Method for gene editing of hematopoietic stem cell, composition and use thereof

Abstract

Disclosed in the present invention are a method for the gene editing of a hematopoietic stem cell, a composition, and a use thereof. Specifically disclosed are a sequence of sgRNA and a use thereof. The present invention establishes a method for using the sgRNA to efficiently edit a hematopoietic stem cell in vitro. The gene editing efficiency can reach 77% or more. The hematopoietic stem cell with CLL1 gene knocked out by using the sgRNA has a good myeloid differentiation function without affecting the function of a differentiated myeloid cell derived therefrom, and both the hematopoietic stem cell with CLL1 gene knocked out and the differentiated myeloid cell derived therefrom can effectively avoid the killing effect of a CLL1-CAR-T cell. The method of the present invention can be used in an application of CAR-T cell therapy combined with hematopoietic stem cell transplantation therapy, can solve the problem of off-target toxicity caused by a CLL1-targeting CAR-T cell recognizing and attacking a normal myeloid cell, and has important clinical value and application prospects for AML treatment.

Description

Method for gene editing of hematopoietic stem cells, composition and application thereof TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, relates to the field of gene editing, and particularly relates to a method for gene editing of hematopoietic stem cells, a composition and application thereof. BACKGROUND

[0002] Acute myeloid leukemia (AML) is mainly caused by malignant colony proliferation of primitive bone marrow cells in the hematopoietic system, and is characterized by abnormal proliferation of bone marrow mother cells and inhibition of growth of normal hematopoietic cells. Patients often have a decrease in whole blood cells (red blood cells, white blood cells and platelets), causing anemia, infection and bleeding clinical symptoms. Chemotherapy is the standard treatment for most AML patients, and drugs such as cytarabine are often used in combination. Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is often used for patients with medium and high risk, and the scheme has good curative effect, and has a lower relapse rate than chemotherapy. Allo-HSCT is currently the only cure for AML. However, AML has a poor prognosis, and relapse of the primary disease after transplantation is still the main cause of death in patients.

[0003] Human C-type lectin-like molecule 1 (CLL1), also known as CLEC12A, is a type II transmembrane glycoprotein composed of an extracellular carbohydrate recognition domain with 6 N-glycosylation sites, a transmembrane region and an intracellular NH2 terminal, and exists in myeloid cells of peripheral blood and bone marrow and most AML cells. CLL1 is expressed on leukemia stem cells (LSC), but not on hematopoietic stem cells (HSC), so CLL1 is a very promising target for targeted therapy of AML. The drug development related to CLL1 is basically CAR-T cell therapy that has entered the clinical stage. Current clinical data have proven the therapeutic potential of CLL1 in AML, providing an opportunity for R / R AML patients (patients with relapsed and / or refractory acute myeloid leukemia) to achieve CR / Cri (complete remission or complete remission with incomplete recovery of blood cell count) before transplantation. After obtaining CR / CRi, according to factors such as the presence or absence of a donor, social economy, self-condition, personal willingness, etc., allo-HSCT or continued consolidation chemotherapy is selected as soon as possible.

[0004] Although the expression intensity is higher in AML cells and LSCs, CLL1 is also expressed in normal myeloid cells, so that the CAR-T cells targeting CLL1 recognize and attack normal myeloid cells, resulting in off-target toxicity, various adverse reactions such as neutropenia, and uncontrolled infection in some patients. By reducing the number of CAR-T cell inputs, the safety can be improved to a certain extent, but no significant clinical efficacy has been observed. Knocking out the CLL1 gene in hematopoietic stem cells makes the differentiated cells not be recognized and killed by CLL1 CAR-T cells while performing functions, which can solve the long-term granulocytopenia and other adverse reactions caused by CLL1 CAR-T off-target toxicity, and bring higher cure rate to AML patients. The combination of CAR-T cell therapy and hematopoietic stem cell transplantation therapy will be one of the effective strategies to solve the off-target toxicity problem.

[0005] The CRISPR-Cas9 gene editing technology is to recognize the target genomic sequence by the artificially designed gRNA, and guide the Cas9 proteinase to effectively cut the DNA double strand to form a double-strand break, and the damage repair will cause gene knockout, etc., so as to finally achieve the purpose of editing the genomic DNA. In view of this, it has important clinical significance for the treatment of AML to research and develop an efficient and precise gene editing method to modify hematopoietic stem cells.

[0006] SUMMARY

[0007] The purpose of the present application is to provide an sgRNA targeting and guiding Cas9 protein to efficiently cut CLL1 gene, a method for editing hematopoietic stem cell genes and its application in tumor immunotherapy. The technical problems to be solved are not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0008] To achieve the above-mentioned purpose, the present application first provides an sgRNA, which comprises a recognition region and a framework region, and the nucleotide sequence of the recognition region can be 1-20 of SEQ ID NO: 5, 1-20 of SEQ ID NO: 6 or 1-20 of SEQ ID NO: 7.

[0009] Further, the nucleotide sequence of the framework region can be SEQ ID NO: 4 or a sequence having more than 90% identity with the nucleotide sequence defined by SEQ ID NO: 4 and having the same function.

[0010] Further, the nucleotide sequence of the sgRNA can be as shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.

[0011] The framework region is responsible for binding with the Cas protein. The recognition region is responsible for binding with the target of the CLL1 gene, guiding the Cas protein to the target.

[0012] The sgRNA can be an sgRNA targeting the human CLL1 gene.

[0013] The sgRNA name shown in SEQ ID NO: 5 can be sgRNA2; the sgRNA name shown in SEQ ID NO: 6 can be sgRNA3; and the sgRNA name shown in SEQ ID NO: 7 can be sgRNA4.

[0014] The present application also provides a biological material, which can be any one of the following:

[0015] A1) a DNA molecule encoding any of the sgRNAs described herein;

[0016] A2) an expression cassette containing the DNA molecule of A1);

[0017] A3) a recombinant vector containing the DNA molecule of A1);

[0018] A4) a recombinant microorganism containing the DNA molecule of A1);

[0019] A5) a recombinant host cell containing the DNA molecule of A1).

[0020] The biological material can express the sgRNA.

[0021] Further, the DNA molecule in A1) includes a DNA molecule with a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10.

[0022] The DNA molecule shown in SEQ ID NO: 1 encodes the sgRNA2 recognition region; the DNA molecule shown in SEQ ID NO: 2 encodes the sgRNA3 recognition region; the DNA molecule shown in SEQ ID NO: 3 encodes the sgRNA4 recognition region; the DNA molecule shown in SEQ ID NO: 8 encodes sgRNA2; the DNA molecule shown in SEQ ID NO: 9 encodes sgRNA3; and the DNA molecule shown in SEQ ID NO: 10 encodes sgRNA4.

[0023] Further, the recombinant vector in A3) includes a recombinant DNA molecule constructed by connecting a DNA molecule encoding the sgRNA with a vector in vitro. The recombinant vector can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the sgRNA into a recipient cell or microorganism and can express the sgRNA to perform the knockout function on the target gene.

[0024] Further, the recombinant vector can be a gene editing vector expressing the sgRNA and the Cas protein. The method for constructing a gene editing vector is well known to those skilled in the art, and a Cas protein matched (or bound) to the designed guide RNA (such as the sgRNA of the present application) can be selected as long as the experimental purpose (such as gene knockout) can be achieved. For example, the sgRNA and the Cas protein can be connected into the same vector and activated by a double promoter, or the sgRNA and the Cas protein can be connected on different vectors, or a backbone vector (such as PX459 vector, PX458 vector, PX461 vector, PX462 vector, PX551 vector, PX552 vector, pGK1.1 vector, PX330 vector, PX335 vector, PX165 vector, eSpCas9(1.1) vector, etc.) containing a Cas protein gene can be selected as an expression vector for the sgRNA, and a DNA molecule encoding the sgRNA is cloned into the backbone vector to construct a gene editing vector targeting the target gene.

[0025] The present application also provides a gene editing composition, which includes B1) and B2):

[0026] B1) the sgRNA described herein anywhere, or the biological material;

[0027] B2) Cas protein or nucleic acid molecule encoding Cas protein.

[0028] In the above gene editing composition, the Cas protein can be selected from Cas9, Cas12a, Cas12b, Cas12i3, Cas13a, Cas13b and Cas13c.

[0029] Further, the Cas protein described herein can be a Cas9 protein. The Cas9 protein is not limited to a specific protein, as long as it can be used with the sgRNA of the present application.

[0030] Further, the Cas9 proteins described herein include Streptococcus pyogenes Cas9 (spCas9, subtype II-A), spCas9 HF (high fidelity), nickase Cas9 (nCas9), Staphylococcus aureus Cas9 (saCas9, subtype II-A), Neisseria meningitidis Cas9 (NmCas9, subtype II-C), Francisella novicida Cas9 (FnCas9, subtype II-B), Streptococcus thermophilus Cas9 (St1Cas9, St3Cas9), Campylobacter jejuni Cas9 (CjCas9), and Treponema sp. Cas9, and Cas9 orthologs from other organisms, but are not limited thereto. The Cas9 proteins can also include high-fidelity Cas9 mutants (e.g., SpCas9-HF1, eSpCas9-1.1, and TrueCut TM HiFi Cas9 proteins), etc.

[0031] In one or more embodiments of the present application, the sgRNA is suitable for use in a CRISPR / Cas9 gene editing system, i.e., the sgRNA can bind to a Cas9 protein and direct the Cas9 protein to cleave a target site.

[0032] The method of the present application can be implemented with any Cas9 protein known in the art. Those skilled in the art can make suitable selection of the coding sequence of the Cas9 protein without departing from the principles of the embodiments of the present application.

[0033] While the methods of the application are generally practiced using a Cas9 protein, it is contemplated that in some aspects, the Cas protein can be a Casl, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, or Cas8. In some aspects, the Cas protein useful in the application comprises a Type I Cas protein. Non-limiting examples of Type I Cas proteins include Cas3, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, CaslOd, Cse1, Cse2, Csy1, Csy2, Csy3, and variants thereof. In some aspects, the Cas protein useful in the application comprises a Type II Cas protein. Non-limiting examples of Type II Cas proteins include Cas9, Csn2, Cas4, and variants thereof. In some aspects, the Cas protein useful in the application comprises a Type III Cas protein. Non-limiting examples include CaslO, Csm2, Cmr5, CsxlO, Csxll, and variants thereof. In some aspects, the Cas protein useful in the application comprises a Type IV Cas protein. A non-limiting example of such a Cas protein includes Csf1. In some aspects, the Cas protein useful in the application comprises a Type V Cas protein. Non-limiting examples include Casl2, Casl2a (Cpfl), Casl2b (C2cl), Casl2c (C2c3), Casl2d (CasY), Casl2e (CasX), Casl2f (Casl4, C2clO), Casl2g, Casl2h, Casl2i, Casl2k (C2c5), C2c4, C2c8, C2c9, and variants thereof. In some aspects, the Cas protein useful in the application comprises a Type VI Cas protein. Non-limiting examples of Type VI Cas proteins include Casl3, Casl3a (C2c2), Casl3b, Casl3c, Casl3d, and variants thereof.

[0034] Further, the gene editing composition can further comprise a delivery system selected from one or more of a polymeric nanoparticle, a liposome, a lipid nanoparticle, a viral vector, or an extracellular vesicle.

[0035] The gene editing composition can be a CRISPR / Cas9 gene editing system.

[0036] The application also provides the use of any of the sgRNAs, the biomaterials, or the gene editing compositions described herein in any of:

[0037] C1) in the specific recognition of a CLL1 gene;

[0038] C2) in the knockout of a CLL1 gene;

[0039] C3) use in the manufacture of a reagent or a kit for preparing a CLL1 gene-knocked-out cell;

[0040] C4) use in the manufacture of a CLL1 gene-knocked-out cell;

[0041] C5) use in the manufacture of a product for preventing or treating a CLL1 target-related disease;

[0042] C6) use in the manufacture of a product for treating a CLL1 target-related disease in combination with CLL1 -targeted CAR cells.

[0043] Further, the cell in C4) can be a cell containing an endogenous CLL1 gene, a cell expressing CLL1 antigen, a hematopoietic stem cell, a hematopoietic progenitor cell, an AML cell or a leukemia stem cell.

[0044] The identification of a cell containing an endogenous CLL1 gene and a cell expressing CLL1 antigen is well known to those skilled in the art. For example, to determine whether a cell contains and / or expresses CLL1, the expression of CLL1 mRNA can be determined by in situ hybridization or RT-PCR (including quantitative RT-PCR) methods, and the expression of CLL1 protein on the cell surface can be determined by immunohistochemistry or FACS methods using antibodies against CLL1 protein.

[0045] Further, the cell in C4) can be a hematopoietic stem cell and / or a hematopoietic progenitor cell.

[0046] Further, the CLL1 target-related disease in C5) and C6) can be a CLL1 -positive cancer (i.e., a cancer expressing CLL1).

[0047] Further, the CLL1 -positive cancer can be acute myeloid leukemia (AML), myelodysplastic syndromes (MDS) or chronic myeloid leukemia (CML, chronic myelocytic leukemia).

[0048] Further, the acute myeloid leukemia (AML) can be refractory and / or relapsed acute myeloid leukemia (R / R AML).

[0049] Further, the CLL1 -targeted CAR cell in C6) can be a CLL1 -targeted CAR-T cell.

[0050] The CLL1-targeted CAR-T cell can be any T cell capable of specifically recognizing and killing CLL1 antigen-expressing cells, which contains and expresses a CLL1-targeted chimeric antigen receptor (CAR). Methods for preparing a chimeric antigen receptor and a T cell containing the chimeric antigen receptor are known in the art, and a T cell can be stably transfected with at least one nucleic acid molecule encoding a CAR to become a CAR-T cell. For example, in an embodiment of the present application, the CAR-T cell is obtained by stably expressing a CAR gene with a nucleotide sequence of SEQ ID NO: 13 (which contains 2 single-domain antibodies specifically recognizing CLL1) into a T cell.

[0051] The present application also provides a method for preparing a CLL1 gene knockout cell, which comprises knocking out a CLL1 gene in a recipient cell using any of the sgRNAs or the gene editing compositions described herein.

[0052] In the above method, the CLL1 gene in the recipient cell can be knocked out by contacting the CLL1 gene in the recipient cell with any of the sgRNAs and Cas proteins described herein.

[0053] In the above method, the contacting step can be performed by the following D1) and D2):

[0054] D1) directly introducing any of the sgRNAs described herein into the recipient cell, or first constructing a DNA molecule encoding any of the sgRNAs described herein into an expression vector and then introducing the expression vector into the recipient cell;

[0055] D2) directly introducing the Cas protein or mRNA of the Cas protein into the recipient cell, or first constructing a DNA molecule encoding the Cas protein into an expression vector and then introducing the expression vector into the recipient cell, or fusing the Cas protein with a cell-penetrating peptide and introducing the Cas protein into the recipient cell through the cell-penetrating peptide.

[0056] It is known to those skilled in the art that Cas proteins, Cas protein mRNA, Cas expression vectors (vectors containing and expressing DNA molecules encoding Cas proteins), sgRNAs, sgRNA expression vectors (vectors containing and expressing DNA molecules encoding sgRNAs) can be transferred into cells by various methods known in the art, such as microinjection, electroporation (electrotransformation method, electroporation method), cationic polymer method (such as DEAE-dextran transfection method), liposome-mediated method, lipid nanoparticle-mediated transfection, protein transduction domain-mediated transduction, calcium phosphate co-precipitation method, viral vector method, gene gun method, etc. but not limited thereto.

[0057] When the sgRNA and Cas protein are delivered using expression vectors, the sgRNA and Cas protein can be expressed in different expression vectors or can be expressed in the same expression vector.

[0058] In one embodiment of the present application, the method of introduction is electroporation.

[0059] Further, the transmembrane peptide is used to promote the uptake and absorption of the Cas protein fused thereto by the cell and to exert biological functions in the cell. Suitable transmembrane peptides are not limited to a particular kind as long as the purpose of carrying the Cas protein to cross the membrane and internalize can be achieved. The transmembrane peptide includes but is not limited to the transcriptional transactivator Tat of human immunodeficiency virus (HIV), the homeodomain transcription factor ANTP of Drosophila, the transcription factor VP22 of herpes simplex virus type 1 (HSV-1), and artificially synthesized polyarginine and polylysine.

[0060] Further, the transmembrane peptide contains at least 5 arginine or lysine residues, and the total length of the transmembrane peptide is 5-30 amino acids. The preferred transmembrane peptide is the Tat protein from HIV virus (such as Tat peptide, YGRKKRRQRRR, SEQ ID NO: 16).

[0061] Further, the method can comprise the following steps:

[0062] (1) mixing the sgRNA of the nucleotide sequence as shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 with the Cas9 protein to obtain an RNP complex;

[0063] (2) introducing the RNP complex into the recipient cell by the method of electroporation to obtain a recombinant cell;

[0064] (3) culturing the recombinant cell, extracting the genomic DNA, and detecting the gene editing.

[0065] Further, the mass ratio of the sgRNA to the Cas9 protein can be 1:(1-4).

[0066] Further, the mass ratio of the sgRNA to the Cas9 protein can be 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:3.5 or 1:4.

[0067] In the above method, the recipient cell can be a cell containing an endogenous CLL1 gene, a cell expressing CLL1 antigen, a hematopoietic stem cell, a hematopoietic progenitor cell, an AML cell or a leukemia stem cell.

[0068] Further, the recipient cell can be a hematopoietic stem cell and / or a hematopoietic progenitor cell.

[0069] Further, when the recipient cells are hematopoietic stem cells and / or hematopoietic progenitor cells, the method further comprises a step of first sorting CD34+ cells by magnetic bead method, and then introducing the sgRNA and Cas9 protein into the CD34+ cells.

[0070] Further, the CD34+ cells can be sorted from mobilized peripheral blood.

[0071] The present application also provides CLL1 gene knockout cells obtained by the method of preparing CLL1 gene knockout cells described herein, which can contain the sgRNA or the gene editing composition described herein.

[0072] Further, the CLL1 gene knockout cells can be CLL1 gene knockout hematopoietic stem cells.

[0073] Further, the CLL1 gene knockout hematopoietic stem cells have at least one of the following properties:

[0074] (1) can avoid recognition and killing by CAR cells targeting CLL1 (such as CLL1 CAR-T cells);

[0075] (2) have good myeloid differentiation function;

[0076] (3) have high self-renewal ability;

[0077] (4) have high and long-term hematopoietic reconstitution ability;

[0078] (5) the myeloid cells differentiated from the CLL1 gene knockout hematopoietic stem cells have normal and good function;

[0079] (6) the myeloid cells differentiated from the CLL1 gene knockout hematopoietic stem cells can avoid recognition and killing by CAR cells targeting CLL1 (such as CLL1 CAR-T cells).

[0080] The present application also provides the use of the CLL1 gene knockout cells described above in the preparation of a product for preventing or treating CLL1 target point related diseases, which can be CLL1 gene knockout hematopoietic stem cells and / or hematopoietic progenitor cells.

[0081] The present application also provides the use of the CLL1 gene knockout cells described above in combination with CAR cells targeting CLL1 in the preparation of a product for preventing or treating CLL1 target point related diseases, which can be CLL1 gene knockout hematopoietic stem cells and / or hematopoietic progenitor cells.

[0082] The present application also provides a pharmaceutical composition comprising the CLL1 gene-knocked-out cell described above, and one or more pharmaceutically acceptable carriers; the CLL1 gene-knocked-out cell can be a CLL1 gene-knocked-out hematopoietic stem cell and / or a hematopoietic progenitor cell.

[0083] The pharmaceutically acceptable carrier is selected from the group consisting of diluents, excipients, fillers, binders, humectants, disintegrants, preservatives, stabilizers, absorption promoters, adsorption carriers, surfactants, lubricants, atomizing agents, suspending agents, plasticizers, and dispersants.

[0084] The dosage form of the pharmaceutical composition can be an injection preparation.

[0085] To prepare the pharmaceutical composition into an injection preparation such as a solution, an emulsion, a freeze-dried powder, and a suspension, all diluents (carriers) commonly used in the art can be used, for example, water, saline, phosphate buffered saline, ethanol, polyethylene glycol, 1,3-propanediol, ethoxylated isostearyl alcohol, polyoxylated isostearyl alcohol, polyoxyethylene sorbitan fatty acid ester, etc. In addition, to prepare an isotonic injection solution, an appropriate amount of sodium chloride, glucose, or glycerol, etc. can be added to the injection preparation, and in addition, a conventional cosolvent, a buffer, a pH adjuster, etc. can be added.

[0086] The pharmaceutical composition can further comprise a cell cryopreservation solution (containing dimethyl sulfoxide, sodium chloride, human blood albumin, etc.).

[0087] The pharmaceutical composition can be used for hematopoietic stem cell transplantation.

[0088] The pharmaceutical composition can be used to reduce or avoid side effects (off-target toxicity) in CLL1-targeted CAR-T therapy.

[0089] The present application also provides a method of preventing or treating a CLL1 target-related disease, the method comprising administering to a subject having a CLL1 target-related disease:

[0090] (1) a drug targeting CLL1;

[0091] (2) a CLL1 gene-knocked-out hematopoietic stem cell and / or a hematopoietic progenitor cell, or the pharmaceutical composition.

[0092] The CLL1 gene-knocked-out hematopoietic stem cell and / or hematopoietic progenitor cell contains the sgRNA or the gene editing composition described herein.

[0093] The administration of the CLL1 gene-knocked-out hematopoietic stem cell and / or hematopoietic progenitor cell to a subject having a CLL1 target-related disease can be simultaneous with, prior to, or after the administration of a drug targeting CLL1.

[0094] In the above method, the CLL1 gene knockout hematopoietic stem cells and / or hematopoietic progenitor cells can be prepared by knocking out the CLL1 gene in a recipient cell using any of the sgRNAs or the gene editing compositions described herein.

[0095] In the above method, the CLL1 -targeting drug can include a CAR cell or an antibody targeting CLL1.

[0096] In the above method, the CLL1 -targeting drug can be a CAR-T cell.

[0097] In the above method, the CAR-T cell can include a chimeric antigen receptor, the amino acid sequence of which can be as set forth in SEQ ID NO: 14.

[0098] In the above method, the CAR-T cell can further include a chimeric switch receptor, the amino acid sequence of which can be as set forth in SEQ ID NO: 15.

[0099] In the above method, the CAR-T cell can be obtained by stably expressing a CAR gene having a nucleotide sequence of SEQ ID NO: 13 in a T cell.

[0100] In the above method, the CLL1 -targeting drug can be a CAR cell or an antibody targeting CLL1.

[0101] In the above method, the CLL1 -targeting drug can be a CAR cell or an antibody targeting CLL1.

[0102] In the above method, the subject can be an AML patient.

[0103] In the above method, the AML patient can be a refractory and / or relapsed acute myeloid leukemia (R / R AML) patient.

[0104] The present application also provides a method for reducing or avoiding side effects of AML-targeting therapy, the method comprising administering CLL1 gene knockout hematopoietic stem cells and / or hematopoietic progenitor cells, or administering the pharmaceutical composition described herein, to an AML patient at the same time, before or after administering a CLL1 -targeting drug to the AML patient.

[0105] Further, in the above method, the CLL1 gene knockout hematopoietic stem cells and / or hematopoietic progenitor cells can be prepared by knocking out the CLL1 gene in a recipient cell using any of the sgRNAs or the gene editing compositions described herein.

[0106] The CLL1 gene knockout hematopoietic stem cells and / or hematopoietic progenitor cells contain any of the sgRNAs or the gene editing compositions described herein.

[0107] Further, in the above method, the side effects can be that when a drug targeting CLL1 is administered to an AML patient, the drug kills normal cells (such as myeloid cells, etc.) in the body that contain and / or express CLL1 antigen, in addition to killing tumor cells.

[0108] Further, in the above method, the normal cells also include hematopoietic stem cells and / or hematopoietic progenitor cells, and their differentiated cells (such as myeloid cells, myeloid progenitor cells, lymphoid cells, lymphoid progenitor cells, etc.) that are input into the patient during hematopoietic stem cell transplantation therapy for the AML patient.

[0109] The products described herein can include reagents, preparations, therapeutic kits, drugs, and pharmaceutical compositions, etc.

[0110] The cells or recipient cells described herein can be cell lines or primary cells.

[0111] The hematopoietic stem cells and / or hematopoietic progenitor cells described herein can be derived from bone marrow, umbilical cord blood (umbilical blood), placental tissue, peripheral blood, mobilized peripheral blood, induced pluripotent stem cells, etc., but are not limited thereto.

[0112] The cells, hematopoietic stem cells, hematopoietic progenitor cells, CAR cells, or CAR-T cells described herein can be autologous or non-autologous (allogeneic, syngeneic, or xenogeneic).

[0113] The cells, hematopoietic stem cells, hematopoietic progenitor cells, CAR cells, or CAR-T cells described herein can be autologous or allogeneic.

[0114] The hematopoietic stem cells and / or hematopoietic progenitor cells described herein can be CD34+ cells.

[0115] The CLL1 target-related diseases described herein can be CLL1-positive cancers (i.e., cancers expressing CLL1).

[0116] The CLL1 -positive cancer described herein can be Acute Myeloid Leukemia (AML), Myelodysplastic Syndromes (MDS) or Chronic Myeloid Leukemia (CML) but is not limited thereto.

[0117] The Acute Myeloid Leukemia (AML) described herein can be Refractory and / or Relapsed Acute Myeloid Leukemia (R / R AML).

[0118] The amount administered described herein can be a therapeutically effective amount. The therapeutically effective amount can refer to the amount of a drug that (i) treats or prevents a particular disease, condition, or disorder; (ii) attenuates, ameliorates, or eliminates one or more symptoms of a particular disease, condition, or disorder; or (iii) prevents or delays the onset of one or more symptoms of a particular disease, condition, or disorder described herein. A therapeutically effective amount can be determined by testing in known in vitro or in vivo (e.g., animal models) systems.

[0119] The CLL1 -knockout hematopoietic stem cells and / or hematopoietic progenitor cells described herein can be administered by various methods known in the art. For example, by intravenous injection or continuous infusion, or orally, intradermally, subcutaneously, intramuscularly, intraventricularly or intrathecally, intraperitoneally, intraarterially, intracapsularly or intrapleurally, preferably intravenously.

[0120] The subject described herein can be a human or a non-human animal.

[0121] The non-human animal described herein can be a non-human mammal.

[0122] The non-human mammal described herein can be any one of a mouse, a rat, a guinea pig, a hamster, a pig, a dog, a sheep, a monkey, a rabbit, a cat, a cow, a horse but is not limited thereto.

[0123] The CLL1 gene described herein can be an endogenous CLL1 gene.

[0124] The present application is finally screened out sgRNA capable of realizing efficient gene editing through a series of design, construction and screening, and further researches and develops a gene editing system containing the sgRNA based on the CRISPR / Cas9 technology, and establishes a method for efficiently editing hematopoietic stem cells in vitro by using the sgRNA, and delivers the Cas9-gRNA ribonucleoprotein complex into cells by electroporation, shortens the duration of RNP in cells, and greatly reduces the off-target effect. The sgRNA disclosed in the present application can target and guide the Cas9 protein to efficiently cut the CLL1 gene. Experiments show that the sgRNA of the present application can efficiently, specifically and lowly off-target knockout the CLL1 gene, and the gene editing efficiency can reach more than 77%, and the hematopoietic stem cells after knocking out the CLL1 gene by using the sgRNA of the present application have good myeloid differentiation function, and do not affect the function of the differentiated myeloid cells, and the hematopoietic stem cells and the differentiated myeloid cells after CLL1 gene knockout can effectively avoid the killing effect of CLL1-CAR-T cells, and avoid the toxic side effects of CLL1 CAR-T. The in vivo experimental results further show that the hematopoietic stem cells after knocking out the CLL1 gene by using the sgRNA of the present application have high and long-term hematopoietic reconstitution ability, not only have high self-renewal ability, but also have good differentiation ability. The method of the present application can be used in the combined application of CAR-T cell therapy and hematopoietic stem cell transplantation therapy, can solve the problem of off-target toxicity of CAR-T cells targeting CLL1 to recognize and attack normal myeloid cells, can be used for replacing the standard transplantation therapy for AML patients, can bring higher cure rate for AML patients, and has important clinical value and application prospect for the treatment of AML.

[0125] Definitions of terms

[0126] In the present application, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Meanwhile, in order to better understand the present application, the definitions and explanations of related terms are provided as follows.

[0127] The term "Cas protein (also known as Cas endonuclease)" generally refers to a series of endonucleases having various activities, which can cut target sites under the guidance of guide RNA (gRNA).

[0128] The term "Cas9 protein" generally refers to a Type II CRISPR system Cas endonuclease that forms a complex with crRNA and tracrRNA or with a guide RNA for specific recognition and cleavage of a whole or partial DNA target sequence. Cas9 protein has two distinct domains: an HNH domain and a RuvC domain. The HNH domain is responsible for cleaving the DNA strand (target strand) that is complementary paired with the crRNA (or gRNA), while the RuvC domain is responsible for cleaving the non-complementary strand (non-target strand). The Cas9 protein described in the present invention is not limited to a specific protein as long as it can be used in cooperation with sgRNA (gRNA). The Cas9 protein can be derived from a bacterial species.

[0129] The term "sgRNA (single-guide RNA)" is a component of the CRISPR-Cas system responsible for guiding the Cas protein to recognize and cleave the target nucleic acid molecule. In actual gene editing applications, sgRNA can be directly synthesized, or obtained by plasmid expression or in vitro transcription. In the art, "gRNA" is generally used interchangeably with "sgRNA". "gRNA" and "sgRNA" are also used interchangeably herein. sgRNA generally refers to a single RNA structure artificially engineered from a crRNA / tracrRNA complex (gRNA) with double RNA structure, in which crRNA and tracrRNA are directly (or through a linker) connected. sgRNA comprises a recognition region and a framework region.

[0130] The term "recognition region" can also be referred to as a guide sequence, which is generally a RNA sequence contained in a guide RNA (sgRNA or gRNA) that is identical or complementary to a target sequence or target site (referred to herein as "guide sequence"). The guide sequence generally has sufficient complementarity to the target sequence so as to be able to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence. Perfect complementarity between the guide sequence and the target sequence is preferred, but certain mismatches (such as 1-6 nucleotide mismatches) are also allowed as long as it still leads to the knockout of the gene. The degree of complementarity between the guide sequence and its corresponding target sequence is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Methods for determining the complementarity of two nucleic acid sequences are within the ability of one of ordinary skill in the art.

[0131] The term "scaffold" generally refers to a structure or scaffold RNA sequence required for binding or interacting with RNA-guided nuclease and / or with other RNA molecules (e.g., tracrRNA) in the RNA (sgRNA or gRNA) guide, and can also be referred to as the backbone sequence of sgRNA. The scaffold can be routinely selected by one skilled in the art, for example, the backbone sequence of sgRNA corresponding to Cas9 can be selected, or some mutants constructed on this basis, which still have the function of binding to the corresponding Cas9.

[0132] The term "RNP mixture" also referred to as "RNP complex" generally refers to a complex composed of RNA and protein. In the present application, the RNP mixture can refer to a Cas9 / sgRNA ribonucleoprotein complex (also referred to herein as Cas9-gRNA ribonucleoprotein complex) comprising two components, i.e., sgRNA (or gRNA) and Cas9 protein.

[0133] The term "identity" generally refers to the degree of similarity between two (nucleotide or amino acid) sequences at the same positions in an alignment, and is usually expressed as a percentage. The identity described herein can refer to the identity of nucleotide sequences. Two copies having exactly the same sequence have 100% identity. One skilled in the art knows that the identity of nucleotide sequences can be determined using the identity search site on the Internet, such as the BLAST page of the NCBI homepage website. For example, the value of identity (%) can be obtained by performing a search in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and then calculating the identity of nucleotide sequences using the computer program BLAST, especially BLASTP or TBLASTN, using the default parameters. In the present application, the identity of more than 90% can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more.

[0134] The term "expression cassette" generally refers to a nucleic acid construct comprising nucleic acid elements sufficient to express a gene of interest. A typical expression cassette comprises a promoter, a MCS (multiple cloning site), and a terminator. An expression cassette can also include a gene of interest, a marker gene (such as a TK gene, a DHFR gene, a CAT gene, and a NEO gene), a ribosome recognition and binding site (SD), a transcription factor binding site (TFBS), an enhancer, a silencer, a repressor, an intron, a poly(A) addition signal sequence, and / or an mRNA splicing signal sequence, etc. The elements in an expression cassette can be directly connected or indirectly connected via a linker.

[0135] The term "vector" generally refers to a vehicle capable of carrying foreign DNA or a gene of interest into a host cell for amplification and / or expression. The vector can be a cloning vector or an expression vector. The vector can be introduced into a host cell by transformation, transduction, or transfection, so that the genetic material elements carried by the vector are amplified and / or expressed in the host cell. A person skilled in the art can select a suitable vector according to the purpose of genetic engineering and the properties of the recipient cell. The vector includes but is not limited to: a plasmid, a phage (such as lambda phage or M13 phage), a cosmid (i.e., a Coles plasmid), a phagemid, a shuttle vector (such as a yeast expression vector), a Ti plasmid, an artificial chromosome (such as a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a P1 artificial chromosome (PAC), or a Ti plasmid artificial chromosome (TAC)), a viral vector (such as a baculovirus vector, a retrovirus (including a lentivirus), an adenovirus, an adeno-associated virus, a poxvirus, a papillomavirus, a papovavirus (such as SV40), a herpesvirus (such as a herpes simplex virus)). A vector can contain multiple elements for controlling expression, including but not limited to a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selection element, and a reporter gene. In addition, the vector can also contain a replication initiation site.

[0136] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsia, mycoplasma, chlamydia, spirochetes, algae, and the like. For example, the bacteria can be from Escherichia sp. (e.g., E. coli), Erwinia sp., Agrobacterium sp. (e.g., A. tumefaciens), Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., and Bacillus sp. (e.g., B. subtilis), and the like. The viruses can include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papovavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus), and the like. The fungi can be from Saccharomyces sp. (e.g., S. cerevisiae, S. pombe, S. pichia), Fusarium sp., Rhizoctonia sp., Verticillium sp., Penicillium sp., Aspergillus sp., and Cephalosporium sp., and the like. The actinomycetes can be from Streptomyces sp. (e.g., S. coelicolor). The algae can be from Cyanophyta (e.g., Cyanobacteria), Fucus sp., Achnanthes sp., Amphiprora sp., Amphora sp., Ankistrodesmus sp., Asteromonas sp., and Boekelovia sp., and the like.

[0137] The term "host cell" is also referred to as recipient cell, and generally refers to any type of cell that can be used for introducing a vector, such as plant cells and animal cells. The host cell can be understood to refer not only to the particular recipient cell, but also to the progeny of such a cell, which progeny will in most cases comprise the same genetic material as the original parent cell and which progeny are still included within the scope of the host cell, as a result of natural, accidental, or deliberate mutation and / or alteration. Suitable host cells are known in the art, wherein: the plant cell can be, but is not limited to, Arabidopsis thaliana, Nicotiana tabacum, Zea mays, Oryza sativa, Triticum aestivum, and the like; the animal cell can be, but is not limited to, mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), Chinese hamster ovary subline cells (CHO-K1 cells), African green monkey kidney cells (Vero cells), SV40-transformed African green monkey kidney cells (COS cells), baby hamster kidney cells (BHK cells), mouse mammary tumor cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblast cells, bone marrow cell lines, T cells or NK cells, and the like), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., Xenopus laevis cells or Andrias davidianus cells), fish cells (e.g., grass carp, common carp, rainbow trout, or catfish cells), insect cells (e.g., Sf21 cells or Sf-9 cells), and the like.

[0138] The term "recombinant vector" generally refers to a recombinant DNA molecule constructed in vitro by joining a foreign gene of interest to a vector, which can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the foreign gene of interest into a recipient cell, and provide the foreign gene of interest with the ability to replicate, integrate, amplify, and / or express in the recipient cell.

[0139] The term "recombinant microorganism" generally refers to a recombinant microorganism obtained by manipulating and modifying the genes of a microorganism of interest, so that the function of the recombinant microorganism is changed. For example, a foreign gene of interest or a recombinant vector is introduced into the microorganism of interest, or the endogenous genes of the microorganism of interest are directly genetically edited.

[0140] The term "recombinant host cell" generally refers to a recombinant host cell obtained by manipulating and modifying the genes of a host cell, so that the function of the recombinant host cell is changed. For example, a foreign gene of interest or a recombinant vector is introduced into the host cell, or the endogenous genes of the host cell are directly genetically edited.

[0141] The term "chimeric antigen receptor (CAR)" generally refers to a transmembrane molecule encoded by an artificially constructed fusion gene, which can guide immune cells to specifically track, identify and eliminate tumor cells expressing relevant target ligands, and has high targeting property. The basic structure of CAR can be divided into four parts, from the extracellular to the intracellular direction, which are the extracellular tumor antigen binding region (referred to as the antigen binding region), the hinge region, the transmembrane region and the intracellular signal region.

[0142] The term "chimeric switch receptor (CSR)" generally refers to a modified T cell that is controlled by genetic engineering means to transform the inhibitory signal into an activating signal when it is inhibited by an inhibitory molecule, so that the T cell can still maintain the attack ability in the inhibitory environment. CSR converts the original immunosuppressive signal into an immunoreactive signal by recognizing the ligand of the inhibitory receptor, thereby activating the immune cells and enhancing the anti-tumor activity of CAR-T cells.

[0143] The term "CAR-T cell" generally refers to a T cell expressing a chimeric antigen receptor (CAR), which can specifically recognize and kill cells expressing a target antigen recognized by the chimeric antigen receptor. The definition of CAR-T cell covers all categories and subcategories of T lymphocytes, including CD4+ T cells, CD8+ T cells, γδ T cells, and effector T cells, memory T cells, regulatory T cells, etc.

[0144] The term "CAR cell" generally refers to a type of genetically modified immune effector cell obtained by introducing the gene of a chimeric antigen receptor (CAR) (CAR gene) into an immune effector cell through molecular biology and genetic engineering technology, and expressing the CAR on the surface of the immune effector cell, thereby obtaining a type of genetically modified immune effector cell that can specifically recognize and kill target cells. In contrast to CAR-T cells, CAR cells are not limited to specific T cell types, and CAR cells can include CAR-T cells, CAR-NK cells, CAR-NKT cells, CAR-γδ T cells, CAR-macrophage (CAR-M cell), CAR-iPSC cell and CAR-PSC cell, etc. but not limited thereto.

[0145] The term "CD34+ cell" generally refers to a CD34 positive cell, also known as CD34+ hematopoietic stem cell. CD34 is a hematopoietic stem cell marker. Commonly used hematopoietic stem cell markers also include CD33, ABCG2, CCR2, Lin -, c-kit (CD117), CD133, etc. The isolation of hematopoietic stem cells using hematopoietic stem cell markers by immunological methods (e.g., fluorescence-activated cell sorting (FACS), immunomagnetic bead technology, immunoadsorbent column technology, affinity separation technology, PANNING technology) is well known to those skilled in the art. CD34+ cells can be enriched / selected by any technique known to those skilled in the art. For example, in one embodiment of the present application, CD34+ cells in mobilized peripheral blood are enriched / selected by magnetic bead sorting using anti-human CD34 conjugated magnetic beads. In the present application, CD34+ cells are derived from mobilized peripheral blood of healthy volunteers, hematopoietic stem cells in bone marrow blood are mobilized into peripheral blood by methods using injection of mobilizing agents (including but not limited to granulocyte colony-stimulating factor (G-CSF), Plerixafor, granulocyte-macrophage colony-stimulating factor (GM-CSF)), and further collection of mobilized peripheral blood is obtained. CD34+ cells can also be purchased commercially, or obtained from clinical samples (such as bone marrow, umbilical cord blood, placental tissue, peripheral blood, mobilized peripheral blood).

[0146] The term "penetratin" is also known as cell-penetrating peptide, cell-penetrating peptide or internalization peptide, which functions to facilitate the uptake and absorption of proteins or polypeptides bound thereto by cells, i.e., to bring proteins or polypeptides into cells to exert biological activity. Such substances are long or short polypeptide fragments with positive charges, which are rich in basic amino acid residues such as arginine and lysine, and have an alpha-helix spatial conformation in secondary structure.

[0147] The term "endogenous" generally refers to any substance from or produced inside a biological, cellular, tissue or system.

[0148] The term "exogenous" generally refers to any substance introduced from or produced outside a biological, cellular, tissue or system.

[0149] The term "autologous" generally refers to cells from the same subject.

[0150] The term "allogeneic" generally refers to cells of the same species that are genetically different from the cells being compared.

[0151] The term "syngeneic" generally refers to cells of a different subject that are genetically identical to the cells being compared.

[0152] The term "xenogeneic" generally refers to cells of a different species from the cells being compared.

[0153] The term "prevention" generally refers to a method performed to prevent or delay the occurrence of a disease or disorder or a symptom in a subject.

[0154] The term "treatment" generally refers to the methods performed with the intent to obtain a beneficial or desired clinical result. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Further, treatment can also mean prolonging survival as compared to expected survival if the subject is not receiving treatment. BRIEF DESCRIPTION OF DRAWINGS

[0155] Figure 1 is the knockout efficiency of CLL1 sgRNA on U937 cell line and the CLL1 expression detection results of the CLL1 knockout cell line in Example 1.

[0156] Figure 2 is the verification results that CLL1 knockout cell line (U937) cannot be recognized and killed by CLL1 CAR-T in Example 2.

[0157] Figure 3 is the knockout efficiency of CLL1 sgRNA on hematopoietic stem cells in Example 3.

[0158] Figure 4 is the in vitro myeloid differentiation of CLL1 knockout hematopoietic stem cells and the functional identification results thereof in Example 4.

[0159] Figure 5 is the verification results that CLL1 knockout hematopoietic stem cells can avoid the killing of their differentiated myeloid cells by CLL1 CAR-T in Example 5.

[0160] Figure 6 is the hematopoietic reconstitution experiment results of CLL1 knockout hematopoietic stem cells in immunodeficient mice in Example 6.

[0161] Figure 7 is a schematic diagram of the structure of the CAR molecule in the CLL1 CAR-T cells of the present application. Embodiments of the present application

[0162] The present application will be further described in conjunction with the specific embodiments, and the examples given are only to illustrate the present application, not to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.

[0163] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0164] U937 cells (CLL1 positive cells) in the following examples were from the Concordia Cell Bank, resource number: 1101HUM-PUMC000059.

[0165] Human CD34+ cells in the following examples were from mobilized peripheral blood of healthy volunteers, which were mobilized from bone marrow blood to peripheral blood by injecting mobilization agent G-CSF, and were collected from the mobilized peripheral blood.

[0166] sgRNA in the following examples was synthesized by Genscript.

[0167] Graphpad statistical software was used to process data in the following examples, the experimental results were expressed as mean ± standard deviation, one-way ANOVA method was used, P<0.05 (*) represented statistically significant difference, P<0.01 (**) represented statistically significant difference, P<0.001 (***) represented extremely statistically significant difference. Quantitative experiments in the following examples, unless otherwise specified, were set up in triplicate, and the results were averaged.

[0168] Retroviral vector MP71 in the following examples was recorded in the following literature: Engels B, Cam H, et al. Retroviral Vectors for High-Level Transgene Expression in T Lymphocytes [J]. Human Gene Therapy, 2003, 14(12): 1155-1168. The biological material was available to the public from the applicant, which was only used for repeating the experiments of the present application, and could not be used for other purposes.

[0169] Peripheral blood mononuclear cells (PBMC) in the following examples were from the venous blood of healthy volunteers.

[0170] The CLL1 DE CAR-CR gene (nucleotide sequence is SEQ ID NO: 13) in the following example expresses a CAR molecule targeting CLL1, and the structure of the CAR molecule is shown in Figure 7. From N-terminus to C-terminus, it is signal peptide (Signal), single-domain antibody 1 specifically targeting CLL1, linker, single-domain antibody 2 specifically targeting CLL1, CD8a hinge region (Hinge), CD8a transmembrane region, costimulatory domain 4-1BB, activation domain CD3 zeta, self-cleavage peptide P2A, and chimeric switch receptor PD-1 & CD27. Among them: the CAR molecule shown in Figure 7 is a chimeric antigen receptor part before P2A, and the amino acid sequence is shown in SEQ ID NO: 14; the chimeric switch receptor part after P2A, and the amino acid sequence is shown in SEQ ID NO: 15.

[0171] The CLL1 CAR-T cell preparation method in the following example is as follows:

[0172] 1. Construction of CLL1 CAR expression vector

[0173] (1) The recombinant vector pUC57-CLL1 DE CAR-CR was double digested with NotI and EcoRI, and the target gene fragment was recovered by gel recovery. The recombinant vector pUC57-CLL1 DE CAR-CR is a recombinant vector obtained by cloning the CLL1 DE CAR-CR gene (SEQ ID NO: 13) into the pUC57 vector, which is synthesized and provided by GenScript Biotech Co., Ltd.

[0174] (2) The retroviral vector MP71 was double digested with NotI and EcoRI, and the large fragment of the vector was recovered by gel recovery.

[0175] (3) The target gene fragment and the large fragment of the vector were connected with T4 ligase to obtain the recombinant retroviral vector MP71-CLL1 DE CAR-CR carrying the CLL1 DE CAR-CR gene.

[0176] (4) The recombinant retroviral vector MP71-CLL1 DE CAR-CR was transformed into competent E. coli DH5a, and the Qiagen plasmid purification kit was used to extract and purify the plasmid to obtain the MP71-CLL1 DE CAR-CR plasmid.

[0177] The recombinant retrovirus vector MP71-CLL1 DE CAR-CR (i.e. MP71-CLL1 DE CAR-CR plasmid) is that the fragment (small fragment) between the NotI and EcoRI recognition sites of the retrovirus vector MP71 is replaced by the DNA fragment whose nucleotide sequence is SEQ ID NO: 13 in the sequence listing, and the other nucleotide sequences of the retrovirus vector MP71 are kept unchanged, to obtain the recombinant expression vector.

[0178] 2. Retrovirus packaging

[0179] The MP71-CLL1 DE CAR-CR plasmid prepared in step 1 is introduced into a packaging cell for packaging, and the virus assembly is completed to obtain a retrovirus. The specific steps of virus packaging are as follows:

[0180] a) Day 1: Phoenix-ECO cells should be less than 20 passages, but not too full. Plate at a cell density of 0.5 x 10 6 / ml, add 10 mL of DMEM medium (10% Fetal Bovine Serum, 2 mM L-glutamine, 1% Penicillin / Streptomycin) to a 10 cm cell culture dish, mix the cells thoroughly, and incubate at 37°C overnight;

[0181] b) Day 2: Transfect when the confluence of ECO cells reaches about 90% (usually 14-18 h after plating), and add chloroquine half an hour before transfection; prepare 15 μg of plasmid, 1.5 M CaCl2 250 μL, add H2O 1 ml, to a total volume of 1.25 mL; add an equal volume of 2x HBS to the plasmid complex, mix well, and incubate at room temperature for 15 minutes; then add the mixture to the ECO cell dish. Incubate at 37°C for 6 h, remove the culture medium, wash once with PBS, and add 10 ml of preheated fresh culture medium;

[0182] c) Day 4: Collect the supernatant 48 h after transfection, filter it with a 0.45 μm filter to obtain a retrovirus solution, and store it at -80°C;

[0183] d) Add 1.2 mL of 15 ug / mL Retronectin coating solution to each well of a 6-well plate, and incubate overnight at 4°C;

[0184] e) Carefully aspirate the blocking solution, wash with 2 mL / well of PBS, add 5 mL of the above virus solution to each well, centrifuge at 2000 x g for 2 h at 32°C, and aspirate the unbound virus supernatant;

[0185] f) Take logarithmic phase PG13 cells with 10 mL PBS wash once, add 1 mL 0.25% recombinant trypsin, room temperature for 2-3 min;

[0186] g) Add 5 ml complete medium containing 10% FBS to terminate digestion, centrifuge at 1500 rpm for 5 min;

[0187] h) Discard the supernatant, adjust the cell density to 0.5x10 5 cell / mL with complete medium, add 3 mL / well to the above virus-coated NTC 6-well plate, so that the final cell number is 1.5x10 5 cell / well;

[0188] i) 37°C, 5% CO2 culture for 48 h;

[0189] j) After 1-2 passages, transfer to T175 culture flask and culture with DEME medium containing 12% FBS for 2 d;

[0190] k) Replace new DEME medium containing 12% FBS and continue to culture for 48 h, then collect the supernatant, filter with 0.45 μm filter to obtain the retrovirus solution, and store at -80°C.

[0191] 3. Retrovirus infection of human T cells

[0192] a) Thaw the frozen healthy human peripheral blood PBMC, and adjust the cell density to 1x10 6 -2x10 6 cells / mL with RPMI-1640 medium containing 10% fetal bovine serum (FBS).

[0193] b) Isolate PBMC to obtain lymphocytes using Ficoll separation solution (Tianjin Haoyang, LTS1077-1), and then isolate CD3+ T cells by magnetic bead method (Miltenyi). Add clinical grade Dynabeads Human T Expander CD3 / CD28 magnetic beads (Invitrogen) to activate T cells at a ratio of magnetic beads: CD3+ cells = 3:1, and culture T cells in a 24-well cell culture plate to obtain activated T cell suspension.

[0194] c) Coat non-tissue treated culture plates with RetroNectin (TAKARA) diluted with PBS to a final concentration of 15 μg / mL, 1.2 mL per well of a 6-well plate. Avoid light, 4°C overnight for standby use.

[0195] d) After two days of T cell activation culture, remove the coated 6-well plate, aspirate the coating solution, and wash the plate once with PBS.

[0196] e) The retrovirus solution prepared in step 2 is added into the wells, 5-6 mL per well, centrifuged at 2000 x g for 2 h at 32°C, and the supernatant is discarded. 3 mL of activated T cell suspension containing hIL-2 (500 U / mL) is added to each well, and the culture is continued for 1 day.

[0197] f) After the cells are infected, the cell density is observed every day, and T cell culture medium containing 500 U / mL IL-2 is added in time to maintain the T cell density at about 5 x 10 5 / mL, which facilitates cell expansion.

[0198] Thus, T cells infected with the retrovirus prepared in step 2, i.e. CLL1 CAR-T cells, are obtained, which contain and express the CLL1 DE CAR-CR gene with the nucleotide sequence of SEQ ID NO: 13.

[0199] Example 1, Design of sgRNA Targeting CLL1 and Verification of Gene Editing Efficiency at Cell Level

[0200] 1. Design of sgRNA sequence

[0201] The sgRNA sequence targeting the human CLL1 gene (GenBank Accession No. 160364 (Update Date 27-May-2024) at positions 9,971,409-9,985,595) was predicted by the Invitrogen online design website (https: / / www.thermofisher.cn / cn / zh / home / life-science / genome-editing / crispr-libraries / trueguide-grnas.html). After preliminary screening, 3 sgRNA sequences with relatively high knockout efficiency were obtained. The DNA sequence encoding the sgRNA2 recognition region is: 5'-CCAATCCAATGAGCAACAGA-3' (SEQ ID NO: 1), the DNA sequence encoding the sgRNA3 recognition region is: 5'-TAGCTCACGACATAATTTGG-3' (SEQ ID NO: 2), and the DNA sequence encoding the sgRNA4 recognition region is: 5'-GTTGTAGAGAAATATTTCTC-3' (SEQ ID NO: 3). The nucleotide sequence of the sgRNA framework region is: 5'-GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 4). The full-length sgRNA is composed of a recognition region and a framework region, wherein the framework region is responsible for binding to the Cas protein; the recognition region is responsible for binding to the target of the CLL1 gene and guiding the Cas protein to the target. The designed full-length sgRNA sequence is shown below (the underlined part is the recognition region sequence of sgRNA):

[0202] sgRNA2:

[0203] 5'-CCAAUCCAAUGAGCAACAGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 5);

[0204] sgRNA3:

[0205] 5'-UAGCUCACGACAUAAUUUGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 6);

[0206] sgRNA4:

[0207] 5'-GUUGUAGAGAAAUAUUUCUCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 7).

[0208] The DNA sequence encoding sgRNA2 is: 5'-CCAATCCAATGAGCAACAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO: 8);

[0209] The DNA sequence encoding sgRNA3 is: 5'-TAGCTCACGACATAATTTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO: 9);

[0210] The DNA sequence encoding sgRNA4 is: 5'-GTTGTAGAGAAATATTTCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (SEQ ID NO: 10).

[0211] 2. Knockout of CLL1 in U937 cell line

[0212] Log phase growing U937 cells were transferred to 15 mL centrifuge tubes, centrifuged at 1,000 rpm for 5 minutes, and the cells were harvested. The supernatant was discarded, and the cells were resuspended in DPBS, centrifuged at 1,000 rpm for 5 minutes, and the DPBS was aspirated and discarded. The U937 cells were resuspended using resuspension buffer SF (LONZA SF Cell Line 4D-Nucleofector TM XKit S, Cat. No. V4XC-2032) at a final concentration of 1 x 10 8cells / ml. Add 3 pg of Cas9 protein (Thermo Fisher product, item number: A50577) and 1 pg of sgRNA into a sterile, DNase / RNase-free 1.5 ml centrifuge tube, and incubate at room temperature for 10 minutes to form an RNP mixture (Cas9-gRNA ribonucleoprotein complex). Then add to 20 pl of cell suspension, mix gently, and incubate at room temperature for about 2 minutes.

[0213] Start LONZA 4D-Nucleofector TM Electroporator, call specific electroporation program FS-100, transfer the mixed solution to the 16-hole Nucleocuvette TM In the electroporation plate, gently tap the Nucleocuvette TM Electroporation plate, make sure that the sample solution covers the bottom of the electroporation hole. Cover the cover, and place the electroporation plate in the 4D-Nucleofector TM Start the electroporation process in the X Unit plate slot. After the run is complete, transfer the cells from the electroporation plate to the preheated medium (Gibco TM RPMI 1640 medium, item number: 11875119, 10% Gibco TM Fetal bovine serum, item number: 10091148), and incubate in a 37°C / 5% CO2 incubator for 2 days.

[0214] Then count the U937 cells for extraction of genomic DNA, according to the kit (TaKaRa MiniBEST Universal Genomic DNA, item number: 9765) instructions. Use Fast PCR Master Mix (TAKARA, item number: RR350A), F primer (5'-AATGATAAAGGATGATGGCTCT-3', SEQ ID NO: 11), R primer (5'-TTCTTCTAACTGCGTGGAAAT-3', SEQ ID NO: 12) to perform PCR amplification of the target fragment, and the reaction conditions and procedures are shown in Table 1 and Table 2:

[0215] Table 1, PCR amplification reaction system

[0216] Table 2, PCR amplification reaction procedure

[0217] After the PCR reaction, the PCR product was sent to GenScript for PCR product sequencing, and the gene editing efficiency was verified using the website https: / / tide.nki.nl / .

[0218] As shown in Figure 1A, all three sgRNAs had good knockout efficiency, and sgRNA3 had the highest editing efficiency, which could reach 77%. Therefore, sgRNA3 was used for CLL1 gene editing in subsequent experiments.

[0219] 3. CLL1 gene knockout line (U937) construction

[0220] The control cells (U937) and the U937 cells after electroporation (named U937- CLL1KO) were taken out from the culture wells, counted, and adjusted to 5-10 cells / ml. 100 μl of diluted cells were added to each well of a 96-well cell plate. It was placed in a 37°C / 5% CO2 incubator. Half of the medium was changed on the 7th day, and the medium was changed every 2-3 days thereafter. Cell clones were observed under a microscope, and only one cell well was marked. When the cell number was sufficient (about 21 days), the expression of CLL1 was detected by flow cytometry.

[0221] U937 cells and U937-CLL1KO cells were taken out and added with flow cytometry antibody APC anti-human CD371 (CLEC12A) Antibody (BioLegend, item number: 353606). After incubation at room temperature for 15 minutes in the dark, centrifugation was performed at 1,000 rpm for 5 minutes, and the cells were resuspended with 200 μL FACS buffer and transferred to a 1.2 mL flow cytometry tube. The cells were read on a flow cytometer (BD Canto-II), and the expression of CLL1 was analyzed.

[0222] As shown in Figure 1B, the expression of CLL1 could be detected on U937 cells, but not on the knockout cell line. This result again proved that sgRNA3 could effectively knockout the CLL1 gene on U937 cells and could be used for subsequent CLL1 gene knockout on hematopoietic stem cells.

[0223] Example 2, CLL1 knockout cell line (U937) cells cannot be recognized and killed by CLL1 CAR-T

[0224] To verify the function of CLL1 knockout cells, we co-incubated CLL1 CAR-T cells (2 x 10 5 ) and U937-CLL1KO cells (6 x 10 5 ) for 4 h. The control group CTR-T was unactivated T cells (2 x 10 5CD107a expression. CD107a is a marker of T cell degranulation, and its expression level is related to the killing activity of T cells. After incubation, flow cytometry staining was performed, 20 pL of diluted antibody PerCP / Cyanine5.5 anti-human CD8 (BioLegend, item number: 980918) and APC anti-human CD107a Antibody (BioLegend, item number: 328620) were added to each well, and incubated at room temperature for 20 min in the dark. Centrifuge at 1500 rpm for 5 min. After discarding the supernatant, resuspend the cells with 400 pL FACS buffer and transfer to flow reading tubes, and read the cells with a flow cytometer (BD Canto-II).

[0225] The results are shown in Figure 2: the proportion of CD107a+T cells in CLL1 CAR-T and U937 co-incubated cells was 23.82%, and CLL1 CAR-T cells could recognize and kill CLL1+U937 cells. The proportion of CD107a+T cells in CLL1 CAR-T and U937-CLL1KO co-incubated cells was 4.00%, and the proportion of negative control co-incubated with CLL1 CAR-T medium was similar. The results show that CLL1 knockout cells cannot be recognized by CLL1 CAR-T cells, so as to avoid the killing of CLL1 CAR-T cells.

[0226] Example 3, Gene editing of hematopoietic stem cells

[0227] 1. Preparation of sorted hematopoietic stem cells (CD34+ cells)

[0228] Mobilized peripheral blood (1 x 10 9 ) was centrifuged at 1500 rpm for 5 min, the supernatant was discarded, and the cells were resuspended with 20 mL DPBS (Gibco, item number: 14190144) + 0.5% HSA (Takeda, batch number: A1X477A). Centrifuge at 1500 rpm for 5 min, discard the supernatant, add 2 mL 0.5% HSA-PBS and 1 ml magnetic beads (Miltenyi CD34 MicroBead Kit, human, item number: 130-046-702) and incubate at room temperature for 30 min.

[0229] After incubation, 20 mL DPBS (Gibco, Cat# 14190144) + 0.5% HSA (Takeda, Lot: A1X477A) was added, and a 70 pm white cell strainer was placed on a 50 mL centrifuge tube to filter the cell suspension. The cell suspension was centrifuged at 1500 rpm for 5 minutes, and the supernatant was discarded. 3 mL of 0.5% HSA-PBS was added to resuspend the cells, and a Miltenyi LS column (Cat# 130-042-401) was carefully clamped on a MACS Multistand. A 15 mL centrifuge tube was placed under the LS column, and 3 mL of 0.5% HSA-PBS was added to rinse the LS column. The cell suspension was added to the LS column, and after the cell suspension was completely dropped, the LS column was washed with 0.5% HSA-PBS three times, each time with 3 mL until the liquid was completely dropped. A new 15 mL centrifuge tube was opened, and the LS column was removed from the MACS Multistand and placed on the 15 mL centrifuge tube. 1 mL of medium (StemSpan SFEMII, Cat# 09605) was added to the LS column, and the cells were quickly pressed into the 15 mL centrifuge tube with a plunger. CD34+ cells were obtained by separation.

[0230] 2. Gene editing of hematopoietic stem cells (CD34+ cells)

[0231] The CD34+ cells were placed in StemSpan SFEMII complete medium (configuration method: add the following cytokines to StemSpan SFEMII medium: SCF (R&D BT-SCF-100), FLT-3L (R&D BT-FT3L-100), TPO (R&D 288-TPE-100), and IL-6 (R&D 206-IL-050 / CF), and the amount of cytokine used was 100 ng / mL) at a cell density of 0.2 x 10 6 / ml, and the cells were cultured in a 37°C / 5% CO2 incubator for 2 days.

[0232] The CD34+ cells were transferred to a 15 mL centrifuge tube, centrifuged at 1,000 rpm for 5 minutes, and the cells were harvested. The supernatant was discarded, and the cells were resuspended in DPBS, centrifuged at 1,000 rpm for 5 minutes, and the DPBS was aspirated and discarded. The CD34+ cells were resuspended using resuspension buffer P3 (P3 Primary Cell 4D-Nucleofector TM X Kit S, Cat# V4XP-3032) at a final concentration of 2 x 10 7cells / ml. Add 3 pg Cas9 protein (Thermo Fisher product, Cat No: A50577) and 2 pg sgRNA into a sterile, DNase / RNase-free 1.5 ml centrifuge tube, incubate at room temperature for 10 minutes to form RNP mixture. Then add to 20 pl cell suspension, mix gently, and incubate at room temperature for about 2 minutes.

[0233] Start LONZA 4D-Nucleofector TM Electroporator, call specific electroporation program DZ-100, transfer the mixed solution to the 16-hole Nucleocuvette TM In the electroporation plate, gently tap the Nucleocuvette TM In the electroporation plate, make sure that the sample solution covers the bottom of the electroporation hole. Cover the cover, and place the electroporation plate in the 4D-Nucleofector TM Start the electroporation process in the X Unit's plate slot. After the run is complete, transfer the cells from the electroporation plate to the preheated medium (StemSpan SFEMII complete medium) and place it in a 37°C / 5% CO2 incubator for 2 days to obtain CLL1 gene knockout hematopoietic stem cells, named CLL1KO CD34+ cells. Then extract the genomic DNA of CLL1 gene knockout CD34+ cells to detect editing by PCR (see the gene editing efficiency detection steps in step 2 of Example 1 for details).

[0234] The results are shown in Figure 3. sgRNA3 also has a high knockout efficiency on hematopoietic stem cells, and the gene editing efficiency can reach 77.1%.

[0235] Example 4, in vitro myeloid differentiation of CLL1 gene knockout hematopoietic stem cells and functional identification

[0236] 1. In vitro myeloid differentiation

[0237] After electroporation of CD34+ cells, prepare the myeloid differentiation medium: StemSpan SFEMII (Cat No: 09605) + 10% StemSpan TM Myeloid Expansion Supplement (Cat No: 02693). CLL1KO CD34+ cells were plated on a cell plate at a density of 10000 cells / ml, and the cells were incubated in a 37°C / 5% CO2 incubator for 14 days. Adjust the cell density to 1 x 10 5 cells / ml every 3-4 days.

[0238] On day 14, cells were taken for flow analysis to analyze the proportion of CD14, CD33, CD11b and CLL1 in the cells. Add 20 μL of diluted antibody FITC anti-human CD14 Antibody (BioLegend, Cat No: 325604), APC / Cyanine7 anti-human CD33 Antibody (BioLegend, Cat No: 366614), PE / Cyanine7 anti-human CD11b Antibody (BioLegend, Cat No: 301412), APC anti-human CD371 (CLEC12A) Antibody (BioLegend, Cat No: 353606) to each well, incubate in the dark at room temperature for 20 min. Centrifuge at 1500 rpm for 5 min. After discarding the supernatant, resuspend the cells with 400 μL of FACS buffer and transfer them to a flow reading tube, and read the cells with a flow cytometer (BD Canto-II).

[0239] The results are shown in Figure 4A, the proportion of CLL1 in the gene editing group (15.2%) is much lower than that in the control group (92.1%), indicating that the CLL1 gene has reached the expected knockout efficiency. The proportion of CD14, CD33 and CD11b in the cells is similar in the control group and the gene editing group, indicating that CLL1 knockout does not affect the myeloid differentiation function of hematopoietic stem cells.

[0240] 2. In vitro functional experiment

[0241] Take the above differentiated cells for functional analysis, add 15 ng / μl PMA (MCE, Cat No: HY-18739) for treatment, detect and quantify reactive oxygen species (ROS) in the cells, refer to the reagent instruction manual (Invitrogen TM CellROX TM Green Flow Cytometry Assay Kit Cat No: C10492). The results are shown in Figure 4B, after PMA treatment, ROS can be induced in the cells, and the results of the control group and the CLL1 gene editing group are similar.

[0242] Take the above differentiated cells for functional analysis, add LPS (Invitrogen TM eBioscience TMCells were treated with lipopolysaccharide (LPS) solution (500×, catalog number: 00-4976-93) for 4 hours, then incubated with IL-6 antibody (BioLegnd PE anti-human IL-6 Antibody, catalog number: 501107) at room temperature in the dark for 20 minutes. After centrifugation at 1500 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in 400 μL of FACS buffer and transferred to flow cytometry tubes. Cells were read using a flow cytometer (BD Canto-II). The results are shown in Figure 4C. LPS treatment induced IL-6 secretion in differentiated cells, with similar results in the control group and the CLL1 gene-edited group.

[0243] The above results indicate that CLL1 gene knockout does not affect the function of myeloid cells differentiated from hematopoietic stem cells.

[0244] Example 5: CLL1 gene knockout hematopoietic stem cells can avoid the killing of differentiated myeloid cells by CLL1-CAR-T.

[0245] Cells from the control group and gene-edited group on day 14 of myeloid differentiation were co-incubated with CLL1 CAR-T cells to observe the killing effect of CLL1 CAR-T cells on myeloid cells differentiated from CLL1 gene knockout hematopoietic stem cells (hereinafter referred to as differentiated myeloid cells). CLL1 CAR-T cells (2×10⁻⁶ cells) were used to further investigate the effect. 5 ) and differentiated myeloid cells (6×10 5 Cells were co-incubated for 4 hours. The +medium group consisted of CLL1 CAR-T cells and Gibco medium. TM RPMI 1640 culture medium, catalog number: 11875119+10% Gibco TM Fetal bovine serum (catalog number: 10091148) was co-incubated to detect CD33 expression. CD33 is a marker of myeloid cells.

[0246] After 4 hours of incubation, flow cytometry staining was performed. 20 μL of diluted PE anti-human CD3 Antibody (BioLegend, catalog number: 317308) and APC / Cyanine7 anti-human CD33 Antibody (BioLegend, catalog number: 366614) were added to each well, and the cells were incubated at room temperature in the dark for 20 minutes. The cells were then centrifuged at 1500 rpm for 5 minutes. After discarding the supernatant, the cells were resuspended in 400 μL of FACS buffer and transferred to flow cytometry reading tubes. Cells were read using a flow cytometer (BD Canto-II).

[0247] As shown in FIG. 5A, after co-incubation with CLL1 CAR-T cells, the proportion of CD33 in unedited cells was 4.73%, and the proportion of CD33 in the gene editing group was 15.7%. Then, CD3- was gated, and the cells were further analyzed, as shown in FIG. 5B, CLL1 gene knockout was normal, and the proportion of CD33 in the control group was 6.29%, and the proportion of CD33 in the CLL1 gene editing group was 25.04%. Therefore, after CLL1 knockout, myeloid cells can be avoided from being killed by CLL1 CAR-T, and the side effects of CLL1 CAR-T can be avoided.

[0248] Example 6, Hematopoietic reconstitution of CLL1 gene knockout hematopoietic stem cells in immunodeficient mice

[0249] Hematopoietic reconstitution was performed using an immunodeficient mouse model huHSC-B-NDG MGMT3 mice (Biosafe, Catalog No: 112479), and 1x10 6 CLL1KO CD34+ cells, 12 weeks after transplantation, bone marrow was detected for the proportion of hCD45+ cells and the like.

[0250] As shown in FIG. 6, 12 weeks after transplantation, the proportion of hCD45+ cells in B-NDG MGMT3 mice reached 30% in the bone marrow, indicating that human hematopoietic stem cells have been successfully reconstituted, and CLL1 gene knockout hematopoietic stem cells have high and long-term hematopoietic reconstitution ability. The proportion of CLL1 in the control group and the CLL1 gene editing group in B-NDG MGMT3 mice was about 28% and 6%, respectively, indicating that the CLL1 knockout efficiency also reached the expected value. The proportion of myeloid cells (CD33+ cells) in the control group and the gene editing group was similar, both accounting for about 34%. The results again proved that CLL1 knockout does not affect the differentiation of myeloid cells, and CLL1 gene knockout hematopoietic stem cells not only have a high self-renewal ability, but also have a good differentiation ability.

[0251] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In general, according to the principle of the present application, the present application is intended to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Industrial applicability

[0252] The sgRNA disclosed in the application can target and guide the Cas9 protein to efficiently cut the CLL1 gene. Experiments show that the sgRNA of the application can efficiently, specifically and low-off-target knockout the CLL1 gene, and the gene editing efficiency can reach more than 77%. The hematopoietic stem cells after the CLL1 gene is knocked out by the sgRNA of the application have good myeloid differentiation function, and meanwhile, the function of the differentiated myeloid cells is not affected. The hematopoietic stem cells and the differentiated myeloid cells after the CLL1 gene is knocked out can effectively avoid the killing effect of CLL1-CAR-T cells, and avoid the toxic side effects of CLL1 CAR-T. The in vivo experimental results further show that the hematopoietic stem cells after the CLL1 gene is knocked out by the sgRNA of the application have high and long-term hematopoietic reconstitution ability, and have high self-renewal ability and good differentiation ability. The method of the application can be used in the combined application of CAR-T cell therapy and hematopoietic stem cell transplantation therapy, can solve the problem of off-target toxicity caused by the CAR-T cells targeting CLL1 recognizing and attacking normal myeloid cells, and can be used to replace the standard transplantation therapy for AML patients, so as to bring higher cure rate for AML patients, and has important clinical value and application prospect for the treatment of AML.

[0253] Cross-reference to Related Applications

[0254] The present application claims priority from a Chinese patent application No. 202410776473.4 filed on June 17, 2024 and entitled "A method for hematopoietic stem cell gene editing, composition and application thereof", the whole content of which is incorporated herein by reference.

Claims

1. sgRNA, characterized in that, The sgRNA comprises a recognition region and a framework region, the nucleotide sequence of the recognition region is 1-20 of SEQ ID NO: 5, 1-20 of SEQ ID NO: 6 or 1-20 of SEQ ID NO:

7.

2. The sgRNA of claim 1, wherein, The nucleotide sequence of the framework region is SEQ ID NO: 4 or a sequence having more than 90% identity with the nucleotide sequence defined by SEQ ID NO: 4 and having the same function.

3. The sgRNA of claim 1 or 2, wherein, The nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO:

7.

4. Biomaterial, characterized in that, The biological material is any one of the following: A1) a DNA molecule encoding the sgRNA of any one of claims 1-3; A2) an expression cassette containing the DNA molecule of A1); A3) a recombinant vector containing the DNA molecule of A1); A4) a recombinant microorganism containing the DNA molecule of A1); A5) a recombinant host cell containing the DNA molecule of A1).

5. A gene editing composition, comprising, The gene editing composition comprises B1) and B2): B1) the sgRNA of any one of claims 1-3, or the biological material of claim 4; B2) a Cas protein or a nucleic acid molecule encoding a Cas protein.

6. The gene editing composition of claim 5, wherein, The Cas protein is selected from Cas9, Cas12a, Cas12b, Cas12i3, Cas13a, Cas13b and Cas13c.

7. Use of the sgRNA of any one of claims 1-3, the biological material of claim 4, or the gene editing composition of claim 5 or 6 in any one of the following: C1) in specific recognition of CLL1 gene; C2) in knocking out CLL1 gene; C3) in preparing a reagent or kit for knocking out CLL1 gene; C4) in preparing a CLL1 gene knockout cell; C5) in preparing a product for preventing or treating CLL1 target point related diseases; C6) in preparing a product for treating CLL1 target point related diseases in combination with CLL1 targeted CAR cells.

8. A method of making a CLL1 knockout cell, comprising, The method comprises knocking out CLL1 gene in a recipient cell using the sgRNA of any one of claims 1-3 or the gene editing composition of claim 5 or 6.

9. The method of claim 8, wherein, The knocking out CLL1 gene in a recipient cell is by contacting CLL1 gene in the recipient cell with the sgRNA of any one of claims 1-3 and a Cas protein.

10. The method of claim 9, wherein, The step of contacting is performed by D1) and D2) as follows: D1) directly introducing the sgRNA of any one of claims 1-3 into the recipient cell, or first constructing a DNA molecule encoding the sgRNA of any one of claims 1-3 into an expression vector and then introducing into the recipient cell; D2) directly introducing the Cas protein or mRNA of the Cas protein into the recipient cell, or first constructing a DNA molecule encoding the Cas protein into an expression vector and then introducing the expression vector into the recipient cell, or fusing the Cas protein with a transmembrane peptide and introducing the Cas protein into the recipient cell through the transmembrane peptide.

11. The method according to any one of claims 8-10, characterized in that, The method comprises the following steps: (1) mixing an sgRNA with a nucleotide sequence as shown in SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 with a Cas9 protein to obtain an RNP complex; (2) introducing the RNP complex into the recipient cell by an electroporation method to obtain a recombinant cell; (3) culturing the recombinant cell, extracting genomic DNA, and detecting gene editing.

12. The method according to any one of claims 8-11, characterized by, The recipient cell is a cell containing an endogenous CLL1 gene, a cell expressing CLL1 antigen, a hematopoietic stem cell, a hematopoietic progenitor cell, an AML cell or a leukemia stem cell.

13. A CLL1 gene knockout cell obtained by the method of any one of claims 8-12, wherein the CLL1 gene knockout cell contains the sgRNA of any one of claims 1-3 or the gene editing composition of claim 5 or 6.

14. Use of the CLL1 gene knockout cell of claim 13 in the preparation of a product for preventing or treating a CLL1 target point related disease, wherein the CLL1 gene knockout cell is a CLL1 gene knockout hematopoietic stem cell and / or a CLL1 gene knockout hematopoietic progenitor cell.

15. Use of the CLL1 gene knockout cell of claim 13 in combination with a CLL1 targeting CAR cell in the preparation of a product for preventing or treating a CLL1 target point related disease, wherein the CLL1 gene knockout cell is a CLL1 gene knockout hematopoietic stem cell and / or a CLL1 gene knockout hematopoietic progenitor cell.

16. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the CLL1 gene knockout cell of claim 13, and one or more pharmaceutically acceptable carriers; and the CLL1 gene knockout cell is a CLL1 gene knockout hematopoietic stem cell and / or a CLL1 gene knockout hematopoietic progenitor cell.

17. A method for preventing or treating a CLL1 target-related disease, comprising administering a CLL1 binding agent to a subject in need thereof. The method comprises administering to a subject suffering from a CLL1 target point related disease: (1) a CLL1 targeting drug; (2) a CLL1 gene knockout hematopoietic stem cell and / or a CLL1 gene knockout hematopoietic progenitor cell, or the pharmaceutical composition of claim 16.

18. The method of claim 17, wherein, The CLL1 gene knockout hematopoietic stem cell and / or the CLL1 gene knockout hematopoietic progenitor cell is prepared by knocking out the CLL1 gene in a recipient cell using the sgRNA of any one of claims 1-3 or the gene editing composition of claim 5 or 6.

19. The method of any one of claims 17 or 18, wherein, The CLL1 targeting drug comprises a CLL1 targeting CAR cell or an antibody.

20. The method of any one of claims 17-19, wherein, The CLL1 targeting drug is a CAR-T cell.

21. The method of claim 20, wherein, The CAR-T cell comprises a chimeric antigen receptor, and the amino acid sequence of the chimeric antigen receptor is as shown in SEQ ID NO:

14.

22. The method of claim 21, wherein, The CAR-T cell further comprises a chimeric switch receptor, and the amino acid sequence of the chimeric switch receptor is as shown in SEQ ID NO:

15.

23. The method of any one of claims 20-22, wherein, The CAR-T cell is obtained by stably expressing a CAR gene with a nucleotide sequence of SEQ ID NO: 13 into a T cell.

24. The method of any one of claims 17-23, wherein, The CLL1 target-related disease is a CLL1-positive cancer.

25. The method of claim 24, wherein, The CLL1-positive cancer is acute myelocytic leukemia, myelodysplastic syndrome or chronic myelocytic leukemia.

26. The method of any one of claims 17-25, wherein, The subject is an AML patient.

27. The method of claim 26, wherein, The AML patient is a refractory and / or relapsed acute myelocytic leukemia patient.

28. A method of reducing or avoiding side effects of AML-targeted therapy, comprising, The method comprises administering the CLL1 gene-knocked hematopoietic stem cell and / or hematopoietic progenitor cell or the pharmaceutical composition of claim 16 to the AML patient at the same time, before or after administering a CLL1-targeting drug to the AML patient.

29. The method of claim 28, wherein, The CLL1 gene-knocked hematopoietic stem cell and / or hematopoietic progenitor cell is prepared by knocking out the CLL1 gene in a recipient cell using the sgRNA of any one of claims 1-3 or the gene editing composition of claim 5 or 6.

30. The method of claim 28 or 29, wherein, The side effect is that when a CLL1-targeting drug is administered to an AML patient, the drug kills normal cells containing and / or expressing CLL1 antigen in the body in addition to targeting and killing tumor cells.

31. The method of claim 30, wherein, The normal cells also include hematopoietic stem cells and / or hematopoietic progenitor cells and their differentiated cells transfused into the AML patient during hematopoietic stem cell transplantation therapy.

Images