Method for purifying molecule-to-be-sequenced-duplex complex, and kit

Abstract

Provided are a method for purifying a molecule-to-be-sequenced-duplex complex, a method for sequencing a purified nucleic acid-polypeptide complex obtained on the basis of the method, and a kit. The method comprises: step a. providing a mixture comprising a ligation product, wherein the ligation product comprises a molecule to be sequenced and a duplex, the duplex comprises a template molecule, a first nucleic acid, and a second nucleic acid, at least a portion of the first nucleic acid is complementarily paired with a first segment of the template molecule, at least a portion of the second nucleic acid is complementarily paired with a second segment of the template molecule, and the template molecule has a first site; step b. from the mixture by means of at least one of a carrier and a carrier complex, capturing the ligation product and an optional duplex to which no molecule to be sequenced is ligated, wherein the carrier complex comprises a third nucleic acid and the carrier; step c. using a first reagent to cleave at a first site in both the ligation product and the optional duplex to which no molecule to be sequenced is ligated, to obtain a first purified product; and step d. using a second reagent to cleave at a second site in the first purified product to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid, and the second segment of the template molecule has the second site.

Description

Method and kit for purifying a molecule-duplex complex TECHNICAL FIELD

[0001] The present disclosure relates to the field of biotechnology, in particular to a method for purifying a molecule-duplex complex, a method for sequencing a purified nucleic acid-polypeptide complex obtained according to the method, and a kit. BACKGROUND

[0002] Proteins are important macromolecules for performing life functions, and decoding their amino acid sequences through sequencing means is of great significance for revealing various biological processes and disease mechanisms. In recent years, research on sequencing DNA at the single molecule level through nanopore sequencing technology has become increasingly widespread. In nanopore sequencing technology, under the action of an electric field force, negatively charged DNA translocates through a nanopore, causing a change in electric current. Because the electrical signals of each nucleotide are different, the sequence information of the DNA can be determined by analyzing the change in electric current. Based on the same principle, nanopore sequencing can also be performed on proteins to determine their amino acid sequences.

[0003] However, there are still some problems in nanopore sequencing technology for proteins. Because there are many types of amino acids that make up proteins, not all of them are uniformly charged, making the translocation efficiency of polypeptides of different electricities different. Although the translocation of polypeptides through the nanopore can be made independent of their electricity by covalently coupling the polypeptides with nucleic acids to form a "nucleic acid-polypeptide" complex, various by-products are inevitably produced in the process of preparing the "nucleic acid-polypeptide" complex. In sequencing, these by-products will produce a large amount of invalid signals, resulting in a low proportion of sequencing signals of the target product, i.e., the nucleic acid-polypeptide complex. However, there is currently no report on the purification scheme for "polypeptide-nucleic acid" libraries. In related technologies, traditional magnetic bead purification is generally not suitable for proteins, and common techniques such as ethanol precipitation, gel electrophoresis, column chromatography are extremely unfriendly to components containing active proteins, in addition, high-performance liquid chromatography technology has the disadvantages of long time consumption, high cost, and large sample loss.

[0004] Therefore, there is an urgent need for a purification method for purifying a molecule-duplex complex, in particular a nucleic acid-polypeptide complex, to effectively remove by-products and improve the proportion of sequencing signals of the target library in nanopore sequencing.

[0005] SUMMARY

[0006] The present disclosure aims to at least partially solve one of the technical problems in the related art.

[0007] To this end, embodiments of the first aspect of the present disclosure provide a method for purifying a molecule-duplex complex. The method comprises: step a. providing a mixture comprising a ligation product, wherein the ligation product comprises a molecule of interest and a duplex, wherein the duplex comprises a template molecule, a first nucleic acid, and a second nucleic acid, wherein at least a portion of the first nucleic acid is complementary to a first segment of the template molecule and at least a portion of the second nucleic acid is complementary to a second segment of the template molecule, wherein the template molecule has a first site, step b. capturing the ligation product and optionally duplexes not ligated to the molecule of interest in the mixture by at least one of a support and a support complex, wherein the support complex comprises a third nucleic acid and the support; step c. cleaving at the first site in the ligation product and optionally duplexes not ligated to the molecule of interest with a first reagent to obtain a first purified product; and step d. cleaving at a second site in the first purified product with a second reagent to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid, and the second segment of the template molecule has the second site. By the purification method of embodiments of the present disclosure, the molecule-duplex complex, particularly the nucleic acid-polypeptide complex, can be purified and separated from various byproducts generated in the preparation process, so as to increase the proportion of the target product, and thus ultimately increase the proportion of the sequencing signal of the target library in nanopore sequencing.

[0008] In some embodiments, the molecule of interest comprises a polypeptide, a DNA, an RNA, and a polymer. In some embodiments, the polymer comprises a polysaccharide and a polyethylene glycol.

[0009] In some embodiments, the first site is located in the first segment or the second segment of the template molecule, or between the first segment and the second segment in the template molecule.

[0010] In some embodiments, the first site and the second site are each independently selected from at least one of an AP site, an endonuclease recognition site, a restriction endonuclease recognition site, or a breakable chemical bond; the first reagent is capable of specifically recognizing and cleaving the first site. In some embodiments, the first reagent comprises an RNase enzyme, an endonuclease, a restriction endonuclease, light, heat, electromagnetic radiation, and other reagents that break the chemical bond; the second reagent is capable of specifically recognizing and cleaving the second site, preferably, the second reagent comprises an RNase enzyme, an endonuclease, a restriction endonuclease, light, heat, electromagnetic radiation, and other reagents that break the chemical bond.

[0011] In some embodiments, the ligation products comprise double-ended ligation products and single-ended ligation products, wherein the test molecule is ligated to both the first nucleic acid and the second nucleic acid to form the double-ended ligation products, and wherein the test molecule is ligated to the first nucleic acid and / or the second nucleic acid to form the single-ended ligation products, respectively.

[0012] In some embodiments, the test molecule is ligated to the first nucleic acid and / or the second nucleic acid via a coupling reaction. In some embodiments, the coupling reaction comprises a reaction between at least one pair of functional groups selected from the group consisting of: amine and aryl azide, amine and hydroxymethyl phosphine, amine and imidate, amine and NHS ester, amine and PFP ester, amine or carboxyl and carbodiimide, carbohydrate and hydrazide, hydroxyl and isocyanate, carbonyl and hydrazine, thiol and maleimide or pyridyl disulfide, thiol amine or hydroxyl and vinyl sulfone or vinyl sulfonamide, and azide and alkyne, such as azide and dibenzocyclooctyne.

[0013] In some embodiments, based on capturing the ligation products and optionally the duplex via the carrier complex, wherein the carrier has a first modification, the third nucleic acid has a second modification and the second site, the carrier forms the carrier complex with the third nucleic acid via a reaction between the first modification and the second modification, the third nucleic acid is complementary paired to a portion of the second nucleic acid; and / or at least a portion of the third nucleic acid is complementary paired to a portion of the second segment of the template molecule, optionally, the first modification and the second modification are each independently selected from the group consisting of amino, carboxyl, hydroxyl, carbonyl, azide, alkyne, biotin, streptavidin, amylose, Ni-NTA, a peptide such as an antigen, preferably, the carrier forms the carrier complex with the third nucleic acid via biotin and streptavidin; optionally, the carrier is at least one of a magnetic bead, a magnetic sheet, a nanogold, a silica particle, or a gel particle, preferably, the carrier is a magnetic bead.

[0014] In some embodiments, the method further comprises one of:

[0015] In some embodiments, the method further comprises one of:

[0016] providing a linker before step b such that the linker is specifically attached to the ligation product;

[0017] providing a linker between step b and step c such that the linker is specifically attached to the ligation product;

[0018] providing a linker between step c and step d such that the linker is specifically attached to the first purified product; and

[0019] providing a linker after step d such that the linker is specifically attached to the second purified product.

[0020] In some embodiments, the linker is one or more of a Y-shaped linker and a bubble-shaped linker.

[0021] Embodiments of the second aspect of the disclosure propose a library construction method, comprising obtaining the second purified product with a linker according to the method of the first aspect, the second purified product with a linker being a target double-end ligation product library, in some embodiments, the linker is a Y-shaped linker and / or a bubble-shaped linker.

[0022] Embodiments of the third aspect of the disclosure propose a sequencing method. The method comprises: obtaining the second purified product with a linker according to any embodiment of the first aspect; and sequencing the second purified product with a linker.

[0023] In some embodiments, the linker is one or more of a Y-shaped linker and a bubble-shaped linker.

[0024] In some embodiments, the sequencing is third generation sequencing, preferably the third generation sequencing is nanopore sequencing.

[0025] Embodiments of the fourth aspect of the present disclosure provide a kit for purifying a molecule-duplex complex to be detected, characterized in that the kit comprises a carrier and / or carrier complex, a first reagent and a second reagent,

[0026] wherein the carrier and / or carrier complex is used for capturing a ligation product and optionally a duplex not ligating the molecule to be detected in a mixture, wherein the ligation product comprises the molecule to be detected and the duplex, wherein the duplex comprises a template molecule, a first nucleic acid and a second nucleic acid, wherein at least a portion of the first nucleic acid is complementarily paired to a first segment of the template molecule, and at least a portion of the second nucleic acid is complementarily paired to a second segment of the template molecule, wherein the template molecule has a first site,

[0027] the first reagent is used for cleaving the first site of the ligation product and optionally the duplex not ligating the molecule to be detected to obtain a first purified product,

[0028] the second reagent is used for cleaving a second site in the first purified product to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid and the second segment of the template molecule has the second site.

[0029] In some embodiments, the carrier is at least one of a magnetic bead, a magnetic sheet, a nano-gold, a silicon particle, and a gel particle, and in some embodiments, the carrier is a magnetic bead.

[0030] In some embodiments, the carrier complex comprises a third nucleic acid and the carrier.

[0031] In some embodiments, the carrier of the carrier complex has a first modification, the third nucleic acid has a second modification and the second site, and the carrier and the third nucleic acid form the carrier complex through a reaction between the first modification and the second modification.

[0032] In some embodiments, at least a portion of the third nucleic acid is complementarily paired to a portion of the second nucleic acid; or at least a portion of the third nucleic acid is complementarily paired to a portion of the second segment of the template molecule.

[0033] In some embodiments, the first modification and the second modification are each independently selected from one of an amino group, a carboxyl group, a hydroxyl group, a carbonyl group, an azide, an alkyne, biotin, streptavidin, amylose, Ni-NTA, a peptide and an antigen.

[0034] In some embodiments, the first site and the second site are each independently selected from at least one of an AP site, an endonuclease recognition site, a restriction endonuclease recognition site, and a cleavable chemical bond;

[0035] The first agent is capable of specifically recognizing and cleaving the first site, preferably, the first agent comprises an RNase enzyme, an endonuclease, a restriction endonuclease, light, heat, electromagnetic radiation, or other agents that break the chemical bond;

[0036] The second agent is capable of specifically recognizing and cleaving the second site, preferably, the second agent comprises an RNase enzyme, an endonuclease, a restriction endonuclease, light, heat, electromagnetic radiation, or other agents that break the chemical bond.

[0037] The advantages and technical effects brought by the independent claims according to the embodiments of the present disclosure are as follows:

[0038] (1) The method for purifying the double-stranded complex of the molecule to be tested according to the embodiments of the present disclosure is widely applicable to double-end ligation products formed by the molecule to be tested being simultaneously connected to multiple nucleic acids of the double-stranded complex, wherein the type of the molecule to be tested can be diverse and the activity is not affected.

[0039] (2) The embodiments of the present disclosure first propose a purification method for a “polypeptide-nucleic acid” complex library, which effectively removes excess linkers, free molecules to be tested, free double-stranded complexes, and single-end ligation products generated during the preparation of “polypeptide-nucleic acid” complexes by combining magnetic beads with template molecules containing rationally designed enzyme cutting sites, so as to achieve the purpose of purifying and enriching the library, thereby improving the sequencing proportion of effective libraries in nanopore sequencing.

[0040] (3) When the target ligation product is captured by the purification method according to the embodiments of the present disclosure, it is not affected by the sequence length and type of the captured ligation product, and has universality.

[0041] (4) Compared with the purification method in the related art, the purification method according to the embodiments of the present disclosure has high purification efficiency, short time consumption, and low cost, and has high practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0042] In order to more clearly illustrate the technical solutions in the present disclosure or the related art, the following will briefly introduce the drawings needed to be used in the embodiments or the related art description. Obviously, the drawings in the following description are only embodiments of the present disclosure, and those skilled in the art can also obtain other drawings according to these drawings without any creative effort.

[0043] Figure 1 is a schematic diagram of a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0044] Figure 2 is a schematic diagram of a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0045] Figure 3 is a schematic diagram of a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0046] Figure 4 is a schematic diagram of a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0047] Figure 5 is a schematic diagram of a first site according to an embodiment of the present disclosure.

[0048] Figure 6 shows a second site according to an embodiment of the present disclosure and various capturing methods according to embodiments of the present disclosure.

[0049] Figure 7 is a schematic diagram of a structure of a carrier complex according to an embodiment of the present disclosure.

[0050] Figure 8 is a schematic diagram of a carrier complex capturing method according to an embodiment of the present disclosure.

[0051] Figure 9 is a sequencing result of a mixture containing ligation products that has not been treated by a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0052] Figure 10 is a sequencing result of a second purified product obtained by a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0053] Figure 11 is a schematic diagram of a purification effect of a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure.

[0054] Figure 12 is a schematic diagram of a carrier complex capturing method according to another embodiment of the present disclosure.

[0055] Figure 13 is a sequencing result of a second purified product obtained by a method for purifying a test molecule-duplex complex according to another embodiment of the present disclosure.

[0056] Figure 14 is a schematic diagram of a purification effect of a method for purifying a test molecule-duplex complex according to another embodiment of the present disclosure.

[0057] Figure 15 is a schematic diagram of a carrier complex capturing method according to yet another embodiment of the present disclosure.

[0058] Figure 16 is a sequencing result of a second purified product obtained by a method for purifying a test molecule-duplex complex according to yet another embodiment of the present disclosure.

[0059] FIG. 17 is a schematic diagram of purification effect of a method for purifying a test molecule-duplex complex according to yet another embodiment of the present disclosure.

[0060] FIG. 18 is a schematic diagram of a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure. DETAILED DESCRIPTION

[0061] Embodiments of the present disclosure are described in detail below with reference to the accompanying drawings. The embodiments described below by reference to the accompanying drawings are exemplary and are intended to explain the present disclosure, and cannot be understood as a limitation of the present disclosure.

[0062] A nucleic acid-polypeptide complex (peptide-oligonucleotide conjugate, referred to as POC or PO for short) is a product formed by linking a polypeptide molecule and a nucleic acid molecule together through a certain chemical structure. Such a complex combines the functions and advantages of both nucleic acid and polypeptide biological molecules, and has advantages such as programmability, high specificity, and biological activity diversity. The nucleic acid-polypeptide complex can be used for nanopore sequencing technology for proteins.

[0063] In some embodiments, the process of preparing a "nucleic acid-polypeptide" complex is shown in FIG. 1: DNA1-top (first nucleic acid), DNA2-top (second nucleic acid), DNA1-bottom (template molecule) are first annealed, and then the test molecule and the template DNA are linked through the click chemistry reaction of azide (N3) and dibenzocyclooctyne (DBCO), to obtain a "nucleic acid-polypeptide-nucleic acid" three-segment linker. The chemical coupling mode between the test substance and the template is not particularly limited, and any suitable combination of reactive functional groups can be used, including but not limited to amine and aryl azide, amine and hydroxymethyl phosphine, amine and imidate, amine and NHS ester, amine and PFP ester, amine or carboxyl and carbodiimide, carbohydrate and hydrazide, hydroxyl and isocyanate, carbonyl and hydrazine, thiol and maleimide or pyridyl disulfide, thiol amine or hydroxyl and vinyl sulfone, vinyl sulfonamide, azide and alkyne, etc. The test molecule can be any substance that can be characterized by a nanopore, including but not limited to polypeptides, DNA, RNA, polymers (such as polysaccharides or PEG), etc. In embodiments of the present disclosure, polypeptides are described as an example.

[0064] In some embodiments, examples of the nucleic acid-polypeptide complex include, but are not limited to: (1) two target nucleic acids are respectively bound to the template molecule in full-length sequence (left) and partial sequence (right) complementarily, and a target polypeptide is coupled to the two target nucleic acids; (2) two target nucleic acids are respectively bound to the template molecule in full-length sequence complementarily, and a target polypeptide is coupled to the two target nucleic acids; (3) two target nucleic acids are respectively bound to the partial sequence of the template molecule formed via a connecting structure in full-length sequence complementarily, and a target polypeptide is coupled to the two target nucleic acids.

[0065] However, in the process of preparing the "nucleic acid-polypeptide" complex, various by-products are inevitably produced, such as excess linker, free target polypeptide, unlinked polypeptide-nucleic acid product, or polypeptide-nucleic acid single-end linked product, etc. In sequencing, these by-products will generate a large amount of invalid signals, resulting in a low proportion of sequencing signals of the target product, i.e., the nucleic acid-polypeptide complex. However, there is no report on the purification scheme for the "polypeptide-nucleic acid" library. In the related art, magnetic bead purification, ethanol precipitation, gel electrophoresis, column chromatography, extraction, high-performance liquid chromatography, etc. are common nucleic acid or polypeptide purification technologies.

[0066] Magnetic bead purification is a common purification method in sequencing library purification. Magnetic beads are usually composed of a small iron oxide particle core and an outer high-molecular material containing functional groups, which can move directionally under the action of a magnetic field. The active groups (such as carboxyl, amino, etc.) on the outer modification of the magnetic beads can produce physical, chemical or biological interactions with the substances around the magnetic beads. Therefore, in the presence of a specific concentration of polyethylene glycol (PEG) and salt ions, magnetic beads with surface modification (such as carboxyl modification) can reversibly adsorb DNA to their surface. For different lengths of DNA carrying different degrees of negative charge, by adjusting the conditions of adsorption and elution, the sorting and purification of DNA can be achieved. However, traditional magnetic bead purification is often used to purify single nucleic acid sequences, and needs to be washed with ethanol during use, so it is not suitable for the purification of proteins, especially the purification of nucleic acid-polypeptide complexes. Moreover, simple magnetic bead purification is difficult to purify short fragment nucleic acid sequences.

[0067] In addition, common techniques such as ethanol precipitation, gel electrophoresis, column chromatography, etc. mostly need to use high salt or denaturing conditions, and therefore are not suitable for application in the purification of nucleic acid-polypeptide complexes containing active proteins. Although high-performance liquid chromatography technology can be used to purify proteins, this method is time-consuming, high-cost, and large-sample-loss, and is only suitable for laboratories, but not for high-throughput sequencing.

[0068] To this end, embodiments of the first aspect of the present disclosure provide a method for purifying a molecule-duplex complex. The method comprises: step a. providing a mixture containing a ligation product, wherein the ligation product comprises a molecule to be tested and optionally a duplex, wherein the duplex comprises a template molecule, a first nucleic acid, and a second nucleic acid, wherein at least a portion of the first nucleic acid is complementary to a first segment of the template molecule, and at least a portion of the second nucleic acid is complementary to a second segment of the template molecule, wherein the template molecule has a first site, step b. capturing the ligation product and optionally the duplex not ligated to the molecule to be tested in the mixture by at least one of a carrier and a carrier complex, wherein the carrier complex comprises a third nucleic acid and the carrier; step c. cleaving at the first site in the ligation product and optionally the duplex not ligated to the molecule to be tested with a first reagent to obtain a first purified product; and step d. cleaving a second site in the first purified product with a second reagent to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid, and the second segment of the template molecule has the second site. By the purification method of the embodiments of the present disclosure, the molecule-duplex complex, particularly the nucleic acid-polypeptide complex, can be purified and separated from various by-products generated in the preparation process, so as to increase the proportion of the target product, thereby ultimately increasing the proportion of the sequencing signal of the target library in nanopore sequencing.

[0069] In some embodiments, the first nucleic acid is DNA1-top, and has the sequence as shown below: pho-GCTTCTCGTG-XX-TTTTTTTTCTCTC / DBCO (SEQ ID NO: 1), wherein DBCO is dibenzocyclooctyne, pho is phosphorylation modification, and X is an empty deoxynucleotide without base. The structural formula of X is:

[0070] In some embodiments, the second nucleic acid is DNA2-top1, and has the sequence as shown below: DBCO-CCCXX-TTTTTTTTTTGCTGTCTTCTGTCGTCGTTTGTCCTCTTGGTGTTCTTCTTGTCAGTGddC (SEQ ID NO: 2), wherein DBCO is dibenzocyclooctyne, X is an empty deoxynucleotide without base, and ddC is a double deoxycytidine nucleotide.

[0071] In some embodiments, the second nucleic acid is DNA2-top2, which has the sequence: DBCO-CCCXX-TTTTTTTTTTGCTGTCTTCTGTCGTCGTTTrCrUrCrUrCrU (SEQ ID NO: 3), wherein DBCO is dibenzocyclooctyne, X is an empty deoxynucleotide without a base, and rU is a ribonucleotide.

[0072] In some embodiments, the template molecule is DNA1-bottom1, which has the sequence: AAACGACGACAGAAGACAGCAAAAAAAAAATTGGGXGAIAGAAAAAAAAAACACGAGAAGCA (SEQ ID NO: 4).

[0073] In some embodiments, the template molecule is DNA1-bottom2, which has the sequence: AAACGACGACAGAAGACAGCAAAAAArArArArATTGGGXGAGAGAAAAAAAAAACACGAGAAGCA (SEQ ID NO: 5), wherein X is an empty deoxynucleotide without a base, and rA is a ribonucleotide.

[0074] In some embodiments, the test molecule is peptide1, which has the sequence: N3-CERVEE{Lys(N3)} (SEQ ID NO: 6), wherein N3 is an azide, the N-terminal amino group is modified to an azide, the C-terminal lysine (Lys) side chain amino group is modified to an azide, and CERVEE is a polypeptide sequence.

[0075] In some embodiments, the test molecule comprises a polypeptide, a DNA, an RNA, or a polymer. In some embodiments, the polymer comprises a polysaccharide or a polyethylene glycol.

[0076] In some specific embodiments, the test molecule is a polypeptide, the test molecule-duplex complex is a nucleic acid-polypeptide complex, and the duplex is a double-stranded molecule comprising the template molecule, the first nucleic acid, and the second nucleic acid.

[0077] FIGS. 2-4 are several schematic flowcharts of methods for purifying a test molecule-duplex complex, according to embodiments of the present disclosure.

[0078] As shown in FIGS. 2-4, the mixture containing the ligation product is first provided by step a. The ligation product comprises a test molecule and a duplex, wherein the duplex comprises a template molecule, a first nucleic acid, and a second nucleic acid. At least a portion of the first nucleic acid is complementary to a first segment of the template molecule, and at least a portion of the second nucleic acid is complementary to a second segment of the template molecule, wherein the template molecule has a first site. FIG. 5 is a schematic diagram of the location of the first site according to embodiments of the present disclosure. In some embodiments, the first site is located in the first segment or the second segment of the template molecule, or between the first segment and the second segment in the template molecule.

[0079] In some embodiments, the mixture containing the ligation product refers to the ligation product (nucleic acid-polypeptide complex) and various byproducts produced in the process of preparing the nucleic acid-polypeptide complex, which can include but are not limited to excess linker, free test molecule, free duplex, and single-end ligation product, etc. It can be understood that the free duplex is composed of the template molecule and the first nucleic acid and the second nucleic acid that are not ligated to the test molecule. The single-end ligation product is formed by the template molecule, the first nucleic acid ligated to the test molecule, the second nucleic acid not ligated to the test molecule; or by the template molecule, the second nucleic acid ligated to the test molecule, the first nucleic acid not ligated to the test molecule; or by the template molecule, the second nucleic acid ligated to the test molecule, the first nucleic acid ligated to another test molecule.

[0080] It should be noted that the method of preparing the ligation product is incorporated herein by reference from the content of patent applications with application numbers PCT / CN2023 / 079680 and PCT / CN2023 / 143721. Thus, the mixture can be a mixture produced in the process of implementing the above method. In some embodiments, the test molecule is ligated to the first nucleic acid and / or the second nucleic acid through a coupling reaction. In some embodiments, the coupling reaction includes a reaction of at least one set of functional groups from the following: amine and aryl azide, amine and hydroxymethyl phosphine, amine and imidate, amine and NHS ester, amine and PFP ester, amine or carboxyl and carbodiimide, carbohydrate and hydrazide, hydroxyl and isocyanate, carbonyl and hydrazine, thiol and maleimide or pyridyl disulfide, thiol amine or hydroxyl and vinyl sulfone, vinyl sulfonamide, and azide and alkyne (e.g., azide and dibenzocyclooctyne).

[0081] As shown in FIGS. 2-4, the mixture containing the ligation product is first provided by step a. The ligation product comprises a test molecule and a duplex, wherein the duplex comprises a template molecule, a first nucleic acid, and a second nucleic acid. At least a portion of the first nucleic acid is complementary to a first segment of the template molecule, and at least a portion of the second nucleic acid is complementary to a second segment of the template molecule, wherein the template molecule has a first site. FIG. 5 is a schematic diagram of the location of the first site according to embodiments of the present disclosure. In some embodiments, the first site is located in the first segment or the second segment of the template molecule, or between the first segment and the second segment in the template molecule.

[0082] FIG. 6 shows the location of the second site and the capturing manners according to embodiments of the present disclosure. It can be understood that the location of the second site can be adjusted according to actual needs, i.e., at least one of the third nucleic acid, the second nucleic acid, and the second segment of the template molecule has the second site. In embodiments of the present disclosure, the capturing manner can be based on capturing the ligation product and optionally the duplex by the carrier complex, wherein the carrier has a first modification, the third nucleic acid has a second modification and the second site, and the carrier and the third nucleic acid form the carrier complex through a reaction between the first modification and the second modification. For example, as shown in B1 and B2 in FIG. 6, the third nucleic acid is complementarily paired with a portion of the second nucleic acid. For another example, as shown in A1 and A2 in FIG. 6, at least a portion of the third nucleic acid is complementarily paired with a portion of the second segment of the template molecule. In some embodiments, the first modification and the second modification are each independently selected from the group consisting of an amino group, a carboxyl group, a hydroxyl group, a carbonyl group, an azide, an alkyne, biotin, streptavidin, amylose, Ni-NTA, a peptide such as an antigen. In some embodiments, the carrier and the third nucleic acid form the carrier complex through biotin and streptavidin. In some embodiments, the carrier is at least one of the following: a magnetic bead, a magnetic sheet, nano-gold, a silicon particle, and a gel particle. In some embodiments, the carrier is a magnetic bead. It can be understood that the second modification depends on the type of the first modification, and any modification that can act with the first modification and form a carrier complex through it can be used as the second modification, and the present application does not intend to limit the type of the above-mentioned modification.

[0083] In embodiments of the present disclosure, the capturing can also be based on capturing the ligation product and the duplex by the carrier, wherein the carrier has a first modification and the second nucleic acid has a third modification or the second segment has a fourth modification. For example, as shown in D1 and D2 in FIG. 6, the carrier is ligated to the second nucleic acid by a reaction between the first modification and the third modification, and the second nucleic acid has the second site. For another example, as shown in C1 and C2 in FIG. 6, the carrier is ligated to the second segment of the template molecule by a reaction between the first modification and the fourth modification, and the second segment of the template molecule has the second site. In some embodiments, the first modification, the third modification and the fourth modification are each independently selected from the group consisting of an amino group, a carboxyl group, a hydroxyl group, a carbonyl group, an azide, an alkyne, biotin, streptavidin, amylose, Ni-NTA, a peptide such as an antigen. In some embodiments, the carrier is ligated to the second nucleic acid by biotin and streptavidin. In some embodiments, the carrier is at least one of a magnetic bead, a magnetic sheet, a nano-gold, a silicon particle or a gel particle. In some embodiments, the carrier is a magnetic bead. It can be understood that the third modification and / or the fourth modification depend on the type of the first modification, and any modification that can interact with the first modification and be ligated to the duplex by the first modification can be the third modification and / or the fourth modification, and the present disclosure is not intended to limit the type of the modification.

[0084] FIG. 7 is a schematic diagram of a structure of a carrier complex according to an embodiment of the present disclosure. As shown in FIG. 7, the carrier complex comprises a third nucleic acid (also referred to as a capture DNA) and a carrier, wherein the third nucleic acid captures the ligation product and the third nucleic acid comprises a second site. In some specific embodiments, the carrier complex is a modified magnetic bead with a specific sequence obtained by co-incubating a streptavidin magnetic bead with a capture DNA modified with biotin. The carrier complex can specifically capture the ligation product and the duplex without the target molecule in the mixture by the third nucleic acid (also referred to as a capture DNA) to remove excess adaptors and free target molecules. Specifically, the capture DNA is complementary to a part of the second nucleic acid and ligated to the second segment of the template molecule, a part of the capture DNA is complementary to the third segment of the template molecule and ligated to the second nucleic acid, and the capture DNA is complementary to the third segment of the template molecule and ligated to the second nucleic acid.

[0085] In some embodiments, the third nucleic acid is a Capture DNA, and the sequence of the Capture DNA is as follows: Biotin-TEG-rCrUrCrUrCrUGCACTGACAAGAAGAACACCAAGAGGAC (SEQ ID NO: 7), wherein Biotin is biotin, TEG is -triethylene glycol, rC and rU are ribonucleotides. In some embodiments, the ligation products comprise double-end ligation products and single-end ligation products, wherein the test molecule is simultaneously ligated to the first nucleic acid and the second nucleic acid to form the double-end ligation products, and wherein the test molecule is respectively ligated to the first nucleic acid or the second nucleic acid to form the single-end ligation products.

[0086] As shown in FIGS. 2-4, the first reagent is then provided by step c. to act on the first site in both the ligation products and the duplexes not ligated to the test molecule to obtain a first purified product. Herein, the first reagent is capable of specifically recognizing and cutting the first site. As a result, the duplexes are cut into two parts at the first site by step c. Herein, the first nucleic acid and the second nucleic acid of the double-end ligation product (nucleic acid-polypeptide complex) remain intact due to being double-end ligated by the polypeptide, accordingly enabling the first segment and the second segment of the cut template molecule to remain in place by base pairing. Herein, the first nucleic acid and the second nucleic acid contained in the free duplexes are two separate parts. Thus, when the template molecule of the single-end ligation product is cut into two parts, its first nucleic acid and the first segment of the cut template molecule are detached from the original position. Herein, the first nucleic acid ligated to the test molecule, the second nucleic acid not ligated to the test molecule, or the second nucleic acid ligated to the test molecule, the first nucleic acid not ligated to the test molecule, or the second nucleic acid ligated to the test molecule, the first nucleic acid ligated to another test molecule in the single-end ligation product are two separate parts. Thus, when the template molecule of the single-end ligation product is cut into two parts, its first nucleic acid or the first nucleic acid ligated to the test molecule, and the first segment of the cut template molecule are detached from the original position. Finally, the first purified product obtained by step c. comprises the intact double-end ligation product complexed with the carrier, the second nucleic acid and the second segment of the single-end ligation product, and / or the second nucleic acid ligated to the test molecule and the second segment of the single-end ligation product. It can be understood that the ligation products and optionally the duplexes not ligated to the test molecule captured by any capture method in step b. are in the form of carrier complexes after being cut by step c.

[0087] In some embodiments, the first site is independently selected from at least one of an AP site, an endonuclease recognition site, a restriction endonuclease recognition site, or a cleavable chemical bond. In some embodiments, the first reagent comprises an RNase enzyme, an endonuclease, a restriction endonuclease, light, heat, electromagnetic radiation, and other reagents that cleave the chemical bond. The first reagent is capable of specifically recognizing and cleaving the first site. It is understood that any reagent-site combination capable of specific recognition and cleavage can be the first reagent and the first site in the present application, and the present application is not intended to be limited in this regard.

[0088] As shown in FIGS. 2-4, a second reagent is then provided by step d. such that the second reagent acts on the second site in the first purified product to obtain a second purified product, wherein the second reagent is capable of specifically recognizing and cleaving the second site. As a result, the vector complex is cleaved at the second site by step c. and separated from the first purified product. Finally, the second purified product comprises the double-end ligation product in free state, the second nucleic acid and the second segment of the single-end ligation product, and / or the second nucleic acid and the second segment of the single-end ligation product with the molecule to be detected ligated.

[0089] In some embodiments, the second site is independently selected from at least one of an AP site, an endonuclease recognition site, a restriction endonuclease recognition site, or a cleavable chemical bond. The second reagent comprises an RNase enzyme, an endonuclease, a restriction endonuclease, light, heat, electromagnetic radiation, and other reagents that cleave the chemical bond. The second reagent is capable of specifically recognizing and cleaving the second site. It is understood that any reagent-site combination capable of specific recognition and cleavage can be the second reagent and the second site in the present application, and the present application is not intended to be limited in this regard.

[0090] FIG. 8, FIG. 12, FIG. 15 respectively show schematic diagrams of the capture mode of the carrier complex according to various embodiments of the present disclosure. In FIG. 8, the first site in the target double-end ligation product (i.e., nucleic acid-polypeptide complex) is located in the region of DNA1 bottom1 (template molecule) that is complementary to DNA1-top (first nucleic acid). The carrier complex is connected to the target double-end ligation product by the Capture DNA (third nucleic acid) with the second site in a complementary pairing manner with DNA2-top1 (second nucleic acid). In FIG. 12, the first site in the target double-end ligation product (i.e., nucleic acid-polypeptide complex) is located in the region of DNA bottom2 (template molecule) that is complementary to DNA2-top1 (second nucleic acid). The carrier complex is connected to the target double-end ligation product by the Capture DNA (third nucleic acid) with the second site in a complementary pairing manner with DNA2-top1 (second nucleic acid). In FIG. 15, the first site is located in the region of DNA bottom1 (template molecule) that is complementary to DNA1-top (first nucleic acid). The carrier is connected to the target double-end ligation product by DNA2-top2 (second nucleic acid) with the second site through the reaction between the first modification and the third modification. Through the purification method of the embodiments of the present disclosure, the molecule-duplex complex to be tested, in particular the nucleic acid-polypeptide complex, can be purified and separated from various by-products generated in the preparation process, so as to increase the proportion of the target product, thereby ultimately increasing the proportion of the sequencing signal of the target library in nanopore sequencing.

[0091] In some specific embodiments, after purification, the signal types are reduced from 6 to 3, thereby increasing the proportion of the sequencing signal of the target library in nanopore sequencing.

[0092] In some embodiments, the third nucleic acid is complementary to a portion of the second nucleic acid; or at least a portion of the third nucleic acid is complementary to the third segment of the template molecule.

[0093] In some embodiments, the method further comprises one of the following: providing a linker before step b such that the linker is specifically connected to the ligation product; providing a linker between step b and step c such that the linker is specifically connected to the ligation product; providing a linker between step c and step d such that the linker is specifically connected to the first purification product; and providing a linker after step d such that the linker is specifically connected to the second purification product. Through the above-mentioned purification method, finally only the intact molecule-duplex complex in a free state with a linker can be used for the next sequencing, thereby achieving the purification and separation of the molecule-duplex complex from various by-products generated in the preparation process of the molecule-duplex complex, improving the proportion of the target product, and finally improving the proportion of the sequencing signal of the target library in nanopore sequencing.

[0094] In some specific embodiments, after purification, the signal type is reduced from 6 to 1, thereby improving the proportion of the sequencing signal of the target library in nanopore sequencing.

[0095] In some embodiments, the linker is one or more of a Y-shaped linker and a bubble-shaped linker. It can be understood that, taking FIG. 4 as an example, the principle of connecting the linker and the double-end ligation product is that only the double-end ligation product is in a double-stranded form, and the end of the first nucleic acid based on the double-stranded form is a blunt end or a sticky end, which can be connected with any linker having a blunt end or a sticky end, thereby achieving the purpose of purifying and separating the target double-end ligation product with a linker. In some embodiments, the linker described herein is defined as a nucleic acid sequence for capture, without emphasizing other functions. In some embodiments, the linker described herein is defined as a nucleic acid sequence that additionally includes other functional sequences such as a tag, a primer, hybrid capture, etc. on the basis of the above-mentioned functions, for library construction / sequencing. Any reasonably designed linker is suitable for the method of the present embodiment, and the present application does not intend to limit this.

[0096] In some embodiments, the Y-shaped linker is composed of three nucleic acid segments of Y-top, Y-bottom and Y-tether.

[0097] In some embodiments, the sequence of Y-top is as follows: XXXXXXXXXXXXXXXXXXXXXXXXXXXXX-TTTTTTTTTT-YYYY-GGTTGTTTCTGTTGGTGCTGATATTGCT (SEQ ID NO: 8), wherein X is a space sub-C3 Spacer (iSpC3), Y is a space sub-Spacer 18 (iSp18), and the structural formula of iSpC3 is

[0098] The structural formula of iSp18 is

[0099] In some embodiments, the sequence of Y-bottom is as follows: pho-GCAATATCAGCACCAACAGAAACAACCTTTGAGGCGAGCGGTCAA (SEQ ID NO: 9).

[0100] Embodiments of the second aspect of the present disclosure propose a library construction method, comprising obtaining a second purified product with a linker according to the method of the first aspect, the second purified product with a linker being a target double-end ligation product library, in some embodiments, the linker is one or more of Y-type linker and bubble-type linker.

[0101] Embodiments of the third aspect of the present disclosure propose a sequencing method. The method comprises: obtaining a second purified product with a linker according to the method of any one of the first aspect; and sequencing the second purified product with a linker.

[0102] In some embodiments, the linker is one or more of Y-type linker and bubble-type linker. In some embodiments, the sequencing is third-generation sequencing, preferably the third-generation sequencing is nanopore sequencing.

[0103] Embodiments of the fourth aspect of the present disclosure propose a kit for purifying a test molecule-duplex complex, characterized in that the kit comprises a carrier and / or carrier complex, a first reagent and a second reagent,

[0104] wherein the carrier and / or carrier complex is used to capture a ligation product and optionally a duplex not ligated with the test molecule in a mixture, wherein the ligation product comprises the test molecule and the duplex, wherein the duplex comprises a template molecule, a first nucleic acid and a second nucleic acid, wherein at least a portion of the first nucleic acid is complementarily paired with a first segment of the template molecule, and at least a portion of the second nucleic acid is complementarily paired with a second segment of the template molecule, wherein the template molecule has a first site,

[0105] the first reagent is used to cut the first site of the ligation product and optionally the duplex not ligated with the test molecule to obtain a first purified product,

[0106] the second reagent is used to cut a second site in the first purified product to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid and the second segment of the template molecule has the second site.

[0107] In summary, the method for purifying the test molecule-duplex complex in the embodiments of the present disclosure can effectively remove the by-products generated in the preparation process of the test molecule-duplex complex, in particular, the “polypeptide-nucleic acid” complex, to achieve the purpose of purifying and enriching the library, thereby improving the sequencing proportion of the effective library in nanopore sequencing; it is not affected by the sequence length and type of the complex, and has universality; compared with the related art, it has the advantages of high purification efficiency, short time consumption, low cost, and high practical application value.

[0108] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0109] Embodiments

[0110] The DNA used in the following embodiments is synthesized by Changzhou Xinyichuangyuan Technology Co., Ltd.

[0111] Example 1

[0112] 1.1 Preparation of nucleic acid-polypeptide complex

[0113] The process of preparing the nucleic acid-polypeptide complex is described in the embodiments of the present disclosure.

[0114] (1) DNA1-top, DNA2-top1, and DNA1-bottom1 were annealed in 1x PBS (purchased from Shengong Bioengineering (Shanghai) Co., Ltd., Catalog No.: E607008-0500) at a ratio of 1:1:1.

[0115] (2) After annealing, 1 equivalent of peptide1 (final concentration: 20 μM) was added to the above solution and reacted at room temperature for 24 h, so that the azide on the polypeptide peptide1 was connected to DNA1-top and DNA2-top through click chemistry reaction of modified dibenzocyclooctyne (DBCO) on DNA1-top and DNA2-top, and paired with DNA1-bottom1.

[0116] (3) The nucleic acid-polypeptide complex was obtained.

[0117] The mixture containing the nucleic acid-polypeptide complex obtained in this embodiment includes, but is not limited to, free test molecules, free duplexes, and single-end ligation products, etc.

[0118] 1.2 Purification of nucleic acid-polypeptide complex

[0119] The present disclosure describes a method for purifying nucleic acid-polypeptide complexes from a mixture of nucleic acid-polypeptide complexes. As discussed above, the step of providing a linker can be performed before or after any of the steps, as shown in FIGS. 2-4. The present embodiment is described in detail using the purification scheme shown in FIG. 2.

[0120] (1) Preparation of Y-shaped linker: anneal Y-top linker and Y-bottom linker to obtain annealed product, and then co-incubate with DNA helicase to obtain Y-shaped linker.

[0121] (2) Add Y-shaped linker (2 mM) to the mixture of nucleic acid-polypeptide complexes at a ratio of 2: 1, and use a T4 ligase kit (purchased from New England Biolabs, Inc., Catalog No.: #M2200L) to ligate the nucleic acid-polypeptide complexes to the Y-shaped linker complex to obtain the library to be purified.

[0122] (3) Incubate 10 pL of SA magnetic beads (purchased from Nanjing Novoprotein Biological Sciences Co., Ltd., Catalog No. N512-01) with 20 pmol of Capture DNA at room temperature for 1 h, and then discard the supernatant.

[0123] (4) Wash the magnetic beads in (3) twice with 1x PBS (containing 0.1% Tween) to remove excess free Capture DNA to obtain magnetic beads with capture strands.

[0124] (5) Add 20 pmol of the library to be purified obtained in step (2) to the capture beads obtained in step (4), and incubate at room temperature for 1 h.

[0125] (6) Discard the supernatant, retain the incubated magnetic beads in (5), and wash twice with 1x PBS (0.1% Tween).

[0126] (7) Add 10 pL of 1x NEBuffer (purchased from New England Biolabs, Inc., Catalog No.: #B7001) to resuspend the magnetic beads obtained in (6), and add 0.5 pL of the first reagent Endonuclease V (purchased from New England Biolabs, Inc., Catalog No.: #M0305), and digest at 37°C for 1 h.

[0127] (8) Discard the supernatant, retain the digested magnetic beads in (7), and wash twice with 1x PBS (0.1% Tween).

[0128] (9) Add 10 μL of 1xPBS to resuspend the magnetic beads obtained in (8), and add 0.5 μL of the second reagent RNase A (purchased from New England Biolabs, Inc., Catalog No.: #M0305) for digestion at 30°C for 40 min.

[0129] (10) Discard the magnetic beads and retain the supernatant.

[0130] The second purified product, i.e., the double-end ligation product in a free state, the second nucleic acid and the second segment of the single-end ligation product, and / or the second nucleic acid and the second segment of the single-end ligation product with the to-be-tested molecule connected, is obtained through this embodiment. Among them, only the intact to-be-tested molecule-duplex complex in a free state has a linker and can serve as a purified sequencing library.

[0131] 1.3 Nanopore sequencing of nucleic acid-polypeptide complexes

[0132] The purified sequencing library obtained in 1.2 and the mixture containing the ligation product without being treated by the method for purifying to-be-tested molecule-duplex complex according to the present disclosure are sequenced by a nanopore, respectively, and sequencing data is collected.

[0133] FIG. 9 is a sequencing result diagram of the mixture containing the ligation product without being treated by the method for purifying to-be-tested molecule-duplex complex according to the present disclosure. FIG. 10 is a sequencing result diagram of the second purified product obtained by the method for purifying to-be-tested molecule-duplex complex according to the present disclosure based on the carrier complex capture mode shown in FIG. 8. As can be seen, the sequencing library treated by the method according to the present disclosure has a high proportion of sequencing signals of the target library in nanopore sequencing.

[0134] FIG. 11 is a purification effect diagram of the second purified product treated by the method for purifying to-be-tested molecule-duplex complex according to the present disclosure. As can be seen from FIGS. 10 and 11, in the purification group treated by the method for purifying to-be-tested molecule-duplex complex according to the present disclosure, the proportion of the target product, i.e., the double-end product, is significantly improved.

[0135] Embodiment 2

[0136] 2.1 Preparation of nucleic acid-polypeptide complexes

[0137] The process for preparing nucleic acid-polypeptide complexes is described in the embodiments of the present disclosure, and the specific steps are referred to 1.1 of Embodiment 1, except that DNA1-bottom2 is used here. The specific steps are as follows:

[0138] (1) Anneal DNA1-top, DNA2-top1, and DNA1-bottom2 in a 1:1:1 ratio in 1xPBS (purchased from Shengong Bioengineering (Shanghai) Co., Ltd., Catalog No.: E607008-0500).

[0139] (2) After annealing, 1 equivalent of peptide 1 (final concentration: 20 mM) was added to the above solution and reacted at room temperature for 24 h, so that the azide on the polypeptide peptide 1 was connected to DNA1-top and DNA2-top1 through click chemistry reaction of modified dibenzocyclooctyne (DBCO) on DNA1-top and DNA2-top1, and paired with DNA1-bottom2.

[0140] (3) Obtain nucleic acid-polypeptide complex.

[0141] The mixture containing the nucleic acid-polypeptide complex obtained by the present embodiment includes, but is not limited to, free test molecules, free duplexes, and single-end ligation products, etc.

[0142] 2.2 Purification of nucleic acid-polypeptide complex

[0143] The method for purifying nucleic acid-polypeptide complex from the mixture of nucleic acid-polypeptide complex is described in the present embodiment. As discussed above, the step of providing the linker can be performed before or after any step, as shown in FIGS. 2 to 4. The purification process shown in FIG. 3 is taken as an example for detailed description in the present embodiment.

[0144] (1) Incubate 10 pL of SA magnetic beads (purchased from Nanjing Novozyme Biotech Co., Ltd., product number N512-01) with 20 pmol of Capture DNA at room temperature for 1 h, and then discard the supernatant.

[0145] (2) Wash the magnetic beads in (1) twice with 1xPBS (containing 0.1% Tween) to remove excess free Capture DNA, and obtain magnetic beads with capture chains.

[0146] (3) Add 20 pmol of the nucleic acid-polypeptide complex to be purified obtained in step 1.1 to the capture beads obtained in step (2), and incubate at room temperature for 1 h.

[0147] (4) Discard the supernatant, retain the incubated magnetic beads in (3), and wash twice with 1xPBS (0.1% Tween), and retain the magnetic beads for later use.

[0148] (5) Prepare Y-shaped linker: anneal the linker top strand Y-top and the linker bottom strand Y-bottom to obtain annealing product, and then co-incubate with DNA helicase to obtain Y-shaped linker.

[0149] (6) The Y-shaped adaptor (2 mM) obtained in (5) was added to the magnetic beads obtained in (4) at a ratio of 2: 1, and the nucleic acid-polypeptide complex was connected with the Y-shaped adaptor complex using a T4 ligase kit (purchased from New England Biolabs, Inc., Catalog No.: #M2200L), and incubated at room temperature for 30 min.

[0150] (7) The supernatant was discarded, and the magnetic beads in (6) were retained, and washed twice with 1xPBS (0.1% Tween).

[0151] (8) 10 pL of 1xRNase H Reaction Buffer (purchased from New England Biolabs, Inc., Catalog No.: #B0297S) was added to resuspend the magnetic beads obtained in (6), and 0.5 pL of the first reagent RNase H (purchased from New England Biolabs, Inc., Catalog No.: #M0297S) was added, and the digestion was performed at 37°C for 20 min.

[0152] (9) The supernatant was discarded, and the digested magnetic beads in (8) were retained, and washed twice with 1xPBS (0.1% Tween).

[0153] (10) 10 pL of 1xPBS was added to resuspend the magnetic beads obtained in (8), and 0.5 pL of the second reagent RNase A (purchased from New England Biolabs, Inc., Catalog No.: #M0305) was added, and the digestion was performed at 30°C for 40 min.

[0154] (11) The magnetic beads were discarded, and the supernatant was retained.

[0155] A second purified product, i.e., a double-end ligation product in a free state, a second nucleic acid and a second segment of a single-end ligation product, and / or a second nucleic acid and a second segment of a single-end ligation product to which a to-be-tested molecule is connected, was obtained by the present example. Among them, only the intact to-be-tested molecule-duplex complex in a free state has an adaptor, which can be used as a purified sequencing library.

[0156] 2.3 Nanopore sequencing of nucleic acid-polypeptide complex

[0157] The purified sequencing library obtained in 2.2 was sequenced by a nanopore, and sequencing data was collected.

[0158] FIG. 13 is a sequencing result diagram of a second purified product obtained by a method for purifying a to-be-tested molecule-duplex complex according to an embodiment of the present disclosure based on the carrier complex capture mode shown in FIG. 12. It can be seen that after being treated by the method for purifying a to-be-tested molecule-duplex complex according to an embodiment of the present disclosure, the sequencing signal proportion of the target library in nanopore sequencing is high.

[0159] Figure 14 is a schematic diagram of the purification effect of the second purification product of the method for purifying the test molecule-duplex complex according to an embodiment of the present disclosure. As can be seen from Figures 13 and 14, in the purification group treated by the method for purifying the test molecule-duplex complex according to an embodiment of the present disclosure, the proportion of the target product, i.e., the double-end product, is significantly increased.

[0160] Example 3

[0161] 3.1 Preparation of nucleic acid-polypeptide complex

[0162] The process for preparing the nucleic acid-polypeptide complex is described in the embodiments of the present disclosure, and with reference to step 1.1 of Example 1, except that DNA2-top2 is used here, which is as follows:

[0163] (1) DNA1-top, DNA2-top2, and DNA1-bottom1 are annealed in a 1:1:1 ratio in 1x PBS (purchased from Shengong Bioengineering (Shanghai) Co., Ltd., Catalog No.: E607008-0500).

[0164] (2) After annealing, 1 equivalent of peptide1 (final concentration: 20 mM) is added to the above solution, and the reaction is carried out at room temperature for 24 h, so that the azide on the polypeptide peptide1 is connected to DNA1-top and DNA2-top2 through click chemistry reaction of the modified dibenzocyclooctyne (DBCO) on DNA1-top and DNA2-top2, and is complementary to DNA1-bottom1.

[0165] (3) The nucleic acid-polypeptide complex is obtained.

[0166] The mixture containing the nucleic acid-polypeptide complex obtained by this embodiment includes, but is not limited to, free test molecules, free duplexes, and single-end ligation products, etc.

[0167] 3.2 Purification of nucleic acid-polypeptide complex

[0168] The method for purifying the nucleic acid-polypeptide complex from the mixture of nucleic acid-polypeptide complexes is described in the embodiments of the present disclosure. As discussed above, the step of providing the linker can be performed before or after any step, as shown in Figures 2 to 4. This embodiment is described in detail taking the purification process shown in Figure 2 as an example.

[0169] (1) Preparation of Y-type linker: After annealing the top strand Y-top and the bottom strand Y-bottom of the linker to obtain the annealing product, the annealing product is incubated with DNA helicase to obtain the Y-type linker.

[0170] (2) Add Y-shaped linker (2 mM) to the mixture of nucleic acid-polypeptide complex at a ratio of 2: 1, and use T4 ligase kit (purchased from New England Biolabs Co., Ltd., #M2200L) to ligate the nucleic acid-polypeptide complex with the Y-shaped linker complex to obtain the library to be purified.

[0171] (3) Take 10 pL of SA magnetic beads (purchased from Nanjing Nuo Weizan Biotechnology Co., Ltd., N512-01) and mix with 20 pmol of the library to be purified in step (2), and incubate on a shaker at room temperature for 1 h, then discard the supernatant.

[0172] (4) Wash the magnetic beads in (3) twice with 1xPBS (containing 0.1% Tween) and retain the magnetic beads.

[0173] (5) Add 10 pL of 1xNEBuffer (purchased from New England Biolabs Co., Ltd., #B7001) to resuspend the magnetic beads obtained in (4), and add 0.5 pL of the first reagent Endonuclease V (purchased from New England Biolabs Co., Ltd., #M0305) and digest at 37°C for 1 h.

[0174] (6) Discard the supernatant, retain the digested magnetic beads in (5), and wash twice with 1xPBS (0.1% Tween).

[0175] (7) Add 10 pL of 1xPBS to resuspend the magnetic beads obtained in (66), and add 0.5 pL of the second reagent RNase A (purchased from New England Biolabs Co., Ltd., #M0305) and digest at 30°C for 40 min.

[0176] (8) Discard the magnetic beads and retain the supernatant.

[0177] The second purified product, i.e., the double-end ligation product in a free state, the second nucleic acid and the second segment of the single-end ligation product, and / or the second nucleic acid and the second segment of the single-end ligation product with the to-be-tested molecule connected, is obtained by this embodiment. Among them, only the complete to-be-tested molecule-duplex complex in a free state has a linker and can be used as a purified sequencing library.

[0178] 3.3 Nanopore sequencing of nucleic acid-polypeptide complex

[0179] The purified sequencing library obtained in 3.2 is sequenced using a nanopore, and sequencing data is collected.

[0180] FIG. 16 is a sequencing result plot of a second purification product obtained by a method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure based on the carrier complex capture mode shown in FIG. 15. As can be seen, after the method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure, the sequencing signal of the target library in nanopore sequencing accounts for a high proportion.

[0181] FIG. 17 is a schematic diagram of the purification effect of a second purification product processed by the method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure. As can be seen from FIGS. 16 and 17, in the purification group processed by the method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure, the proportion of the target product, i.e., the double-end product, is significantly improved.

[0182] In summary, the method for purifying a test molecule-duplex complex according to an embodiment of the present disclosure can effectively remove the by-products generated in the preparation process of the “polypeptide-nucleic acid” complex, so as to achieve the purpose of purifying and enriching the library, thereby improving the sequencing proportion of the effective library in nanopore sequencing; it is not affected by the sequence length and type of the complex, and has universality; compared with the related art, it has the advantages of high purification efficiency, short time consumption, low cost, and high practical application value.

[0183] In the description of the present disclosure, it should be understood that the terms “center”, “longitudinal”, “transverse”, “length”, “width”, “thickness”, “upper”, “lower”, “front”, “rear”, “left”, “right”, “vertical”, “horizontal”, “top”, “bottom”, “inner”, “outer”, “clockwise”, “counterclockwise”, “axial”, “radial”, “circumferential” and the like indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, and are only for the purpose of facilitating the description of the present disclosure and simplifying the description, and therefore cannot be understood as indicating or implying that the devices or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore cannot be understood as limiting the present disclosure.

[0184] In addition, the terms “first” and “second” are only for descriptive purposes and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the technical features indicated. Therefore, the features defined with “first” and “second” can explicitly or implicitly include at least one of the features. In the description of the present disclosure, the meaning of “a plurality of” is at least two, such as two, three, etc., unless otherwise explicitly and specifically limited.

[0185] In the present disclosure, unless specifically defined otherwise, the terms "mount", "connected", "connecting", "fixed", and the like, should be understood broadly, for example, can be fixed connection, can be detachable connection, or integral; can be mechanical connection, can be electrical connection or communication with each other; can be directly connected, or indirectly connected through an intermediate medium, can be the internal communication of two elements or the interaction relationship between two elements, unless otherwise specifically defined. For those skilled in the art, the specific meaning of the above terms in the present disclosure can be understood according to the specific circumstances.

[0186] In the present disclosure, unless specifically defined otherwise, the first feature is "on" or "under" the second feature can be that the first and second features are in direct contact, or the first and second features are in indirect contact through an intermediate medium. Moreover, the first feature "above", "over" and "on" the second feature can be that the first feature is directly above or obliquely above the second feature, or only indicates that the horizontal height of the first feature is higher than that of the second feature. The first feature "below", "under" and "under" the second feature can be that the first feature is directly below or obliquely below the second feature, or only indicates that the horizontal height of the first feature is less than that of the second feature.

[0187] In the present disclosure, the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" and the like mean that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present disclosure. In the present specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, those skilled in the art can combine and combine different embodiments or features of different embodiments or examples described in the present specification without contradiction.

[0188] Although the embodiments of the present disclosure have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limiting the present disclosure, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present disclosure.

Claims

1. A method for purifying a molecule-double-stranded complex of an analyte, characterized in that, The method includes: Step a. Provide a mixture containing the linkage product. The ligation product comprises the test molecule and a double strand. The double-stranded compound comprises a template molecule, a first nucleic acid, and a second nucleic acid. At least a portion of the first nucleic acid is complementary to a first segment of the template molecule, and at least a portion of the second nucleic acid is complementary to a second segment of the template molecule. The template molecule has a first site. Step b. Capture the ligation product and, optionally, the unligated duplex of the test molecule in the mixture by at least one of the carrier and the carrier complex, wherein the carrier complex comprises a third nucleic acid and the carrier; Step c. Cleavage the first site in the ligation product and optionally the unligated duplex of the analyte using the first reagent to obtain a first purified product; and Step d. Cut the second site in the first purified product with the second reagent to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid, and the second segment of the template molecule has the second site.

2. The purification method according to claim 1, characterized in that, The molecule to be tested includes polypeptides, DNA, RNA, or polymers, preferably, the polymer includes polysaccharides or polyethylene glycol.

3. The purification method according to claim 1 or 2, characterized in that, The first site is located in the first segment or the second segment of the template molecule, or between the first segment and the second segment of the template molecule.

4. The purification method according to any one of claims 1 to 3, characterized in that, The first site and the second site are each independently selected from at least one of the following: AP site, endonuclease recognition site, restriction endonuclease recognition site, and cleavable chemical bond; The first reagent is capable of specifically recognizing and cleaving the first site. Preferably, the first reagent includes RNase enzyme, endonuclease, restriction endonuclease, light, heat, electromagnetic radiation, or other reagents that break the chemical bond. The second reagent is capable of specifically recognizing and cleaving the second site. Preferably, the second reagent includes RNase enzyme, endonuclease, restriction endonuclease, light, heat, electromagnetic radiation, or other reagents that break the chemical bond.

5. The purification method according to any one of claims 1 to 4, characterized in that, The connection products include double-ended connection products and single-ended connection products. The test molecule is simultaneously linked to both the first nucleic acid and the second nucleic acid to form the dual-terminal linkage product. The test molecule is respectively linked with the first nucleic acid or the second nucleic acid to form the single-end ligation product.

6. The purification method according to any one of claims 1 to 5, characterized in that, The analyte is linked to the first nucleic acid and / or the second nucleic acid via a coupling reaction. Preferably, the coupling reaction includes a reaction of at least one group of the following functional groups: amine with aryl azide, amine with hydroxymethylphosphine, amine with imine ester, amine with NHS ester, amine with PFP ester, amine or carboxyl with carbodiimide, carbohydrate with acyl hydrazine, hydroxy with isocyanate, carbonyl with hydrazine, mercapto with maleimide or pyridyl disulfide, mercaptoamine or hydroxy with vinyl sulfone or vinyl sulfonamide, and azide with alkyne, preferably azide with dibenzocyclooctyne.

7. The purification method according to any one of claims 1 to 6, characterized in that, The carrier complex is formed by capturing the ligation product and optionally the double strand via the carrier complex, wherein the carrier of the carrier complex has a first modification, the third nucleic acid has a second modification and a second site, and the carrier and the third nucleic acid react between the first modification and the second modification to form the carrier complex. At least a portion of the third nucleic acid is complementary to a portion of the second nucleic acid; or at least a portion of the third nucleic acid is complementary to a portion of the second segment of the template molecule. Optionally, the first modification and the second modification are each independently selected from one of amino, carboxyl, hydroxyl, carbonyl, azide, alkyne, biotin, streptavidin, amylose, Ni-NTA, peptide and antigen. Preferably, the carrier and the third nucleic acid are reacted by biotin and streptavidin to form the carrier complex. Optionally, the carrier is at least one of the following: magnetic beads, magnetic sheets, gold nanoparticles, silicon particles, and gel particles; preferably, the carrier is magnetic beads.

8. The purification method according to any one of claims 1 to 7, characterized in that, Based on the capture of the ligation product and optionally the double strand via the vector, wherein the vector has a first modification and the second nucleic acid has a third modification or the second segment has a fourth modification, The vector and the second nucleic acid are linked through a reaction between the first modification and the third modification, and the second nucleic acid has the second site; or The carrier and the second segment of the template molecule are linked through a reaction between the first modification and the fourth modification, and the second segment of the template molecule has the second site. Optionally, the first modification, the third modification, and the fourth modification are each independently selected from one of the following groups: amino, carboxyl, hydroxyl, carbonyl, azide, alkyne, biotin, streptavidin, amylose, Ni-NTA, peptide, and antigen. Preferably, the vector is linked to the second nucleic acid via biotin and streptavidin; Preferably, the carrier and the second segment are connected by biotin and streptavidin; Optionally, the carrier is at least one of the following: magnetic beads, magnetic sheets, gold nanoparticles, silicon particles, and gel particles, preferably, the carrier is magnetic beads.

9. The purification method according to any one of claims 1 to 8, characterized in that, The method also includes one of the following: A connector is provided prior to step b to allow the connector to specifically connect to the connection product; A connector is provided between steps b and c to allow the connector to specifically connect to the connection product; A connector is provided between step c and step d to allow the connector to specifically connect to the first purified product; and Following step d, a connector is provided to specifically link to the second purified product. Optionally, the connector is one or more of a Y-type connector and a bubble connector.

10. A library construction method, characterized in that, include: The method according to claim 9 yields a second purified product with a connector, wherein the second purified product with a connector is a target dual-end linked product library, preferably, the connector is one or more of a Y-type connector and a vesicular connector.

11. A sequencing method, characterized in that, The method includes: The method according to claim 9 yields a second purified product having a linker; and The second purified product with the adapter was sequenced; Optionally, the sequencing is third-generation sequencing, and preferably, the third-generation sequencing is nanopore sequencing. Preferably, the connector is one or more of a Y-type connector and a bubble connector.

12. A kit for purifying a molecule-double-stranded complex of an analyte, characterized in that, The kit includes a carrier and / or a carrier complex, a first reagent, and a second reagent. The carrier and / or carrier complex is used to capture the ligation product and optionally unligated duplex of the test molecule in the mixture. The ligation product comprises the test molecule and the duplex, the duplex comprising a template molecule, a first nucleic acid, and a second nucleic acid. At least a portion of the first nucleic acid is complementary to a first segment of the template molecule, and at least a portion of the second nucleic acid is complementary to a second segment of the template molecule. The template molecule has a first site. The first reagent is used to cleave the first site of the ligation product and optionally the unligated duplex of the analyte molecule to obtain a first purified product. The second reagent is used to cleave the second site in the first purified product to obtain a second purified product, wherein at least one of the third nucleic acid, the second nucleic acid, and the second segment of the template molecule has the second site.

13. The reagent kit according to claim 12, characterized in that, The kit also includes a connector for specifically connecting to the ligation product, the first purified product, or the second purified product; Optionally, the carrier is at least one of the following: magnetic beads, magnetic sheets, gold nanoparticles, silicon particles, and gel particles; preferably, the carrier is magnetic beads. Optionally, the vector complex comprises a third nucleic acid and the vector; Optionally, the carrier of the carrier complex has a first modification, the third nucleic acid has a second modification and a second site, and the carrier and the third nucleic acid react between the first modification and the second modification to form the carrier complex; Optionally, at least a portion of the third nucleic acid is complementary to a portion of the second nucleic acid; or at least a portion of the third nucleic acid is complementary to a portion of the second segment of the template molecule. Optionally, the first modification and the second modification are each independently selected from one of amino, carboxyl, hydroxyl, carbonyl, azide, alkyne, biotin, streptavidin, amylose, Ni-NTA, peptide and antigen; Optionally, the first site and the second site are each independently selected from at least one of the following: AP site, endonuclease recognition site, restriction endonuclease recognition site, and cleavable chemical bond; The first reagent is capable of specifically recognizing and cleaving the first site. Preferably, the first reagent includes RNase enzyme, endonuclease, restriction endonuclease, light, heat, electromagnetic radiation, or other reagents that break the chemical bond. The second reagent is capable of specifically recognizing and cleaving the second site. Preferably, the second reagent includes RNase enzyme, endonuclease, restriction endonuclease, light, heat, electromagnetic radiation, or other reagents that break the chemical bond.

Images