Recombinant oncolytic virus and use thereof

By inserting exogenous genes and knocking out genes into pseudorabies virus, combined with immune checkpoint inhibitors, the developed recombinant oncolytic virus has solved the problems of antiviral immune limitation and selective infection of existing oncolytic viruses in humans, achieving highly efficient killing of tumor cells and immune activation, and significantly prolonging the survival of mice.

WO2025260921A1PCT designated stage Publication Date: 2025-12-26SUZHOU RUIKANG TAI BIOTECHNOLOGY CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/088400
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-19
Filing Date
2025-04-11
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Existing oncolytic virus therapies have limitations in their application in the human body, including limitations in antiviral immunity, difficulty in controlling injection dosage and frequency, and a lack of selective infection of normal tissue cells, resulting in limited clinical efficacy.

Method used

To develop a recombinant oncolytic virus that enhances the replication efficiency, killing power, and immune response of tumor cells by inserting exogenous genes, particularly gene knockout and fusion proteins such as PRV-ΔTK/US3-RFP and PRV-ΔTK/EP0-RFP, into the pseudorabies virus genome, and to improve the targeting and safety of tumor therapy by combining it with immune checkpoint blockers such as PD-L1 and CTLA-4 inhibitors.

Benefits of technology

It significantly enhanced the killing effect on tumor cells and the immune response, improved the effectiveness and safety of tumor treatment, prolonged the survival of mice, and demonstrated significant tumor suppression and immune activation in a melanoma model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025088400_26122025_PF_FP_ABST
    Figure CN2025088400_26122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention pertains to the technical field of biology and specifically relates to a recombinant oncolytic virus and use thereof. With a TK gene single-deletion virus strain as a backbone and the US3 and EP0 genes as "platforms", the recombinant oncolytic virus is obtained by inserting an immunomodulatory cytokine gene. Compared with the wild-type pseudorabies virus, the modified pseudorabies virus has enhanced replication efficiency in human tumor cells, an improved ability to induce pathological changes in human tumor cells, an improved ability to kill human tumor cells, and an enhanced ability to induce innate immune responses. The recombinant oncolytic virus can be used as a single agent or in combination with other anticancer drugs to enable the combined application of tumor immunotherapy. The present invention provides a wider field of view, more possibilities, and new hopes for tumor treatment, and also provides more effective and safer treatment options for patients.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant oncolytic virus and application thereof TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a recombinant oncolytic virus and application thereof. BACKGROUND

[0002] Oncolytic virus (OV) represents a new type of therapeutic agent, which is characterized by preferentially infecting tumor cells, leading to the destruction of infected cells and inducing systemic anti-tumor immunity. These viruses have a unique ability to efficiently enter cells, and once they enter cells, they will perform gene expression and replication, usually leading to the death of infected cells. With cell death, the released antigen components include components derived from host cells and viruses themselves or inserted exogenous components. Therefore, the cell death mediated by viral infection of tumor cells often releases tumor neoantigens, thereby inducing an anti-tumor immune response. Due to the damage of tumor cells, the local inflammatory response is enhanced, which changes the tumor microenvironment, and these immune responses can also trigger systemic anti-tumor immune responses. Therefore, oncolytic viruses not only have the effect of directly lysing tumor cells, but also can induce immune responses against tumor neoantigens and change the tumor microenvironment.

[0003] Currently, various viruses are being developed as oncolytic viruses, including adenovirus, herpes virus, vaccine virus, Newcastle disease virus (NDV), and measles virus. Among them, Talimogene laherparepvec (T-VEC) is the first oncolytic virus approved by FDA, which is developed from herpes simplex virus type 1 (HSV-1). Herpes virus has many advantages as an oncolytic virus, including strong coding ability, high viral titer, rich molecular virology research data, and the ability to re-infect the host multiple times. Pseudorabies virus (PRV) is a porcine pathogen, belonging to the subfamily of alpha-herpesvirinae and the genus of varicellovirus. Although pigs are the natural host and reservoir of PRV, the virus can also infect many other mammals, including carnivores, rodents and ruminants. PRV has a double-stranded genomic DNA of about 143 kb, at least 72 genes, including virulence-related genes and many non-essential genes. Due to the large genome of PRV, it can insert exogenous genes, thus making it a valuable vector for expressing different exogenous proteins.

[0004] The thymidine kinase UL23 (TK) gene is one of the major virulence genes of PRV and is also a non-essential gene of PRV, which encodes 320 amino acids (Kit, S., Kit, M., and Pirtle, E. C. (1985) Attenuated properties of thymidine kinase-negative deletion mutant of pseudorabies virus. Am J Vet Res. 46, 1359-1367). TK is essential for PRV to produce infectious virus particles in non-dividing cells. When TK is deleted, PRV can specifically infect and kill rapidly replicating malignant tumor cells without damaging normal cells, which can significantly improve the targeting of tumor treatment. Animal experiment results show that TK-deleted PRV mutants are highly attenuated in mice, rabbits and pigs (McGregor, S., Easterday, B. C., Kaplan, A. S., and Ben-Porat, T. (1985) Vaccination of swine with thymidine kinase-deficient mutants of pseudorabies virus. Am J Vet Res. 46, 1494-1497.). In some OV, the deletion of this gene leads to an increase in tumor selectivity and solves the problem of uncontrolled replication in non-target tissues (Cho, E., Ryu, E. J., Jiang, F., Jeon, U. B., Cho, M., Kim, C. H. et al. (2018) Preclinical safety evaluation of hepatic arterial infusion of oncolytic poxvirus. Drug Des Devel Ther. 12, 2467-2474.). The serine / threonine kinase US3 gene is a non-essential gene of PRV, which can affect the host immune response through multiple mechanisms. Knocking out the US3 gene can inhibit the immune escape of the virus and improve the host's killing of infected cells. In addition, US3 is also involved in inhibiting apoptosis and can regulate the phosphorylation level of UL50.Studies have shown that Bartha K61 strain has higher safety compared to other PRV strains (HB98 and DCD-1 strains) (Lin, W., Shao, Y., Tan, C., Shen, Y., Zhang, X., Xiao, J. et al. (2019) Commercial vaccine against pseudorabies virus: A hidden health risk for dogs. Vet Microbiol. 233, 102-112.), which has a longer latency time and a lower replication rate, but the commercial vaccine Bartha K61 is not completely safe for dogs. It has been reported that after US3 deletion, it is highly attenuated for dogs (Yin, H., Li, Z., Zhang, J., Huang, J., Kang, H., Tian, J. et al. (2020) Construction of a US7 / US8 / UL23 / US3-deleted recombinant pseudorabies virus and evaluation of its pathogenicity in dogs. Vet Microbiol. 240, 108543.). Compared with rPRV-ΔUS7 / US8 / UL23 virus, rPRV-ΔUS7 / US8 / UL23 / US3 has significantly reduced virulence in dogs. The PRV EP0 (Early Protein0) gene is an early gene that regulates the transcription of the PRV genome. EP0 is a non-essential virulence gene, and its deletion leads to a decrease in the virulence of PRV, as well as a decrease in viral titer and plaque size. CN116144607A discloses a oncolytic virus and its application, the oncolytic virus is a mutant herpes virus obtained by inactivating the US3 gene and / or TK gene in the wild-type herpes virus genome, which is non-pathogenic to humans, can replicate in human tumor cells or tumor cell lines, but not in human normal cells or cell lines. Compared with wild-type herpes virus, the modified mutant herpes virus has enhanced replication efficiency in human tumor cells, improved ability to induce cytopathic effects in human tumor cells, increased killing power for human tumor cells, and enhanced ability to induce innate immune response; it can serve as an effective active ingredient for lysing tumor cells, as well as an expression vector and / or delivery vector for tumor treatment active molecules. However, as a viral therapy, OV has obvious defects compared to other immunotherapies: first, the human body's anti-viral immune response will limit the effectiveness of OV, so the injection dose, timing, and frequency of OV need to be strictly considered; second, although OV has shown a high degree of selective infection, there is no strong clinical trial data to prove that it will not be expressed in normal tissue cells.Therefore, it is very important to induce oncolytic cell-specific invasion of cancer cells, which is the reason why most oncolytic viruses have been locally injected into tumors in clinical practice.

[0005] Tumor immunotherapy is a treatment method that enhances the immune system to fight cancer. Well-studied checkpoint proteins include PD-1, PD-L1, and CTLA-4, which act by blocking inhibitory receptors on T cells to enhance immunity to kill cancer cells. Although immune checkpoint inhibition (ICI) has achieved some success, only about 10%–40% of certain tumor patients can benefit from checkpoint blockade therapy due to limited immune cell infiltration and immunosuppressive tumor microenvironment. To overcome this challenge, various combination strategies have been developed. Oncolytic virus immunotherapy combined with immune checkpoint blockade can produce additive or synergistic therapeutic effects in tumor treatment. The purpose of immune checkpoint blockade is to block the body's immune suppression mechanisms, which enhance the body's immune response to tumors in cancer patients and improve drug efficacy. Therefore, immune checkpoint blockade or stimulation of immune enhancement pathways (immune agonists) has great potential for the development of cancer treatment methods. Such drugs that have been approved or are undergoing animal experiments and clinical trials include CTLA-4, PD-1, PD-L1, LAG-3, TIM-3, VISTA, CSF1R, IDO, CEACAM1, GITR, 4-1-BB, KIR, SLAMF7, OX40, CD40, ICOS, or CD47, etc. Although ICI, especially PD-1 inhibitors, have made breakthrough progress in tumor treatment, single-agent therapy with ICI still fails to achieve the desired expectations, and even the best drug-responsive patients have a total remission rate that is difficult to break through 35%–40% (Sivanandam V, LaRocca CJ, Chen NG, Fong Y, Warner SG. Oncolytic viruses and immune checkpoint inhibition: the best of both worlds [J]. Molecular Therapy-Oncolytics, 2019, 13:93-106.). SUMMARY

[0006] In view of the defects in the prior art described above, the purpose of the present application is to provide an engineered oncolytic virus expressing at least one fusion protein blocking the immune co-inhibitory pathway and enhancing the immune co-stimulatory pathway. This oncolytic virus can be used as a single agent and can be used in combination with other anticancer drugs, including chemotherapy, targeted drug therapy, radiotherapy, immune checkpoint blockade, and / or immune-enhancing drugs, providing a broader perspective, more possibilities, and new hope for tumor treatment, and also providing more effective and safer treatment options for patients.

[0007] In a first aspect, the present application provides a recombinant oncolytic virus obtained by inserting an exogenous gene into a modified viral genome, said recombinant oncolytic virus having an improved or enhanced effect on at least one of the following properties compared to a wild-type virus:

[0008] A. replication efficiency in human tumor cells;

[0009] B. ability to cause cytopathic effect in human tumor cells;

[0010] C. killing power on human tumor cells;

[0011] D. ability to induce innate immune response;

[0012] E. safety to the host.

[0013] Further, the virus comprises a wild-type virus or an attenuated vaccine strain virus derived from a pig.

[0014] Preferably, the virus is a porcine herpesvirus type 1 (SHV-1), also known as pseudorabies virus (PRV).

[0015] Further, the modified virus strain is selected from one or more of a gene knockout strain and / or a fusion protein.

[0016] Further, the gene knockout strain is selected from one or more of a rPRV-ΔTK, a rPRV-ΔEP0, a rPRV-ΔUS3, a rPRV-ΔUL50, a rPRV-ΔgD, a rPRV-ΔgE, and / or a rPRV-ΔgI gene knockout strain.

[0017] Further, the fusion protein is selected from one or more of a PRV-ΔTK / US3-RFP and / or a PRV-ΔTK / EP0-RFP fusion protein.

[0018] Further, the exogenous gene inserted into the recombinant oncolytic virus is selected from one or more of an exogenous GM-CSF-encoding gene, an exogenous IL-2-encoding gene, an exogenous IL-12-encoding gene, an exogenous IL-15-encoding gene, an exogenous IL-18-encoding gene, an exogenous IL-21-encoding gene, an exogenous IFN-γ-encoding gene, an exogenous OX40-encoding gene, an exogenous PD-L1 inhibitor-encoding gene, an exogenous PD-1 inhibitor-encoding gene, and / or an exogenous CTLA-4 inhibitor-encoding gene.

[0019] Further, the PD-L1, PD-1, and CTLA-4 inhibitors are PD-L1, PD-1, and CTLA-4 antibodies or fragments thereof.

[0020] Further, the tumor includes, but is not limited to, melanoma, non-small cell lung cancer, small cell lung cancer, lung adenocarcinoma, esophageal cancer, liver cancer, gastric cancer, kidney cancer, bladder cancer, head and neck tumor, Hodgkin's lymphoma, cervical cancer, breast cancer, colorectal cancer, colon cancer, nasopharyngeal cancer, ovarian cancer, prostate cancer, endometrial cancer, glioma, neuroendocrine tumor, malignant mesothelioma, non-Hodgkin's lymphoma, Merkel cell carcinoma, and all microsatellite instability-high (MSI-H) solid tumors.

[0021] In a second aspect, the present application provides a pharmaceutical composition comprising the recombinant oncolytic virus of the first aspect of the present application and another anticancer drug, which has the effect of improving or enhancing at least one of the following properties:

[0022] A. replication efficiency in human tumor cells;

[0023] B. ability to cause cytopathic effect in human tumor cells;

[0024] C. killing power on human tumor cells;

[0025] D. ability to induce innate immune response;

[0026] E. safety to the host.

[0027] Further, the another anticancer drug includes traditional cytotoxic drugs, molecular targeted drugs, anti-tumor biological drugs, and other drugs with anticancer effects.

[0028] Further, the traditional cytotoxic drugs include one or more of cisplatin, paclitaxel, 5-fluorouracil, cyclophosphamide, and / or bendamustine.

[0029] Further, the molecular targeted drugs include one or more of imatinib mesylate, gefitinib, anlotinib, rituximab, and / or trastuzumab.

[0030] Further, the anti-tumor biological drugs include cell-derived macromolecular targeted drugs and fermentation-produced anti-tumor antibiotics.

[0031] Further, the other drugs with anticancer effects include one or more of glucocorticoids, plant and animal extracts with anti-tumor activity, and chimeric antigen receptor T lymphocytes.

[0032] Further, the pharmaceutical composition can further comprise the recombinant oncolytic virus of the first aspect of the present application and a pharmaceutically acceptable carrier or diluent.

[0033] Further, the tumor includes, but is not limited to, melanoma, non-small cell lung cancer, small cell lung cancer, lung adenocarcinoma, esophageal cancer, liver cancer, gastric cancer, kidney cancer, bladder cancer, head and neck tumor, Hodgkin's lymphoma, cervical cancer, breast cancer, colorectal cancer, colon cancer, nasopharyngeal cancer, ovarian cancer, prostate cancer, endometrial cancer, glioma, neuroendocrine tumor, malignant mesothelioma, non-Hodgkin's lymphoma, Merkel cell carcinoma, and all microsatellite instability-high (MSI-H) solid tumors.

[0034] In a third aspect, the present application provides a product comprising the recombinant oncolytic virus of the first aspect of the present application.

[0035] Further, the product can be preserved in a sterile vial, ampoule or syringe.

[0036] In a fourth aspect, the present application provides a method of enhancing the replication efficiency of pseudorabies virus in human tumor cells, the ability to cause cytopathic effect in human tumor cells, the killing power of human tumor cells, the ability to induce innate immune response and / or the safety of the host, comprising inserting an exogenous gene in the genome of a modified pseudorabies virus.

[0037] Further, the modified virus strain is selected from one or more of a gene knockout strain and / or a fusion protein.

[0038] Further, the gene knockout strain is selected from one or more of rPRV-ΔTK, rPRV-ΔEP0, rPRV-ΔUS3, rPRV-ΔUL50, rPRV-ΔgD, rPRV-ΔgE and / or rPRV-ΔgI gene knockout strain.

[0039] Further, the fusion protein is selected from one or more of PRV-ΔTK / US3-RFP and / or PRV-ΔTK / EP0-RFP fusion protein.

[0040] Further, the exogenous gene is selected from one or more of an exogenous GM-CSF-encoding gene, an exogenous IL-2-encoding gene, an exogenous IL-12-encoding gene, an exogenous IL-15-encoding gene, an exogenous IL-18-encoding gene, an exogenous IL-21-encoding gene, an exogenous IFN-γ-encoding gene, an exogenous OX40-encoding gene, an exogenous PD-L1 inhibitor-encoding gene, an exogenous PD-1 inhibitor-encoding gene and / or an exogenous CTLA-4 inhibitor-encoding gene.

[0041] Further, the PD-L1, PD-1 and CTLA-4 inhibitors are PD-L1, PD-1 and CTLA-4 antibodies or fragments thereof.

[0042] Fifthly, the present invention provides the application of recombinant oncolytic virus in the preparation of tumor therapeutic drugs, wherein the recombinant oncolytic virus has at least one of the following functions:

[0043] A. As an effective active ingredient for lysing tumor cells and inhibiting tumor growth;

[0044] B. As an expression vector and / or targeted delivery vector for tumor therapeutic active molecules;

[0045] C. As an immune enhancer, it is used to enhance the innate immune response.

[0046] Furthermore, the tumors include, but are not limited to, melanoma, non-small cell lung cancer, small cell lung cancer, lung adenocarcinoma, esophageal cancer, liver cancer, gastric cancer, kidney cancer, bladder cancer, head and neck tumors, Hodgkin lymphoma, cervical cancer, breast cancer, colorectal cancer, colon cancer, nasopharyngeal carcinoma, ovarian cancer, prostate cancer, endometrial cancer, glioma, neuroendocrine tumors, malignant mesothelioma, non-Hodgkin lymphoma, Merkel cell carcinoma, and all microsatellite highly unstable (MSI-H) solid tumors. Beneficial effects

[0047] 1. The PRV-ΔTK / US3 and PRV-ΔTK / EP0 in this invention can infect and lyse various types of tumor cells under in vitro conditions, thereby inhibiting tumor growth.

[0048] 2. In this invention, the deletion of the TK gene can significantly weaken the virulence of the PRV Bartha K61 strain, and PRV-ΔTK / US3 has relatively high safety in immunocompetent mice.

[0049] 3. This invention found that PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15 recombinant oncolytic viruses all maintained their killing effect when infecting tumor cells, and the differences in their killing ability against tumor cells were not significant. This demonstrates the stability and effectiveness of recombinant oncolytic viruses in infecting tumor cells.

[0050] 4. The PRV-RFP, PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15 recombinant viruses in this invention can reduce the tumor growth rate in mice; PRV has a good oncolytic effect in a mouse skin melanoma model. Furthermore, PRV-miPD-L1 / IL-15 exhibits the best tumor-suppressing effect in the melanoma model, followed by PRV-miPD-L1 and PRV-IL-15.

[0051] 5. The PRV-RFP, PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15 recombinant viruses in this invention can prolong the survival of mice infected with cutaneous melanoma. Among them, PRV-miPD-L1 / IL-15 showed the most significant effect on prolonging the survival of mice. At the end of the observation period, one mouse was still alive, its tumor had completely regressed, and no recurrence occurred in the following 30 days. This further demonstrates that PRV-miPD-L1 / IL-15 has a good tumor-suppressing effect on B16-F10 melanoma.

[0052] 6. In this invention, PRV, as an oncolytic virus, can better activate local tumor immunity. Attached Figure Description

[0053] Figure 1 shows the screening of PRV Bartha K61 single-deficient virus. (A) Workflow of B16-F10 melanoma model and oncolytic virus treatment. (B) Changes in tumor volume of B16-F10 mice. (C) Overall survival of tumor-bearing mice.

[0054] Figure 2 shows the lesions in PK15 cells after infection with TK / US3 gene knockout pseudorabies virus. Note: Red arrows indicate diseased cells, and green arrows indicate healthy cells.

[0055] Figure 3 shows the construction of the TK / US3 double gene deletion recombinant virus. (A) Schematic diagram of the recombinant pseudorabies virus (PRV) vector with TK and US3 deletion. (B) PCR identification of TK and US3 gene knockout. (C) Western blot detection of TK and US3 protein expression after cell infection by recombinant virus.

[0056] Figure 4 shows the in vitro inhibitory effect of PRV-ΔTK / US3 on different tumor cells. Note: Ns, nonsignificant; *, P<0.05; **, P<0.01; ***, P<0.001; ****, P<0.0001. The same applies below.

[0057] Figure 5 shows the survival curves of mice infected with different viral strains.

[0058] Figure 6 shows the construction of recombinant oncolytic PRV (PRV-miPD-L1 / IL-15) carrying miPD-L1 and hetIL-15. A. Schematic diagram of PRV vector; V, PRV serine / threonine kinase US3 gene; R and L, right and left sequences; RFP, red fluorescent protein; B. PCR detection of exogenous gene insertion; C. Expression of miPDL1 gene in tumor cells infected with recombinant virus; D. Expression of hetIL-15 gene in tumor cells infected with recombinant virus; E. Levels of miPDL1 and IL-15 proteins in PK15 cells infected with recombinant virus at different time points.

[0059] Figure 7 shows the in vitro tumor-suppressing effect of recombinant oncolytic virus.

[0060] Figure 8 shows how recombinant oncolytic virus inhibits B16-F10 tumor growth and prolongs mouse survival. (A) Flowchart of recording mouse B16-F10 melanoma volume and survival; (B) Changes in mouse B16-F10 tumor volume; (C) Survival curve analysis of tumor-bearing mice after oncolytic virus treatment.

[0061] Figure 9 shows the expression of TK and EPO proteins in cells after infection with the recombinant virus, as detected by Western blotting.

[0062] Figure 10 shows the infection and killing effects of rPRV-RFP on mouse and canine tumor cells.

[0063] Figure 11 shows the effect of exogenous gene insertion on viral replication.

[0064] Figure 12 shows the in vivo tumor-suppressing effect evaluation of recombinant oncolytic virus. (A) B16-F10 melanoma model and workflow of oncolytic virus treatment; (B) Changes in tumor volume of B16-F10 mice; (C) Survival curve analysis of tumor-bearing mice after oncolytic virus treatment.

[0065] Figure 13 shows the histopathological examination of tumor tissue from mice treated with PRV. Note: Red arrows indicate localized necrosis of tumor cells; green arrows indicate infiltration of tumor tissue by inflammatory cells. Detailed Implementation

[0066] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0067] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0068] Terminology Explanation

[0069] PD-1: Programmed cell death 1 is a transmembrane protein encoded by the PDCD1 gene. It is an important immunosuppressive molecule in the leukocyte differentiation antigen 28 (CD28) superfamily. As a negative regulator of the immune system, it is mainly expressed on the surface of activated T lymphocytes, B lymphocytes and macrophages.

[0070] PD-L1: The ligand programmed cell death 1 ligand 1 is the ligand of PD-1, a 40kD transmembrane protein encoded by the CD274 gene. When PD-L1 binds to PD-1 on the surface of activated T lymphocytes, it can negatively regulate T cell activity, reducing the body's ability to clear tumor cells and facilitating tumor cell immune escape. It is highly expressed in non-small cell lung cancer, melanoma, and ovarian cancer.

[0071] IL-15: Interleukin-15 is a T-cell growth factor. Mature human IL-15 is a 14-15 kDa glycoprotein and a member of the four α-helical bundle families of cytokines. IL-15 is one of the most promising cytokines in cancer immunotherapy. It is an innate anti-tumor active factor independent of natural killer (NK) cells and CD8+ T cells and is also a key factor in NK cell proliferation and activation.

[0072] Immune checkpoint inhibition (ICI): The principle of ICI is to inhibit immune checkpoints, thereby relieving the tumor's suppressive effect on the immune system, restoring the immune function of T cells, and activating T cells to kill tumor cells. It mainly includes anti-CTLA-4 antibodies, anti-PD-1 antibodies, and anti-PD-L1 antibodies.

[0073] Multiplicity of infection (MOI): MOI = virus / cell. The higher the MOI, the higher the number of viruses integrated into the chromosome and the higher the expression level of the target protein.

[0074] Example 1: Screening based on PRV Bartha K61 single-deficiency virus

[0075] In the early stages, the laboratory successfully constructed single-deficient recombinant viruses rPRV-ΔTK, rPRV-ΔUS3, and rPRV-ΔUL50, and tested the safety of the viruses after deletion of each virulence gene in mice by monitoring tumor growth and survival rate in a C57 / 6J B16-F10 mouse melanoma model.

[0076] When the average tumor volume in the C57 / 6J B16-F10 mouse melanoma model reaches 50-100 mm... 3 All mice were randomly divided into five experimental groups, with three mice in each group. Mice in each group received unilateral intratumoral injections of PRV Bartha K61, rPRV-ΔTK, rPRV-ΔUS3, and rPRV-ΔUL50 single-gene deletion strains, respectively, at a dose of 1 × 10⁻⁶. 7 PFU (100 μl) was administered as a control with an equal volume of DMEM. Three treatments were given, with each treatment spaced one day apart (Figure 1A). Mouse weight was recorded, and a weight change curve was plotted to assess the mice's health and the potential for toxic side effects from continued administration. Tumor size was recorded from the first treatment, and data were compiled to plot a tumor volume growth curve to evaluate the inhibitory effect of the recombinant oncolytic virus on tumors. The observation period was 40 days, starting from the first treatment (day 0), and continuing until the tumor volume reached 2500 mm². 3 The mice were humanely euthanized, and the time of death for each group of mice was recorded. The survival curves of the mice were plotted to evaluate the impact of the recombinant virus on the survival of tumor-bearing mice.

[0077] The results showed that PRV inhibited tumor growth, with rPRV-ΔTK and rPRV-ΔUS3 strains exhibiting better tumor-suppressing effects compared to rPRV-ΔUL50 (Figure 1B). However, in terms of overall survival, rPRV-ΔTK showed the best performance, while rPRV-ΔUL50 was relatively weaker (Figure 1C). This indicates that the deletion of TK and US3 significantly reduced viral virulence compared to wild-type virus. Therefore, we chose the rPRV-ΔTK single-deficient viral strain as the backbone to reduce viral virulence, improve viral targeting to tumors, and thus enhance viral safety.

[0078] Building upon this, to further reduce viral virulence, we deleted the US3 and EP0 genes, which can reduce PRV virulence, namely PRV-ΔTK / US3 and PRV-ΔTK / EP0, respectively. Using these two genes as "platforms," ​​we inserted immunomodulatory cytokine genes to achieve combined application of tumor immunotherapy, thereby improving the efficacy of tumor treatment.

[0079] Example 2: Construction of PRV TK / US3 double-deficient pseudorabies virus using CRISPR / Cas9

[0080] 1. The PRV Bartha TK monodeficient virus was constructed in the laboratory previously. The target oligo sequences for the sgRNA targeting the TK gene are shown in Table 1:

[0081] Table 1 Primers used for TK knockout sgRNA synthesis

[0082] 2. Based on the PRV Bartha TK monodeficient virus, sgRNAs targeting the US3 and EP0 genes were designed and constructed. The targeting oligo sequences are shown in Table 2.

[0083] Table 2 Primers used for US3 knockout sgRNA synthesis

[0084] 2. The genome of PRV Bartha K61 virus was extracted using the SDS-proteinase K method (1).

[0085] 3. Constructing a TK / US3 gene knockout pseudorabies virus using CRISPR / Cas9

[0086] After PK15 cells have grown to a confluence of 10cm cells in a cell culture dish, press 4×10 5 Six-well plates were prepared. Simultaneously, following the Lipo2000 instructions, viral genome (2.5 μg), sgRNA1 (0.5 μg), sgRNA2 (0.5 μg), Donor plasmid (1.0 μg), and Cas9 (1 μg) were transfected into PK15 cells. For the first 6 hours post-transfection, OPTI-MEM was used as the culture medium. After 6 hours, the medium was replaced with complete medium containing 10% FBS for continued culture. Approximately 72 hours after transfection, cytopathic effects were observed in PK15 cells (Figure 2). At this point, the viral supernatant was harvested for single-clone screening or stored at -80°C for subsequent experiments.

[0087] 4. Monoclonal screening of recombinant oncolytic viruses

[0088] Using the obtained viral supernatant, viral monoclonal antibodies were screened using the endpoint dilution method. First, the virus supernatant was diluted at 5 × 10⁶ cells per well in a 96-well plate. 3 PK15 cells were seeded at a density of [number] cells / cell. After the cells adhered, the virus solution was added at a ratio of 10:1. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 Viral samples were treated with the highest dilution ratios and inoculated into 96-well plates. Three days later, cytopathic effects were observed in each well of the highest dilution gradient. The viral fluid from the wells of the highest dilution gradient was harvested and stored at -80°C for subsequent experiments.

[0089] 5. Small-scale extraction of viral genome

[0090] PK15 with 3×10 5 After the cells adhered to the 12-well plates and were inoculated with the virus, once 80% of the cells showed cytopathic effects, the viral supernatant was discarded. The viral genome was then extracted according to the Beyotime Genomic DNA Miniature Kit instructions for subsequent PCR and sequencing identification.

[0091] 6. PCR and sequencing identification of recombinant viruses

[0092] The extracted viral genome was used for PCR identification. US3 upstream identification primers were designed upstream of the US3CDS sequence, and US3 downstream identification primers were designed at positions 250-500 bp of the US3 gene. The sequences of each identification primer are shown in Table 3.

[0093] Table 3 Primers for US3 gene knockout identification

[0094] The results showed that the TK and US3 gene fragments obtained by PCR from the non-knockout virus were located at the 300-400 bp position, while those obtained by PCR from the knockout virus were located at the 200-300 bp position. Compared with Bartha WT, the US3 gene in the other samples was missing approximately 100 bp (Figure 3B). These results confirm the deletion of the US3 gene in the recombinant virus, thus successfully constructing a TK / US3 double-gene deletion virus (PRV-ΔTK / US3).

[0095] 7. Western Blot identification of recombinant oncolytic virus

[0096] In a 12-well plate, at 3×10 5 PK15 cells were seeded at a specific density in each well. After the cells adhered, they were inoculated with a virus. Once 80% of the cells showed cytopathic effects, the supernatant was discarded, and the cell sample was harvested for Western blotting.

[0097] Western blotting results showed that TK and US3 proteins were absent after the recombinant virus infected the cells, and the virus with absent TK and US3 protein expression was successfully obtained (Figure 3C).

[0098] Example 3: Evaluation of the in vitro tumor suppression effect of PRV-ΔTK / US3

[0099] To evaluate the in vitro tumor-suppressive effect of PRV-ΔTK / US3, this invention used cell counting to plot cell survival curves. Different tumor cell lines, including Hep2, B-CMT, B16-F10, CT-26, and Pan02, were used at 3×10⁻⁶ cells / year. 5Cells were seeded at a density of 12-well plates, and the seeding time was recorded to ensure all cells were cultured under the same growth conditions. Once cells were fully adherent, various tumor cell lines were infected with PRV-ΔTK / US3 virus at MOIs of 1, 5, 10, and 25. The virus and cells were co-incubated for 1 hour to ensure adequate infection. The virus solution was then removed, and the culture medium was replaced with fresh medium. The culture plates were placed in an incubator and cultured for another 48 hours. 48 hours after the end of the culture period, cells were deaggregated from the bottom of the culture dish using trypsin digestion, and cell counts were performed. Cell count data for various tumor cell lines at different MOIs were recorded and compiled. GraphPad Prism 8 statistical software was used to analyze and statistically summarize the cell counts for each group, generating growth curves or bar charts to illustrate the changing trends of cell growth under different MOI conditions.

[0100] The results showed that as the MOI increased, the proliferation of all tumor cells gradually decreased, and the degree of decrease was negatively correlated with the MOI. This result indicates that PRV-ΔTK / US3 can infect and lyse multiple types of tumor cells under in vitro conditions, thereby inhibiting tumor growth (Figure 4).

[0101] Example 3: Evaluation of the in vivo tumor-suppressing effect of recombinant oncolytic virus

[0102] Six-week-old female C57BL / 6 mice were purchased and housed in the animal facility for one week to acclimatize. The mice were randomly divided into four groups of seven mice each to test the safety of different deletion strains in immunocompetent mice. PRV WT, PRV-ΔTK, and PRV-ΔTK / US3 virus strains were administered at doses of 5 × 10⁻⁶. 6 TCID 50 C57BL / 6 mice were infected via intranasal administration. The control group received an equal volume of DMEM. Mice mortality was observed daily for 40 days to assess the lethal effects of different viral strains on mice. Survival curves of challenged mice were analyzed using the Kaplan-Meier method.

[0103] The results showed that all mice infected with the WT strain died within 10 days, while no mice infected with PRV-ΔTK or PRV-ΔTK / US3 died within 40 days (Figure 5). These results indicate that the deletion of the TK gene significantly weakens the virulence of the PRV Bartha K61 strain, while PRV-ΔTK / US3 shows relatively high safety in immunocompetent mice.

[0104] Example 4: Construction of a recombinant virus expressing an immunomodulatory factor gene

[0105] 1. Construction of the Donor plasmid (Figure 6A)

[0106] (1) Construction of Donor plasmid containing RFP expression cassette

[0107] Using the PRV Bartha K61 genome as a template, the first 1-220 bp of the US3 decoy fragment was cloned. Using a pre-preserved plasmid as a template, the CMV enhancer and promoter fragments, the RFP fragment, and the pCloneEZ-Blunt-Amp-HC vector fragment were cloned. US3, CMV, and RFP were ligated with the pCloneEZ-Blunt-Amp-HC vector fragment via homologous recombination to form a complete circular plasmid. After successful sequencing, the plasmid was extracted and named pT-RFP.

[0108] (2) Construction of Donor plasmid containing miPD-L1 expression cassette

[0109] The miPD-L1 gene was synthesized by Qingke Biotechnology Co., Ltd. PCR was performed using the pT-RFP plasmid as a template to obtain a DNA fragment containing the US3 bait sequence, CMV promoter, and RFP sequence, i.e., linearized pT-RFP. Using primer design, a P2A self-cleavage site sequence (GGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTATG) was added downstream of miPD-L1 and upstream of RFP. Homologous recombination then ligated the linearized pT-RFP fragment to the miPD-L1 gene to form a complete circular plasmid. After successful sequencing, the plasmid was extracted and named pT-miPD-L1.

[0110] (3) Construction of Donor plasmid containing hetIL-15 expression cassette

[0111] The hetIL-15 gene was synthesized by Qingke Biotechnology. PCR was performed using pT-RFP and pSin plasmids as templates to obtain linearized pT-RFP and the pEF-1α promoter. P2A self-cleavage sites were added downstream of hetIL-15 and upstream of RFP using primer design. Homologous recombination was used to ligate the linearized pT-RFP fragment, the hetIL-15 gene, and the pEF-1α promoter to form a complete circular plasmid. After successful sequencing, the plasmid was extracted and named pT-IL-15.

[0112] (4) Construction of Donor plasmid containing miPD-L1 / IL-15 expression cassette

[0113] Using pT-miPD-L1 and pT-IL-15 as templates, miPD-L1 and hetIL-15 gene fragments were obtained, respectively. These fragments were then ligated to pCloneEZ-Blunt-Amp-HC via homologous recombination to form a circular plasmid. After successful sequencing, the plasmid was extracted and named pT-miPD-L1 / IL-15. The primer sequences used for Donor plasmid construction are as follows:

[0114] Table 4 Primers used for Donor plasmid construction

[0115] 2. Monoclonal screening of recombinant oncolytic viruses

[0116] Using the harvested viral supernatant, viral monoclonal antibodies were screened by endpoint dilution, as in Example 1. When constructing the gene-inserting virus, positive wells containing red fluorescence were observed and marked using a fluorescence microscope. The viral solution from the dilution well with the highest titer was harvested and stored at -80°C.

[0117] 3. Identification of recombinant oncolytic virus by PCR and sequencing

[0118] The recombinant oncolytic virus was identified by PCR and sequencing. After successful identification, the monoclonal virus was amplified, aliquoted, and stored at -80°C.

[0119] As shown in Figure 6B, the Donor plasmid fragment was observed at a position above 5000bp through PCR and nucleic acid electrophoresis, proving that the sample is a recombinant oncolytic virus with gene insertion.

[0120] 4. Identification of recombinant oncolytic virus by qRT-PCR and Western Blot

[0121] B16-F10 tumor cells were respectively treated at 3×10 5 Cells were seeded at the specified density in 12-well plates, and the seeding time was recorded to ensure all cells were cultured under identical growth conditions. Once cells were fully adherent, tumor cells were infected with PRV-RFP, PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15 viruses at a 2 MOI. RNA was extracted 24 hours later, and the expression of miPDL1 and hetIL-15 genes in the cells was detected by qRT-PCR (Figures 6C and 6D).

[0122] PK15 tumor cells were respectively injected at 3×10 5Cells were seeded at the specified density in 12-well plates, and the seeding time was recorded to ensure all cells were cultured under identical growth conditions. Once cells were fully adherent, tumor cells were infected with PRV-RFP, PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15 viruses at a 1 MOI. Protein samples were harvested at 12 and 24 hours, and intracellular miPDL1 and IL-15 protein levels were analyzed using Western blotting (Figure 6E).

[0123] The results showed that the miPD-L1 gene was inserted into cells infected with the virus (PRV-miPD-L1 and PRV-miPD-L1 / IL-15) and the hetIL-15 gene was inserted into cells infected with the virus (PRV-IL-15 and PRV-miPD-L1 / IL-15) and the hetIL-15 protein was expressed.

[0124] Example 5: Evaluation of the in vitro tumor-suppressing effect of the novel recombinant oncolytic virus

[0125] PRV-RFP, PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15 recombinant oncolytic viruses were used to infect B16-F10 and CT-26 tumor cells with MOIs of 1, 5, 10, and 25, respectively. Cell survival curves were plotted using the same method as in Example 2.

[0126] As shown in Figure 7, there was no significant difference in the cytolytic ability of the various recombinant oncolytic viruses against cells. This result indicates that different types of recombinant oncolytic viruses can maintain their cytotoxic effect when infecting tumor cells, and the differences in their cytotoxic ability against tumor cells are not significant. These experimental results further demonstrate the stability and effectiveness of the novel recombinant oncolytic viruses in infecting tumor cells.

[0127] Example 6: Evaluation of the in vivo tumor-suppressing effect of the novel recombinant oncolytic virus

[0128] Four-week-old female C57BL / 6 mice were purchased and housed in the animal facility for one week to acclimatize, in preparation for tumor cell inoculation. B16-F10 cells were subcutaneously inoculated into the inner right thigh of the mice at a density of 5 × 10⁶ cells. 5 Cells / mouse. Tumor formation was observed 5-6 days after inoculation. The length (L) and width (W) of the tumor in the tumor-bearing mice were measured using calipers, and the tumor volume was calculated and recorded. The formula for calculating tumor volume is: V(mm²) 3 )=(L×W 2 ) / 2

[0129] V represents volume, in mm. 3L represents length, in mm; W represents width, in mm.

[0130] Tumors with a volume of 50-100 mm were selected. 3 Tumor-bearing mice were randomly assigned to different groups for subsequent viral treatment.

[0131] Mice in each group underwent unilateral intratumoral injection of PRV-RFP, PRV-miPD-L1, PRV-IL-15, and PRV-miPD-L1 / IL-15, respectively, with a viral injection dose of 3.5 × 10⁻⁶. 7 PFU was used as a control, with an equal volume of 10% FBS cell culture medium. Each mouse received three treatments, one day apart (Figure 8A). Mouse weight was recorded, and a weight change curve was plotted to assess health status and the potential for toxic side effects from continued administration. Tumor size was recorded from the first treatment, and data were compiled to plot tumor volume growth curves to evaluate the inhibitory effect of recombinant oncolytic virus on tumors. The observation period was 40 days, starting from the first treatment (day 0). Mice were humanely euthanized when their tumor volume reached 2500 mm³, and the time of death was recorded for each group. Survival curves were plotted to assess the impact of recombinant oncolytic virus on the survival of tumor-bearing mice.

[0132] The results showed that, compared with the control group, the tumor growth rate of mice in each viral treatment group was significantly reduced, further demonstrating that PRV exhibited a good oncolytic effect in the mouse skin melanoma model. Furthermore, comparing the various viral treatment groups, it was found that PRV-miPD-L1 / IL-15 had the best tumor-suppressing effect in the B16-F10 melanoma model, followed by PRV-miPD-L1 and PRV-IL-15, while PRV-RFP had the weakest tumor-suppressing effect in the B16-F10 melanoma model (Figure 8B).

[0133] Compared with the control group, the survival time of mice in each experimental group was prolonged to some extent. Among them, the PRV-miPD-L1 / IL-15 treatment group showed the most significant effect in prolonging the survival time of mice. At the end of the observation period, one mouse was still alive, its tumor had completely regressed, and there was no recurrence in the following 30 days (Figure 8C).

[0134] Example 7: Construction of PRV TK / EP0 double-deficient pseudorabies virus using CRISPR / Cas9

[0135] Following the method described in Example 2, sgRNA targeting the EP0 gene was designed and constructed based on PRV Bartha TK monovirus. The targeting oligo sequences are shown in Table 5.

[0136] Table 5 Primers used for EP0 knockout sgRNA synthesis

[0137] 2. The genome of PRV Bartha K61 virus was extracted using the SDS-proteinase K method.

[0138] 3. Constructing pseudorabies virus with TK and EP0 gene knockout using CRISPR / Cas9

[0139] After PK15 cells have grown to a confluence of 10cm cells in a cell culture dish, press 4×10 5 Six-well plates were prepared. Simultaneously, following the Lipo2000 instructions, viral genome (2.5 μg), sgRNA1 (0.5 μg), sgRNA2 (0.5 μg), Donor plasmid (1.0 μg), and Cas9 (1 μg) were transfected into PK15 cells. For the first 6 hours post-transfection, OPTI-MEM was used as the culture medium. After 6 hours, the medium was replaced with complete medium containing 10% FBS for continued culture. Approximately 72 hours after transfection, cytopathic effects were observed in PK15 cells. At this point, the viral supernatant was harvested for single-clone selection or stored at -80°C for subsequent experiments.

[0140] 4. Monoclonal screening of recombinant oncolytic viruses

[0141] Using the obtained viral supernatant, viral monoclonal antibodies were screened using the endpoint dilution method. First, the virus supernatant was diluted at 5 × 10⁶ cells per well in a 96-well plate. 3 PK15 cells were seeded at a density of [number] cells / cell. After the cells adhered, the virus solution was added at a ratio of 10:1. -1 10 -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 Viral samples were treated with the highest dilution ratios and inoculated into 96-well plates. Three days later, cytopathic effects were observed in each well of the highest dilution gradient. The viral fluid from the wells of the highest dilution gradient was harvested and stored at -80°C for subsequent experiments.

[0142] 5. Western Blot identification of recombinant oncolytic virus

[0143] In a 12-well plate, at 3×10 5 PK15 cells were seeded at a specific density in each well. After the cells adhered, they were inoculated with a virus. Once 80% of the cells showed cytopathic effects, the supernatant was discarded, and the cell sample was harvested for Western blotting.

[0144] As shown in Figure 9, the EP0 protein was not expressed after the virus samples 2 and 3 were infected with cells, indicating that the EP0 gene knockout was successful and TK / EP0 double-deficient virus was successfully obtained.

[0145] Furthermore, recombinant viruses with RFP and iPD-L1 gene insertions were constructed according to the method shown in Example 4, and named rPRV-RFP and rPRV-iPD-L1, respectively.

[0146] Example 8: Evaluation of the in vitro tumor-suppressing effect of recombinant oncolytic virus rPRV-RFP

[0147] CT26 (mouse colon cancer cells) and TC-1 (mouse lung epithelial cells) cells were grown in RPMI 1640 medium supplemented with 10% filtered, heat-inactivated fetal bovine serum (FBS) and 100 μg / mL penicillin. B-CMT (canine breast cancer cell line) cells were cultured in Durbeco modified Eagle's medium (DMEM). The modified DMEM medium contained 10% FBS and 100 μg / mL penicillin.

[0148] 2×10 5 B-CMT, CT26, and TC-1 cells were seeded into 96-well plates and cultured for 24 h. Subsequently, cells were infected with rPRV-RFP in DMEM medium at MOIs of 0.1, 1, 5, 25, or 50 and incubated at 37°C. After 24 h, 10 μL of CCK-8 solution was added to each well, and the plates were incubated for 1–4 h. Absorbance at 450 nm was measured using a microplate reader. Data from each group were analyzed and statistically processed using GraphPad Prism8 software, and bar charts were generated to demonstrate the infection and killing effects of rPRV-RFP on mouse and canine tumor cells under different MOI conditions.

[0149] As shown in Figure 10, tumor cell proliferation gradually weakened with increasing MOI, and the degree of weakening was negatively correlated with MOI. This indicates that rPRV-RFP retained its ability to infect and kill multiple types of tumor cells in mice and dogs.

[0150] Example 9: Determination of Virus One-Step Growth Kinetics

[0151] PK15 (porcine kidney 15) cells were cultured in Durbeco modified Eagle medium (DMEM). The modified DMEM medium contained 10% FBS and 100 μg / mL penicillin.

[0152] PK15 cells were infected with rPRV-ΔTK, rPRV-RFP, and rPRV-iPD-L1 at an MOI of 1 and then cultured at 37°C for 2 h in a 5% CO2 incubator. The supernatant was discarded, and fresh DMEM medium was added. Virus was harvested after 48 h. The 50% tissue culture infection dose (TCID) was determined by 50% endpoint dilution assay using the Reed and Muench method. 50 ), to calculate the viral titer in PK15 cells.

[0153] As shown in Figure 11, the growth rates of rPRV-RFP and rPRV-iPD-L1 viruses were slightly lower than those of rPRV-ΔTK, but the difference was not significant. This indicates that the insertion of the foreign gene does not affect the replication of the virus itself, and the virus retains its ability to infect and replicate in tumor cells.

[0154] Example 10: Evaluation of the in vivo tumor-suppressing effect of a novel recombinant oncolytic virus

[0155] 5x10 mg / L was subcutaneously injected into the ventral side of C57 mice. 5 One B16-F10 cell (100 μL) was collected and ear-tagged. One week later, tumors with a volume of 50-100 mm were selected. 3 Mice were randomly divided into groups, with the experimental group receiving 100 μL of 1x10⁻¹ solution. 6.5 Intratumoral injection of viruses (rPRV-RFP and rPRV-iPD-L1) was performed, while the control group received intratumoral injection of 100 μL of PK15 cell culture supernatant. Injections were administered every other day for a total of three times (Figure 12A). Tumor diameter was measured and recorded every three days. Data were compiled and a tumor volume growth curve was plotted to evaluate the inhibitory effect of recombinant oncolytic virus on tumors. The tumor volume calculation formula is: V(mm²) 3 )=0.52×L×W 2 ;

[0156] Where V represents volume, the unit is mm. 3 L represents length, in mm; W represents width, in mm.

[0157] The observation period was 40 days, starting from the first treatment (day 0). When the mice reached a volume of 2500 mm3, they were humanely euthanized. The time of death of mice in each group was recorded, and mouse survival curves were plotted to evaluate the effect of recombinant oncolytic virus on the survival of tumor-bearing mice.

[0158] As shown in Figures 12B and 12C, the virus treatment groups significantly reduced tumor volume and prolonged the survival of tumor-bearing mice, and rPRV-iPD-L1 showed superior anti-tumor activity compared to rPRV-RFP.

[0159] Example 11 Tumor Histological Examination

[0160] Seven days after the last treatment, mouse tumor tissue was collected and preserved in 10% formalin at 4°C for three days. The tissue was dehydrated using alcohol, butanol, and xylene, and then embedded in paraffin. Sections approximately 4.5–5 μm thick were then cut from the paraffin block. These sections were dewaxed, stained with hematoxylin and eosin, and mounted with Vitrogel. They were examined using an upright optical microscope.

[0161] As shown in Figure 13, the number of inflammatory cells entering the tumor site increased in the viral treatment group, suggesting that PRV, as an oncolytic virus, can better activate local tumor immunity.

Claims

1. A recombinant oncolytic virus, obtained by inserting a foreign gene into a modified viral genome, wherein the recombinant oncolytic virus, compared with a wild-type virus, improves or enhances at least one of the following properties: A. Replication efficiency in human tumor cells; B. The ability to cause cytopathic effects in human tumor cells; C. Killing power against human tumor cells; D. The ability to induce a natural immune response; E. Safety of the host.

2. The virus as described in claim 1 includes wild-type virus or attenuated vaccine strain virus derived from pigs; preferably, the virus is porcine herpesvirus type 1 (SHV-1), also known as pseudorabies virus (PRV).

3. The modified viral strain as described in claim 1 is selected from one or more gene knockout strains and / or fusion proteins.

4. The exogenous gene as described in claim 1 is selected from one or more of the following: exogenous GM-CSF encoding gene, exogenous IL-2 encoding gene, exogenous IL-12 encoding gene, exogenous IL-15 encoding gene, exogenous IL-18 encoding gene, exogenous IL-21 encoding gene, exogenous IFN-γ encoding gene, exogenous OX40 encoding gene, exogenous PD-L1 inhibitor encoding gene, exogenous PD-1 inhibitor encoding gene, and / or exogenous CTLA-4 inhibitor encoding gene.

5. A pharmaceutical composition comprising the recombinant oncolytic virus described in the first aspect of the present invention and another anticancer drug, the pharmaceutical composition having the effect of improving or enhancing at least one of the following properties: A. Replication efficiency in human tumor cells; B. The ability to cause cytopathic effects in human tumor cells; C. Killing power against human tumor cells; D. The ability to induce a natural immune response; E. Safety of the host.

6. Another anticancer drug as described in claim 1 includes traditional cytotoxic drugs, molecularly targeted drugs, antitumor biological drugs, and other drugs with anticancer effects.

7. The pharmaceutical composition of claim 1 may further comprise the recombinant oncolytic virus described in the first aspect of the invention and a pharmaceutically acceptable carrier or diluent.

8. A product comprising the recombinant oncolytic virus described in the first aspect of the present invention.

9. A method for enhancing the replication efficiency of pseudorabies virus in human tumor cells, its ability to cause cytopathic effects in human tumor cells, its killing power against human tumor cells, its ability to induce innate immune responses, and / or its safety to the host, comprising inserting a foreign gene into a modified pseudorabies virus genome.

10. The application of recombinant oncolytic virus in the preparation of tumor therapeutic drugs, wherein the recombinant oncolytic virus has at least one of the following functions: A. As an effective active ingredient for lysing tumor cells and inhibiting tumor growth; B. As an expression vector and / or targeted delivery vector for tumor therapeutic active molecules; C. As an immune enhancer, it is used to enhance the innate immune response.

Citation Information

Patent Citations

  • Pseudorabies virus for tumor treatment

    CN110101723A

  • Novel oncolytic virus and preparation method and application thereof

    CN110218707A

  • Attenuated pseudorabies virus with deletion gene and application of attenuated pseudorabies virus as vaccine

    CN110699329A

  • Oncolytic virus and application thereof

    CN116144607A