[0150] Construction of a library of glycosyltransferase UGT76G1 mutants and screening of superior mutants

[0151] The wild-type glycosyltransferase UGT76G1 gene sequence was randomly mutated using error-prone PCR to construct a mutant library. Using ugt76g1-ATG-F and ugt76g1-TAA-R primers and pRB1k-ugt76g1 plasmid as a template, ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA) due to its low-fidelity nature. The amplification system and procedure are shown in Tables 1 and 2.

[0152] ugt76g1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.18)

[0153] ugt76g1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.19)

[0154] Table 1 Error-prone PCR amplification systems

[0155] Table 2 Commonly Misunderstood PCR Amplification Procedures

[0156] The PCR product was purified to obtain the UGT76G1 mutant gene fragment. The UGT76G1 mutant gene fragment was ligated to the vector pRB1k using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT76G1 mutant gene. The Gibson ligation reaction system is shown in Table 3.

[0157] Table 3 Gibson linkage reaction system

[0158] After reacting in a 50℃ water bath for 1 hour, the Gibson ligation product was transferred to *E. coli* DH5α competent cells for culture. After culturing, the *E. coli* cells were placed in a shaker for 1 hour to recover. Following recovery, the *E. coli* cells were plated and incubated at 37℃ for 12 hours. Once colonies grew, five single-clone strains were randomly selected, cultured, and their plasmids were extracted and sequenced. Subsequently, colonies on the plate were scraped with a glass rod to extract plasmids, yielding a plasmid mutant library, which was stored at -20℃ for subsequent high-throughput screening of the mutant library.

[0159] The high-throughput screening steps are as follows:

[0160] (1) After the construction of the glycosyltransferase UGT76G1 mutant library was completed, single colonies on the plate were picked with a toothpick that had been sterilized by high temperature and high pressure and inoculated into a 96-well plate containing 800 μL of LB medium (containing kanamycin sulfate). Seed culture was obtained by shaking in a 96-well plate at 37℃ and 900 rpm for 24 h.

[0161] (2) Dip the inoculation needle into the seed culture and transfer it to another new 96-well LB medium containing kanamycin sulfate (final concentration 50 μg / mL). Incubate at 37°C and 900 rpm until OD is reached. 600 When the concentration reaches 0.6–0.8, add 1 mM L-arabinose to a final concentration and continue induction culture for 22 h in a 96-well plate at 30°C and 900 rpm. After induction culture, centrifuge at 3000 × g for 20 min and collect the bacterial cells. Add lysozyme solution to each well, mix thoroughly, and allow the lysozyme to fully act on the cells, lysing the cells and releasing the intracellular enzyme. After cell lysis, centrifuge at 4°C and 3000 × g for 20 min in a refrigerated centrifuge to obtain the glycosyltransferase UGT76G1 mutant enzyme solution.

[0162] (3) Preparation of AtSUS enzyme solution: Seed culture of recombinant E. coli expressing sucrose synthase AtSUS was taken with an inoculation needle and transferred to an Erlenmeyer flask containing 10 mL of LB medium. The medium also contained kanamycin sulfate (final concentration 50 μg / mL). The culture was carried out in a shaker at 37℃ and 220 r / min. When OD... 600 When the concentration reaches 0.6–0.8, L-arabinose with a final concentration of 1 mM is added. After culturing at 30°C and 220 r / min for 22 h, the cells are collected by centrifugation and ultrasonic disruption. The cells are then centrifuged at 5000 × g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0163] (4) Mix 25mM steviol glycoside STV, 150mM sucrose, 2.5mM UDPG, 0.16mL AtSUS enzyme solution, 0.16mL UGT76G1 mutant enzyme solution, and 100mM sodium phosphate buffer. Incubate at 37℃ for 7 hours, then heat for 5 minutes to terminate the reaction. The pH of the reaction system is 7.

[0164] (5) DNS detection: Centrifuge at 3000×g for 20 min at 4°C in a refrigerated centrifuge and collect the supernatant. Add 70 μL of the reaction supernatant and 210 μL of DNS to a clean 96-well plate, mix well, and heat for 5 min to perform the DNS colorimetric reaction. After cooling to room temperature, centrifuge at 3000×g for 18 min, and transfer 200 μL of the supernatant to a 96-well microplate for OD detection using a microplate reader. 540 Numerical values. Filter out OD. 540The reaction solution with high values ​​used the UGT76G1 mutant and was retested in vials.

[0165] (6) Small-bottle validation: OD was obtained by screening with a 96-well plate. 540 After using the mutant in the high-value reaction solution, single colonies of UGT76G1 mutant, wild-type UGT76G1, and recombinant E. coli expressing sucrose synthase AtSUS were picked and inoculated into test tubes, respectively. The tubes were then incubated in a shaker at 37°C and 220 rpm for 12 h to obtain seed culture. The seed culture was then inoculated into 20 mL LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a 1% volume ratio, and incubated at 37°C and 220 rpm until OD was obtained. 600 L-arabinose was added to a final concentration of 1 mM at pH values ​​of 0.6-0.8 for induction, and the cells were cultured at 30℃ and 220 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the cells were lysed and centrifuged to obtain UGT76G1 mutant enzyme solution, wild-type UGT76G1 enzyme solution, and sucrose synthase AtSUS enzyme solution for subsequent experiments.

[0166] The reaction system in vials consisted of 25 mM steviol glycoside STV, 150 mM sucrose, 2.5 mM UDPG, 0.5 mL UGT76G1 mutant enzyme solution or wild-type UGT76G1 enzyme solution, 0.2 mL AtSUS enzyme solution, and 100 mM sodium phosphate buffer to a total volume of 10 mL. The pH of the reaction system was 7. The reaction was incubated in a water bath at 37°C for 7 hours, then stopped by boiling for 5 minutes. After centrifugation at 10000×g for 2 minutes, the supernatant was collected for DNS detection, and the OD was analyzed. 540 The reaction products catalyzed by mutants with higher values ​​than wild-type UGT76G1 were analyzed by HPLC to verify the yield of rebaudioside A (RA).

[0167] After multiple initial screenings and vial re-screenings of the UGT76G1 mutant library using 96-well plates, six superior mutants were finally selected from nearly 35,000 mutants. These mutants exhibited higher enzyme activities than the wild type and significantly improved efficiency in catalyzing the synthesis of rebaudioside A from steviol STV. The yield of rebaudioside A from these superior mutants in vial re-testing is shown in Figure 1. Specifically, the yield of rebaudioside A synthesized using mutant 68S was more than 30 times higher than that of wild-type UGT76G1. Mutant 68S, as sequenced, is obtained by mutating the amino acid sequence shown in SEQ ID NO.1 as follows: amino acid position 109 changed from L to Q, amino acid position 113 changed from S to C, and amino acid position 424 changed from I to F.

[0168] Example 4

[0169] Scale-up study of the synthesis of rebaudioside A by the optimal mutant 68S

[0170] Seed cultures of mutant 68S and sucrose synthase AtSUS were inoculated separately into 400 ml LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C with shaking at 220 rpm until OD was achieved. 600 L-arabinose was added to a final concentration of 1 mM at pH values ​​of 0.6-0.8 for induction, and the cells were cultured at 30℃ and 220 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the cells were lysed and centrifuged to obtain UGT76G1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0171] The reaction system was as follows: 60 mM steviol glycoside STV, 360 mM sucrose, 3 mM UDPG, 10 mL AtSUS enzyme solution, 10 mL 68S enzyme solution, and 100 mM sodium phosphate buffer to a final volume of 100 mL. The reaction was carried out at 37°C for 18 h. The pH of the reaction system was 7.

[0172] The reaction solution was sampled every 4 hours, and the yield of rebaudioside A was detected by HPLC. The results are shown in Figure 2. The optimal mutant 68S can convert 60 mM steviol STV into 60 mM rebaudioside A within 18 hours, that is, all steviol STV can be converted into rebaudioside A.

[0173] Example 5

[0174] Construction of recombinant E. coli AtSUS expressing sucrose synthase AtSUS

[0175] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers and Arabidopsis thaliana sucrose synthase AtSUS cDNA as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The atsus gene fragment is shown in SEQ ID NO.6, and the amino acid sequence of sucrose synthase AtSUS is shown in SEQ ID NO.5.

[0176] Inf-pYB1k-atsus-F:

[0177] Inf-pYB1k-atsus-R:

[0178] The atsus gene fragment was ligated into the expression vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-atsus.

[0179] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1):109. This pYB1k vector has been disclosed.)

[0180] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0181] pYB1k-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0182] The above-mentioned atsus gene fragment and pYB1k expression vector fragment were ligated using the Gibson assembly method.

[0183] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). Gibson ligation products were added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.

[0184] Multiple single-clone strains were selected for culture and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pYB1k-atsus.

[0185] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO.11)

[0186] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0187] Escherichia coli BW25113 competent cells were prepared using the CaCl2 method. The recombinant expression vector pYB1k-atsus was transformed into the E. coli BW25113 competent cells, and the cells were then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing pYB1k-atsus were selected and named AtSUS.

[0188] Example 6

[0189] Construction of recombinant Escherichia coli UGT91C1 expressing wild-type glycosyltransferase UGT91C1

[0190] Using ugt91c1-F and ugt91c1-R as primers, and the cDNA of glycosyltransferase UGT91C1 from wild-type rice (Oryza sativa) as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ugt91c1 gene fragment.

[0191] ugt91c1-F:

[0192] ugt91c1-R:

[0193] Using pET28a-F and pET28a-R as primers and the empty pET28a vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pET28a expression vector fragment. (This pET28a vector was previously disclosed in Pei Wang, Hai-Yan Zhou, Bo Li, Wen-Qing Ding, Zhi-Qiang Liu, Yu-Guo Zheng, Multiple modification of Escherichia coli for enhanced β-alanine biosynthesis through metabolic engineering, Bioresource Technology, Volume 342, 2021, 126050).

[0194] pET28a-F:GAATTCGAGCTCCGTCGACAAG (SEQ ID NO. 26)

[0195] pET28a-R: GGTATATCTC CTTCTTAAAG (SEQ ID NO. 27)

[0196] The above-mentioned ugt91c1 gene fragment and pET28a expression vector fragment were ligated using the Gibson assembly method.

[0197] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). Gibson ligation products were added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.

[0198] Multiple single-clone strains were selected for culture and PCR verification was performed using primers T7-F and ugt91c1-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pET28a-ugt91c1.

[0199] T7-F:TAATACGACTCACTATAGGG(SEQ ID NO.28)

[0200] ugt91c1-F300-R:GGCGGTGCAGTTCAACCATG(SEQ ID NO.29)

[0201] After preparing E. coli BL21(DE3) competent cells using the CaCl2 method, the recombinant expression vector pET28a-ugt91c1 was transformed into the E. coli BL21(DE3) competent cells, which were then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing pET28a-ugt91c1 were selected and named recombinant E. coli UGT91C1.

[0202] Example 7

[0203] Construction of a library of glycosyltransferase UGT91C1 mutants

[0204] UGT91C1 was randomly mutated using error-prone PCR. Primers ugt91c1-ATG-F and ugt91c1-TAA-R were used, and the pET28a-ugt91c1 plasmid was used as a template. The low-fidelity nature of rTaq DNA polymerase (TAKARA) was utilized for ep-PCR amplification. The amplification system and procedure are shown in Tables 4 and 5.

[0205] ugt91c1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.18)

[0206] ugt91c1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.19)

[0207] Table 4 Commonly Misunderstood PCR Amplification Systems

[0208] Table 5 Commonly Misunderstood PCR Amplification Procedures

[0209] After purification of the PCR product, the mutant gene fragment of UGT91C1 was obtained. These fragments were then ligated to the vector pET28a using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT91C1 mutant gene. The Gibson ligation reaction system is shown in Table 6.

[0210] Table 6 Gibson linkage reaction system

[0211] After reacting in a 50℃ water bath for 1 hour, the plasmid containing the UGT91C1 mutant gene was transferred to *E. coli* DH5α competent cells and cultured. The cells were then incubated in a shaker for 1 hour. After incubation, the cells were plated and incubated at 37℃ for 12 hours. Once colonies grew, five single-clone strains were randomly selected, and their plasmids were extracted and sequenced. Subsequently, colonies on the plate were scraped with a glass rod to extract plasmids, yielding a plasmid mutant library, which was stored at -20℃ for subsequent high-throughput screening of the mutant library.

[0212] Example 8

[0213] High-throughput screening of superior mutants

[0214] After the random mutant library was constructed, single colonies were picked from the plate using a toothpick sterilized by high temperature and autoclave, and inoculated into a 96-well plate containing 800 μL of LB medium (containing kanamycin sulfate). The seed culture was obtained by shaking and culturing in a 96-well plate at 37°C and 900 rpm for 24 h.

[0215] Dip the inoculation needle into the seed culture and transfer it to a new 96-well LB medium containing kanamycin sulfate (final concentration 50 μg / mL). Incubate at 37°C and 900 rpm until the OD of the culture medium is measured. 600When the cytoplasmic reticulum reached 0.6–0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.4 mM, and the cells were further induced and cultured in a 96-well plate at 30°C and 900 rpm for 22 h. After induction, the cells were collected by centrifugation at 3000 × g for 20 min. Lysozyme solution was added to each well and mixed thoroughly to allow the lysozyme to fully act on the cells, lysing them and releasing the intracellular enzyme. After cell lysis, the cells were centrifuged at 3000 × g for 20 min at 4°C in a refrigerated centrifuge to obtain the glycosyltransferase UGT91C1 mutant enzyme solution.

[0216] Preparation of AtSUS enzyme solution: The seed culture of recombinant *E. coli* AtSUS was collected using an inoculation needle and transferred to an Erlenmeyer flask containing 10 mL of LB medium, which also contained kanamycin sulfate (final concentration 50 μg / mL). The flask was incubated at 37℃ and 220 rpm in a shaker. When the OD... 600 When the concentration reaches 0.6–0.8, add L-arabinose to a final concentration of 1 mM and continue culturing at 30°C and 220 r / min for 22 h. Centrifuge, collect the bacterial cells, and then sonicate to disrupt the cells. Centrifuge at 5000 × g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0217] The reaction system consisted of 7 mM rebaudioside A, 42 mM sucrose, 1.6 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mL of glycosyltransferase UGT91C1 mutant enzyme solution and wild-type UGT91C1 enzyme solution, mixed with 100 mM sodium phosphate buffer. The reaction was incubated in a water bath at 37°C for 6 h, then terminated by heating for 5 min. The pH of the reaction system was 8.

[0218] DNS assay: The reaction product was centrifuged at 3000×g for 20 min at 4°C in a refrigerated centrifuge, and the supernatant was collected. 70 μL of the supernatant and 210 μL of DNS were added to a clean 96-well plate, mixed well, and heated for 5 min to develop the DNS colorimetric reaction. After cooling to room temperature, the plate was centrifuged at 3000×g for 18 min. 200 μL of the supernatant was transferred to a 96-well microplate, and the OD value was measured using a microplate reader. 540 Numerical value. OD 540 The UGT91C1 mutant used in the reaction solution with the high value is the mutant with high activity, and it is then retested in a vial.

[0219] Small-bottle validation: OD was obtained after screening with a 96-well plate. 540After obtaining mutants with high viral loads, single colonies of the mutant, wild-type UGT91C1, and recombinant Escherichia coli AtSUS were picked and inoculated into test tubes, respectively. The tubes were then incubated in a shaker at 37°C and 220 rpm for 12 hours to obtain seed culture. The seed culture was then inoculated into 20 mL LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a 1% volume ratio, and incubated again at 37°C and 220 rpm until OD was achieved. 600 When the pH was 0.6-0.8, IPTG was added to the culture medium of mutant and wild-type UGT91C1 to induce induction with a final concentration of 0.4 mM, while L-arabinose was added to the culture medium of AtSUS to induce induction. All three were cultured at 30℃ and 220 rpm for 15 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), and the cells were resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer. After disruption and centrifugation, UGT91C1 mutant enzyme solution, wild-type UGT91C1 enzyme solution, and sucrose synthase AtSUS enzyme solution were obtained.

[0220] The reaction system in vials consisted of: 8 mM rebaudioside A, 48 mM sucrose, 1.6 mM UDPG, 0.5 mL UGT91C1 mutant enzyme solution or wild-type UGT91C1 enzyme solution, 0.2 mL AtSUS enzyme solution, and 100 mM sodium phosphate buffer to a total volume of 10 mL. The pH of the reaction system was 8. The reaction was carried out in a water bath at 37°C for 6 hours, then stopped by boiling for 5 minutes. The mixture was centrifuged at 10000 × g for 2 minutes, and the supernatant was used for the DNS reaction. The OD was then analyzed. 540 The yield of rebaudioside D was verified by HPLC analysis of the reaction solution catalyzed by the mutant with a higher value than that of wild-type UGT91C1.

[0221] Filtering results:

[0222] After multiple screenings of the UGT91C1 mutant library, the inventors ultimately obtained seven superior mutants from nearly 500,000 mutants. These mutants all exhibited higher enzyme activities than the wild type, significantly improving the efficiency of catalyzing the synthesis of rebaudioside D from rebaudioside A. The rebaudioside D yield results are shown in Figure 3. Among them, the optimal mutant 2-12E showed a nearly 30-fold increase in rebaudioside D yield compared to the wild type. Sequencing revealed that the amino acid sequence of mutant 2-12E was obtained by mutating amino acid position 89 (N to Y), amino acid position 155 (M to L), amino acid position 274 (S to T), and amino acid position 361 (N to S) from the amino acid sequence shown in SEQ ID NO. 20.

[0223] Example 9

[0224] Scale-up study of the synthesis of rebaudioside D by the optimal mutant 2-12E

[0225] Seed cultures of mutant 2-12E and sucrose synthase AtSUS were inoculated separately into 400 ml LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C with shaking at 220 rpm until OD was obtained. 600 When the pH was 0.6-0.8, two culture media were sequentially induced with IPTG to a final concentration of 0.4 mM and L-arabinose to a final concentration of 1 mM, respectively, and cultured at 30℃ and 220 rpm for 15 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and then the bacterial cells were lysed and centrifuged to obtain UGT91C1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0226] The reaction system was as follows: Rebaudioside A 27.4 mM, sucrose 164.4 mM, UDPG 1 mM, AtSUS enzyme solution 10 mL, 2-12E enzyme solution 10 mL, and 100 mM sodium phosphate buffer to a final volume of 100 mL. Reaction conditions: pH 8, reaction at 37°C for 15 h.

[0227] The reaction solution was sampled every 4 hours, and the yield of rebaudioside D was analyzed by HPLC to detect the trend of change with conversion time. The results are shown in Figure 4. The optimal mutant 2-12E can convert 27.4 mM rebaudioside A into 25.8 mM rebaudioside D within 15 hours, with a conversion rate of RA reaching 94.2%.

[0228] Example 10

[0229] Construction of recombinant Escherichia coli engineered strain AtSUS

[0230] Using Inf-pYB1k-atsus-F and Inf-pYB1k-atsus-R as primers, and the cDNA of the Arabidopsis-derived sucrose synthase gene atsus as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aibote Biotechnology Co., Ltd.) to obtain the correct atsus gene fragment. The sequence of the atsus gene fragment is shown in SEQ ID NO.6, and the amino acid sequence of the sucrose synthase atsus is shown in SEQ ID NO.5.

[0231] Inf-pYB1k-atsus-F:

[0232] Inf-pYB1k-atsus-R:

[0233] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment. (You R, Wang L, Shi C, Chen H, Zhang S, Hu M, Tao Y. Efficient production of myo-inositol in Escherichia coli through metabolic engineering. Microb. Cell Fact. 2020 May 24; 19(1):109. This pYB1k vector has been disclosed.)

[0234] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.9)

[0235] pYB1k-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO.10)

[0236] The atsus gene was ligated into the expression vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-atsus.

[0237] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). Gibson ligation products were added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.

[0238] Multiple single clones were selected for culture and PCR verification was performed using primers pBAD-F and atsus-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pYB1k-atsus.

[0239] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO.11)

[0240] atsus-F300-R:CTTGTGGGTCGTTGTCGAGGATG(SEQ ID NO.12)

[0241] Escherichia coli BW25113 competent cells were prepared using the CaCl2 method. The plasmid pYB1k-atsus1 was transformed into the E. coli BW25113 competent cells, and then plated on LB agar plates containing kanamycin and incubated overnight at 37°C. Positive clones containing pYB1k-atsus1 were selected to obtain the recombinant E. coli engineered strain AtSUS.

[0242] Example 11

[0243] Construction of a recombinant Escherichia coli strain expressing wild-type glycosyltransferase UGT76G1

[0244] Based on the nucleotide sequence of the wild-type glycosyltransferase UGT76G1 from the NCBI database, Anhui General Biotechnology Co., Ltd. synthesized the full sequence and transferred it into the vector pET28a to obtain the recombinant expression vector pET28a-ugt76g1. (This expression vector was previously disclosed in Pei Wang, Hai-Yan Zhou, Bo Li, Wen-Qing Ding, Zhi-Qiang Liu, Yu-Guo Zheng, Multiple modification of Escherichia coli for enhanced β-alanine biosynthesis through metabolic engineering, Bioresource Technology, Volume 342, 2021, 126050).

[0245] Using Inf-pYB1k-ugt76g1-F and Inf-pYB1k-ugt76g1-R as primers and pET28a-ugt76g1 as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct ugt76g1 gene fragment.

[0246] Inf-pYB1k-ugt76g1-F:

[0247] Inf-pYB1k-ugt76g1-R:

[0248] Using pYB1k-F and pYB1k-R as primers and the empty pYB1k vector as a template, PCR amplification was performed using high-fidelity DNA polymerase (Wuhan Aiboteke Biotechnology Co., Ltd.) to obtain the correct pYB1k expression vector fragment.

[0249] pYB1k-F: CTCGAGGGTAGATCTGGTAC (SEQ ID NO.15)

[0250] pYB1k-R: GGTTAATTCCTCCTGTTAGC (SEQ ID NO.16)

[0251] The ugt76g1 gene was ligated into the empty vector pYB1k using the Gibson assembly method to obtain the expression vector pYB1k-ugt76g1.

[0252] Escherichia coli DH5α competent cells were prepared using the CaCl2 method (Beijing TransGen Biotech Co., Ltd.). Gibson ligation products were added to the DH5α competent cells and reacted on ice for 30 min, then in a 42°C water bath for 90 s, followed by 2 min on ice. Then, 1 mL of LB medium was added, and the cells were incubated at 37°C in a shaker for 1 h. Finally, the cells were plated on LB agar plates containing kanamycin and incubated overnight at 37°C.

[0253] Multiple single clones were selected for culture and PCR verification was performed using primers pBAD-F and ugt76g1-F300-R. Positive clones with the correct target sequence size were selected for culture, and plasmids were extracted. The obtained positive clone plasmids were named pYB1k-ugt76g1.

[0254] pBAD-F: GATTATTTGCACGGCGTCAC (SEQ ID NO.11)

[0255] ugt76g1-F300-R:CTGCAGTTCCAGTTCACGAC(SEQ ID NO.17)

[0256] Escherichia coli BW25113 competent cells were prepared using the CaCl2 method. The plasmid pYB1k-ugt76g1 was then transformed into the E. coli BW25113 competent cells, followed by plating on LB agar plates containing kanamycin and incubation overnight at 37°C. Positive clones containing pYB1k-ugt76g1 were selected; these were the recombinant E. coli expressing the wild-type glycosyltransferase UGT76G1.

[0257] Example 12

[0258] Construction of a library of glycosyltransferase UGT76G1 mutants

[0259] Wild-type glycosyltransferase UGT76G1 was randomly mutated using error-prone PCR to construct a mutant library. Using ugt76g1-ATG-F and ugt76g1-TAA-R primers and pYB1k-ugt76g1 plasmid as a template, ep-PCR amplification was performed using rTaq DNA polymerase (TAKARA) due to its low-fidelity nature. The amplification system and procedure are shown in Tables 7 and 8.

[0260] ugt76g1-ATG-F:ATGGCCGAAAACAAGACCGA(SEQ ID NO.18)

[0261] ugt76g1-TAA-R:TTACAAAGAGGAAATGTAAG(SEQ ID NO.19)

[0262] Table 7 Commonly Misunderstood PCR Amplification Systems

[0263] Table 8 Commonly Misunderstood PCR Amplification Procedures

[0264] After purification of the PCR product, the mutant gene fragment of UGT76G1 was obtained. These fragments were then ligated to the vector pYB1k using the Gibson seamless ligation kit to obtain a complete plasmid mutant library containing the UGT76G1 mutant gene. The Gibson ligation reaction system is shown in Table 9.

[0265] Table 9 Gibson Linkage Reaction System

[0266] The reaction was carried out in a 50℃ water bath for 1 hour. The resulting plasmid containing the UGT76G1 mutant gene was then transferred to *E. coli* DH5α competent cells and cultured. The cells were then incubated in a shaker for 1 hour. After incubation, the cells were plated and incubated at 37℃ for 12 hours. After colony growth, five single-clone strains were randomly selected, and their plasmids were extracted and sequenced after culturing the bacterial culture. Subsequently, colonies were scraped from the plate with a glass rod to extract the plasmid library, which was stored at -20℃ for subsequent high-throughput screening of mutant libraries.

[0267] Example 13

[0268] High-throughput screening

[0269] After the random mutant library was constructed, single colonies were picked from the plate using a toothpick sterilized by high temperature and autoclave, and inoculated into a 96-well plate containing 800 μL of LB medium (containing kanamycin sulfate). The seed culture was obtained by shaking and culturing in a 96-well plate at 37°C and 900 rpm for 24 h.

[0270] Seed culture was collected using an inoculation needle and transferred to a new 96-well LB medium containing kanamycin sulfate (final concentration 50 μg / mL). The culture was incubated at 37°C and 900 rpm until OD500 was achieved. 600 When the pH value reached 0.6–0.8, L-arabinose was added to a final concentration of 1 mM, and the cells were induced and cultured for another 22 h at 30 °C and 900 rpm in a 96-well plate shaker. After induction culture, the cells were collected by centrifugation at 3000 × g for 20 min. Lysozyme solution was added to each well and mixed thoroughly to allow the lysozyme to fully act on the cells, lysing them and releasing the intracellular enzyme. After lysis, the cells were centrifuged at 3000 × g for 20 min at 4 °C in a refrigerated centrifuge to obtain the glycosyltransferase UGT76G1 mutant enzyme solution, which was used for subsequent reactions.

[0271] Preparation of AtSUS enzyme solution: Seed culture of recombinant Escherichia coli strain AtSUS was collected using an inoculation needle and transferred to an Erlenmeyer flask containing 10 mL of LB medium, which also contained kanamycin sulfate (final concentration 50 μg / mL). The flask was incubated at 37℃ and 220 rpm in a shaker. When OD... 600 When the concentration reaches 0.6–0.8, add L-arabinose to a final concentration of 1 mM and continue culturing at 30°C and 220 r / min for 22 h. Centrifuge, collect the bacterial cells, and then sonicate to disrupt the cells. Centrifuge at 5000 × g for 5 min to obtain the sucrose synthase AtSUS enzyme solution.

[0272] Reaction system: 8 mM rebaudioside D, 48 mM sucrose, 1.6 mM UDPG, 0.16 mL AtSUS enzyme solution, 0.16 mL glycosyltransferase UGT76G1 mutant enzyme solution, 100 mM sodium phosphate buffer, mixed, pH of the reaction system is 8, reacted in a water bath at 37℃ for 6 h, and the reaction was terminated by heating for 5 min.

[0273] DNS assay procedure: The reaction product was centrifuged at 3000×g for 20 min at 4°C in a refrigerated centrifuge to obtain the reaction supernatant. 70 μL of the reaction supernatant and 210 μL of DNS were added to a clean 96-well plate, mixed well, and heated for 5 min to initiate the DNS colorimetric reaction. After cooling to room temperature, the plate was centrifuged at 3000×g for 18 min. 200 μL of the supernatant was transferred to a 96-well microplate, and the OD was measured using a microplate reader. 540 Numerical value. OD 540 The UGT76G1 mutant used in the reaction solution with the high value is the mutant with high activity, and it is then retested in a vial.

[0274] Small-bottle validation: OD was obtained after screening with a 96-well plate. 540After obtaining mutants with high glycosyltransferase values, single colonies of the UGT76G1 mutant, wild-type UGT76G1 glycosyltransferase, and recombinant Escherichia coli strain AtSUS were picked and inoculated into test tubes, respectively. The tubes were then incubated in a shaker at 37°C and 220 rpm for 12 h to obtain seed culture. The seed culture was then inoculated into 20 mL LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a 1% volume ratio, and incubated at 37°C and 220 rpm until OD was obtained. 600 L-arabinose was added to a final concentration of 1 mM at pH values ​​of 0.6-0.8 for induction, and the cells were cultured at 30℃ and 200 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), and the cells were resuspended in 0.51 mL of 100 mM pH 8.0 sodium phosphate buffer. The cells were then lysed and centrifuged to obtain UGT76G1 mutant enzyme solution, wild-type UGT76G1 enzyme solution, and sucrose synthase AtSUS enzyme solution.

[0275] The reaction system consisted of 8 mM rebaudioside D, 48 mM sucrose, 1.6 mM UDPG, 0.5 mL UGT76G1 mutant enzyme solution or wild-type UGT76G1 enzyme solution, and 0.2 mL AtSUS enzyme solution. The solution was brought to a final volume of 10 mL with 100 mM sodium phosphate buffer. The pH of the reaction system was 8. The mixture was incubated in a water bath at 37°C for 6 hours, then stopped by boiling for 5 minutes. After centrifugation at 10000×g for 2 minutes, the supernatant was used for the DNS reaction. The OD was then analyzed. 540 The yield of rebaudioside M was verified by HPLC analysis of the reaction solution catalyzed by the mutant with a higher value than that of wild-type UGT76G1.

[0276] Filtering results:

[0277] After multiple initial screenings and vial rescreenings of the UGT76G1 mutant library, the inventors ultimately obtained four superior mutants from nearly 2000 mutants. These four mutants exhibited higher enzyme activities than the wild type, significantly improving the efficiency of catalyzing the synthesis of rebaudioside M from rebaudioside D. The yield results of rebaudioside M from the superior mutants in vial retesting are shown in Figure 5. Among them, mutant 101H10 showed a nearly 10-fold increase in rebaudioside M yield compared to the wild type. Sequencing revealed that the amino acid sequence of mutant 2-12E was obtained by the following mutations based on the amino acid sequence shown in SEQ ID NO.1: amino acid position 89 was mutated from M to H, amino acid position 380 from L to M, and amino acid position 411 from A to Y.

[0278] Example 14

[0279] Scale-up study of the synthesis of rebaudioside M by the optimal mutant 101H10

[0280] Seed cultures of mutant 101H10 and sucrose synthase AtSUS were inoculated separately into 400 ml LB medium (containing kanamycin sulfate at a final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C with shaking at 220 rpm until OD was obtained. 600 When the α-gravity was 0.6-0.8, L-arabinose was added to two culture media to a final concentration of 1 mM for induction, and the culture was carried out at 30℃ and 220 rpm for 18 h. After the culture was completed, the bacterial cells were collected by centrifugation (5000×g for 10 min), resuspended in 10.5 mL of 100 mM pH 8.0 sodium phosphate buffer, and the bacterial cells were then lysed and centrifuged to obtain UGT76G1 mutant 68S enzyme solution and sucrose synthase AtSUS enzyme solution.

[0281] Reaction system: Rebaudioside D 20mM, sucrose 120mM, UDPG 1mM, sucrose synthase AtSUS1 enzyme solution 10mL, mutant 101H10 enzyme solution 10mL, and sodium phosphate buffer to make up to 100mL. The pH of the reaction system is 8. Reaction conditions: 37℃ for 16h.

[0282] The reaction solution was sampled every 1 hour, and the yield of rebaudioside M was detected by HPLC as a function of conversion time. The results are shown in Figure 6. The optimal mutant 101H10 can convert 20 mM rebaudioside D (RD) into 17.2 mM rebaudioside M (RM) within 16 hours, with an RD conversion rate of 86%.

[0283] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A glycosyltransferase UGT76G1 mutant, characterized in that, The UGT76G1 mutant is any one of the following (A)-(C): (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The amino acid at position 109 is mutated from L to Q; The 113th amino acid is mutated from S to C; The 424th amino acid is mutated from I to F; (B) is a protein with more than 95% identity to the amino acid sequence defined by (A) and has the same function; (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

2. The glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that, The amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.

3.

3. Any of the following biomaterials: (A) An expression gene that encodes the UGT76G1 mutant of claim 1 or 2; (B) A recombinant plasmid having the expression gene described in (A) linked to it; (C) A recombinant cell containing the expression gene of the recombinant plasmid or the UGT76G1 mutant.

4. An enzyme composition, characterized in that, The enzyme composition comprises: a glycosyltransferase UGT76G1 mutant and a sucrose synthase AtSUS; the glycosyltransferase UGT76G1 mutant is as described in claim 1 or 2; Sucrose synthase AtSUS is either (B1) or (B2) as follows: The amino acid sequence of (B1) is shown in SEQ ID NO.5; Proteins whose amino acid sequences defined by (B2) and (B1) are more than 95% identical and have the same function.

5. A complete recombinant bacterial strain expressing the enzyme composition of claim 4, characterized in that, The recombinant strain includes recombinant strain A and recombinant strain B: recombinant strain A contains recombinant plasmid A, which is obtained by constructing the encoding gene of the glycosyltransferase UGT76G1 mutant as described in claim 1 or 2 into an expression vector; recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid.

6. The complete set of recombinant strains according to claim 5, characterized in that, The host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

7. A method for synthesizing rebaudioside A using a glycosyltransferase UGT76G1 mutant, characterized in that, Includes the following steps: Stevioside STV, UDPG, sucrose, and the enzyme composition of claim 4 or the induced expression enzyme product of the complete set of recombinant strains in claim 5 are added to the catalytic reaction system. The reaction is carried out, the enzyme is inactivated, and the supernatant is obtained by centrifugation. The supernatant contains rebaudioside A.

8. The method according to claim 7, characterized in that, The inducible expression enzyme products of the complete set of recombinant strains in claim 5 include inducible expression enzyme product A and inducible expression enzyme product B; The method for obtaining the induced expression enzyme product A includes the following steps: The seed culture of recombinant strain A from claim 5 was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was... 600 When the concentration reaches 0.6–0.8, add L-arabinose and continue induction culture for 8–40 h. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product A; the inoculum size is 1 v / v%; the final concentration of kanamycin sulfate is 10–100 μg / mL; and the final concentration of L-arabinose is 0.1–15 mM. The method for obtaining the induced expression enzyme product B includes the following steps: The seed culture of recombinant strain B from claim 5 was inoculated into a culture medium containing kanamycin sulfate and cultured at 30–40°C and 200–300 rpm until OD. 600 When the concentration reaches 0.6–0.8, add L-arabinose and continue culturing for 8–40 h. Centrifuge and collect the bacterial cells, break the cells, centrifuge again, and collect the supernatant, which is the induced expression enzyme product B. The inoculum size is 1 v / v%. The final concentration of kanamycin sulfate is 10–100 μg / mL. The final concentration of L-arabinose is 0.1–15 mM.

9. The method according to claim 7 or 8, characterized in that, In the catalytic reaction system, the concentration of steviol glycoside STV is 10–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 50–800 mM, the amount of inducible expression enzyme product of recombinant strain A is 0.1–50 mL, and the amount of inducible expression enzyme product of recombinant strain B is 0.1–50 mL.

10. The method according to claim 7, characterized in that, The catalytic reaction system has a pH of 5.0–8.0, a temperature of 25–60°C, and a reaction time of 5–30 h.

11. A glycosyltransferase UGT91C1 mutant, characterized in that, The UGT91C1 mutant is any one of the following (A)-(C): (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.20: The 89th amino acid is mutated from N to Y; The 155th amino acid was mutated from M to L; The 274th amino acid is mutated from S to T; The 361st amino acid was mutated from N to S; (B) Proteins that have 95% or 98% or more of the same amino acid sequence as defined in (A) and have the same function; (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

12. The glycosyltransferase UGT91C1 mutant according to claim 11, characterized in that, The amino acid sequence of the UGT91C1 mutant is shown in SEQ ID NO.

22.

13. A biomaterial, characterized in that, The biomaterial includes any one of the following: (A) An expression gene encoding a mutant of the glycosyltransferase UGT91C1 as described in claim 11 or 12; (B) A recombinant plasmid containing the expression gene described in (A); (C) A recombinant cell containing the recombinant plasmid or the gene expressing the glycosyltransferase UGT91C1 mutant.

14. An enzyme composition, characterized in that, The enzyme composition comprises the glycosyltransferase UGT91C1 mutant of claim 11 or 12 and sucrose synthase AtSUS; The sucrose synthase AtSUS is either (B1) or (B2) as follows: (B1) has the amino acid sequence shown in SEQ ID NO.5; Proteins whose amino acid sequences defined by (B2) and (B1) are 95% or 98% identical and have the same function.

15. A complete recombinant bacterial strain for expressing the enzyme composition of claim 14, characterized in that, The complete set of recombinant strains includes recombinant strain A and recombinant strain B: The recombinant strain A contains the recombinant plasmid as described in claim 13; The recombinant strain B contains recombinant plasmid B, which is obtained by constructing the encoding gene of sucrose synthase AtSUS into a plasmid.

16. The complete set of recombinant strains according to claim 15, characterized in that, The host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

17. A method for synthesizing rebaudioside D using a glycosyltransferase UGT91C1 mutant, characterized in that, Includes the following steps: Rebaudin A, UDPG, sucrose, and the enzyme composition of claim 14 or the induced expression enzyme product of the complete set of recombinant strains of claim 15 are added to the catalytic reaction system. After the reaction is completed, the enzyme is inactivated, centrifuged, and the supernatant is collected, wherein the supernatant contains rebaudin D.

18. The method according to claim 17, characterized in that, The inducible expression enzyme products of the complete set of recombinant strains in claim 15 include inducible expression enzyme product A and inducible expression enzyme product B. The method for obtaining the induced expression enzyme product A is as follows: The seed culture of recombinant strain A from claim 15 was inoculated into a culture medium containing kanamycin sulfate, and the OD of the culture medium was... 600 When the concentration reaches 0.6–0.8, isopropyl-β-D-thiogalactoside is added for induction culture for 8–40 h. The cells are then centrifuged and collected. Lysozyme solution is added to the cells to disrupt them, or the cells are sonicated and disrupted. The supernatant is collected after centrifugation; this is the induced expression enzyme product A. The final concentration of kanamycin sulfate is 10–100 g / L. μg / mL; the final concentration of isopropyl-β-D-thiogalactoside is 0.01–1 mM; The method for obtaining the induced expression enzyme product B is as follows: The seed culture of recombinant strain B according to claim 15 was inoculated into a culture medium containing kanamycin sulfate and cultured at 25–40°C and 200–300 r / min until OD. 600 When the concentration reaches 0.6–0.8, L-arabinose is added and the culture is continued for 8–40 h. The cells are then centrifuged and collected. Lysozyme solution is added to the cells to break them up or the cells are broken up by sonication. The cells are then centrifuged again and the supernatant is collected as the induced expression enzyme product B. The final concentration of kanamycin sulfate is 10–100 μg / mL, and the final concentration of L-arabinose is 0.1–15 mM.

19. The method according to claim 17 or 18, characterized in that, In the catalytic reaction system, the concentration of rebaudioside A is 5–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 40–800 mM, the amount of induced expression enzyme product A added is 0.1–50 mL, and the amount of induced expression enzyme product B added is 0.1–50 mL.

20. The method according to claim 17 or 18, characterized in that, The catalytic reaction system has a pH of 5.0–8.0, a temperature of 25–60°C, and a reaction time of 5–30 h.

21. A glycosyltransferase UGT76G1 mutant, characterized in that, The UGT76G1 mutant is any one of the following (A)-(C): (A) Proteins obtained by performing any one or more of the following mutations based on the amino acid sequence shown in SEQ ID NO.1: The 89th amino acid was mutated from M to H; The 380th amino acid was mutated from L to M; The 411th amino acid is mutated from A to Y; (B) Proteins that have 95% or 98% or more of the same amino acid sequence as defined in (A) and have the same function; (C) A fusion protein obtained by attaching a tag to the end of the protein defined in (A) or (B).

22. The glycosyltransferase UGT76G1 mutant according to claim 21, characterized in that, The amino acid sequence of the UGT76G1 mutant is shown in SEQ ID NO.

30.

23. A biomaterial, characterized in that, The biomaterial includes any one of the following: (A) An expression gene encoding a mutant of the glycosyltransferase UGT76G1 as described in claim 21 or 22; (B) A recombinant plasmid containing the expressed gene described in (A); (C) A recombinant cell comprising the recombinant plasmid described in (B) or the expressed gene described in (A).

24. An enzyme composition, characterized in that, The enzyme composition comprises the glycosyltransferase UGT76G1 mutant of claim 21 or 22 and sucrose synthase AtSUS; The sucrose synthase AtSUS is either (B1) or (B2): The amino acid sequence of (B1) is shown in SEQ ID NO.5; Proteins whose amino acid sequences defined by (B2) and (B1) are 95% or 98% identical and have the same function.

25. A method for synthesizing rebaudioside M using glycosyltransferase UGT76G1 as a catalyst, characterized in that, Rebaudin M was synthesized using the enzyme composition of claim 24 as a substrate, with rebaudin D, UDPG and sucrose as substrates.

26. The method according to claim 25, characterized in that, In the catalytic reaction system, the concentration of rebaudioside D is 5–100 mM, the concentration of UDPG is 0.1–5 mM, the concentration of sucrose is 40–800 mM, the amount of glycosyltransferase UGT76G1 mutant enzyme solution added is 0.1–50 mL, and the amount of sucrose synthase AtSUS enzyme solution added is 0.1–50 mL.

27. The method according to claim 26, characterized in that, The preparation method of the glycosyltransferase UGT76G1 mutant enzyme solution includes the following steps: (1) The coding gene of the glycosyltransferase UGT76G1 mutant was constructed into an expression vector to obtain recombinant plasmid A. Recombinant plasmid A was transformed into host bacteria to obtain recombinant strain A. (2) The seed culture of recombinant strain A was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the glycosyltransferase reaches 0.6–0.8, L-arabinose is added and the cells are induced and cultured at 25–40°C for 8–40 hours. After centrifugation, the bacterial cells are collected and lysed. The supernatant is then centrifuged again, and the supernatant is the glycosyltransferase UGT76G1. The mutant enzyme solution was prepared at an inoculum size of 1 v / v%. The final concentration of kanamycin sulfate was 10–100 μg / mL, and the final concentration of L-arabinose was 0.1–15 mM.

28. The method according to claim 26, characterized in that, The preparation method of the sucrose synthase AtSUS enzyme solution includes the following steps: (1) The AtSUS encoding gene of sucrose synthase was constructed into an expression vector to obtain recombinant plasmid B. Recombinant plasmid B was transformed into host bacteria to obtain recombinant strain B. (2) The seed culture of recombinant strain B was inoculated into a culture medium containing kanamycin sulfate and cultured until the OD of the culture medium was measured. 600 When the concentration reaches 0.6–0.8, add L-arabinose and continue induction culture at 25–40℃ for 8–40 h. Centrifuge, collect the bacterial cells and lyse the cells. Centrifuge again, and the supernatant is the sucrose synthase AtSUS enzyme solution. The inoculum size is 1 v / v%. The final concentration of kanamycin sulfate is 10–100 μg / mL. The final concentration of L-arabinose is 0.1–15 mM.

29. The method according to claim 27 or 28, characterized in that, The host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum.

30. The method according to claim 25 or 26, characterized in that, In the catalytic reaction system, the pH value is 5.0–8.0, the temperature is 25–60℃, and the reaction time is 5–30 h.

Images