Methods for treating liver diseases using recombinant fusion proteins comprising interleukin-18-binding protein and antigen binding fragment to serum albumin

Abstract

Provided are methods of treating liver diseases comprising administering recombinant proteins comprising an interleukin-18-binding protein and an antigen binding fragment that binds to serum albumin.

Description

METHODS FOR TREATING LIVER DISEASES USING RECOMBINANT FUSION PROTEINS COMPRISING INTERLEUKIN- 18-BINDING PROTEIN AND ANTIGEN BINDING FRAGMENT TO SERUM ALBUMINREFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0001] This application contains a Sequence Listing, which has been electronically submitted in XML format, and is hereby incorporated by reference in its entirety. Said XML copy, created on June 5, 2024, is named 2662-0010W001 SEQL.xml and is 139,264 bytes in size.TECHNICAL FIELD

[0002] The present disclosure relates to methods of treating liver diseases comprising administering recombinant proteins comprising an interleukin- 18-binding protein and an antigen binding fragment that binds to serum albumin.BACKGROUND

[0003] Autoimmune diseases are caused by autoimmunity due to abnormality in the body's immune system and cause the immune system to incorrectly react to normal chemicals and some cells in the body. The human immune system basically recognizes microorganisms invading the human body as foreign antigens and normally attacks and removes them but does not attack its own cells due to its self-tolerance. However, when the self-tolerance of the immune system is destroyed, the human body continuously destroys its own cells, causing inflammation and immune responses while autoreactive T cells, in response to own cells (or autoantigens), are activated and autoantibodies are generated.

[0004] Interleukin- 18 (IL- 18) is a pro-inflammatory cytokine that plays a crucial role in the immune system by regulating immune response to infection and inflammation. IL- 18 is secreted by activation of NOD-like receptor family, pyrin domain-containing 3 (NLRP3) inflammasome and stimulates natural killer (NK) cells and T lymphocytes to produce type 1 cytokines such as interferon-gamma (IFN-y) (Harel et al., 2022). While IL- 18 is essential for mounting an effective immune response, uncontrolled action and production of IL- 18 can lead to harmful catastrophe to drive chronic inflammation and tissue damage. Therefore, our body employs a natural neutralizer for IL- 18 known as IL- 18 binding protein (IL-18BP) which is a soluble protein that directly binds to IL- 18, thereby blocking its interaction with IL- 18 receptors (Park et al., 2022). IL-18BP prevents exerting pro-inflammatory activation of IL- 18 and helps to maintain immune homeostasis. Impaired balance of IL- 18 and IL-18BP has beenimplicated in various disorders, including autoimmune diseases, cancers, and infectious diseases (Harel et al., 2022).

[0005] There is a need to develop anti-inflammatory therapeutic agents capable of increasing administration convenience and efficiency for patients by reducing the dosage and frequency of administration while minimizing side effects.SUMMARY OF THE INVENTION

[0006] Disclosed herein are methods of treating liver diseases, such as but not limited to primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis.

[0007] Disclosed herein are methods of treating primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, and / or inflammatory bowel disease (IBD) in a subject in need thereof, comprising administering to the subject a recombinant fusion protein comprising an interleukin- 18 -binding protein (IL-18BP) and an antigen binding fragment (Fab) against serum albumin. In some embodiments, the recombinant fusion protein inhibits PSC-induced fibrosis to inhibit development of senescent-associated phenotype (SASP) mediated inflammation, reactive cholangiocytes, elevated alkaline phosphatase (ALP) and gammaglutamyl transferase (GGT) activity, reduce bile acid level, and / or downregulate mRNA expression of fibrotic marker genes (e.g., Collal, Acta2, and Timpl).

[0008] Also disclosed herein are methods of treating nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis in a subject in need thereof, comprising administering to the subject a recombinant fusion protein comprising an interleukin- 18-binding protein (IL- 18BP) and an antigen binding fragment (Fab) against serum albumin. In some embodiments, the methods further comprise administering an anti-steatotic agent to the subject. In some embodiments, the recombinant fusion protein inhibits hepatic fibrogenesis, fibrotic and inflammatory marker genes in STAM livers, and / or fibrogenic activation of HSCs.

[0009] The recombinant fusion proteins include an interleukin- 18-binding protein and an antigen binding fragment against serum albumin.

[0010] Also disclosed herein are pharmaceutical compositions for preventing or treating theliver diseases, the pharmaceutical compositions including the recombinant fusion protein as an active ingredient.

[0011] The fusion proteins can further comprise a linker that links the IL-18BP to the Fab. In some embodiments, the linker links the IL-18BP to a C-terminus of the heavy chain constantdomain, an N-terminus of the heavy chain variable domain, a C-terminus of the light chain constant domain, and / or an N-terminus of the light chain variable domain of the Fab. In some embodiments, the linker links the IL-18BP to a C-terminus of the heavy chain constant domain. In some embodiments, the linker comprises 1 to 50 amino acids. In some embodiments, the linker comprises an amino acid sequence of any one of SEQ ID NOS: 16 and 70-84.

[0012] In some embodiments, in the fusion proteins disclosed herein, the heavy chain and the light chain of the Fab are bound by a noncovalent bond.

[0013] The Fab can comprise a heavy chain comprising a heavy chain variable domain comprising( 1 ) a heavy chain complementarity determining domain 1 (CDR 1 ) comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain complementarity determining domain 2 (CDR2) comprising the amino acid sequence of WINTYSGGTKYAQKFQG (SEQ ID NO:23), and a heavy chain complementarity determining domain 3 (CDR3) comprising the amino acid sequence of LGHCQRGICSDALDT (SEQ ID NO:24);(2) a heavy chain CDR1 comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain CDR2 comprising the amino acid sequence ofRINTYNGNTGYAQRLQG (SEQ ID NO:25), and a heavy chain CDR3 comprising the amino acid sequence ofLGHCQRGICSDALDT (SEQ ID NO:24);(3) a heavy chain CDR1 comprising the amino acid sequence of NYGIH (SEQ ID NO:26), a heavy chain CDR2 comprising the amino acid sequence ofSISYDGSNKYYADSVKG (SEQ ID NO:27), and a heavy chain CDR3 comprising the amino acid sequence ofDVHYYGSGSYYNAFDI (SEQ ID NO:28);(4) a heavy chain CDR1 comprising the amino acid sequence of SYAMS (SEQ ID NO:29), a heavy chain CDR2 comprising the amino acid sequence ofVISHDGGFQYYADSVKG (SEQ ID NO:30), and a heavy chain CDR3 comprising the amino acid sequence ofAGWLRQYGMDV (SEQ ID NO:31);(5) a heavy chain CDR1 comprising the amino acid sequence of AYWIA (SEQ ID NO:32), a heavy chain CDR2 comprising the amino acid sequence of MIWPPDADARYSPSFQG (SEQ ID NO:33), and a heavy chain CDR3 comprising the amino acid sequence of LYSGSYSP (SEQ ID NO:34); or(6) a heavy chain CDR1 comprising the amino acid sequence of AYSMN (SEQ ID NO:35), a heavy chain CDR2 comprising the amino acid sequence ofSISSSGRYIHYADSVKG (SEQ ID NO:36), and a heavy chain CDR3 comprising the amino acid sequence ofETVMAGKALDY (SEQ ID NO:37); and a light chain comprising a light chain variable domain comprising(7) a light chain CDR1 comprising the amino acid sequence of RASQSISRYLN (SEQ ID NO:38), a light chain CDR2 comprising the amino acid sequence of GASRLES (SEQ ID NO:39), and a light chain CDR3 comprising the amino acid sequence of QQSDSVPVT (SEQ ID NO:40);(8) a light chain CDR1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO:41), a light chain CDR2 comprising the amino acid sequence of AASSLQS (SEQ ID NO:42), and a light chain CDR3 comprising the amino acid sequence of QQSYSTPPYT (SEQ ID NO:43);(9) a light chain CDR1 comprising the amino acid sequence of RASQSIFNYVA (SEQ ID NO:44), a light chain CDR2 comprising the amino acid sequence of DASNRAT (SEQ ID NO:45), and a light chain CDR3 comprising the amino acid sequence of QQRSKWPPTWT (SEQ ID NO:46);(10) a light chain CDR1 comprising the amino acid sequence of RASETVSSRQLA (SEQ ID NO:47),a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QQYGSSPRT (SEQ ID NO:49);(11) a light chain CDR1 comprising the amino acid sequence of RASQSVSSSSLA (SEQ ID NO:50), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QKYSSYPLT (SEQ ID NO:51); or(12) a light chain CDR1 comprising the amino acid sequence of RASQSVGSNLA (SEQ ID NO:52), a light chain CDR2 comprising the amino acid sequence of GASTGAT (SEQ ID NO:53), and a light chain CDR3 comprising the amino acid sequence of QQYYSFLAKT (SEQ ID NO:54).

[0014] In some embodiments, in the fusion proteins disclosed herein, the heavy chain variable domain comprises a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO:35, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:36, and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO:37; and the light chain variable domain comprises a light chain CDR1 comprising the amino acid sequence of SEQ ID NO:52, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO:53, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:54.

[0015] In some embodiments, the heavy chain variable domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60. In some embodiments, the light chain variable domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:61, 62, 63, 64, 65, 66, or 67. In some embodiments, the heavy chain variable domain comprises an amino acid sequence of SEQ ID NO:55, 56, 57, 58, 59, or 60, and the light chain variable domain comprises an amino acid sequence of SEQ ID NO:61, 62, 63, 64, 65, 66, or 67. In some embodiments, the heavy chain constant domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:68. In some embodiments, the light chain constant domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:69.

[0016] The IL-18-binding protein can comprise an amino acid sequence having at least 90% identity to SEQ ID NO:7. In some embodiments, the IL- 18 -binding protein comprises an amino acid sequence of SEQ ID NO:7.

[0017] In some embodiments, the heavy chain of the Fab comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 19. In some embodiments, the heavy chain of the Fab comprises an amino acid sequence of SEQ ID NO: 19. In some embodiments, the fusion protein comprises an amino acid sequence having at least 90% identity to SEQ ID NO: 13 and an amino acid sequence having at least 90% identity to SEQ ID NO: 19. In some embodiments, the fusion protein comprises an amino acid sequence of SEQ ID NO: 13 and an amino acid sequence of SEQ ID NO: 19.

[0018] Also disclosed herein are nucleic acid molecules encoding any of the recombinant fusion proteins disclosed herein.

[0019] Further disclosed herein are expression vectors comprising any of the nucleic acid molecules disclosed herein.

[0020] Disclosed herein are cells transformed with any of the expression vectors disclosed herein.

[0021] Disclosed herein are compositions comprising any of the recombinant fusion proteins disclosed herein. Also disclosed herein are pharmaceutical compositions comprising any of the compositions disclosed herein and a pharmaceutically acceptable excipient. Also disclosed are kits comprising any of the compositions disclosed herein and a label comprising instructions for a use.BRIEF DESCRIPTION OF DRAWINGS

[0022] FIGS. 1A-1B. Heavy chain (FIG. 1A) and light chain (FIG. IB) expression vectors for the preparation of a recombinant fusion protein.

[0023] FIG. 2. A schematic structure of an APB-R3 protein.

[0024] FIG. 3. SDS-PAGE results of analyzing the size of the APB-R3 protein in an amount of 1 pg / we 11 and 2 pg / well under reducing (R), non-reducing and boiled (NR(B)), and nonreducing and non-boiled (NR(NB)) conditions.

[0025] FIG. 4. SEC-HPLC results of analyzing purity of the APB-R3 protein.

[0026] FIG. 5. Results of analyzing an isoelectric point of the APB-R3 protein.

[0027] FIG. 6. A graph showing IL- 18 inhibition in a KG-1 cell line by the APB-R3 protein.

[0028] FIG. 7. A graph showing IL-18 inhibition in mouse CD4+ T cells by the APB-R3 protein.

[0029] FIG. 8. A graph showing protein concentrations in blood after subcutaneous administration of the APB-R3 protein into rats.

[0030] FIG. 9. A graph showing protein concentrations in blood after intravenous administration of the APB-R3 protein into rats.

[0031] FIG. 10. A graph showing body weight of mice in Macrophage activation syndrome (MAS) disease model.

[0032] FIGS. 11A-11B. Graphs showing spleen weight / body weight and Liver weight / body weight of mice in Macrophage activation syndrome (MAS) disease model.

[0033] FIGS. 12A-12B. Graphs showing the levels of serum Aspartate aminotransferase (AST) and Alanine aminotransferase (ALT) of mice in Macrophage activation syndrome (MAS) disease model.

[0034] FIGS. 13A-13B. Graphs showing the levels of serum IFN-y and CXCL9 of mice in Macrophage activation syndrome (MAS) disease model.

[0035] FIG. 14. A graph showing the cell population of splenic monocytes / macrophages of mice in Macrophage activation syndrome (MAS) disease model.

[0036] FIGS. 15A-15F. IL-18 signaling is activated in DDC diet-induced cholestatic disease. Male C57BL / 6 mice were fed with DDC diet for 3 weeks. Representative images of (FIG. 15A) H&E staining and (FIG. 15B) Sirius red staining for liver sections. (FIG. 15C) Quantitative real time PCR analysis of the transcript levels of 1118 and Ill8bp in the liver (n = 4 or 5). (FIG. 15D) The protein levels of total IL-18, IL-18BP and free IL-18 in the liver (n = 10). (E) Quantitative real time PCR analysis of the transcript levels of Ill8rl and Ill8rap in the liver (n = 4 - 10). (FIG. 15F) Representative images of co-immunostaining for CK19 (green) and IL- 18RD (red) in liver sections. *P < 0.05, **P < 0.01 and ***P < 0.001. The bar represents mean ± SD. The data were analyzed by the Student’s t-test for simple comparisons.

[0037] FIGS. 16A-16G. APB-R3 ameliorates progression of DDC diet-induced PSC. 6- week-old C57BL / 6 male mice were fed with chow or DDC diet for 3 weeks. The mice were intraperitoneally administered with APB-R3 at a dose of 10 mg / kg thrice weekly for 3 weeks. (FIG. 16A) Schematic representation of experimental procedure to test the effect of APB-R3 in mice fed with DDC diet. (FIG. 16B) Body and liver weight. (FIG. 16C) Plasma ALP, GGT, ALT and AST levels were quantified with an automated enzyme assay (n = 9 or 10). (FIG. 16D) Plasma levels of total bile acids (n = 5 or 9). (FIG. 16E) Representative images of H&E staining. (FIG. 16F) Representative images (left) and quantification (right) of CK19-positive immunostained regions in sectioned livers (n = 10). FIG. 16G. KrtlO mRNA level, fold change; Chow (n=10), DDC vechicle (n=8), and DDC r3 (n=8). *P < 0.05, **P < 0.01 and***P<o.OOl. The bar represents mean ± SD. The data were analyzed by one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0038] FIGS. 17A-17C. Blockade of IL-18 via APB-R3 treatment reduces peribiliary fibrosis. (FIG. 17A) Sirius red staining (top) and alpha-SMA staining (bottom) of liver sections, and quantification of positive area (right) (n = 3 - 10). (FIG. 17B) Hepatic collagen hydroxyproline levels were measured (n = 5 or 10). (FIG. 17C) The mRNA levels of fibrotic markers such as Collal, Acta2 and Timpl in the liver were measured by RT-qPCR (n = 5 or 8). *P < 0.05, **P < 0.01 and ***P < 0.001. The bar represents mean ± SD. The data were analyzed by one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0039] FIGS. 18A-18C. APB-R3 represses hepatic expressions of SASP markers. (FIG. 18A) The mRNA levels of SASP markers such as Tgfb, Illb, Cdkn2a and Cdknlb in the liver were measured by RT-qPCR (n = 5 or 8). (FIG. 18B) Representative western blot for p21, pl6, and HSP60 in the liver. (FIG. 18C) The quantification of beta-gal-positive areas in sectioned livers (n = 5 or 9). *P < 0.05, **P < 0.01 and ***P < 0.001. The bar represents mean ± SD. The data were analyzed by one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0040] FIGS. 19A-19H. Hepatic IL-18 and IL-18BP are elevated under NASH condition. Male C57BL / 6 mice were fed FPC diet for 16 weeks or with MCD diet for 6 weeks. (FIG. 19A) Measurement of Ill8bp, 1118, and Nlrp3 mRNA levels in the livers obtained from chow or FPC diet-fed mice by qRT-PCR (n=8). (FIG. 19B) Measurement of Ill8bp, 1118, and Nlrp3 mRNA levels in the livers obtained from chow or MCD diet-fed mice by qRT-PCR (n=3 or 8). (FIG. 19C) ELISA assay was conducted to measure hepatic amounts of IL-18, IL-18BP, and free IL 18 in FPC (left, n=5 or 8) or MCD (right, n=8) diet-fed mice. (FIG. 19D) Measurement of Ill8rl, and Ill8rap mRNA levels in the livers obtained from chow or FPC diet-fed mice by qRT-PCR (n=5 or 8). (FIG. 19E) ELISA assay was conducted to measure concentrations of IL- 18, IL-18BP, and free IL18 in plasma of human patients with healthy, NAFLD, NASH Fl, and NASH F3-4 stage (n=8-10). (FIG. 19F) Gene expression analysis was conducted using public data sets obtained from GEO site at the NCBI (GSE61260). Hepatic mRNA levels of 1L18BP, IL18, IL18R1, and IL18RAP were analyzed. (FIG. 19G) Ileum-derived IL- 18 was also enhanced in NASH condition. (FIG. 19H) The transcriptional expressions of IL- 18 receptor (Ill8rl, Ill8rap) were also increased in the NASH liver. The data processed as quantile normalized intensity value (n=38 for normal; n=24 for NASH). *P < 0.05, **P < 0.01 and ***P < 0.001. The data represent mean ± SEM. The data were analyzed by the Student’s t-test for simple comparisons or one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0041] FIGS. 20A-20I. Augmented IL- 18 leads to release of hepatic IL-18BP via T cell-driven IFNgammaproduction. (FIG. 20A) Representative images of IL18BP immunostaining in FPC and MCD diet-fed liver sections. (FIG. 20B) Measurement of Il-18bp mRNA levels treated with pro-inflammatory cytokines in primary hepatocytes (n=4). (FIG. 20C) Immunoblot for IL18BP in cell supernatant obtained from IFNgamma-treated primary hepatocytes. (FIG. 20D) Primary hepatocytes were treated with IFNgammaas indicated concentrations (18 hr) and time intervals (20 ng / ml), and then Ill8bp mRNA levels were measured (n=3 or 4) (FIG. 20E) Measurement of Ifng mRNA levels in the livers obtained from FPC (left, n=8) or MCD (right, n=3 or 8) diet-fed mice. (FIG. 20F) ELISA assay was conducted to measure hepatic amounts of IFNgamma in FPC (left, n=4 or 6) or MCD (right, n=7) diet-fed mice. (FIG. 20G) The numbers of IFNy-positive Thl cells in the FPC (left, n=5 or 8) or MCD (right, n=8) diet-fed livers were analyzed by flow cytometry. (FIG. 20H) Primary hepatocytes were incubated with conditioned medium (CM) from the culture of anti-CD3 or recombinant IL- 18 (rIL-18)- pretreated CD4 T cells for 18 hr. Measurement of Ill8bp mRNA levels were performed by qRT- PCR (left, n=4). The concentrations of IFNy (right) in hepatocytes medium were measured (right, n=4). (FIG. 201) Primary hepatocytes were incubated with CM from the culture of anti- CD3, recombinant IL- 18 (rIL-18) or anti-IFNgamma-pretreated CD4 T cells for 18 hr. Measurement of Ill8bp mRNA levels were performed by qRT-PCR (n=4). *P < 0.05, **P < 0.01 and ***P < 0.001. The data represent mean ± SEM. The data were analyzed by the Student’s t-test for simple comparisons or one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0042] FIGS. 21A-21H. Knockout of IL-18BP worsens liver inflammation and fibrosis in NASH models. 8-week-old C57BL6 wild-type (WT) and IL-18BP knockout (KO) mice were fed FPC diet for 15 weeks. (FIG. 21 A) Representative captured livers (left) and the liver / body weight ratio at the end of experiments (right). (FIG. 2 IB) Measurement of plasma ALT and AST levels. (FIG. 21C) H&E and Oil red O-stained liver sections (left). Hepatic TG levels were measured (right). (FIG. 21D) NAS score and numbers of inflammatory foci of liver histology. (FIG. 2 IE) The numbers of Ly6Chlmonocyte-derived cells (MDCs) and IFNy- positive Thl cells were analyzed by flow cytometry in the liver. (FIG. 2 IF) Sirius red-stained liver sections. (FIG. 21G) Measurement of hepatic hydroxyproline. (FIG. 21H) Measurement of mRNA levels of pro-inflammatory and fibrosis genes such as Ifng, Tnfa, Ccl2, Collal, Col3al, Acta2 and Timpl in the liver. *P < 0.05, **P < 0.01 and ***p < 0.001. The data represent mean ± SEM. n=5-l 1 per mice group. The data were analyzed by one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0043] FIGS. 22A-22G. Treatment of APB-R3, a long-acting IL-18BP, completely ameliorates NASH symptoms by combination therapy of GLP1R agonist. C57BL6 wild-type were fed FPC diet for 19 weeks. Drugs were administered from 11 to 19 weeks. 8 mg / kg of APB-R3 (SAFA-hIL18BP) and / or 100 pg / kg of GLP1 agonist (Liraglutide®) were administered three times a week as indicated. (FIG. 22A) Representative captured livers. (FIG. 22B) The ratio of liver / body weight (left) and plasma ALT levels (right) were measured at the end of experiments. (FIG. 22C) H&E and Oil red O-stained liver sections. (FIG. 22D) NAS score and numbers of inflammatory foci of liver histology. (FIG. 22E) The numbers of Ly6ChlMDCs were analyzed by flow cytometry in the liver. (FIG. 22F) ELISA assay was conducted to measure hepatic amounts of IFNgamma. (FIG. 22G) The numbers of IFNy-positive Thl, CD8 T and ILC1 were analyzed by flow cytometry in the liver. *P < 0.05, **P < 0.01 and ***p < 0.001. The data represent mean ± SEM. n=4-8 per mice group. The data were analyzed by one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0044] FIGS. 23A-23I. APB-R3 largely ameliorates hepatic fibrosis progression. (FIG. 23A) Measurement of mRNA levels of fibrosis genes such as Collal, Col3al, Acta2, and Des in non-activated (Day 3) and activated (Day 5) primary hepatic stellate cells (HSCs). APB-R3 were treated at Day 4 for 18 hr (n=4). (FIG. 23B) Immunofluorescence images of primary HSCs for alpha-SMA. (FIGS. 23C-23G) C57BL6 wild-type were fed FPC diet for 19 weeks. Drugs were administered from 11 to 19 weeks. 8 mg / kg of APB-R3 (SAFA-hIL18BP) and / or 100 pg / kg of GLP1 agonist (Liraglutide®) were administered three times a week as indicated. (FIG. 23C) Sirius red and aSMA-stained liver sections. (FIG. 23D) Fibrosis score of liver histology. (FIG. 23E) Measurement of mRNA levels of fibrosis genes such as Collal and Timpl in the livers. (FIG. 23F) Measurement of hepatic hydroxyproline. (FIG. 23G) ELISA assay was conducted to measure plasma procollagen type III N-terminal (Pro-C3). (FIGS. 23H and 231) C57BL6 wild-type were administered with carbon tetrachloride (CCL) for 5 weeks. 8 mg / kg of APB-R3 or PBS were administered three times a week at 3 to 5 weeks. (FIG. 23H) Sirius red-stained liver sections (left) and positive area were analyzed by ImageJ (right). (FIG. 231) ELISA assay was conducted to measure plasma Pro-C3. *P < 0.05, **P < 0.01 and ***P < 0.001. The data represent mean ± SEM. n=4-8 per mice group. The data were analyzed by the Student’s t-test for simple comparisons or one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0045] FIGS. 24A-24G. APB-R3 exhibits therapeutic effectiveness to alleviate liver injuries in a STAM NASH model. (FIG. 24A) STAM mice were intraperitoneally injected with 10 mg / kg dose of APB-R3 three times a week or orally gavaged with 5 mg / kg dose of Telmisartanonce daily from 6 to 12 weeks of age. (FIG. 24B) Liver / body weight ratio at the end of the experiment in the STAM model. (FIG. 24C) Plasma ALT and AST activity were measured. (FIG. 24D) H&E-stained liver sections (left) and hepatic TG levels (right). (FIG. 24E) Sirius red-stained liver sections (left). Sirius red-positive area were analyzed by ImageJ (right). (FIG. 24F) Measurement of hepatic hydroxyproline. (FIG. 24G) Measurement of mRNA levels of fibrosis genes such as Called, Acta2, and Illb in the liver (n=. *P < 0.05, **P < 0.01 and ***P < 0.001. The data represent mean ± SEM. n=4-9 per mice group. The data were analyzed by one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0046] FIG. 25. IL18BP KO Strategy. IL-18BP knockout (KO) mice by CRISPR / Cas9 method and investigated the effect of IL-18BP deficiency on NASH progression (FIG. 25) (Jang et al., 2023).

[0047] FIGS. 26A and 26B. MCD Model IL18BP. The numbers of inflammatory foci were reduced by APB-R3 in MCD diet-induced acute NASH livers (FIG. 26A). The effects of APB- R3 on hepatic fibrotic regression were also observed in MCD diet-fed mice (FIG. 26B).

[0048] FIGS. 27A and 27B. Activated HSCs induce IL-18 production by increased expression of NLRP3.

[0049] FIGS. 28A-28F. Therapeutic effects of APB-R3 on CC14-induced liver fibrosis. As shown, FIG. 28A is a schematic of CC14-induced liver fibrosis mouse model with vehicle or APB-R3 intraperitoneal injection. FIG. 28B shows Sirius red stained sections of CC14- induced liver with vehicle (left) or APB-R3 (right) injection (x40 original magnification). FIG. 28C shows that Sirius red positive area was quantified in CC14-induced liver. FIG. 28D is a Western blot analysis of aSMA in the liver of the CC14+ Vehicle and CC14+APB-R3. In FIG. 29E, the relative band intensity refers to the intensity of aSMA normalized to that of GAPDH. FIG. 28F show total hepatic hydroxyproline levels quantified from CC14-induced liver with vehicle or APB-R3. *P < 0.01 and ***P < 0.0001. Scale bars represent 200pm. The data represent means ± SEM. The data were analyzed by the Student’s t-test for simple comparisons or one-way ANOVA with Tukey’s post hoc test for multiple groups.DETAILED DESCRIPTIONMethods and Uses for Treatment

[0050] Disclosed herein are methods of treating liver diseases, such as but not limited to primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis.

[0051] Disclosed herein are methods of treating primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, and / or inflammatory bowel disease (IBD) in a subject in need thereof, comprising administering to the subject a recombinant fusion protein comprising an interleukin- 18 -binding protein (IL-18BP) and an antigen binding fragment (Fab) against serum albumin. In some embodiments, the recombinant fusion protein inhibits PSC-induced fibrosis to inhibit development of senescent-associated phenotype (SASP) mediated inflammation, reactive cholangiocytes, elevated alkaline phosphatase (ALP) and gammaglutamyl transferase (GGT) activity, reduce bile acid level, and / or downregulate mRNA expression of fibrotic marker genes (e.g., Collal, Acta2, and Timpl).

[0052] Also disclosed herein are methods of treating nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis in a subject in need thereof, comprising administering to the subject a recombinant fusion protein comprising an interleukin- 18-binding protein (IL- 18BP) and an antigen binding fragment (Fab) against serum albumin. In some embodiments, the methods further comprise administering an anti-steatotic agent to the subject. In some embodiments, the recombinant fusion protein inhibits hepatic fibrogenesis, fibrotic and inflammatory marker genes in STAM livers, and / or fibrogenic activation of HSCs.

[0053] The subject can be a human or non-human mammal, such as pets and farm animals. The term “subject” refers to a subject or patient in need of treatment.

[0054] As used herein, the term “treating” or “treatment” means all of actions by which symptoms of the disease or condition have improved, been eliminated, or been modified favorably by administering the compositions disclosed herein.

[0055] Also disclosed herein are uses of the compositions disclosed herein for the treatment of liver diseases or conditions such as PSC or NASH in subjects in need thereof. Also disclosed herein are the compositions disclosed herein for use in the treatment of liver diseases or conditions such as PSC or NASH in subjects in need thereof. Also disclosed herein are the use of the compositions disclosed herein for the manufacture of a medicament for treatment of liver diseases or conditions such as PSC or NASH in subjects in need thereof.

[0056] In some embodiments, the compositions decrease white blood cells in blood of the subject. In some embodiments, the white blood cells are neutrophils, monocytes, basophils, or a combination thereof.

[0057] In some embodiments, an elimination half-life (Tl / 2) of the recombinant proteins disclosed herein is at least about 2-fold greater, at least 2.5-fold, at least about 3-fold greater, at least 3.5-fold, at least about 4-fold greater, at least about 5-fold greater, at least about 7-fold greater, at least about 10-fold greater, or any folds or ranges of fold derived therefrom greaterthan that of IL- 18BP. In some embodiments, the recombinant protein has an elimination halflife (Tl / 2) of about 8 hrs to about 20 hrs, about 10 hrs to about 18 hours, about 12 hrs to about 15 hrs, or any half-life or ranges derived therefrom. In some embodiments, a Tmax of the recombinant protein is at least about 10% to about 200% higher, about 50% to 100% higher, about 50% to 75% higher, or any % or ranges of % derived therefrom greater than a Tmax of IL-18BP. In some embodiments, a dose of the recombinant protein at about 360 ug / kg of the subject provides a Tmax of about 8 hrs to about 20 hrs, about 10 hrs to about 15 hrs, about 12 hrs to about 14 hrs, or any Tmax or ranges of Tmax derived therefrom. In some embodiments, a Cmax of the recombinant protein is at least about 10% higher, at least about 20% higher, at least about 30% higher, or any % or ranges of % derived therefrom than a Cmax of IL-18BP. In some embodiments, a dose of the recombinant protein at about 360 ug / kg of the subject provides a Cmax of about 700 ng / ml to about 1000 ng / ml, about 750 ng / ml to about 900 ng / ml, about 800 ng / ml to about 850 ng / ml, or any doses or ranges of doses derived therefrom. In some embodiments, an AUClast of the recombinant protein is at least about 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, or any fold or ranges of folds derived therefrom than an AUClast of an IL-18BP. In some embodiments, a dose of the recombinant protein at about 360 ug / kg of the subject provides an AUClast of about 8000 hr*ng / ml to about 25000 hr*ng / ml, about 16000 hr*ng / ml to about 22000 hr*ng / ml, about 18000 hr*ng / ml to about 20000 hr*mg / ml, or any concentrations or ranges of concentrations derived therefrom.

[0058] In some aspects, presented herein are methods for modulating one or more immune functions or responses in a subject, comprising to a subject in need thereof administering an antibody described herein, or a composition thereof. Disclosed herein are methods for activating, enhancing or inducing one or more immune functions or responses in a subject, comprising to a subject in need thereof administering an antibody or a composition thereof. In some embodiments, presented herein are methods for preventing and / or treating diseases in which it is desirable to activate or enhance one or more immune functions or responses, comprising administering to a subject in need thereof an antibody described herein or a composition thereof. In certain embodiments, presented herein are methods of treating an autoimmune disease or condition comprising administering to a subject in need thereof an antibody or a composition thereof.

[0059] In some embodiments, the fusion proteins disclosed herein activate, enhance, or induce one or more immune functions or responses in a subject by at least 99%, at least 98%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least50%, at least 45%, at least 40%, at least 45%, at least 35%, at least 30%, at least 25%, at least 20%, or at least 10%, or in the range of between 10% to 25%, 25% to 50%, 50% to 75%, or 75% to 95% relative to the immune function in a subject not administered the recombinant protein described herein using assays well known in the art, e.g., ELISPOT, ELISA, and cell proliferation assays.

[0060] Pharmaceutical compositions described herein can be useful in enhancing, inducing, or activating the activities of the recombinant proteins disclosed herein and treating a disease or condition.

[0061] The compositions to be used for in vivo administration can be sterile. This is readily accomplished by filtration through, e.g., sterile filtration membranes.

[0062] Still other aspects provide a pharmaceutical composition for preventing or treating liver diseases as disclosed herein, the pharmaceutical composition including the recombinant fusion protein as an active ingredient. Still other aspects provide a method of preventing or treating liver diseases as disclosed herein, the method including administering the recombinant fusion protein to an individual. Specific details of the recombinant fusion protein are as described above.Antibodies and Fragments Thereof

[0063] Disclosed herein are methods of treating liver diseases, such as but not limited to primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis, comprising administer to subjects in need thereof recombinant fusion proteins comprising an interleukin- 18 -binding protein (IL-18BP) and an antigen binding fragment (Fab) against serum albumin. The fusion proteins can further comprise a linker that links the IL- 18BP to the Fab.

[0064] In some embodiments, in the fusion proteins disclosed herein, the heavy chain and the light chain of the Fab are bound by a noncovalent bond.

[0065] The Fab can comprise a heavy chain comprising a heavy chain variable domain comprising( 1 ) a heavy chain complementarity determining domain 1 (CDR 1 ) comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain complementarity determining domain 2 (CDR2) comprising the amino acid sequence of WINTYSGGTKYAQKFQG (SEQ ID NO:23), anda heavy chain complementarity determining domain 3 (CDR3) comprising the amino acid sequence of LGHCQRGICSDALDT (SEQ ID NO:24);(2) a heavy chain CDR1 comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain CDR2 comprising the amino acid sequence ofRINTYNGNTGYAQRLQG (SEQ ID NO:25), and a heavy chain CDR3 comprising the amino acid sequence ofLGHCQRGICSDALDT (SEQ ID NO:24);(3) a heavy chain CDR1 comprising the amino acid sequence of NYGIH (SEQ ID NO:26), a heavy chain CDR2 comprising the amino acid sequence ofSISYDGSNKYYADSVKG (SEQ ID NO:27), and a heavy chain CDR3 comprising the amino acid sequence ofDVHYYGSGSYYNAFDI (SEQ ID NO:28);(4) a heavy chain CDR1 comprising the amino acid sequence of SYAMS (SEQ ID NO:29), a heavy chain CDR2 comprising the amino acid sequence ofVISHDGGFQYYADSVKG (SEQ ID NO:30), and a heavy chain CDR3 comprising the amino acid sequence ofAGWLRQYGMDV (SEQ ID NO:31);(5) a heavy chain CDR1 comprising the amino acid sequence of AYWIA (SEQ ID NO:32), a heavy chain CDR2 comprising the amino acid sequence of MIWPPDADARYSPSFQG (SEQ ID NO:33), and a heavy chain CDR3 comprising the amino acid sequence of LYSGSYSP (SEQ ID NO:34); or(6) a heavy chain CDR1 comprising the amino acid sequence of AYSMN (SEQ ID NO:35), a heavy chain CDR2 comprising the amino acid sequence ofSISSSGRYIHYADSVKG (SEQ ID NO:36), and a heavy chain CDR3 comprising the amino acid sequence ofETVMAGKALDY (SEQ ID NO:37); and a light chain comprising a light chain variable domain comprising(7) a light chain CDR1 comprising the amino acid sequence of RASQSISRYLN (SEQ ID NO:38), a light chain CDR2 comprising the amino acid sequence of GASRLES (SEQ ID NO:39), and a light chain CDR3 comprising the amino acid sequence of QQSDSVPVT (SEQ ID NO:40);(8) a light chain CDR1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO:41), a light chain CDR2 comprising the amino acid sequence of AASSLQS (SEQ ID NO:42), and a light chain CDR3 comprising the amino acid sequence of QQSYSTPPYT (SEQ ID NO:43);(9) a light chain CDR1 comprising the amino acid sequence of RASQSIFNYVA (SEQ ID NO:44), a light chain CDR2 comprising the amino acid sequence of DASNRAT (SEQ ID NO:45), and a light chain CDR3 comprising the amino acid sequence of QQRSKWPPTWT (SEQ ID NO:46);(10) a light chain CDR1 comprising the amino acid sequence of RASETVSSRQLA (SEQ ID NO:47), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QQYGSSPRT (SEQ ID NO:49);(11) a light chain CDR1 comprising the amino acid sequence of RASQSVSSSSLA (SEQ ID NO:50), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QKYSSYPLT (SEQID NO:51); or(12) a light chain CDR1 comprising the amino acid sequence of RASQSVGSNLA (SEQ ID NO:52), a light chain CDR2 comprising the amino acid sequence of GASTGAT (SEQ ID NO:53), anda light chain CDR3 comprising the amino acid sequence of QQYYSFLAKT (SEQ ID NO:54).

[0066] In some embodiments, the heavy chain variable domain comprises a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO:35, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:36, and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO:37, and the light chain variable domain comprises a light chain CDR1 comprising the amino acid sequence of SEQ ID NO:52, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO:53, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:54.

[0067] In some embodiments, the heavy chain variable domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60. In some embodiments, the light chain variable domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:61, 62, 63, 64, 65, 66, or 67. In some embodiments, the heavy chain variable domain comprises an amino acid sequence of SEQ ID NO:55, 56, 57, 58, 59, or 60, and the light chain variable domain comprises an amino acid sequence of SEQ ID NO:61, 62, 63, 64, 65, 66, or 67. In some embodiments, the heavy chain constant domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:68. In some embodiments, the light chain constant domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:69.

[0068] In some embodiments, the heavy chain of the Fab comprises an amino acid sequence of SEQ ID NO: 19. In some embodiments, the fusion protein comprises an amino acid sequence of SEQ ID NO:13 and an amino acid sequence of SEQ ID NO:19.

[0069] In some embodiments of the recombinant proteins disclosed herein, the heavy chain variable domain comprises a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO:35, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:36, and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO:37, and the light chain variable domain comprises a light chain CDR1 comprising the amino acid sequence of SEQ ID NO:52, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO:53, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:54.

[0070] In some embodiments, the heavy chain variable domain comprises an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60.

[0071] In some embodiments, the light chain variable domain comprises an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:61, 62, 63, 64, 65, 66, or 67.

[0072] In some embodiments, the heavy chain variable domain comprises the amino acid sequence of SEQ ID NO:55, 56, 57, 58, 59, or 60, and the light chain variable domain comprises the amino acid sequence of SEQ ID NO:61, 62, 63, 64, 65, 66 or 67.

[0073] In some embodiments, the Fab comprises a heavy chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60, and a light chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:61, 62, 63, 64, 65, or 66 or 67, respectively, or in any combinations of heavy chain variable domain and light chain variable domain disclosed herein. For example, the Fab can comprise a heavy chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 60 and a light chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:67.

[0074] In some embodiments, the heavy chain constant domain comprises an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:68.

[0075] In some embodiments, the light chain constant domain comprises an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:69.

[0076] In some embodiments, the recombinant fusion protein can comprise a heavy chain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:19. In some embodiments, the Fab comprises a heavy chain domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 10 (VH-CHI domain). In some embodiments, the Fab comprises a light chain domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 13 (VL-CK domain).

[0077] In some embodiments, the recombinant fusion protein can comprise a heavy chain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 19; and a light chain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 13. The recombinant protein can have significantly improved pharmacokinetic properties while maintaining the intrinsic biological activity of the IL-18BP.

[0078] In some embodiments, the Fab comprises a heavy chain domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 10 (VH-CHI domain) and a light chain domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 13 (VL-CK domain).

[0079] As disclosed herein, the recombinant fusion protein comprises an interleukin- 18- binding protein and an antigen binding fragment against serum albumin. In some embodiments, the recombinant fusion protein comprises a heavy chain comprising 395 amino acids and a light chain comprising 215 amino acids. In some embodiments, no glycosylation exists in the antigen binding fragment against serum albumin, and 1, 2, 3, or 4 N-glycosylation and one O-glycosylation sites exist in the IL-18-binding protein. Thus, in some embodiments, the recombinant fusion protein can include glycosylation.

[0080] In some embodiments, the recombinant fusion proteins are monovalent, bivalent, or multivalent, e.g., one, two, or more of the IL-18BP moiety can be linked to the antigen binding fragment that binds to serum albumin.

[0081] As used herein, the term “interleukin- 18 -binding protein (IL-18BP)” refers to a protein that binds to IL- 18 and inhibits binding of IL- 18 and IL- 18 receptors to exhibit an antagonistic action. In a healthy person, the blood concentration of IL- 18 -binding protein is known to be as much as 20 times the concentration of IL- 18. There are four isoforms of the IL- 18 -binding protein in humans: a, b, c, and d. Among the four isoforms, type a and c IL-18-binding proteins are known to have high biological activity, i.e., high ability to bind IL-18, and shows a crossreaction between human IL- 18 and murine IL- 18. Isoform a has 399 pM of the ability to bind to human IL- 18 , indicating high levels of binding ability. The IL- 18BP can be a non-mutated natural protein or an isoform, which can be obtained from public databases or publications, see, e.g., Kim S.-H. et al., PNAS 97:1190-1195 (2000). In some embodiments, the IL-18BP comprises an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%,at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:7. The IL-18- binding protein can comprise an amino acid sequence having at least 90% identity to SEQ ID NO:7. In some embodiments, the IL-18-binding protein comprises an amino acid sequence of SEQ ID NO:7. In some embodiments, a nucleic acid molecule encoding the IL-18-binding protein comprises a nucleotide sequence of SEQ ID NO: 8 or SEQ ID NO:9.

[0082] As used herein, the term “linker” refers to a peptide inserted between proteins such that when the recombinant fusion protein is prepared by linking the IL-18-binding protein and the anti-serum albumin Fab antibody fragment, structural flexibility of these proteins can be increased to enhance the activity of each bound protein. There is no limitation on the type of linker or the number of amino acids, as long as it can minimize immune responses. For example, the linker can include 1 amino acid to 20 amino acids, 1 amino acid to 15 amino acids, 1 amino acid to 10 amino acids, or 1 amino acid to 8 amino acids. In some embodiments, the linker can link the IL-18-binding protein at the C-terminus of the heavy chain region of the antigen binding fragment against serum albumin. For example, the linker can include an amino acid sequence of SEQ ID NO: 16. A nucleic acid encoding the linker including the amino acid sequence of SEQ ID NO:16 can be represented by SEQ ID NO:17 or SEQ ID NO:18.

[0083] In some embodiments, the linker links the IL-18BP to a C-terminus of the heavy chain constant domain, an N-terminus of the heavy chain variable domain, a C-terminus of the light chain constant domain, and / or an N-terminus of the light chain variable domain of the Fab. In some embodiments, the linker links the IL-18BP to a C-terminus of the heavy chain constant domain. In some embodiments, the linker comprises 1 to 50 amino acids. In some embodiments, the linker comprises an amino acid sequence having at least 80%, at least 85%, 90%, at least 95%, or at least 100% identity to any one of SEQ ID NOS: 16 and 70-84. In some embodiments, the linker comprises an amino acid sequence of any one of SEQ ID NOS: 16 and 70-84.

[0084] Further, the linker can be appropriately modified for use, if needed. For example, the linker can be a polypeptide composed of 1 to 50 or 1 to 20 arbitrary or nonarbitrary amino acids. The peptide linker can include Gly, Asn, and Ser residues, and can also include neutral amino acids such as Thr and Ala. An amino acid sequence suitable for the peptide linker is known in the art. Adjusting the copy number “n” allows for optimization of the linker in order to achieve appropriate separation between the functional moieties or to maintain necessary inter-moiety interaction. Other linkers are known in the art, e.g., G and S linkers containing additional amino acid residues, such as T and A, to maintain flexibility, as well as polar amino acid residues to improve solubility. Therefore, the linker can be a flexible linker containing G,S, and / or T, A residues. The linker can have a general formula of (GpSs)nor (SpGs)n, wherein, independently, p is an integer of 1 to 10, s is 0 or an integer of 0 to 10, p + s is an integer of 20 or less, and n is an integer of 1 to 20. More specifically, examples of the linker can include (GGGGS)n (SEQ ID NO:72), (SGGGG)n(SEQ ID NO:73), (SRSSG)n(SEQ ID NO:74), (SGSSC)n (SEQ ID NO:75), (GKSSGSGSESKS)n (SEQ ID NO:76), (RPPPPC)n(SEQ ID NO:77), (SSPPPPC)n (SEQ ID NO:78), (GSTSGSGKSSEGKG)n (SEQ ID NO:79), (GSTSGSGKSSEGSGSTKG)n (SEQ ID NO: 80), (GSTSGSGKPGSGEGSTKG)n (SEQ ID NO:81), or (EGKSSGSGSESKEF)n(SEQ ID NO:82), wherein n can be an integer of 1 to 20, or 1 to 10.

[0085] As used herein, the term “serum albumin” is one of proteins constituting basic materials of cells and plays an important role in maintaining the osmotic pressure between blood vessels and tissues by allowing body fluids to stay in blood vessels. In addition, the term “antigen binding fragment against serum albumin” can refer to an anti-serum albumin antibody or an antigen binding fragment of the antibody molecule specifically binding to an epitope of serum albumin.

[0086] An antigen binding fragment of an antibody or an antibody fragment refers to a fragment retaining an antigen-binding function, and includes Fab, F(ab'), F(ab')2, Fv, etc. Fab of the antibody fragments has a structure including variable regions of a light chain and a heavy chain, a constant region of the light chain, and a constant region (CH) of the heavy chain with one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing one or more cysteine residues at the C-terminal of the heavy chain CH domain. F(ab')2 antibody is produced when the cysteine residue of the hinge region of Fab' forms a disulfide bond. Recombinant techniques for generating Fv fragments with minimal antibody fragments having only a heavy chain variable region and a light chain variable region are described in PCT International Publication Nos. WO88 / 10649, WG88 / 106630, WG88 / 07085, WG88 / 07086, and WO88 / 09344. In a two-chain Fv, a heavy chain variable region and a light chain variable region are connected via a non-covalent bond. In a single chain Fv (scFv), a heavy chain variable region and a light chain variable region are generally connected via a peptide linker by a covalent bond or directly at the C-terminal. Thus, the single chain Fv (scFv) can have a structure such as a dimer, like the two-chain Fv. Such an antibody fragment can be obtained using a protein hydrolyzing enzyme (for example, when a whole antibody is cleaved with papain, Fab can be obtained, and when a whole antibody is cleaved with pepsin, F(ab')2 fragment can be obtained), and it can also be produced through a recombinant gene technology.

[0087] In some embodiments, the antigen binding fragment against serum albumin can include a heavy chain region comprising an amino acid sequence of SEQ ID NO: 10; and a light chain region comprising an amino acid sequence of SEQ ID NO: 13. In some embodiments, nucleic acid molecule encoding the heavy chain region comprising the amino acid sequence of SEQ ID NO: 10 can have a nucleotide sequence of SEQ ID NO: 11 or 12. In some embodiments, nucleic acid molecule encoding the light chain region comprising the amino acid sequence of SEQ ID NO:13 can have a nucleotide sequence of SEQ ID NO:14 or 15.

[0088] As used herein, the term “recombinant fusion protein” or “fusion protein” refers to a protein, in which two or more proteins are artificially linked. In some embodiments, the recombinant fusion protein refers to a protein, in which the IL-18-binding protein and the antigen binding fragment against serum albumin, i.e., anti-serum albumin Fab antibody fragment are linked to each other. Such a recombinant fusion protein can be obtained by expressing and purifying the same by chemical synthesis or a genetic recombination method, after each partner is determined. In some embodiments, the recombinant fusion protein can be obtained by expressing, in a cell expression system, a fusion gene (expression vector) in which a gene sequence encoding the IL-18-binding protein and a gene sequence encoding the antigen binding fragment of anti-serum albumin are linked. In the recombinant fusion protein, the IL- 18-binding protein and the anti-serum albumin Fab antibody fragment are, either directly or via a linker, linked to each other. In some embodiments, the recombinant fusion protein can include a heavy chain including the IL-18-binding protein, the linker, a heavy chain region of the antigen binding fragment against serum albumin; and a light chain including a light chain region of the antigen binding fragment against serum albumin via a non-covalent bond. For example, the recombinant fusion protein can comprise a peptide including an amino acid sequence of SEQ ID NO: 19 and a peptide including an amino acid sequence of SEQ ID NO: 13.

[0089] As used herein, the terms “antibody” and “antibodies” are terms of art and can be used interchangeably herein and refer to a molecule with an antigen-binding site that specifically binds an antigen. Antibodies can include, e.g., monoclonal antibodies, recombinantly produced antibodies, human antibodies, resurfaced antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, an antibody light chain monomer, an antibody heavy chain monomer, an antibody light chain dimer, an antibody heavy chain dimer, an antibody light chain- antibody heavy chain pair, intrabodies, heteroconjugate antibodies, single domain antibodies, monovalent antibodies, single chain antibodies or single-chain Fvs (scFv), camelized antibodies, affybodies, Fab fragments, F(ab’)2 fragments, disulfide-linked Fvs (sdFv), anti-idiotypic (anti-Id) antibodies (including, e.g., anti-anti-Id antibodies), bispecific antibodies, and multispecific antibodies.

[0090] Antibodies can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), any class e.g., IgGi, IgG2, IgGi. IgG4, IgAi, or IgA2), or any subclass (e.g., IgG2aor IgG2b) of immunoglobulin molecule.

[0091] As used herein, the terms “bioeffector moiety,” “antigen-binding domain,” “antigenbinding region,” “antigen-binding site,” and similar terms refer to the portions of the recombinant protein that comprises the amino acid residues that confer on the recombinant protein its specificity for the antigen (e.g., the complementarity determining regions (CDR)). The antigen-binding region can be derived from any animal species, such as feline, rodents (e.g., mouse, rat, or hamster) and humans.

[0092] As used herein, the terms “variable region” or “variable domain” are used interchangeably and are common in the art. The variable region typically refers to a portion of an antibody, generally, a portion of a light or heavy chain, typically about the amino-terminal 110 to 120 amino acids in the mature heavy chain and about 90 to 115 amino acids in the mature light chain, which differ extensively in sequence among antibodies and are used in the binding and specificity of a particular antibody for its particular antigen. The variability in sequence is concentrated in those regions called complementarity determining regions (CDRs) while the more highly conserved regions in the variable domain are called framework regions (FR). Without wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with antigen. In certain embodiments, the variable region is a human variable region. In certain embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In particular embodiments, the variable region is a primate (e.g., non-human primate) variable region. In certain embodiments, the variable region comprises rodent or murine CDRs and primate (e.g., non-human primate) framework regions (FRs).

[0093] The terms “VE” and “VL domain” are used interchangeably to refer to the light chain variable region of an antibody. The terms “VH” and “VH domain” are used interchangeably to refer to the heavy chain variable region of an antibody.

[0094] As used herein, the term “heavy chain (HC or CH)” refers to both a full-length heavy chain and a fragment thereof, the full-length heavy chain including a variable region domain VH including an amino acid sequence having a sufficient variable region (VR) sequence to confer specificity for an antigen and three constant region domains CHI, CH2, and CH3. Asused herein, the term “light chain (LC or CL)” refers to both a full-length light chain and a fragment thereof, the full-length light chain including a variable region domain VL including an amino acid sequence having a sufficient VR sequence to confer specificity for an antigen and a constant region domain CL.

[0095] The heavy chain constant domain and the light chain constant domain can be derived from an IgGl antibody constant domain, and in any one or more thereof, cysteine which is an amino acid used in a disulfide bond between the light chain and the heavy chain domain can be conserved or deleted or substituted with an amino acid residue other than cysteine. For example, the heavy chain constant domain can comprise an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:68, and the light chain constant domain can comprise an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:69. The deletion or substitution of cysteine in the domain can contribute to improving an expression level of the recombinant protein in transformed cells during a process of producing the above-mentioned recombinant protein. In some embodiments, (i) one or more cysteines in the heavy chain constant domain and / or (ii) one or more cysteines in the light chain constant domain that is / are located in an interchain disulfide bond between the light chain and the heavy chain is / are conserved, deleted, and / or substituted with an amino acid residue other than cysteine.

[0096] The term “Kabat numbering” and like terms are recognized in the art and refer to a system of numbering amino acid residues in the heavy and light chain variable regions of an antibody, or an antigen-binding portion thereof. In certain aspects, the CDRs of an antibody can be determined according to the Kabat numbering system (see, e.g., Kabat EA & Wu TT (1971) Ann NY Acad Sci 190: 382-391 and Kabat EA et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242). Using the Kabat numbering system, CDRs within an antibody heavy chain molecule are typically present at amino acid positions 31 to 35, which optionally can include one or two additional amino acids, following 35 (referred to in the Kabat numbering scheme as 35A and 35B) (CDR1), amino acid positions 50 to 65 (CDR2), and amino acid positions 95 to 102 (CDR3). Using the Kabat numbering system, CDRs within an antibody light chain molecule are typically present at amino acid positions 24 to 34 (CDR1), amino acid positions 50 to 56 (CDR2), and amino acid positions 89 to 97 (CDR3). In some embodiments, the CDRs of the antibodies described herein have been determined according to the Kabat numbering scheme.

[0097] As used herein, the term “constant region” or “constant domain” are interchangeable and have its meaning common in the art. The constant region is an antibody portion, e.g., a carboxyl terminal portion of a light and / or heavy chain, which is not directly involved in binding of an antibody to an antigen but which can exhibit various effector functions, such as interaction with the Fc receptor. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence relative to an immunoglobulin variable domain.

[0098] As used herein, the term “heavy chain” when used in reference to an antibody can refer to any distinct type, e.g., alpha (a), delta (5), epsilon (a), gamma (y), and mu (p), based on the amino acid sequence of the constant domain, which give rise to IgA, IgD, IgE, IgG, and IgM classes of antibodies, respectively, including subclasses of IgG, e.g., IgGi, IgG2, IgGs. and IgG4-

[0099] As used herein, the term “light chain” when used in reference to an antibody can refer to any distinct type, e.g., kappa (CK) or lambda (CX) based on the amino acid sequence of the constant domains. Light chain amino acid sequences are well known in the art. In specific embodiments, the light chain is a human light chain.

[0100] “Binding affinity” generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner e.g., an antigen). Unless indicated otherwise, as used herein, “binding affinity” refers to intrinsic binding affinity which reflects a 1 : 1 interaction between members of a binding pair (e.g., antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (KD). Affinity can be measured and / or expressed in a number of ways known in the art, including, but not limited to, equilibrium dissociation constant (KD), and equilibrium association constant (KA). The KD is calculated from the quotient of koff / kon, whereas KA is calculated from the quotient of kon / koff. konrefers to the association rate constant of, e.g., an antibody to an antigen, and koff refers to the dissociation of, e.g., an antibody to an antigen. The konand koff can be determined by techniques known to one of ordinary skill in the art, such as BIAcore® or KinExA.

[0101] In some embodiments, the binding affinity of the recombinant fusion proteins disclosed herein has a binding affinity that is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4- fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10- fold, or any ranges therein higher than that of human IL-18BPa, e.g., 2-fold to 10-fold higher.

[0102] As used herein, a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of aminoacid residues having side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In certain embodiments, one or more amino acid residues within a CDR(s) or within a framework region(s) of an antibody can be replaced with an amino acid residue with a similar side chain.

[0103] As used herein, an “epitope” is a term in the art and refers to a localized region of an antigen to which an antibody can specifically bind. An epitope can be, e.g., contiguous amino acids of a polypeptide (linear or contiguous epitope) or an epitope can, e.g., come together from two or more non-contiguous regions of a polypeptide or polypeptides (conformational, non-linear, discontinuous, or non-contiguous epitope). In certain embodiments, the epitope to which an antibody binds can be determined by, e.g., NMR spectroscopy, X-ray diffraction crystallography studies, ELISA assays, hydrogen / deuterium exchange coupled with mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), array-based oligopeptide scanning assays, and / or mutagenesis mapping (e.g., site-directed mutagenesis mapping). For X-ray crystallography, crystallization can be accomplished using any of the known methods in the art e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4):339-350; McPherson A (1990) Eur J Biochem 189:1-23; Chayen NE (1997) Structure 5:1269-1274; McPherson, A. (1976) J. Biol. Chem. 251:6300-6303). Antibody: antigen crystals can be studied using well known X-ray diffraction techniques and can be refined using computer software such as X-PLOR (Yale University, 1992, distributed by Molecular Simulations, Inc.; see, e.g., Meth Enzymol (1985) volumes 114 & 115, eds Wyckoff HW et al., -, U.S. 2004 / 0014194), and BUSTER (Bricogne G (1993) Acta Crystallogr D Biol Crystallogr 49 (Pt l):37-60; Bricogne G (1997) Meth Enzymol 276A:361-423, ed Carter CW; Roversi P et al., (2000) Acta Crystallogr D Biol Crystallogr 56 (Pt 10): 1316-1323). Mutagenesis mapping studies can be accomplished using any method known to one of skill in the art. See, e.g., Champe M et al., (1995) J Biol Chem 270: 1388-1394 and Cunningham BC & Wells JA (1989) Science 244:1081-1085 for a description of mutagenesis techniques, including alanine scanning mutagenesis techniques. In some embodiments, the epitope of an antibody is determined using alanine scanning mutagenesis studies.

[0104] As used herein, the terms “immunospecifically binds,” “immunospecifically recognizes,” “specifically binds,” and “specifically recognizes” are analogous terms in the context of antibodies and refer to molecules that bind to an antigen (e.g., epitope, immune complex, or binding partner of an antigen-binding site) as such binding is understood by one skilled in the art. For example, a molecule that specifically binds to an antigen can bind to other peptides or polypeptides, generally with lower affinity as determined by, e.g., immunoassays, BIAcore®, KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays known in the art. In some embodiments, molecules that immunospecifically bind to an antigen bind to the antigen with a KA that is at least 2 logs, 2.5 logs, 3 logs, 4 logs or greater than the KA when the molecules bind to another antigen.

[0105] In some embodiments, molecules that immunospecifically bind to an antigen do not cross react with other proteins under similar binding conditions. In some embodiments, molecules that immunospecifically bind to an antigen do not cross react with other proteins. In some embodiments, provided herein are recombinant proteins that bind to a specified antigen with higher affinity than to another unrelated antigen. In certain embodiments, provided herein is a recombinant protein that binds to a specified antigen (e.g., human serum albumin) with a 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or higher affinity than to another, unrelated antigen as measured by, e.g., a radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay. In some embodiments, the extent of binding of a recombinant protein described herein to an unrelated, protein is less than 10%, 15%, or 20% of the binding of the antibody to the specified antigen as measured by, e.g., a radioimmunoassay.

[0106] In some embodiments, provided herein are recombinant proteins that bind to an antigen of various species, such as felines, rodents e.g., mouse, rat, or hamster) and humans. In some embodiments, provided herein are recombinant proteins that bind to a human antigen with higher affinity than to another species of the antigen. In certain embodiments, provided herein are recombinant proteins that bind to a human antigen with a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or higher affinity than to another species as measured by, e.g., a radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay. In some embodiments, the recombinant proteins described herein, which bind to a human antigen, will bind to another species of the antigen protein with less than 10%, 15%, or 20% of the binding of the antibody to the human antigen protein as measured by, e.g., a radioimmunoassay, surface plasmon resonance, or kinetic exclusion assay.

[0107] As used herein, the term “host cell” can be any type of cell, e.g., a primary cell, a cell in culture, or a cell from a cell line. In embodiments, the term “host cell” refers to a cell transfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny of such a cell cannot be identical to the parent cell transfected with the nucleic acid molecule, e.g., due to mutations or environmental influences that can occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome.

[0108] In certain aspects, a recombinant protein described herein can be described by its VL domain alone, or its VH domain alone, or by its 3 VL CDRs alone, or its 3 VH CDRs alone. See, e.g., Rader C et al., (1998) PNAS 95: 8910-8915, which is incorporated herein by reference in its entirety, describing the humanization of the mouse anti-avf antibody by identifying a complementing light chain or heavy chain, respectively, from a human light chain or heavy chain library, resulting in humanized antibody variants having affinities as high or higher than the affinity of the original antibody. See also Clackson T et al., (1991) Nature 352:624-628, which is incorporated herein by reference in its entirety, describing methods of producing antibodies that bind a specific antigen by using a specific VL domain (or VH domain) and screening a library for the complementary variable domains. The screen produced 14 new partners for a specific VH domain and 13 new partners for a specific VL domain, which were strong binders, as determined by ELISA. See also Kim SJ & Hong HJ, (2007) J Microbiol 45:572-577, which is incorporated herein by reference in its entirety, describing methods of producing antibodies that bind a specific antigen by using a specific VH domain and screening a library (e.g., human VL library) for complementary VL domains; the selected VL domains in turn could be used to guide selection of additional complementary e.g., human) VH domains.

[0109] In certain aspects, the CDRs of an antibody can be determined according to the Chothia numbering scheme, which refers to the location of immunoglobulin structural loops (see, e.g., Chothia C & Lesk AM, (1987), J Mol Biol 196: 901-917; Al-Lazikani B et al., (1997) J Mol Biol 273: 927-948; Chothia C et al., (1992) J Mol Biol 227: 799-817; Tramontane A et al., (1990) J Mol Biol 215(1): 175-82; and U.S. Pat. No. 7,709,226). Typically, when using the Kabat numbering convention, the Chothia CDR-H1 loop is present at heavy chain amino acids 26 to 32, 33, or 34, the Chothia CDR-H2 loop is present at heavy chain amino acids 52 to 56, and the Chothia CDR-H3 loop is present at heavy chain amino acids 95 to 102, while the Chothia CDR-L1 loop is present at light chain amino acids 24 to 34, the Chothia CDR-L2 loop is present at light chain amino acids 50 to 56, and the Chothia CDR-L3 loop is present at light chain amino acids 89 to 97. The end of the Chothia CDR-H1 loop when numbered using theKabat numbering convention varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places the insertions at H35A and H35B; if neither 35A nor 35B is present, the loop ends at 32; if only 35A is present, the loop ends at 33; if both 35A and 35B are present, the loop ends at 34).

[0110] In certain aspects, provided herein are recombinant proteins that specifically bind to serum albumin (e.g., human serum albumin) and comprise the Chothia VL CDRs of a VL. In certain aspects, provided herein are antibodies that specifically bind to serum albumin (e.g., human serum albumin) and comprise the Chothia VH CDRs of a VH. In certain aspects, provided herein are antibodies that specifically bind to serum albumin (e.g., human serum albumin) and comprise the Chothia VL CDRs of a VL and comprise the Chothia VH CDRs of a VH. In certain embodiments, antibodies that specifically bind to serum albumin (e.g., human serum albumin) comprise one or more CDRs, in which the Chothia and Kabat CDRs have the same amino acid sequence. In certain embodiments, provided herein are antibodies that specifically bind to serum albumin and comprise combinations of Kabat CDRs and Chothia CDRs.

[0111] In certain aspects, the CDRs of an antibody can be determined according to the IMGT numbering system as described in Lefranc M-P, (1999) The Immunologist 7: 132-136 and Lefranc M-P et al., (1999) Nucleic Acids Res 27: 209-212. According to the IMGT numbering scheme, VH-CDR1 is at positions 26 to 35, VH-CDR2 is at positions 51 to 57, VH- CDR3 is at positions 93 to 102, VL-CDR1 is at positions 27 to 32, VL-CDR2 is at positions 50 to 52, and VL-CDR3 is at positions 89 to 97.

[0112] In certain aspects, the CDRs of an antibody can be determined according to MacCallum RM et al., (1996) J Mol Biol 262: 732-745. See also, e.g., Martin A. “Protein Sequence and Structure Analysis of Antibody Variable Domains,” in Antibody Engineering, Kontermann and Diibel, eds., Chapter 31, pp. 422-439, Springer-Verlag, Berlin (2001).

[0113] In certain aspects, the CDRs of an antibody can be determined according to the AbM numbering scheme, which refers AbM hypervariable regions that represent a compromise between the Kabat CDRs and Chothia structural loops and are used by Oxford Molecular’s AbM antibody modeling software (Oxford Molecular Group, Inc.).

[0114] In some embodiments, the position of one or more CDRs along the VH (e.g., CDR1, CDR2, or CDR3) and / or VL e.g., CDR1, CDR2, or CDR3) region of an antibody described herein can vary by one, two, three, four, five, or six amino acid positions so long as immunospecific binding to an antigen is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). For example,the position defining a CDR of an antibody described herein can vary by shifting the N- terminal and / or C-terminal boundary of the CDR by one, two, three, four, five, or six amino acids, relative to the CDR position of an antibody described herein, so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In other embodiments, the length of one or more CDRs along the VH (e.g., CDR1, CDR2, or CDR3) and / or VL (e.g., CDR1, CDR2, or CDR3) region of an antibody described herein can vary (e.g., be shorter or longer) by one, two, three, four, five, or more amino acids, so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%).

[0115] In some embodiments, a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and / or VH CDR3 described herein can be one, two, three, four, five or more amino acids shorter than one or more of the CDRs described herein so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In other embodiments, a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and / or VH CDR3 described herein can be one, two, three, four, five or more amino acids longer than one or more of the CDRs described herein so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In other embodiments, the amino terminus of a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and / or VH CDR3 described herein can be extended by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In other embodiments, the carboxy terminus of a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and / or VH CDR3 described herein can be extended by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In other embodiments, the amino terminus of a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and / or VH CDR3 described herein can be shortened by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). In someembodiments, the carboxy terminus of a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and / or VH CDR3 described herein can be shortened by one, two, three, four, five or more amino acids compared to one or more of the CDRs described herein so long as immunospecific binding to the antigen(s) is maintained (e.g., substantially maintained, e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%). Any method known in the art can be used to ascertain whether immunospecific binding to the antigen(s) is maintained, e.g., the binding assays and conditions described in the “Examples” section herein.

[0116] The determination of percent identity between two sequences (e.g., amino acid sequences or nucleic acid sequences) can also be accomplished using a mathematical algorithm. A specific, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin S & Altschul SF (1990) PNAS 87: 2264-2268, modified as in Karlin S & Altschul SF (1993) PNAS 90: 5873-5877. Such an algorithm is incorporated into the NBEAST and XBEAST programs of Altschul SF et al., (1990) J Mol Biol 215: 403. BEAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules described herein. BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score 50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul SF et al., (1997) Nuc Acids Res 25: 3389 3402. Alternatively, PSI BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI Blast programs, the default parameters of the respective programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., National Center for Biotechnology Information (NCBI) on the worldwide web, ncbi.nlm.nih.gov). Another specific, nonlimiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11 17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0117] The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0118] The recombinant proteins disclosed herein can be fused or conjugated e.g., covalently or noncovalently linked) to a detectable label or substance. Examples of detectable labels or substances include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (125I,121I), carbon (14C), sulfur (35S), tritium (3H), indium (121In), and technetium ("Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin. Such labeled antibodies can be used to detect antigen proteins.Antibody Production

[0119] According to one exemplary embodiment, a recombinant protein (APB-R3) was prepared, the recombinant protein (APB-R3) including an antigen binding fragment binding to human serum albumin, wherein the antigen binding fragment is bound with a heavy chain constant domain and a light chain constant domain; and an IL-18BP linked to the heavy chain constant domain. It was confirmed that the recombinant protein was obtained in a high yield while maintaining biological activities possessed by the respective factors.

[0120] Still other aspects provide methods of preparing the recombinant protein, the methods including (a) culturing the cells; and (b) recovering the recombinant protein from the cultured cells. The cells can be cultured in various media. A commercially available medium can be used as a culture medium without limitation. All other essential supplements known to those skilled in the art can also be included at appropriate concentrations. Culture conditions, e.g., temperature, pH, etc., are those previously used together with the host cell selected for expression, and will be apparent to those skilled in the art. The recovering of the recombinant proteins can be performed by removing impurities by, e.g., centrifugation or ultrafiltration, and purifying the resultant by, e.g., affinity chromatography, etc. Other additional purification techniques, e.g., anion or cation exchange chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography, etc. can be used.

[0121] Recombinant proteins disclosed herein can be produced by any method known in the art for the synthesis of antibodies, e.g., by chemical synthesis or by recombinant expression techniques. The methods described herein employ, unless otherwise indicated, conventional techniques in molecular biology, microbiology, genetic analysis, recombinant DNA, organic chemistry, biochemistry, PCR, oligonucleotide synthesis and modification, nucleic acid hybridization, and related fields within the skill of the art. These techniques are described, e.g., in the references cited herein and are fully explained in the literature. See, e.g., Maniatis T et al., (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; Sambrook J et al., (1989), Molecular Cloning: A Laboratory Manual, Second Edition,Cold Spring Harbor Laboratory Press; Sambrook J et al., (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel FM et al.LCurrent Protocols in Molecular Biology, John Wiley & Sons (1987 and annual updates); Current Protocols in Immunology, John Wiley & Sons (1987 and annual updates) Gait (ed.) (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein (ed.) (1991) Oligonucleotides and Analogues: A Practical Approach, IRL Press; Birren B et al., (eds.) (1999) Genome Analysis: A Laboratory Manual, Cold Spring Harbor Laboratory Press.

[0122] In some embodiments, the recombinant proteins described herein are antibodies (e.g., recombinant antibodies) prepared, expressed, created, or isolated by any means that involves creation, e.g., via synthesis or genetic engineering of DNA sequences. In certain embodiments, such antibodies comprise sequences (e.g., DNA sequences or amino acid sequences) that do not naturally exist within the antibody germline repertoire of an animal or mammal e.g., human) in vivo.

[0123] In some aspects, provided herein are methods of making recombinant proteins disclosed herein comprising culturing a cell or host cell as described herein. In some aspects, provided herein are methods of making a recombinant protein comprising expressing (e.g., recombinantly expressing) the antibodies using a cell or host cell described herein (e.g., a cell or a host cell comprising polynucleotides encoding an antibody described herein). In some embodiments, the cell is an isolated cell. In some embodiments, the exogenous polynucleotides have been introduced into the cell. In some embodiments, the method further comprises purifying the antibody obtained from the cell or host cell.

[0124] Antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, e.g., in Harlow E & Lane D, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling GJ et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563 681 (Elsevier, N.Y., 1981). The term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology. For example, monoclonal antibodies can be produced recombinantly from host cells exogenously expressing an antibody described herein.

[0125] A “monoclonal antibody,” as used herein, is an antibody produced by a single cell (e.g., hybridoma or host cell producing a recombinant antibody), wherein the antibody immunospecifically binds to an antigen (e.g., human serum albumin) as determined, e.g., by ELISA or other antigen-binding or competitive binding assay known in the art or in theExamples provided herein. In particular embodiments, a monoclonal antibody can be a chimeric antibody or a humanized antibody. In certain embodiments, a monoclonal antibody is a monovalent antibody or multivalent (e.g., bivalent) antibody. In certain embodiments, a monoclonal antibody can be a Fab fragment or a F(ab’)2 fragment. Monoclonal antibodies described herein can, e.g., be made by the hybridoma method as described in Kohler G & Milstein C (1975) Nature 256: 495 or can, e.g., be isolated from phage libraries using the techniques as described herein, for example. Other methods for the preparation of clonal cell lines and of monoclonal antibodies expressed thereby are well known in the art (see, e.g., Chapter 11 in: Short Protocols in Molecular Biology, (2002) 5th Ed., Ausubel FM et al., supra).

[0126] Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art. For example, in the hybridoma method, a mouse or other appropriate host animal, such as a sheep, goat, rabbit, rat, hamster or macaque monkey, is immunized to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the antigen (e.g., human serum albumin)) used for immunization. Alternatively, lymphocytes can be immunized in vitro. Eymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding JW (Ed), Monoclonal Antibodies: Principles and Practice, pp. 59-103 (Academic Press, 1986)). Additionally, a RIMMS (repetitive immunization multiple sites) technique can be used to immunize an animal (Kilpatrick KE et al., (1997) Hybridoma 16:381-9, incorporated by reference in its entirety).

[0127] Antibodies described herein can be generated by any technique known to those of skill in the art. For example, Fab and F(ab’)2 fragments described herein can be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab’)2 fragments). A Fab fragment corresponds to one of the two identical arms of a tetrameric antibody molecule and contains the complete light chain paired with the VH and CHI domains of the heavy chain. A F(ab’)2 fragment contains the two antigen-binding arms of a tetrameric antibody molecule linked by disulfide bonds in the hinge region.

[0128] Further, the antibodies described herein can also be generated using various phage display methods known in the art. In phage display methods, proteins are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from cDNA libraries (e.g., human or murine cDNA libraries of affected tissues). The DNA encoding the VH and VL domains are recombined together with a scFv linker by PCR and cloned into a phagemidvector. The vector is electroporated in E. coli and the E. coli is infected with helper phage. Phage used in these methods are typically filamentous phage including fd and M13, and the VH and VL domains are usually recombinantly fused to either the phage gene III or gene VIII. Phage expressing an antibody that binds to a particular antigen can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Examples of phage display methods that can be used to make the antibodies described herein include those disclosed in Brinkman U et al., (1995) J Immunol Methods 182: 41-50; Ames RS et al., (1995) J Immunol Methods 184: 177-186; Kettleborough CA et al., (1994) Eur J Immunol 24: 952-958; Persic L et al., (1997) Gene 187: 9-18; Burton DR & Barbas CF (1994) Advan Immunol 57: 191-280; PCT / GB91 / 001134; W090 / 02809, WO91 / 10737, W092 / 01047, WO92 / 18619, WO93 / 11236, WO95 / 15982, W095 / 20401, and WO97 / 13844; and U.S. Pat. Nos. 5,698,426, 5,223,409, 5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637, 5,780,225, 5,658,727, 5,733,743, and 5,969,108.

[0129] As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate antibodies, including human antibodies, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described below. Techniques to recombinantly produce antibodies such as Fab, Fab’ and F(ab’)2 fragments can also be employed using methods known in the art such as those disclosed in WO92 / 22324; Mullinax RE et al., (1992) BioTechniques 12(6): 864-9; Sawai H et al., (1995) Am J Reprod Immunol 34: 26-34; and Better M et al., (1988) Science 240: 1041-1043.

[0130] In some aspects, to generate antibodies, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences from a template, e.g., scFv clones. Utilizing cloning techniques known to those of skill in the art, the PCR amplified VH domains can be cloned into vectors expressing a VH constant region, and the PCR amplified VL domains can be cloned into vectors expressing a VL constant region, e.g., human kappa or lambda constant regions. The VH and VL domains can also be cloned into one vector expressing the necessary constant regions. The heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express antibodies, e.g., IgG, using techniques known to those of skill in the art.

[0131] A chimeric antibody is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules. For example, a chimeric antibody can contain a variable region of a human monoclonal antibody fused to a constant region of ahuman antibody. Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison SL (1985) Science 229: 1202-7; Oi VT & Morrison SL (1986) BioTechniques 4: 214-221; Gillies SD et al., (1989) J Immunol Methods 125: 191-202; and U.S. Pat. Nos. 5,807,715, 4,816,567, 4,816,397, and 6,331,415.Polynucleotides, Vectors, and Cells

[0132] Disclosed herein are nucleic acid molecules encoding the recombinant proteins disclosed herein.

[0133] Disclosed herein are expression vectors comprising the nucleic acid molecules disclosed herein.

[0134] Disclosed herein are cells transformed with the expression vectors disclosed herein.

[0135] Since the nucleic acid, the expression vector, and the transformed cell include the above-described recombinant protein or the nucleic acid encoding the recombinant protein as it is, or they use the same, descriptions common thereto will be omitted.

[0136] For example, in some aspects, the recombinant protein can be produced by isolating the nucleic acid encoding the recombinant protein. The nucleic acid is isolated and inserted into a replicable vector to perform additional cloning (DNA amplification) or additional expression. On the basis of this, other aspects relate to a vector including the nucleic acid.

[0137] As used herein, the term “nucleic acid” or “nucleic acid molecule” comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides as basic units of the nucleic acid include not only natural nucleotides but also analogues having modified sugar or base moieties.

[0138] The nucleic acid is interpreted to include a nucleotide sequence showing substantial identity to the nucleotide sequence. Substantial identity means a nucleotide sequence showing at least 80% homology, more specifically at least 90% homology, and most specifically at least 95% homology, when the nucleotide sequence of the present disclosure and another optional sequence are aligned to correspond to each other as much as possible and the aligned sequences are analyzed using an algorithm commonly used in the art.

[0139] DNA encoding the recombinant protein is easily isolated or synthesized by using a common process (e.g., by using an oligonucleotide probe capable of specifically binding to the DNA encoding the recombinant protein). Many vectors are available. Vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.

[0140] As used herein, the term “vector” includes, as a means to express a target gene in a host cell, plasmid vectors; cosmid vectors; viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors, etc. In the vector, the nucleic acid encoding the recombinant protein is operably linked to a promoter.

[0141] “Operably linked” refers to a functional linkage between a nucleic acid expression control sequence (e.g., a promoter, a signal sequence, an array of transcriptional regulatory factor binding sites) and another nucleic acid sequence, whereby the control sequence directs transcription and / or translation of another nucleic acid sequence.

[0142] When a prokaryotic cell is used as a host, a powerful promoter capable of directing transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, Ipp promoter, pLZ promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), a ribosome binding site for initiation of translation, and a transcription / translation termination sequence are generally included. For example, when a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (e.g., metallothionein promoter, P-actin promoter, human hemoglobin promoter, and human muscle creatine promoter) or a promoter derived from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus (CMV) promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, promoter of Moloney virus, promoter of Epstein-Barr virus (EBV), and promoter of Rous sarcoma virus (RSV)) can be used, and a polyadenylated sequence can be commonly used as the transcription termination sequence. In some cases, the vector can be fused with another sequence to facilitate purification of the recombinant protein expressed therefrom. The sequence to be fused includes, e.g., glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), 6X His (hexahistidine; Quiagen, USA), etc. The vector includes, as a selective marker, an antibiotic-resistant gene that is ordinarily used in the art, e.g., genes resistant against ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, and tetracycline.

[0143] In still other aspects, the present disclosure provides cells transformed with the above- mentioned vectors. The cells used to produce the recombinant protein of the present disclosure can be prokaryotic cells, yeast cells, or higher eukaryotic cells, but are not limited thereto. Prokaryotic host cells such as Escherichia coli, the genus bacillus strains such as Bacillus subtilis and Bacillus thuringiensis, Streptomyces, Pseudomonas (e.g., Pseudomonas putida). Proteus mirabilis and Staphylococcus (e.g., Staphylococcus carnosus) can be used. However, animal cells are most interested, and examples of the useful host cell line can include COS-7,BHK, CHO (GS null CHO-K1), CHOK1, DXB-11, DG-44, CHO / -DHFR, CV1, COS-7, HEK293, BHK, TM4, VERO, HELA, MDCK, BRL 3A, W138, Hep G2, SK-Hep, MMT, TRI, MRC 5, FS4, 3T3, RIN, A549, PC12, K562, PER.C6, SP2 / 0, NS-0, U20S, or HT1080, but are not limited thereto.

[0144] As used herein, the term “transformation” means a molecular biological technique that changes the genetic trait of a cell by a DNA chain fragment or plasmid which possesses a different type of foreign gene from that of the original cell, penetrates among the cells, and combines with DNA in the original cell. Transformation means insertion of the expression vector including the gene of the recombinant protein into a host cell.

[0145] Provided herein are nucleic acid molecules comprising a nucleotide sequence encoding a recombinant protein described herein (e.g., a variable light chain region and / or variable heavy chain region) that immunospecifically binds to an antigen, and vectors, e.g., vectors comprising such polynucleotides for recombinant expression in host cells (e.g., E. coli and mammalian cells). Provided herein are polynucleotides comprising nucleotide sequences encoding any of the antibodies provided herein, as well as vectors comprising such polynucleotide sequences, e.g., expression vectors for their efficient expression in host cells, e.g., mammalian cells.

[0146] As used herein, an “isolated” polynucleotide or nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source (e.g., in a mouse or a human) of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. For example, the language “substantially free” includes preparations of polynucleotide or nucleic acid molecule having less than about 15%, 10%, 5%, 2%, 1%, 0.5%, or 0.1% (in particular less than about 10%) of other material, e.g., cellular material, culture medium, other nucleic acid molecules, chemical precursors and / or other chemicals. In some embodiments, a nucleic acid molecule(s) encoding an antibody described herein is isolated or purified.

[0147] Provided herein are polynucleotides comprising nucleotide sequences encoding antibodies, which immunospecifically bind to an antigen polypeptide e.g., human serum albumin) and comprises an amino acid sequence as described herein, as well as antibodies that compete with such antibodies for binding to an antigen polypeptide (e.g., in a dose-dependent manner), or which binds to the same epitope as that of such antibodies.

[0148] Provided herein are polynucleotides comprising a nucleotide sequence encoding the light chain or heavy chain of an antibody described herein. The polynucleotides can comprisenucleotide sequences encoding a light chain comprising the VL FRs and CDRs of antibodies described herein. The polynucleotides can comprise nucleotide sequences encoding a heavy chain comprising the VH FRs and CDRs of antibodies described herein.

[0149] Provided herein are polynucleotides comprising a nucleotide sequence encoding a recombinant protein comprising a Fab comprising three VH chain CDRs, e.g., containing VL CDR1, VL CDR2, and VL CDR3 of an antibody to human serum albumin described herein and three VH chain CDRs, e.g., containing VH CDR1, VH CDR2, and VH CDR3 of an antibody to human serum albumin described herein.

[0150] Provided herein are polynucleotides comprising a nucleotide sequence encoding a recombinant protein comprising a VL domain.

[0151] In certain embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a recombinant protein provided herein comprising a light chain variable region comprising an amino acid sequence described herein (e.g., SEQ ID NO:61, 62, 63, 64, 65, 66, or 67), wherein the antibody immunospecifically binds to serum albumin.

[0152] In certain embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding an antibody provided herein comprising a heavy chain variable region comprising an amino acid sequence described herein e.g., SEQ ID NO:55, 56, 57, 58, 59, or 60), wherein the antibody immunospecifically binds to serum albumin.

[0153] In specific aspects, provided herein are polynucleotides comprising a nucleotide sequence encoding an antibody comprising a light chain and a heavy chain, e.g., a separate light chain and heavy chain. With respect to the light chain, in some embodiments, a polynucleotide provided herein comprises a nucleotide sequence encoding a kappa light chain. In other embodiments, a polynucleotide provided herein comprises a nucleotide sequence encoding a lambda light chain. In yet other embodiments, a polynucleotide provided herein comprises a nucleotide sequence encoding an antibody described herein comprising a human kappa light chain or a human lambda light chain. In some embodiments, a polynucleotide provided herein comprises a nucleotide sequence encoding an antibody, which immunospecifically binds to serum albumin, wherein the antibody comprises a light chain, and wherein the amino acid sequence of the VL domain can comprise the amino acid sequence set forth in SEQ ID NO:61, 62, 63, 64, 65, 66, or 67 and wherein the constant region of the light chain comprises the amino acid sequence of a kappa light chain constant region.

[0154] Also provided herein are polynucleotides encoding an antibody or a fragment thereof that are optimized, e.g., by codon / RNA optimization, replacement with heterologous signal sequences, and elimination of mRNA instability elements. Methods to generate optimizednucleic acids encoding an antibody or a fragment thereof (e.g., light chain, heavy chain, VH domain, or VL domain) for recombinant expression by introducing codon changes and / or eliminating inhibitory regions in the mRNA can be carried out by adapting the optimization methods described in, e.g., U.S. Pat. Nos. 5,965,726; 6,174,666; 6,291,664; 6,414,132; and 6,794,498, accordingly. For example, potential splice sites and instability elements (e.g., A / T or A / U rich elements) within the RNA can be mutated without altering the amino acids encoded by the nucleic acid sequences to increase stability of the RNA for recombinant expression. The alterations utilize the degeneracy of the genetic code, e.g., using an alternative codon for an identical amino acid. In some embodiments, it can be desirable to alter one or more codons to encode a conservative mutation, e.g., a similar amino acid with similar chemical structure and properties and / or function as the original amino acid.

[0155] In certain embodiments, an optimized polynucleotide sequence encoding an antibody described herein or a fragment thereof e.g., VL domain or VH domain) can hybridize to an antisense (e.g., complementary) polynucleotide of an unoptimized polynucleotide sequence encoding an antibody described herein or a fragment thereof (e.g., VL domain or VH domain). In specific embodiments, an optimized nucleotide sequence encoding an antibody described herein or a fragment hybridizes under high stringency conditions to antisense polynucleotide of an unoptimized polynucleotide sequence encoding an antibody described herein or a fragment thereof. In some embodiments, an optimized nucleotide sequence encoding an antibody described herein or a fragment thereof hybridizes under high stringency, intermediate or lower stringency hybridization conditions to an antisense polynucleotide of an unoptimized nucleotide sequence encoding an antibody described herein or a fragment thereof. Information regarding hybridization conditions has been described, see, e.g., US 2005 / 0048549 (e.g., paragraphs 72-73), which is incorporated herein by reference.

[0156] The polynucleotides can be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. Nucleotide sequences encoding antibodies described herein and modified versions of these antibodies can be determined using methods well known in the art, i.e., nucleotide codons known to encode particular amino acids are assembled in such a way to generate a nucleic acid that encodes the antibody. Such a polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier G et al., (1994), BioTechniques 17: 242-246), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.

[0157] Alternatively, a polynucleotide encoding an antibody or fragment thereof described herein can be generated from nucleic acid from a suitable source (e.g., a hybridoma) using methods well known in the art (e.g., PCR and other molecular cloning methods). For example, PCR amplification using synthetic primers hybridizable to the 3’ and 5’ ends of a known sequence can be performed using genomic DNA obtained from hybridoma cells producing the antibody of interest. Such PCR amplification methods can be used to obtain nucleic acids comprising the sequence encoding the light chain and / or heavy chain of an antibody. Such PCR amplification methods can be used to obtain nucleic acids comprising the sequence encoding the variable light chain region and / or the variable heavy chain region of an antibody. The amplified nucleic acids can be cloned into vectors for expression in host cells and for further cloning, e.g., to generate chimeric and humanized antibodies.

[0158] If a clone containing a nucleic acid encoding a particular antibody or fragment thereof is not available, but the sequence of the antibody molecule or fragment thereof is known, a nucleic acid encoding the immunoglobulin or fragment can be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library or a cDNA library generated from, or nucleic acid, such as poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody described herein) by PCR amplification using synthetic primers capable of hybridizing to the 3’ and 5’ ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR can then be cloned into replicable cloning vectors using any method well known in the art.

[0159] DNA encoding recombinant proteins described herein can be readily isolated and sequenced using conventional procedures e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the recombinant proteins). Hybridoma cells can serve as a source of such DNA. Once isolated, the DNA can be placed into expression vectors, which are then transfected into host cells such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells (e.g., CHO cells from the CHO GS System™ (Lonza)), or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of recombinant proteins in the recombinant host cells.

[0160] To generate antibodies, PCR primers including VH or VL nucleotide sequences, a restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences in scFv clones. Utilizing cloning techniques known to those of skill in the art, the PCR amplified VH domains can be cloned into vectors expressing a heavy chainconstant region, e.g., the human gamma 4 constant region, and the PCR amplified VL domains can be cloned into vectors expressing a light chain constant region, e.g., human kappa or lambda constant regions. In certain embodiments, the vectors for expressing the VH or VL domains comprise an EF- la promoter, a secretion signal, a cloning site for the variable domain, constant domains, and a selection marker such as neomycin. The VH and VL domains can also be cloned into one vector expressing the necessary constant regions. The heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, e.g., IgG, using techniques known to those of skill in the art.

[0161] The DNA also can be modified, e.g., by substituting the coding sequence for human heavy and light chain constant domains in place of the murine sequences, or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a nonimmunoglobulin polypeptide.

[0162] Also provided are polynucleotides that hybridize under high stringency, intermediate or lower stringency hybridization conditions to polynucleotides that encode an antibody described herein. In specific embodiments, polynucleotides described herein hybridize under high stringency, intermediate or lower stringency hybridization conditions to polynucleotides encoding a VH domain and / or VL domain provided herein.

[0163] Hybridization conditions have been described in the art and are known to one of skill in the art. For example, hybridization under stringent conditions can involve hybridization to filter-bound DNA in 6x sodium chloride / sodium citrate (SSC) at about 45°C followed by one or more washes in 0.2xSSC / 0.1% SDS at about 50-65°C; hybridization under highly stringent conditions can involve hybridization to filter-bound nucleic acid in 6xSSC at about 45 °C followed by one or more washes in 0.1xSSC / 0.2% SDS at about 68°C. Hybridization under other stringent hybridization conditions are known to those of skill in the art and have been described, see, e.g., Ausubel FM et al., eds., (1989) Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York at pages 6.3.1-6.3.6 and 2.10.3.

[0164] Other aspects provide recombinant vectors comprising the gene encoding the IL- 18- binding protein and the nucleic acid encoding the antigen binding fragment against serum albumin. Still other aspects provide a cell transformed with the vector.

[0165] Disclosed herein are nucleic acid molecules encoding a heavy chain region comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:10. Disclosed herein arenucleic acid molecules encoding a light chain region comprising a nucleotide sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:11 or 12.

[0166] Disclosed herein are nucleic acid molecules encoding a light chain region comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:13. Disclosed herein are nucleic acid molecules encoding a light chain region comprising a nucleotide sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:14 or 15.

[0167] In some embodiments, disclosed herein are nucleic acids, each encoding the light chain region of SEQ ID NO: 10 and the heavy chain region of SEQ ID NO: 19. In some embodiments, the nucleic acid encoding the light chain region of SEQ ID NO: 10 can be represented by SEQ ID NO:11 or SEQ ID NO: 12, and the nucleic acid encoding the heavy chain region of SEQ ID NO:19 can be represented by SEQ ID NO:20 or SEQ ID NO:21.

[0168] Further disclosed herein are expression vectors comprising:(a) a promoter,(b) a first nucleic acid molecule encoding a light chain that binds to serum albumin, and(c) a second nucleic acid molecule encoding heavy chain and a bioactive effector moiety such as IL-18BP and a linker, wherein the promoter, the first nucleic acid sequence, and the second nucleic acid molecules are operably linked. The second nucleic acid molecule can encode 1, 2, 3, 4, 5, 6, or more bioactive effector moieties and linkers.

[0169] Also disclosed herein are expression vectors comprising:(a) a promoter and(b) a nucleic acid molecule encoding a heavy chain variable domain as disclosed herein and a heavy chain constant domain as disclosed herein.

[0170] Also disclosed herein are expression vectors comprising:(a) a promoter and(b) a nucleic acid molecule encoding a IL18BP as disclosed herein, a heavy chain variable domain as disclosed herein, and a heavy chain constant domain as disclosed herein.

[0171] Also disclosed herein are expression vectors comprising:(a) a promoter and(b) a nucleic acid molecule encoding a light chain variable domain as disclosed herein and a light chain constant domain as disclosed herein.

[0172] Also disclosed herein are expression vectors comprising:(a) a promoter and(b) a nucleic acid molecule encoding an IL- 18BP as disclosed herein, a light chain variable domain as disclosed herein, and a light chain constant domain as disclosed herein. One, two, three, or more expression vectors or nucleic acid molecules can be expressed to produce the desired recombinant proteins.

[0173] In some embodiments, a first nucleic acid molecule or vector comprises a nucleic acid sequence encoding a recombinant protein comprising an antigen binding fragment comprising a heavy chain, wherein the heavy chain comprises a heavy chain variable domain and a heavy chain constant domain, wherein the heavy chain variable domain comprises( 1 ) a heavy chain complementarity determining domain 1 (CDR 1 ) comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain complementarity determining domain 2 (CDR2) comprising the amino acid sequence of WINTYSGGTKYAQKFQG (SEQ ID NO:23), and a heavy chain complementarity determining domain 3 (CDR3) comprising the amino acid sequence of LGHCQRGICSDALDT (SEQ ID NO:24);(2) a heavy chain CDR1 comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain CDR2 comprising the amino acid sequence ofRINTYNGNTGYAQRLQG (SEQ ID NO:25), and a heavy chain CDR3 comprising the amino acid sequence ofLGHCQRGICSDALDT (SEQ ID NO:24);(3) a heavy chain CDR1 comprising the amino acid sequence of NYGIH (SEQ ID NO:26), a heavy chain CDR2 comprising the amino acid sequence ofSISYDGSNKYYADSVKG (SEQ ID NO:27), and a heavy chain CDR3 comprising the amino acid sequence ofDVHYYGSGSYYNAFDI (SEQ ID NO:28);(4) a heavy chain CDR1 comprising the amino acid sequence of SYAMS (SEQ ID NO:29), a heavy chain CDR2 comprising the amino acid sequence of VISHDGGFQYYADSVKG (SEQ ID NO:30), anda heavy chain CDR3 comprising the amino acid sequence of AGWLRQYGMDV (SEQ ID NO:31);(5) a heavy chain CDR1 comprising the amino acid sequence of AYWIA (SEQ ID NO:32), a heavy chain CDR2 comprising the amino acid sequence of MIWPPDADARYSPSFQG (SEQ ID NO:33), and a heavy chain CDR3 comprising the amino acid sequence of LYSGSYSP (SEQ ID NO:34); or(6) a heavy chain CDR1 comprising the amino acid sequence of AYSMN (SEQ ID NO:35), a heavy chain CDR2 comprising the amino acid sequence ofSISSSGRYIHYADSVKG (SEQ ID NO:36), and a heavy chain CDR3 comprising the amino acid sequence ofETVMAGKALDY (SEQ ID NO:37).

[0174] Disclosed herein is a second nucleic acid molecule or vector comprises a nucleic acid sequence encoding a recombinant protein comprising an antigen binding fragment comprising a light chain, wherein the light chain comprises a light chain variable domain and a light chain constant domain, wherein the light chain variable domain comprises(7) a light chain CDR1 comprising the amino acid sequence of RASQSISRYLN (SEQ ID NO:38), a light chain CDR2 comprising the amino acid sequence of GASRLES (SEQ ID NO:39), and a light chain CDR3 comprising the amino acid sequence of QQSDSVPVT (SEQ ID NO:40);(8) a light chain CDR1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO:41), a light chain CDR2 comprising the amino acid sequence of AASSLQS (SEQ ID NO:42), and a light chain CDR3 comprising the amino acid sequence of QQSYSTPPYT (SEQ ID NO:43);(9) a light chain CDR1 comprising the amino acid sequence of RASQSIFNYVA (SEQ ID NO:44), a light chain CDR2 comprising the amino acid sequence of DASNRAT (SEQ ID NO:45), anda light chain CDR3 comprising the amino acid sequence of QQRSKWPPTWT (SEQ ID NO:46);(10) a light chain CDR1 comprising the amino acid sequence of RASETVSSRQLA (SEQ ID NO:47), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QQYGSSPRT (SEQ ID NO:49);(11) a light chain CDR1 comprising the amino acid sequence of RASQSVSSSSLA (SEQ ID NO:50), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QKYSSYPLT (SEQ ID NO:51); or(12) a light chain CDR1 comprising the amino acid sequence of RASQSVGSNLA (SEQ ID NO:52), a light chain CDR2 comprising the amino acid sequence of GASTGAT (SEQ ID NO:53), and a light chain CDR3 comprising the amino acid sequence of QQYYSFLAKT (SEQ ID NO:54).

[0175] For example, the nucleic acid molecule encoding IL-18BP can be linked to the first or second nucleic acid molecule or vector described above.

[0176] In other embodiments, the first nucleic acid molecule can comprise a nucleic acid sequence encoding a Fab comprising: a heavy chain variable domain comprising (1) above and a light chain variable domain comprising (7) above; a heavy chain variable domain comprising (2) above and a light chain variable domain comprising (8) above; a heavy chain variable domain comprising (3) above and a light chain variable domain comprising (9) above; a heavy chain variable domain comprising (4) above and a light chain variable domain comprising (10) above; a heavy chain variable domain comprising (5) above and a light chain variable domain comprising (11) above; a heavy chain variable domain comprising (6) above and a light chain variable domain comprising (12) above; or any or all combinations of a heavy chain variable domain and a light chain variable domain described above. In some embodiments, the first nucleic acid molecule comprises a nucleic acid sequence encoding a Fab (SL335) comprising the heavy chain variable domain comprises a heavy chain CDR1 comprising the amino acidsequence of SEQ ID NO:35, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO:36, and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO:37, and the light chain variable domain comprises a light chain CDR1 comprising the amino acid sequence of SEQ ID NO:52, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO:53, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:54. The first or second nucleic acid molecule can encode the IL-18BP.

[0177] In other embodiments, a first nucleic acid molecule or vector comprises a nucleic acid sequence encoding a Fab comprising a heavy chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60. In some embodiments, a second nucleic acid molecule or vector comprises a nucleic acid sequence encoding a Fab comprising a light chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:61, 62, 63, 64, 65, 66, or 67. The nucleic acid molecule encoding IL-18BP can be linked to the first or second nucleic acid molecule or vector.

[0178] In some embodiments, a first nucleic acid molecule or vector comprises a nucleic acid sequence encoding a Fab comprising a heavy chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60, and a light chain variable domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:61, 62, 63, 64, 65, or 66 or 67, respectively.

[0179] In some embodiments, the first nucleic acid molecule comprises a nucleic acid sequence encoding a Fab (SL335) comprising a heavy chain domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 10 (VH-CHI domain) and a light chain domain comprising an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 13 (VL- CK domain).

[0180] In some embodiments, the bioactive effector moiety is IL-18BP. In some embodiments, a nucleic acid molecule encodes an IL- 18-BP protein comprises an amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:7. In some embodiments, a nucleic acid molecule encoding the IL-18-binding protein comprises a nucleotide sequence having at least 90%, at least 93%,at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO:8 or SEQ ID NO:9. For example, the first nucleic acid molecule can comprise a nucleotide sequence encoding the amino acid sequence having at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to one or more of SEQ ID NO:7, e.g., SEQ ID NO:8 or 9.

[0181] Recombinant expression of an antibody or fragment thereof described herein (e.g., a heavy or light chain of an antibody described herein) that specifically binds to involves construction of an expression vector containing a polynucleotide that encodes the antibody or fragment. Once a polynucleotide encoding an antibody or fragment thereof (e.g., heavy or light chain variable domains) described herein has been obtained, the vector for the production of the antibody molecule can be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody or antibody fragment (e.g., light chain or heavy chain) encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody or antibody fragment (e.g., light chain or heavy chain) coding sequences and appropriate transcriptional and translational control signals. These methods include, e.g., in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Also provided are replicable vectors comprising a nucleotide sequence encoding an antibody molecule described herein, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a fragment thereof, or a heavy or light chain CDR, operably linked to a promoter. Such vectors can, e.g., include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., W086 / 05807 and W089 / 01036; and U.S. Pat. No. 5,122,464) and variable domains of the antibody can be cloned into such a vector for expression of the entire heavy, the entire light chain, or both the entire heavy and light chains.

[0182] An expression vector can be transferred to a cell (e.g., host cell) by conventional techniques and the resulting cells can then be cultured by conventional techniques to produce an antibody described herein.

[0183] A variety of host-expression vector systems can be utilized to express antibody molecules described. Such host-expression systems represent vehicles by which the coding sequences of interest can be produced and subsequently purified, but also represent cells which can, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule described herein in situ. These include but are not limited to microorganisms such as bacteria e.g., E. coli and B. subtilis) transformed with recombinantbacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast e.g., Saccharomyces Pichid) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems (e.g., green algae such as Chlamydomonas reinhardtii) infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS (e.g., COS1 or COS), CHO, BHK, MDCK, HEK 293, NSO, PER.C6, VERO, CRL7O3O, HsS78Bst, HeLa, and NIH 3T3, HEK-293T, HepG2, SP210, Rl.l, B-W, L-M, BSC1, BSC40, YB / 20 and BMT10 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). In some embodiments, cells for expressing antibodies described herein (e.g., an antibody comprising the CDRs of any one of antibodies pabl949 or pab2044) are CHO cells, e.g., CHO cells from the CHO GS System™ (Lonza). In some embodiments, cells for expressing antibodies described herein are human cells, e.g., human cell lines. In some embodiments, a mammalian expression vector is pOptiVEC™ or pcDNA3.3. In some embodiments, bacterial cells such as Escherichia coli, or eukaryotic cells (e.g., mammalian cells), especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary (CHO) cells in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking MK & Hofstetter H (1986) Gene 45: 101-105; and Cockett MI et al., (1990) Biotechnology 8: 662- 667). In certain embodiments, antibodies described herein are produced by CHO cells or NSO cells. In some embodiments, the expression of nucleotide sequences encoding antibodies described herein is regulated by a constitutive promoter, inducible promoter or tissue specific promoter.

[0184] In bacterial systems, a number of expression vectors can be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such an antibody is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified can be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruether U & Mueller-Hill B (1983) EMBO J 2: 1791-1794), in which the antibody coding sequence can be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye S & Inouye M (1985) Nuc Acids Res 13: 3101-3109; Van Heeke G & Schuster SM (1989) J Biol Chem 24: 5503-5509); and the like. For example, pGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione 5-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.

[0185] In mammalian host cells, a number of viral-based expression systems can be utilized. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest can be ligated to an adenovirus transcription / translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene can then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts e.g., see Logan J & Shenk T (1984) PNAS 81: 3655-3659). Specific initiation signals can also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see, e.g., Bitter G et al., (1987) Methods Enzymol 153:516-544).

[0186] In addition, a host cell strain can be chosen which modulates the expression of the inserted sequences or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products can be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product can be used. Such mammalian hostcells include but are not limited to CHO, VERO, BHK, Hela, MDCK, HEK 293, NIH 3T3, W138, BT483, Hs578T, HTB2, BT2O and T47D, NSO (a murine myeloma cell line that does not endogenously produce any immunoglobulin chains), CRL7O3O, COS (e.g., COS1 or COS), PER.C6, VERO, HsS78Bst, HEK-293T, HepG2, SP210, Rl.l, B-W, L-M, BSC1, BSC40, YB / 20, BMT10 and HsS78Bst cells. In certain embodiments, recombinant proteins described herein (e.g., an antibody comprising the CDRs are produced in mammalian cells, such as CHO cells.

[0187] In some embodiments, the antibodies described herein have reduced fucose content or no fucose content. Such antibodies can be produced using techniques known one skilled in the art. For example, the antibodies can be expressed in cells deficient or lacking the ability of to fucosylate. In a specific example, cell lines with a knockout of both alleles of al, 6- fucosyltransferase can be used to produce antibodies with reduced fucose content. The Potelligent® system (Lonza) is an example of such a system that can be used to produce antibodies with reduced fucose content.

[0188] For long-term, high-yield production of recombinant proteins, stable expression cells can be generated. For example, cell lines which stably express recombinant proteins disclosed herein can be engineered. In specific embodiments, a cell provided herein stably expresses a light chain / light chain variable domain and a heavy chain / heavy chain variable domain which associate to form an antibody described herein (e.g., an antibody comprising the CDRs).

[0189] In certain aspects, rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, poly adenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA / polynucleotide, engineered cells can be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can advantageously be used to engineer cell lines which express an antibody described herein or a fragment thereof. Such engineered cell lines can be particularly useful in screening and evaluation of compositions that interact directly or indirectly with the antibody molecule.

[0190] A number of selection systems can be used, including but not limited to, the herpes simplex virus thymidine kinase (Wigler M et al., (1977) Cell 11(1): 223-232),hypoxanthineguanine phosphoribosyltransferase (Szybalska EH & Szybalski W (1962) PNAS 48(12): 2026-2034) and adenine phosphoribosyltransferase (Lowy I et al., (1980) Cell 22(3): 817-823) genes can be employed in tk-, hgprt- or aprt-cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler M et al., (1980) PNAS 77(6): 3567-3570; O’Hare K et al., (1981) PNAS 78: 1527-1531); gpt, which confers resistance to mycophenolic acid (Mulligan RC & Berg P (1981) PNAS 78(4): 2072-2076); neo, which confers resistance to the aminoglycoside G-418 (Wu GY & Wu CH (1991) Biotherapy 3: 87-95; Tolstoshev P (1993) Ann Rev Pharmacol Toxicol 32: 573-596; Mulligan RC (1993) Science 260: 926-932; and Morgan RA & Anderson WF (1993) Ann Rev Biochem 62: 191-217; Nabel GJ & Feigner PE (1993) Trends Biotechnol 11(5): 211-215); and hygro, which confers resistance to hygromycin (Santerre RF et al., (1984) Gene 30(1-3): 147-156).

[0191] The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington CR & Hentschel CCG. The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3 (Academic Press, New York, 1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse GF et al., (1983) Mol Cell Biol 3: 257-66).

[0192] The host cell can be co-transfected with two or more expression vectors described herein, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors can contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. The host cells can be co-transfected with different amounts of the two or more expression vectors. For example, host cells can be transfected with any one of the following ratios of a first expression vector and a second expression vector: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:12, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50.

[0193] Alternatively, a single vector can be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot NJ (1986) Nature 322: 562-565; and Kohler G (1980) PNAS 77: 2197-2199). The coding sequences for the heavy and light chains can comprise cDNA or genomic DNA. The expression vector can be monocistronic or multicistronic. A multicistronic nucleic acid construct can encode 2, 3,4, 5, 6, 7, 8, 9, 10 or more, or in the range of 2-5, 5-10 or 10-20 genes / nucleotide sequences. For example, a bicistronic nucleic acid construct can comprise in the following order a promoter, a first gene e.g., heavy chain of an antibody described herein), and a second gene and (e.g., light chain of an antibody described herein). In such an expression vector, the transcription of both genes can be driven by the promoter, whereas the translation of the mRNA from the first gene can be by a cap-dependent scanning mechanism and the translation of the mRNA from the second gene can be by a cap-independent mechanism, e.g., by an IRES.

[0194] Once an antibody molecule described herein has been produced by recombinant expression, it can be purified by any method known in the art for purification of an immunoglobulin molecule, e.g., by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Further, the antibodies described herein can be fused to heterologous polypeptide sequences described herein or otherwise known in the art to facilitate purification.

[0195] In specific embodiments, an antibody described herein is isolated or purified. Generally, an isolated antibody is one that is substantially free of other antibodies with different antigenic specificities than the isolated antibody. For example, in some embodiments, a preparation of an antibody described herein is substantially free of cellular material and / or chemical precursors. The language “substantially free of cellular material” includes preparations of an antibody in which the antibody is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, an antibody that is substantially free of cellular material includes preparations of antibody having less than about 30%, 20%, 10%, 5%, 2%, 1%, 0.5%, or 0.1% (by dry weight) of heterologous protein (also referred to herein as a “contaminating protein”) and / or variants of an antibody, e.g., different post-translational modified forms of an antibody. When the antibody or fragment is recombinantly produced, it is also generally substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, 2%, 1%, 0.5%, or 0.1% of the volume of the protein preparation. When the antibody or fragment is produced by chemical synthesis, it is generally substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. Accordingly, such preparations of the antibody or fragment have less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or compounds other than the antibody or fragment of interest. In some embodiments, antibodies described herein are isolated or purified.Compositions

[0196] Still other aspects provide compositions, e.g., pharmaceutical compositions, for treating liver diseases primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis, the pharmaceutical compositions comprising the recombinant protein as an active ingredient; methods of treating liver diseases primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis, the methods comprising administering the composition to a subject; and medical uses of the recombinant protein for preventing or treating liver diseases primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis.

[0197] For example, the pharmaceutical composition can comprise (a) a pharmaceutically effective amount of the recombinant protein; and (b) a pharmaceutically acceptable carrier.

[0198] In some embodiments, the in vivo half-life of the pharmaceutical composition can exhibit a 2- to 20-fold increase, as compared with that of human IL-18BP. The in vivo halflife can exhibit, e.g., about 2.5-fold to about 3.5-fold, about 3.5-fold to about 6-fold increase, about 4-fold to about 6-fold increase, about 4.5-fold to about 6-fold increase, about 5-fold to about 6-fold increase, about 5.5- fold to about 6-fold increase, about 3-fold to about 5.5-fold increase, about 3.5-fold to about 5.5-fold increase, about 4-fold to about 5.5-fold increase, about 4.5-fold to about 5.5-fold increase, about 5-fold to about 5.5-fold increase, about 3-fold to about 5-fold increase, about 3.5-fold to about 5-fold increase, about 4-fold to about 5-fold increase, about 4.5-fold to about 5-fold increase, about 3-fold to about 4.5-fold increase, about 3.5-fold to about 4.5-fold increase, about 4-fold to about 4.5-fold increase, or any fold or ranges of folds derived therefrom, as compared with that of human IL- 18BP. In some embodiments, the in vivo half-life of the human IL-18BP can be evaluated after subcutaneous injection of the human IL-18BP.

[0199] In some embodiments, the pharmaceutical composition can decrease white blood cell levels in blood. The white blood cells can be, e.g., neutrophils, monocytes, basophils, or a combination thereof. In some embodiments, the decreased white blood cell level can be sustained and maintained until day 20 after administration, until day 15 after administration, until day 12 after administration, until day 10 after administration, until day 8 after administration, until day 7 after administration, or any ranges derived therefrom.

[0200] The pharmaceutical composition can be prepared in a unit dosage form or in a multidose container by formulating using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by a person skilled in the art to which the present disclosure pertains. In this case, the formulation can be in the form of a solution, suspension, or emulsion in an oily or aqueous medium, or in the form of an extract, a suppository, a powder, granules, a tablet, or a capsule, and the formulation can further include a dispersing agent or a stabilizing agent.

[0201] Provided herein are compositions comprising a recombinant protein described herein having the desired degree of purity in a physiologically acceptable carrier, excipient or stabilizer (Remington’s Pharmaceutical Sciences (1990) Mack Publishing Co., Easton, PA). Also disclosed herein are pharmaceutical compositions comprising a recombinant protein described herein and a pharmaceutically acceptable excipient. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed.

[0202] The pharmaceutical composition for preventing or treating liver diseases primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis according to some aspects can be used after formulating in the form of oral preparations, such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injectable preparations according to common methods, and for formulation, the pharmaceutical composition can include an appropriate carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions.

[0203] The carrier, excipient, or diluent can include various compounds or mixtures, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc.

[0204] When formulated, it can be prepared using commonly used diluents or excipients, such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.

[0205] Solid formulations for oral administration can be prepared by mixing the recombinant fusion protein with at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate or talc can also be used.

[0206] Liquid formulations for oral administration can include suspensions, solutions for internal use, emulsions, syrups, etc. In addition to water and liquid paraffin, which arecommonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, preservatives, etc. can be included.

[0207] Formulations for parenteral administration include sterile aqueous solutions, nonaqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. The non-aqueous solvents and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. As a suppository base, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol gelatin, etc. can be used.Routes of Administration & Dosages

[0208] The pharmaceutical compositions of the present disclosure can be administered to a subject through a variety of administration routes including oral, transcutaneous, subcutaneous, intravenous, and intramuscular administration routes.

[0209] The amount of a recombinant protein or composition disclosed herein that will be effective in the treatment and / or prevention of a condition will depend on the nature of the disease and can be determined by standard clinical techniques.

[0210] In the present disclosure, the amount of the recombinant protein disclosed herein that is actually administered is determined in light of various relevant factors including the disease to be treated, a selected route of administration, the age, sex and body weight of a patient, and severity of the disease, and the type of a bioactive polypeptide as an active ingredient. Since the recombinant protein of the present disclosure has excellent sustainability in blood, the number and frequency of administration of the peptide preparations comprising the recombinant protein of the present disclosure can be noticeably reduced.

[0211] The pharmaceutical composition is administered in a pharmaceutically effective amount. As used herein, the “pharmaceutically effective amount” or “effective amount” in the context of the administration of a therapy to a subject refers to the amount of a therapy that achieves a desired prophylactic or therapeutic effect. An effective dose level can be determined depending on factors including a patient’s disease type, severity, drug activity, drug sensitivity, administration time, administration route and excretion ratio, treatment period, and co-administered drugs, and other factors well known in the medical field. The pharmaceutical composition can be administered as a single therapeutic agent or in combination with other therapeutic drugs, and can be administered with existing therapeutic drugs simultaneously, separately, or sequentially, once or in a few divided doses. It is important to administer the composition in a minimum amount sufficient to obtain the maximum effect without any side effects, considering all the factors, and this amount can be easily determinedby those skilled in the art. As used herein, the term “pharmaceutically effective amount” refers to an amount sufficient to treat the liver disease such as PSC or NASH.

[0212] An appropriate dosage of the pharmaceutical composition for preventing or treating liver diseases primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis according to some aspects varies depending on a patient's conditions, body weight, disease severity, drug formulation, administration route and period, but can be appropriately selected by those skilled in the art. However, for desirable effects, the pharmaceutical composition can be administered at a daily dose of 0.0001 mg / kg to 2,000 mg / kg, and specifically, 0.001 mg / kg to 2,000 mg / kg. Administration can be performed once a day, or in several divided doses.

[0213] The precise dose to be employed in a composition will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each subject’s circumstances. For example, effective doses can also vary depending upon means of administration, target site, physiological state of the patient (including age, body weight and health), other medications administered, or whether treatment is prophylactic or therapeutic. Usually, the patient is a human but can be a nonhuman, such as pets, e.g., dogs and cats. Treatment dosages are optimally titrated to optimize safety and efficacy.

[0214] In certain embodiments, an in vitro assay is employed to help identify optimal dosage ranges. Effective doses can be extrapolated from dose response curves derived from in vitro or animal model test systems.

[0215] In some embodiments, the recombinant fusion protein can be administered at a dose of 0.001 mg / kg to 2,000 mg / kg. For example, the recombinant fusion protein can be administered at a dose of 0.001 mg / kg to 0.01 mg / kg, 0.1 mg / kg to 1 mg / kg, 0.3 mg / kg to 1 mg / kg, 1 mg / kg to 1.5 mg / kg, 1.5 mg / kg to 2 mg / kg, 2 mg / kg to 3 mg / kg, 3 mg / kg to 4 mg / kg, 4 mg / kg to 10 mg / kg, 10 mg / kg to 15 mg / kg, 15 mg / kg to 20 mg / kg, 30 mg / kg to 40 mg / kg, 60 mg / kg to 80 mg / kg, 100 mg / kg to 200 mg / kg, or any dose or ranges of doses derived therefrom.

[0216] The pharmaceutical composition for preventing or treating liver diseases such as primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, inflammatory bowel disease (IBD), nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis according to some aspects can be administered to mammals, such as rats, mice, livestock, humans, etc., via various routes. All modes of administration can be contemplated,for example, by oral, rectal or intravenous, intramuscular, subcutaneous, or intradural administration, or intracerebroventricular injection.

[0217] The pharmaceutical compositions can be orally or parenterally administered. Specifically, the pharmaceutical composition can be parenterally administered, and in this case, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, intrapulmonary administration, and rectal administration. In some embodiments, it can be administered in the form of subcutaneous injection. When orally administered, a protein or peptide is digested, and therefore, it is required to formulate an oral composition by coating the active ingredient or protecting it from degradation in the stomach. In addition, the pharmaceutical compositions can be administered by any device capable of delivering an active substance to target cells.

[0218] As described above, the recombinant fusion protein can exhibit, e.g., a half-life about 3.5 times extended in rats, as compared with the human recombinant IL-18BP, and exhibits a biological activity at a similar level to that of IL-18BP not fused to SL335. Therefore, since the recombinant fusion protein can exhibit similar efficacy even with less frequency of administration, patients can be administered with the drug at more convenient intervals.EXAMPLESExample 1. Preparation of Recombinant Fusion Protein Including Interleukin-18- Binding Protein and Antigen Binding Fragment Against Serum Albumin

[0219] 1-1. Preparation of vector expressing interleukin- 18 -binding protein and vector expressing antigen binding fragment against serum albumin

[0220] A recombinant fusion protein including an interleukin IL- 18 -binding protein (IL-18BP) and an antibody fragment binding to serum albumin was prepared. A human interleukin- 18- binding protein (hIL-18BP) gene needed in experiments was synthesized by Cosmogenetech co, Ltd. (South Korea). A Fab antibody fragment (SL335) binding to human serum albumin was selected from human naive antibody libraries, and heavy chain and light chain genes were synthesized by ATUM (Newark, California).

[0221] A recombinant gene (SL335H-Linker-hIL18BP), in which ML-18BP was linked to the C-terminus of SL335 heavy chain via a peptide linker (GSAPAPGS; SEQ ID NO: 16), was prepared. In detail, the SL335H-Linker-hIL18BP gene was amplified using primers represented by SEQ ID NOS:1 to 4 of Table 1 below under conditions of 30 cycles of 95°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute. Thereafter, the amplified recombinantgene and pD2535NT to be used as an expression vector were treated with BbsI (Takara, Japan) restriction enzyme, respectively to digest the BbsI site, and then treated with T4 DNA ligase, and inserted into each vector. Meanwhile, an SL335 light chain gene was inserted into a pD2359 vector.Table 1.

[0222] FIGS. 1A and IB show heavy chain (FIG. 1A) and light chain (FIG. IB) expression vectors for the preparation of the recombinant fusion protein according to an aspect. As shown in FIG. 1, in the heavy chain, human recombinant IL-18BP was linked to the C-terminus of SL335H via the peptide linker.

[0223] 1-2. Preparation of transient expression cells

[0224] ExpiCHO-S™ cells (Thermo Fisher scientific) were suspended in a 125 ml culture flask containing an expression medium (ExpiCHO expression media, Thermo Fisher Scientific), and then cultured in a shaking incubator under conditions of 37°C, 140 rpm, 5% CO2, and 80% humidity. Thereafter, to prepare transient expression cells, the cultured cells were dispensed at a density of 6.0 x 106cells / ml, and plasmid vectors (pD2535NT, pD2539), into which the heavy chain and light chain genes prepared in Example 1-1 were respectively inserted, were transfected into the dispensed cells. Then, the cells were cultured in the shaking incubator under the same conditions as above for 16 hours, and immediately treated with an ExpiCHO feed and enhancer. On day 3 of culture, the cells were further treated with the ExpiCHO feed,and cultured for 8 days at an incubator temperature set to 32 °C. After the culture was completed, the harvested culture medium was centrifuged at 4,000 rpm and 4°C for 15 minutes to separate the cells and the culture medium. Then, the culture medium was passed through a 0.2 pm filter paper to remove impurities.

[0225] 1-3. Preparation of stable cell line

[0226] A stable cell line was prepared using HD-BIOP3 GS null CH0-K1 cells (Horizon Discovery). In detail, cells were dispensed at a density of 3.0 x 105cells / ml in a CD FortiCHO (Thermo Fisher Scientific) medium containing 4 mM of L-glutamine, followed by seed culture for one day in a shaking incubator under conditions of 37°C, 5% CO2, and 80% or more humidity. For transfection, cells were aliquoted at a density of 1.0 x 106cells / ml, and each plasmid vector (pD2535NT, pD2539) prepared in Example 1-1 was transfected into the dispensed cells using an OptiPRO SFM medium and a Freestyle max reagent (Invitrogen, Carlsbad, California), and then cultured for 2 days under conditions of 37°C, 5% CO2, and 80% or more humidity. Thereafter, to perform stable pool selection, the medium was replaced with a CD FortiCHO medium without L-glutamine by centrifugation, and 50 pM of methionine sulfoximine (MSX) (Sigma-Aldrich, St. Louis, Missouri) and 10 pg / ml of puromycin (Thermo Fisher Scientific) were treated every two days to remove cells not transfected with the vector. Thereafter, the medium was replaced by a CD FortiCHO medium containing both MSX and puromycin every 7 to 10 days using a centrifuge, and the number of cells was maintained at 5.0 x 105cells / ml each time and cultured for 21 days. Thereafter, when viability was recovered at 90% or more, a stock was prepared at 1.0 x 107cells / ml.

[0227] 1-4. Isolation and purification of APB-R3 protein

[0228] The protein sample present in the culture medium of Example 1-3 was purified by sequentially performing affinity chromatography (AC), cation exchange chromatography (CEX), and anion exchange chromatography (AEX). In detail, affinity chromatography was performed at a flow rate of 8 ml / min, and cation exchange chromatography was performed at a flow rate of 2 ml / min. Then, the proteins purified by the cation exchange chromatography were passed through anion exchange chromatography, and the proteins not bound to resins were recovered. The protein purified by the above method was named APB-R3.

[0229] FIG. 2 shows a structure of the APB-R3 protein according to an aspect. As shown in FIG. 2, APB-R3 was confirmed to have a structure, in which SL335 which is a human Fab fragment specifically binding to serum albumin, and IL-18BP were linked via a peptide linker, and the heavy chain (SL335H-peptide linker-IL-18BP) and the light chain (SL335L) were non- covalently linked. It was also confirmed that SL335 consists of human VH-CHI (SL335H) andVL-CK(SL335L). Meanwhile, SL335 which is a sequence selected from human naive antibody libraries, is expected to have very low immunogenicity, because the sequence is very similar to the original human antibody sequence.Comparative Example 1. Preparation of Recombinant Human Interleukin-18-binding protein

[0230] A recombinant gene, in which a His-tag (HHHHHHHH; SEQ ID NO: 85) was linked to the C terminus of ML-18BP, was prepared. In detail, hIL18BP-his8 was amplified under the same conditions as in Example 1-1 using primers represented by SEQ ID NOS:5 and 6 of Table 1. Then, the product was inserted into an expression vector in the same manner as in Example 1-1, and then a recombinant human IL-18-binding protein was prepared by the methods of Examples 1-2 to 1-4. Then, the protein was purified using HiTrap IMAC HP (GE Healthcare) and AKTA pure 150 L equipment.Experimental Example 1. Molecular Characteristics of APB-R3 Protein

[0231] 1-1. Examination of size

[0232] SDS-PAGE was performed to examine the sizes of the proteins prepared in Example 1 and Comparative Example 1. In detail, protein samples were prepared using a non-reducing 4xSDS sample buffer (Thermo Fisher Scientific) and 2-mercaptoethanol under reducing and non-reducing conditions. For the non-reducing conditions, samples which were heated at 100°C for 5 minutes or not heated were prepared to compare the shape and size of the proteins by heating. A protein size marker (SMOBio, Taiwan) was prepared to compare the sizes of proteins under the respective conditions. The prepared protein samples were loaded into a Mini-protein TGX precast gel, 4-15%, 15-well (Bio-Rad) in an amount of 1 pg or 2 pg per well, followed by electrophoresis in a tris-glycine SDS running buffer at 150 V for 1 hour. After the electrophoresis was completed, the SDS-PAGE gel was reacted with an EZ-Gel staining solution (DoGenBio, South Korea) to perform staining for 1 hour, followed by destaining in distilled water for one day.

[0233] FIG. 3 shows SDS-PAGE results of analyzing the size of the APB-R3 protein in an amount of 1 pg / well and 2 pg / well under reducing (R), non-reducing and boiled (NR(B)), and non-reducing and non-boiled (NR(NB)) conditions. As shown in FIG. 3, SL335H-IL18BP heavy chain protein under reducing conditions and non-reducing and boiled conditions for 5 minutes exhibited a protein band at about 60 kDa, which is higher than a theoretical size of 41.905 kDa, due to additional N-linked and O-linked glycans, and SL335L light chainexhibited a protein band at 20 kDa to 25 kDa similar to a theoretical size (23.311 kDa). In contrast, under non-reducing and non-boiled conditions, a protein band corresponding to an intact form of APB-R3, in which the heavy chain and the light chain were bound, was observed with high purity at 75 kDa to 100 kDa, and protein bands, each corresponding to unbound heavy and light chains, were weakly detected.

[0234] 1-2. Examination of purity

[0235] SE-HPLC was performed to measure purity of the APB-R3 protein purified in Example 1-4. First, a TSKgel UltraSW Aggregate 7.8x300 mm (Tosoh Bioscience, Japan) column and 1260 infinity II LC system (Agilent Technologies, Santa Clara, California) HPLC equipment were equilibrated with 20 mM citric acid at pH 5.5 buffer. Analytical samples were prepared by diluting with 20 mM citric acid at pH 5.5 buffer, and ~25 pg of the sample was loaded onto the column. SE-HPLC analysis was performed at a flow rate of 0.7 ml / min and a maximum pressure limit of 120 bar for 30 minutes, and purity was measured at A280 nm wavelength.

[0236] FIG. 4 shows SEC-HPLC results of analyzing purity of the APB-R3 protein according to an aspect. As shown in FIG. 4, it was confirmed that the APB-R3 protein had purity of 98% or more.

[0237] 1-3. Examination of isoelectric point

[0238] In order to measure an isoelectric point (pl) of the APB-R3 protein purified in Example 1-4, isoelectric focusing analysis (IEF) was performed. In detail, a pH3-10 IEF gel (Koma gel) was used, and 3 pg, 5 pg, and 10 pg of samples were loaded, and the conditions were at 100 V for 1 hour, at 200 V for 1 hour, and at 500 V for 1 hour. The protein was fixed using 12% trichloroacetic acid (TCA) and stained with coomassie brilliant blue (CBB). Thereafter, pl of the protein was analyzed using ImageMaster™ 2D Platinum (GE Healthcare, ver.5.0).

[0239] FIG. 5 shows results of analyzing an isoelectric point of the APB-R3 protein according to an aspect. As shown in FIG. 5, a band was observed at pl of 4.40 to 6.00.

[0240] 1-4. Examination of molecular weight

[0241] Intact mass spectrometry analysis was performed to measure a molecular weight of the APB-R3 protein of Example 1. In detail, intact mass spectrometry analysis was performed under reduced conditions (20 mM DTT, 37°C) using Dionex UHPLC (Thermo Fisher Scientific) and Q-TOF 5600+ MS / MS system (AB SCIEX, CA, USA). The molecular weight was measured in a mobile phase of acetonitrile (ACN; J.T. Baker) at a flow rate of 0.3 ml / min using Acquity UPLC® BEH130 C4, 1.7 pm column, and the results are shown in Table 2 below.Table 2

[0242] As shown in Table 2, it was confirmed that molecular weights of the light chain (SL335L) and the heavy chain (SL335H-IL18BP) of the APB-R3 protein were 23.306 kDa and 46.611 kDa, respectively.Example 2. Evaluation of biological activity of APB-R3 protein

[0243] 2-1. Examination of IL- 18 inhibition degree (1)

[0244] To evaluate biological functions of the APB-R3 protein purified in Example 1-4, IL-18 inhibition degree of the protein was examined using a human KG-1 cell line (ATCC, CCL- 246) expressing IFN-y in response to IL-18. First, the protein sample of Example 1 was prepared by diluting the sample with a PBS buffer supplemented with 0.3% bovine serum albumin (BSA). Thereafter, each sample was treated with a recombinant human IL- 18 protein (R&D Systems) and allowed to react for 1 hour in a 37°C incubator. Thereafter, 1.3 x 106cells / ml of KG-1 cells were prepared in an IMDM medium containing recombinant TNF-a (BioLegend, San Diego, California), and then dispensed into the protein mixture, in which the reaction was completed. The mixture of the cells and proteins were reacted for 23 hours in an incubator under 37°C and 5% CO2 conditions, and then the supernatant and cells were separated using a centrifuge. The separated supernatant was analyzed to measure the amount of IFN-y secreted from KG-1 cells by recombinant IL- 18. The concentration of IFN-y secreted in the supernatant was analyzed using ELISA MAX™ Deluxe Set human IFN-y (BioLegend) and performed according to the standard experimental method specified in the product. Comparative Example 1 and SL335 protein were analyzed in the same manner.

[0245] FIG. 6 shows a graph showing IL- 18 inhibition in the KG-1 cell line by the APB-R3 protein according to an aspect. As shown in FIG. 6, KG-1 cells produced and expressed IFN- y in an IL- 18 concentration-dependent manner, and the APB-R3 protein inhibited IFN-y production in a concentration-dependent manner, similar to IL-18BP-His protein. In addition, IC50 of APB-R3 was 0.0419 nM, and IC50 of IL-18BP-His was 0.0240 nM, indicating that human IL-18BP fused to SL335 maintained its intact biological property.

[0246] 2-2. Examination of IL- 18 inhibition degree (2)

[0247] To evaluate biological functions of the APB-R3 protein purified in Example 1-4, IL-18 inhibition degree of APB-R3 was examined using Naive CD4+ T cells isolated from C57BL / 6 mouse (Orient Bio). First, anti-CD3 (Biolegend, clone 145-2C11) diluted at a concentration of 5 pg / ml using a PBS buffer was dispensed in an amount of 50 pl in each well of a 96-well culture plate (Corning, 3596), and then coated at 4 °C for 16 hours. The plate was washed twice with 200 pl / well of PBS before adding the cells. Prior to treatment of the isolated Naive CD4+ T cells with the sample, the following pretreatment was performed. A recombinant mouse IL- 18 protein (R&D Systems) and a recombinant mouse IL- 12 protein (PeproTech) were prepared at a concentration of 10 ng / ml by diluting with an RPMI1640 (Gibco) medium containing 10% fetal bovine serum (FBS) (Gemini bio), 50 pM 2-mercaptoethanol (Gibco), 10 mM HEPES (Gibco), and 5 pg / ml gentamycin (Gibco), and then mixed with APB-R3 protein samples serially diluted and allowed to react in a 37°C incubator for 1 hour. Then, the reacted samples were treated with 1.0 x 105cells / ml of CD4+ T cells and allowed to react for 48 hours in an incubator under 37°C and 5% CO2 conditions. To measure the amount of IFN-y secreted from CD4+T cells by the recombinant mouse IL- 18, the separated supernatant was analyzed using ELISA MAX™ Deluxe Set mouse IFN-y (BioLegend) and performed according to the standard experimental method specified in the product. Comparative Example 1 , recombinant mouse IL-18BP (R&D System), and SL335 protein were analyzed in the same manner.

[0248] FIG. 7 shows a graph showing IL- 18 inhibition in mouse CD4+ T cells by the APB-R3 protein according to an aspect. As shown in FIG. 7, mouse CD4+ T cells produced and expressed INF-y in an IL-18 concentration-dependent manner, and the APB-R3 protein inhibited IFN-y production in a concentration-dependent manner, similar to human IL-18BP- His protein. In contrast, it was confirmed that mouse IL-18BP inhibits IFN-y production in a concentration-dependent manner, but its inhibitory activity was lower than that of APB-R3.Example 3. Pharmacokinetic evaluation of APB-R3 protein

[0249] Absorption, distribution, in vivo changes, and excretion of the APB-R3 protein prepared in Example 1 were examined through pharmacokinetics. In detail, after breeding 20 healthy male rats from Koatech (South Korea), single subcutaneous administration of the protein of Example 1 was performed for five mice each at a dose of 6 mg / kg, followed by a single intravenous administration at a dose of 2 mg / kg. Single subcutaneous administration of the protein of Comparative Example 1 was also performed (five mice) at a dose of 3 mg / kg, respectively, followed by intravenous administration (five mice) at a dose of 1 mg / kg.Thereafter, 0.5 ml of whole blood was collected through the jugular vein according to a predetermined blood sampling schedule [single subcutaneous administration: 0, 0.33, 1, 1.5, 3, 5, 7, 12, 24, 48, 72, 120, and 168 hours (13 points in total), single intravenous administration: 0, 0.083, 0.25, 0.5, 1.25, 3, 5, 10, 24, 48, and 72 hours (11 points in total)], and plasma was separated by centrifugation and stored in a cryogenic freezer (-70°C). Then, ELISA was performed to quantitatively analyze the protein concentration in the plasma. No dead animals were observed during the experimental period, and no abnormal symptoms related to the administration of the test substance were observed.

[0250] FIG. 8 shows a graph showing protein concentrations in blood after subcutaneous administration of the APB-R3 protein into rats. As shown in FIG. 8, the proteins of Example 1 and Comparative Example 1 reached the maximum blood concentration (Cmax) at 24 hours and 12 hours after subcutaneous administration to rats, respectively, and then decreased. In detail, Example 1 showed 23817.148 ng / mL, and Comparative Example 1 showed 2533.5136 ng / mL, indicating a difference of about 9.4 times. In addition, Example 1 showed in vivo exposure (AUC last) value of 1595699.12 h-ng / mL, which was about 22.8 times higher than Comparative Example 1, which showed a value of 69900.47 h-ng / mL. In addition, with regard to an elimination half-life (T1 / 2), Example 1 showed about 34.92 hours and Comparative Example 1 showed about 9.69 hours, indicating that the half-life of Example 1 was about 3.6 times longer.

[0251] FIG. 9 shows a graph showing protein concentrations in blood after intravenous administration of the APB-R3 protein into rats. As shown in FIG. 9, when measured at 0.083 hours after intravenous administration of Example 1 and Comparative Example 1 into rats, the maximum blood concentration was 109049.3 ng / mL and 41969.6564 ng / mL, respectively, indicating that Example 1 showed about 2.6 times higher concentration. It was also observed that the elimination half-life of Example 1 was 21.81 hours, and the elimination half-life of Comparative Example 1 was 6.51 hours, indicating that the half-life of Example 1 was about 3.4 times longer.

[0252] In other words, the recombinant fusion protein can exhibit the increased elimination half-life in the body regardless of the administration method, and therefore, patients can be administered with the drug at more convenient intervals. In addition, as compared with the existing IL-18BP protein, the recombinant fusion protein has the same or similar activity even with a small dose, and thus it is possible to broaden the selection of therapeutic agents.Example 4. In vivo efficacy study in CpG-induced macrophage activation syndrome mouse model

[0253] 4-1. Materials and Methods

[0254] All mice used in the experiment were bred in the Animal Laboratory center at Kangwon National University. IL18bp KO (knock out) mice were established by using CRISPR / Cas9 techniques with C57BL / 6 (Orient Bio) by Macrogen (South Korea) and the mice over 8 weeks of age were used in the experiment.

[0255] Each of 150 ug of APB-R3, 90 ug of anti-serum albumin Fab antibody (SL335), 250 ug of anti-mouse IL-lbeta antibody (BioXcell, BE0246), 250 ug of anti-mouse IL-6R antibody (BioXcell, BE0047), 250 ug of Isotype antibody control (BioXcell, BP0085) and vehicle (PBS) were intraperitoneally administered every day for 9 days. CpG ODN 1826 was synthesized by Integrated DNA Technologies, Inc. (Coralville, Lowa) and dissolved in PBS. After 2 hours of each antibody administration at day 0, 2, 4, 6, 8, 50 ug of dissolved CpG ODN 1826 was intraperitoneally administered in each mouse. During the experiment, all mice were weighed every day with the balance.

[0256] Blood samples heparinized by the capillary (Superior, HSU-2901000) in the ophthalmic vein of mice on day 10 were centrifuged at 4°C to 8000 rpm after incubation for an hour at room temperature. The serum of the upper layer was separated and stored in the cryo-temperature freezer at -80°C. Mouse IFN-gamma ELISA kit (Biolegend, 430804), Mouse CXCL9 / MIGA kit (R&D, DY492-05) and Mouse Ferritin ELISA kit (Abeam, ab 157713) were used and experiments were conducted according to the manufacturer's recommended protocols. Aspartate transaminase (AST) and alanine transaminase (ALT) were measured by DK Korea (South Korea) using Beckman AU480 (Brea, California) according to IFCC (International Federation of Clinical Chemistry) standard method.

[0257] All mice were sacrificed at day 10 and each spleen and liver were extracted for the measurement of weight, cell phenotyping by flow cytometry with BD FACSVerse™ (BD Biosciences), histology by hematoxylin and eosin (H&E) staining.

[0258] 4-2. Results

[0259] Macrophage activation syndrome (MAS) was induced by CpG, TLR9 agonist, in C57BL / 6 mice. A significant loss of weight was observed in every IL18bp knock-out (KO) mice, but not in wild type (WT) mice. The body weight was similarly recovered in APB-R3 administered KO group and none treated groups, but the group treated with competitive antibodies (anti-IL-6R and anti-IL-lbeta) did not recover their weight (FIG. 10).

[0260] The liver and spleen weight were measured, respectively, at the end of the experiment considering hepatomegaly and splenomegaly of MAS. There was no significant difference of the liver weight / body weight between in CpG+APB-R3 administered KO group and CpG administered WT group (FIG. 11B). On the other hand, the spleen weight / body weight was lower in CpG+APB-R3 administered KO group in comparison to both CpG+anti-IL-6R antibody and CpG+anti-IL-lbeta antibody administered KO groups (competitive antibodies) (FIG. 11 A).

[0261] The levels of serum AST and ALT were measured at the end of the experiment with Beckman AU480. The levels of AST and ALT in CpG+APB-R3 administered KO group were similar to none treated WT, none treated KO and CpG administered WT groups, but statistically lower (p<0.05) than that of both CpG+anti-IL-6R antibody and CpG+anti-IL-lbeta antibody administered KO groups (FIGS. 12A and 12B). Plus, the levels of serum IFN- y and CXCL9 were down regulated in CpG+APB-R3 administered KO group compared to other CpG administered groups (FIGS. 13A and 13B).

[0262] The cell population of splenic monocytes / macrophages was measured by flow cytometry with FACSVerse. The cell population was upregulated in CpG administered groups but slightly lower in APB-R3 administered group which is similar to that of CpG administered WT group (FIG. 14).

[0263] The extracted liver and spleen were stained with H&E at the end of the experiment. The disruption of splenic structure was observed in all CpG administered groups but relatively conserved lymphoid follicle area were observed in APB-R3 administered group. Some infiltration of immune cells induced by inflammation were identified in all CpG administered groups, but relatively lower infiltration was observed in APB-R3 administered group in comparison to both competitive antibodies administered groups (data not shown).Example 5. Binding Affinity

[0264] 7-1. Material & Method

[0265] Surface Plasmon Resonance (SPR) assay was performed by Wide River Institute of Immunology (Seoul National University, Seoul, KR) to measure the binding affinity, equilibrium dissociation constant (KD), of APB-R3 to recombinant human IL- 18 (Prospec) and human serum albumin (Sigma) by using BiaCore™ T200 (GE Healthcare), Sensor Chip CM5 (Cytiva), and HBS-EP+ (Cytiva), as a running buffer. APB-R3 was immobilized by using Amine Coupling Kit (GE Healthcare) in pH 4.5 and the analyte of human IL- 18 was diluted and prepared at 62.5 nM, 31.3 nM, 15.6 nM, 7.8 nM, 3.9 nM, and 1.95 nM, and the analyte ofhuman serum albumin was diluted and prepared at 1,250 nM, 625 nM, 313 nM, 156 nM, 78 nM, 39 nM, and 19.5 nM. Kinetics between APB-R3 and human IL-18 or human serum albumin was analyzed by 1 : 1 binding fitting.

[0266] 7-2. Result

[0267] The binding affinity (KD) of human IL-18BP isoform a (IL-18BPa) for human IL- 18 was known to be 399 pM, as determined by BIAcore affinity assays (Kim, S.-H. et al., Proc. Natl. Acad. Sci.97:1190-1195 (2000)). In this study, the binding affinity of APB-R3, antiserum albumin Fab + human IL-18BPa fusion protein to human IL- 18 and human serum albumin was determined by Surface Plasmon Resonance (SPR) assay (BiaCore™ T200) and the binding affinity (KD) value of APB-R3 for recombinant human IL-18 was 6.09 x 10"11M (60.9 pM), which is approximately 6-fold higher than that of human IL-18BPa (60.9 pM vs. 399 pM) as described in Kim S.-H. et al. (2000). The KD value of APB-R3 for human serum albumin was 1.68 x 10-8M (16.8 nM) (Table 3).Table 3.Example 6. In vitro immunogenicity assay of APB-R3

[0268] Material & Methods

[0269] In vitro immunogenicity risk of APB-R3 was assessed in a 52 healthy donor human target population by using Lonza’s in vitro PBMC proliferation assay platform (Epibase® in vitro proliferation assay) for the analysis of T cell proliferation. A keyhole limpet haemocyanin (KLH) was used as a positive control.

[0270] Results

[0271] A significant CD4+ T cell response was induced in 98% (51 / 52) of donors by KLH positive control and was also significantly different to the blank over the whole test population. A significant CD4+ T cell responses was induced only in 10% (5 / 52) of donors by APB-R3 and was not significantly different to the blank over the whole test population. The results suggest that APB-R3 can be considered relatively low risk of immunogenicity (Table 4).Table 4.*The p-value relates to the single sample t-test hypothesis that the frequency distribution of SI for a given antigen represents a distribution with a mean SI value of 1.Example 7. Disruption of IL-18 signaling via engineered IL-18PB alleviates cholestatic liver disease

[0272] Primary sclerosing cholangitis (PSC) is a rare, idiopathic, and progressive cholestatic liver disease featured with hepatic inflammation and fibrosis causing intra- and extrahepatic injury of bile ducts. In patients with PSC, biliary stricture occurs by scarring-mediated narrowed and obstructed bile ducts. Biliary obstruction causes bile accumulation in the liver, in which excessive bile components gradually damages liver cells and induces hepatic cirrhosis [1]. Despite numerous efforts to delay and cure PSC development, approved clinical therapeutic drug has yet to be established. Operation of liver transplantation is the only intervention to extend survival; nevertheless, recurrent PSC after surgery emerge approximately 30% of recipients [2]. Therefore, further research is needed to develop effective medical therapy to manage PSC progression.

[0273] During PSC progression, cholangiocytes become reactive, and play harmful roles that induce hepatobiliary inflammation and fibrosis [3]. Damaged pathogenic reaction of cholangiocyte initiates inflammatory responses, resulting in recruitment and activation of fibroblasts and immune cells in periductal stromal regions, which ultimately lead to the fibro- inflammatory phenotype [4]. In particular, senescent population of injured cholangiocytes results in detrimental outcomes of PSC through increased production of senescent-associated phenotype (SASP) markers composed of cytokines, chemokines, and growth factors [5].

[0274] Bile acids promote assembly of NOD-, LRR- and pyrin domain-containing protein 3 (NLRP3)-mediated inflammasome and subsequently trigger cleavage of pro-caspase 1, and thus promote the secretion of interleukin- 18 (IL- 18) [6]. Secreted IL- 18 binds to the IL- 18 receptor, which is the ligand binding chain for mature IL- 18, and drives inflammatory cascade through myeloid differentiation factor 88 (Myd88)-dependent NF-kappaB activation [7]. Normally, its biological activity is inhibited by IL- 18 binding protein (IL-18BP) in homeostatic condition, which binds with IL- 18 and neutralizes its function with forming high-affinity complexes. However, impaired balance between IL- 18 and IL-18BP results in uncontrolled IL- 18 activity that would drive auto-inflammatory macrophage activation syndromes-associated with diverse diseases including adult-onset Still’s disease and hemophagocytic lymphohistocytosis [8].

[0275] Roles of IL- 18 and IL-18BP on liver injuries were reported despite the fact that inflammasome-induced IL- 1 beta has been considered as a major contributor for liver inflammation. Interestingly, significant increases of IL- 18 levels in plasma and liver were observed in patients with cholestatic disease [10, 11]. Further studies demonstrated that IL-18 inhibition by exogenous IL-18BP protected mice against endotoxin-mediated liver damage as well as senescence-associated secretory phenotype (SASP)-mediated pulmonary fibrosis [12, 13]. It was also known that inherited deficiency of IL-18BP in humans causes excessive activation of NK cells and drives the death of viral hepatitis-infected hepatocytes

[0014] . However, therapeutic evidence and pathologic mechanisms of balance of IL- 18 and IL-18BP in PSC disease has not been reported yet.

[0276] Primary sclerosing cholangitis (PSC) is a chronic cholestatic liver disease characterized by progressive inflammation and fibrosis around intrahepatic and extrahepatic bile ducts leading to severe hepatic cirrhosis and high mortality. Although there is an urgent clinical unmet need for PSC, no effective medical therapy has been developed to delay the disease progression until today. IL- 18 binding protein (IL- 18BP) is well-known to be a natural negative feedback regulator for IL- 18, and we had developed a recombinant long-acting IL-18BP referred to as APB-R3 as a therapeutic agent to treat IL-18-related inflammatory diseases. Here, we aimed to study whether disrupted IL- 18 signaling by APB-R3 treatment can inhibit PSC injuries in the experimental DDC diet-induced PSC rodent model. First, we found that the amounts of free IL- 18 are augmented under PSC condition with increased expression of biliary IL- 18 receptors. Administration of APB-R3 effectively attenuated key diagnostic parameters of PSC such as plasma ALP and GGT activities as well as bile acids levels. We also observed that blockade of IL- 18 suppressed ductular reactive and proliferative phenotypes of cholangiocytes. Additionally, APB-R3 significantly ameliorated DDC diet-induced periductal fibrosis and transcriptions of pro-fibrotic marker genes. Enhanced senescence associated secretory phenotype (SASP) markers in cholestatic liver disease were diminished by APB-R3 treatment. Our findings clearly demonstrate that the administration of IL-18BP biologies, APB- R3, effectively alleviates DDC diet-induced biliary injuries in rodent PSC model, implying APB-R3 can be a promising therapeutic reagent which warrants clinical human trials as new therapeutic options.

[0277] To develop a therapeutic biologies that neutralizing IL- 18 in such diseases, we had created a long-acting version of IL-18BP fusion protein, referred to as APB-R3 by covalently linking IL-18BP to an anti-serum albumin Fab [9].

[0278] In the present study, we hypothesized that IL-18BP can be one of gamechangers as a new therapeutic reagent to relieve PSC disease and assessed whether blockade of IL- 18 via APB-R3 ameliorates PSC-induced liver injury.MATERIALS AND METHODS

[0279] Animal experiments

[0280] Pathogen-free 6 weeks of age male C57BL / 6J mice (Japan SLC, Inc., Hamamatsu, Japan) were randomized into 3 groups (Chow, DDC / Vehicle and DDC / APB-R3). The mice in DDC group without Chow group were fed with 0.1% 5-diethoxycarbonyl-l,4- dihydrocollidine (DDC) (Sigma- Aldrich, St. Louis, MO) for 21 days to induce a cholangitis. Chow group was fed with normal diet. The mice in DDC / APB-R3 groups were intraperitoneally administered with vehicle supplemented with 10 mg / kg of APB-R3 thrice weekly from Day 0 to Day 20. Specific pathogen-free (SPF) facility was under controlled conditions of temperature (23 ± 3°C), humidity (50 ± 20%), lighting (12 h light / dark cycle) with ad libitum food and water. The animals were sacrificed at Day 21 after DDC feeding by exsanguination through direct cardiac puncture under isoflurane anesthesia (Pfizer Inc., New York, NY). Animal experiments were conducted at SMC Laboratories, Inc. (Tokyo, Japan); study number SLMN071-2108-0.

[0281] H&E and Sirius red staining of sectioned liver tissues

[0282] Liver tissues were fixed in Bouin's solution (Sigma-Aldrich) and under paraffin- embedded. Fixed tissues were sectioned at 10 Dm. The tissue sections were placed on slide and deparaffinized in serial baths of xylene and ethanol followed by staining using Lillie- Mayer’s Hematoxylin (Muto Pure Chemicals, Tokyo, Japan) and eosin solution (Wako Pure Chemical Industries, Osaka, Japan) or picrosirius red solution (Abeam, Cambridge, MA). The stained slides were imaged using a digital camera (Leica, Wetzlar, Germany). For quantitative analysis of fibrosis area, bright field images of Sirius red-stained sections were captured around the central vein using a digital camera (Leica), and the positive areas were measured using ImageJ software (National Institute of Health, Bethesda, MD).

[0283] Immunostaining of mice liver section

[0284] Liver tissue sections were fixed and deparaffinized as reported above. Liver samples underwent antigen retrieval using a Diva Decloaker buffer (Biocare Medical, Concord, CA) with boiling for 10 min. Samples were washed and incubated in a blocking buffer containing 1% BSA, 5% serum and 0.3% Triton-X (Sigma- Aldrich) in PBS at RT for 1 h before being incubated with primary antibodies overnight at 4°C. The used primary antibodies are listed inTable SI. After washing, secondary antibodies were incubated at RT for 1 h. Glass cover slips were mounted with DAPI-containing fluoroshield (Electron Microscopy Sciences, Hatfield, PA). Images were acquired using a LSM88O Confocal microscope (Carl Zeiss, Oberkochen, Germany). Positive area was quantified by computerized image analysis on blinded sections using Image J (NIH).

[0285] For immunohistochemistry experiments, the sections were treated with instant immunohistochemical reagents and then incubated in a buffer solution containing 3, 3- diaminobenzidine tetrahydrochloride (DAB) to produce a brown reaction product. The primary antibodies are listed in Table 5 Sections were counterstained with hematoxylin. Sections were counter-stained with Mayer’s hematoxylin for visualization of background tissue, dehydrated in alcohol / xylene. The stained slides were captured around the central vein using a digital camera (Leica). Positive area was quantified as positivity (positive brown pixels divided by all stained pixels) using Image J (NIH).Table 5. List of Primers UsedGene AccessionNo. Nucleotide Sequence (SEQ ID) Species1118 NM_008360 Sense 5’- CAGCCTGTGTTCGAGGATATG -3’ (NO:86)Antisense 5’- TCACAGCCAGTCCTCTTACT -3’ (NO:87) MouseIl18bp NM_0105315’- CACATCTGCACCTCAGACAA -3’ (NO:88) Mouse5’- GTGCTGGGTACTGCTTAGTT -3’ (NO:89)1118r1 NM_0083655’- CCAGGACACATGGCTGTATAA -3’ (NO:90) Mouse5’- GTAGTAGCCCTCATCTCCAAAC -3’ (NO:91 )MouseII Wrap NM_010553 5’- A (Purpose:GTCCGAGCTGTGGTTAAAG -3’ (NO:92) qRT-5’- CAAGCTCTACGTCCAGTGTATC -3’ (NO:93) PCR)Col1a1 NM 0 GAAACCCGAGGTATGCTTGA -3’ (NO:94)- 07742 “ AInt .isense 5’ Mouse oc, GTTGGGACAGTCCAGTTCTT -3’ (NO:95)Acta2 NM 007392 ^e"se5’ CCATCATGCGTCTGGACTT -3’ (NO:96)- Antisensec, MouseGGCAGTAGTCACGAAGGAATAG -3’ (NO:97)TimpKl NM 001044384 „ ! 5’ - Antisense GATTCAAGGCTGTGGGAAATG -3’ (NO:98) Mouse5E, ACTCTTCACTGCGGTTCTG -3’ (NO:99)Tgfbl NM_011577 SenseAntisenseCTTTAGGAAGGACCTGGGTTG -3’ (NO: 100) MouseGTGTGTCCAGGCTCCAAATA -3’ (NOD 01 )Sense111 b NM_008361 AntisenseAGAGCCCATCCTCTGTGACTCA -3’ (NO:102) MouseTGCTTGGGATCCACACTCTCCA -3’ (NO: 103)Cdknl b NM_009875 Sense 5’- AGTGTCCCTTTCGGTAAGAATG -3’ (NO: 104)Antisense 5’- TCAGAACCTCCAAGTGAGAATAAG -3’ Mouse(NO:105)Cdkn2a NM_001040654 Sense 5’- GCTGGGTGGTCTTTGTGTA -3’ (NO: 106) MouseAntisense 5’- TTAGCTCTGCTCTTGGGATTG -3’ (NO:1CKrt19 SenseNM_001313963 Antisense 5’- GTATGAGATCATGGCCGAGAAG -3’ (NO: 108) Mouse 5’- GTGACTTCGGTCTTGCTTATCT -3’ (NO:109)18s NR_003278 Sense 5’- GTAACCCGTTGAACCCCATT -3’ (NO: 110)Antisense Mouse5’- CCATCCAATCGGTAGTAGCG -3’ (NO:111 )

[0286] Quantitative real-time polymerase chain reaction (qRT-PCR)

[0287] Total RNA was extracted using Easy-BLUE™ Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea). For cDNA synthesis, samples were reverse transcribed using random priming and High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster city, CA) according to the guidelines of manufacturer. qPCR experiment was performed using Power SYBR™ Green PCR Master Mix (Applied Biosystems) in a StepOnePlus Real-Time PCR System (Applied Biosystems). The relative amounts of all mRNAs were calculated by using the comparative threshold cycles (delta CT) method and normalized to 18S rRNA as a housekeeping gene. The primers used are listed Table 6.Table 6. List of Antibodies UsedAntibodies Host species Company PurposeCK19 Rat DSHB IFIL-18R1 Mouse R&D systems IF aSMA Rabbit abeam IHC p21 Rabbit abeam WB p16 Rabbit Bio-rad WBHSP60 Mouse Santa cruz WBAnti-mouse IgG, Alexa 594 Donkey Invitrogen IFAnti-rat IgG, Alexa 488 Donkey Invitrogen IFAnti-rabbit IgG HRP Goat Bio-rad WBAnti-mouse IgG HRP Goat Bio-rad WB

[0288] Enzyme-linked immunosorbent assay (ELISA )

[0289] The Duoset ELISA Kit targeting IL- 18 (R&D Systems, Minneapolis, MN) and the Quantikine ELISA kit targeting IL-18BP (R&D Systems) were used to measure amounts of IL- 18 and IL-18BP in the liver of murine samples according to the manufacturer’s instructions.Optical density was measured at 450 nm using a SpectraMax i3x Multi-Mode Microplate Reader (Molecular devices, San Jose, CA).

[0290] Liver hydroxyproline content assay

[0291] The total soluble collagen concentration within liver tissues was measured with the PicoSense Total Collagen Assay Kit (BIOMAX, Guri, Korea) according to the manufacturer’s instruction. Homogenized liver tissue samples were dissolved in 12N HC1 and heated for 3h at 120°C. After centrifugation, supernatants were collected. The total collagen concentration was measured at 560nm in all collected supernatants.

[0292] Western blot analysis

[0293] Frozen liver tissues were homogenized with RIPA buffer (Rockland Immunochemicals, Limerick, PA) containing cocktail of protease inhibitors (Roche, Basel, Switzerland) by TissueLyser II (Qiagen, Hilden, Germany). The protein concentration was measured by BCA assay (Thermo Fisher, Waltham, MA). Proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA), which were soaked in Tris-buffered saline-Tween 20 (TBS-T) solution containing 5% dry milk (Bio-Rad, Hercules, CA) at RT for Ih to block non-specific binding. The membranes were exposed to primary antibodies: anti-p21 (Abeam), anti-pl6 (Bio-Rad) or anti-HSP60 (Santa Cruz Biotechnology, Dallas, TX) in 5% dry milk overnight at 4°C. The membranes were washed thrice with TBST and incubated with horseradish peroxidase (HRP)-labeled secondary antibodies: anti-rabbit or anti-mouse (Bio-Rad) at RT for Ih. After washing thrice more with TBST, all immunoreactions were visualized by enhanced chemiluminescence (Bio-Rad). Images were acquired using Fusion Solo 6x chemiluminescence system (Vilber, Collegien, France).

[0294] Senescence-associated / l-galactosidase assay

[0295] To conduct the senescence-associated P-galactosidase activity assay, frozen liver sections on slides were incubated in X-gal working solution (0.5 mg / ml X-gal (Sigma- Aldrich), 0.125 mM K4Fe(CN)6• 3H2O, 0.125 Mm K3Fe(CN)6, and 0.5 mg MgCh) at 37°C for 24h. After washing three times, stained samples counterstained with nuclear fast red for 5 min. Glass cover slips were mounted with aqueous mounting medium.

[0296] Plasma biochemistry analysis

[0297] Plasma ALP, GGT, ALT, and AST activitis were measured by Dri-chem NX500i hematology analyzers (Fujifilm, Tokyo, Japan). Plasma bile acid levels were measured by EnzyFluo™ Bile Acid Assay Kit (BioAssay Systems, Hayward, CA).

[0298] Statistics

[0299] All values are represented as the means+standard deviation (SD). Statistical analyses were conducted using an unpaired two-tailed Student’s t-test for simple comparisons or a oneway ANOVA with Tukey’s post hoc test for multiple comparisons. P < 0.05 was considered significantly different.RESULTS

[0300] Enhanced hepatic IL-18 signaling are observed in DDC diet-induced cholestatic disease

[0301] To identify whether IL- 18 signaling are activated in liver cholestatic disease, we measured hepatic levels of IL- 18 and IL- 18BP in DDC diet-induced PSC model. After 3 weeks of diet, H&E and Sirius red staining showed that bile duct proliferation, bilirubin accumulation and peribiliary fibrosis around bile canaliculi was enhanced in the liver of DDC-fed mice (Fig. 15 A, B). Strikingly, we found that mRNA and protein levels of IL- 18 and IL-18BP were increased in PSC liver (Fig. 15C, D). Although hepatic IL-18BP was enhanced under PSC condition, the amounts of hepatic free IL- 18 are augmented by DDC diet feeding (Fig. 15D). Furthermore, the transcriptional expression of IL- 18 receptors, Ill8rl and Ill8rap genes exhibited significant increased pattern after PSC induction (Fig. 15E). Based on analysis of single cell sequencing database, T and NK cells are major cells to transcript IL- 18 receptors genes. In contrast, immunostaining of IL- 18 receptor revealed that hepatic IL-18RD expression is exclusively located in CK19-positive cholangiocyte in control and PSC liver, indicating that augmented IL- 18 signaling can influence phenotypic changes of cholangiocyte in PSC diseases (Fig. 15F). These data demonstrate that increased IL- 18 signaling and biliary expression of IL- 18 receptor under PSC condition might contribute to aggravating the progression of PSC.

[0302] APB-R3 alleviates exacerbation of hepatobiliary injuries in mice with PSC

[0303] To study functions of IL-18 and IL-18BP in PSC development, we intraperitoneally administered with APB-R3 (engineered IL-18BP biologies) into DDC diet-fed mice to observe therapeutic potential of IL-18BP proteins against PSC [9] (Fig. 16A). The body and liver weight were significantly decreased in DDC diet-fed mice compared to chow-fed group, whereas mice with APB-R3 treatment displayed no alteration of weights (FIG. 16B). Although plasma ALT and AST activities, the marker of liver injury, didn’t show change by APB-R3, the levels of key PSC parameters such as ALP and GGT as well as bile acid were significantly decreased by administration of APB-R3 (FIGS. 16C and 16D). Moreover, histological analysis revealed that APB-R3 challenge effectively suppressed infiltration of inflammatory cells around bile ducts and proliferation of reactive cholangiocytes (FIGS. 16E and 16F).Cytokeratin 19 (CK19)-positive area and mRNA levels of Krtl9 enhanced by DDC diet feeding was also reduced by IL-18 blockade (FIGS. 16F and 16G). These results suggest that APB-R3 leads to beneficial effects that ameliorate hepatobiliary injuries induced by activated IL- 18 signaling in PSC liver.

[0304] APB-R3 represses DDC diet-induced peribiliary fibrosis

[0305] We further investigated whether APB-R3 effectively reduces PSC-induced hepatic fibrosis. Sirius red and DSMA staining showed that APB-R3 significantly attenuated DDC diet-induced expanded peribiliary fibrotic formations and collagen fibers (FIG. 17A). In addition, increased hepatic collagen content by DDC diet feeding was significantly reduced by APB-R3 administration (FIG. 17B). The mRNA transcriptions of fibrotic marker genes such as Collal, Acta2 and Timpl were largely increased under PSC conditions, and these levels were diminished by treatment of APB-R3 (FIG. 17C). Thus, our results demonstrate that administration of IL- 18 neutralizer, APB-R3, exhibits effective inhibitor for PSC-induced fibrosis to prevent development of hepatic cirrhosis.

[0306] IL-18BP biologies decreases expression of SASP markers

[0307] In cholestatic diseases, cholangiocytes undergo cellular senescence and release inflammatory SASP cytokines with strong expression of cell cycle arrest proteins, leading to hepatic inflammation and fibrosis [2, 15]. It was reported that IL- 18 can trigger fibroblast senescence with increased SASP-mediated inflammation

[0013] . Therefore, we examined whether IL- 18 neutralizer can inhibit DDC diet-induced PSC injuries via suppression of SASP activation. We confirmed that gene transcriptions of SASP markers such as Tgfb, Illb, Cdkn2a (pl 6) and Cdknlb (p27) were upregulated by DDC diet; but, APB-R3 significantly decreased transcriptional expression of these genes (FIG. 18 A). Similarly, DDC diet-induced hepatic protein expression of p21 and pl 6 were also reduced through administration of APB-R3 (FIG. 18B). Elevated beta-gal staining for detection of cellular senescence in cholestatic liver were repressed after APB-R3 treatment (FIG. 18C), suggesting that the administration of APB-R3 which disturbs IL- 18 signaling effectively alleviates DDC diet induced-liver symptoms via inhibition of SASP activation.DISCUSSION

[0308] PSC is an inflammatory cholestatic liver disease that impairs bile circulation, leading to excessive accumulation of bile acids, bilirubin, and cholesterol in the liver. Concentrated bile components can leak from bile canaliculi and ducts, and thus causes hepatic cell death, periductal inflammation and fibrosis, and proliferative ductular reaction [3]. Despite recenttrials to delay disease progression of PSC, there are no Food and Drug Administration (FDA)- approved pharmacological drugs available to alleviate PSC. In this study, we found that engineered IL-18BP biologies, APB-R3, inhibits hepatic SASP activation and ultimately attenuates the symptoms of PSC such as reactive cholangiocytes, elevated ALP and GGT activity, and periductal fibrosis. We propose that APB-R3 possesses profound protective effects in mice of DDC diet-induced PSC and enables development of novel therapeutic pipeline that targets IL- 18 signaling to ameliorate PSC.

[0309] We demonstrated that free IL- 18 level is elevated in DDC diet-induced PSC livers along with upregulated transcriptions of IL- 18 receptors, indicating that IL- 18 signaling are augmented under PSC condition (FIGS. 15C-15E). Actions of IL-18 cytokine are performed by binding to IL-18Ralpha, then forms complex with IL-18Ralpha to initiate signaling pathway [8]. Interestingly, we found that hepatic IL-18Ralpha are exclusively enriched in CK19- positive cholangiocyte populations (FIG. 15F). Other major liver cells didn’t show distinct transcription of IL- 18 receptor except T and NK cell populations, indicating that IL- 18 receptor proteins in bile duct cells are mainly modulated in translational phase. Signaling cascade of IL- 18 consists of Myd88, MAPK, and NF-kB related with inflammatory actions. IL-18 suppresses cellular senescence in pulmonary fibroblast through attenuation of Klotho expression

[0013] . Additionally, epithelial barrier function of reactive cholangiocytes is affected by NLRP3- induced IL- 18

[0011] . Pathologic roles of IL- 18 signaling in damaged cholangiocytes are further needed to be defined to understand mechanisms of PSC progression. APB-R3 can block signaling cascade IL- 18 in ductal cells, which might become novel strategy that directly modulates pathobiology of cholangiocytes such as cytokine secretion, developmental pathway, and bile secretion

[0016] .

[0310] IL- 18 can be produced and released from other tissues as well as the liver, and further have an impact on other local diseases. Systemic loss of IL- 18 signaling and overexpression of IL-18BP promote obesity and insulin resistance through alteration of white and brown fat physiology [17, 18], and this could suggest that a pharmacological drug targeting IL-18 might influence adipose tissue metabolism. However, APB-R3 didn’t lead to any body and fat weight changes in experimental cholestatic diseases, implying that APB-R3 would only affect inflammasome-activated tissues (FIGS. 16B). The intestine can also lead to IL-18 production from epithelial cells when intestinal IL- 17 receptor signaling is disrupted, contributing to exacerbation of immune-mediated hepatic inflammation

[0019] . Approximately 70% of patients with PSC have inflammatory bowel disease (IBD), and pathologic connections between PSC and intestines are not well understood. Interestingly, intestinal IL- 18 is up-regulated in IBDpatients, affecting that increased IL- 18 inhibits goblet cell maturation and aggravates inflamed colitis [20, 21]. Indeed, other inhibitors of IL-18 signaling such as GSK1070806 (anti-IL-18 antibody) are evaluated under clinical trials for IBD (NCT01035645). Therefore, IL-18 might be a key player to solve missing link of IBD-induced PSC progression, and thus anti-cholestatic effects of APB-R3 can be due to disturbance of gut-derived IL-18 actions. Systemic effects by APB-R3 treatment are needed to be further studied.

[0311] We found that APB-R3 significantly constrained DDC diet-induced SASP markers such as TGFbeta, IL-lbeta, pl6, p21, and p27 (FIGS. 18A-18C), and MMP3. Biliary senescence induces catastrophic development of PSC symptoms such as recruitment of myofibroblast and immune cells near ductal regions and TGFbeta production causing periductal fibrosis [5]. Cholangiocyte senescence exhibits strong relationship in histological and clinical severity in patients with PSC

[0022] . Reduction of biliary SASP alleviates hepatic inflammation and fibrosis in the multidrug resistance 2 (Mdr2) deficient PSC livers

[0023] . Therefore, repression of SASP could be therapeutic strategy to delay PSC progression. It has been reported that IL- 18 contributes to induction of pulmonary fibroblast senescence, indicating that APB-R3 have a potential to directly restrain cholangiocyte senescence

[0013] . In particular, inhibition of SASP marker TGFbeta effectively decreases cellular senescence and restores injured livers under DDC diet-fed condition [5]. In our experiments, hepatic TGFbeta levels were significantly reduced by APB-R3 treatment (FIG. 18A). Since hepatic stellate cells are activated by direct exposure of IL- 18 cytokine in vitro

[0024] , APB-R3 treatment can ameliorate DDC diet-induced periductal fibrosis through direct suppression of fibrotic activation of hepatic stellate cells (FIGS. 17A-17C). Detailed intracellular molecular mechanisms how IL- 18 and IL-18BP modulate senescence of cholangiocytes and fibrogenesis of stellate cells is under future investigations.

[0312] Although there is no approved drug for PSC in clinics, various therapeutic approaches are being developed to deal with PSC progression and symptoms. High dose of ursodeoxycholic acid reduced serum AST and ALP, but did not improve survival rate with numerous serious side effects

[0025] . The farnesoid X receptor (FXR) agonists have shown positive results in treating PSC because FXR can decrease bile acid synthesis via release of intestinal fibroblast growth factor 19 (FGF19)

[0026] . Obeticholic acid (OCA) and cilofexor attenuated serum ALP activity and fibrosis marker in patients with PSC compared with placebo group [27, 28]. However, these drugs are not yet approved for PSC treatment since chronic administration of FXR agonists occurred mild to moderate pruritus issues in phase II trial. Engineered FGF19 analogue exhibited alleviation of hepatic fibrosis with lowered ALT andAST levels; but, the primary endpoint for reduced ALP levels was not met

[0029] . Here, we conducted preclinical studies whether long-acting IL-18BP biologies delay PSC development in diet-induced mice model. We discovered that disturbance of IL- 18 signaling extensively suppressed important disease markers including plasma ALP, GGT and bile acid levels, proliferation of reactive ductular cells and periductal fibrosis with reduction in S ASP activation (FIGS. 16A-16F, 17A-17C, and 18A-18C). We believe that APB-R3 can be a novel effective therapeutic candidate to alleviate PSC injuries without any IL- 18 blocker-mediated severe side effects. Therefore, developing our engineered IL-18BP biologies as clinical drug targeting PSC provides new therapeutic options to overcome hurdle of curing PSC disease.

[0313] References[1] EASL, EASL clinical practice guidelines: management of cholestatic liver diseases, J. Hepatol. 51 (2009) 237-267. doi:10.1016 / j.jhep.2009.04.009[2] J.H. Tabibian, et al., Primary sclerosing cholangitis, part 1: Epidemiology, etiopathogenesis, clinical features, and treatment, Gastroenterol. Hepatol (N Y). 14 (2018) 293-304.[3] X. Jiang and T.H. Karlsen, Genetics of primary sclerosing cholangitis and pathophysiological implications, Nat. Rev. Gastroenterol. Hepatol. 14 (2017) 279-295. doi: 10.1038 / nrgastro.2016.154[4] M.E. Guicciardi, et al., The spectrum of reactive cholangiocytes in primary sclerosing cholangitis, Hepatology 71 (2020) 741-748. doi:10.1002 / hep.31067[5] S. Ferreira-Gonzalez, et al., Paracrine cellular senescence exacerbates biliary injury and impairs regeneration, Nat. commun. 9 (2018) 1020. doi: 10.1038 / s41467-018-03299-5[6] T.M. Holtmann, et al., Bile acids activate NLRP3 inflammasome, promoting murine liver inflammation or fibrosis in a cell type-specific manner, Cells 10 (2021). doi: 10.3390 / cellsl0102618[7] M. Harel, et al., Balance between interleukin- 18 and interleukin- 18 binding protein in auto- inflammatory diseases, Cytokine 150 (2022) 155781. doi:10.1016 / j.cyto.202L 155781[8] S.Y. Park, et al., Interleukin- 18 binding protein in immune regulation and autoimmune diseases, Biomedicines 10 (2022). doi:10.3390 / biomedicinesl0071750[9] Y.-S. Jang, et al., Albumin-binding recombinant human IL-18BP ameliorates macrophage activation syndrome and atopic dermatitis via direct IL- 18 inactivation, bioRxiv (2023). doi: 10.1101 / 2023.05.30.542831

[0010] I.H. El-Sayed, et al., The effect of endoscopic retrograde cholangiopancreatography on the serum IL- 18 and erythrocytes antioxidative capacity in biliary obstructive jaundice, Clin. Chim. Acta. 336 (2003) 123-128. doi:10.1016 / s0009-8981(03)00336-x

[0011] L. Maroni, et al., Nlrp3 activation induces il-18 synthesis and affects the epithelial barrier function in reactive cholangiocytes, Am. J. Pathol. 187 (2017) 366-376. doi: 10.1016 / j.ajpath.2016.10.010

[0012] R. Faggioni, et al., IL-18-binding protein protects against lipopolysaccharide- induced lethality and prevents the development of Fas / Fas ligand-mediated models of liver disease in mice, J. Immunol. 167 (2001) 5913-5920. doi:10.4049 / jimmunol.167.10.5913

[0013] L.M. Zhang, et al., Interleukin- 18 promotes fibroblast senescence in pulmonary fibrosis through down-regulating Klotho expression, Biomed. Pharmacother. 113 (2019) 108756. doi: 10.1016 / j.biopha.2019.108756

[0014] S. Belkaya, et al., Inherited IL-18BP deficiency in human fulminant viral hepatitis, J. Exp. Med. 216 (2019) 1777-1790. doi:10.1084 / jem.20190669

[0015] V. Meadows, et al., Biliary epithelial senescence in liver disease: there will be SASP, Front. Mol. Biosci. 8 (2021) 803098. doi:10.3389 / fmolb.2021.803098

[0016] J.M. Banales, et al., Cholangiocyte pathobiology, Nat. Rev. Gastroenterol. Hepatol. 16 (2019) 269-281. doi:10.1038 / s41575-019-0125-y

[0017] M.G. Netea, et al., Deficiency of interleukin- 18 in mice leads to hyperphagia, obesity and insulin resistance, Nat. Med. 12 (2006) 650-656. doi:10.1038 / nml415

[0018] X. Zhang, et al., Differential IL18 signaling via IL18 receptor and Na-Cl co-transporter discriminating thermogenesis and glucose metabolism regulation, Nat. Commun. 13 (2022) 7582. doi:10.1038 / s41467-022-35256-8

[0019] P. Castillo-Dela Cruz, et al., Intestinal IL-17R signaling constrains IL-18-driven liver inflammation by the regulation of microbiome-derived products, Cell Rep. 29 (2019) 2270- 2283. doi:10.1016 / j.celrep.2019.10.042

[0020] T.T. Pizarro, et al., IL-18, a novel immunoregulatory cytokine, is up-regulated in Crohn's disease: expression and localization in intestinal mucosal cells, J. Immunol. 162 (1999) 6829- 6835.

[0021] R. Nowarski, et al., Epithelial IL- 18 equilibrium controls barrier function in colitis, Cell 163 (2015) 1444-1456. doi: 10.1016 / j.cell.2015.10.072

[0022] N. Cazzagon, et al., Cholangiocyte senescence in primary sclerosing cholangitis is associated with disease severity and prognosis, JHEP Rep. 3 (2021) 100286. doi: 10.1016 / j.jhepr.202L 100286

[0023] M. Alsuraih, et al., Genetic or pharmacological reduction of cholangiocyte senescence improves inflammation and fibrosis in the Mdr2 (- / -) mouse, JHEP Rep. 3 (2021) 100250. doi: 10.1016 / j.jhepr.202L 100250

[0024] J. Knorr, et al., Interleukin- 18 signaling promotes activation of hepatic stellate cells in mouse liver fibrosis, Hepatology 77 (2023) 1968-1982. doi:10.1002 / hep.32776

[0025] K.D. Lindor, et al., High-dose ursodeoxycholic acid for the treatment of primary sclerosing cholangitis, Hepatology 50 (2009) 808-814. doi:10.1002 / hep.23082

[0026] S.A. Kliewer and D.J. Mangelsdorf, Bile acids as hormones: The FXR-FGF15 / 19 pathway, Dig. Dis. 33 (2015) 327-331. doi: 10.1159 / 000371670

[0027] K.V. Kowdley, et al., A randomized, placebo-controlled, phase II study of obeticholic acid for primary sclerosing cholangitis, J. Hepatol. 73 (2020) 94-101. doi: 10.1016 / j.jhep.2020.02.033

[0028] M. Trauner, et al., The nonsteroidal Farnesoid X Receptor agonist cilofexor (GS-9674) improves markers of cholestasis and liver injury in patients with primary sclerosing cholangitis, Hepatology 70 (2019) 788-801. doi:10.1002 / hep.30509

[0029] G.M. Hirschfield, et al., Effect of NGM282, an FGF19 analogue, in primary sclerosing cholangitis: A multicenter, randomized, double-blind, placebo-controlled phase II trial, J. Hepatol. 70 (2019) 483-493. doi: 10.1016 / j.jhep.2018.10.035Example 8. Therapeutic treatment of IL-18 binding protein suppresses fibrotic progression in nonalcoholic steatohepatitis

[0314] Nonalcoholic steatohepatitis (NASH) is a chronic liver disease featured with broad spectrum of nonalcoholic fatty liver disease (NAFLD), which ranges from simple fatty liver to chronic liver inflammation and remarkable fibrotic formation (Singh et al., 2015). The prevalence of NASH is expected to gradually increase by 63% from 2015 to 2030 with high occurrence of adult obesity and elevated aging diseases (Chris et al., 2018). In particular, NASH-induced hepatic fibrosis and cirrhosis notably influence mortality rate of NASH patients leading to onset of cardiovascular disease and neuro-cognitive dysfunction (Anstee et al., 2013). Hepatic fibrosis is featured with excessive deposition of extracellular matrix (ECM) and scarring through persistent cell death and inflammation in the liver (Tsuchida et al., 2017). Hepatic stellate cells (HSCs) are key players in the process of liver fibrosis because activated HSCs highly express proteins related with ECM production and scar formation and developed toward myofibroblast. Extracellular mediators such as transforming growth factor beta (TGFbeta) released from inflammatory cells promote imbalanced HSC activation (Tsuchida et al., 2017). Interestingly, inflammasome activation induces fibrotic phenotypes of HSCs, and thereby triggers hepatic fibrosis in murine model (Inzaugarat et al., 2019). The emerging concept of HSCs inactivation to inhibit fibrotic progression has been focused to cure hepaticfibrosis in NASH, but there are still no approved therapeutic strategy to disturb HSCs activation to relieve NASH and fibrosis (Zisser et al., 2021).

[0315] Constitutively activated NLRP3 promotes production of IL-lbeta and IL-18, resulting in spontaneous induction of hepatic inflammation and fibrosis in mice (Wree et al., 2014). Indeed, the patients with NASH exhibited amplified activity of NLRP3 and caspase- 1 in the livers (Gaul et al., 2021). Blockade of NLRP3 inflammasome via treatment of inhibitor (MCC950) effectively attenuates liver inflammation and scarring formation in NASH mice models (Mridha et al., 2017). Interestingly, disturbance of IL-lbeta by an IL-1 receptor antagonist didn’t rescue the degree of fibrosis, indicating that other NLRP3-dependent players contribute to fibrotic activation (Wree et al., 2014). Recently, the role of IL-18 in the development of hepatic fibrosis was found that IL- 18 directly drove HSC activation in the hyperactivated NLRP3 models (Knorr et al., 2022). In addition, enhanced IL-18 signaling exacerbates liver inflammation through NK and T cell-mediated IFNgamma productions (Castillo-dela Cruz et al., 2019). Plasma concentrations of IL-18 are elevated in patients with chronic liver cirrhosis and correlate with disease severity (Ludwiczek et al., 2002). Thus, pharmacological approaches that inhibit IL- 18 signaling may provide promising opportunity to ameliorate NASH-driven inflammation and fibrosis.

[0316] Background and Aims: Nonalcoholic steatohepatitis (NASH) is a chronic liver disease associated with hepatic fibrosis. Inflammasome-mediated IL- 18 signaling is enhanced under NASH condition. IL- 18 binding protein (IL- 18BP) is a soluble protein that blocks IL- 18 actions via direct binding. Roles and therapeutic potential of IL-18BP on NASH-induced fibrosis are largely unknown. Here, we examined behavior and pharmacological potential of IL-18BP on NASH and liver fibrosis.

[0317] Approach and Results: We identified that hepatic and plasma levels of IL-18BP and IL- 18 are elevated in mice and human NASH status. Expression of IL- 18BP is mainly enhanced in damaged hepatocytes. We found that augmented IL- 18 stimulatemd IFNgamma production in T cells, and thereby released IFNgamma accelerated hepatic IL-18BP transcriptions. IL- 18BP-deficient mice exhibited exacerbated symptoms of liver injuries including inflammation and fibrosis after NASH diet feeding. We newly developed IL-18BP biologies (APB-R3) and injected into mice to evaluate pharmacologic efficacy of IL-18BP against NASH. Combined treatment of APB-R3 and anti-steatotic agents showed complete protective functions against diet-induced NASH. APB-R3 strikingly abolished hepatic fibrotic formation with reduced plasma and hepatic collagen markers. We further observed that NASH injuries with STAM toxicity model were also alleviated by APB-R3 treatment.

[0318] Conclusions: This study proposes that abrogation of IL- 18 signaling by boosting IL- 18BP strongly inhibits development of NASH-induced fibrosis and IL- 18BP biologies can become potential therapeutic drug for curing NASH.

[0319] In severe conditions of chronic liver diseases, the amounts of plasma IL-18BP are increased; however, elevated IL-18BP levels are not sufficient to prevent disease progression (Ludwiczek et al., 2002). Exogenous injection of IL-18BP ameliorates endotoxin-induced liver damage (Faggioni et al., 2001). Therefore, we examined therapeutic potential of IL-18BP to cure liver inflammation and fibrosis in NASH models. Herein, we found that free IL- 18 levels were elevated under NASH conditions even if production of IL- 18BP were increased. Systemic loss of IL-18BP largely exacerbated liver inflammation and fibrosis in NASH mice models. We further employed our engineered IL-18BP biologies (APB-R3), which shows long serum half-life in rodent and monkey. Here, we provide clear evidence for therapeutic potency of IL- 18BP biologies to ameliorate hepatic fibrosis in multiple NASH models and suggest novel approaches for combination therapy of IL-18BP biologies with anti-steatotic agents to completely relieve NASH development.METHODS

[0320] Animal experiments

[0321] For the generation of IL-18BP knockout (KO) mice

[0322] 8 -week-old C57BL / 6 wild-type male mice or IL-18BP knockout (KO) mice were fed for regular chow with tap water or fructose, palmitate, cholesterol and trans-fat (FPC) diet (TD.190142; Envigo, Indianapolis, IN, USA) with sugar water (fructose + glucose) during 15- 19 weeks. APB-R3 (SAFA-hIL18BP; AprilBio Co., Ltd. Korea), Liraglutide (GLP1 analogue), and APB-R3 + Liraglutide (Combined) were intraperitoneally administered to mice thrice a week for 8 weeks. 8-week-old C57BL / 6 wild-type male mice were intraperitoneally injected with CCL (Sigma-Aldrich, MO) dissolved in corn oil twice a week for 5 weeks. APB-R3 and vehicle were administered thrice a week after the third week of CCL injection. For induction of STAM model, 2-day-old male C57BL6 mice were subcutaneously administered 200 pig streptozotocin solution and fed high-fat diet after 4 weeks of age. At 6 weeks of age, the drugs including APB-R3 and Telmisartan were administered to mice for 6 weeks. CO2 euthanasia was performed, and liver tissues were fixed in 4% paraformaldehyde or stored frozen in liquid nitrogen. All experiments were performed in a blinded and randomized fashion. Animal experiments were conducted at SMC Laboratories, Inc. (Tokyo, Japan); study number SLMN081-2209-2.

[0323] Isolation of primary hepatocytes and stellate cells

[0324] Primary mouse liver cells were isolated from 8-10 week old male wild-type C57BL / 6 mice (Jackson Laboratories, ME) by perfusion of collagenase type IV (Sigma-Aldrich). The livers were perfused with 0.2 mg / ml of collagenase buffer in HBSS solution by injection of syringe toward the inferior vena cava as described previously (Han et al., 2017). After centrifugation at 500 rpm, the hepatocyte pellets were cultured in Ml 99 medium (Sigma- Aldrich) with 10% fetal bovine serum (FBS), 1% penicillin / streptomycin and dexamethasone. The nonparenchymal cell-containing supernatant was further separated using 26% Percoll (GE Healthcare, Madison, WI, USA) to obtain hepatic leukocytes including monocyte-derived cells (MDCs) and macrophages. The isolated immune cells were used for flow cytometric analysis. To isolate HSCs, the nonparenchymal cell-containing supernatant was loaded onto 11.5% OptiPrep (Sigma- Aldrich) and centrifuged at 1,400 g for 15 min. After centrifugation, HSCs were collected at the pellet and cultured in Dulbecco's modified Eagle medium with 10% FBS and 1% penicillin / streptomycin for 4 days to spontaneously activate (D4 HSCs). The D4 HSCs were exposed to 50 pg / ml of APB-R3 (Aprilbio) overnight. The cells were cultured in an incubator with 5% CO2 at 37°C.

[0325] Quantitative real-time polymerase chain reaction (qRT-PCR)

[0326] Liver tissue was homogenized using easy-BLUE™ (iNtRON, Korea) and TissueLyser II (Qiagen, Germany). Total RNA was isolated using the RNeasy mini kit (Qiagen) following the manufacturer's protocol. After separating hepatocytes and HSCs, total RNA was isolated using RNeasy Micro kit (Qiagen). Concentration and quality of purified RNA were analyzed using a UV-Vis Nabi spectrophotometer (MicroDigital, Korea), and reverse transcription of 0.04-1 pg RNA was performed. For cDNA generation, a high-capacity cDNA reverse transcription kit (Thermo Fisher, MA) was used. The reaction of SYBR® Green PCR master mix (Applied Biosystems, CA), primers, and cDNA mixture was performed using StepOnePlus real-time PCR system (Applied Biosystems). The fold change of mRNA levels of the target gene was estimated by the equation 2ACt(ACt = Ct of the target gene minus Ct of housekeeping genes such as 18S rRNA, Gapdh, or Actb). The fold change in gene transcription was shown based on a level of 1 in each control group. See FIGS. 19A, 19B, 19D, 20F, 21H, 23E, and 24G for liver tissue and FIGS. 20B, 20D, 20E, 20H, 201, and 23A for hepatocyte and HSCs.

[0327] Enzyme-linked immunosorbent assay (ELISA )

[0328] For ELISA experiments, frozen liver tissue was homogenized with protease inhibitors and RIPA lysis mixture buffer (Sigma-Aldrich) using a Tissue Lyser II (Qiagen). Mouse blood was collected in EDTA tube and centrifuged at 4°C at 6000 rpm for 10 minutes to obtain plasma.ELISA kits to measure IL-18, IL-18BP, IFNgamma (R&D systems, MN) and procollagen type III N-terminal (Pro-C3) (Novus Biologicals, CO) were used according to the manufacturer's protocol. The calculation to measure free IL- 18 levels was based on 1:1 binding ratio between IL- 18 and IL-18BP with a dissociation constant (Kd) of 0.4 nM (Ludweczek et al., 2002). Absorbance was measured at 450 nm by a SpectraMax plus 384 multiplate reader (Molecular Devices, CA).

[0329] Human Patients

[0330] The study protocol was approved by the Severance Hospital Institutional Review Board (IRB No. 4-2015-0184). Human serum was provided and analyzed using an ELISA (R&D Systems) kit according to the manufacturer's protocol. Absorbance was measured at 450 nm.

[0331] Preparation of conditioned medium from CD4 Thl cells

[0332] CD4 Thl cell conditioned medium (CM) was prepared as follows: Purified and sterilized monoclonal antibodies (mAbs) specific for murine CD3 (5 pg / ml, BioLegend, CA) were distributed onto 24 well plates and incubated overnight at 4°C. After washing three times, freshly isolated naive CD4 T cells were added at 5 x 105cells / well to anti-CD3-coated plates and cultured with recombinant IL- 18 (rIL-18) or anti-IFNgamma Ab (BioXcell, NH) in RPMI 1640 culture medium. After 2 d, cell-free supernatants were collected and stored at -80°C before use. Alternatively, T cells were cultured without stimulation with anti-CD3, and supernatants were collected as negative controls for CM.

[0333] Staining of stellate cells and sectioned liver tissues

[0334] HSCs were washed with PBS and fixed with 2% cold methanol for 10 minutes at 4°C. The cells were then blocked with 5% bovine serum albumin (BSA; Sigma- Aldrich) for 1 hour at room temperature and overnight with the primary antibody, mouse anti-aSMA (Dako, Denmark). Alexa488-conjugated secondary antibody was incubated at 1:300 for 1 hour. Fluoro-Gel II with DAPI (Electron Microscopy Sciences, PA) was used to mount the cells. Paraffin-embedded sectioned-tissues were deparaffinized with Xylene (Duksan, Korea), and washed with 100%, 95% and 70% EtOH. Sectioned tissues were stained with hematoxylin and eosin (Sigma- Aldrich) or Piero-Sirius Red solution (Abeam) according to manufacturer’s protocols. Cryo-sectioned frozen tissues are stained with heated Oil Red solution (Sigma- Aldrich) for 10 min. Stained sections were captured Ezscope U200 microscope (Macrotech, Korea) and LSM88O Super Sensitive High Resolution Confocal Laser Scanning Microscope (Carl Zeiss, Germany). Stained areas in the sectioned tissues were measured by Image J software (NIH). Histological assessments were performed by a pathologist under blind conditions. NAS and CRN fibrosis score was used (Kleiner et al., 2005; Younossi et al., 2018).

[0335] Flow cytometry

[0336] The liver tissues are homogenized in collagenase D (Sigma-Aldrich) buffer using a GentleMAX dissociator (Miltenyi Biotec, Germany). The homogenized tissues are centrifugated for 3 minutes at 500 rpm, and the supernatant was obtained and centrifuged at 1,700 rpm for 5 minutes to prepare non -parenchymal pellet. The non-parenchymal cells are obtained after stacking on 26% percoll and centrifuging at 1700 rpm for 5 minutes. Hepatic immune cells are collected as a pellet. Anti-CD16 / 32 (BioLegend, CA) was added to block the Fc antibody receptor, washed, and cells were incubated with fluorescence-conjugated antibody containing PerCP / Cy5.5- or FITC-anti-Ly6C, FITC- or BV510-anti-CD45, APC / Cy7-anti- Ly6G, APC-anti-F4 / 80, PE / Cy7-anti-CDl lb, and PE-anti-TIM4 (Biolegend) for 30 min. DAPI was used to stain to exclude dead cells. FlowJo software (BD Biosciences, UK) was used and analyzed on a FACS Lyric™ machine (BD Biosciences).

[0337] Measurement of hepatic triglycerides (TGs) and plasma ALT and AST

[0338] For measurement of liver TG levels, frozen liver tissues were homogenized with RIPA lysis buffer using Tissue Lyser II (Qiagen). A lipid layer was obtained after centrifugation at 14,000 rpm for 10 minutes. TG was measured at 570 nm absorbance using a SpectraMax plus 384 multiplate reader (Molecular Devices) by the EnzyChrom™ Triglyceride Assay Kit (BioAssay Systems, CA) according to the manufacturer's protocol. Mouse blood was collected in EDTA tube and then centrifuged at 6,000 rpm for 10 minutes at 4°C. The upper plasma was separated and obtained. Plasma ALT / AST levels were measured using GPT / ALT-P or GOT / AST-P chips with Dri-chem NX500i hematology analyzers (Fujifilm, Japan).

[0339] Measurement of hepatic hydroxyproline

[0340] For hydroxyproline measurements, frozen liver tissue was homogenized with D.W using a tissue Lyser II (Qiagen). Hydrochloride was added in the same amount and hydrolyzed by incubation at a 120°C heat block for 3 hours. PicoSense Total Collagen Assay kit (BioMax, Korea) was used according to the manufacturer's protocol. Absorbance was measured at 560 nm.

[0341] Statistics

[0342] All values are represented as the means+standard deviation (SEM). Statistical analyses were conducted using an unpaired two-tailed Student’s t-test for simple comparisons or a oneway ANOVA with Tukey’s post hoc test for multiple comparisons. P < 0.05 was considered significantly different.RESULTS

[0343] Hepatic free IL-18 is elevated in NASH condition despite increased expression oflL- 18BP

[0344] To analyze hepatic IL- 18 signaling under experimental NASH condition, we employed FPC and MCD diet model to induce steatohepatitis and fibrosis in C57BL / 6 mice (Im et al., 2021). The mRNA levels of Ill8bp in the liver were induced by FPC and MCD diet feeding (FIGS. 19A and 19B). Consistently, hepatic amounts of IL-18BP proteins are increased under NASH conditions (FIG. 19C). The transcriptional levels of 1118 gene were not upregulated in the livers of FPC-fed mice, but protein levels were elevated because NLRP3 activation was followed by NASH injury (FIGS. 19A-19C). Ileum-derived IL-18 was also enhanced in NASH condition (FIG. 19G). Active free IL-18 levels were still higher in NASH liver even if amounts of IL- 18BP protein are augmented, suggesting that elevated levels of IL- 18BP is not enough to completely inhibit IL- 18 signaling (FIGS. 19A-19C). The transcriptional expressions of IL- 18 receptor (Ill8rl, Ill8rap) were also increased in the NASH liver (FIGS. 19D and 19H). We observed that concentrations of plasma IL- 18 were similarly increased in human patients with NAFLD and NASH, whereas IL-18BP levels were only raised in severe F3-4 stage of human NASH (FIG. 19E). Therefore, the level of circulating free IL-18 was elevated until mild NASH Fl stage, indicating that activated IL- 18 signaling might be important to the progression of catastrophic NASH-induced cirrhosis (FIG. 19E). Analysis of public human NCBI database (GSE61260) showed that hepatic gene transcriptions associated with IL-18BP and IL- 18 pathway are significantly higher in NASH livers compared with in normal livers (FIG. 19F). Together, these results propose that relevance of increased IL-18BP and activated IL- 18 signaling clinically and experimentally exist in NASH progression.

[0345] Augmented IL-18 promotes release of hepatic IL-18BP via IFNgamma production

[0346] To further elucidate the relevance of IL-18 and IL-18BP on hepatic inflammation, we performed immunostaining of IL-18BP in FPC and MCD-fed mice. The NASH liver tissues exhibited obvious steatosis and inflammatory foci, as shown by H&E-stained sections. Herein, IL-18BP expressions in liver tissues were significantly enhanced under NASH condition, especially in parenchymal hepatocytes (FIG. 20 A). To delineate the inducer of IL-18BP in hepatocytes, we stimulated primary hepatocytes with several inflammatory cytokine related to hepatic inflammation. Among them, IFN-gamma markedly induced the mRNA expression and secretion of IL-18BP on primary hepatocytes (FIGS. 20B and 20C). The Ill8bp mRNA expression by IFN-gamma was sufficiently induced under the treatment of 5 ng / ml and for 12 hr (FIG. 20D). Indeed, Ifng mRNA levels and amounts of IFNgamma in the liver were increased in NASH models (FIGS. 20E and 20F), which was consistent with increased numberof IFNgamma-positive Thl cells (FIG. 20G). To elucidate what drives IFNgamma-mediated IL-18BP expression, primary hepatocytes were cultured with conditioned medium (CM) obtained from CD4 T cells as indicated condition (FIGS. 20H and 201). Treatment of anti-CD3 CM obtained from activated CD4 T cells substantially induced Ill8bp mRNA expression; this was further enhanced by co-treatment with recombinant IL- 18 (rIL-18) CM. As expected, the secretion of IFNgamma by CD4 T cells was induced under the stimulation of anti-CD3, which synergized withrIL-18 (FIG. 20H). Consistently, this synergic effect was completely abrogated by neutralization of IFNgamma (FIG. 201), indicating that IFNgammasecreted from activated CD4 T cells by rIL-18 treatment is major factor to induce IL-18BP expression in primary hepatocyte. Totally, these results demonstrate that increased IFNgamma-positive Thl cells induced by elevated IL- 18 signaling in NASH have a pivotal role for hepatic inflammation through the induction of IL-18BP expression.

[0347] Knockout of IL-18BP worsens liver inflammation and fibrosis in NASH models

[0348] Given that IL-18BP has the potential to act as a modulator of hepatitis, we generated IL-18BP knockout (KO) mice by CRISPR / Cas9 method and investigated the effect of IL-18BP deficiency on NASH progression (FIG. 25) (Jang et al., 2023). Compared to FPC-fed WT (WT FPC) mice, the indicators of NASH symptoms including liver / body weight ratio and plasma ALT / AST levels were largely increased in FPC-fed IL-18BP knockout (KO FPC) mice (FIGS. 21A and 21B). However, lipid accumulation and hepatic TG levels did not differ between WT FPC and KO FPC, indicating that loss of IL-18BP did not affect hepatic steatosis (FIG. 21C). Instead, NAS score and number of inflammatory foci were significantly increased by IL-18BP knockout (FIG. 21D). In addition, more infiltration of inflammatory monocyte-derived cells (MDCs) and IFNgamma-positive Thl cells were observed in KO FPC liver (FIG. 21E). Remarkably, collagen deposition and the content of liver hydroxyproline were notably augmented in IL-18BP deficient liver (FIGS. 21F and 21G). mRNA expression of If ng, Tnfa and ccl2 (inflammation-associated genes) and Collal, Col3al, Acta2 and Timpl (fibrosis- associated genes) were largely up-regulated in the liver of KO FPC (FIG. 21H). Altogether, these results suggest that IL-18BP, as natural antagonist of IL- 18, is crucial gatekeeper to inhibit progression of hepatic inflammation and fibrosis in NASH models.

[0349] Treatment of APB-R3, a long-acting IL-18BP, completely ameliorates NASH symptoms with combination of GLP1R agonist

[0350] To test the therapeutic effect of IL-18BP on NASH development, we developed the long-acting IL- 18BP biologies, referred to as APB-R3, recombinantly fused with an anti-serum albumin Fab to enhance -half-life in rodents and monkeys (Jang et al., 2023). Hepatic outcomesof APB-R3 treatment in FPC diet-induced NASH model were assessed with sole- or coadministration of anti-steatotic agents (Liraglutide) because IL-18BP didn’t alter hepatic steatosis (FIG. 21C). Liraglutide is agonistic peptide analogue for glucagon-like peptide 1 receptor (GLP1R) that decreases liver fat contents by significant reduction of body weight (Petit et al., 2017). The ratio of liver / body weight was not markedly reduced by sole-treatment of APB-R3, whereas APB-R3 significantly decreased plasma ALT levels (FIGS. 22A and 22B). Hepatic steatosis was diminished by liraglutide; however, APB-R3 didn’t show dramatic reduction in lipid accumulation consistent with results of IL-18BP deficient liver (FIG. 22C). Interestingly, the impact of APB-R3 is mainly associated with attenuation of liver inflammation such as inflammatory foci and inflammatory monocyte-derived cells infiltration, resulting in prominent attenuation of histological NAS score by co-treatment of APB-R3 and liraglutide (FIGS. 22D and 22E). The numbers of inflammatory foci were also reduced by APB-R3 in MCD diet-induced acute NASH livers (FIG. 26A). The group of combined therapy showed the lowest amounts of hepatic IFNgamma and numbers of IFNgamma-positive cells (FIGS. 22F and 22G).

[0351] IL- 18 directly leads to fibrotic activation of primary HSCs when NLRP3 inflammasome is activated itself (Inzaugarat et al., 2019; Knorr et al., 2022). Activated HSCs induce IL- 18 production by increased expression of NLRP3 (FIGS. 27A and 27B). We observed that IL- 18 blockade by APB-R3 incubation notably decreased transcriptions of fibrotic gene markers and alphaSMA expression in primary HSCs (FIGS. 23A and 23B). Liver sections obtained from FPC diet-induced NASH mice displayed that APB-R3 treatment strikingly abolished collagen accumulation and sinusoidal fibrosis (FIGS. 23C and 23D). Soletreatment of liraglutide did not eradicate the regions of periportal and pericentral fibrosis (FIGS. 23C and 23D). The effects of APB-R3 on hepatic fibrotic regression were also observed in MCD diet-fed mice (FIG. 26B). The transcriptional expressions of Collal and Timpl were reduced by APB-R3 and Liraglutide treatment (FIG. 23E). Levels of hepatic hydroxyproline and plasma Pro-C3 as biomarker of liver fibrosis were also decreased in APB -R3 -treated mice groups (FIGS. 23F and 23G). Therefore, combined treatment of APB-R3 and anti-steatotic drugs can completely reverse NASH liver to normal status (FIGS. 23A-22G and 23A-23I). We further tested anti-fibrotic effect of APB-R3 in CCL- induced hepatic cirrhosis model. Administration of APB-R3 remarkably alleviated formation of bridging fibrosis and collagen deposition (FIG. 23H). APB-R3 also reduced diagnostic plasma concentrations of Pro-C3, indicating that neutralization of IL- 18 signaling by our engineered long-acting IL-18BP biologies can prevent hepatic fibrogenesis in cirrhotic diseases (FIG. 231).

[0352] APB-R3 shows therapeutic effectiveness to reduce liver injuries in STAM NASH models

[0353] Next, we examined whether blockade of IL- 18 by APB-R3 suppresses progression of NASH using STAM model in which mice display similar developmental characteristics of steatosis and NASH until 12 weeks as human NASH (Saito et al., 2015). Then, telmisartan was employed as the disease comparator group in STAM model to compare with effectiveness of APB-R3 (Park et al., 2019) (Figure 6A). APB-R3 didn’t significantly decrease mass of liver weight, but plasma ALT and AST levels were similarly reduced by treatment of APB-R3 and telmisartan (FIGS. 24B and 24C). Unexpectedly, the improvement of hepatic steatosis was displayed by histology and reduction in amounts of TGs was observed by APB-R3 administration (FIG. 24D). Similar fibrotic attenuation by treatment of APB-R3 and telmisartan was observed relative to vehicle-treated group (FIGS. 24E and 24F). APB-R3 effectively down-regulated transcriptional levels of fibrotic and inflammatory marker genes in STAM livers (FIG. 24G). Pharmacological effects based on the results of diet- and STAM- induced NASH models indicate that APB-R3 is an attractive therapeutic drug to effectively ameliorate NASH development.DISCUSSION

[0354] In the present study, we found that uncontrolled free-IL-18 in the liver was augmented under the NASH condition to cause severe hepatic inflammation and fibrosis (FIGS. 19A-19F). Although expression of IL-18BP was also increased, IL-18BP level was not enough to completely inhibit the activity of IL- 18 (FIG. 19C). In the human plasma, free IL- 18 concentrations are higher in early stage of NASH compared with Healthy control because of late augmentation of IL-18BP, indicating that sufficient amounts of IL-18BP are needed to block NASH development (FIG. 19E). Indeed, free IL-18 and IL-18BP are elevated and correlate with degree of chronic liver diseases including fibrosis (Ludwiczek et al., 2002). We newly discovered that hepatocytes are major source of IL-18BP in the liver via regulatory feedback mechanism of IL-18 stimulation for IFNgamma production in Thl cells (FIGS. 20A- 01). Interestingly, systemic depletion of IL-18BP resulted in dramatically worsened disease severity than WT mice in NASH, indicating that feedback mechanism of IL-18BP is important gatekeeper to inhibit NASH development (FIGS. 21A-21H). Impaired hepatocytes by other stressors including lipotoxicity, oxidative stress, and unfolding protein stress might disturb sufficient production of IL- 18BP to completely block IL- 18 signaling in NASH. Therefore, our results suggest that complete blockade of IL- 18 activity by injection of additional exogenousIL-18BP has a great potential for the improvement of IL- 18 -induced NASH inflammation and fibrosis.

[0355] Previously, some studies have reported that NLRP3 inflammasome activation is responsible for the development of liver inflammation and fibrosis in NASH mice model (de Carvalho Ribeiro and Szabo, 2022). Inflammasome leads to elevated secretion of inflammatory IL- 1 beta and IL- 18 cytokines contributing to liver injuries. IL- 1 beta has been proposed as a key player for inflammasome-mediated NASH development; but, many studies showed unexpected results about roles of IL- 1 beta. Treatment of IL-1 receptor antagonist, anakinra, only reduced hepatic inflammation whereas did not alter HSC activation and collagen deposition in the liver (Wree et al., 2014). In a NLRP3 mouse model expressing constitutively activated NLRP3 in myeloid cells, IL-1 receptor knockout did not prevent pathogenesis of liver inflammation (Brydges et al., 2013). In contrast, roles of IL-18 signaling are identified and emphasized for liver inflammation and fibrosis. Systemic loss of IL- 18 receptor largely diminished neutrophil accumulation in the liver when NLRP3 was hyperactivated in myeloid cells (Brydges et al., 2013). Also, IL-18 receptor knockout mice exhibited reduction of ALT levels in diet-induced NAFLD models (Hohenester et al., 2020). Recently, Knorr et al. identified pathogenic roles of IL- 18 in liver fibrosis, which IL- 18 directly leads to fibrogenic activation of HSCs in the hyperactivated NLRP3 mice models (Knorr et al., 2023). But, this group did not further investigate modulation of hepatic inflammation and therapeutic potential in NASH disease (Knorr et al., 2023). Here, we identified that IL-18 signaling are enhanced in NASH conditions and focused on striking roles of IL-18BP on liver inflammation and fibrosis in NASH mice models using IL-18BP knockout mice and IL-18BP biologies (FIGS. 21A-21H, 22A-22G, 23A-23I, and 24A-24G).

[0356] We identified that the presence of APB-R3 in vitro directly suppressed fibrogenic activation of HSCs (FIGS. 23 A and 26A). Activation of canonical NLRP3 inflammasome in HSCs can release IL- 18 cytokines, and released-IL-18 further promotes induction of mRNA levels of profibrotic genes (Inzaugarat et al., 2019; Knorr et al., 2022). HSCs-specific persistent activation of NLRP3 altered quiescent status toward activated HSCs, resulting in exacerbated phenotypes of hepatic inflammation and fibrosis (Inzaugarat et al., 2019). Therefore, APB-R3 could interrupt self-boosting IL- 18 signaling, and effectively inhibit fibrogenic activation of HSCs in vitro (FIGS. 23 A and 23B). Blockade of Il-lbeta by treatment with anakinra reduced proliferative function of primary HSCs; but anakinra unexpectedly worsened hepatic fibrosis in CC14-injected in vivo mice model (Meier et al., 2019; Reiter et al., 2016). In contrast, our findings indicate that APB-R3 largely diminished development of fibrogenesis in vitro and invivo, both. Therefore, administration of IL-18BP biologies provides beneficial therapeutic strategy because APB-R3 directly suppresses hepatic fibrogenesis of HSCs via inhibition of NLRP3-mediated IL- 18 self-boosting. Intracellular molecular mechanisms how IL- 18 and IL- 18BP modulate HSC activation should be defined in the near future.

[0357] IL- 18 and IL-18BP can be systemically circulated in our body and several studies have reported physiological roles of IL-18BP in other tissues. IL- 18 deficiency promotes insulin resistance and obesity, and transgenic overexpression of IL-18BP results in slight induction of insulin tolerance, suggesting harmful functions of IL-18BP (Netea et al., 2006). However, impaired balance of IL- 18 and IL-18BP leads to uncontrolled inflammatory diseases in other tissues. IL-18BP is important to induce goblet cell maturation in colitis diseases via blockade of IL- 18 activity, and thus recombinant IL-18BP effectively attenuates intestinal damages in dextran sulfate sodium colitis model (Nowarski et al., 2015; Sivakumar et al., 2002). Furthermore, neutralization of IL- 18 by exogenous IL-18BP administration largely decreased severity of rheumatoid arthritis (Plater-Zyberk et al., 2001). To apply clinical usage of IL-18BP therapy, we newly generated engineered long-acting IL-18BP biologies, and recently reported that APB-R3 efficiently attenuated IL-18-induced macrophage activation syndrome (MAS) in the spleen and atopic dermatitis in the skin (Jang et al., 2023). In this result, we further proved that APB-R3 is an effective agent to alleviate liver inflammation and fibrosis in diverse NASH mice models, suggesting that APB-R3 can be attractive pharmaceutical agents to relieve numerous IL- 18 -related inflammatory diseases to be approved for broad clinical usage (FIGS. 22A-22G, 23A-23I, and 24A-24G).

[0358] Recently, numerous pipelines to cure NASH and liver fibrosis have been developed in many pharmaceutical companies. Obeticholic acid, a farnesoid x receptor agonist, was clinically tested in phase II and III, which showed effective resolution of NASH and fibrosis (Younossi et al., 2019). However, the Food and Drug Administration (FDA) rejected approval of obeticholic acid because long-term administration of obeticholic acid resulted in severe side effects such as pruritus and increased plasma cholesterols (NCT02548351). Madrigal pharmaceuticals developed resmetirom, a liver-directed selective thyroid hormone receptor beta agonist, to target NASH (Kelly et al., 2014). This candidate displayed reduction in ALT and AST levels, liver fat contents, and fibrosis in phase III trials without any remarkable side effects (Harrison et al., 2021; NCT05500222). Based on mechanisms of resmetirom that enhances breakdown of lipids, hepatic fatty liver was dramatically improved compared to placebo; but anti-fibrotic effects were not evident (Harrison et al., 2019). NASH is multifactorial disease involving diverse mechanisms for hepatic steatosis, inflammation andfibrosis, indicating that combination therapy targeting multiple liver mechanisms is promising option to be developed as FDA-approved drug against NASH (Jeong et al., 2020). Our suggested pipeline APB-R3 neutralized IL- 18 activity and showed positive outcomes that strikingly abolished hepatic fibrosis and inflammation (FIGS. 23A-23I). Knorr et al. reported that treatment of recombinant human IL-18BP (Tadeking Alfa) reduced collagen deposition in the overactivated NLRP3 -mediated injured liver (Knorr et al., 2022). APB-R3 is an improved biologies of human IL-18BP which shows prolonged stability and comparable bioactivity to block IL-18 signaling compared with Tadeking Alfa via fusion with anti-albumin Fab (Jang et al., 2023). Our results demonstrate that sole-treatment of APB-R3 contains therapeutic potential to ameliorate liver inflammation and fibrosis under NASH condition. Therefore, combination therapy with GLP-1R agonist and APB-R3 prominently reversed NASH-injured liver toward normal histologic status (FIGS. 22A-22G). In summary, the combination of anti- steatotic agents and anti-fibrotic APB-R3 would be attractive therapeutic options against NASH, which propose new insight into the clinical approaches of inflammasome regulator and IL-18BP biologies for the treatment of NASH.

[0359] References1. Singh S, Allen AM, Wang Z, Prokop LJ, Murad MH, Loomba R. Fibrosis progression in nonalcoholic fatty liver vs nonalcoholic steatohepatitis: a systematic review and metaanalysis of paired-biopsy studies. Clin Gastroenterol Hepatol. 2015;13:643-654.e641-649; quiz e639-640.2. Estes C, Razavi H, Loomba R, Younossi Z, Sanyal AJ. Modeling the epidemic of nonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease. Hepatology. 2018;67:123-133.3. Anstee QM, Targher G, Day CP. Progression of NAFLD to diabetes mellitus, cardiovascular disease or cirrhosis. Nat Rev Gastroenterol Hepatol. 2013;10:330-344.4. Tsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation. Nat Rev Gastroenterol Hepatol. 2017;14:397-411.5. Inzaugarat ME, Johnson CD, Holtmann TM, et al. NLR Family Pyrin Domain- Containing 3 Inflammasome Activation in Hepatic Stellate Cells Induces Liver Fibrosis in Mice. Hepatology. 2019;69:845-859.6. Zisser A, Ipsen DH, Tveden-Nyborg P. Hepatic Stellate Cell Activation and Inactivation in NASH-Fibrosis-Roles as Putative Treatment Targets? Biomedicines. 2021 ;9.7. Harel M, Fauteux-Daniel S, Girard-Guyonvarc'h C, Gabay C. Balance between Interleukin- 18 and Interleukin- 18 binding protein in auto-inflammatory diseases. Cytokine. 2022;150:155781.8. Park SY, Hisham Y, Shin HM, Yeom SC, Kim S. Interleukin- 18 Binding Protein in Immune Regulation and Autoimmune Diseases. Biomedicines. 2022; 10.9. Wree A, Eguchi A, McGeough MD, et al. NLRP3 inflammasome activation results in hepatocyte pyroptosis, liver inflammation, and fibrosis in mice. Hepatology. 2014;59:898-910.10. Gaul S, Leszczynska A, Alegre F, et al. Hepatocyte pyroptosis and release of inflammasome particles induce stellate cell activation and liver fibrosis. J Hepatol. 2021;74:156-167.11. Mridha AR, Wree A, Robertson AAB, et al. NLRP3 inflammasome blockade reduces liver inflammation and fibrosis in experimental NASH in mice. J Hepatol. 2017;66: 1037-1046.12. Knorr J, Kaufmann B, Inzaugarat ME, et al. Interleukin- 18 signaling promotes activation of hepatic stellate cells in mouse liver fibrosis. Hepatology. 2023;77:1968-1982.13. Castillo-Dela Cruz P, Wanek AG, Kumar P, et al. Intestinal IL-17R Signaling Constrains IL-18-Driven Liver Inflammation by the Regulation of Microbiome-Derived Products. Cell Rep. 2019;29:2270-2283.e2277.14. Ludwiczek O, Kaser A, Novick D, et al. Plasma levels of interleukin- 18 and interleukin- 18 binding protein are elevated in patients with chronic liver disease. J Clin Immunol. 2002;22:331-337.15. Faggioni R, Cattley RC, Guo J, et al. IL-18-binding protein protects against lipopolysaccharide- induced lethality and prevents the development of Fas / Fas ligand- mediated models of liver disease in mice. J Immunol. 2001;167:5913-5920.16. Jang Y-S, Lee K, Park M, et al. Albumin-binding recombinant human IL-18BP ameliorates macrophage activation syndrome and atopic dermatitis via direct IL- 18 inactivation. bioRxiv. 2023:2023.2005.2030.542831.17. Han YH, Kim HJ, Na H, et al. RORa Induces KLF4-Mediated M2 Polarization in the Liver Macrophages that Protect against Nonalcoholic Steatohepatitis. Cell Rep. 2017;20:124- 135.18. Im YR, Hunter H, de Gracia Hahn D, et al. A Systematic Review of Animal Models of NAFLD Finds High-Fat, High-Fructose Diets Most Closely Resemble Human NAFLD. Hepatology. 2021;74:1884-1901.19. Petit JM, Cercueil JP, Loffroy R, et al. Effect of Liraglutide Therapy on Liver Fat Content in Patients With Inadequately Controlled Type 2 Diabetes: The Lira-NAFLD Study. J Clin Endocrinol Metab. 2017;102:407-415.20. Saito K, Uebanso T, Maekawa K, et al. Characterization of hepatic lipid profiles in a mouse model with nonalcoholic steatohepatitis and subsequent fibrosis. Sci Rep. 2015;5: 12466.21. Park JG, Mok JS, Han YI, et al. Connectivity mapping of angiotensin-PPAR interactions involved in the amelioration of non-alcoholic steatohepatitis by Telmisartan. Sci Rep. 2019;9:4003.22. de Carvalho Ribeiro M, Szabo G. Role of the Inflammasome in Liver Disease. Annu Rev Pathol. 2022;17:345-365.23. Brydges SD, Broderick L, McGeough MD, Pena CA, Mueller JL, Hoffman HM. Divergence of IL-1, IL-18, and cell death in NLRP3 inflammasomopathies. J Clin Invest. 2013;123:4695-4705.24. Hohenester S, Kanitz V, Schiergens T, et al. IL-18 but Not IL-1 Signaling Is Pivotal for the Initiation of Liver Injury in Murine Non-Alcoholic Fatty Liver Disease. Int J Mol Sci. 2020;21.25. Meier RPH, Meyer J, Montanari E, et al. Interleukin- 1 Receptor Antagonist Modulates Liver Inflammation and Fibrosis in Mice in a Model-Dependent Manner. Int J Mol Sci. 2019;20.26. Reiter FP, Wimmer R, Wottke L, et al. Role of interleukin- 1 and its antagonism of hepatic stellate cell proliferation and liver fibrosis in the Abcb4(- / -) mouse model. World J Hepatol. 2016;8:401-410.27. Netea MG, Joosten LA, Lewis E, et al. Deficiency of interleukin- 18 in mice leads to hyperphagia, obesity and insulin resistance. Nat Med. 2006;12:650-656.28. Nowarski R, Jackson R, Gagliani N, et al. Epithelial IL-18 Equilibrium Controls Barrier Function in Colitis. Cell. 2015;163:1444-1456.29. Sivakumar PV, Westrich GM, Kanaly S, et al. Interleukin 18 is a primary mediator of the inflammation associated with dextran sulphate sodium induced colitis: blocking interleukin 18 attenuates intestinal damage. Gut. 2002;50:812-820.30. Plater-Zyberk C, Joosten LA, Helsen MM, et al. Therapeutic effect of neutralizing endogenous IL- 18 activity in the collagen-induced model of arthritis. J Clin Invest. 2001;108:1825-1832.31. Kelly MJ, Pietranico-Cole S, Larigan JD, et al. Discovery of 2-[3,5-dichloro-4-(5- isopropyl-6-oxo-l, 6-dihydropyridazin-3-yloxy)phenyl]-3,5-dioxo-2, 3,4,5- tetrahydro[l,2,4]triazine-6-carbonitrile (MGL-3196), a Highly Selective Thyroid HormoneReceptor agonist in clinical trials for the treatment of dyslipidemia. J Med Chem. 2014;57:3912-3923.32. Harrison SA, Bashir M, Moussa SE, et al. Effects of Resmetirom on Noninvasive Endpoints in a 36-Week Phase 2 Active Treatment Extension Study in Patients With NASH. Hepatol Commun. 2021;5:573-588.33. Harrison SA, Bashir MR, Guy CD, et al. Resmetirom (MGL-3196) for the treatment of non-alcoholic steatohepatitis: a multicentre, randomised, double-blind, placebo-controlled, phase 2 trial. Lancet. 2019;394:2012-2024.34. Jeong SW. Nonalcoholic Fatty Liver Disease: A Drug Revolution Is Coming. Diabetes Metab J. 2020;44:640-657.Example 9CCL4-induced liver fibrosis mouse model

[0360] 8-week-old C57BL / 6 wild-type male mice were intraperitoneally injected with CCI4 (Sigma-Aldrich, St. Louis, MO) dissolved in corn oil twice a week for 10 weeks. APB-R3 and vehicle were administered three times a week after the 7th week of CCI4 injection. CO2 euthanasia was performed, and liver tissues were fixed in 4% paraformaldehyde or stored frozen in liquid nitrogen. All experiments were performed in a blinded and randomized fashion.Liver histology

[0361] The liver tissues were fixed in 4% formalin solution, embedded in paraffin, cut at 5 pm. Paraffin-embedded sectioned-tissues were deparaffinized with Xylene (Duksan, Ansan, Korea), and washed with 100%, 95% and 70% EtOH. Sectioned tissues were stained with Piero-Sirius Red solution (Abeam, Cambridge, MA) according to manufacturer’s protocols. Stained sections were captured Ezscope U200 microscope (Macrotech, Goyang, Korea). Stained areas in the sectioned tissues were measured by Image J software (NIH). Histological assessments were performed by a pathologist under blind conditions. NAS and CRN fibrosis score was used.Protein extraction and Western Blot analysis

[0362] The protein was extracted from the liver tissues using RIPA buffer (sigma-aldrich, R0278) containing complete protease inhibitor cocktail (Roche Applied Sciences, #11697498001). 40 pg proteins were separated using sodium dodecyl sulfate polyacrylamide (SDS-PAGE) gel, and transferred to polyvinylidene fluoride (PVDF) membranes. Blocked in 5% BSA for 2 h at the room temperature and incubated in primary antibody for a-SMA (DAKO, M085129-2), GAPDH (bs-2188R, bioss), with 1:1000 dilution in 3% BSA at 4 °C overnight. Then, the membranes were washed three times with TBST each 10 min, and the membranes were incubated in the secondary antibody at room temperature for 2 h. The blots were visualized using ECL chemiluminescence kit (1065-260-000, labcon). GAPDH was used as loading control and Image J software (National Institutes of Health, Bethesda, MD, USA) was used for densitometric analysis of the bands.Measurement of hepatic hydroxyproline

[0363] For hydroxyproline measurements, frozen liver tissue was homogenized with D.W using a tissue Lyser II (Qiagen). Hydrochloride was added in the same amount and hydrolyzed by incubation at a 120°C heat block for 3 hours. PicoSense Total Collagen Assay kit (BioMax, Daejeon, Korea) was used according to the manufacturer's protocol. Absorbance was measured at 560 nm.Therapeutic effects of APB-R3 on CC14-induced liver fibrosis

[0364] As shown, FIG. 28A is a schematic of CC14-induced liver fibrosis mouse model with vehicle or APB-R3 intraperitoneal injection. FIG. 28B shows Sirius red stained sections of CC14-induced liver with vehicle (left) or APB-R3 (right) injection (x40 original magnification). FIG. 28C shows that Sirius red positive area was quantified in CC14-induced liver. FIG. 28D is a Western blot analysis of aSMA in the liver of the CC14+Vehicle and CC14+APB-R3. In FIG. 28E, the relative band intensity refers to the intensity of aSMA normalized to that of GAPDH. FIG. 28F show total hepatic hydroxyproline levels quantified from CC14-induced liver with vehicle or APB-R3. *P < 0.01 and ***P < 0.0001. Scale bars represent 200pm. The data represent means ± SEM. The data were analyzed by the Student’s t-test for simple comparisons or one-way ANOVA with Tukey’s post hoc test for multiple groups.

[0365] Example 10

[0366] A synopsis of a protocol for a Phase 1 clinical trial is provided in Table 7.Table 7Table 8. Schedule of AssessmentsAbbreviations: AEs = adverse events; BMI = body mass index; BP = Blood pressure; COVID- 19 = coronavirus disease; ECG = electrocardiogram; FSH = follicle-stimulating hormone; HBsAg = hepatitis B surface antigen; HCV = hepatitis C virus; HIV = human immunodeficiency virus; HR = Heart rate; IV = intravenous; PK = pharmacokinetic; PD = pharmacodynamic; RR = Respiration rate; TT = Tympanic temperature.

[0367] The above description of the present disclosure is only for illustrating, and it will be understood by those skilled in the art that the present disclosure may be easily modified in a different specific form without changing the technical spirit or essential characteristics thereof. Therefore, it should be understood that the above exemplary embodiments are not limitative, but illustrative in all aspects.

[0368] All of the various aspects, embodiments, and options described herein can be combined in any and all variations.

[0369] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be herein incorporated by reference.

Claims

WHAT IS CLAIMED IS:

1. A method of treating primary sclerosing cholangitis (PSC), hepatic cirrhosis, periductal fibrosis, and / or inflammatory bowel disease (IBD) in a subject in need thereof, comprising administering to the subject a recombinant fusion protein comprising an interleukin- 18 -binding protein (IL-18BP) and an antigen binding fragment (Fab) against serum albumin.

2. The method of claim 1, wherein the recombinant fusion protein inhibits PSC- induced fibrosis to inhibit development of senescent-associated phenotype (SASP) mediated inflammation, reactive cholangiocytes, elevated alkaline phosphatase (ALP) and gammaglutamyl transferase (GGT) activity, reduce bile acid level, and / or downregulate mRNA expression of one or more fibrotic marker genes.

3. A method of treating nonalcoholic steatohepatitis (NASH), liver inflammation, and / or liver fibrosis in a subject in need thereof, comprising administering to the subject a recombinant fusion protein comprising an interleukin- 18 -binding protein (IL-18BP) and an antigen binding fragment (Fab) against serum albumin.

4. The method of claim 3, further comprising administering an anti-steatotic agent to the subject.

5. The method of claim 3 or 4, wherein the recombinant fusion protein inhibits hepatic fibrogenesis, fibrotic and inflammatory marker genes in STAM livers, and / or fibrogenic activation of HSCs6. The method of any one of claims 1-5, wherein the fusion protein further comprising a linker that links the IL-18BP to the Fab.

7. The method of claim 6, wherein the linker links the IL-18BP to a C-terminus of the heavy chain constant domain, an N-terminus of the heavy chain variable domain, a C- terminus of the light chain constant domain, and / or an N-terminus of the light chain variable domain of the Fab.

8. The method of claim 7, wherein the linker links the IL-18BP to a C-terminus of the heavy chain constant domain.

9. The method of any one of claims 6-8, wherein the linker comprises 1 to 50 amino acids.

10. The method of claim 9, wherein the linker comprises an amino acid sequence of any one of SEQ ID NOS: 16 and 70-84.

11. The method of any one of claims 1-10, wherein the heavy chain and the light chain of the Fab are bound by a noncovalent bond.

12. The method of any one of claims 1-11, wherein the Fab comprises a heavy chain comprising a heavy chain variable domain comprising( 1 ) a heavy chain complementarity determining domain 1 (CDR 1 ) comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain complementarity determining domain 2 (CDR2) comprising the amino acid sequence of WINTYSGGTKYAQKFQG (SEQ ID NO:23), and a heavy chain complementarity determining domain 3 (CDR3) comprising the amino acid sequence of LGHCQRGICSDALDT (SEQ ID NO:24);(2) a heavy chain CDR1 comprising the amino acid sequence of SYGIS (SEQ ID NO:22), a heavy chain CDR2 comprising the amino acid sequence ofRINTYNGNTGYAQRLQG (SEQ ID NO:25), and a heavy chain CDR3 comprising the amino acid sequence ofLGHCQRGICSDALDT (SEQ ID NO:24);(3) a heavy chain CDR1 comprising the amino acid sequence of NYGIH (SEQ ID NO:26), a heavy chain CDR2 comprising the amino acid sequence ofSISYDGSNKYYADSVKG (SEQ ID NO:27), and a heavy chain CDR3 comprising the amino acid sequence ofDVHYYGSGSYYNAFDI (SEQ ID NO:28);(4) a heavy chain CDR1 comprising the amino acid sequence of SYAMS (SEQ ID NO:29),a heavy chain CDR2 comprising the amino acid sequence ofVISHDGGFQYYADSVKG (SEQ ID NO:30), and a heavy chain CDR3 comprising the amino acid sequence ofAGWLRQYGMDV (SEQ ID NO:31);(5) a heavy chain CDR1 comprising the amino acid sequence of AYWIA (SEQ ID NO:32), a heavy chain CDR2 comprising the amino acid sequence of MIWPPDADARYSPSFQG (SEQ ID NO:33), and a heavy chain CDR3 comprising the amino acid sequence of LYSGSYSP (SEQ ID NO:34); or(6) a heavy chain CDR1 comprising the amino acid sequence of AYSMN (SEQ ID NO:35), a heavy chain CDR2 comprising the amino acid sequence ofSISSSGRYIHYADSVKG (SEQ ID NO:36), and a heavy chain CDR3 comprising the amino acid sequence ofETVMAGKALDY (SEQ ID NO:37); and a light chain comprising a light chain variable domain comprising(7) a light chain CDR1 comprising the amino acid sequence of RASQSISRYLN (SEQ ID NO:38), a light chain CDR2 comprising the amino acid sequence of GASRLES (SEQ ID NO:39), and a light chain CDR3 comprising the amino acid sequence of QQSDSVPVT (SEQ ID NO:40);(8) a light chain CDR1 comprising the amino acid sequence of RASQSISSYLN (SEQ ID NO:41), a light chain CDR2 comprising the amino acid sequence of AASSLQS (SEQ ID NO:42), and a light chain CDR3 comprising the amino acid sequence of QQSYSTPPYT (SEQ ID NO:43);(9) a light chain CDR1 comprising the amino acid sequence of RASQSIFNYVA (SEQ ID NO:44), a light chain CDR2 comprising the amino acid sequence of DASNRAT (SEQ ID NO:45), anda light chain CDR3 comprising the amino acid sequence of QQRSKWPPTWT (SEQ ID NO:46);(10) a light chain CDR1 comprising the amino acid sequence of RASETVSSRQLA (SEQ ID NO:47), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QQYGSSPRT (SEQ ID NO:49);(11) a light chain CDR1 comprising the amino acid sequence of RASQSVSSSSLA (SEQ ID NO:50), a light chain CDR2 comprising the amino acid sequence of GASSRAT (SEQ ID NO:48), and a light chain CDR3 comprising the amino acid sequence of QKYSSYPLT (SEQ ID NO:51); or(12) a light chain CDR1 comprising the amino acid sequence of RASQSVGSNLA (SEQ ID NO:52), a light chain CDR2 comprising the amino acid sequence of GASTGAT (SEQ ID NO:53), and a light chain CDR3 comprising the amino acid sequence of QQYYSFLAKT (SEQ ID NO:54).

13. The method of any one of claims 1-12, wherein the heavy chain variable domain comprises a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO:35, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 36, and a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO:37, and wherein the light chain variable domain comprises a light chain CDR1 comprising the amino acid sequence of SEQ ID NO:52, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO:53, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:54.

14. The method of any one of claims 1-13, wherein the heavy chain variable domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:55, 56, 57, 58, 59, or 60.

15. The method of any one of claims 1-14, wherein the light chain variable domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:61, 62, 63, 64, 65, 66, or 67.

16. The method of any one of claims 1-5, wherein the heavy chain variable domain comprises an amino acid sequence of SEQ ID NO:55, 56, 57, 58, 59, or 60, and the light chain variable domain comprises an amino acid sequence of SEQ ID NO:61, 62, 63, 64, 65, 66, or 67.

17. The method of any one of claims 1-16, wherein the heavy chain constant domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:68.

18. The method of any one of claims 1-17, wherein the light chain constant domain comprises an amino acid sequence having at least 90% identity to SEQ ID NO:69.

19. The method of any one of claims 1-18, wherein the IL- 18 -binding protein comprises an amino acid sequence having at least 90% identity to SEQ ID NO:7.

20. The method of any one of claims 1-19, wherein the IL-18-binding protein comprises an amino acid sequence of SEQ ID NO:7.

21. The method of any one of claims 1-20, wherein the heavy chain of the Fab comprises an amino acid sequence of SEQ ID NO: 19.

22. The method of any one of claims 1-21 comprising an amino acid sequence of SEQ ID NO: 13 and an amino acid sequence of SEQ ID NO: 19.

23. The method of any one of claims 1-22, wherein the fusion protein is administered as a pharmaceutical composition comprising the fusion protein and a pharmaceutically acceptable excipient.

Images