Intestinal microbiome-based biomarker composition for diagnosing neurodegenerative diseases and use thereof

Abstract

The present invention provides: a composition for diagnosing neurodegenerative diseases comprising an agent capable of detecting a urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof; and a method for providing information for diagnosing neurodegenerative diseases using the urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof.

Description

Intestinal microbiome-based biomarker composition for diagnosing neurodegenerative diseases and use thereof

[0001] The present invention relates to a biomarker composition derived from intestinal microorganisms for diagnosing neurodegenerative diseases and a method for providing information for diagnosing neurodegenerative diseases using the same.

[0002] Type 2 diabetes mellitus (T2DM) has seen a rapid increase in prevalence in recent decades. However, advances in treatment have reduced the incidence of existing complications, such as aortic and small vessel disease. While this has extended life expectancy, it has also led to the emergence of new complications, such as liver disease, cognitive impairment, and motor impairment. In particular, diabetic patients are associated with brain atrophy in areas affected by degenerative brain diseases, which has been reported to increase the risk of developing Parkinson's disease (PD) and Alzheimer's disease.

[0003] The human gut microbiome is known to consist of approximately 39 trillion microorganisms, containing over 1,000 times more information than the human genome, forming a symbiotic relationship with humans. These microorganisms can transform or break down external factors unavailable to humans, producing various products that can influence human metabolism. These changes in the gut microbiome have been linked to not only intestinal diseases but also metabolic diseases such as diabetes and cardiovascular disease, as well as neurological disorders such as Parkinson's and Alzheimer's.

[0004] However, due to the geographic diversity of gut microbiome composition, finding specific microbiome signatures specifically related to diabetes and diabetic complications remains a challenging problem.

[0005] Meanwhile, despite the geographical differences in microbiome composition, the production of butyrate, a microbiome-derived metabolite, has been reported to be reduced in diabetes and diabetic complications, regardless of race or region. These microbial metabolites, as products of microbiome function, possess a chemical diversity capable of penetrating various tissues and can either exert beneficial effects on the host or induce disease.

[0006] Furthermore, nitrate reductase, a microbiome-derived enzyme, has been reported to have increased expression during the development of inflammatory bowel disease. These microbial enzymes, as key players in microbiome function, produce metabolites that can either benefit the host or induce disease.

[0007] Therefore, the discovery of enzymes and metabolites derived from disease-associated microorganisms can play a crucial role not only in understanding disease markers but also in understanding the mechanisms of disease action. It can also play a crucial role in the development of inhibitors to suppress these enzymes. Examples include trimethylamine N-oxide (TMAO), which contributes to arteriosclerosis and thrombosis.

[0008] Recently, the gut microbiome has been shown to influence brain diseases such as Parkinson's and Alzheimer's by producing physiologically active metabolites, and it is thought to serve as a crucial intermediary between the gut and the brain. However, microbial metabolites that directly penetrate the brain and act as causative factors of degenerative brain diseases have not yet been identified. Furthermore, while Parkinson's disease is a degenerative brain disease characterized by motor impairment, it is also known to be accompanied by various non-motor disorders. The prevalence of conditions such as anxiety, depression, and REM sleep disorders increases as the disease progresses, significantly reducing the quality of life of patients and contributing to increased medical costs.

[0009] Against this backdrop, the discovery of gut microbe-derived metabolites that can directly penetrate the brain and the gut microbe-derived enzymes that produce these metabolites suggests that they could be important targets for the treatment of Parkinson's disease, and the development of Parkinson's disease treatments that can inhibit these metabolites is therefore required.

[0010] Therefore, the present invention aims to solve the problems of the prior art as described above by discovering a microbial metabolite that directly passes through the brain blood barrier (BBB) ​​and induces neurodegeneration, and to find a target that can inhibit neurodegeneration using the same.

[0011] Accordingly, the inventors of the present invention confirmed that imidazole propionate (ImP), a microbial metabolite produced when Streptococcus mutans, which possesses the urocanate reductase enzyme closely related to Parkinson's disease, was colonized alone, directly penetrates the brain and induces neurodegeneration. In addition, in order to increase the completeness of the present invention, the inventors of the present invention developed an intestinal commensal Escherichia coli MG1655 that overexpressed the urocanate reductase enzyme, and confirmed that this strain induced neurodegeneration when colonized alone, thereby completing the present invention that suggests the urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof as a marker and disease target for neurodegenerative diseases, particularly Parkinson's disease.

[0012] The purpose of the present invention is to provide a biomarker composition for diagnosing neurodegenerative diseases, comprising urocanate reductase enzyme, a strain having the same, or a metabolite thereof.

[0013] Another object of the present invention is to provide a composition for diagnosing a neurodegenerative disease, comprising an agent capable of detecting urocanate reductase enzyme, a strain having the same, or a metabolite thereof.

[0014] Another object of the present invention is to provide a method for providing information for diagnosing a neurodegenerative disease, comprising a step of detecting a urocanate reductase enzyme, a strain having the enzyme, or a metabolite thereof from a biological sample of an individual.

[0015] Another object of the present invention is to provide a composition for producing an animal model of a neurodegenerative disease comprising the enzyme urocanate reductase, a strain having the enzyme, or imidazole propionate.

[0016] Another object of the present invention is to provide a method for producing an animal model of a neurodegenerative disease, comprising a step of administering to an animal other than a human an enzyme, a strain having the enzyme, or imidazole propionate.

[0017] Another object of the present invention is to provide an animal model for neurodegenerative disease prepared by administering urocanate reductase enzyme, a strain having the same, or imidazole propionate.

[0018] Another object of the present invention is to provide a method for screening a neurodegenerative disease treatment agent, comprising: (a) treating a biological sample of an individual with a candidate substance for treating a neurodegenerative disease; and (b) measuring a change in the detection level of urocanate reductase enzyme, a strain having the enzyme, or a metabolite thereof before and after treating the candidate substance in the sample.

[0019] To avoid confusion due to overlapping content, the description of redundant content will be omitted below. In other words, the content of the invention is not limited to the content described below, and the content of the invention should be interpreted based on the overall content of the invention.

[0020] In the present invention, we confirmed that the enzyme urocanate reductase (UrdA) is a gut microbiota-derived enzyme closely related to neurodegenerative diseases. Specifically, we demonstrated that imidazole propionate (ImP), a microbial metabolite degraded from histidine by UrdA from Streptococcus mutans (S. mutans), directly penetrates the brain and induces neurodegeneration, thereby suggesting a new target for the treatment of neurodegenerative diseases.

[0021] This will be explained in more detail below.

[0022] In one aspect of the present invention, a biomarker composition for diagnosing a neurodegenerative disease is provided, comprising urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof.

[0023] In the present invention, urocanate reductase (UrdA) is a bacterial flavin-dependent enzyme that reduces urocanate to imidazole propionate. It is known to be involved in the production of imidazole propionate, one of the final metabolites of the microbial histidine degradation pathway.

[0024] In the present invention, the strain of urocanate reductase (UrdA) may refer to a strain having urocanate reductase. Specifically, it may include Streptococcus mutans, Shewanella oneidensis, Lactiplantibacillus plantarum, Parvimonas micra, etc. Preferably, it may be Streptococcus mutans.

[0025] In the present invention, the metabolite of the urocanate reductase (UrdA) enzyme may be any metabolite that is decomposed by a strain having the urocanate reductase (UrdA) enzyme. Specifically, it may include imidazole propionate (ImP), glucan, lactic acid, etc. Preferably, it may be imidazole propionate (ImP).

[0026] More specifically, urocanate reductase (UrdA), an enzyme encoded by the genome of Streptococcus mutans strains, is a bacterial flavin-dependent enzyme that reduces urocanate to imidazole propionate (ImP). Imidazole propionate is a metabolite derived from the amino acid histidine, produced by the gut microbiota enzyme UrdA.

[0027] In the present invention, the metabolite of the urocanate reductase (UrdA) enzyme is a metabolite produced by a strain having urocanate reductase, and may include imidazole propionate (ImP).

[0028] In the present invention, the strain having the urocanate reductase (UrdA) enzyme may include a Streptococcus mutans strain.

[0029] In the present invention, it was confirmed that the urocanate reductase (UrdA) enzyme derived from intestinal microorganisms that produces ImP is a microbial enzyme closely related to neurodegenerative diseases.

[0030] The enzyme urocanate reductase (UrdA) is involved in the production of ImP, one of the final metabolites of the histidine degradation pathway in microorganisms. Histidine is converted to urocanate by hutH, and UrdA converts urocanate to ImP.

[0031] According to the present invention, it was confirmed that ImP, a metabolite produced by a Streptococcus mutans strain having the enzyme urocanate reductase (UrdA), can pass through the blood-brain barrier, and that ImP reaching the brain affects motor neuron disorders. More directly, it was confirmed that motor neuron disorders were induced by ImP produced by the strain when Streptococcus mutans-derived urocanate reductase was overexpressed in the enteric commensal E. coli strain MG1655, which does not have the ability to produce imidazole propionate.

[0032] In this way, the present invention confirmed that the accumulation of ImP in the brain is related to Parkinson's disease, and thus confirmed the possibility that the urocanate reductase (UrdA) enzyme or a strain having the urocanate reductase (UrdA) enzyme or a metabolite produced by the enzyme can be used as a biomarker for diagnosing neurodegenerative diseases or screening for therapeutic agents therefor.

[0033] In another aspect of the present invention, a composition for diagnosing a neurodegenerative disease is provided, comprising an agent capable of detecting urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof.

[0034] In the present invention, the neurodegenerative disease is Parkinson's disease, Alexander disease, Alpert disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), ataxia telangiectasia, neuronal lipofuscinosis, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, cerebral palsy, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, frontotemporal lobar degeneration, Gaucher disease, Huntington's disease, HIV-associated dementia, Kennedy disease, Krabbe disease, Lewy body dementia, lysosomal storage disorder, neuroborreliosis, Machado-Josef disease, motor neuron disease, multisystem atrophy, multiple sclerosis, multiple sulfatase deficiency, mucolipidosis, narcolepsy, Niemann-Pick type C, Niemann-Pick disease, Feliceus-Merzbacher disease, Pick disease, Pompe disease, primary lateral sclerosis, prion disease, progressive supranuclear palsy, Refsum disease, Schilder The neurodegenerative disease may include subacute combined degeneration of the spine secondary to pernicious anemia, Spielmayr-Vogt-Sjögren-Batten disease, spinocerebellar ataxia, spinal muscular atrophy, Stille-Richardson-Olzewski disease, spinal syphilis, Tay-Sachs disease, etc., and preferably, the neurodegenerative disease may be Parkinson's disease. Parkinson's disease is also referred to herein as Parkinson's disease.

[0035] In the present invention, complications of neurodegenerative diseases may include depression, anxiety, impulse control disorder, hallucinations, panic attacks, phobias, sleep disorders, sleep attacks, REM sleep behavior disorder, constipation, urinary disorders, olfactory disorders, autonomic nervous system disorders, etc., and preferably may be depression and anxiety.

[0036] More specifically, complications of the neurodegenerative disease may be complications caused by Parkinson's disease. Symptoms of these complications include the aforementioned symptoms, preferably depression and anxiety.

[0037] The term “diagnosis” herein includes determining the susceptibility of a subject to a particular disease or condition, determining whether a subject currently has a particular disease or condition (e.g., identifying Parkinson’s disease), determining the prognosis of a subject with a particular disease or condition, or therametrics (e.g., monitoring the condition of a subject to provide information about the efficacy of a treatment).

[0038] According to one embodiment of the present invention, a strain overexpressing UrdA was produced for the beneficial enterobacteria Escherichia coli (MG1655), and it was confirmed that neurodegenerative diseases, particularly Parkinson's disease, were induced through this. Through this, it was confirmed that UrdA alone is a factor inducing neurodegenerative diseases, particularly Parkinson's pathology, and that changes in its level can serve as a biomarker factor for the diagnosis of Parkinson's disease.

[0039] Specifically, the formulation may be one that detects the enzyme urocanate reductase (UrdA). The formulation capable of detecting the enzyme urocanate reductase (UrdA) may include, for example, at least one selected from the group consisting of a primer, a probe, an antisense oligonucleotide, an aptamer, an antibody, and a microbial selective medium specific for the enzyme urocanate reductase (UrdA).

[0040] The above formulation may also detect a strain having the enzyme urocanate reductase (UrdA). Such a strain may refer to a strain having urocanate reductase. Specifically, it may include Streptococcus mutans, Shewanella oneidensis, Lactiplantibacillus plantarum, Parvimonas micra, Eggerthella lenta, Eggerthella guodeyinii, Fusobacterium animalis, Lactiplantibacillus paraplantarum, Brevibacillus laterosporus, Aerococcus urinae, Adlercreutzia equolifaciens, etc., and the strains may be capable of producing urocanate reductase. It is known that the bacterium has the ability to produce ImP from urocanate by possessing urocanate reductase (Koh et al., Cell. 2018. 175(4):947-961.e17). Preferably, it may be Streptococcus mutans.

[0041] The preparation for detecting the above strains may comprise, for example, one or more selected from the group consisting of primers, probes, antisense oligonucleotides, aptamers, antibodies and microbial selective media specific for the above-mentioned strains, or known nucleic acid sequences or proteins thereof.

[0042] The sequences of primers specific for the above-mentioned strains are as shown in Table 1 below.

[0043] BacteriaForwardReverseStreptococcus mutansGGGCGGTTTGAAGATTGATACACAA(SEQ ID NO: 5)ACTTATTAGCAGCATTCTGTTACAG(SEQ ID NO: 6)Parvimonas micraGCAGGAGAAACTACGGGTGGAATT(SEQ ID NO: 7)TCGCTGCATTAGTTCCTGCTATA(SEQ ID NO: 8)Eggerthella lentaCCGCGATGTCATCTCCAACGCCATC(SEQ ID NO: 9)ATCGGTTAGGCGAGTGCCGCCGCGT(SEQ ID NO: 10)Eggerthella guodeyiniiCCGCGACGTCATCTCGAACGCCATC(SEQ ID NO: 11)ATCGGTTAGGCGAGCGCCGCCGCGT(SEQ ID NO: 12)Shewanella oneidensisCACCAAAGACGGACTAATGTATAAG(SEQ ID NO: 13)AGCAAACAAGCCCGGAATCACCTTT (SEQ ID NO: 14)Fusobacterium animalisATTGGAGGAAACCATGAAAAAAAAT (SEQ ID NO: 15)CCCATCTTTGTCATACCCTAGTCCT (SEQ ID NO: 16)Lactiplantibacillus paraplantarumGAAGACTGGGGCCGATTTGACCACT (SEQ ID NO: 17)CGAATCTTATTGCAAATACTTAAAC (SEQ ID NO: 18)Brevibacillus laterosporusGCCTACAAATTAATACAAATGCGGA (SEQ ID NO: 19)ACAAGATTACTTCGCGGCCTTTGCT (SEQ ID NO: 20)Aerococcus urinaeACCAACAAGTGGAAGATGGCACCCT (SEQ ID NO: 21)TTTACTAAGCTTCCTGGCTAGCGTT (SEQ ID NO: 22)Adlercreutzia equolifaciensGGTTATTATGTCAGGTTGTTCTCGT(SEQ ID NO: 23)GTGTCTACCGCAAGCGTCTGATTGT(SEQ ID NO: 24)

[0044] Specifically, the formulation may be one for detecting a metabolite of a strain having the enzyme urocanate reductase (UrdA). Such a formulation may be one for applying any method, such as a gas or liquid chromatography device, a high-performance liquid chromatography (HPLC) device, a thin layer chromatography (TLC), an electrochemical analysis device, a refractive index spectroscopy device, a fluorescence analysis device, a light scattering analysis device, an ultraviolet spectroscopy, an infrared spectroscopy, an enzyme-linked immunosorbent assay (ELISA), and / or a mass spectrometry device, for detecting a metabolite of a strain having the enzyme urocanate reductase (UrdA).

[0045] The above formulation can be applied regardless of form as long as it is for detecting the enzyme urocanate reductase (UrdA), a strain having the enzyme, or a metabolite thereof.

[0046] Detection of the urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof according to the present invention may be detection of one, two, or all three of these.

[0047] The above detection may be, for example, measuring the amount of enzyme expression of UrdA, the amount of a Streptococcus mutans strain having the enzyme, and the concentration of imidazole propionate (ImP), a metabolite of the UrdA enzyme.

[0048] In another aspect of the present invention, a method for providing information for diagnosing a neurodegenerative disease is provided, comprising a step of detecting urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof from a biological sample of an individual.

[0049] Specifically, the information providing method for diagnosing the above neurodegenerative disease is as follows:

[0050] (a) detecting urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof from a biological sample of an individual; and

[0051] (b) a step of comparing the detection level of the urocanate reductase (UrdA) enzyme detected in (a) or the metabolite produced by the strain having the urocanate reductase (UrdA) enzyme with the level detected from a biological sample of a normal control group not suffering from a neurodegenerative disease.

[0052] Preferably, the information providing method for diagnosing the neurodegenerative disease is as follows:

[0053] (c) The detection level detected in step (a) above,

[0054] i) If the level is increased compared to that detected in a normal control group not suffering from a neurodegenerative disease, the subject is classified as having developed or having a high probability of developing a neurodegenerative disease;

[0055] ii) a step in which the subject is classified as not having a neurodegenerative disease, if the level of detection is similar or equivalent to that in a normal control group not suffering from a neurodegenerative disease;

[0056] In the present invention, the detection may be a measurement of the level of urocanate reductase (UrdA) enzyme expression, a Streptococcus mutans strain having UrdA, or the concentration of imidazole propionate (ImP), a metabolite thereof.

[0057] The above metabolite may be a metabolite produced by the urocanate reductase (UrdA) enzyme of Streptococcus mutans.

[0058] Metabolites produced by Streptococcus mutans strains having the urocanate reductase (UrdA) enzyme may include imidazole propionate (ImP).

[0059] ImP is a histidine metabolite produced by Streptococcus mutans, which possesses the enzyme urocanate reductase (UrdA).

[0060] In the present invention, the above-mentioned object means a living organism used for testing, inspection, analysis, evaluation, etc., and may preferably be a mammal (e.g., human, monkey, cow, horse, rat, mouse, guinea pig, rabbit, dog, cat, sheep, goat, etc.), and more preferably, may be a human.

[0061] In the present invention, the biological sample may differ from the normal control group in terms of the expression level of the urocanate reductase (UrdA) enzyme, the amount of metabolites produced by the strain having the urocanate reductase (UrdA) enzyme, or the detection level, depending on the degree of occurrence or progression of the neurodegenerative disease.

[0062] The biological sample may include, but is not limited to, samples such as tissue, blood, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine, colon tissue, feces, and brain tissue of an individual, and preferably, the sample may be blood, cerebrospinal fluid, colon tissue, brain tissue, or feces. The biological sample may be obtained by a method that does not cause harm to the individual.

[0063] The biological sample of the above entity may be isolated from a living organism.

[0064] The above detection can be performed using any method such as a gas or liquid chromatography device, a high performance liquid chromatography (HPLC) device, a thin layer chromatography (TLC), an electrochemical analysis device, a refractive index spectroscopy device, a fluorescence analysis device, a light scattering analysis device, an ultraviolet spectroscopy, an infrared spectroscopy, an enzyme-linked immunosorbent assay (ELISA), and / or a mass spectrometer.

[0065] In another aspect of the present invention, a composition for producing an animal model of a neurodegenerative disease comprising the enzyme urocanate reductase (UrdA), a strain having the enzyme, or imidazole propionate is provided.

[0066] More specifically, the present invention provides a composition for producing a neurodegenerative disease animal model comprising an enzyme, urocanate reductase (UrdA), a Streptococcus mutans strain, an Escherichia coli strain overexpressing UrdA, or imidazole propionate.

[0067] The description of the above “Streptococcus mutans strain”, “imidazole propionate”, and “neurodegenerative disease” is as described above.

[0068] In the present invention, “the E. coli overexpressing UrdA may preferably be the intestinal commensal E. coli (Escherichia coli MG1655). That is, by overexpressing UrdA in the intestinal commensal E. coli (Escherichia coli MG1655), which is a beneficial bacterium, it has the advantage of being able to confirm the action of UrdA without being affected by the bacterium.

[0069] According to one embodiment of the present invention, it may be an enteropathogenic Escherichia coli (Escherichia coli MG1655) that overexpresses UrdA. Escherichia coli MG1655 is a strain provided as ATCC 700926, and is an E. coli strain that overexpresses UrdA for this strain.

[0070] More specifically, UrdA has a peptide sequence of SEQ ID NO: 1.

[0071] The E. coli strain that overexpresses UrdA as described above can be produced by overexpressing a vector system having a nucleic acid sequence that includes a promoter as a replication control region and has an expression activity that regulates the expression of the target gene, i.e., transcription and translation, after being functionally linked to the target gene. For example, the vector can be produced by inserting a nucleic acid sequence capable of overexpressing the target UrdA into an E. coli-derived transformation vector selected from the group consisting of pUC19, pUC18, pBR322, pHSG299, pHSG298, pHSG399, pHSG398, RSF1010, pMW119, pMW118, pMW219 and pMW218 and expressing the resulting vector.

[0072] According to one embodiment of the present invention, a nucleic acid sequence of SEQ ID NO: 2 capable of expressing UrdA was inserted into pUC19 to produce a recombinant vector, and the vector was expressed in Escherichia coli MG1655 to produce Escherichia coli overexpressing the desired UrdA.

[0073] The composition for producing an animal model of a neurodegenerative disease of the present invention comprises 1x10 Streptococcus mutans strain or Escherichia coli overexpressing UrdA. 6 1x10 10 It can be included at a concentration of CFU / ml (per animal), preferably 1x10 8 1x10 10 A concentration of CFU / ml (per animal), more preferably approximately 1x10 9 It can be included at a concentration of CFU / ml (per animal). The composition for producing an animal model of Parkinson's disease of the present invention can be administered orally or parenterally, and the administration method can use a method commonly known in the relevant technical field.

[0074] In addition, the composition for producing a neurodegenerative disease animal model of the present invention may contain the metabolite ImP at a concentration of 0.1 to 500 μg, preferably at a concentration of 10 to 100 μg. The composition for producing a Parkinson's disease animal model of the present invention may be administered orally or parenterally, and the administration method may use a method commonly known in the relevant technical field.

[0075] In another aspect of the present invention, a method for producing an animal model of a disease is provided, comprising administering to a non-human animal an enzyme, a strain having the enzyme, or imidazole propionate.

[0076] Specifically, the present invention provides a method for producing an animal model of a neurodegenerative disease, comprising administering a Streptococcus mutans strain, Escherichia coli overexpressing UrdA, or imidazole propionate.

[0077] Specifically, the above Streptococcus mutans is a strain having UrdA.

[0078] In another aspect of the present invention, an animal model for neurodegenerative disease manufactured by a manufacturing method according to the present invention is provided.

[0079] In another aspect of the present invention,

[0080] (a) a step of treating a biological sample of an individual with a candidate substance for treating a neurodegenerative disease; and

[0081] (b) a step of measuring a change in the detection level of urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof before and after treating the candidate substance in the sample; a method for screening a therapeutic agent for a neurodegenerative disease is provided.

[0082] In another aspect of the present invention,

[0083] (a) a step of treating a biological sample of an individual with a candidate substance for treating a neurodegenerative disease; and

[0084] (b) a step of measuring a change in the detection level of a metabolite produced by a Streptococcus mutans strain having the urocanate reductase (UrdA) enzyme or Escherichia coli overexpressing the urocanate reductase (UrdA) enzyme before and after treating the candidate substance in the sample; a method for screening a therapeutic agent for a neurodegenerative disease is provided.

[0085] The description of the above “urocanate reductase (UrdA) enzyme, Streptococcus mutans strain having the enzyme or a metabolite thereof”, or “Escherichia coli overexpressing the urocanate reductase (UrdA) enzyme”, and “neurodegenerative disease” is as described above.

[0086] The above entity may be an entity that is afflicted with or suffering from a neurodegenerative disease. Such entities may exclude humans.

[0087] The above-mentioned subject is an animal model that is induced with any neurodegenerative disease or suffers from a neurodegenerative disease, and is preferably an animal model that is induced with Parkinson's disease. For example, it may be a neurotoxic model induced by administering an environmental toxin or a synthetic toxin, or a genetic animal model produced through genetic modification of α-synuclein, Parkin, Pink1, DJ-1, LRRK2, etc. In addition, it may be an animal model produced by administering a Streptococcus mutans strain having the enzyme urocanate reductase (UrdA), or Escherichia coli overexpressing the enzyme urocanate reductase (UrdA), or imidazole propionate.

[0088] Preferably, a method for screening a neurodegenerative disease treatment agent comprises:

[0089] (c) It may further include a step of selecting a candidate substance that reduces the detection level of urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof.

[0090] Preferably, a method for screening a neurodegenerative disease treatment agent comprises:

[0091] (c) may further include a step of selecting a candidate substance that reduces the detection level of a Streptococcus mutans strain, an enzyme thereof, or a metabolite thereof.

[0092] The above detection level may be the amount of Streptococcus mutans strain or E. coli overexpressing UrdA, the enzyme expression amount of UrdA, or the concentration level of imidazole propionate (ImP), a metabolite of the UrdA enzyme of Streptococcus mutans, and a candidate substance that reduces the detection level of any one or more of these may be selected as a treatment for a neurodegenerative disease.

[0093] In addition, if the neurodegenerative disease treatment candidate drug of the present invention is administered to an animal model of a neurodegenerative disease and the symptoms of the neurodegenerative disease induced by treatment with the enzyme urocanate reductase (UrdA), a strain having the enzyme, or a metabolite thereof are observed to be alleviated (e.g., dopaminergic neuron reduction, cranial nerve inflammation, alpha-synuclein accumulation (or increase), or loss (or impairment) of motor ability, the drug is judged to be an effective substance for preventing or treating a neurodegenerative disease.

[0094] The present invention confirmed the association between Streptococcus mutans strains containing the enzyme urocanate reductase (UrdA) and neurodegenerative diseases, and demonstrated that ImP, a metabolite degraded from histidine by UrdA of S. mutans, directly penetrates the brain and induces neurodegeneration. This allows for the diagnosis of neurodegenerative diseases in a simple and non-invasive manner. Furthermore, using these microbial biomarkers, it is possible to screen for therapeutic agents for neurodegenerative diseases that can inhibit the expression of ImP or the activity of UrdA in a simple and efficient manner.

[0095] Figure 1 shows the results of an abundance analysis of genes encoding enzymes involved in the histidine degradation pathway in the gut microbiomes of healthy patients and Parkinson's disease patients.

[0096] Figure 2 shows the results of verification using ROC curves for UrdA and ImP, enzymes or their metabolites of microbial strains selected as new biomarkers for diagnosing neurodegenerative diseases.

[0097] Figure 3 shows the results of comparative analysis of the concentration of ImP in the culture medium when UrdA-negative enteroendocrine Escherichia coli MG1655 (E. coli (Con)), UrdA-overexpressing enteroendocrine Escherichia coli MG1655 (E. coli (urdA)), and S. mutans were treated with urocanate.

[0098] Figure 4 shows the results of immunocytochemistry analysis of the concentration of ImP in the plasma and brain, the pole test, and the dopaminergic neurodegeneration in the substantia nigra in the groups administered UrdA-negative E. coli and the enterobacterial E. coli MG1655 strain overexpressing UrdA.

[0099] Figure 5 shows the results of comparative analysis of the concentration of ImP, a metabolite of S. mutans, in the plasma and brain of the S. mutans strain administration group and the normal control group, the results of the pole test, and the results of immunohistochemistry analysis of dopaminergic neurodegeneration in the substantia nigra.

[0100] Figure 6 shows the results of confirming changes in the levels of ImP, a metabolite of S. mutans, and neurogenic movement disorders in the brain of mice administered with an mTORC1 inhibitor.

[0101] Figure 7 shows the changes in the mTORC1 mechanism that occur when mouse primary cortical neurons are treated with inhibitors of ImP and mTORC1 and 38γ.

[0102] Figure 8 shows the results of immunocytochemistry analysis of dopaminergic neurodegeneration in the substantia nigra when rapamycin was treated in mice administered ImP.

[0103] Figure 9 shows the results of a comparative analysis of the ImP levels in the plasma of a group of Parkinson's disease patients and a group of healthy subjects (control group).

[0104] Figure 10 shows the results of phylogenetic analysis of strains having UrdA (urocanate reductase) activity.

[0105] To aid in understanding the present invention, examples are presented. The following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the examples.

[0106] Example 1. Identification of microbial strains and genes associated with Parkinson's disease.

[0107] Based on the detection of ImP in the brain, the fact that ImP is one of the microbial metabolites of diabetes, and the association with the severity of Parkinson's disease in diabetic patients, with respect to microbial strains and genes associated with Parkinson's disease, we investigated the potential association between ImP and Parkinson's disease.

[0108] ImP is one of the final products of the microbial histidine degradation pathway, where histidine is converted to urocanate by hutH, and urocanate is converted to ImP by UrdA.

[0109] Accordingly, to investigate specific steps in the histidine degradation pathway related to Parkinson's disease, the abundance of urdA and hutH, genes encoding enzymes involved in the histidine degradation pathway, was analyzed in the gut microbiomes of healthy patients and Parkinson's disease patients, and the results are shown in Fig. 1.

[0110] As shown in Figure 1, urdA levels were significantly higher in the gut microbiomes of Parkinson's disease patients, whereas hutH levels did not show significant differences. These results suggest that microbial strains harboring UrdA, particularly S. mutans, may influence the pathogenesis of Parkinson's disease, and that S. mutans strains and UrdA-induced metabolites, ImP, are closely associated with Parkinson's disease.

[0111] Meanwhile, based on the conservation of amino acid sequences in the FAD active site, phylogenetic analysis of strains with UrdA (urocanate reductase) activity revealed that Streptococcus mutans, Shewanella oneidensis, Eggerthella lenta, Lactiplantibacillus paraplantarum, Brevibacillus laterosporus, Aerococcus urinae, and Adlercreutzia equolifaciens possess urocanate reductase and thus have the ability to produce ImP from urocanate (Fig. 10).

[0112] Example 2. ROC analysis of microbial strains or their metabolites selected as novel biomarkers for diagnosing neurodegenerative diseases.

[0113] To evaluate the potential of UrdA and ImP as biomarkers for predicting neurodegenerative disease status, the area under the ROC curve (AUC) values ​​were obtained through the receiver operating characteristic curve (ROC) curve, and the results are shown in Fig. 2.

[0114] As a result of verifying UrdA and ImP through the ROC curve, the closer the AUC is to 1, the better the model is as a diagnostic marker. All of them showed high AUC values ​​of 0.5 or higher, and in particular, the AUC value in the ROC curve of ImP showed a high value of 0.7917.

[0115] Therefore, we verified that UrdA possessed by S. mutans and ImP, a microbial metabolite produced by S. mutans, are suitable as metabolite biomarkers.

[0116] Example 3. Confirmation of ImP production and neurodegenerative effects of intestinal commensal Escherichia coli strains overexpressing UrdA enzyme.

[0117] To determine whether the UrdA enzyme, which is closely related to Parkinson's disease, affects ImP production and neurodegeneration, we developed a commensal E. coli strain (E. coli MG1655) that overexpresses UrdA derived from S. mutans, which does not affect ImP production and Parkinson's disease.

[0118] Specifically, in the present invention, the expression vector is pUC19, which includes a promoter sequence and a nucleotide sequence of a gene to be expressed, and a lac promoter sequence and a nucleotide sequence encoding UrdA are operably linked in the 5'-3' order.

[0119] The urdA gene, which is the expression target gene of the present invention, was obtained from Streptococcus mutans by PCR using the primers UrdA-Sal1 (GTGTGTCGACATGAAATTAATTGCT (SEQ ID NO: 3)) and UrdA-Kpn1 (GTGTGGTACCTTAGCAGCATTCTGTTAC (SEQ ID NO: 4)). The obtained UrdA fragment product and the expression vector pUC19 were treated with restriction enzymes (Kpn1, Sal1), and the obtained PCR product and vector were ligated using T4 ligase. The expression vector including the nucleotide sequence encoding the urdA gene can be transformed into the enteroendocrine commensal Escherichia coli MG1655 to produce a recombinant strain. The enteroendocrine commensal Escherichia coli MG1655 itself is a strain that does not possess the urdA gene and is known as a beneficial bacterium. The vector of the present invention can be transported into a host and expressed in the host cell, and in this case, the recombinant strain of the present invention has excellent ImP production ability.

[0120] When the enterobacterial Escherichia coli strain MG1655, which overexpressed the above UrdA enzyme, was cultured together with urocanate, the ImP level of the culture medium was measured using HPLC-MS / MS (perkinElmer, QSight™ LC / MS / MS 400, Waters ACQUITY UPLC BEH C18 2.1 x 50 mm column) liquid chromatography / mass spectrometry, and the ImP level was quantitatively analyzed using an ImP standard substance. The results are shown in Fig. 3.

[0121] As shown in Fig. 3, UrdA-negative E. coli did not produce ImP when treated with urocanate, but E. coli overexpressing the UrdA enzyme showed an increase in ImP concentration due to urocanate, which was similar to the ImP concentration produced by urocanate in S. mutans. Thus, the ImP production ability of the enterocommensal E. coli strain overexpressing the UrdA enzyme was confirmed.

[0122] In addition, to confirm whether ImP, a metabolite of the UrdA enzyme derived from gut microbes, also affects motor neuron disorders, mice without any gut microbes were colonized with the intestinal commensal Escherichia coli MG1655, which overexpresses the UrdA enzyme, and then ImP production ability and a mouse motor neuron test called the pole test were performed.

[0123] Specifically, 1x10 of the intestinal commensal strain MG1655, which overexpressed UrdA, was injected into mice with no intestinal microbiota. 9 The strain was administered orally for a total of 17 days out of 35 days at a concentration of CFU / ml (per animal) to allow colonization of the intestine.

[0124] Specifically, ImP levels in plasma and brain were measured using HPLC-MS / MS liquid chromatography / mass spectrometry, and ImP levels were quantitatively analyzed using ImP standards. In the pole test, a rough pole (diameter 1 cm, height 50 cm) was placed vertically on the floor, and the time until the mouse came down to the floor with its head facing the top of the pole was measured. When mice first climbed on the pole, they tended not to come down due to fear, so they were allowed to acclimate to the pole for at least 2 minutes. After that, a total of 3 tests were performed, and the average value was used for evaluation.

[0125] In addition, to confirm the neurodegenerative effect, the number of tyrosine hydroxylase (TH)-positive dopaminergic neurons in the substantia nigra, which indicates dopaminergic neurodegeneration in the midbrain, was analyzed using immunohistochemistry. The results are shown in Fig. 4 (con: control group, UrdA OE: group administered with E. coli strain overexpressing UrdA).

[0126] As shown in Fig. 4, when the intestinal commensal strain MG1655 (E. coli) overexpressing UrdA was colonized in mice with no intestinal microorganisms, the ImP produced by UrdA significantly increased in the blood as well as in the brain compared to the control group, confirming that UrdA enzyme-derived ImP can pass through the blood-brain barrier.

[0127] In addition, compared to the control group, mice colonized with the intestinal commensal strain MG1655 that overexpressed UrdA took a long time to descend from the upper end of the pole to the lower end, indicating motor impairment. In addition, the number of tyrosine hydroxylase (TH)-positive dopaminergic neurons in the substantia nigra was significantly reduced, indicating dopaminergic neurodegeneration in the midbrain.

[0128] These results confirmed that the UrdA enzyme derived from gut microbes is related to the pathological symptoms associated with Parkinson's disease.

[0129] Example 4. Confirmation of BBB penetration ability and neurodegenerative effect of ImP produced solely by S. mutans strain

[0130] To determine whether ImP, a microbial metabolite produced by intestinal S. mutans harboring UrdA, which is closely related to Parkinson's disease, can reach the brain, mice lacking any intestinal microbiota were single-colonized with S. mutans. ImP levels in plasma and brain were measured using HPLC-MS / MS liquid chromatography / mass spectrometry, and ImP levels were quantitatively analyzed using ImP standards. In addition, to determine whether ImP reaching the brain affects motor neuron disorders, the pole test, a mouse motor neuron test, and the number of tyrosine hydroxylase (TH)-positive dopaminergic neurons in the substantia nigra, which indicates dopaminergic neurodegeneration in the midbrain, were analyzed using immunohistochemistry. Specifically, the pole test involved placing a rough pole (1 cm in diameter, 50 cm in height) vertically on the floor. The time it took for the animal to descend to the top of the pole, with its head pointing toward the floor, was measured. A total of three tests were performed, and the average value was used for evaluation. The results are shown in Fig. 5 (Veh: control group; Sm: experimental group in which S. mutans was colonized alone).

[0131] As shown in Fig. 5, ImP produced by the S. mutans strain alone with UrdA significantly increased not only in the blood but also in the brain compared to the control group, confirming that ImP derived from gut microbes can pass through the blood-brain barrier. In addition, it was confirmed that mice with increased colonization of intestinal S. mutans and increased ImP, a metabolite produced by it, took a long time to descend from the upper end of the pole to the lower end compared to the control group, inducing motor impairment. In addition, the number of tyrosine hydroxylase (TH)-positive dopaminergic neurons in the substantia nigra was significantly reduced, indicating that dopaminergic neurodegeneration occurred in the midbrain.

[0132] From these results, we confirmed that the accumulation of ImP, a metabolite of UrdA enzyme possessed by intestinal microorganisms, in the brain is related to the pathological symptoms associated with Parkinson's disease.

[0133] Example 5. Confirmation of the ImP inhibitory effect of rapamycin, an mTORC1 inhibitor.

[0134] ImP can activate mTORC1 through p38γ, and inhibiting mTORC1 can protect dopaminergic neurons in Parkinson's disease by preventing α-synuclein accumulation. Therefore, to determine whether rapamycin, an mTORC1 inhibitor, also affects motor dysfunction caused by ImP metabolites derived from gut microbiota, mice colonized with S. mutans alone were treated with rapamycin, and the motor dysfunction and ImP levels in brain tissue were examined using the pole test. Specifically, the pole test was performed by placing a rough pole (1 cm in diameter, 50 cm in height) vertically on the floor, and the time it took for the head to fall to the floor by pointing it at the top of the pole was measured. A total of three tests were performed and the average value was used for evaluation. ImP levels in brain tissue were measured using liquid chromatography / mass spectrometry, and ImP levels were quantitatively analyzed using ImP standards. The results are shown in Fig. 6 (Veh: control group, Sm: group of mice colonized solely with S. mutans, S.m+Rap: group of mice colonized solely with S. mutans treated with rapamycin).

[0135] As shown in Figure 6, motor dysfunction induced by S. mutans or its metabolite ImP was found to be restored by rapamycin treatment, although ImP levels were not affected by rapamycin.

[0136] In addition, to confirm whether ImP treatment in the brain activates mTORC1, primary cortical neurons were treated with 100 μM ImP for 24 hours, and then co-treated with 20 nM rapamycin, an mTORC1 inhibitor, and 1 mM pirfenidone, a p38γ inhibitor, respectively, and protein expression was confirmed through Western blotting. The results are shown in Fig. 7.

[0137] As shown in Figure 7, ImP treatment increased phosphorylation of S6K1, a substrate of mTORC1, and this was restored to control levels by rapamycin and pirfenidone, which are mTORC1 and p38γ inhibitors, respectively. This confirmed the potential of ImP as a marker for screening Parkinson's disease therapeutics.

[0138] In addition, mice that had been directly injected with 10 μg of ImP into the brain were treated with rapamycin, an mTORC1 inhibitor, intraperitoneally at a concentration of 4 mg / kg every other day. The number of tyrosine hydroxylase (TH)-positive dopaminergic neurons in the substantia nigra, which indicates dopaminergic neurodegeneration in the midbrain, was analyzed using immunocytochemistry. The results are shown in Fig. 8.

[0139] As shown in Figure 8, mice directly injected with ImP showed a significant decrease in the number of tyrosine hydroxylase (TH)-positive dopaminergic neurons in the substantia nigra, resulting in dopaminergic neurodegeneration in the midbrain. Subsequent treatment with rapamycin showed that this degeneration was reversed.

[0140] These results confirmed that gut microbiota-derived ImP induces dopaminergic neurodegeneration through mTORC1 activation, and that rapamycin, which inhibits mTORC1 activity, inhibits the dopaminergic neurodegeneration mechanism induced by ImP.

[0141] Therefore, it was confirmed that UrdA enzyme or ImP, a metabolite of UrdA enzyme, is useful for screening therapeutic agents for neurodegenerative diseases.

[0142] Example 6. Determination of ImP levels in the blood of Parkinson's disease patients.

[0143] To determine whether ImP is associated with Parkinson's disease pathology in humans, plasma ImP levels were measured in 65 patients with Parkinson's disease (mean age 65 years, mean disease duration 5 years) and 65 age-matched neurologically healthy controls using liquid chromatography / mass spectrometry (PerkinElmer, QSight™ LC / MS / MS 400, Waters ACQUITY UPLC BEH C18 2.1 x 50 mm column), and quantitatively analyzed using ImP standards. The results are shown in Fig. 9 (Healthy: healthy control group, Parkinson: Parkinson's disease patient group).

[0144] As shown in Figure 9, the mean ImP concentration of neurologically healthy subjects was 5.3 nM (median 1.5 nM, 25th percentile 0.85 nM, 75th percentile 3.2 nM). In contrast, the mean ImP concentration of Parkinson's disease patients was 177.3 nM (median 10.25 nM, 25th percentile 1.78 nM, 75th percentile 223.3 nM).

[0145] Through these results, it was confirmed that UrdA enzyme can be used for diagnosis as a factor related to Parkinson's disease, and ImP, a metabolite derived from gut microbes that contains UrdA enzyme, is a microbial metabolite that affects Parkinson's disease through systemic circulation.

Claims

1. A composition for diagnosing a neurodegenerative disease, comprising an agent capable of detecting urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof.

2. In the first paragraph, the strain having the urocanate reductase (UrdA) enzyme is Streptococcus mutans, Shewanella oneidensis, Lactiplantibacillus plantarum, Parvimonas micra, Eggerthella lenta, Eggerthella guodeyinii, Fusobacterium animalis, Lactiplantibacillus paraplantarum, Brevibacillus laterosporus, Aerococcus urinae, and Adlercruzia. A composition for diagnosing a neurodegenerative disease, comprising at least one selected from the group consisting of Adlercreutzia equolifaciens.

3. A composition for diagnosing a neurodegenerative disease, wherein the metabolite of the urocanate reductase (UrdA) enzyme in paragraph 1 is at least one selected from the group consisting of imidazole propionate (ImP), glucan, and lactic acid.

4. In paragraph 1, the neurodegenerative disease is Parkinson's disease, Alexander disease, Alpert disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), ataxia telangiectasia, neuronal lipofuscinosis, Batten disease, bovine spongiform encephalopathy (BSE), Canavan disease, cerebral palsy, Cockayne syndrome, corticobasal degeneration, Creutzfeldt-Jakob disease, frontotemporal lobar degeneration, Gaucher disease, Huntington's disease, HIV-associated dementia, Kennedy disease, Krabbe disease, Lewy body dementia, lysosomal storage disorder, neuroborreliosis, Machado-Josef disease, motor neuron disease, multisystem atrophy, multiple sclerosis, multiple sulfatase deficiency, mucolipidosis, narcolepsy, Niemann-Pick type C, Niemann-Pick disease, Feliceus-Merzbacher disease, Pick disease, Pompe disease, primary lateral sclerosis, prion disease, progressive supranuclear palsy, Refsum A composition for diagnosing a neurodegenerative disease, wherein the composition is selected from any one of the following: disease, Schilder's disease, subacute combined degeneration of the spine secondary to pernicious anemia, Spielmayr-Vogt-Sjögren-Batten disease, spinocerebellar ataxia, spinal muscular atrophy, Stille-Richardson-Olzewski disease, spinal syphilis, and Tay-Sachs disease.

5. A composition for diagnosing a neurodegenerative disease, wherein the neurodegenerative disease in paragraph 1 is Parkinson's disease.

6. A composition for diagnosing a neurodegenerative disease, wherein the agent capable of detecting the urocanate reductase (UrdA) enzyme in the first paragraph comprises at least one selected from the group consisting of a primer, probe, antisense oligonucleotide, aptamer, antibody, and microbial selection medium specific therefor.

7. A composition for diagnosing a neurodegenerative disease, wherein the agent capable of detecting a strain having the urocanate reductase (UrdA) enzyme in the first paragraph comprises at least one selected from the group consisting of a primer, a probe, an antisense oligonucleotide, an aptamer, an antibody, and a microbial selection medium specific therefor.

8. A composition for diagnosing a neurodegenerative disease, wherein the detection of the urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof in the first paragraph comprises measuring by at least one selected from the group consisting of a gas or liquid chromatography device, a high-performance liquid chromatography (HPLC) device, a thin layer chromatography (TLC), an electrochemical analysis device, a refractive index spectroscopy device, a fluorescence analysis device, a light scattering analysis device, an ultraviolet spectroscopy, an infrared spectroscopy, an enzyme-linked immunosorbent assay (ELISA), and a mass spectrometer.

9. A method for providing information for diagnosing a neurodegenerative disease, comprising a step of detecting urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof from a biological sample of an individual.

10. In paragraph 9, the information providing method for diagnosing the neurodegenerative disease is as follows: (a) detecting urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof from a biological sample of an individual; and (b) A method for providing information for diagnosing a neurodegenerative disease, comprising a step of comparing the detection level of the urocanate reductase (UrdA) enzyme detected in (a), a strain having the same, or a metabolite thereof with the level detected in a biological sample of a normal control group not suffering from a neurodegenerative disease.

11. In paragraph 10, (c) The detection level detected in step (a) above, i) If the level is increased compared to that detected in a normal control group not suffering from a neurodegenerative disease, the subject is classified as having developed or having a high probability of developing a neurodegenerative disease; ii) A method for providing information for diagnosing a neurodegenerative disease, further comprising a step of classifying the subject as not having a neurodegenerative disease if the detection level is similar or equivalent to that in a normal control group not suffering from a neurodegenerative disease.

12. A method for providing information for diagnosing a neurodegenerative disease, wherein the detection comprises measuring the level of expression of urocanate reductase (UrdA) enzyme, the amount of Streptococcus mutans strain, or the concentration of imidazole propionate in paragraph 9.

13. A method for providing information for diagnosing a neurodegenerative disease, wherein the biological sample is at least one selected from the group consisting of tissue, blood, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine, colon tissue, feces, and brain tissue.

14. A composition for producing an animal model of a neurodegenerative disease comprising urocanate reductase (UrdA) enzyme, a strain having this enzyme, or imidazole propionate.

15. A method for producing an animal model of a disease, comprising administering to an animal other than a human an enzyme, a strain having the enzyme, or imidazole propionate. 16.(a) a step of treating a biological sample of an individual suffering from or having a neurodegenerative disease with a candidate therapeutic agent for a neurodegenerative disease; and (b) A method for screening a neurodegenerative disease treatment agent, comprising: a step of measuring a change in the detection level of urocanate reductase (UrdA) enzyme, a strain having the same, or a metabolite thereof before and after treating the candidate substance in the sample; 17. A method for screening a therapeutic agent for a neurodegenerative disease, further comprising the step of (c) selecting a candidate substance that reduces the detection level of urocanate reductase (UrdA) enzyme, a strain having the enzyme, or a metabolite thereof, in paragraph 16.

18. A method for screening a therapeutic agent for a neurodegenerative disease, in claim 17, wherein the detection level comprises the activity level of the urocanate reductase (UrdA) enzyme, the amount of a Streptococcus mutans strain having the enzyme, or the concentration of imidazole propionate.

Images