Linkage modified oligomeric agents and uses thereof

Abstract

The present disclosure provides oligomeric compounds (including oligomeric compounds that are antisense agents or portions thereof) comprising a modified oligonucleotide having at least one modified internucleoside linking group.

Description

[0001] LINKAGE MODIFIED OLIGOMERIC AGENTS AND USES THEREOF Sequence Listing The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled CHEM0111SEQ.xml created May 29, 2025, which is 21 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Field The present disclosure provides oligomeric agents (including oligomeric agents that are antisense agents or portions thereof) comprising a modified oligonucleotide having at least one modified internucleoside linking group. Background The principle behind antisense technology is that an antisense compound hybridizes to a target nucleic acid and modulates the amount, activity, and / or function of the target nucleic acid. For example, in certain instances, antisense compounds result in altered transcription or translation of a target. Such modulation of expression can be achieved by, for example, target RNA degradation or occupancy-based inhibition. An example of modulation of RNA target function by degradation is RNase H-based degradation of the target RNA upon hybridization with a DNA-like antisense compound. Another example of modulation of gene expression by target degradation is RNA interference (RNAi). RNAi refers to antisense-mediated gene silencing through a mechanism that utilizes the RNA- induced silencing complex (RISC). An additional example of modulation of RNA target function is by an occupancy-based mechanism such as is employed naturally by microRNA. MicroRNAs are small non- coding RNAs that regulate the expression of protein-coding RNAs. The binding of an antisense compound to a microRNA prevents that microRNA from binding to its messenger RNA targets, and thus interferes with the function of the microRNA. MicroRNA mimics can enhance native microRNA function. Certain antisense compounds alter splicing of pre-mRNA. Another example of modulation of gene expression is the use of antisense compounds in a CRISPR system. Regardless of the specific mechanism, sequence- specificity makes antisense compounds attractive as tools for target validation and gene functionalization, as well as therapeutics to selectively modulate the expression of genes involved in the pathogenesis of disease. Antisense technology is an effective means for modulating the expression of one or more specific gene products and can therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications. Chemically modified nucleosides may be incorporated into antisense compounds to enhance one or more properties, such as nuclease resistance, tolerability, pharmacokinetics, or affinity for a target nucleic acid. Summary The present disclosure provides oligomeric agents (including oligomeric agents that are antisense agents or portions thereof) comprising modified oligonucleotides consisting of linked subunits linked through internucleoside linking groups, wherein at least one of the internucleoside linking groups has Formula I: for each internucleoside linking group of the modified oligonucleotide of X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is selected from: a heterocyclyl , a substituted heterocyclyl , a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a cyclopropyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, a fragment of Formula II: ; wherein each of Z1, Z2, Z3, Z4, and Z5is N or C, provided that no more than two adjacent Z1, Z2, Z3, Z4, and Z5are N; and R3is absent when Z1is N; R4is absent when Z2is N; R5is absent when Z3is N; R6is absent when Z4is N, and R7is absent when Z5is N; and each of R3-R7, when present, is selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, N(R9R10); R8is H, OH, OR9, aryl, substituted aryl, or N(R10R11); R9is aryl, substituted aryl, or C1-C6alkyl; R10and R11are each, independently, H, C1-C6alkyl, or C(=O)Me; Provided that if each of Z1, Z2, Z3, Z4, and Z5is C: If R5is alkyl, NH2, C(=O)NH(R10), or NHC(=O)Me, then at least one of R3, R4, R6,and R7is other than H; If R4,R5, and R6are H, then neither R3nor R7is NO2; If each of R3-R7is H, then L is not methylene; a fragment of Formula III: ; wherein Y1,Y2,Y3, and Y4are selected from C, N, O or S, provided that if one of Y1,Y2,Y3, and Y4is O or S, then an adjacent Y1,Y2,Y3, or Y4is not O or S; wherein the ring is aromatic; and each of R12-R15is absent or selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, or N(R9R10); with the proviso that Formula III is not 1-methyl-2-imidazole; or a fragment of Formula IV ; wherein R16, R17, R18, and R19are independently selected from H or C1-C6alkyl, or R17and R18join to form a 5- or 6-membered heterocycle; or a fragment of Formula V; ; wherein n is from 0-6; m is from 1-4; q is 0-3; and R20, R21, and R22are independently selected from H or C1-C6alkyl; with the proviso that if n and q are 0, then R21is not CH3. Detailed Description It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. DEFINITIONS The following definitions are provided, along with additional definitions throughout the specification, for a complete understanding of the instant invention. Unless specific definitions are provided herein, nomenclature used in connection with, and procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Unless otherwise indicated, certain terms have the following meanings: As used herein, a substituent at the “2′-position” means that the substituent is directly attached to the carbon at the 2′-position of a furanosyl sugar moiety. As used herein, “2′-deoxynucleoside” means a nucleoside comprising a 2′-deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2′-deoxynucleoside is a 2′-β-D-deoxynucleoside which comprises a 2′- β-D-deoxyribosyl sugar moiety, and which is in the β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). A 2′-deoxynucleoside or a nucleoside comprising a 2′-deoxyfuranosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil). As used herein, “2′-deoxy sugar moiety” means a 2′-H(H) deoxyfuranosyl sugar moiety. Unless otherwise indicated, a 2′-deoxy sugar moiety is a 2′-β-D-deoxyribosyl sugar moiety, which has the β-D ribosyl stereochemical configuration as found in naturally occurring deoxyribonucleic acid (DNA). As used herein, “2′-MOE” means a 2′-OCH2CH2OCH3group at the 2′-position of a furanosyl sugar moiety. A “2′-MOE sugar moiety” means a sugar moiety with a 2′-OCH2CH2OCH3group at the 2′-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-MOE sugar moiety is in the β-D-ribosyl stereochemical configuration. “MOE” means O-methoxyethyl. As used herein, “2′-MOE nucleoside” or “2′-OCH2CH2OCH3nucleoside” means a nucleoside comprising a 2′-MOE sugar moiety (or 2′-OCH2CH2OCH3furanosyl sugar moiety). As used herein, “2′-OMe” means a 2′-OCH3group at the 2′-position of a furanosyl sugar moiety. A “2′-OMe sugar moiety” means a sugar moiety with a 2′-OCH3group at the 2′-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-OMe sugar moiety is in the β-D-ribosyl stereochemical configuration. As used herein, “2′-OMe nucleoside” means a nucleoside comprising a 2′-OMe sugar moiety. As used herein, “2′-F” means a 2′-fluoro group at the 2′-position of a furanosyl sugar moiety. A “2′-F sugar moiety” means a sugar moiety with a 2′-F group at the 2′-position of a furanosyl sugar moiety. Unless otherwise indicated, a 2′-F sugar moiety is in the β-D-ribosyl configuration. As used herein, “2′-F nucleoside” means a nucleoside comprising a 2′-F sugar moiety. As used herein “2′-NMA” means a 2′-OCH2C(=O)-N(H)CH3group at the 2′-position of a furanosyl sugar moiety. A “2′-NMA sugar moiety” means a sugar moiety with a 2′-OCH2C(=O)-N(H)CH3group at the 2′-position of a furanosyl sugar moiety. As used herein, “2′-NMA nucleoside” means a nucleoside comprising a 2′-NMA sugar moiety. As used herein, “2′-substituted nucleoside” means a modified nucleoside comprising a 2′-substituted furanosyl sugar moiety. As used herein, “2′-substituted sugar moiety” means a modified furanosyl sugar moiety wherein the 2′-position is attached to at least one substituent other than H or OH. A 2′-substituted sugar moiety includes a bicyclic sugar moiety wherein the second ring is joined to the furanosyl ring at the 2′-position.2′-substituted sugar moieties include, but are not limited to, 2′-OMe sugar moieties, 2′-MOE sugar moieties, 2′-F sugar moieties, 2′-NMA sugar moieties, cEt sugar moieties, and LNA sugar moieties. As used herein, “stop site” refers to the 3′-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide when the oligonucleotide is maximally aligned with the target nucleic acid. As used herein, “start site” refers to the 5′-most nucleotide of a target nucleic acid which is complementary to an oligonucleotide when the oligonucleotide is maximally aligned with the target nucleic acid. As used herein, “5-methylcytosine” means a cytosine modified with a methyl group attached at the 5 position. A 5-methylcytosine is a modified nucleobase. As used herein, an “abasic subunit” means a group of atoms other than a nucleoside or nucleoside mimic that is between two internucleoside linkages in an oligonucleotide. An abasic subunit does not comprise a nucleobase. In certain embodiments, an “abasic subunit” is a spacer. A “spacer” is an abasic furanosyl sugar moiety, an abasic acyclic sugar surrogate having any of Formula B1, Formula C1, or Formula D1, or an abasic cyclic sugar surrogate having Formula A1. As used herein, “acyclic sugar surrogate nucleoside” means a nucleoside having Formula B, Formula C, or Formula D: wherein X is O, S, C(R5R6), N(E1), NC(=O)-(E1); each J1and J2are independently H or C1-C6alkyl; n is 0, 1 or 2; m is 0, 1, or 2; o is 0 or 1; s is 0 or 1; R1is H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, or (CH2)qR8; R2, R3, and R4are each independently H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-yl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR8; E1is H, C1-C6alkyl or substituted C1-C6alkyl; R5and R6are independently H, OH, C1-C6alkyl, or N(R7); wherein if R5is OH, then R6is not OH; R7is H, C1-C6alkyl, or C(=O)R9, wherein R9is C1-C6alkyl; R8is OH, halogen, methoxy, ethoxy, azido, C2-C6alkenyl, or C2-C6alkynyl, and q is 1, 2, or 3; and Bx is a nucleobase. As used herein, “acyclic sugar surrogate” means the sugar moiety of an acyclic sugar surrogate nucleoside. An acyclic sugar surrogate without an attached nucleobase is a spacer. As used herein, “ameliorate” with reference to a symptom of a disease, means improvement in, or lessening of, or preclusion of, at least one symptom of a disease. As used herein, “disease” includes disorders, conditions, and injuries. Amelioration may be reduction in severity or frequency of a symptom or the delayed onset, prevention of occurrence of, or slowing of progression in the severity or frequency of, a symptom. Progression, frequency, or severity indicators may be determined by subjective or objective measures known in the art and / or described herein. As used herein, “antisense activity” means any detectable and / or measurable change attributable (whether directly and / or indirectly) to hybridization of an antisense oligonucleotide to a target nucleic acid. For example, compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vitro assay; or, for example compounds have antisense activity when they alter the amount or activity of a target nucleic acid by 25% or more in an in vivo assay. Antisense activity may be assessed in a standard assay. Herein, antisense activity is a modulation in the amount or expression of a target nucleic acid or a protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the oligonucleotide. As used herein, “antisense agent” means an oligomeric agent comprising an antisense oligonucleotide. As used herein, “antisense oligonucleotide” means an oligonucleotide having at least one region (a “targeting region”) that is complementary to a target nucleic acid (e.g., a target region). An antisense oligonucleotide may be paired with a second oligonucleotide (herein, a “sense oligonucleotide”) that is complementary to the antisense oligonucleotide (for example, forming an “oligomeric duplex”) or may be an unpaired antisense oligonucleotide. A “hairpin oligonucleotide” is an unpaired oligonucleotide that has at least one region that is self-complementary. As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising a furanosyl sugar moiety and a second ring, wherein the second ring is formed via a bridge connecting two non-geminal atoms in the ring of the furanosyl sugar moiety, thereby forming a bicyclic structure. Examples of bicyclic sugar moieties include locked nucleic acid (LNA) sugar moieties and constrained ethyl (cEt) sugar moieties as defined herein. As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. As used herein, “blunt” or “blunt ended” in reference to one end of an oligomeric duplex means that there are no terminal unpaired nucleotides. One or both ends of an oligomeric duplex may be blunt. As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that has affinity for a particular cell type or particular cell types. For example, a cell-targeting moiety may have affinity for a cell surface moiety, such as a cell surface receptor on a particular cell type. As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF. As used herein, “cleavable moiety” means a group of atoms comprising at least one bond that is cleaved under physiological conditions, e.g., in a cell and / or a subject. For example, a cleavable moiety may be cleaved inside a cell or sub-cellular compartment, such as an endosome or lysosome. A cleavable moiety may be cleaved by endogenous enzymes, such as nucleases. As used herein, “complementary nucleobase(s)”, “complementary nucleobase pairs”, or “complementary” in reference to nucleobase(s) means nucleobases that form hydrogen bonds with one another . Complementary nucleobase pairs include, but are not limited to, adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G), hypoxanthine (I) and thymine (T), hypoxanthine and adenine (A), hypoxanthine (I) and uracil (U), hypoxanthine (I) and cytosine (C), and hypoxanthine (I) and 5-methylcytosine (mC). Hypoxanthine is the nucleobase of the nucleoside inosine. Certain modified nucleobases that are complementary to unmodified nucleobases or to other modified nucleobases are known in the art. As used herein, “complementary nucleobase sequence(s)” or “complementary” in reference to a nucleobase sequence(s) refers to two nucleobase sequences in which some, a majority, or all of the nucleobases in the two nucleobase sequences are complementary nucleobases when the sequences are aligned. As used herein “nucleobase sequence” means the order of contiguous nucleobases or abasic subunits in a strand of linked oligonucleotide subunits or a region thereof (e.g., an oligonucleotide or region thereof, or a target nucleic acid or region thereof) independent of any sugar or internucleoside linkage modification. Complementary nucleobase sequences may be nucleobase sequences of two separate strands of linked oligonucleotide subunits or regions thereof (e.g., an oligonucleotide and a region of a target nucleic acid, or an antisense oligonucleotide and its paired sense oligonucleotide) or complementary nucleobase sequences may be nucleobase sequences of two regions of a single strand (e.g., self-complementary regions of a hairpin oligonucleotide). As used herein, when a first strand of linked oligonucleotide subunits (e.g., an oligonucleotide) or region thereof is described as being complementary to a second strand of oligonucleotide subunits or region thereof (e.g., a target nucleic acid or another oligonucleotide), it means that the nucleobase sequence of the first strand of linked oligonucleotide subunits or region thereof is complementary to the nucleobase sequence of the second strand of linked oligonucleotide subunits or region thereof. As used herein, when an oligonucleotide or region thereof is described as being complementary to a region of a target nucleic acid, it means that the nucleobase sequence of the oligonucleotide or region thereof is complementary to the nucleobase sequence of the region of the target nucleic acid. As used herein, “the nucleobase sequence of” a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each internucleoside linkage, independently, is modified or unmodified, irrespective of the presence or absence of modifications indicated in the referenced SEQ ID NO. As used herein, two nucleobase sequences are “maximally aligned” when the number of possible complementary nucleobase pairs between the two nucleobase sequences is maximized when the two nucleobase sequences are aligned in opposite directions, allowing for bulges or gaps of up to 5 oligonucleotide subunits. Not every pair of nucleobases in the aligned nucleobase sequences needs to be complementary for the two sequences to be “complementary” Rather, some mismatches or gaps are tolerated. A gap may occur, for example, when an oligonucleotide includes an abasic subunit. Unless otherwise specified, “complementary” is assumed to be at least 70%. Complementary nucleobase sequences may be 75%, 80%, 85%, 90%, 95%, or 100% complementary. For example, if a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is 80% complementary to another nucleobase sequence, then 16 of the nucleobase pairs are complementary nucleobases when the sequences are maximally aligned. If a nucleobase sequence of an oligonucleotide consisting of 20 nucleosides is at least 80% complementary to another nucleobase sequence, then 16, 17, 18, 19, or 20 of the nucleobase pairs are complementary nucleobases. As used herein, “fully complementary” or “100% complementary” means that the two nucleobase sequences are the same length and each nucleobase pair of the two nucleobase sequences is complementary when the equal length sequences are maximally aligned. For nucleobase sequences that are different lengths, the percent complementarity is expressed based on the oligonucleotide that has the fewest nucleobases. As used herein, abasic subunits do not count when counting the number of nucleobases for the purposes of calculating complementarity. For example, if an oligonucleotide consists of 20 subunits, including 2 abasic subunits and 18 nucleosides, and all 18 of those nucleosides form complementary base pairs with a target nucleic acid, then the oligonucleotide is considered to be 100% complementary to the target nucleic acid. As used herein, “conjugate group” means a group of atoms that is directly or indirectly attached to an oligonucleotide. A conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide. As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide. As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule (e.g., an oligonucleotide) modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. As used herein, “complementary region” in reference to a strand of linked oligonucleotide subunits (e.g., an oligonucleotide or a target nucleic acid) is a region of the strand in which the nucleobase sequence of the region is complementary with the nucleobase sequence of a separate strand of linked oligonucleotide subunits (e.g., an oligonucleotide and a target nucleic acid, or an antisense oligonucleotide and a sense oligonucleotide), or the nucleobase sequence of a region within the same strand of linked oligonucleotide subunits (e.g., in a “hairpin oligonucleotide”). A complementary region of a strand may be a portion of a strand or may include the entire strand of linked oligonucleotide subunits. A complementary region may include a mismatch, but the nucleobases of the terminal nucleosides of a complementary region are complementary to the nucleobases of the terminal nucleosides of the equal-length region of the separate strand of linked oligonucleotide subunits or to the nucleobases of the terminal nucleosides of the region within the strand of linked oligonucleotide subunits. A “targeting region” of an oligonucleotide is a complementary region in which the nucleobase sequence of the region is complementary to the nucleobase sequence of a target region of a target nucleic acid. A targeting region of an oligonucleotide maybe be a portion of the oligonucleotide or may include the entire oligonucleotide. A “duplexing region” is a complementary region of an oligonucleotide (e.g., an antisense or sense oligonucleotide) having a nucleobase sequence that is complementary to the nucleobase sequence of a second oligonucleotide or region thereof. A duplexing region may be a portion of an oligonucleotide or may include the entire oligonucleotide. As used herein, “constrained ethyl” or “cEt” or “cEt sugar moiety” means a β-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4′-carbon and the 2′-carbon of the β-D ribosyl sugar moiety, wherein the bridge has the formula 4′-CH(CH3)-O-2′, and wherein the methyl group of the bridge is in the S configuration. As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety. As used herein a “cyclic sugar surrogate nucleoside” is a nucleoside having Formula A: J is H, C1-C6alkyl, or C2-C6alkenyl; X is O, S, C(R1R2), N(R3), or X1-X2, wherein X1-X2is C(R1)=C(R2), C(R1R2)-C(R1R2), O-C(R1R2), C(R1R2)-O, S-C(R1R2), C(R1R2)-S, N(R3)-C(R1R2), or C(R1R2)-N(R3); Y is C(R1R2) or Y1-Y2, wherein Y1-Y2is C(R1)=C(R2) or C(R1R2)-C(R1R2); Z is C(G1G2) or Z1-Z2or Z1-Z2-Z3,,wherein Z1-Z2is C(G1)=C(R1), C(R1)=C(G1); C(G1G2)-C(R1R2), C(R1R2)-C(G1G2); wherein Z1-Z2-Z3is C(G1G2)-C(R1R2)-C(R1R2), C(R1R2)-C(G1G2)-C(R1R2), or C(R1R2)- C(R1R2)-C(G1G2); Q is CH or N; each R1and R2is independently H, OH, C1-C6alkyl, or N(R4); wherein if R1is OH, then R2is not OH; each R3and R4is independently H, C1-C6alkyl, or C(=O)R5, wherein R5is C1-C6alkyl; each G1and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if G1is OH, then G2is not OH; each R6and R7is, independently, H, halogen, C1-C6alkyl or substituted C1-C6alkyl; each XGis O, S or N(E1); R8is H, halogen, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2-C6alkynyl, substituted C2-C6alkynyl or N(E2)(E3); E1, E2and E3are each, independently, H, C1-C6alkyl or substituted C1-C6alkyl; m is 0 or 1; p is 0 or 1; q is from 1 to 6; s is 0 or 1; j is 0 or 1; Bx is a nucleobase; and provided that if X is O, Z is C(G1G2), and Q is CH, then m is 1. As used herein, “cyclic sugar surrogate” means the sugar moiety of a cyclic sugar surrogate nucleoside. An abasic cyclic sugar surrogate is an abasic subunit. As used herein, “deoxy region” means a region of 5-12 contiguous oligonucleotide subunits, wherein at least 70% of the subunits are DNA nucleosides. Each subunit of a deoxy region is selected from a 2′- deoxynucleoside, a 2′-substituted nucleoside, and an abasic subunit. A deoxy region supports RNase H activity. As used herein, “DNA nucleoside” means a nucleoside comprising an unmodified DNA sugar moiety. A DNA nucleoside may comprise a modified or unmodified nucleobase. A DNA nucleoside may comprise a uracil nucleobase or a modified nucleobase. As used herein, “DNA sugar moiety” means an unmodified DNA sugar moiety. As used herein, “double-stranded” refers to two oligonucleotides that are hybridized to each other through complementary base pairs including those between two separate strands of linked oligonucleotide subunits (e.g., an antisense oligonucleotide and a sense oligonucleotide or an antisense oligonucleotide and a target nucleic acid) and those within a single oligonucleotide (e.g., a hairpin oligonucleotide). As used herein, “duplex” means a structure formed by the hybridization of complementary base pairs between two strands of linked oligonucleotide subunits or regions thereof (e.g., two separate oligonucleotides or an antisense oligonucleotide and a target nucleic acid For clarity, herein a “hairpin oligonucleotide” is a single strand of linked oligonucleotide subunits that comprises a region that is double stranded and is not considered a duplex. As used herein, a “furanosyl sugar moiety" is a group of atoms that comprises a furanose ring, and is numbered according to the structure below, with optional additional substituents at any of the 1′, 2′, 3′, 4′, and 5′ positions. . As or “hybridization” means the act or process of two complementary regions of subunits (e.g., oligonucleotides, nucleic acids) annealing together to form a double-stranded region. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. As used herein, “internucleoside linkage” means the covalent linkage between immediately adjacent subunits in an oligonucleotide. As used herein, “unmodified internucleoside linkage” means a phosphodiester internucleoside linkage. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. A “phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. A “mesyl phosphoramidate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with NS(=O)2CH3. Unless otherwise indicated, for linked nucleosides comprising furanosyl sugar moieties, an internucleoside linkage joins the 3′-carbon of one furanosyl sugar moiety to the 5′-carbon of the other furanosyl sugar moiety. As used herein, “inverted nucleoside” means a nucleoside having a 3′ to 3′ and / or 5′ to 5′ internucleoside linkage. As used herein, “inverted sugar moiety” means a furanosyl sugar moiety having a 3′ to 3′ and / or 5′ to 5′ internucleoside linkage to the remainder of an oligonucleotide. As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., nucleosides adjacent to one another; however, an abasic subunit or a nucleoside mimic may be present between two linked nucleosides). As used herein, a “mismatch” between two aligned nucleobase sequences means that the two nucleobases at a specified position of the aligned nucleobase sequences are not complementary nucleobases. An abasic subunit in one nucleobase sequence is not considered a mismatch with a nucleobase in the second nucleobase sequence; rather, it can be treated as an alignment gap. As used herein, “modified nucleoside” means a nucleoside where the sugar moiety and / or nucleobase is modified. As used herein, “modified sugar moiety” means a group of atoms forming the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA. A modified sugar moiety is selected from a modified furanosyl sugar moiety, a cyclic sugar surrogate (described by Formula A), an acyclic sugar surrogate (described by Formula B, Formula C, or Formula D), or a sugar mimic. As used herein, a “modified nucleobase” means a nucleobase other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase. A “5-methylcytosine” (mC) is a modified nucleobase. Inosine (I) is a nucleoside comprising the modified nucleobase hypoxanthine. As used herein, “motif” means a pattern of independently unmodified and / or independently modified subunits, sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide. As used herein, “non-bicyclic modified sugar moiety” means a modified furanosyl sugar moiety comprising a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring. As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein, “nucleoside” means a compound or oligonucleotide subunit comprising a sugar moiety or a sugar surrogate and a nucleobase. A nucleoside may be an “unmodified nucleoside” or a “modified nucleoside”. As used herein, a “nucleoside mimic” means a compound or subunit comprising a sugar mimic and a nucleobase. As used herein, “nucleoside overhang” or “overhang” refers to unpaired oligonucleotide subunits at either or both ends of a duplex or a hairpin structure. The nucleosides of an overhang are not part of the “duplexing region” of either of the two strands of linked oligonucleotide subunits. As used herein, "oligomeric agent" means a compound or complex comprising or consisting of at least one modified oligonucleotide and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which may be covalently attached directly or indirectly to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. Herein, where two oligonucleotides are described as being covalently attached to one another, such attachment is other than through a direct internucleoside linkage. Thus, a single, unbranched oligonucleotide comprising only direct internucleoside linkages cannot be described as two separate covalently linked oligonucleotides. As used herein, an “oligonucleotide” means a compound consisting of 10-80 linked oligonucleotide subunits, wherein a maximum of 5 subunits are abasic subunits. An “oligonucleotide subunit” or "subunit" is a nucleoside, a nucleoside mimic, or an abasic subunit (e.g. a ‘spacer’). Unless otherwise indicated, oligonucleotides consist of 12-80 linked subunits. Unless otherwise indicated, no more than 5 of the subunits of an oligonucleotide are spacers. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one subunit and / or at least one internucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide consisting of unmodified nucleosides linked by phosphodiester internucleoside linkages. An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide to form an oligomeric duplex, or it may be unpaired. As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric agent and a sterile aqueous solution. A pharmaceutical composition may show activity in certain cell lines. As used herein, “pharmaceutically acceptable diluent” means an ingredient in a pharmaceutical composition suitable for use in administering to a subject. Typically, a “diluent” lacks pharmacological activity but is desirable in preparing a pharmaceutical composition. As used herein, “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. As used herein, “prodrug” means a therapeutic agent in a first form outside the body that is converted to a second form within a subject or cells thereof. Typically, conversion of a prodrug within the subject is facilitated by the action of an enzyme (e.g., endogenous or viral enzyme) or chemical present in cells or tissues and / or by physiologic conditions. The first form of the prodrug may be less active than the second form. As used herein, “RNA nucleoside” means a nucleoside comprising an unmodified RNA sugar moiety. An RNA nucleoside may comprise a modified or unmodified nucleobase. An RNA nucleoside may comprise a thymine nucleobase or a modified nucleobase. As used herein, “RNA sugar moiety” means an unmodified RNA sugar moiety. As used herein, “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNAi (ssRNAi), hairpin RNAi, and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent modulates the amount and / or activity of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H. As used herein, “RNase H agent” means an antisense agent that acts, at least in part, through RNase H to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNase H agents may be single-stranded or RNase H agents may be double-stranded. RNase H compounds may comprise conjugate groups and / or terminal groups. RNase H agents may modulate the amount and / or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC / Ago2. As used herein, “single-stranded” in reference to a strand of linked oligonucleotide subunits (e.g., an oligonucleotide) means that the strand is not part of a duplex or part of a double-stranded region. Single- stranded nucleic acids (e.g., single-stranded oligonucleotides) are capable of hybridizing to complementary nucleic acids to form duplexes, at which point they are no longer single-stranded. As used herein, “splice-modulating agent” means an antisense agent that acts, at least in part, by modulating the splicing of a target nucleic acid. As used herein, “steric-blocking agent” means an antisense agent that acts, at least in part, due to directly binding to a target nucleic acid, thus blocking the interaction of the target nucleic acid with other nucleic acids or proteins. As used herein, “stabilized phosphate moiety” means a 5′-phosphate analog that is metabolically more stable than a 5′-phosphate as naturally occurs on DNA or RNA. As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not intentionally controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that chiral center. It is understood that a stereorandom chiral center may not be racemic because one absolute configuration predominates following synthesis, e.g., due to steric and electronic interactions of reagents with the reactant molecule. The stereorandom chiral center may be at the phosphorous atom of a stereorandom phosphorothioate or stereorandom mesyl phosphoramidate internucleoside linkage. As used herein, a “strand” or “strand of linked oligonucleotide subunits” means contiguous linked nucleosides, nucleoside mimics, and / or abasic subunits connected via internucleoside linkages. A strand of linked oligonucleotide subunits has a nucleobase sequence. As used herein, “subject” means a human or a non-human animal. The subject may be a human. As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “sugar mimic” means a group of atoms forming the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA other than a modified furanosyl sugar moiety, a cyclic sugar surrogate, or an acyclic sugar surrogate. As used herein, “sugar surrogate nucleoside” means a nucleoside comprising a cyclic sugar surrogate or nucleoside comprising an acyclic sugar surrogate. As used herein, “symptom” of a disease means any manifestation, indication, sign, or evidence of a disease. Symptoms include subjective and objective indicia of a disease and may be perceived, experienced, detected, observed, measured, and / or quantified. A symptom may be apparent only upon invasive diagnostic testing, including, but not limited to, post-mortem tests. A symptom may be an absence of a feature, such as failing to reach expected developmental milestones. As used herein, “target nucleic acid” means a nucleic acid that an antisense oligonucleotide is designed to affect. As used herein, “target RNA” means an RNA transcript and includes pre-mRNA and / or mRNA unless otherwise specified. As used herein, “target region” refers to a portion of a target nucleic acid that is complementary to the targeting region of an antisense oligonucleotide. As used herein, “treating,” or “treatment,” with respect to a disease, means administering a compound or agent to a subject having or at risk for developing such disease. Treating a disease may result in amelioration of at least one symptom of such disease. Treatment may reduce, improve, and / or prevent one or more symptom(s) such that a symptom of the disease is diminished, is no longer apparent, or is never apparent. As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount ameliorates at least one symptom of a disease. As used herein, “unmodified nucleobase” means unmodified adenine (A), unmodified thymine (T), unmodified cytosine (C), unmodified uracil (U), or unmodified guanine (G). As used herein, an “unmodified nucleoside” means a compound or subunit comprising an unmodified sugar moiety and an unmodified nucleobase. As used herein, “unmodified sugar moiety” means a 2′-OH(H) β-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2′-H(H) β-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties are furanosyl or deoxyfuranosyl sugar moieties in the β-D-ribosyl stereochemical configuration, and have one hydrogen at each of the 1′, 3′, and 4′ positions, an oxygen at the 3′ position, two hydrogens at the 5′ position, and two hydrogens (DNA) or a hydrogen and an OH (RNA) at the 2′ position. As used herein, "alkyl" refers to a saturated straight or branched hydrocarbon substituent group containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to 22 carbon atoms (“C1-C22alkyl”), more typically from 1 to 12 carbon atoms (“C1-C12alkyl”) with from 1 to 6 carbon atoms (“C1-C6alkyl”) being more preferred. Alkyl groups as used herein may optionally include one or more further substituent groups. As used herein, "alkenyl," refers to a straight or branched hydrocarbon chain substituent group containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to 22 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups. As used herein, "alkynyl", refers to a straight or branched hydrocarbon substituent group containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to 22 carbon atoms, more typically from 2 to 12 carbon atoms with from 2 to 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups. As used herein, "alkoxy" refers to an alkyl-O- substituent group, where alkyl is as defined herein. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec- butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups. As used herein, "aryl" refers to a carbocyclic ring system substituent group having one or more aromatic rings. The aryl may be monocyclic or may include two or more fused rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from 6 to 10 ring atoms. Aryl groups as used herein may optionally include further substituent groups. As used herein, "cycloalkyl" refers to a saturated or unsaturated carbocyclic ring system substituent group that does not include an aromatic ring. The cycloalkyl may be monocyclic or may include two or more fused rings. Examples of cycloalkyl groups include without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, and the like. Preferred cycloalkyl ring systems have from 3 to 10 ring atoms (“C3- C10cycloalkyl”). Cycloalkyl groups as used herein may optionally include further substituent groups. As used herein, "halo" or "halogen" refers to a substituent group selected from fluoride, chloride, bromide and iodide. As used herein, "heteroaryl" refers to a substituent group comprising a ring system in which at least one of the rings is aromatic, and at least one ring includes one or more ring heteroatoms. The heteroaryl may be monocyclic or may include two or more fused rings. Heteroaryl groups include at least one ring atom selected from sulfur, nitrogen or oxygen, wherein the sulfur is optionally present as a sulfoxide or sulfone, and wherein the nitrogen is optionally present as an N-oxide. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, thiophenyl, furanyl, quinolinyl, and the like. Heteroaryl groups as used herein may optionally include further substituent groups. As used herein, "heteroalkyl" refers to an alkyl substituent group as defined herein in which one or more CH2units are replaced with a heteroatom independently selected from O, NH, N(C1-6alkyl), S, SO, and SO2, except that heteroalkyl does not encompass groups defined herein as alkoxy. Examples of heteroalkyl groups include without limitation, methoxypropyl, ethoxymethyl, propylsulfonyl, 1-(methylthio)propan-2-yl, methyl(methylthio)amino, N-propylamino, 2-(methylamino)ethyl, and the like. Heteroalkyl groups typically include from 1 to 20 carbon atoms (“C1-C20heteroalkyl”), more typically from 1 to 12 carbon atoms (“C1-C12 heteroalkyl”) with from 1 to 6 carbon atoms (“C1-C6heteroalkyl”) being more preferred. Heteroalkyl groups as used herein may optionally include one or more further substituent groups. As used herein, "heterocyclyl" refers to a substituent group comprising a ring system in which none of the rings are aromatic, and at least one ring includes one or more ring heteroatoms. Heterocyclyl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heterocyclyl groups include at least one ring atom selected from sulfur, nitrogen or oxygen, wherein the sulfur is optionally present as a sulfoxide or sulfone. Examples of heterocyclyl groups include without limitation, morpholino, oxirane, tetrahydropyranyl, tetrahydrothienyl, sulfolanyl, and the like. Heterocyclyl groups as used herein may optionally include further substituent groups. The term “substituted”, with respect to chemical groups means, unless otherwise indicated, a group is substituted with 1, 2, 3, 4, or 5 or more substituent groups selected from halo (e.g., perhalo), hydroxy, azido, SH, CN, OCN, nitro, C1-C20alkyl (e.g., C1-C2alkyl), C1-C10substituted alkyl (e.g., CF3), C2-C10alkenyl, C2- C10alkynyl, C1-C10heteroalkyl, C1-C10alkoxy, C1-C10substituted alkoxy (e.g., OCF3), S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, aralkyl, O- aralkyl, C3-10cycloalkyl, C6-10aryl, heterocyclyl, heteroaryl, N(Rm)(Rn), C(O)N(Rm)(Rn), N(Rm)(Rn)C(O)Rm, S(O)2N(Rm)(Rn), N(Rm)(Rn)S(O)2Rm, OC(O)N(Rm)(Rn), N(Rm)C(O)N(Rm)(Rn), N(Rm)C(O)ORn, C(O)ORm, and OC(O)Rm, where each Rmand Rnis, independently, H, OH, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. Substituent groups of this paragraph can be unsubstituted or further substituted at a carbon atom with one or more groups independently selected from: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, cyano, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Certain Embodiments The present disclosure provides the following non-limiting embodiments: Embodiment 1. An oligomeric agent comprising a modified oligonucleotide consisting of 12-70 linked subunits linked through internucleoside linking groups, wherein at least one subunit is a nucleoside comprising a modified sugar moiety, and wherein at least one of the internucleoside linking groups has Formula I: wherein independently for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is selected from: a heterocyclyl , a substituted heterocyclyl , a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a fragment of Formula II: ; of Z1, Z2, Z3, Z4, and Z5is N or C, provided that no more than two adjacent Z1, Z2, Z3, Z4, and Z5are N; and R3is absent when Z1is N; R4is absent when Z2is N; R5is absent when Z3is N; R6is absent when Z4is N, and R7is absent when Z5is N; and each of R3-R7, when present, is selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, N(R9R10); R8is H, OH, OR9, aryl, substituted aryl, or N(R10R11); R9is aryl, substituted aryl, or C1-C6alkyl; R10and R11are each, independently, H, C1-C6alkyl, or C(=O)Me; Provided that if each of Z1, Z2, Z3, Z4, and Z5is C: If R5is alkyl, NH2, C(=O)NH(R10), or NHC(=O)Me, then at least one of R3, R4, R6,and R7is other than H; If R4,R5, and R6are H, then neither R3nor R7is NO2; If each of R3-R7is H, then L is not methylene; a fragment of Formula III: ; wherein Y1,Y2,Y3, and Y4are selected from C, N, O or S, provided that if one of Y1,Y2,Y3, and Y4is O or S, then an adjacent Y1,Y2,Y3, or Y4is not O or S; wherein the ring is aromatic; and each of R12-R15is absent or selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, or N(R9R10); with the proviso that Formula III is not 1-methyl-2-imidazole; or a fragment of Formula IV ; R16, R17, R18, and R19are independently selected from H or C1-C6alkyl, or R17and R18join to form a 5- or 6-membered heterocycle; or a fragment of Formula V; ; wherein n is from 0-6; m is from 1-4; q is 0-3; and R20, R21, and R22are independently selected from H or C1-C6alkyl; with the proviso that if n and q are 0, then R21is not CH3. Embodiment 2. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2is selected from an isoxazole, a diazole, an imidazole, or a thiophene. Embodiment 3. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2is dimethoxyphenyl, optionally 3,4-dimethoxyphenyl. Embodiment 4. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2is pyridyl, optionally 3-pyridyl. Embodiment 5. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2is thienyl, optionally 2-thienyl. Embodiment 6. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2is dimethyl isoxazole. Embodiment 7. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2is 1-methyl-4-imidazole. Embodiment 8. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2comprises guanidine. Embodiment 9. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula II. Embodiment 10. The oligomeric agent of embodiment 9, wherein at least one internucleoside linking group of Formula I has Formula VI: agent of embodiment 9, wherein at least one internucleoside linking group of Formula I has Formula VII: Embodiment 12. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula III. Embodiment 13. The oligomeric agent of embodiment 12, wherein at least one internucleoside linking group of Formula I has Formula VIII: Embodiment 14. The oligomeric agent of embodiment 12, wherein at least one internucleoside linking group of Formula I has Formula IX: Embodiment 15. The oligomeric agent of embodiment 12, wherein at least one internucleoside linking group of Formula I has Formula X: Em o men 6. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula IV. Embodiment 17. The oligomeric agent of embodiment 16, wherein at least one internucleoside linking group of Formula I has Formula XI: 18. agent of embodiment 16, wherein at least one internucleoside linking group of Formula I has Formula XII: Embodiment 19. The oligomeric agent of embodiment 16, wherein at least one internucleoside linking group of Formula I has Formula XIII: Embodiment 20. The oligomeric agent of embodiment 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula V. Embodiment 21. The oligomeric agent of embodiment 20, wherein at least one internucleoside linking group of Formula I has Formula XIV: Em o men . e oligomeric agent of embodiment 20, wherein at least one internucleoside linking group of Formula I has Formula XV: oligomeric agent of embodiment 20, wherein at least one internucleoside linking group of Formula I has Formula XVI: Embodiment 24. The oligomeric agent of embodiment 20, wherein at least one internucleoside linking group of Formula I has Formula XVII: Embodiment 25. The oligomeric agent of embodiment 20, wherein at least one internucleoside linking group of Formula I has Formula XVIII: Embodiment 26. The oligomeric agent of any of embodiments 1-25, wherein the modified oligonucleotide comprises a deoxy region consisting of 6-15 linked subunits, wherein each subunit of the deoxy region is a DNA nucleoside; wherein the deoxy region is flanked on the 5’ side by a 5’-region consisting of 1-8 linked 5’-region subunits and on the 3’ side by a 3’-region consisting of 1-8 linked 3’-region subunits; wherein the 3’-most subunit of the 5’-region is a nucleoside that comprises a modified sugar moiety; and the 5’-most subunit of the 3’-region is a nucleoside that comprises a modified sugar moiety. Embodiment 27. The oligomeric agent of embodiment 25, wherein the deoxy region comprises 9, 10, or 11 DNA nucleosides. Embodiment 28. The oligomeric agent of embodiment 26-27, wherein the 5’-region comprises 3-5 linked 5’-region subunits and the 3’-region comprises 3-5 linked 3’-region subunits, wherein each 5’- region subunit and each 3’-region subunit is a nucleoside that comprises a modified sugar moiety. Embodiment 29. The oligomeric agent of embodiment 28, wherein each modified sugar moiety is selected from a non-bicyclic 2’-substituted sugar moiety and a bicyclic sugar moiety. Embodiment 30. The oligomeric agent of any of embodiments 28-29, wherein the non-bicyclic 2’- substituted sugar moiety is a 2’-MOE sugar moiety or a 2’-OMe sugar moiety. Embodiment 31. The oligomeric agent of any of embodiments 28-30, wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 32. The oligomeric agent of any of embodiments 26-31, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides. Embodiment 33. The oligomeric agent of any of embodiments 27-32, wherein the 5’-region and the 3’-region each comprise three cEt sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 34. The oligomeric agent of any of embodiments 27-32, wherein the 5’-region and the 3’-region each comprise five 2’-MOE sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 35. The oligomeric agent of any of embodiments 1-34, wherein the oligonucleotide comprises at least three different internucleoside linking groups. Embodiment 36. An oligomeric agent comprising a modified oligonucleotide consisting of 12-70 linked subunits linked through internucleoside linking groups, wherein at least one subunit is a nucleoside comprising a modified sugar moiety, and wherein at least one of the internucleoside linking groups has Formula I: wherein independently for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is an aryl or substituted aryl; and wherein the modified oligonucleotide comprises a deoxy region consisting of 6-15 linked nucleosides, wherein each nucleoside of the deoxy region is a DNA nucleoside; wherein the deoxy region is flanked on the 5’ side by a 5’-region consisting of 1-8 linked 5’-region nucleosides and on the 3’ side by a 3’-region consisting of 1-8 linked 3’-region nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety; and wherein the oligonucleotide comprises at least three different internucleoside linking groups. Embodiment 37. The oligomeric agent of embodiment 35 or 36, wherein the three different internucleoside linking groups are selected from a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, one or more internucleoside linking groups of Formula I, a mesyl phosphoramidate internucleoside linking group, a phosphorodithioate internucleoside linking group, and a methyl phosphonate internucleoside linking group. Embodiment 38. The oligomeric agent of embodiment 37, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group. Embodiment 39. The oligomeric agent of embodiment 37, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group, and a phosphodiester internucleoside linking group. Embodiment 40. The oligomeric agent of any of embodiments 36-39, wherein the deoxy region comprises 9, 10, or 11 DNA nucleosides. Embodiment 41. The oligomeric agent of embodiment 36-40, wherein the 5’-region comprises 3-5 linked 5’-region subunits and the 3’-region comprises 3-5 linked 3’-region subunits, wherein each 5’- region subunit and each 3’-region subunit is a nucleoside that comprises a modified sugar moiety. Embodiment 42. The oligomeric agent of embodiment 41, wherein each modified sugar moiety is selected from a non-bicyclic 2’-substituted sugar moiety and a bicyclic sugar moiety. Embodiment 43. The oligomeric agent of any of embodiments 41-42, wherein the non-bicyclic 2’- substituted sugar moiety is a 2’-MOE sugar moiety or a 2’-OMe sugar moiety. Embodiment 44. The oligomeric agent of any of embodiments 41-42, wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 45. The oligomeric agent of any of embodiments 36-44, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides. Embodiment 46. The oligomeric agent of any of embodiments 36-46, wherein the 5’-region and the 3’-region each comprise three cEt sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 47. The oligomeric agent of any of embodiments 36-46, wherein the 5’-region and the 3’-region each comprise five 2’-MOE sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 48. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises at least two internucleoside linking groups of Formula I. Embodiment 49. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises at least three internucleoside linking groups of Formula I. Embodiment 50. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises at least four internucleoside linking groups of Formula I. Embodiment 51. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises exactly two internucleoside linking groups of Formula I. Embodiment 52. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises exactly three internucleoside linking groups of Formula I. Embodiment 53. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises exactly four internucleoside linking groups of Formula I. Embodiment 54. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises no more than four internucleoside linking groups of Formula I. Embodiment 55. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises no more than five internucleoside linking groups of Formula I. Embodiment 56. The oligomeric agent of any of embodiments 1-47, wherein the modified oligonucleotide comprises no more than six internucleoside linking groups of Formula I. Embodiment 57. The oligomeric agent of any of embodiments 26-56, wherein the 3’-region comprises at least one internucleoside linking group of Formula I. Embodiment 58. The oligomeric agent of any of embodiments 26-56, wherein the 3’-region comprises exactly one internucleoside linking groups of Formula I. Embodiment 59. The oligomeric agent of any of embodiments 26-56, wherein the 3’-region comprises at least two internucleoside linking groups of Formula I. Embodiment 60. The oligomeric agent of any of embodiments 26-56, wherein the 3’-region comprises exactly two internucleoside linking groups of Formula I. Embodiment 61. The oligomeric agent of any of embodiments 26-56, wherein the 3’-region comprises exactly three internucleoside linking groups of Formula I. Embodiment 62. The oligomeric agent of any of embodiments 26-61, wherein the 5’-region comprises at least one internucleoside linking groups of Formula I. Embodiment 63. The oligomeric agent of any of embodiments 26-61, wherein the 5’-region comprises exactly one internucleoside linking groups of Formula I. Embodiment 64. The oligomeric agent of any of embodiments 26-61, wherein the 5’-region comprises at least two internucleoside linking groups of Formula I. Embodiment 65. The oligomeric agent of any of embodiments 26-61, wherein the 5’-region comprises exactly two internucleoside linking groups of Formula I. Embodiment 66. The oligomeric agent of any of embodiments 26-61, wherein the 5’-region comprises exactly three internucleoside linking groups of Formula I. Embodiment 67. The oligomeric agent of any of embodiments 26-66, wherein each internucleoside linkage within the deoxy region is selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage. Embodiment 68. The oligomeric agent of any of embodiments 26-67, wherein each internucleoside linkage within the 3’-region is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and an internucleoside linking group of Formula I. Embodiment 69. The oligomeric agent of any of embodiments 26-68, wherein each internucleoside linkage within the 5’-region is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and an internucleoside linking group of Formula I. Embodiment 70. The oligomeric agent of any of embodiments 26-69, wherein the 5’-region consists of 3-5 linked nucleosides and has the formula: (Nd1)L1(Nd2)L2[(Nd3)L3]p[(Nd4)L4]q(Nd5)L5; wherein Nd1, Nd2, Nd3, Nd4are independently selected from a 2’-substituted nucleoside, a DNA nucleoside, or a nucleoside comprising a sugar surrogate; Nd5is a 2’-substituted nucleoside or a nucleoside comprising a sugar surrogate; p and q are each 0 or 1; wherein each of L1, L2, L3, L4, and each L5is an internucleoside linkage; and wherein at least two of L1, L2, L3, L4are of Formula I. Embodiment 71. The oligomeric agent of embodiment 70, wherein p and q are 1 and L2, L3, and L4are of Formula I. Embodiment 72. The oligomeric agent of embodiment 70 or 71, wherein L1and L5are phosphorothioate internucleoside linking groups. Embodiment 73. The oligomeric agent of any of embodiments 48-74, wherein each internucleoside linking group of Formula I is the same. Embodiment 74. The oligomeric agent of any of embodiments 1-73, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety selected from a modified furanosyl sugar moiety or a sugar surrogate. Embodiment 75. The oligomeric agent of embodiment 74 wherein the first modified oligonucleotide comprises at least one nucleoside comprising a non-bicyclic modified sugar moiety. Embodiment 76. The oligomeric agent of embodiment 75, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety, a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety. Embodiment 77. The oligomeric agent of embodiment 76, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety. Embodiment 78. The oligomeric agent of embodiment 74, wherein the first modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety. Embodiment 79. The oligomeric agent of embodiment 78, wherein the bicyclic sugar moiety comprises a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'. Embodiment 80. The oligomeric agent of embodiment 78, wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 81. The oligomeric agent of embodiment 74, wherein the first modified oligonucleotide comprises at least one nucleoside comprising a cyclic sugar surrogate. Embodiment 82. The oligomeric agent of embodiment 81, wherein the cyclic sugar surrogate is HNA or FHNA. Embodiment 83. The oligomeric agent of any of embodiments 1-82, wherein each subunit of the modified oligonucleotide is a nucleoside or an abasic subunit. Embodiment 84. The oligomeric agent of embodiment 83, wherein the modified oligonucleotide comprises exactly one abasic subunit and each remaining subunit is a nucleoside. Embodiment 85. The oligomeric agent of any of embodiments 1-84, wherein each subunit of the modified oligonucleotide is a nucleoside. Embodiment 86. The oligomeric agent of any of embodiments 1-85, wherein the modified oligonucleotide comprises at least one modified nucleobase. Embodiment 87. The oligomeric agent of embodiment 86, wherein the modified nucleobase is 5- methylcytosine or hypoxanthine. Embodiment 88. The oligomeric agent of any of embodiments 1-86, wherein each nucleobase of the modified oligonucleotide is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. Embodiment 89. The oligomeric agent of any one of embodiments 1-88, comprising a conjugate group comprising a conjugate linker and a conjugate moiety. Embodiment 90. The oligomeric agent of embodiment 89, wherein the conjugate group comprises a cell-targeting moiety. Embodiment 91. The oligomeric agent of any one of embodiments 89-90, wherein the conjugate group comprises a GalNAc moiety or a conjugate moiety that binds type 1 transferrin receptor (TfR1). Embodiment 92. The oligomeric agent of any of embodiments 1-91, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length region of a target nucleic acid. Embodiment 93. The oligomeric agent of any of embodiments 1-92, wherein the modified oligonucleotide consists of 16, 18, 20, 21, or 23 linked nucleosides. Embodiment 94. The oligomeric agent of any one of embodiments 1-93, wherein the modified oligonucleotide is not part of a duplex. Embodiment 95. The oligomeric agent of any one of embodiments 1-94, comprising a second modified oligonucleotide comprising linked oligomeric subunits, wherein the number of linked oligomeric subunits in the second modified oligonucleotide is 12-70, wherein the second modified oligonucleotide comprises a duplexing region comprising at least 12 nucleosides, and wherein the nucleobase sequence of the duplexing region is at least 80% complementary to the nucleobase sequence of the modified oligonucleotide. Embodiment 96. The oligomeric agent of embodiment 95 wherein the second modified oligonucleotide consists of the duplexing region. Embodiment 97. The oligomeric agent of any one of embodiments 95-96, wherein the second modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. Embodiment 98. The oligomeric agent of embodiment 97, wherein the modified sugar moiety is a modified furanosyl sugar moiety or a sugar surrogate. Embodiment 99. The oligomeric agent of any one of embodiments 95-98, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a non-bicyclic modified sugar moiety. Embodiment 100. The oligomeric agent of embodiment 99, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety, a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety. Embodiment 101. The oligomeric agent of embodiment 99, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety or a 2’-F sugar moiety. Embodiment 102. The oligomeric agent of any one of embodiments 95-101, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety. Embodiment 103. The oligomeric agent of embodiment 102, wherein the bicyclic sugar moiety comprises a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'. Embodiment 104. The oligomeric agent of any one of embodiments 95-103, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a sugar surrogate. Embodiment 105. The oligomeric agent of any of embodiments 95-104, wherein each subunit of the second modified oligonucleotide is a nucleoside or an abasic subunit. Embodiment 106. The oligomeric agent of embodiment 105, wherein the second modified oligonucleotide comprises exactly one abasic subunit and each remaining subunit is a nucleoside. Embodiment 107. The oligomeric agent of any of embodiments 105, wherein each subunit of the second modified oligonucleotide is a nucleoside. Embodiment 108. The oligomeric agent of any of embodiments 95-108, wherein the second modified oligonucleotide comprises at least one modified nucleobase. Embodiment 109. The oligomeric agent of embodiment 108, wherein the modified nucleobase is 5- methylcytosine or hypoxanthine. Embodiment 110. The oligomeric agent of any of embodiments 95-108, wherein each nucleobase of the second modified oligonucleotide is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. Embodiment 111. The oligomeric agent of any of embodiments 95-110, wherein the second modified oligonucleotide consists of 15-21 linked subunits. Embodiment 112. The oligomeric agent of any one of embodiments 95-111, wherein the second modified oligonucleotide is attached to a conjugate group comprising a conjugate linker and a conjugate moiety. Embodiment 113. The oligomeric agent of embodiment 112, wherein the conjugate group comprises a cell-targeting moiety. Embodiment 114. The oligomeric agent of any one of embodiments 112-113, wherein the conjugate group comprises a GalNAc moiety or a conjugate moiety that binds type 1 transferrin receptor (TfR1). Embodiment 115. The oligomeric agent of any of embodiments 95-114, wherein each internucleoside linking group of the second modified oligonucleotide is selected from a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, one or more internucleoside linking groups of Formula I, a mesyl phosphoramidate internucleoside linking group, a phosphorodithioate internucleoside linking group, and a methyl phosphonate internucleoside linking group. Embodiment 116. The oligomeric agent of embodiment 115, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group. Embodiment 117. The oligomeric agent of embodiment 116, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group, and a phosphodiester internucleoside linking group. Embodiment 118. A pharmaceutical composition comprising the oligomeric agent of any of embodiments 1-117 and a pharmaceutically acceptable carrier or diluent. Embodiment 119. A method comprising contacting a cell with the oligomeric agent or pharmaceutical composition of any of embodiments 1-117. Embodiment 120. A method of modulating the amount or activity of a target nucleic acid in a cell, comprising contacting the cell with the oligomeric agent or pharmaceutical composition of any of embodiments 1-119. Embodiment 121. Use of the oligomeric agent or composition of any of embodiments 1-120 for treatment of a disease or condition. Embodiment 122. Use of the oligomeric agent or composition of any of embodiments 1-120 for a preparation of a medicament for treatment of a disease or condition. Embodiment 123. An oligomeric agent comprising a modified oligonucleotide consisting of 12-70 linked subunits linked through internucleoside linking groups, wherein at least one subunit is a nucleoside comprising a modified sugar moiety, and wherein at least one of the internucleoside linking groups has Formula I: wherein independently for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is selected from: a heterocyclyl , a substituted heterocyclyl , a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a cyclopropyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, a fragment of Formula II: ; w ere n each of Z1, Z2, Z3, Z4, and Z5is N or C, provided that no more than two adjacent Z1, Z2, Z3, Z4, and Z5are N; and R3is absent when Z1is N; R4is absent when Z2is N; R5is absent when Z3is N; R6is absent when Z4is N, and R7is absent when Z5is N; and each of R3-R7, when present, is selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, N(R9R10); R8is H, OH, OR9, aryl, substituted aryl, or N(R10R11); R9is aryl, substituted aryl, or C1-C6alkyl; R10and R11are each, independently, H, C1-C6alkyl, or C(=O)Me; Provided that if each of Z1, Z2, Z3, Z4, and Z5is C: If R5is alkyl, NH2, C(=O)NH(R10), or NHC(=O)Me, then at least one of R3, R4, R6,and R7is other than H; If R4,R5, and R6are H, then neither R3nor R7is NO2; If each of R3-R7is H, then L is not methylene; a fragment of Formula III: ; wherein Y1,Y2,Y3, and Y4are selected from C, N, O or S, provided that if one of Y1,Y2,Y3, and Y4is O or S, then an adjacent Y1,Y2,Y3, or Y4is not O or S; wherein the ring is aromatic; and each of R12-R15is absent or selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, or N(R9R10); with the proviso that Formula III is not 1-methyl-2-imidazole; or a fragment of Formula IV ; wherein R16, R17, R18, and R19are independently selected from H or C1-C6alkyl, or R17and R18join to form a 5- or 6-membered heterocycle; or a fragment of Formula V; ; 6; m is from 1-4; q is 0-3; and R20, R21, and R22are independently selected from H or C1-C6alkyl; with the proviso that if n and q are 0, then R21is not CH3. Embodiment 124. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2is selected from an isoxazole, a diazole, an imidazole, or a thiophene. Embodiment 125. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2is dimethoxyphenyl, optionally 3,4-dimethoxyphenyl. Embodiment 126. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2is pyridyl, optionally 3-pyridyl. Embodiment 127. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2is thienyl, optionally 2-thienyl. Embodiment 128. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2is dimethyl isoxazole. Embodiment 129. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2is 1-methyl-4-imidazole. Embodiment 130. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2comprises guanidine. Embodiment 131. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula II. Embodiment 132. The oligomeric agent of embodiment 131, wherein at least one internucleoside linking group of Formula I has Formula VI: Embodiment 133. The oligomeric agent of embodiment 131, wherein at least one internucleoside linking group of Formula I has Formula VII: O H N Embodiment 134. The oligomeric agent of embodiment 131, wherein at least one internucleoside linking group of Formula I has Formula XX: Embodiment 135. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula III. Embodiment 136. The oligomeric agent of embodiment 135, wherein at least one internucleoside linking group of Formula I has Formula VIII: Embodiment 137. The oligomeric agent of embodiment 135, wherein at least one internucleoside linking group of Formula I has Formula IX: Embodiment 138. The oligomeric agent of embodiment 135, wherein at least one internucleoside linking group of Formula I has Formula X: Embodiment 139. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula IV. Embodiment 140. The oligomeric agent of embodiment 139, wherein at least one internucleoside linking group of Formula I has Formula XI: O Embodiment 141. The oligomeric agent of embodiment 139, wherein at least one internucleoside linking group of Formula I has Formula XII: Formula XII Embodiment 142. The oligomeric agent of embodiment 139, wherein at least one internucleoside linking group of Formula I has Formula XIII: Embodiment 143. The oligomeric agent of embodiment 123, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula V. Embodiment 144. The oligomeric agent of embodiment 143, wherein at least one internucleoside linking group of Formula I has Formula XIV: Embodiment 145. The oligomeric agent of embodiment 143, wherein at least one internucleoside linking group of Formula I has Formula XV: Embodiment 146. The oligomeric agent of embodiment 143, wherein at least one internucleoside linking group of Formula I has Formula XVI: Embodiment 147. The oligomeric agent of embodiment 143, wherein at least one internucleoside linking group of Formula I has Formula XVII: Embodiment 148. The oligomeric agent of embodiment 143, wherein at least one internucleoside linking group of Formula I has Formula XVIII: Embodiment 149. The oligomeric agent of embodiment 123, wherein at least one internucleoside linking group of Formula I has Formula XIX: Embodiment 150. The oligomeric agent of embodiment 123, wherein at least one internucleoside linking group of Formula I has Formula XXI: Formula XXI Embodiment 151. The oligomeric agent of embodiment 123, wherein at least one internucleoside linking group of Formula I has Formula XXII: Formula XXII Embodiment 152. The oligomeric agent of any of embodiments 1-151, wherein the modified oligonucleotide comprises a deoxy region consisting of 6-15 linked subunits, wherein each subunit of the deoxy region is a DNA nucleoside; wherein the deoxy region is flanked on the 5’ side by a 5’-region consisting of 1-8 linked 5’-region subunits and on the 3’ side by a 3’-region consisting of 1-8 linked 3’-region subunits; wherein the 3’-most subunit of the 5’-region is a nucleoside that comprises a modified sugar moiety; and the 5’-most subunit of the 3’-region is a nucleoside that comprises a modified sugar moiety. Embodiment 153. The oligomeric agent of embodiment 152, wherein the deoxy region comprises 9, 10, or 11 DNA nucleosides. Embodiment 154. The oligomeric agent of embodiment 152-153, wherein the 5’-region comprises 3-5 linked 5’-region subunits and the 3’-region comprises 3-5 linked 3’-region subunits, wherein each 5’- region subunit and each 3’-region subunit is a nucleoside that comprises a modified sugar moiety. Embodiment 155. The oligomeric agent of embodiment 154, wherein each modified sugar moiety is selected from a non-bicyclic 2’-substituted sugar moiety and a bicyclic sugar moiety. Embodiment 156. The oligomeric agent of embodiment 155, wherein the non-bicyclic 2’-substituted sugar moiety is a 2’-MOE sugar moiety or a 2’-OMe sugar moiety. Embodiment 157. The oligomeric agent of any of embodiments 155-156 wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 158. The oligomeric agent of any of embodiments 152-157, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides. Embodiment 159. The oligomeric agent of any of embodiments 153-158, wherein the 5’-region and the 3’-region each comprise three cEt sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 160. The oligomeric agent of any of embodiments 153-158, wherein the 5’-region and the 3’-region each comprise five 2’-MOE sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 161. The oligomeric agent of any of embodiments 123-160, wherein the oligonucleotide comprises at least three different types of internucleoside linking groups. Embodiment 162. An oligomeric agent comprising a modified oligonucleotide consisting of 12-70 linked subunits linked through internucleoside linking groups, wherein at least one subunit is a nucleoside comprising a modified sugar moiety, and wherein at least one of the internucleoside linking groups has Formula I: wherein independently for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is an aryl or substituted aryl; and wherein the modified oligonucleotide comprises a deoxy region consisting of 6-15 linked nucleosides, wherein each nucleoside of the deoxy region is a DNA nucleoside; wherein the deoxy region is flanked on the 5’ side by a 5’-region consisting of 1-8 linked 5’-region nucleosides and on the 3’ side by a 3’-region consisting of 1-8 linked 3’-region nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety; and wherein the oligonucleotide comprises at least three different internucleoside linking groups. Embodiment 163. The oligomeric agent of embodiment 161 or 162, wherein the three different internucleoside linking groups are selected from a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, one or more internucleoside linking groups of Formula I, a mesyl phosphoramidate internucleoside linking group, a phosphorodithioate internucleoside linking group, and a methyl phosphonate internucleoside linking group. Embodiment 164. The oligomeric agent of embodiment 163, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group. Embodiment 165. The oligomeric agent of embodiment 163, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group, and a phosphodiester internucleoside linking group. Embodiment 166. The oligomeric agent of any of embodiments 162-165, wherein the deoxy region comprises 9, 10, or 11 DNA nucleosides. Embodiment 167. The oligomeric agent of embodiment 162-166, wherein the 5’-region comprises 3-5 linked 5’-region subunits and the 3’-region comprises 3-5 linked 3’-region subunits, wherein each 5’- region subunit and each 3’-region subunit is a nucleoside that comprises a modified sugar moiety. Embodiment 168. The oligomeric agent of embodiment 167, wherein each modified sugar moiety is selected from a non-bicyclic 2’-substituted sugar moiety and a bicyclic sugar moiety. Embodiment 169. The oligomeric agent of embodiment 168, wherein the non-bicyclic 2’-substituted sugar moiety is a 2’-MOE sugar moiety or a 2’-OMe sugar moiety. Embodiment 170. The oligomeric agent of any of embodiments 168-169, wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 171. The oligomeric agent of any of embodiments 162-170, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides. Embodiment 172. The oligomeric agent of any of embodiments 162-171, wherein the 5’-region and the 3’-region each comprise three cEt sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 173. The oligomeric agent of any of embodiments 162-172, wherein the 5’-region and the 3’-region each comprise five 2’-MOE sugar moieties and the central region comprises 10 DNA nucleosides. Embodiment 174. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises at least two internucleoside linking groups of Formula I. Embodiment 175. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises at least three internucleoside linking groups of Formula I. Embodiment 176. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises at least four internucleoside linking groups of Formula I. Embodiment 177. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises exactly two internucleoside linking groups of Formula I. Embodiment 178. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises exactly three internucleoside linking groups of Formula I. Embodiment 179. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises exactly four internucleoside linking groups of Formula I. Embodiment 180. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises no more than four internucleoside linking groups of Formula I. Embodiment 181. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises no more than five internucleoside linking groups of Formula I. Embodiment 182. The oligomeric agent of any of embodiments 123-173, wherein the modified oligonucleotide comprises no more than six internucleoside linking groups of Formula I. Embodiment 183. The oligomeric agent of any of embodiments 152-182, wherein the 3’-region comprises at least one internucleoside linking group of Formula I. Embodiment 184. The oligomeric agent of any of embodiments 152-182, wherein the 3’-region comprises exactly one internucleoside linking groups of Formula I. Embodiment 185. The oligomeric agent of any of embodiments 152-182, wherein the 3’-region comprises at least two internucleoside linking groups of Formula I. Embodiment 186. The oligomeric agent of any of embodiments 152-182, wherein the 3’-region comprises exactly two internucleoside linking groups of Formula I. Embodiment 187. The oligomeric agent of any of embodiments 152-182, wherein the 3’-region comprises exactly three internucleoside linking groups of Formula I. Embodiment 188. The oligomeric agent of any of embodiments 152-187, wherein the 5’-region comprises at least one internucleoside linking groups of Formula I. Embodiment 189. The oligomeric agent of any of embodiments 152-187, wherein the 5’-region comprises exactly one internucleoside linking groups of Formula I. Embodiment 190. The oligomeric agent of any of embodiments 152-187, wherein the 5’-region comprises at least two internucleoside linking groups of Formula I. Embodiment 191. The oligomeric agent of any of embodiments 152-187, wherein the 5’-region comprises exactly two internucleoside linking groups of Formula I. Embodiment 192. The oligomeric agent of any of embodiments 152-187, wherein the 5’-region comprises exactly three internucleoside linking groups of Formula I. Embodiment 193. The oligomeric agent of any of embodiments 152-192, wherein each internucleoside linkage within the deoxy region is selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage. Embodiment 194. The oligomeric agent of any of embodiments 152-193, wherein each internucleoside linkage within the 3’-region is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and an internucleoside linking group of Formula I. Embodiment 195. The oligomeric agent of any of embodiments 152-194, wherein each internucleoside linkage within the 5’-region is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and an internucleoside linking group of Formula I. Embodiment 196. The oligomeric agent of any of embodiments 152-195, wherein the 5’-region consists of 3-5 linked nucleosides and has the formula: (Nd1)L1(Nd2)L2[(Nd3)L3]p[(Nd4)L4]q(Nd5)L5; wherein Nd1, Nd2, Nd3, Nd4are independently selected from a 2’-substituted nucleoside, a DNA nucleoside, or a nucleoside comprising a sugar surrogate; Nd5is a 2’-substituted nucleoside or a nucleoside comprising a sugar surrogate; p and q are each 0 or 1; wherein each of L1, L2, L3, L4, and each L5is an internucleoside linkage; and wherein at least two of L1, L2, L3, L4are of Formula I. Embodiment 197. The oligomeric agent of embodiment 196, wherein p and q are 1 and L2, L3, and L4are of Formula I. Embodiment 198. The oligomeric agent of embodiment 196 or 197, wherein L1and L5are phosphorothioate internucleoside linking groups. Embodiment 199. The oligomeric agent of embodiment 1, wherein the modified oligonucleotide consists of 20 linked nucleosides and has a linkage motif selected from: s[VI][VI][VI]sssssssssssooss, s[VII][VII][VII]sssssssssssooss, s[VIII][VIII][VIII]sssssssssssooss, s[IX][IX][IX]sssssssssssooss, s[X][X][X]sssssssssssooss, s[XI][XI][XI]sssssssssssooss, s[XII][XII][XII]sssssssssssooss, s[XIII][XIII][XIII]sssssssssssooss, s[XIV][XIV][XIV]sssssssssssooss, s[XV][XV][XV]sssssssssssooss, s[XVI][XVI][XVI]sssssssssssooss, [XVII][XVII][XVII]sssssssssssooss, [XVIII][XVIII][XVIII]sssssssssssooss, s[XIX][XIX][XIX]sssssssssssooss s[XX][XX][XX]sssssssssssooss, s[XXI][XXI][XXI]sssssssssssooss s[XXII][XXII][XXII]sssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, each “[VI]” represents a 3,4-dimethoxyphenylsulfonyl phosphoramidate internucleoside linkage (Formula VI), each “[VII]” represents a 3-pyridinesulfonyl phosphoramidate internucleoside linkage (Formula VII), each “[VIII]” represents a 1-methyl-1H-imidazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula VIII), each “[IX]” represents a 2-thiophenesulfonyl phosphoramidate internucleoside linkage (Formula IX), each “[X]” represents a 3,5-dimethylisoxazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula X), each “[XI]” represents a cyclic tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XI), each “[XII]” represents a tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XII), each “[XIII]” represents a guanidinium ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIII), each “[XIV]” represents an amino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIV), each “[XV]” represents a dimethylamino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XV), each “[XVI]” represents a dimethylamino propylsulfonyl phosphoramidate internucleoside linkage (Formula XVI), each “[XIX]” represents a cyclopropylsulfonyl phosphoramidate internucleoside linkage (Formula XX), each “[XX]” represents Formula XX, each “[XXI]” represents Formula XXI, and each “[XXII]” represents Formula XXII. Embodiment 200. The oligomeric agent of any of embodiments 174-199, wherein each internucleoside linking group of Formula I is the same. Embodiment 201. The oligomeric agent of any of embodiments 123-200, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety selected from a modified furanosyl sugar moiety or a sugar surrogate. Embodiment 202. The oligomeric agent of embodiment 201 wherein the first modified oligonucleotide comprises at least one nucleoside comprising a non-bicyclic modified sugar moiety. Embodiment 203. The oligomeric agent of embodiment 202, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety, a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety. Embodiment 204. The oligomeric agent of embodiment 203, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety. Embodiment 205. The oligomeric agent of embodiment 201, wherein the first modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety. Embodiment 206. The oligomeric agent of embodiment 205, wherein the bicyclic sugar moiety comprises a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'. Embodiment 207. The oligomeric agent of embodiment 206, wherein the bicyclic sugar moiety is a cEt sugar moiety. Embodiment 208. The oligomeric agent of embodiment 201, wherein the first modified oligonucleotide comprises at least one nucleoside comprising a cyclic sugar surrogate. Embodiment 209. The oligomeric agent of embodiment 208, wherein the cyclic sugar surrogate is HNA or FHNA. Embodiment 210. The oligomeric agent of any of embodiments 123-209, wherein each subunit of the modified oligonucleotide is a nucleoside or an abasic subunit. Embodiment 211. The oligomeric agent of embodiment 210, wherein the modified oligonucleotide comprises exactly one abasic subunit and each remaining subunit is a nucleoside. Embodiment 212. The oligomeric agent of any of embodiments 123-211, wherein each subunit of the modified oligonucleotide is a nucleoside. Embodiment 213. The oligomeric agent of any of embodiments 123-212, wherein the modified oligonucleotide comprises at least one modified nucleobase. Embodiment 214. The oligomeric agent of embodiment 213, wherein the modified nucleobase is 5- methylcytosine or hypoxanthine. Embodiment 215. The oligomeric agent of any of embodiments 123-213, wherein each nucleobase of the modified oligonucleotide is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. Embodiment 216. The oligomeric agent of any one of embodiments 123-215, comprising a conjugate group comprising a conjugate linker and a conjugate moiety. Embodiment 217. The oligomeric agent of embodiment 216, wherein the conjugate group comprises a cell-targeting moiety. Embodiment 218. The oligomeric agent of any one of embodiments 216-217, wherein the conjugate group comprises a GalNAc moiety or a conjugate moiety that binds type 1 transferrin receptor (TfR1). Embodiment 219. The oligomeric agent of any of embodiments 123-218, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length region of a target nucleic acid. Embodiment 220. The oligomeric agent of any of embodiments 123-219, wherein the modified oligonucleotide consists of 16, 18, 20, 21, or 23 linked nucleosides. Embodiment 221. The oligomeric agent of any one of embodiments 123-220, wherein the modified oligonucleotide is not part of a duplex. Embodiment 222. The oligomeric agent of any one of embodiments 123-221, comprising a second modified oligonucleotide comprising linked oligomeric subunits, wherein the number of linked oligomeric subunits in the second modified oligonucleotide is 12-70, wherein the second modified oligonucleotide comprises a duplexing region comprising at least 12 nucleosides, and wherein the nucleobase sequence of the duplexing region is at least 80% complementary to the nucleobase sequence of the modified oligonucleotide. Embodiment 223. The oligomeric agent of embodiment 222 wherein the second modified oligonucleotide consists of the duplexing region. Embodiment 224. The oligomeric agent of any one of embodiments 222-223, wherein the second modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety. Embodiment 225. The oligomeric agent of embodiment 224, wherein the modified sugar moiety is a modified furanosyl sugar moiety or a sugar surrogate. Embodiment 226. The oligomeric agent of any one of embodiments 222-225, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a non-bicyclic modified sugar moiety. Embodiment 227. The oligomeric agent of embodiment 226, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety, a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety. Embodiment 228. The oligomeric agent of embodiment 226, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety or a 2’-F sugar moiety. Embodiment 229. The oligomeric agent of any one of embodiments 222-228, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety. Embodiment 230. The oligomeric agent of embodiment 229, wherein the bicyclic sugar moiety comprises a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'. Embodiment 231. The oligomeric agent of any one of embodiments 222-230, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a sugar surrogate. Embodiment 232. The oligomeric agent of any of embodiments 222-231, wherein each subunit of the second modified oligonucleotide is a nucleoside or an abasic subunit. Embodiment 233. The oligomeric agent of embodiment 232, wherein the second modified oligonucleotide comprises exactly one abasic subunit and each remaining subunit is a nucleoside. Embodiment 234. The oligomeric agent of any of embodiments 233, wherein each subunit of the second modified oligonucleotide is a nucleoside. Embodiment 235. The oligomeric agent of any of embodiments 232-233, wherein the second modified oligonucleotide comprises at least one modified nucleobase. Embodiment 236. The oligomeric agent of embodiment 235, wherein the modified nucleobase is 5- methylcytosine or hypoxanthine. Embodiment 237. The oligomeric agent of any of embodiments 222-235, wherein each nucleobase of the second modified oligonucleotide is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine. Embodiment 238. The oligomeric agent of any of embodiments 222-237, wherein the second modified oligonucleotide consists of 15-21 linked subunits. Embodiment 239. The oligomeric agent of any one of embodiments 222-238, wherein the second modified oligonucleotide is attached to a conjugate group comprising a conjugate linker and a conjugate moiety. Embodiment 240. The oligomeric agent of embodiment 239, wherein the conjugate group comprises a cell-targeting moiety. Embodiment 241. The oligomeric agent of any one of embodiments 239-240, wherein the conjugate group comprises a GalNAc moiety or a conjugate moiety that binds type 1 transferrin receptor (TfR1). Embodiment 242. The oligomeric agent of any of embodiments 222-241, wherein each internucleoside linking group of the second modified oligonucleotide is selected from a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, one or more internucleoside linking groups of Formula I, a mesyl phosphoramidate internucleoside linking group, a phosphorodithioate internucleoside linking group, and a methyl phosphonate internucleoside linking group. Embodiment 243. The oligomeric agent of embodiment 242, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group. Embodiment 244. The oligomeric agent of embodiment 243, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group, and a phosphodiester internucleoside linking group. Embodiment 245. A pharmaceutical composition comprising the oligomeric agent of any of embodiments 123-244 and a pharmaceutically acceptable carrier or diluent. Embodiment 246. A method comprising contacting a cell with the oligomeric agent or pharmaceutical composition of any of embodiments 123-244. Embodiment 247. A method of modulating the amount or activity of a target nucleic acid in a cell, comprising contacting the cell with the oligomeric agent or pharmaceutical composition of any of embodiments 123-246. Embodiment 248. Use of the oligomeric agent or composition of any of embodiments 123-245 for treatment of a disease or condition. Embodiment 249. Use of the oligomeric agent or composition of any of embodiments 123-245 for a preparation of a medicament for treatment of a disease or condition. Oligomeric Agents Provided herein are oligomeric agents comprising or consisting of at least one modified oligonucleotide having at least one modified internucleoside linking group of Formula I, and optionally one or more additional associated features selected from: (a) one or more additional modified or unmodified oligonucleotides, each of which may be hybridized to or covalently linked to the at least one modified oligonucleotide and / or to each other; (b) one or more conjugate groups, which may be covalently attached to any oligonucleotide of such oligomeric agent; and (c) one or more terminal groups. Oligonucleotides may be unmodified oligonucleotides or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to an unmodified oligonucleotide (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage). In certain embodiments, the modified internucleoside linkage is a modified internucleoside linking group of Formula I. In certain embodiments, compounds described herein are oligomeric agents (including oligomeric agents that are antisense agents or portions thereof) having at least one modified internucleoside linking group of Formula I. I. Modifications A. Modified Oligonucleotide Subunits Modified oligonucleotide subunits include modified nucleosides, modified nucleoside surrogates, modified nucleoside mimics, and abasic subunits. Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or a combination thereof. Modified nucleoside surrogates and modified nucleoside mimics comprise a modified sugar moiety and a nucleobase, which may be a modified nucleobase or an unmodified nucleobase. Abasic subunits comprise an unmodified or modified sugar moiety, but lack a nucleobase. In certain embodiments, modified oligonucleotide subunits comprising the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified antisense and / or sense oligonucleotides described herein. 1. Modified Sugar Moieties Modified sugar moieties include modified furanosyl sugar moieties, cyclic sugar surrogates, acyclic sugar surrogates, and sugar mimics. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic furanosyl sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties, such as furanosyl sugar moieties. In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more substituent groups including, but not limited to, substituents at the 2′, 3′, 4′, and / or 5′ positions, as numbered below: In certain embodiments, the modified furanosyl sugar moiety is a ribosyl sugar moiety that is not an unmodified sugar moiety (i.e., an unmodified RNA or unmodified DNA moiety). In certain embodiments, the modified furanosyl sugar moiety is a xylosyl, lyxosyl, or arabinosyl sugar moiety. In certain embodiments, non-bicyclic modified sugar moieties are 2′-substituted sugar moieties and comprise a substituent group at the 2′-position. Examples of substituent groups suitable for the 2′-position of modified sugar moieties include but are not limited to: F, OCH3(“OMe” or “O-methyl”), and O(CH2)2OCH3(“MOE” or “O-methoxyethyl” or OCH2CH2OCH3). In certain embodiments, 2′-substituent groups are selected from: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, C1-C10alkoxy, substituted C1-C10alkoxy, C1-C10alkyl, substituted C1-C10alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl, O(CH2)2ON(CH3)2(“DMAOE”), or O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”). Synthetic methods for some of these 2′-substituent groups may be found, e.g., in Cook et al., U.S.6,531,584; Cook et al., U.S.5,859,221; and Cook et al., U.S.6,005,087. Certain embodiments of these 2′-substituent groups may be further substituted with one or more substituent groups independently selected from: halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, heterocyclyl, C1-C6alkylene-NH2, C1-C6alkylene-NHRa2, C1-C6alkylene-N(Ra2)2, C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(C1- C4alkyl) S S NHC N C4C NHS N C4alkyl) C2-C6each Ra3is independently hydrogen, OH, C1-C6alkyl, C1-C6haloalkyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, or heterocyclyl. In certain embodiments, a sugar moiety comprises two of the above substituents at the 2′-position. In certain embodiments, a sugar moiety comprises a 2′-fluoro and a second 2′-substituent. In certain embodiments, a 2′-substituted sugar moiety comprises a non-bridging 2′-substituent group selected from: F, NH2, N3, OCF3,OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)- N(Rm)(Rn)), where each Rmand Rnis, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10alkyl. In certain embodiments, a 2′-substituted sugar moiety comprises a non-bridging 2′-substituent group selected from: F, OCF3,OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2O(CH2)2N(CH3)2(“DMAEOE”), and OCH2C(=O)-N(H)CH3(“NMA”). In certain embodiments one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched. In certain embodiments, a 2′-substituted sugar moiety comprises a 2′-substituent group selected from: F, OCH3, and O(CH2)2OCH3. In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by stereochemical configuration. For example, a 2′- deoxyfuranosyl sugar moiety (i.e., 2′-(H)H furanosyl sugar moiety) may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., WO 2020 / 072991. A 2′-modified sugar moiety has an additional stereocenter at the 2′- position relative to a 2′-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible stereochemical configurations. Modified furanosyl sugar moieties described herein are in the β-D- ribosyl stereochemical configuration unless otherwise specified. In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise a substituent group at the 4′-position. Examples of substituent groups suitable for the 4′-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise a substituent group at the 3′-position. Examples of substituent groups suitable for the 3′-position of modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise a substituent group at the 5′-position. Examples of substituent groups suitable for the 5′-position of modified sugar moieties include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkynyl, allyl, and alkyl (e.g., methyl (R or S), ethyl (R or S)). In certain embodiments, non-bicyclic modified furanosyl sugar moieties comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties, such as described in Migawa et al., US 2010 / 0190837, or alternative 2′- and 5′-modified sugar moieties as described in Rajeev et al., US 2013 / 0203836. Certain modified furanosyl sugar moieties are bicyclic sugar moieties and comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include, but are not limited to: 4′-CH2-2′, 4′-(CH2)2-2′, 4′-(CH2)3-2′, 4′-CH2-O-2′ (“LNA”), 4′-CH2-S-2′, 4′-(CH2)2-O-2′ (“ENA”), 4′-CH(CH3)-O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH2-O-CH2-2′, 4′-CH2-N(R)-2′, 4′-CH(CH2OCH3)-O-2′ (“constrained MOE” or “cMOE”) and analogs thereof, 4′-C(CH3)(CH3)-O-2′ and analogs thereof, 4′-CH2-N(OCH3)-2′ and analogs thereof, 4′-CH2-O-N(CH3)-2′, 4′-CH2-C(H)(CH3)-2′, 4′-CH2-C(=CH2)-2′ and analogs thereof, 4′-C(RaRb)- N(R)-O-2′, 4′-C(RaRb)-O-N(R)-2′, 4′-CH2-O-N(R)-2′, and 4′-CH2-N(R)-O-2′, wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12alkyl. Representative U.S. patents that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S.7,427,672; Swayze et al., U.S.7,741,457; Swayze et al., U.S.8,022,193; Seth et al., U.S.8,278,283; Prakash et al., U.S.8,278,425; and Seth et al., U.S.8,278,426. In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, - C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Raand Rbis, independently, halo, cyano, ORa2, NO2, NH2, NHRa2, N(Ra2)2, C1-C6alkyl, C1-C6haloalkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-10aryl, heteroaryl, heterocyclyl, C1-C6alkylene-NH2, C1- C6alkylene-NHRa2, C1-C6alkylene-N(Ra2)2, C(O)Ra3, C(O)ORa3, C(O)NHRa3, C(O)N(C1-C4alkyl)Ra3, SRa3, S(O)2Ra3, S(O)Ra3, NHC(O)Ra3, N(C1-C4alkyl)C(O)Ra3, NHS(O)Ra3, N(C1-C4alkyl)S(O)Ra3, NHS(O)2Ra3, and N(C1-C4alkyl)S(O)2Ra3; each Ra2is independently selected from C1-C6alkyl, C2-C6alkenyl, C2-C6alkynyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, and heterocyclyl; each Ra3is independently hydrogen, OH, C1-C6alkyl, C1-C6haloalkyl, C3-C10cycloalkyl, C6-C10aryl, heteroaryl, or heterocyclyl. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 5′ and the 3′ furanose ring atoms. Examples of such 5′ to 3′ bridging sugar substituents include, but are not limited to, 5′- (CH2)2-3′ (bcDNA), 5′-(CH2)3-3′ (bc4,3DNA), 5′-C(F)=CH-CH2-3′, and 5′-CH2-CHQ-3′, wherein Q is an attachment to an internucleoside linkage. Additional bicyclic sugar moieties are known in the art, see, for example: Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., U.S.8,080,644; Ramasamy et al., U.S.6,525,191; Seth et al., U.S.7,547,684; and Seth et al., U.S.7,666,854. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by stereochemical configuration. For example, an LNA nucleoside (described herein) may be in the α-L configuration or in the β-D configuration. α-L-methyleneoxy (4′-CH2-O-2′) or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al. Nucleic Acids Res. 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown, in certain studies, to increase siRNA stability in serum, and to reduce off-target effects (Elmén, J. et al. Nucleic Acids Res.2005, 33(1), 439-447; Mook, O. R. et al. Mol. Canc. Ther.2007, 6(3), 833-843; Grunweller, A. et al. Nucleic Acids Res.2003, 31(12), 3185- 3193). Herein, general descriptions of bicyclic nucleosides include both stereochemical configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the β-D stereochemical configuration, unless otherwise specified. In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5′-substituted and 4′-2′ bridged sugars). In certain embodiments, modified sugar moieties are sugar surrogates, selected from cyclic sugar surrogates and acyclic sugar surrogates. A cyclic sugar surrogate is represented by Formula A1: D is either H or the attachment point for a heterocyclic nucleobase Bx; J is H, C1-C6alkyl, or C2-C6alkenyl; X is O, S, C(R1R2), N(R3), or X1-X2, wherein X1-X2is C(R1)=C(R2), C(R1R2)-C(R1R2), O-C(R1R2), C(R1R2)- O, S-C(R1R2), C(R1R2)-S, N(R3)-C(R1R2), or C(R1R2)-N(R3); Y is C(R1R2) or Y1-Y2, wherein Y1-Y2is C(R1)=C(R2), or C(R1R2)-C(R1R2); Z is C(G1G2), Z1-Z2, or Z1-Z2-Z3, wherein Z1-Z2is C(G1)=C(R1), C(R1)=C(G1), C(G1G2)-C(R1R2), or C(R1R2)- C(G1G2), and Z1-Z2-Z3is C(G1G2)-C(R1R2)-C(R1R2), C(R1R2)-C(G1G2)-C(R1R2), or C(R1R2)-C(R1R2)- C(G1G2); Q is CH or N; each R1and R2is independently H, OH, C1-C6alkyl, or N(R4); wherein if R1is OH, then R2is not OH; each R3and R4is independently H, C1-C6alkyl, or C(=O)R5, wherein R5is C1-C6alkyl; each G1and G2is independently H, OH, halogen or O-[C(R6)(R7)]q-[(C=O)s-XG]j-R8; wherein if G1is OH, then G2is not OH; each R6and R7is, independently, H, halogen, C1-C6alkyl or substituted C1-C6alkyl; each XGis O, S or N(E1); R8is H, halogen, C1-C6alkyl, substituted C1-C6alkyl, C2-C6alkenyl, substituted C2-C6alkenyl, C2- C6alkynyl, substituted C2-C6alkynyl or N(E2)(E3); E1, E2and E3are each, independently, H, C1-C6alkyl or substituted C1-C6alkyl; m is 0 or 1; p is 0 or 1; q is from 1 to 6; s is 0 or 1; j is 0 or 1; and with the proviso that if X is O, Z is C(G1G2), and Q is CH, then m is 1. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom (X is S, C(R1R2), or N(R3)). In certain such embodiments, such modified sugar moieties also comprise bridging and / or non-bridging substituents as described herein. For example, certain cyclic sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position and / or the 5′ position. In certain embodiments, cyclic sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a cyclic sugar surrogate comprises a six-membered tetrahydropyran (“THP”), where X in Formula A1is O-C(R1R2), p is 1, Q is CH, Z is C(G1G2), and m is 0. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), altritol nucleic acid (G1=OH; G2=H; “ANA”), and fluoro HNA (FHNA): see e.g., Egli, M. et al. J. Am. Chem. Soc.2011, 133(41), 16642-16649; Swayze et al., U.S.8,088,904; and Swayze et al., U.S.8,440,803); FHNA can also be referred to as a F-THP or 3′-fluoro tetrahydropyran or 3′-FHNA). In certain embodiments, cyclic sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having Formula A1, above, wherein X is O, Y and Z are each CH2, and Q is N. In certain embodiments, a morpholino is modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.” In certain embodiments, sugar surrogates are acyclic sugar surrogates and have Formula B1, C1, or D1: Formula B1 Wherein: D is either H or the attachment point for a heterocyclic nucleobase Bx; X is O, S, C(R5R6), N(E1), NC(=O)-(E1); each J1and J2are independently H or C1-C6alkyl; n is 0, 1 or 2; m is 0, 1, or 2; o is 0 or 1; s is 0 or 1; R1is H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, or (CH2)qR8; R2, R3, and R4are each independently H, OH, halogen, C1-C6alkyl, C1-C6alkoxy, C2-C6alkenyl, C2-C6alkynyl, S-CH3, N(CH3)(CH3), OCH2CH2OCH3, O-alkylamino, or (CH2)qR8; E1is H, C1-C6alkyl or substituted C1-C6alkyl; R5and R6are independently H, OH, C1-C6alkyl, or N(R7); wherein if R5is OH, then R6is not OH; R7is H, C1-C6alkyl, or C(=O)R9, wherein R9is C1-C6alkyl; R8is OH, halogen, methoxy, ethoxy, azido, C2-C6alkenyl, or C2-C6alkynyl, and q is 1, 2, or 3. In certain embodiments, acyclic sugar surrogates are the “unlocked” sugar structure of UNA (“unlocked nucleic acid”) nucleosides. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent Publication No.2011 / 0313020. In certain embodiments, acyclic sugar surrogates are the glycerol as found in GNA (“glycol nucleic acid”) nucleosides, having Formula B1wherein n is 1, m and o are 0, s is 1, and J2, R2, and R3are each H, or the butyl as found in acyclic butyl nucleic acid, having Formula B1wherein n is 2, m and o are 0, s is 1, and J2, R2, and R3are each H. In certain embodiments, acyclic sugar surrogates are also known as “C3 spacers” and have Formula B1wherein n and o are 1; m and s are 0, and J1, J2, R1, and R3are each H. In certain embodiments, GNA is (S)-GNA. Further acyclic sugar surrogates include those described in Manoharan et al., U.S.10,913,767; US patent publication US 2021 / 0238595; and PCT publication WO 2023 / 109940. In certain embodiments, modified oligonucleotides include one or more sugar mimic, in which a group of atoms other than a “furanosyl sugar moiety” or a “sugar surrogate” form the portion of a nucleoside corresponding to the β-D-ribosyl sugar in RNA. In certain embodiments, a sugar mimic is a portion of the backbone of a peptide nucleic acid, while the remainder of the backbone of the peptide nucleic acid is an internucleoside linkage. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos.5,539,082; 5,714,331; and 5,719,262. In certain embodiments, the modified oligonucleotide comprises a modification disclosed in U.S. Patent Nos. 10,233,448 or 11,504,391. 2. Modified Nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more subunits in which the sugar moiety is not attached to a nucleobase (e.g., the subunit does not comprise a nucleobase), referred to as an abasic subunit. In certain embodiments, an abasic subunit is a spacer. In certain embodiments, modified oligonucleotides do not comprise abasic subunits. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, an “adenine nucleobase” is an unmodified adenine nucleobase unless otherwise indicated. As used herein, a “thymine nucleobase” is an unmodified thymine nucleobase unless otherwise indicated. As used herein, a “uracil nucleobase” is an unmodified uracil nucleobase unless otherwise indicated. As used herein, a “cytosine nucleobase” is an unmodified cytosine nucleobase unless otherwise indicated. As used herein, a “guanine nucleobase” is an unmodified guanine nucleobase unless otherwise indicated. Unless otherwise indicated, modified adenine has structure (AI): wherein: R1Ais absent or H; R2Ais H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6thioalkyl, or substituted C1- C6thioalkyl, C1-C6alkyloxy, or substituted C1-C6alkyloxy; R6Ais H, N(Ra)(Rb), oxo, acetyl, formyl, or O- phenyl; Y7Ais N and R7Ais absent or is C1-C6alkyl; or Y7Ais C and R7Ais H, C1-C6alkyl, or N(Ra)(Rb); Y8Ais N and R8Ais absent, or Y8Ais C and R8Ais H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare each independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais absent, R2Ais H, and R6Ais NH2(unmodified adenine). Unless otherwise indicated, modified guanine has structure (GI): ; R6Gis oxo and R1Gis H, or R6Gis O-C1-C6alkyl or S-C1-C6alkyl and R1Gis absent; Y7Gis N and R7Gis absent or is C1-C6alkyl; or Y7Gis C and R7Gis H, C1-C6alkyl, or N(Ra)(Rb); Y8Gis N and R8Gis absent, or Y8Gis C and R8Gis H, a halogen, OH, C1-C6alkyl, or substituted C1-C6alkyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where Y7Gis N and R7Gis absent; Y8Gis C, R8Gis H, R2Gis NH2, R6Gis =O, and R1Gis H (unmodified guanine). Unless otherwise indicated, modified thymine or modified uracil has structure (TI): wherein: each X is independently O or S and R5Uis H, OH, halogen, O-C1-C20alkyl, O-C1-C12substituted alkyl, C1-C12alkyl, substituted C1-C12alkyl, C1-C12alkenyl, substituted C1-C12alkenyl, C1-C12alkynyl, or substituted C1-C12alkynyl; wherein if each X is O, R5Uis not H or CH3(unmodified uracil and unmodified thymine, respectively). Unless otherwise indicated, modified cytosine has structure (CI): wherein: X is O or S; R4Cis N(Ra)(Rb); R5Cis H, OH, halogen, O-C1-C12alkyl, O-C1-C12substituted alkyl, C1-C12alkyl , substituted C1-C12alkyl, C1-C12alkenyl, or substituted C1-C12alkenyl; Raand Rbare independently H, C1-C6alkyl, substituted C1-C6alkyl, C1-C6alkenyl, substituted C1-C6alkenyl, C1-C12alkynyl, substituted C1-C12alkynyl, acetyl, or formyl, or together form a 5-7-membered heterocycle; excluding where X is O, R4Cis NH2, and R5Cis H (unmodified cytosine). As used herein, a “5-methyl cytosine nucleobase” is a modified cytosine where X is O, R4Cis NH2, and R5Cis methyl. Hypoxanthine has structure (HI): HIis considered a modified adenine, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais R6Ais oxo. In certain embodiments, modified nucleobases of a modified oligonucleotide are selected from: 5- substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-propynyl (-CºC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6- azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7- deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N- isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N- benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3- diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Englisch, U. et al., Angew. Chem. Int. Ed.1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443. Preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases, are known in the art and can be readily identified in publications, including, without limitation, Rogers et al., U.S.5,134,066; Benner et al., U.S.5,432,272; Matteucci et al., U.S.5,502,177 ; Froehler et al., U.S.5,594,121 ; and Cook et al., U.S.5,681,941. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase selected from modified adenine (A) having a structure represented by structure AI, modified guanine (G) having a structure represented by structure GI, modified thymine (T) or modified uracil (U) having a structure represented by structure TI, and modified cytosine (C) having a structure represented by structure CI. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and 5-methylcytosine (mC). 5-methylcytosine is a modified nucleobase having structure CI, where X is O, R4Cis NH2, and R5Cis CH3. In certain embodiments, each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, 5-methylcytosine (mC), and hypoxanthine. Hypoxanthine is a modified nucleobase having structure HIand is also a modified A represented by structure AI, where Y7Ais N and R7Ais absent; Y8Ais C, R8Ais H, R1Ais H, R2Ais H, and R6Ais oxo. In certain embodiments, there are no modified nucleobases in a modified oligonucleotide and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U. 3. Modified Internucleoside Linkages a. Internucleoside Linkages of Formula I In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I are selected over agents lacking such internucleoside linkages of Formula I because of one or more desirable properties. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have enhanced cellular uptake. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have enhanced affinity for target nucleic acids. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have increased stability in the presence of nucleases. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have enhanced bioavailability. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have enhanced RNase H activity. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have enhanced RNAi activity. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have reduced interactions with certain proteins. In certain embodiments, oligomeric agents and modified oligonucleotides described herein having one or more modified internucleoside linkages of Formula I have increased interactions with certain proteins. In certain embodiments, oligomeric agents (including oligomeric agents that are antisense agents) comprise or consist of a modified oligonucleotide complementary to a target nucleic acid comprising one or more modified internucleoside linkages of Formula I: for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is selected from: a heterocyclyl, a substituted heterocyclyl, a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a cyclopropyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, a fragment of Formula II: ; wherein each of Z1, Z2, Z3, Z4, and Z5is N or C, provided that no more than two adjacent Z1, Z2, Z3, Z4, and Z5are N; and R3is absent when Z1is N; R4is absent when Z2is N; R5is absent when Z3is N; R6is absent when Z4is N, and R7is absent when Z5is N; and each of R3-R7, when present, is selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, N(R9R10); R8is H, OH, OR9, aryl, substituted aryl, or N(R10R11); R9is aryl, substituted aryl, or C1-C6alkyl; R10and R11are each, independently, H, C1-C6alkyl, or C(=O)Me; Provided that if each of Z1, Z2, Z3, Z4, and Z5is C: If R5is alkyl, NH2, C(=O)NH(R10), or NHC(=O)Me, then at least one of R3, R4, R6,and R7is other than H; If R4,R5, and R6are H, then neither R3nor R7is NO2; If each of R3-R7is H, then L is not methylene; a fragment of Formula III: ; wherein Y1,Y2,Y3, and Y4are selected from C, N, O or S, provided that if one of Y1,Y2,Y3, and Y4is O or S, then an adjacent Y1,Y2,Y3, or Y4is not O or S; wherein the ring is aromatic; and each of R12-R15is absent or selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, or N(R9R10); with the proviso that Formula III is not 1-methyl-2-imidazole; a fragment of Formula IV ; wherein R16, R17, R18, and R19are independently selected from H or C1-C6alkyl, or R17and R18join to form a 5- or 6-membered heterocycle; a fragment of Formula V; ; wherein n is from 0-6; m is from 1-4; q is 0-3; and R20, R21, and R22are independently selected from H or C1-C6alkyl; with the proviso that if n and q are 0, then R21is not CH3; In certain embodiments, a linkage of Formula I, wherein R2is a fragment of Formula II, is selected from Formula VI or VII below: In certain embodiments, a linkage of Formula I, wherein R2is a fragment of Formula III, is selected from Formula VIII-X below: In certain embodiments, a linkage of Formula I, wherein R2is a fragment of Formula IV, is selected from Formula XI-XIII below: In certain embodiments, a linkage of Formula I, wherein R2is a fragment of Formula V, is selected from Formula XIV-Formula XVIII below: In certain embodiments, a linkage of Formula I has Formula XIX below: In certain embodiments, a linkage of Formula I has Formula XXI or XXII below: Formula XXI Formula XXII b. Other Internucleoside Linkages In certain embodiments, oligomeric agents and modified oligonucleotides comprise or consist of a modified oligonucleotide complementary to a target nucleic acid comprising one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. linking group In may be linked together using any internucleoside linkage. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include unmodified phosphodiester internucleoside linkages, modified phosphotriesters such as THP phosphotriester and isopropyl phosphotriester, phosphonates such as methylphosphonate, isopropyl phosphonate, isobutyl phosphonate, and phosphonoacetate, phosphoramidates, phosphorothioate, and phosphorodithioate (“HS- P=S”). Representative non-phosphorus containing internucleoside linkages include but are not limited to methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (- O-SiH2-O-); formacetal, thioacetamido (TANA), alt-thioformacetal, glycine amide, and N,N'- dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. In certain embodiments, a modified oligonucleotide comprises a mesyl phosphoramidate linkage having a formula: . linkages having reduced charge (referred to as “neutral internucleoside linkages”) have been described. Such neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2-N(CH3)-O-5′), amide-3 (3′-CH2-C(=O)-N(H)-5′), amide-4 (3′-CH2-N(H)-C(=O)-5′), formacetal (3′-O-CH2-O-5′), methoxypropyl (MOP) (see US 9,926,556), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2component parts. In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage comprising a triazole, alkyne, or cyclic guanidine moiety. In certain embodiments, a modified internucleoside linkage is any of those described in WO2016 / 028187. In certain embodiments, a modified internucleoside linkage comprises the formula: ; for each such internucleoside linking group of a modified oligonucleotide: Z from O, S, Se, C1-4alkyl, NH, BH3; R1and R2are independently selected from H, NR1AR1B, OR3, SR3, S(O)H, S(O)R3, S(O)2H, S(O)2R3, S(O)2NH2, S(O)2NHR3, S(O)2N(R3)2, C1-C10alkyl, C2-C10alkenyl, C2-C10alkynyl, C6-C10aryl; or R wherein each R1A, R1B, R2A, and R2Bis independently selected from H, C1-C10alkyl, C2-C10alkenyl, C2-C10alkynyl, or C6-C10aryl; and R3is selected from C1-C10alkyl, C2-C10alkenyl, C2-C10alkynyl, or C6-C10aryl. In certain embodiments, a modified internucleoside linkage comprises a modified linking group having a formula: ; such internucleoside linking group of a modified oligonucleotide: Z is selected from O, S, Se, C1-4alkyl, NH, BH3; R1, R2, R3, and R4are each independently selected from H, C1-C10alkyl, C2-C10alkenyl, C2-C10alkynyl, or C6-C10aryl; or R1and R3are each C(J)2and together form a 5-membered ring and / or R2and R4are each C(J)2and together form a 5-membered ring; or R1and R2are each C(J)2and together form a 5-membered ring; wherein J is selected from H, C1-C10alkyl, C2-C10alkenyl, C2-C10alkynyl, or C6-C10aryl. In certain embodiments, a modified internucleoside linkage comprises a linking group having a formula: or may be enriched for the (Rp) or (Sp) configuration. In certain embodiments, internucleoside linkages are not 3′-to-5′ internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, where a sugar moiety is linked 3′ to 3′ and / or 5′ to 5′, as shown below: Bx Y is selected from O, S, N(R1)SO2R2, N(R1)(R3), wherein R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; R2is selected from an aryl, a substituted aryl, a heterocyclyl, a substituted heterocyclyl, a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a diazole, a substituted diazole, a C1-C22alkoxy, C1-C22alkyl, C1-C22alkenyl, C1-C22alkynyl, substituted C1-C22alkyl, substituted C1-C22alkenyl substituted C1-C22alkynyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, and a conjugate group; or wherein each is independently of Formula I. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one internucleoside linkage depicted above will be present. In certain embodiments, additional features (e.g., a conjugate group) are attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to either or both ends of an oligonucleotide. In certain embodiments, nucleosides are linked 2′ to 5′ rather than the 3′ to 5′ linkage. Such a linkage between two nucleosides is illustrated below. , nucleobase; X is O or S, and Y is selected from O, S, N(R1)SO R , 2 2N(R1)(R3), wherein R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; R2is selected from an aryl, a substituted aryl, a heterocyclyl, a substituted heterocyclyl, a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a diazole, a substituted diazole, a C1-C22alkoxy, C1-C22alkyl, C1-C22alkenyl, C1-C22alkynyl, substituted C1-C22alkyl, substituted C1-C22alkenyl substituted C1-C22alkynyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, and a conjugate group; or wherein each is independently of Formula I. In certain embodiments, nucleosides can be linked by vicinal 2’, 3’-phosphodiester bonds. In certain such embodiments, the nucleosides are threofuranosyl nucleosides (TNA; see Bala, et al., J Org. Chem.2017, 82:5910-5916). A TNA linkage is shown below. In certain embodiments, a bicyclic sugar moiety may be linked via an atom on the non-furanosyl ring. In certain such embodiments, a bicyclic sugar moiety is linked 7’ to 5’, as shown below in the context of three linked nucleosides: . Additional modified linkages include α,β-D-CNA type linkages and related conformationally- constrained linkages, shown below. Synthesis of such molecules has been described previously (see Dupouy, et al., Angew. Chem. Int. Ed. Engl., 2014, 45: 3623-3627; Borsting, et al. Tetrahedron, 2004, 60:10955- 10966; Ostergaard, et al., ACS Chem. Biol.2014, 9: 1975-1979; Dupouy, et al., Eur. J. Org. Chem.., 2008, 1285-1294; Martinez, et al., PLoS One, 2011, 6:e25510; Dupouy, et al., Eur. J. Org. Chem., 2007, 5256- 5264; Boissonnet, et al., New J. Chem., 2011, 35: 1528-1533.)

[0002] c. Chiral Internucleoside Linkages In certain embodiments, internucleoside linkages have at least one chiral center. In such embodiments, a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates, sulfonyl phosphoramidates, and phosphorothioates. The mesyl phosphoramidate internucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) mesyl phosphoramidates comprise one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase:

[0003] . omprises a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “Bx” indicates a nucleobase: . of Formula I may comprise a chiral center. An internucleoside linkage of Formula I where X is S comprises a chiral center. In certain embodiments, modified oligonucleotides comprise chiral linkages of Formula I, illustrated below. . Modified oligonucleotides comprising internucleoside linkages having a chiral center may be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising internucleoside linkages containing chiral centers in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise one or more phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, populations of modified oligonucleotides comprise one or more mesyl phosphoramidate internucleoside linkages wherein all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate and / or mesyl phosphoramidate linkage. Nonetheless, each individual phosphorothioate and / or mesyl phosphoramidate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and / or mesyl phosphoramidate internucleoside linkages in a particular, independently selected stereochemical configuration (e.g., Rp or Sp). In certain embodiments, the particular phosphorothioate and / or mesyl phosphoramidate linkage is present in the selected configuration in at least 65%, 70%, 80, 90%, or 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka, N., et al. J. Am. Chem. Soc.2003, 125, 8307-8317; Wan, W. B., et al. Nucleic Acids Res. 2014, 42, 13456. and WO 2017 / 015555. As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein one or more particular chiral centers are not stereorandom as defined herein. Chirally enriched stereocenters are intentionally controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration at that center. Populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate internucleoside linkage. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein may be stereorandom or chirally enriched. B. Certain Motifs In certain embodiments, oligomeric agents and modified oligonucleotides described herein comprise or consist of oligonucleotides. Modified oligonucleotides can be described by their motif, e.g. a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more stereo-non-standard nucleosides. In certain embodiments, modified oligonucleotides comprise one or more stereo-standard nucleosides. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns or motifs of sugar moieties, nucleobases, and internucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and / or internucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). 1. Certain Sugar Motifs In certain embodiments, oligomeric agents and modified oligonucleotides described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and / or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include without limitation any of the sugar modifications discussed herein. In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each subunit of the deoxy region is a deoxynucleoside. In certain embodiments, each subunit of the deoxy region is a 2′-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 or 7-12 linked subunits. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked subunits. In certain embodiments, at least one subunit within the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one subunit within the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three subunits within the deoxy region comprise a modified sugar moiety. In certain embodiments, at least one subunit of the deoxy region comprises a 2′-OMe sugar moiety. In certain embodiments, exactly one subunit of the deoxy region comprises a 2′-OMe sugar moiety. In certain embodiments, at least one subunit of the deoxy region is a spacer. In certain embodiments, at least one subunit of the deoxy region is an abasic cyclic sugar surrogate. In certain embodiments, the deoxy region is flanked on the 5′-side by a 5′-region consisting of linked 5′-region subunits and on the 3′-side by a 3′- region consisting of linked 3′-region subunits, wherein the 3′-most subunits of the 5′-region comprises a modified sugar moiety and the 5′-most subunits of the 3′-region comprises a modified sugar moiety. The three regions (the 5′-region, the deoxy region, and the 3′-region) form a contiguous sequence of oligonucleotide subunits. In certain embodiments, the sugar moiety of the 3′-most subunit of the 5′-region and the sugar moiety of the 5′-most subunit of the 3′-region each differ from the sugar moiety of the respective adjacent subunit of the deoxy region, thus defining the boundary between the 5′-region, the deoxy region, and the 3′-region. In certain embodiments, each subunit of the 5′-region and each subunit of the 3′-region comprises a modified sugar moiety. In certain embodiments, at least two subunits of the 5′-region and at least two subunits of the 3′-region comprises a modified sugar moiety. In certain embodiments, at least three subunits of the 5′-region and at least three subunits of the 3′-region comprises a modified sugar moiety. In certain embodiments, at least four subunits of the 5′-region and each subunit of the 3′-region comprises a modified sugar moiety. In certain embodiments, each of the subunits of the 5′-region comprise the same modified sugar moiety. In certain embodiments, the subunits of the 5′-region comprise two or more different modified sugar moieties. In certain embodiments, each of the subunits of the 3′-region comprise the same modified sugar moiety. In certain embodiments, the subunits of the 3′-region comprise two or more different modified sugar moieties. In certain embodiments, each subunit of the 3’-region and the 5’-region is a nucleoside comprising a modified sugar moiety. In certain embodiments, the 5′-region and the 3′-region of a modified oligonucleotide each consist of 1-8 subunits. In certain embodiments, the 5′-region consists of 1-7 subunits. In certain embodiments, the 5′- region consists of 1-6, 2-6, 3-6, or 3-5 subunits. In certain embodiments, the 5′-region consists of 1, 2, 3, 4, 5, 6, 7, or 8 subunits. In certain embodiments, the 3′-region consists of 1-7 subunits. In certain embodiments, the 3′-region consist of 1-6, 2-6, 3-6, or 3-5 subunits. In certain embodiments, the 3′-region consists of 1, 2, 3, 4, 5, 6, 7, or 8 subunits. In certain embodiments, the deoxy region consists of 8, 9, 10, 11, or 12 subunits, with each subunits comprising a 2′-β-D-deoxyribosyl sugar moiety. In certain embodiments, such modified oligonucleotides are referred to as “gapmers”. Herein, the lengths (number of subunits) of the 5′-region, the deoxy region, and the 3′-region of an oligonucleotide may be provided using the notation [# of subunits in the 5′-region] – [# of subunits in the deoxy region] – [# of subunits in the 3′-region]. Thus, a 3-10-3 gapmer consists of 3 linked subunits in each wing and 10 linked subunits in the gap. Where such nomenclature is followed by a specific modification, the 5′-region and the 3′-region consist of nucleosides comprising that modification for each sugar moiety, and the gap subunits are nucleosides comprising 2′-β-D-deoxyribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2′-MOE nucleosides in the 5′-region (or “wing”), 10 linked 2′-β-D- deoxynucleosides in the deoxy region (or “gap”), and 5 linked 2′-MOE nucleosides in the 3′-region (or “wing”). A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5′- region, 8 linked 2′-β-D-deoxynucleosides in the deoxy region, and 5 linked nucleosides comprising a modified sugar moiety in the 3′-region. A 5-8-5 mixed gapmer has at least two differently modified sugar moieties in the 5′- and / or the 3′-regions. In certain embodiments, each subunit of a modified oligonucleotide, or portion thereof, is a nucleoside comprising a 2’-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate, or a 2’- deoxyribosyl sugar moiety. In certain embodiments, the 2’-substituted sugar moiety is selected from a 2’- MOE sugar moiety, a 2’-NMA sugar moiety, a 2’-OMe sugar moiety, and a 2’-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, PNA, THP, and F-HNA. In certain embodiments, modified oligonucleotides comprise at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 subunits comprising a modified sugar moiety. In certain embodiments, the modified sugar moiety is selected independently from a 2’-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2’-substituted sugar moiety is selected from a 2’-MOE sugar moiety, a 2’-NMA sugar moiety, a 2’-OMe sugar moiety, and a 2’-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA. In certain embodiments, each subunit of a modified oligonucleotide is a nucleoside comprising a modified sugar moiety (“fully modified oligonucleotide”). In certain embodiments, each subunit of a fully modified oligonucleotide is a nucleoside comprising a 2’-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2’-substituted sugar moiety is selected from a 2’-MOE sugar moiety, a 2’-NMA sugar moiety, a 2’-OMe sugar moiety, and a 2’-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA. In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same modified sugar moiety (“uniformly modified sugar motif”). In certain embodiments, the uniformly modified sugar motif is 7 to 20 nucleosides in length. In certain embodiments, each nucleoside of the uniformly modified sugar motif comprises a 2’-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2’-substituted sugar moiety is selected from a 2’-MOE sugar moiety, a 2’-NMA sugar moiety, a 2’-OMe sugar moiety, and a 2’-F sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from morpholino, modified morpholino, THP, and F-HNA. In certain embodiments, modified oligonucleotides having at least one fully modified sugar motif may also comprise at least 1, at least 2, at least 3, or at least 42’-deoxyribonucleosides. 2. Certain Nucleobase Motifs In certain embodiments oligomeric agents and modified oligonucleotides described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5’-end of the oligonucleotide. In certain embodiments, one nucleoside comprising a modified nucleobase is in the central region of a modified oligonucleotide. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-β-D- deoxyribosyl moiety. In certain such embodiments, the modified nucleobase is selected from: 5-methyl cytosine, 2-thiopyrimidine, 2-thiothymine, 6-methyladenine, inosine, pseudouracil, or 5-propynepyrimidine. 3. Certain Internucleoside Linkage Motifs In certain embodiments, oligomeric agents and modified oligonucleotides described herein comprise or consist of oligonucleotides. In certain embodiments, oligonucleotides comprise modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, the modified internucleoside linkages are of Formula I. In certain embodiments, some or all of the internucleoside linkages in the 5’-region and 3’-region are modified internucleoside linkages of Formula I. In certain embodiments, the terminal internucleoside linkages are modified internucleoside linkages of Formula I. In certain embodiments, the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one of the 5’-region and the 3’- region, and at least one modified internucleoside linkage of Formula I. In certain embodiments, the internucleoside linkage motif comprises at least one phosphorothioate internucleoside linkage in at least one of the 5’-region and the 3’-region, and at least one modified internucleoside linkage of Formula I. In certain embodiments, modified oligonucleotides comprise at least one region having the formula: (Ng1)L1(Ng2)L2(Ng3)L3, wherein each Ngis a nucleoside comprising furanosyl sugar moiety or a sugar surrogate and each L is an internucleoside linking group; wherein each of L1, L2, and L3is a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, or an internucleoside linking group of Formula I: wherein each of L1L2and L3is a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, or an internucleoside linking group of Formula I: wherein at least one of L1, L2, and L3an internucleoside linking group of Formula I; and at least one of L1, L2, and L3is a phosphorothioate or a phosphodiester internucleoside linking group, wherein independently for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is selected from: a heterocyclyl , a substituted heterocyclyl , a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a cyclopropyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, a fragment of Formula II: ; wherein each of Z1, Z2, Z3, Z4, and Z5is N or C, provided that no more than two adjacent Z1, Z2, Z3, Z4, and Z5are N; and R3is absent when Z1is N; R4is absent when Z2is N; R5is absent when Z3is N; R6is absent when Z4is N, and R7is absent when Z5is N; and each of R3-R7, when present, is selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, N(R9R10); R8is H, OH, OR9, aryl, substituted aryl, or N(R10R11); R9is aryl, substituted aryl, or C1-C6alkyl; R10and R11are each, independently, H, C1-C6alkyl, or C(=O)Me; Provided that if each of Z1, Z2, Z3, Z4, and Z5is C: If R5is alkyl, NH2, C(=O)NH(R10), or NHC(=O)Me, then at least one of R3, R4, R6,and R7is other than H; If R4,R5, and R6are H, then neither R3nor R7is NO2; If each of R3-R7is H, then L is not methylene; a fragment of Formula III: ; wherein Y1,Y2,Y3, and Y4are selected from C, N, O or S, provided that if one of Y1,Y2,Y3, and Y4is O or S, then an adjacent Y1,Y2,Y3, or Y4is not O or S; wherein the ring is aromatic; and each of R12-R15is absent or selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, or N(R9R10); with the proviso that Formula III is not 1-methyl-2-imidazole; or a fragment of Formula IV ; wherein R16, R17, R18, and R19are independently selected from H or C1-C6alkyl, or R17and R18join to form a 5- or 6-membered heterocycle; or a fragment of Formula V; ; wherein n is from 0-6; m is from 1-4; q is 0-3; and R20, R21, and R22are independently selected from H or C1-C6alkyl; with the proviso that if n and q are 0, then R21is not CH3. In certain embodiments, L is alkyl. In certain embodiments, L is ethyl. In certain embodiments, X is O. In certain embodiments, R1is H. In certain embodiments, each internucleoside linkage within the 3’-region of a modified oligonucleotide is of Formula I. In certain embodiments, one internucleoside linkage within the 3’-region of a modified oligonucleotide is of Formula I. In certain embodiments, two internucleoside linkages within the 3’-region of a modified oligonucleotide are of Formula I. In certain embodiments, three internucleoside linkages within the 3’-region of a modified oligonucleotide are of Formula I. In certain embodiments, four internucleoside linkages within the 3’-region of a modified oligonucleotide are of Formula I. In certain embodiments, each internucleoside linkage within the 3’-region of a modified oligonucleotide is of Formula I. In certain embodiments, one internucleoside linkage within the 3’-region of a modified oligonucleotide and the internucleoside linkage at the junction of the 3’-region and the central region of the modified oligonucleotide are of Formula I. In certain embodiments, two internucleoside linkages within the 3’-region of a modified oligonucleotide and the internucleoside linkage at the junction of the 3’-region and the central region of the modified oligonucleotide are of Formula I. In certain embodiments, three internucleoside linkages within the 3’-region of a modified oligonucleotide and the internucleoside linkage at the junction of the 3’-region and the central region of the modified oligonucleotide are of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of Formulas VI-XXII. In certain embodiments, the internucleoside linkages within the 5’-region of a modified oligonucleotide are all modified with internucleoside linking groups of Formula I. In certain embodiments, one internucleoside linkage within the 5’-region of a modified oligonucleotide is of Formula I. In certain embodiments, two internucleoside linkages within the 5’-region of a modified oligonucleotide are of Formula I. In certain embodiments, three internucleoside linkages within the 5’-region of a modified oligonucleotide are of Formula I. In certain embodiments, four internucleoside linkages within the 5’-region of a modified oligonucleotide are of Formula I. In certain embodiments, each internucleoside linkage within the 5’-region of a modified oligonucleotide is of Formula I. In certain embodiments, one internucleoside linkage within the 5’-region of a modified oligonucleotide and the internucleoside linkage at the junction of the 5’-region and the central region of the modified oligonucleotide are of Formula I. In certain embodiments, two internucleoside linkages within the 5’-region of a modified oligonucleotide and the internucleoside linkage at the junction of the 5’-region and the central region of the modified oligonucleotide are of Formula I. In certain embodiments, three internucleoside linkages within the 5’-region of a modified oligonucleotide and the internucleoside linkage at the junction of the 5’-region and the central region of the modified oligonucleotide are of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage having any of Formulas VI-XXII. In certain embodiments, the internucleoside linkages within the central region of a modified oligonucleotide are all of Formula I. In certain embodiments, one internucleoside linkage within the central region of a modified oligonucleotide is of Formula I. In certain embodiments, two internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, three internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, four internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, five internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, six internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, seven internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, eight internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, nine internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, ten internucleoside linkages within the central region of a modified oligonucleotide are of Formula I. In certain embodiments, each internucleoside linkage within the central region of a modified oligonucleotide is of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of Formulas VI-XXII. In certain embodiments, the internucleoside linking group linking the 1stand 2ndnucleosides of the 3’ region as counted from the 5’-end of the 3’-region is of Formula I. In certain embodiments, the internucleoside linking group linking the 2ndand 3rdnucleosides of the 3’-region as counted from the 5’-end of the 3’-region is of Formula I. In certain embodiments, the internucleoside linking group linking the 3rdand 4thnucleosides of the 3’-region as counted from the 5’-end of the 3’-region is of Formula I. In certain embodiments, the internucleoside linking group linking the 4thand 5thnucleosides of the 3’-region as counted from the 5’-end of the 3’-region is of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of Formulas VI-XXII. In certain embodiments, the internucleoside linking group linking the 1stand 2ndnucleosides of the 5’ region as counted from the 5’-end of the oligonucleotide is of Formula I. In certain embodiments, the internucleoside linking group linking the 2ndand 3rdnucleosides of the 5’-region as counted from the 5’-end of the 5’-region is of Formula I. In certain embodiments, the internucleoside linking group linking the 3rdand 4thnucleosides of the 5’-region as counted from the 5’-end of the oligonucleotide is of Formula I. In certain embodiments, the internucleoside linking group linking the 4thand 5thnucleosides of the 5’-region as counted from the 5’-end of the oligonucleotide is of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of Formulas VI-XXII. In certain embodiments, the 5’-region consists of 3-5 linked nucleosides, and has the formula: (Nd1)L1(Nd2)L2[(Nd3)L3]p[(Nd4)L4]q(Nd5)L5; wherein Nd1, Nd2, Nd3, Nd4are independently selected from a 2’-substituted nucleoside, a DNA nucleoside, or a nucleoside comprising a sugar surrogate; Nd5is a 2’-substituted nucleoside or a nucleoside comprising a sugar surrogate; p and q are each 0 or 1; wherein each of L1, L2, L3, L4, and each L5is an internucleoside linkage; wherein at least two of L1, L2, L3, L4is an internucleoside linkage of Formula I. In certain such embodiments, L1and L5are each a phosphorothioate internucleoside linkage and each of L2, L3, and L4are selected between a phosphodiester internucleoside linkage and an internucleoside linkage of Formula I. In certain such embodiments, L1and L5are each a phosphorothioate internucleoside linkage and each of L2, L3, and L4is an internucleoside linkage of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of any of Formulas VI-XXII. In certain embodiments, the oligonucleotide comprises at least one block of at least 3 consecutive internucleoside linking groups of Formula I. In certain such embodiments, at least one such block is located at the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located at the 5’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 5’ end of the oligonucleotide. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of any of Formulas VI-XXII. In certain such embodiments, some or all of the internucleoside linkages in the 5’-region and 3’- region are unmodified phosphate linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one of the 5’-region and the 3’-region, wherein the at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are of Formula I or phosphorothioate internucleoside linkages. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of any of Formulas VI-XXII. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, a (Sp) phosphorothioate, and a (Rp) phosphorothioate. In certain embodiments, the internucleoside linkages within the central region of a modified oligonucleotide are all modified. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the 5’-region and 3’-region are (Sp) phosphorothioates, and the central region comprises at least one Sp, Sp, Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such internucleoside linkage motifs. In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3’ end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3’ end of the oligonucleotide. In certain embodiments, oligonucleotides comprise one or more methylphosphonate linkages. In certain embodiments, modified oligonucleotides comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosphonate linkages. In certain embodiments, one methylphosphonate linkage is in the central region of an oligonucleotide. In certain embodiments, the oligonucleotide comprises one or more mesyl phosphoramidate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 2 mesyl phosphoramidate internucleoside linkages. In certain embodiments, the oligonucleotide comprises 2, 3, 4, or 5 mesyl phosphoramidate internucleoside linkages. In certain embodiments, one or more mesyl phosphoramidate internucleoside linkages is in the central region of an oligonucleotide. In certain embodiments, it is desirable to arrange the number of modified internucleoside linking groups of Formula I, mesyl phosphoramidate internucleoside linkages, phosphorothioate internucleoside linkages, and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of modified internucleoside linking groups of Formula I, mesyl phosphoramidate internucleoside linkages, phosphorothioate internucleoside linkages, and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of modified internucleoside linking groups of Formula I and / or mesyl phosphoramidate internucleoside linkages and / or phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of modified internucleoside linking groups of Formula I and / or mesyl phosphoramidate internucleoside linkages and / or phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance. In certain embodiments, the number of phosphodiester internucleoside linkages may be decreased by replacing phosphodiester internucleoside linkages with modified internucleoside linking groups of Formula I. In certain embodiments, decreasing the number of phosphodiester internucleoside linkages and increasing the number of modified internucleoside linking groups of Formula I increases the therapeutic index of a modified oligonucleotide or oligomeric agent. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased by replacing phosphorothioate internucleoside linkages with modified internucleoside linking groups of Formula I. In certain embodiments, decreasing the number of phosphorothioate internucleoside linkages and increasing the number of modified internucleoside linking groups of Formula I increases the therapeutic index of a modified oligonucleotide or oligomeric agent. In certain embodiments, an oligomeric agent is a duplex comprising an antisense oligonucleotide and a sense oligonucleotide. In certain embodiments, an oligomeric agent is a double-stranded RNAi agent comprising an RNAi antisense modified oligonucleotide and an RNAi sense modified oligonucleotide, wherein one or both of the RNAi antisense modified oligonucleotide and / or RNAi sense oligomeric agent have one or more modified internucleoside linking groups of Formula I. In certain embodiments, the RNAi antisense modified oligonucleotide comprises at least two, at least three, at least four, at least five, or at least six modified internucleoside linking groups of Formula I. In certain embodiments, the RNAi sense modified oligonucleotide comprises at least two, at least three, at least four, at least five, or at least six modified internucleoside linking groups of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage having any of Formulas VI-XXII. In certain embodiments, the RNAi antisense modified oligonucleotide comprises exactly one modified internucleoside linking group of Formula I. In certain embodiments, the RNAi antisense modified oligonucleotide comprises exactly two, three four, five, or six modified internucleoside linking groups of Formula I. In certain embodiments, the RNAi antisense modified oligonucleotide comprises at least 6, at least 7, at least 8, or at least 9 modified internucleoside linking groups of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage having any of Formulas VI-XXII. In certain embodiments, the RNAi sense modified oligonucleotide comprises exactly one modified internucleoside linking group of Formula I. In certain embodiments, the RNAi sense modified oligonucleotide comprises exactly two, three, four, five, or six modified internucleoside linking groups of Formula I. In certain embodiments, the RNAi sense modified oligonucleotide comprises at least 6, at least 7, at least 8, or at least 9 modified internucleoside linking groups of Formula I. In certain embodiments, each internucleoside linking group of the RNAi sense modified oligonucleotide is a modified internucleoside linking groups of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of any of Formulas VI-XXII. In certain embodiments, at least one of the five 3’-most internucleoside linking groups of the RNAi antisense modified oligonucleotide is a modified internucleoside linking group of Formula I. In certain embodiments, at least two of the five 3’-most internucleoside linking groups of the RNAi antisense modified oligonucleotide are modified internucleoside linking groups of Formula I. In certain embodiments, at least one nucleoside of the seed region of the RNAi antisense modified oligonucleotide is a modified internucleoside linking group of Formula I. In certain embodiments, at least one nucleoside within nucleosides 2 to 8 of the RNAi antisense modified oligonucleotide, counting from the 5’ end, is a modified internucleoside linking group of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of any of Formulas VI-XXII. In certain embodiments, an oligomeric agent (including an oligomeric agent that is an antisense agent or a portion thereof) is a single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide. In certain embodiments, the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide comprises at least two, at least three, at least four, at least five, or at least six modified internucleoside linking groups of Formula I. In certain embodiments, the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide comprises exactly one, two, three, four, five, or six modified internucleoside linking groups of Formula I. In certain embodiments, the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide comprises at least 6, at least 7, at least 8, or at least 9 modified internucleoside linking groups of Formula I. In certain embodiments, each internucleoside linking group of the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide is a modified internucleoside linking groups of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage of any of Formulas VI-XXII. In certain embodiments, at least one of the first 5 internucleoside linkages from the 5’ end of the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide is a modified internucleoside linking group of Formula I. In certain embodiments, at least one of the five 3’-most internucleoside linking groups from the 3’ end of the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide is a modified internucleoside linking group of Formula I. In certain embodiments, at least one nucleoside of the seed region of the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide is a modified internucleoside linking group of Formula I. In certain embodiments, at least one nucleoside within nucleosides 2 to 8 of the single-stranded RNAi compound or RNAi agent comprising an RNAi antisense modified oligonucleotide, counting from the 5’ end, is a modified internucleoside linking group of Formula I. In certain such embodiments, each internucleoside linkage of Formula I is selected from an internucleoside linkage having any of VI-XXII. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif (from 5′ to 3′) of: s[TIQSPA][TIQSPA][TIQSPA]sssssssssssooss, s[VI][VI][VI]sssssssssssooss, s[VII][VII][VII]sssssssssssooss, s[VIII][VIII][VIII]sssssssssssooss, s[IX][IX][IX]sssssssssssooss, s[X][X][X]sssssssssssooss, s[XI][XI][XI]sssssssssssooss, s[XII][XII][XII]sssssssssssooss, s[XIII][XIII][XIII]sssssssssssooss, s[XIV][XIV][XIV]sssssssssssooss, s[XV][XV][XV]sssssssssssooss, s[XVI][XVI][XVI]sssssssssssooss, [XVII][XVII][XVII]sssssssssssooss, [XVIII][XVIII][XVIII]sssssssssssooss, s[XIX][XIX][XIX]sssssssssssooss s[XX][XX][XX]sssssssssssooss s[XXI][XXI][XXI]sssssssssssooss s[XXII][XXII][XXII]sssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, each “z” represents a mesyl phosphoramidate internucleoside linkage, each “[TIQSPA]” represents a 1,2,3,4- tetrahydroisoquinoline-7-sulfonyl phosphoramidate internucleoside linkage, each “[VI]” represents a 3,4- dimethoxyphenylsulfonyl phosphoramidate internucleoside linkage (Formula VI), each “[VII]” represents a 3-pyridinesulfonyl phosphoramidate internucleoside linkage (Formula VII), each “[VIII]” represents a 1- methyl-1H-imidazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula VIII), each “[IX]” represents a 2-thiophenesulfonyl phosphoramidate internucleoside linkage (Formula IX), each “[X]” represents a 3,5-dimethylisoxazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula X), each “[XI]” represents a cyclic tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XI), each “[XII]” represents a tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XII), each “[XIII]” represents a guanidinium ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIII), each “[XIV]” represents an amino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIV), each “[XV]” represents a dimethylamino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XV), each “[XVI]” represents a dimethylamino propylsulfonyl phosphoramidate internucleoside linkage (Formula XVI), each “[XIX]” represents a cyclopropylsulfonyl phosphoramidate internucleoside linkage (Formula XX), each “[XX]” represents Formula XX, each “[XXI]” represents Formula XXI, and each “[XXII]” represents Formula XXII, as shown in the figures below. Formula X Formula XI Formula XII Formula XIII Formula XXII C. Lengths It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. Proc. Natl. Acad. Sci. USA 1992, 89:7305-7309, a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches. In certain embodiments, oligonucleotides (including modified oligonucleotides) have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked oligonucleotide subunits, where X represents the fewest number of subunits in the range and Y represents the largest number subunits in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X≤ Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked subunits. In certain embodiments, modified oligonucleotides consist of 16 linked subunits. In certain embodiments, modified oligonucleotides consist of 17 linked subunits. In certain embodiments, modified oligonucleotides consist of 18 linked subunits. In certain embodiments, modified oligonucleotides consist of 19 linked subunits. In certain embodiments, modified oligonucleotides consist of 20 linked subunits. In certain embodiments, modified oligonucleotides consist of 21 linked subunits. In certain embodiments, modified oligonucleotides consist of 22 linked subunits. In certain embodiments, modified oligonucleotides consist of 23 linked subunits. In certain embodiments, the modified oligonucleotides have no more than 1 to 3 mismatches to a target nucleic acid. In certain embodiments, the modified oligonucleotides have no more than 1 to 3 abasic subunits. In certain embodiments, each subunit of a modified oligonucleotide is a nucleoside. In certain embodiments, antisense oligonucleotides consist of 12-30 linked subunits. In certain embodiments, antisense oligonucleotides consist of 17-25 linked subunits. In certain embodiments, antisense oligonucleotides consist of 17-23 linked subunits. In certain embodiments, antisense oligonucleotides consist of 17-21 linked subunits. In certain embodiments, antisense oligonucleotides consist of 18-30 linked subunits. In certain embodiments, antisense oligonucleotides consist of 20-30 linked subunits. In certain embodiments, antisense oligonucleotides consist of 21-30 linked subunits. In certain embodiments, antisense oligonucleotides consist of 23-30 linked subunits. In certain embodiments, antisense oligonucleotides consist of 18-25 linked subunits. In certain embodiments, antisense oligonucleotides consist of 20-22 linked subunits. In certain embodiments, antisense oligonucleotides consist of 21-23 linked subunits. In certain embodiments, antisense oligonucleotides consist of 23-24 linked subunits. In certain embodiments, antisense oligonucleotides consist of 20 linked subunits. In certain embodiments, antisense oligonucleotides consist of 21 linked subunits. In certain embodiments, antisense oligonucleotides consist of 22 linked subunits. In certain embodiments, antisense oligonucleotides consist of 23 linked subunits. In certain embodiments, each subunit is a nucleoside. In certain embodiments, sense oligonucleotides consist of 12-30 linked subunits. In certain embodiments, sense oligonucleotides consist of 16-25 linked subunits. In certain embodiments, sense oligonucleotides consist of 16-23 linked subunits. In certain embodiments, sense oligonucleotides consist of 16-21 linked subunits. In certain embodiments, sense oligonucleotides consist of 16-30 linked subunits. In certain embodiments, sense oligonucleotides consist of 18-30 linked subunits. In certain embodiments, sense oligonucleotides consist of 19-30 linked subunits. In certain embodiments, sense oligonucleotides consist of 16-25 linked subunits. In certain embodiments, sense oligonucleotides consist of 18-25 linked subunits. In certain embodiments, sense oligonucleotides consist of 18-20 linked subunits. In certain embodiments, sense oligonucleotides consist of 19-21 linked subunits. In certain embodiments, sense oligonucleotides consist of 18 linked subunits. In certain embodiments, sense oligonucleotides consist of 19 linked subunits. In certain embodiments, sense oligonucleotides consist of 20 linked subunits. In certain embodiments, sense oligonucleotides consist of 21 linked subunits. In certain embodiments, each subunit is a nucleoside. D. Oligomeric Agent Modifications Provided oligomeric agents comprise one or more modifications (e.g., a modified sugar moiety, a modified nucleobase, a modified internucleoside linkage, and / or combinations thereof), incorporated into a modified oligonucleotide. In certain embodiments, a modified oligonucleotide is characterized by modification motif(s) and overall length. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each internucleoside linkage of a modified oligonucleotide having one or more modified sugar moiety and / or sugar motif, independently, is modified or unmodified and may or may not follow the modification pattern of the sugar modifications or sugar motif. For example, internucleoside linkages within a region of a modified oligonucleotide comprising certain sugar modifications may be the same or different from one another and may be the same or different from the internucleoside linkages of the region of the modified oligonucleotide comprising different sugar modifications. Likewise, such modified oligonucleotides may comprise one or more modified nucleobase independent of the pattern of the sugar modifications or sugar motif and independent of the internucleoside linkages or internucleoside linkage motif. Unless specifically indicated, all modifications are independent of nucleobase sequence. Furthermore, each modification, whether internucleoside linkage, modified sugar moiety, or modified nucleobase, of an antisense oligonucleotide is independent of each modification of a paired sense oligonucleotide unless specifically indicated otherwise. E. Nucleobase Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequence. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked oligonucleotide subunits (e.g., another oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid) or a region thereof. In certain embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to a nucleobase sequence of a second strand of linked oligonucleotide subunits or a region thereof. In certain embodiments, the nucleobase sequence of a region or entire length of an oligonucleotide is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of a second strand of linked oligonucleotide subunits or region thereof. In certain embodiments, an oligonucleotide comprises one or more abasic subunits. An abasic subunit is not considered complementary to any nucleobase. F. Oligomeric Duplexes In certain embodiments, an oligomeric agent provided herein comprises a modified oligonucleotide having a targeting region having a nucleobase sequence complementary to a sequence in a target nucleic acid paired with a second oligonucleotide to form an oligomeric duplex. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a target nucleic acid and a second oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the second oligonucleotide is a modified oligonucleotide. In some embodiments, an oligomeric duplex comprises a first modified oligonucleotide having a targeting region complementary to a target region of a target nucleic acid and a second modified oligonucleotide having a duplexing region complementary to the first modified oligonucleotide or a region thereof. In certain embodiments, the oligomeric duplex is part of an oligomeric agent, wherein the oligomeric agent comprises or consists of: (1) a first modified oligonucleotide, (2) a second oligonucleotide, and (3) optionally a terminal group and / or a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may be linked to a conjugate group. Either or both modified oligonucleotides of an oligomeric duplex may comprise a terminal group. Each modified oligonucleotide of an oligomeric duplex may include non-complementary or unpaired overhanging subunits. In certain embodiments, the overhanging subunit is a nucleoside, and the nucleobase of the non-complementary or unpaired overhanging nucleosides is adenine or thymine. In certain embodiments, the two modified oligonucleotides have at least one mismatch relative to one another. In certain embodiments, one or both of the modified oligonucleotides comprises at least one abasic subunit. In certain embodiments, an oligomeric duplex comprises: a first modified oligonucleotide containing a targeting region comprising at least 12 oligonucleotide subunits , wherein the nucleobase sequence of the targeting region is at least 80% complementary to the nucleobase sequence of a target region of a target nucleic acid; and a second modified oligonucleotide containing a duplexing region comprising at least 12 oligonucleotide subunits, wherein the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 80% complementary to the nucleobase sequence of a duplexing region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the targeting region of the first modified oligonucleotide comprises the same number of subunits as the target region of the target nucleic acid; that is, there are no gaps or bulges. In certain embodiments, the duplexing region of the second modified oligonucleotide comprises the same number of subunits as the duplexing region of the first modified oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense oligonucleotide. In certain embodiments, the nucleobase sequence of the duplexing region of the second modified oligonucleotide is at least 90%, at least 95%, at least 98% or 100% complementary to the nucleobase sequence of an equal length region (e.g., a region of the targeting region) of the first modified oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense oligonucleotide. In certain embodiments, the first modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the second modified oligonucleotide is a sense RNAi oligonucleotide. G. Conjugates In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides, and optionally, one or more conjugate groups and / or one or more terminal groups. In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more conjugate groups. In certain embodiments, an oligomeric agent comprises one or more modified oligonucleotides and one or more terminal groups. Conjugate groups comprise or consist of a conjugate moiety and a conjugate linker. A conjugate group or a terminal group may be attached at the 5′ end of an oligonucleotide and / or at the 3′ end of an oligonucleotide and / or at any internal position of an oligonucleotide. In certain embodiments, conjugate groups are attached through a modified sugar moiety or a modified internucleoside linkage. In certain embodiments, oligomeric agents comprise a modified oligonucleotide, a cell-targeting moiety, and a conjugate linker. 1. Conjugate Groups A conjugate group comprises or consists of a conjugate moiety and a conjugate linker. In certain embodiments, a conjugate moiety attached to an oligonucleotide modifies one or more properties of the attached oligonucleotide compared to the same oligonucleotide lacking the conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, a conjugate moiety imparts a new property on the attached oligonucleotide. In some embodiments, the conjugate group comprises a small molecule drug (e.g., an active pharmaceutical ingredient), an aliphatic chain, a lipid, a peptide, a protein, a hydrocarbon, a polyamine, a polyamide, a polyether, a thioether, an aptamer, an antibody, an antibody fragment, a VHH camelid antibody fragment, a VNAR shark antibody fragment, a vitamin, a fatty acid, a carbohydrate, an intercalator, a reporter molecule, a small molecule, or an alkyl moiety, e.g., a C22 alkyl, C20 alkyl, C17 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain optionally has one or more unsaturated bonds. In some embodiments, the conjugate group comprises a 6-palmitamidohexyl moiety or a 2-(hydroxymethyl)-6- palmitamidohexyl moiety. In certain embodiments, the conjugate group comprises a cell-targeting moiety. In certain embodiment, the conjugate group comprises a lipophilic moiety. In certain embodiments, the lipophilic moiety is selected from the group consisting of a C8-C22 alkyl moiety, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl) lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine. In certain embodiments, the alkyl moiety is a saturated straight chain C16 hydrocarbon. Methods of preparing conjugated oligonucleotides are known in the art and / or described herein. For example, in one non-limiting solid phase method for large-scale synthesis of conjugated oligonucleotides, monomethoxytrityl (MMT)-protected 5′ or (3′)-amino-modified oligonucleotide intermediates are generated using the phosphoramidate monomer coupling method and detritylated as described in U.S. Patent No. 10,450,342. The 5′ (or 3′) MMT-protected amino group may be linked to the oligonucleotide through a linker group such as an alkyl phosphate group, and the MMT group may be removed from the oligonucleotide via solution-phase detritylation conducted at certain temperatures and pH. In certain embodiments, the detritylated oligonucleotide is then reacted with a conjugate group (e.g., a GalNAc3) to generate a conjugated oligonucleotide. 2. Certain Cell-targeting Moieties In certain embodiments, a conjugate moiety comprises or consists of a cell-targeting moiety. In certain embodiments, a cell-targeting moiety has affinity for a cell surface receptor on a cell. In certain embodiments, a cell-targeting moiety has affinity for a cell surface moiety on a cell. In certain embodiments, a cell-targeting moiety is capable of binding a cell surface receptor on a cell. In certain embodiments, a cell- targeting moiety is capable of binding a cell surface moiety on a cell. In certain embodiments, an oligomeric agent comprising a cell-targeting moiety is capable of being internalized by the cell when the cell-targeting moiety interacts with and / or binds a cell surface receptor and / or cell surface moiety. In certain embodiments, a cell surface receptor is not expressed ubiquitously (e.g., the cell surface receptor is undetectable in at least one tissue of a human subject), and a cell-targeting moiety selectively delivers an oligomeric agent, a modified oligonucleotide, or an oligomeric duplex to a tissue of interest or a cell of interest. By way of non- limiting example, the tissue of interest may be any one or more of brain, spinal cord, retina, heart, kidney, liver, lung, skeletal muscle, cardiac muscle, smooth muscle, adipose, white adipose, brown adipose, spleen, bone, intestine, colon, testes, breast, ovary, placenta, uterus, bladder, pancreas, pituitary, prostate, skin, adrenal gland, and thyroid. By way of non-limiting example, the cell of interest may be any one or more of a myocyte, adipocyte, hepatocyte, cardiomyocyte, vascular smooth muscle cell, endothelial cell, neuron, blood cell, macrophage, lymphocyte, cancer cell, and immune cell. Asialoglycoprotein Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, the cell-targeting moiety comprises more than one ligand, and each ligand has affinity for the ASGP-R. In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is N-acetyl galactosamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises three GalNAc ligands. In certain embodiments, the cell-targeting moiety is any one of those described in US 9,127,276. GLP-1 Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for a GLP-1 receptor. In certain embodiments, the cell-targeting moiety is any one of those described in US 2019 / 0134214. GABA Transporter & Sortilin Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for neurons. In certain embodiments, the cell-targeting moiety has affinity for a neurotransmitter receptor. In certain embodiments, a cell-targeting moiety has affinity for a Sortilin receptor. In certain embodiments, the cell-targeting moiety is any one of those described in WO 2021 / 236599. In certain embodiments, the cell-targeting moiety has affinity for a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011 / 131693, WO 2014 / 064257. Angiotensin II Type 1 Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for an Angiotensin II Type I (AGTR1) receptor. In certain embodiments, the cell-targeting moiety is any one of those described in US 2022 / 0243210. Integrin Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for an integrin. In certain embodiments, the cell-targeting moiety has affinity for integrin αvβ3 and / or αvβ5. In certain embodiments, the cell-targeting moiety is any one of those described in any of WO 2019 / 210200, WO 2019 / 210308. In certain embodiments, the cell-targeting moiety has affinity for integrin αvβ6. In certain embodiments, the cell-targeting moiety is any one of those described in any of WO 2018 / 085415, WO 2019 / 089765, WO 2022 / 056269, WO 2022 / 056277, or WO 2022 / 056286. Transferrin Receptor Ligands In certain embodiments, a cell-targeting moiety has affinity for the type 1 transferrin receptor (TfR1; also known as CD71). In certain embodiments, a cell-targeting moiety comprises an anti-TfR1 antibody or antigen-binding fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the anti-TfR1 antibody or antigen-binding fragment thereof may be any known in the art including but not limited to those described in WO 1991 / 004753; WO 2013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO 2020 / 132584; WO 2020 / 028864; US 7,208,174; US 9,034,329; US 10,550,188; and US 11,512,136. In certain embodiments, a fragment of an anti-TfR1 antibody is a F(ab′)2, Fab, Fab′, Fv, scFv, VHH, or VNAR. In certain embodiments, an antibody binds to TfR1 through an engineered Fc domain rather than through the antigen-binding portion, as described in, e.g., US 2020 / 0223935. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfR1 that does not include the antigen-binding fragment of an antibody. In certain embodiments, the protein or peptide capable of binding TfR1 may be any known in the art including but not limited to those described in WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; WO 2022 / 026555; WO 2023 / 027125; WO 2023 / 022234; and US 10,138,483. In certain embodiments, the peptide is a cyclic peptide, as described in WO 2021 / 167107. In certain embodiments, the peptide is a bicyclic peptide known as a ‘bicycle ligand’ selected from those described in WO 2022 / 101633 and WO 2023 / 056388. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfR1. In certain embodiments, the aptamer capable of binding TfR1 may be any known in the art including but not limited to those described in WO 2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198. 3. Conjugate Linkers In certain embodiments, oligomeric agents comprise an oligonucleotide and a conjugate group, wherein the conjugate group consists of a conjugate moiety and a conjugate linker. The conjugate linker links the conjugate moiety to the oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises one or more atoms. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers, including the conjugate linkers described herein, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate moieties to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to react with a particular site on a parent compound and the other is selected to react with a conjugate moiety. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. In certain embodiments, conjugate linkers comprise chemical groups that are formed upon a reaction between a first functional group and a second functional group. In certain embodiments, an oligonucleotide (e.g., a modified oligonucleotide) is attached to the first functional group during synthesis, and a conjugate moiety is attached to a second functional group during synthesis. Then, the two compounds are mixed under specific conditions to yield the oligonucleotide covalently linked to the conjugate moiety. Such reactions that are compatible with both oligonucleotide and peptide chemistry have been previously described and are often called “bioconjugation” reactions. These reactions include strain-promoted azide-alkyne cycloaddition (SPAAC), copper-catalyzed click reaction (CuAAC), active ester conjugation to an amino modified oligonucleotide, maleimide-thiol Michael addition, ketol / hydroxylamine ligation, the Staudinger ligation, reductive amination, thioether formation, disulfide formation, reductive alkylation, catalyst-free N-arylation, sulfur fluoride exchange click reaction (SuFEx), and inverse demand Diels-Alder reaction. Certain such reactions are described in, e.g., Jbara, M., et al. Angew. Chem. Int. Ed.2021, 60 (21), 12109-12115; Dong, J., et al. Angew. Chem. Int. Ed.2014, 53 (36), 9430-9448.4; Zhang, C. et al. Angew. Chem. Int. Ed. Engl. 2019, 58 (15), 4810–4839; Walsh, S. J., et al. Chem. Soc. Rev., 2021, 50, 1305-1353; Tiefenbrunn, T. et al. Biopolymers, 2010, 94 (1), 95-106; Drake, P. M., et al. Bioconjug. Chem.2014, 25 (7), 1331-1341; Bode, J. W., Acc. Chem. Res., 2017, 50 (9), 2104–2115; Magano, J., et al. Org. Proc. Res. Dev.2014, 18, 142-151; McKay, C. S. and Finn, M. G. Chem. Biol.2014, 21 (9), 1075-101; Christy, M. P. et al. Org. Lett.2020, 22, 2365; Ren, H., et al. Angew. Chem. Int. Ed. Engl.2009, 48, 9658–9662; Rohrbacher, F. et al., Helv. Chim. Acta.2018, 101 (5), e1800039; Baalmaan, M., et al. Angew. Chem. Int. Ed.2020, 59 (31), 12885-12893; Lang, K., et al. J. Am. Chem. Soc.2014, 9 (1), 16-20; Nair, D. P., et al. Chem. Mater.201326 (1), 724-744; Kalia, J. and Raines, R. T. Angew. Chem. Int. Ed., 2008, 47, 7523-7526. Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1- C10alkyl, substituted or unsubstituted C2-C10alkenyl or substituted or unsubstituted C2-C10alkynyl, wherein a nonlimiting list of substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. In certain embodiments, it is desirable for a conjugate moiety to be cleaved from the oligonucleotide. For example, in certain circumstances oligomeric agents comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric agent has been taken up, it is desirable that the conjugate moiety be cleaved to release the unconjugated oligonucleotide or oligomeric duplex. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable bond is selected from an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphodiester linkage between an oligonucleotide and a conjugate moiety. In certain embodiments, a cleavable moiety may be part of the oligonucleotide and comprises or consists of one or more linked nucleosides. In certain such embodiments, the one or more linked nucleosides are linked to one another and / or to the remainder of the oligonucleotide through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2′-deoxynucleoside that is either the 3′ or 5′-terminal nucleoside of an oligonucleotide linked by a phosphodiester internucleoside linkage to an adjacent nucleoside of the oligonucleotide and covalently attached to the conjugate linker or conjugate moiety by a phosphodiester or phosphorothioate linkage. In certain such embodiments, the cleavable moiety comprises 2′-deoxyadenosine. In certain embodiments, oligomeric agents described herein comprise an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the oligonucleotide is attached to the conjugate moiety using Click chemistry known in the art. Compounds have been prepared using Click chemistry wherein alkynyl phosphonate internucleoside linkages on an oligonucleotide attached to a solid support are converted into the 1,2,3-triazolylphosphonate internucleoside linkages and then cleaved from the solid support (Krishna, H. et al. J. Am. Chem. Soc.2012, 134(28), 11618-11631). Additional conjugate linkers suitable for oligonucleotide conjugates are prepared by Click chemistry described in “Click Chemistry for Biotechnology and Materials Science” Ed. Joerg Lahann, Wiley 2009. Further examples of linking chemistry include an inverse electron demand Diels-Alder reaction, e.g., as described in Argamunt et al., J. Org. Chem.2020, 85, 10, 6593–6604, Sarrett et al., Nat. Protocols 2021, 16, 3348–3381; Handula et al., Molecules, 2021, 26 (15), 4640, Wiessler et al., Int. J. Med. Sci.2010, 7 (1), 19–28; copper-catalyzed azide-alkyne cycloaddition (CuAAC) see, e.g., S. I. Presolski, et al., J. Am. Chem. Soc.2010, 132, 14570–14576; D. Soriano Del Amo, et al., J. Am. Chem. Soc., 2010, 132, 16893–16899; Staudinger reaction, see, e.g., Saxon and C. R. Bertozzi, Science, 2000, 287, 2007–2010; B. L. Nilsson, et al., Org. Lett., 2000, 2, 1939–1941, E. Saxon, et al., Org. Lett., 2000, 2, 2141–2143; formation of hydrazones and oximes, see, e.g., J. Y. Axup, et al., Proc. Natl. Acad. Sci. U. S. A., 2012, 109, 16101–16106; photoclick reactions, see, e.g., W. Song, et al., Angew. Chem., Int. Ed., 2008, 47, 2832–2835, A. Herner and Q. Lin, Top. Curr. Chem., 2016, 374, 1; strain-promoted alkyne- nitrone cycloaddition (SPANC) reactions, see, e.g., D. A. MacKenzie, et al., Curr. Opin. Chem. Biol., 2014, 21, 81–88; transition metal catalyzed cross coupling, see, e.g., M. Chalker, et al., J. Am. Chem. Soc., 2009, 131, 16346–16347; nucleophilic additions, in particular, of a thiol to a maleimide, see, e.g., Kang et al., Chem. Sci., 2021, 12, 13613-13647, Bernardim et al., Nat. Comm.2016, 7, 13128, Jain et al., Pharm. Res. 2015, 32 (11), 3526-3540. In certain embodiments, the conjugate linker is prepared by reaction of a first reactive moiety with a second reactive moiety, wherein the first reactive moiety is attached to the oligonucleotide and the second reactive moiety is attached to the conjugate moiety, or a precursor thereof. In certain embodiments, the conjugate linker is prepared by reaction of a dipolarophile (e.g., a triple bonded moiety such as an alkyne or nitrile) with a 1,3-dipole (e.g., an azide, a nitrone, an isocyanate, or a thioisocyanate): a carbon atom or a heteroatom, one of X and Y is attached to an oligonucleotide, and the other of X and Y is attached to a conjugate moiety. The conjugate linker thus prepared may comprise a five-membered unsaturated heterocyclic ring such as a triazole. In certain embodiments, the conjugate linker is prepared by reaction of a dieneophile (e.g., an electron rich double bond such as a furan or derivative thereof) with an electron poor diene (e.g., a tetrazine): , atom or a heteroatom, one of X and Y is attached to an oligonucleotide, and the other of X and Y is attached to a conjugate moiety. The conjugate linker thus prepared may comprise a six-membered unsaturated heterocyclic ring such as a dihydropyrazine. In certain embodiments, the conjugate linker is prepared by reaction of a nucleophile (e.g., a thiol or amine) with an electrophile (e.g., an electron-poor carbonyl or carbonyl-conjugated alkene or alkyne): , where or a heteroatom, one of X and Y is attached to an oligonucleotide, and t e ot er o X and Y s attac ed to a conjugate moiety. The conjugate linker thus prepared may comprise a thioether, hydrazone, oxime, or amide. Each of the first reactive moiety and the second reactive moiety may attach at any suitable position of the oligonucleotide and the conjugate moiety, for example, at a position described herein. In certain embodiments, the conjugate moiety comprises a peptide or polypeptide. In certain embodiments, the second reactive moiety is attached to an amino-acid side chain of a peptide or polypeptide. In certain embodiments, the second reactive moiety is attached to the N-terminus of the peptide or polypeptide. In certain embodiments, the second reactive moiety is attached to the C-terminus of a peptide or polypeptide. In certain embodiments, the second reactive moiety replaces the amino group of a lysine of a peptide or polypeptide. In certain embodiments, a Click reaction is used to link a conjugate moiety and an oligonucleotide by reacting: with amine, including but not limited to the following compound: , to yield: , an azide to yield: , he conjugate moiety, and wherein X represents the remainder of the conjugate moiety. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker is prepared from the following compound: . agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: ; wherein N-N=N is formed from an azido group of the conjugate moiety; X represents the remainder of the conjugate moiety; and Y represents the remainder of the conjugate linker and the oligonucleotide. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: ; conjugate moiety; X represents the remainder of the In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: ; moiety; X represents the remainder of the conjugate moiety; and Y represents the oligonucleotide. In certain embodiments, a Click reaction is used to link a conjugate moiety and an oligonucleotide by reacting: in solution together with but not limited to the following compound: , , to yield: , wher conjugate moiety, and wherein X represents the remainder of the conjugate moiety. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker is prepared from the following compound: . In oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: ; an azido group of the conjugate moiety; X represents the remainder of the conjugate moiety; and Y represents the remainder of the conjugate linker and the oligonucleotide. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: ; wherein N-N=N is formed from an azido group of the conjugate moiety; X represents the remainder of the conjugate moiety; and Y represents the oligonucleotide. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: ; of the conjugate moiety; X represents the remainder of the In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: , moiety; and Y comprises the oligonucleotide. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugated oligonucleotide has the formula: , and Y comprises the conjugate moiety. In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . In certain embodiments, an oligomeric agent comprises an oligonucleotide linked to a conjugate moiety by a conjugate linker, wherein the conjugate linker comprises: . an oligomeric agent comprises an oligonucleotide linked to a conjugate a wherein the conjugate linker comprises: . oligomeric agent comprises an oligonucleotide linked to a conjugate a the conjugate linker comprises: . a Click reaction is used to link a conjugate moiety and an oligonucleotide by reacting: to the conjugate moiety and X is attached to the oligonucleotide, to yield: . preparation of the above starting materials and intermediates can be found in one or more of the following: Agard, N. J., et al. “A Strain-Promoted [3 + 2] Azide-Alkyne Cycloaddition for Covalent Modification of Biomolecules in Living Systems.” J. Am. Chem. Soc.2004, 126, 15046– 15047; Lang, K., and Chin, J. W. “Biorthogonal Reactions for Labeling Proteins.” ACS Chem. Biol. 2014, 9 (1), 16-20; Nair, D. P. et al. “The Thiol-Michael Addition Click Reaction: A Powerful and Widely Used Tool in Materials Chemistry.” Chem. Mater.201326 (1), 724-744; WO2011 / 136645; Kölmel, D. K. and Kool, E. T. “Oximes and Hydrazones in Bioconjugation: Mechanism and Catalysis.” Chem. Rev.2017, 117, 10358-10376; Wang, J. et al. “Polyfluorophenyl Ester-Terminated Homobifunctional Cross-Linkers for Protein Conjugation.” Synlett, 2017, 28 (15), 1934-1938; Kishimoto, S. et al. “Site-Specific Chemical Conjugation of Antibodies by Using Affinity Peptide for the Development of Therapeutic Antibody Format,” Bioconjugate Chem., 2019, 30 (3), 698-702, Wu and Devaraj, “Inverse Electron-Demand Diels–Alder Bioorthogonal Reactions,” Top. Curr. Chem.2016, 374, 3, Oliveira et al., “Inverse electron demand Diels– Alder reactions in chemical biology,” Chem. Soc. Rev., 2017, 46, 4895-4950. H. Terminal Groups In certain embodiments, provided herein are oligomeric agents comprising one or more modified oligonucleotides and one or more terminal groups. As used herein, “terminal group” means a group of atoms that is covalently linked to a terminus of an oligonucleotide. Examples of a terminal group include, but are not limited to, a capping group, a phosphate moiety, a stabilized phosphate group, and a protecting group. In certain embodiments, one or more terminal groups is attached to either or both ends of an oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3′-end and / or at the 5′-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3′-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 5′-end of the oligonucleotide. In certain embodiments, one or more terminal groups is attached at the 3′-end of the oligonucleotide and one or more terminal groups is attached at the 5′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3′-end of the oligonucleotide and / or at the 5′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 5′-end of the oligonucleotide. In certain embodiments, a terminal group is attached at the 3′-end of the oligonucleotide and a terminal group is attached at the 5′-end of the oligonucleotide. In certain embodiments, an oligonucleotide comprises a terminal group comprising an abasic sugar moiety or an abasic sugar surrogate. In certain embodiments, the terminal group is an abasic inverted sugar moiety. In certain embodiments, an oligonucleotide is linked to a terminal group comprising a stabilized 5′- phosphate. In certain embodiments, in an oligomeric duplex provided herein, a terminal group comprising a stabilized phosphate moiety is attached at the 5′-end of the first modified oligonucleotide. The stabilized phosphate moiety results in stabilization of a 5′-phosphate moiety of the 5′-terminal nucleoside of an oligonucleotide, relative to the stability of an unmodified 5′-phosphate of a nucleoside under biologic conditions. Such stabilization of a 5′-phosphate group includes but is not limited to resistance to removal by phosphatases. Stabilized phosphate moieties, include, but are not limited to, 5′-phosphonates, including, but not limited to 5′-vinylphosphonate, 5′-methylphosphonate, and 5′-cyclopropyl phosphonate. In certain embodiments, the stabilized phosphate moiety is a cyclopropyl phosphonate or an (E)-vinyl phosphonate. II. Target Nucleic Acids A. Target Nucleic Acids, Target Regions and Nucleotide Sequences In certain embodiments, antisense agents, oligomeric agents, or modified oligonucleotides described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, a pre-mRNA and corresponding mRNA are both target nucleic acids of a single compound. In certain such embodiments, the target region is entirely within an intron of a target pre-mRNA. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is a microRNA. In certain embodiments, the target region is in the 5’ UTR of a gene. In certain embodiments, the target region is within a translation suppression element region of a target nucleic acid. III. Methods and Uses A. Antisense Activity In certain embodiments, oligomeric agents provided herein comprise an antisense oligonucleotide that is capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric agents are antisense agents. In certain antisense activities, hybridization of an antisense oligonucleotide to a target nucleic acid results in recruitment of a protein, e.g., RNase H or Argonaute, that cleaves the target nucleic acid. Certain antisense agents result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, oligomeric agents are antisense agents that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like subunits in the antisense agent are tolerated and RNase H activity is retained. In certain embodiments, such antisense agents reduce expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain antisense activities, an antisense oligonucleotide is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense oligonucleotides result in cleavage of the target nucleic acid by Argonaute. Antisense agents that comprise an antisense oligonucleotide that is loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA). In certain embodiments, an RNAi agent may be a hairpin oligonucleotide that has a double-stranded region. In certain embodiments, RNAi agents are capable of RISC- mediated modulation of a target nucleic acid in a cell. In certain embodiments, such RNAi agents reduce or the expression of or reduce the amount or activity of a target nucleic acid by 25% or more in the standard in vitro assay. In certain embodiments, RNAi agents selectively affect one or more target nucleic acid. Such RNAi agents comprise a modified oligonucleotide having a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity. In certain embodiments, an RNAi agent comprises a modified oligonucleotide that does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense oligonucleotide to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in exon inclusion or exon exclusion. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in retained intron exclusion. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid (e.g., miRNA, lncRNA, sncRNA). In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in modulation of translation of the target nucleic acid. In certain embodiments, hybridization of an oligomeric agent to a target nucleic acid results in an increase in the amount or activity of a target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in increased translation of the target nucleic acid. In certain embodiments, hybridization of an antisense oligonucleotide to a target nucleic acid results in reduced translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and / or a phenotypic change in a cell or animal. B. Treatment, Prophylaxis In certain embodiments, provided herein are methods of modulating target expression, target RNA levels, and / or target protein levels and / or activity, in a subject having, or at risk of having, a disease, disorder, condition or injury associated with said target and / or said target protein, wherein the method includes administering to the subject an oligomeric agent comprising or consisting of a modified oligonucleotide comprising a targeting region complementary to a target region of a target nucleic acid thereby modulating expression of target nucleic acid in the subject. In certain embodiments, expression of target nucleic acid is modulated. In certain embodiments, administering such an oligomeric agent modulates target expression, target RNA levels, and / or target protein levels and / or activity, in the plasma, serum, blood, cerebrospinal fluid (CSF) or other tissues of the subject. In some instances, such an oligomeric agent is administered parenterally. In some instances, an oligomeric agent is administered intravenously, subcutaneously, intramuscularly, or intrathecally. In certain embodiments, the detectable amount of the target RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a target nucleic acid, for the manufacture or preparation of a medicament for ameliorating, or delaying or preventing development or progression of a disease and / or for ameliorating, preventing or delaying the onset of one or more symptoms of a disease. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving symptoms of a disease, such as a genetic disease. Certain embodiments are drawn to an oligomeric agent comprising or consisting of a modified oligonucleotide having a targeting region complementary to a target region of a target nucleic acid, for the manufacture or preparation of a medicament for treating a disease. In certain embodiments, the disease is a genetic disease. In certain embodiments, prophylactic administration of an oligomeric agent or composition provided herein to a subject at risk for disease is able to prevent, ameliorate, postpone or delay a symptom and / or development or progression of disease progression. In certain embodiments, an oligomeric agent is for the manufacture or preparation of a medicament for improving symptoms of a disease. In any of the methods or uses described herein, the oligomeric agent be any oligomeric agent (e.g., an oligomeric agent comprising or consisting of a modified oligonucleotide, an antisense oligonucleotide, or oligomeric duplex, and optionally one or more conjugate and / or terminal groups) described herein. III. Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric agent described herein, wherein each oligomeric agent comprises or consists of a modified oligonucleotide. In certain embodiments, the one or more oligomeric agent comprises or consists of an antisense oligonucleotide. In certain embodiments, a pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric agent. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and phosphate-buffered saline (PBS). In certain embodiments, sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agent (e.g., a modified oligonucleotide or oligomeric duplex) provided herein and artificial cerebrospinal fluid (“artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent comprising or consisting of a modified oligonucleotide and sterile saline. In certain such embodiments, a pharmaceutical composition consists of such oligomeric agent and sterile saline. In certain embodiments, a pharmaceutical composition consists essentially of such oligomeric agent and sterile saline. In certain embodiments, the sterile saline is sterile PBS. In certain embodiments, the sterile saline is pharmaceutical grade. In certain embodiments, a pharmaceutical composition comprises an oligomeric agent and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of an oligomeric agent and aCSF. In certain embodiments, a pharmaceutical composition consists essentially of an oligomeric agent and aCSF. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2. In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agent and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone. In certain embodiments, an oligomeric agent may be admixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent encompass any pharmaceutically acceptable salts of the oligomeric agent, esters of the oligomeric agent, or salts of such esters. As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. In certain embodiments, pharmaceutical compositions comprising an oligomeric agent comprising or consisting of one or more modified oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric agents provided herein, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved, for example by endogenous nucleases, within the body. In certain embodiments, oligomeric agents are lyophilized and isolated, e.g., as sodium salts. In certain embodiments, a sodium salt of an oligomeric agent is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS. In certain embodiments, a sodium salt of an oligomeric agent is mixed with PBS. Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain methods, a nucleic acid, such as an oligomeric agent comprising a modified oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, nucleic acid complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of an oligomeric agent to muscle tissue. In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used. In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more oligomeric agents to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody. In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™ and 65% w / v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose. In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier or diluent and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, diluents, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” herein is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de-protonated / in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof” expressly includes all such forms that may be fully or partially protonated / de- protonated / in association with one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, oligomeric agents provided herein are in aqueous solution with sodium. In certain embodiments, oligomeric agents are in aqueous solution with potassium. In certain embodiments, oligomeric agents are in PBS. In certain embodiments, oligomeric agents are in water. In certain such embodiments, the pH of a solution is adjusted with NaOH and / or HCl to achieve a desired pH. Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex, antisense agent) in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric duplex. As described herein, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) exists as a solvent-free, sodium-acetate free, anhydrous, free acid. In certain embodiments, where an oligomeric agent (e.g., modified oligonucleotide, oligomeric duplex) is in solution comprising sodium (e.g., saline), the oligomeric agent may be partially or fully de-protonated and in association with sodium ions. However, the mass of the protons is nevertheless counted toward the weight of the dose, and the mass of the sodium ions is not counted toward the weight of the dose. When an oligomeric agent comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric agent. If the conjugate group also has an acid, the conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose. Nonlimiting disclosure and incorporation by reference Each of the literature and patent publications listed herein is incorporated by reference in its entirety. While certain compounds, compositions, and methods have been described herein with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application, is incorporated herein by reference in its entirety. The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (i.e., 2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (i.e., thymine (5-methyl uracil) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’-substituent(s) that are neither OH nor H. One of skill in the art will readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds. Herein, the description of compounds as having “the nucleobase sequence of” a SEQ ID NO. describes only the nucleobase sequence. Accordingly, absent additional description, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO. does not limit sugar or internucleoside linkage modifications or presence or absence of additional substituents such as a conjugate group. Further, absent additional description, the nucleobases of a compound “having the nucleobase sequence of” a SEQ ID NO. include such compounds having modified forms of the identified nucleobases as described herein. Herein, the description of compounds by chemical notation (subscripts and / or superscripts to indicate chemical modifications) without reference to a specific Compound No. include only each noted modification, but may include additional substituents, such as a conjugate group, unless otherwise indicated. For example, the chemical notation of “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound may include additional substituents, such as a conjugate group. Herein, where a specific compound (e.g., with reference to a Compound No.) is described (as in the examples) by chemical notation, each nucleobase, sugar, and internucleoside linkage of such specific compound is modified only as indicated. Accordingly, in the context of a description of a specific compound having a particular Compound No., “AesTkomCezGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-MOE sugar moiety (indicated by the “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not include additional substituents. Herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying a sequence (e.g., in separate text that appears within or above or below a table of compounds). Where a specific compound is described herein by way of a drawn chemical structure, each nucleobase, sugar, and internucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure. One of skill will appreciate, however, that drawn compounds may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds. While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies between a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description. The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to:2H or3H in place of1H,13C or14C in place of12C,15N in place of14N,17O or18O in place of16O, and33S,34S,35S, or36S in place of32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric agent that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging. EXAMPLES The following examples are intended to illustrate certain aspects of the invention and are not intended to limit the invention in any way. Example 1: Design and synthesis of modified oligonucleotides with substituted sulfonyl phosphoramidate linkages Modified oligonucleotides complementary to mouse MALAT1 were designed and synthesized as shown in the table below. Each modified oligonucleotide in the table below has the same sequence GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8), wherein each cytosine residue is a 5-methylcytosine, and is 100% complementary to the complement of mouse MALAT1 GenBank Accession No. NC_000085.6 truncated from nucleosides 5793001 to 5806000 (SEQ ID NO: 1). Each modified oligonucleotide in the table below is a 5-10-5 MOE gapmer with a sugar motif of (from 5′ to 3′): eeeeeddddddddddeeeee, wherein “e” represents a 2′-MOE sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety. Each modified oligonucleotide in the table below has an internucleoside linkage motif as described in the column labeled “Internucleoside Linkage (5′ to 3′)”, wherein each “o” represents a phosphorothioate internucleoside linkage, each “s” represents a phosphorothioate internucleoside linkage, each “z” represents a mesyl phosphoramidate internucleoside linkage, each “[iPrSPA]” represents an isopropylsulfonyl phosphoramidate internucleoside linkage, each “[TIQSPA]” represents a 1,2,3,4-tetrahydroisoquinoline-7-sulfonyl phosphoramidate internucleoside linkage, each “[VI]” represents a 3,4-dimethoxyphenylsulfonyl phosphoramidate internucleoside linkage (Formula VI), each “[VII]” represents a 3-pyridinesulfonyl phosphoramidate internucleoside linkage (Formula VII), each “[VIII]” represents a 1-methyl-1H-imidazole- 4-sulfonyl phosphoramidate internucleoside linkage(Formula VIII), each “[NAcPhSPA]” represents an N- acetylsulfanilyl phosphoramidate internucleoside linkage, each “[IX]” represents a 2-thiophenesulfonyl phosphoramidate internucleoside linkage (Formula IX), each “[X]” represents a 3,5-dimethylisoxazole-4- sulfonyl phosphoramidate internucleoside linkage (Formula X), and each “[DMASPA]” represents a dimethylaminosulfonyl phosphoramidate internucleoside linkage, as shown in the figures below: Compound No.626112 was previously disclosed in International Patent No. WO 2016 / 044828. Table 1 Design of modified oligonucleotides complementary to mouse MALAT1, with substituted sulfonyl phosphoramidate linkages Compound SEQ ′′ l i i k ′ ′ID O 888 1638244GCCAGGCTGGTTATGACTCA szzzsssssssssssooss 8GCCAGGCTGGTTATGACT88888 888 Substituted sulfonyl azides were synthesized from their corresponding sulfonyl chlorides, then incorporated into modified oligonucleotides via Staudinger reaction to yield modified oligonucleotides with substituted sulfonyl phosphoramidate linkages, as shown in the scheme below. of sodium azide (2.5g, 38.41 mmol, 1 eq.) in anhydrous MeCN (43 mL), and the reaction was stirred at room temperature overnight. After reaction completion was confirmed by1H NMR, the reaction was filtered and crude 3,4- dimethoxybenzenesulfonyl azide (2) was used directly in a Staudinger reaction with a modified oligonucleotide intermediate, following known procedures, to yield a modified oligonucleotide with 3,4- dimethoxyphenylsulfonyl phosphoramidate linkages. Modified oligonucleotides with 1,2,3,4-tetrahydroisoquinoline-7-sulfonyl phosphoramidate linkages, N-methylimidazole-4-sulfonyl phosphoramidate linkages, N-acetylsulfanilyl phosphoramidate linkages, 2- thiophenesulfonyl phosphoramidate linkage, 3-pyridinesulfonyl phosphoramidate linkages, or 3,5- dimethylisoxazole-4-sulfonyl phosphoramidate were synthesized following the general procedure described above. Example 2: Potency of modified oligonucleotides complementary to mouse Malat1 RNA in wild type mice, 8-weeks Wild type C57BL / 6 mice (Taconic Biosciences) were treated with modified oligonucleotides described above. Groups of 3 C57BL / 6 mice each received a single ICV bolus of modified oligonucleotide at various doses as indicated in the tables below. One group of 3 C57BL / 6 mice was received a single ICV bolus of PBS as a negative control. Eight weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure amount of mouse Malat1 RNA using mouse primer probe set mMALAT1#2 (forward sequence TGGGTTAGAGAAGGCGTGTACTG, designated herein as SEQ ID NO: 2; reverse sequence TCAGCGGCAACTGGGAAA designated herein as SEQ ID NO: 3; probe sequence CGTTGGCACGACACCTTCAGGGACT designated herein as SEQ ID NO.4). Malat1 RNA levels were normalized to mouse PPIA. Mouse PPIA was amplified using primer probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA, designated herein as SEQ ID NO: 5; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 6; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 7). Results are presented as percent mouse Malat1 RNA relative to the amount of Malat1 RNA in PBS treated animals, (% control). The half maximal effective dose (ED50) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA). Table 2 Dose-dependent reduction of mouse Malat1 mRNA in wild type mice Malat1 RNA (% control) Compound Dose 50 ) 3 99 73 10 72 37 1565044 45 7 Dose-dependent reduction of mouse Malat1 mRNA in wild type mice Malat1 RNA (% control) Compound Dose ED50S inal ED50 ) 3 76 75 10 75 44 1825316 22 8 Example 3: Design and synthesis of modified oligonucleotides with substituted sulfonyl phosphoramidate linkages Modified oligonucleotides complementary to mouse MALAT1 were designed and synthesized as shown in the table below. The modified oligonucleotides are 20 nucleosides in length. Each modified oligonucleotide in the table below has the same sequence GCCAGGCTGGTTATGACTCA (SEQ ID NO: 8), wherein each cytosine residue is a 5-methylcytosine, and is 100% complementary to the complement of mouse MALAT1 GenBank Accession No. NC_000085.6 truncated from nucleosides 5793001 to 5806000 (SEQ ID NO: 1). Each modified oligonucleotide in the table below is a 5-10-5 MOE gapmer with a sugar motif of (from 5′ to 3′): eeeeeddddddddddeeeee, wherein “e” represents a 2′-MOE sugar moiety and each “d” represents a 2′-β-D-deoxyribosyl sugar moiety. Each modified oligonucleotide in the table below has an internucleoside linkage motif as described in the column labeled “Internucleoside Linkage (5′ to 3′)”, wherein each “o” represents a phosphorothioate internucleoside linkage, each “s” represents a phosphorothioate internucleoside linkage, each “z” represents a mesyl phosphoramidate internucleoside linkage, each “[VI]” represents a 3,4-dimethoxyphenylsulfonyl phosphoramidate internucleoside linkage (Formula VI), each “[VIII]” represents a 1-methyl-1H-imidazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula VIII), each “[XI]” represents a cyclic tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XI), each “[XII]” represents a tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XII), each “[XIII]” represents a guanidinium ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIII), each “[XIV]” represents an amino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIV), each “[XV]” represents a dimethylamino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XV), each “[XVI]” represents a dimethylamino propylsulfonyl phosphoramidate internucleoside linkage (Formula XVI), each “[XIX]” represents a cyclopropyl sulfonyl phosphoramidate internucleoside linkage (Formula XIX), each “[XX]” represents a phenylsulfonyl phosphoramidate (Formula XX), each “[XXI]” represents a carboxyl ethyl sulfonyl phosphoramidate (Formula XXI), and each “[XXII]” represents a methyl amido ethylsulfonyl phosphoramidate (Formula XXII), as shown in the figures above or below. Formula XXII Table 4 Design of modified oligonucleotides complementary to mouse MALAT1, with substituted sulfonyl phosphoramidate linkages Compound NNucleobase Sequence (5′ to 3′) Internucleoside Linkage (5′ to 3′) SEQ ID NO 1818757 GCCAGGCTGGTTATGACTCA s[XIX][XIX][XIX]sssssssssssooss 8 1918024 GCCAGGCTGGTTATGACTCA s[XX][XX][XX]sssssssssssooss8 Example 4: Activity of modified oligonucleotides complementary to mouse MALAT1 RNA in wild type mice, 8-weeks Selected modified oligonucleotides described above were tested in wild-type mice to assess the activity of the modified oligonucleotides. Groups of 3 C57BL / 6 mice each received a single ICV bolus of modified oligonucleotide at a dose of 30 µg. One group of 3 C57BL / 6 mice was received a single ICV bolus of PBS as a negative control. Eight weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure amount of mouse MALAT1 RNA using mouse primer probe set mMALAT1#2 (described herein above). MALAT1 RNA levels were normalized to mouse PPIA. Mouse PPIA was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent mouse MALAT1 RNA relative to the amount of MALAT1 RNA in PBS treated animals, (% control). Table 5 Reduction of mouse MALAT1 mRNA in wild type mice MALAT1 (% Compound Control) l Example 5: Potency of modified oligonucleotides complementary to mouse MALAT1 RNA in wild type mice, 8-weeks Selected modified oligonucleotides described above were tested in wild-type mice to assess the activity and potency of the modified oligonucleotides. Groups of 3 C57BL / 6 mice each received a single ICV bolus of modified oligonucleotide at various doses as indicated in the tables below. One group of 4 C57BL / 6 mice was received a single ICV bolus of PBS as a negative control. Eight weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure amount of mouse MALAT1 RNA using mouse primer probe set mMALAT1#2 (described herein above). MALAT1 RNA levels were normalized to mouse PPIA. Mouse PPIA was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent mouse MALAT1 RNA relative to the amount of MALAT1 RNA in PBS treated animals, (% control). The half maximal effective dose (ED50) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA). Table 6 Dose-dependent reduction of mouse MALAT1 mRNA in wild type mice MALAT1 RNA (% control) Compound Dose N ( )ED50Spinal ED50 ) 2 3 Example 6: Duration of Action of modified oligonucleotides complementary to mouse MALAT1 RNA in wild type mice Modified oligonucleotides described above were tested in wild-type mice to assess the activity and duration of action of the modified oligonucleotides. Groups of 3-6 C57BL / 6 mice each received a single ICV bolus of modified oligonucleotide at a dose of 30 µg. Groups of 3-6 C57BL / 6 mice each received a single ICV bolus of PBS as a negative control. The table below is a combination of 4 studies. At various timepoints, indicated in the table below, post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis to measure amount of mouse MALAT1 RNA using mouse primer probe set mMALAT1#2 (described herein above). MALAT1 RNA levels were normalized to mouse PPIA. Mouse PPIA was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent mouse MALAT1 RNA relative to the amount of MALAT1 RNA in PBS treated animals, (% control). Table 7 Reduction of mouse MALAT1 mRNA in wild type mice MALAT1 (% Compound Timepoint Control) l 2 39 25 8 43 34

Claims

WHAT IS CLAIMED:

1. An oligomeric agent comprising a modified oligonucleotide consisting of 12-70 linked subunits linked through internucleoside linking groups, wherein at least one subunit is a nucleoside comprising a modified sugar moiety, and wherein at least one of the internucleoside linking groups has Formula I:for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; and R2is selected from: a heterocyclyl , a substituted heterocyclyl , a heteroaryl, a substituted heteroaryl, a disubstituted aryl, a cyclopropyl, COOH, CONHJ1, wherein J1is H or C1-C6alkyl, a fragment of Formula II: ;wherein each of Z1, Z2, Z3, Z4, and Z5is N or C, provided that no more than two adjacent Z1, Z2, Z3, Z4, and Z5are N; and R3is absent when Z1is N; R4is absent when Z2is N; R5is absent when Z3is N; R6is absent when Z4is N, and R7is absent when Z5is N; and each of R3-R7, when present, is selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, N(R9R10); R8is H, OH, OR9, aryl, substituted aryl, or N(R10R11); R9is aryl, substituted aryl, or C1-C6alkyl; R10and R11are each, independently, H, C1-C6alkyl, or C(=O)Me; Provided that if each of Z1, Z2, Z3, Z4, and Z5is C: If R5is alkyl, NH2, C(=O)NH(R10), or NHC(=O)Me, then at least one of R3, R4, R6,and R7is other than H;If R4,R5, and R6are H, then neither R3nor R7is NO2; If each of R3-R7is H, then L is not methylene; a fragment of Formula III: ;wherein Y1,Y2,Y3, and Y4are selected from C, N, O or S, provided that if one of Y1,Y2,Y3, and Y4is O or S, then an adjacent Y1,Y2,Y3, or Y4is not O or S; wherein the ring is aromatic; and each of R12-R15is absent or selected, independently, from H, OH, C(=O)-R8, C1-C6alkyl, C1-C6alkoxy, NO2, or N(R9R10); with the proviso that Formula III is not 1-methyl-2-imidazole; or a fragment of Formula IV ;wherein R16, R17, R18, and R19are independently selected from H or C1-C6alkyl, or R17and R18join to form a 5- or 6-membered heterocycle; or a fragment of Formula V; ;wherein n is from 0-6; m is from 1-4; q is 0-3; and R20, R21, and R22are independently selected from H or C1-C6alkyl; with the proviso that if n and q are 0, then R21is not CH3.

2. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2is selected from an isoxazole, a diazole, an imidazole, or a thiophene.

3. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2is dimethoxyphenyl, optionally 3,4-dimethoxyphenyl.

4. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2is pyridyl, optionally 3-pyridyl.

5. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2is thienyl, optionally 2-thienyl.

6. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2is dimethyl isoxazole.

7. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2is 1-methyl-4-imidazole.

8. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2comprises guanidine.

9. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula II.

10. The oligomeric agent of claim 9, wherein at least one internucleoside linking group of Formula I has Formula VI:

11. The oligomeric agent of claim 9, wherein at least one internucleoside linking group of Formula I has Formula VII: N12. The oligomeric agent of claim 9, wherein at least one internucleoside linking group of Formula I has Formula XX:

13. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula III.

14. The oligomeric agent of claim 13, wherein at least one internucleoside linking group of Formula I has Formula VIII:

15. The oligomeric agent of claim 13, wherein at least one internucleoside linking group of Formula I has Formula IX:

16. The oligomeric agent of claim 13, wherein at least one internucleoside linking group of Formula I has Formula X:

17. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula IV.

18. The oligomeric agent of claim 17, wherein at least one internucleoside linking group of Formula I has Formula XI: O H19. The oligomeric agent of claim 17, wherein at least one internucleoside linking group of Formula I has Formula XII:

20. The oligomeric agent of claim 17, wherein at least one internucleoside linking group of Formula I has Formula XIII:

21. The oligomeric agent of claim 1, wherein for at least one internucleoside linking group of Formula I, R2comprises a fragment of Formula V.

22. The oligomeric agent of claim 21, wherein at least one internucleoside linking group of Formula I has Formula XIV:Formula XIV 23. The oligomeric agent of claim 21, wherein at least one internucleoside linking group of Formula I has Formula XV:

24. The oligomeric agent of claim 21, wherein at least one internucleoside linking group of Formula I has Formula XVI:

25. The oligomeric agent of claim 21, wherein at least one internucleoside linking group of Formula I has Formula XVII:

26. The oligomeric agent of claim 21, wherein at least one internucleoside linking group of Formula I has Formula XVIII:

27. The oligomeric agent of claim 1, wherein at least one internucleoside linking group of Formula I has Formula XIX:

28. The oligomeric agent of claim 1, wherein at least one internucleoside linking group of Formula I has Formula XXI:Formula XXI 29. The oligomeric agent of claim 1, wherein at least one internucleoside linking group of Formula I has Formula XXII:Formula XXII 30. The oligomeric agent of any of claims 1-29, wherein the modified oligonucleotide comprises a deoxy region consisting of 6-15 linked subunits, wherein each subunit of the deoxy region is a DNA nucleoside; wherein the deoxy region is flanked on the 5’ side by a 5’-region consisting of 1-8 linked 5’-region subunits and on the 3’ side by a 3’-region consisting of 1-8 linked 3’-region subunits; wherein the 3’-most subunit of the 5’-region is a nucleoside that comprises a modified sugar moiety; and the 5’-most subunit of the 3’-region is a nucleoside that comprises a modified sugar moiety.

31. The oligomeric agent of claim 29, wherein the deoxy region comprises 9, 10, or 11 DNA nucleosides.

32. The oligomeric agent of claim 30-31, wherein the 5’-region comprises 3-5 linked 5’-region subunits and the 3’-region comprises 3-5 linked 3’-region subunits, wherein each 5’-region subunit and each 3’-region subunit is a nucleoside that comprises a modified sugar moiety.

33. The oligomeric agent of claim 32, wherein each modified sugar moiety is selected from a non- bicyclic 2’-substituted sugar moiety and a bicyclic sugar moiety.

34. The oligomeric agent of claim 33, wherein the non-bicyclic 2’-substituted sugar moiety is a 2’-MOE sugar moiety or a 2’-OMe sugar moiety.

35. The oligomeric agent of any of claims 33-34, wherein the bicyclic sugar moiety is a cEt sugar moiety.

36. The oligomeric agent of any of claims 30-35, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides.

37. The oligomeric agent of any of claims 31-36, wherein the 5’-region and the 3’-region each comprise three cEt sugar moieties and the central region comprises 10 DNA nucleosides.

38. The oligomeric agent of any of claims 31-36, wherein the 5’-region and the 3’-region each comprise five 2’-MOE sugar moieties and the central region comprises 10 DNA nucleosides.

39. The oligomeric agent of any of claims 1-38, wherein the oligonucleotide comprises at least three different types of internucleoside linking groups.

40. An oligomeric agent comprising a modified oligonucleotide consisting of 12-70 linked subunits linked through internucleoside linking groups, wherein at least one subunit is a nucleoside comprising a modified sugar moiety, and wherein at least one of the internucleoside linking groups has Formula I:wherein independently for each internucleoside linking group of the modified oligonucleotide of Formula I: X is selected from O or S; L is absent, C1-C6alkyl, or C1-C6heteroalkyl; R1is selected from H, C1-C6alkyl, and substituted C1-C6alkyl; andR2is an aryl or substituted aryl; and wherein the modified oligonucleotide comprises a deoxy region consisting of 6-15 linked nucleosides, wherein each nucleoside of the deoxy region is a DNA nucleoside; wherein the deoxy region is flanked on the 5’ side by a 5’-region consisting of 1-8 linked 5’-region nucleosides and on the 3’ side by a 3’-region consisting of 1-8 linked 3’-region nucleosides; wherein the 3’-most nucleoside of the 5’-region comprises a modified sugar moiety; and the 5’-most nucleoside of the 3’-region comprises a modified sugar moiety; and wherein the oligonucleotide comprises at least three different internucleoside linking groups.

41. The oligomeric agent of claim 39 or 40, wherein the three different internucleoside linking groups are selected from a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, one or more internucleoside linking groups of Formula I, a mesyl phosphoramidate internucleoside linking group, a phosphorodithioate internucleoside linking group, and a methyl phosphonate internucleoside linking group.

42. The oligomeric agent of claim 41, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group.

43. The oligomeric agent of claim 41, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group, and a phosphodiester internucleoside linking group.

44. The oligomeric agent of any of claims 40-43, wherein the deoxy region comprises 9, 10, or 11 DNA nucleosides.

45. The oligomeric agent of claim 40-44, wherein the 5’-region comprises 3-5 linked 5’-region subunits and the 3’-region comprises 3-5 linked 3’-region subunits, wherein each 5’-region subunit and each 3’-region subunit is a nucleoside that comprises a modified sugar moiety.

46. The oligomeric agent of claim 45, wherein each modified sugar moiety is selected from a non- bicyclic 2’-substituted sugar moiety and a bicyclic sugar moiety.

47. The oligomeric agent of claim 45 wherein the non-bicyclic 2’-substituted sugar moiety is a 2’-MOE sugar moiety or a 2’-OMe sugar moiety.

48. The oligomeric agent of any of claims 46-47, wherein the bicyclic sugar moiety is a cEt sugar moiety.

49. The oligomeric agent of any of claims 40-48, wherein the modified oligonucleotide consists of 16, 18, or 20 linked nucleosides.

50. The oligomeric agent of any of claims 40-49, wherein the 5’-region and the 3’-region each comprise three cEt sugar moieties and the central region comprises 10 DNA nucleosides.

51. The oligomeric agent of any of claims 40-50, wherein the 5’-region and the 3’-region each comprise five 2’-MOE sugar moieties and the central region comprises 10 DNA nucleosides.

52. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises at least two internucleoside linking groups of Formula I.

53. The oligomeric agent of any of claims 1-52, wherein the modified oligonucleotide comprises at least three internucleoside linking groups of Formula I.

54. The oligomeric agent of any of claims 1-53, wherein the modified oligonucleotide comprises at least four internucleoside linking groups of Formula I.

55. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises exactly two internucleoside linking groups of Formula I.

56. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises exactly three internucleoside linking groups of Formula I.

57. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises exactly four internucleoside linking groups of Formula I.

58. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises no more than four internucleoside linking groups of Formula I.

59. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises no more than five internucleoside linking groups of Formula I.

60. The oligomeric agent of any of claims 1-51, wherein the modified oligonucleotide comprises no more than six internucleoside linking groups of Formula I.

61. The oligomeric agent of any of claims 30-60, wherein the 3’-region comprises at least one internucleoside linking group of Formula I.

62. The oligomeric agent of any of claims 30-60, wherein the 3’-region comprises exactly one internucleoside linking groups of Formula I.

63. The oligomeric agent of any of claims 30-60, wherein the 3’-region comprises at least two internucleoside linking groups of Formula I.

64. The oligomeric agent of any of claims 30-60, wherein the 3’-region comprises exactly two internucleoside linking groups of Formula I.

65. The oligomeric agent of any of claims 30-60, wherein the 3’-region comprises exactly three internucleoside linking groups of Formula I.

66. The oligomeric agent of any of claims 30-65, wherein the 5’-region comprises at least one internucleoside linking groups of Formula I.

67. The oligomeric agent of any of claims 30-65, wherein the 5’-region comprises exactly one internucleoside linking groups of Formula I.

68. The oligomeric agent of any of claims 30-65, wherein the 5’-region comprises at least two internucleoside linking groups of Formula I.

69. The oligomeric agent of any of claims 30-65, wherein the 5’-region comprises exactly two internucleoside linking groups of Formula I.

70. The oligomeric agent of any of claims 30-65, wherein the 5’-region comprises exactly three internucleoside linking groups of Formula I.

71. The oligomeric agent of any of claims 30-70, wherein each internucleoside linkage within the deoxy region is selected from a phosphorothioate internucleoside linkage and a mesyl phosphoramidate internucleoside linkage.

72. The oligomeric agent of any of claims 30-71, wherein each internucleoside linkage within the 3’- region is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and an internucleoside linking group of Formula I.

73. The oligomeric agent of any of claims 30-72, wherein each internucleoside linkage within the 5’- region is selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and an internucleoside linking group of Formula I.

74. The oligomeric agent of any of claims 30-73, wherein the 5’-region consists of 3-5 linked nucleosides and has the formula: (Nd1)L1(Nd2)L2[(Nd3)L3]p[(Nd4)L4]q(Nd5)L5; wherein Nd1, Nd2, Nd3, Nd4are independently selected from a 2’-substituted nucleoside, a DNA nucleoside, or a nucleoside comprising a sugar surrogate; Nd5is a 2’-substituted nucleoside or a nucleoside comprising a sugar surrogate; p and q are each 0 or 1; wherein each of L1, L2, L3, L4, and each L5is an internucleoside linkage; andwherein at least two of L1, L2, L3, L4are of Formula I.

75. The oligomeric agent of claim 74, wherein p and q are 1 and L2, L3, and L4are of Formula I.

76. The oligomeric agent of claim 74 or 75, wherein L1and L5are phosphorothioate internucleoside linking groups.

77. The oligomeric agent of claim 1, wherein the modified oligonucleotide consists of 20 linked nucleosides and has a linkage motif selected from: s[VI][VI][VI]sssssssssssooss, s[VII][VII][VII]sssssssssssooss, s[VIII][VIII][VIII]sssssssssssooss, s[IX][IX][IX]sssssssssssooss, s[X][X][X]sssssssssssooss, s[XI][XI][XI]sssssssssssooss, s[XII][XII][XII]sssssssssssooss, s[XIII][XIII][XIII]sssssssssssooss, s[XIV][XIV][XIV]sssssssssssooss, s[XV][XV][XV]sssssssssssooss, s[XVI][XVI][XVI]sssssssssssooss, [XVII][XVII][XVII]sssssssssssooss, [XVIII][XVIII][XVIII]sssssssssssooss, s[XIX][XIX][XIX]sssssssssssooss s[XX][XX][XX]sssssssssssooss, s[XXI][XXI][XXI]sssssssssssooss s[XXII][XXII][XXII]sssssssssssooss, wherein each “s” represents a phosphorothioate internucleoside linkage, each “o” represents a phosphodiester internucleoside linkage, each “[VI]” represents a 3,4-dimethoxyphenylsulfonyl phosphoramidate internucleoside linkage (Formula VI), each “[VII]” represents a 3-pyridinesulfonyl phosphoramidate internucleoside linkage (Formula VII), each “[VIII]” represents a 1-methyl-1H-imidazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula VIII), each “[IX]” represents a 2- thiophenesulfonyl phosphoramidate internucleoside linkage (Formula IX), each “[X]” represents a 3,5-dimethylisoxazole-4-sulfonyl phosphoramidate internucleoside linkage (Formula X), each “[XI]” represents a cyclic tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XI), each “[XII]” represents a tetramethylguanidine ethylsulfonyl phosphoramidate internucleoside linkage (Formula XII), each “[XIII]” represents a guanidinium ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIII), each “[XIV]” represents an amino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XIV), each “[XV]” represents a dimethylamino ethylsulfonyl phosphoramidate internucleoside linkage (Formula XV), each “[XVI]” represents a dimethylamino propylsulfonyl phosphoramidate internucleoside linkage (Formula XVI), each “[XIX]” represents a cyclopropylsulfonyl phosphoramidate internucleoside linkage (Formula XX), each “[XX]” represents Formula XX, each “[XXI]” represents Formula XXI, and each “[XXII]” represents Formula XXII.

78. The oligomeric agent of any of claims 52-77, wherein each internucleoside linking group of Formula I is the same.

79. The oligomeric agent of any of claims 1-78, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety selected from a modified furanosyl sugar moiety or a sugar surrogate.

80. The oligomeric agent of claim 79 wherein the first modified oligonucleotide comprises at least one nucleoside comprising a non-bicyclic modified sugar moiety.

81. The oligomeric agent of claim 80, wherein the non-bicyclic modified sugar moiety is a 2’-OMe sugar moiety, a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety.

82. The oligomeric agent of claim 81, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety.

83. The oligomeric agent of claim 79, wherein the first modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety.

84. The oligomeric agent of claim 83, wherein the bicyclic sugar moiety comprises a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'.

85. The oligomeric agent of claim 83, wherein the bicyclic sugar moiety is a cEt sugar moiety.

86. The oligomeric agent of claim 79, wherein the first modified oligonucleotide comprises at least one nucleoside comprising a cyclic sugar surrogate.

87. The oligomeric agent of claim 86, wherein the cyclic sugar surrogate is HNA or FHNA.

88. The oligomeric agent of any of claims 1-87, wherein each subunit of the modified oligonucleotide is a nucleoside or an abasic subunit.

89. The oligomeric agent of claim 88, wherein the modified oligonucleotide comprises exactly one abasic subunit and each remaining subunit is a nucleoside.

90. The oligomeric agent of any of claims 1-89, wherein each subunit of the modified oligonucleotide is a nucleoside.

91. The oligomeric agent of any of claims 1-90, wherein the modified oligonucleotide comprises at least one modified nucleobase.

92. The oligomeric agent of claim 91, wherein the modified nucleobase is 5-methylcytosine or hypoxanthine.

93. The oligomeric agent of any of claims 1-91, wherein each nucleobase of the modified oligonucleotide is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine.

94. The oligomeric agent of any one of claims 1-93, comprising a conjugate group comprising a conjugate linker and a conjugate moiety.

95. The oligomeric agent of claim 94, wherein the conjugate group comprises a cell-targeting moiety.

96. The oligomeric agent of any one of claims 94-95, wherein the conjugate group comprises a GalNAc moiety or a conjugate moiety that binds type 1 transferrin receptor (TfR1).

97. The oligomeric agent of any of claims 1-96, wherein the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length region of a target nucleic acid.

98. The oligomeric agent of any of claims 1-97, wherein the modified oligonucleotide consists of 16, 18, 20, 21, or 23 linked nucleosides.

99. The oligomeric agent of any one of claims 1-98, wherein the modified oligonucleotide is not part of a duplex.

100. The oligomeric agent of any one of claims 1-99, comprising a second modified oligonucleotide comprising linked oligomeric subunits, wherein the number of linked oligomeric subunits in the second modified oligonucleotide is 12-70, wherein the second modified oligonucleotide comprises a duplexing region comprising at least 12 nucleosides, and wherein the nucleobase sequence of the duplexing region is at least 80% complementary to the nucleobase sequence of the modified oligonucleotide.

101. The oligomeric agent of claim 100 wherein the second modified oligonucleotide consists of the duplexing region.

102. The oligomeric agent of any one of claims 100-101, wherein the second modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

103. The oligomeric agent of claim 102, wherein the modified sugar moiety is a modified furanosyl sugar moiety or a sugar surrogate.

104. The oligomeric agent of any one of claims 100-103, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a non-bicyclic modified sugar moiety.

105. The oligomeric agent of claim 104, wherein the non-bicyclic modified sugar moiety is a 2’- OMe sugar moiety, a 2’-MOE sugar moiety, a 2’-F sugar moiety, or a 2’-NMA sugar moiety.

106. The oligomeric agent of claim 104, wherein the non-bicyclic modified sugar moiety is a 2’- OMe sugar moiety or a 2’-F sugar moiety.

107. The oligomeric agent of any one of claims 100-106, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety.

108. The oligomeric agent of claim 107, wherein the bicyclic sugar moiety comprises a 4’-2’ bridge selected from 4'-CH2-O-2' and 4'-CH(CH3)-O-2'.

109. The oligomeric agent of any one of claims 100-108, wherein the second modified oligonucleotide comprises at least one nucleoside comprising a sugar surrogate.

110. The oligomeric agent of any of claims 100-109, wherein each subunit of the second modified oligonucleotide is a nucleoside or an abasic subunit.

111. The oligomeric agent of claim 110, wherein the second modified oligonucleotide comprises exactly one abasic subunit and each remaining subunit is a nucleoside.

112. The oligomeric agent of any of claims 111, wherein each subunit of the second modified oligonucleotide is a nucleoside.

113. The oligomeric agent of any of claims 110-112, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

114. The oligomeric agent of claim 113, wherein the modified nucleobase is 5-methylcytosine or hypoxanthine.

115. The oligomeric agent of any of claims 100-113, wherein each nucleobase of the second modified oligonucleotide is selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified adenine, and unmodified guanine.

116. The oligomeric agent of any of claims 100-115, wherein the second modified oligonucleotide consists of 15-21 linked subunits.

117. The oligomeric agent of any one of claims 100-116, wherein the second modified oligonucleotide is attached to a conjugate group comprising a conjugate linker and a conjugate moiety.

118. The oligomeric agent of claim 117, wherein the conjugate group comprises a cell-targeting moiety.

119. The oligomeric agent of any one of claims 117-118, wherein the conjugate group comprises a GalNAc moiety or a conjugate moiety that binds type 1 transferrin receptor (TfR1).

120. The oligomeric agent of any of claims 100-119, wherein each internucleoside linking group of the second modified oligonucleotide is selected from a phosphodiester internucleoside linking group, a phosphorothioate internucleoside linking group, one or more internucleoside linking groupsof Formula I, a mesyl phosphoramidate internucleoside linking group, a phosphorodithioate internucleoside linking group, and a methyl phosphonate internucleoside linking group.

121. The oligomeric agent of claim 120, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group.

122. The oligomeric agent of claim 121, wherein each internucleoside linking group is selected from an internucleoside linking group of Formula I, a mesyl phosphoramidate internucleoside linking group, and a phosphorothioate internucleoside linking group, and a phosphodiester internucleoside linking group.

123. A pharmaceutical composition comprising the oligomeric agent of any of claims 1-122 and a pharmaceutically acceptable carrier or diluent.

124. A method comprising contacting a cell with the oligomeric agent or pharmaceutical composition of any of claims 1-122.

125. A method of modulating the amount or activity of a target nucleic acid in a cell, comprising contacting the cell with the oligomeric agent or pharmaceutical composition of any of claims 1-124.

126. Use of the oligomeric agent or composition of any of claims 1-123 for treatment of a disease or condition.

127. Use of the oligomeric agent or composition of any of claims 1-123 for a preparation of a medicament for treatment of a disease or condition.

Images