Antitumor drug

By using inhibitors of the mitochondrial oxidative phosphorylation pathway, especially ATP5B inhibitors, the problem of precision in tumor treatment has been solved, achieving highly effective tumor treatment and reducing drug side effects.

WO2025261327A1PCT designated stage Publication Date: 2025-12-26SHANGHAI SHIJIANG BIOTECHNOLOGY CO LTD +1
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/101332
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-18
Filing Date
2025-06-17
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Current technologies are insufficient for precise treatment of tumors, leading to problems such as inappropriate treatment and drug side effects.

Method used

By employing inhibitors of the mitochondrial oxidative phosphorylation pathway, particularly inhibitors of the mitochondrial oxidative phosphorylation pathway complex V, such as ATP5B inhibitors, precise treatment of tumors with high creatine kinase B expression can be achieved by inhibiting the expression or activity of creatine kinase B.

Benefits of technology

It significantly improves the precision of tumor treatment and reduces drug dosage and toxic side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025101332_26122025_PF_FP_ABST
    Figure CN2025101332_26122025_PF_FP_ABST
Patent Text Reader

Abstract

An antitumor drug. Specifically, provided is use of a mitochondrial oxidative phosphorylation pathway inhibitor for preparing a composition or formulation for preventing and / or treating tumors. The mitochondrial oxidative phosphorylation pathway inhibitor has an excellent and precise therapeutic effect on tumors with high expression of creatine kinase B.
Need to check novelty before this filing date? Find Prior Art

Description

An antitumor drug TECHNICAL FIELD

[0001] The present application relates to the field of medicine, in particular to an antitumor drug. BACKGROUND

[0002] Tumor is a common disease that seriously endangers human health, and the mortality rate of malignant tumor has been on the rise. Due to the heterogeneity of tumor, if the same treatment method or the same drug is simply used according to its source or pathological characteristics, etc., it is easy to cause improper treatment, and miss the valuable treatment time and opportunity of the patient, so it is necessary to use precise treatment for different conditions of tumor. With the development of biological technology, tumor is continuously typed at the molecular level of gene, protein, etc., and more and more changes in expression and activity of tumor-related genes and proteins have been discovered. The changes in expression and activity of tumor-related genes and proteins play an important role in the development of malignant tumor. The discovery and application of biomarkers will provide precise guidance for the application of related drugs, so that precise treatment of tumor becomes possible, thereby realizing targeted drug administration, significantly improving tumor treatment effect, and reducing drug dosage and side effects.

[0003] Therefore, there is an urgent need in the art to develop a drug capable of precise treatment of tumor. SUMMARY

[0004] An object of the present application is to provide a use of a mitochondrial oxidative phosphorylation pathway inhibitor for significantly excellent precise treatment of a tumor with high expression of creatine kinase B.

[0005] In a first aspect of the present application, a use of a mitochondrial oxidative phosphorylation pathway inhibitor for preparing a composition or preparation for preventing and / or treating a tumor is provided.

[0006] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a mitochondrial oxidative phosphorylation pathway complex V inhibitor.

[0007] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises an ATP5B inhibitor of mitochondrial oxidative phosphorylation pathway complex V.

[0008] In another preferred embodiment, the inhibitor comprises a specific inhibitor or a non-specific inhibitor.

[0009] In another preferred embodiment, the inhibition comprises expression or activity inhibition.

[0010] In another preferred embodiment, the expression comprises mRNA or protein expression.

[0011] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a gene, a protein, or a compound.

[0012] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a DNA, a RNA, a compound, or a protein.

[0013] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a shRNA, a miRNA, or an iRNA.

[0014] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a shRNA, a nucleotide sequence of which is shown in SEQ ID No: 1.

[0015] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a gene knockout agent or a gene silencing agent.

[0016] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a gene knockout agent or a gene silencing agent for the mitochondrial oxidative phosphorylation pathway.

[0017] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a gene knockout agent or a gene silencing agent for the mitochondrial oxidative phosphorylation pathway complex V.

[0018] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a gene knockout agent or a gene silencing agent for the ATP5B of the mitochondrial oxidative phosphorylation pathway complex V.

[0019] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises an inhibitor for knocking down, knocking out, or silencing the expression or activity of the mitochondrial oxidative phosphorylation pathway.

[0020] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises an inhibitor for knocking down, knocking out, or silencing the expression or activity of the mitochondrial oxidative phosphorylation pathway complex V.

[0021] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises an inhibitor for knocking down, knocking out, or silencing the expression or activity of the ATP5B of the mitochondrial oxidative phosphorylation pathway complex V.

[0022] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises a compound of Formula I, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof;

[0023] wherein,

[0024] R1, R2, R3, R4, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C1-C12 alkoxy, substituted or unsubstituted C1-C12 alkylthio, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 5-12 membered heteroaryl;

[0025] R5is none, hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C1-C12 alkoxy, substituted or unsubstituted C1-C12 alkylthio, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 5-12 membered heteroaryl;

[0026] Z1is

[0027] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl (such as trifluoromethyl), C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C8 alkoxy, C1-C8 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C8 haloalkoxy, C1-C8 haloalkylthio, C6-C12 aryl, 5-10 membered heteroaryl.

[0028] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl (such as trifluoromethyl), C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C6 alkoxy, C1-C6 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C6 haloalkoxy, C1-C6 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0029] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4 or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C4alkyl, C3-C8cycloalkyl, C1-C4haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxy, mercapto, amino, C1-C4alkoxy, C1-C4alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C4haloalkoxy, C1-C4haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0030] In another preferred embodiment, the heterocycloalkyl and the heteroaryl each independently have 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected from N, O and S on the heterocyclic ring.

[0031] In another preferred embodiment, the heterocycloalkyl has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected from N, O and S on the heterocyclic ring.

[0032] In another preferred embodiment, the heteroaryl has 1 to 4 (preferably 1, 2, 3 or 4) heteroatoms selected from N, O and S on the heterocyclic ring.

[0033] In another preferred embodiment, is a single or double bond.

[0034] In another preferred embodiment, R5is nothing, is a double bond.

[0035] In another preferred embodiment, R5is not nothing, is a single bond.

[0036] In another preferred embodiment, R5is not nothing and is a double bond.

[0037] In another preferred embodiment, R5is not nothing and is a double bond, the N atom to which R5is attached is N + .

[0038] In another preferred embodiment, R5is nothing, hydrogen or C1-C3alkyl.

[0039] In another preferred embodiment, R5is a double bond, the N atom to which R5is attached is N + .

[0040] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C10 alkoxy, substituted or unsubstituted C1-C10 alkylthio, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-10 membered heteroaryl.

[0041] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C8 alkoxy, substituted or unsubstituted C1-C8 alkylthio, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.

[0042] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C5-C8 cycloalkyl, substituted or unsubstituted 5-8 membered heterocycloalkyl, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C1-C6 alkylthio, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.

[0043] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C1-C4 alkoxy, substituted or unsubstituted C1-C4 alkylthio, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.

[0044] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C5-C8 cycloalkyl, substituted or unsubstituted 5-8 membered heterocycloalkyl, substituted or unsubstituted C1-C4 alkoxy, substituted or unsubstituted C1-C4 alkylthio, substituted or unsubstituted C6-C8 aryl, substituted or unsubstituted 5-8 membered heteroaryl.

[0045] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C5-C8 cycloalkyl, substituted or unsubstituted 5-8 membered heterocycloalkyl, substituted or unsubstituted C1-C4 alkoxy, substituted or unsubstituted C1-C4 alkylthio, substituted or unsubstituted C6 aryl, substituted or unsubstituted C7 aryl, substituted or unsubstituted C8 aryl, substituted or unsubstituted 5-8 membered (e.g., 5, 6, 7, 8) heteroaryl.

[0046] In another preferred embodiment, R1, R2, R3, R4, R5, R6, R7, R8, and R9 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3 cycloalkyl, substituted or unsubstituted C4 cycloalkyl, substituted or unsubstituted C5 cycloalkyl, substituted or unsubstituted C6 cycloalkyl, substituted or unsubstituted C7 cycloalkyl, substituted or unsubstituted C8 cycloalkyl, substituted or unsubstituted C9 cycloalkyl, substituted or unsubstituted C10 cycloalkyl, substituted or unsubstituted 5-8 membered heterocycloalkyl, substituted or unsubstituted C1-C4 alkoxy, substituted or unsubstituted C1-C4 alkylthio, substituted or unsubstituted C6 aryl, substituted or unsubstituted C7 aryl, substituted or unsubstituted C8 aryl, substituted or unsubstituted 5-8 membered (e.g., 5, 6, 7, 8) heteroaryl.

[0047] In another preferred embodiment, R1, R2, R3, R4, R7, and R8 are each independently hydrogen.

[0048] In another preferred embodiment, R5 is hydrogen, methyl, ethyl, propyl, or butyl.

[0049] In another preferred embodiment, R6 is hydrogen, methyl, ethyl, propyl, butyl, phenyl, trifluoromethyl-phenyl-.

[0050] In another preferred embodiment, the trifluoromethyl-phenyl is a monosubstituted trifluoromethyl-phenyl-.

[0051] In another preferred embodiment, in the trifluoromethyl-phenyl, the trifluoromethyl is substituted at the ortho, meta, or para position of the phenyl ring.

[0052] In another preferred embodiment, the trifluoromethyl-phenyl is:

[0053] In another preferred embodiment, R6 is hydrogen, methyl, ethyl, propyl, butyl, phenyl, substituted phenyl.

[0054] In another preferred embodiment, the substituted phenyl means that one or more (e.g., 2, 3, or 4) hydrogens of the phenyl group are replaced with a trifluoromethyl group.

[0055] In another preferred embodiment, substituted phenyl means that one hydrogen of phenyl is substituted with trifluoromethyl.

[0056] In another preferred embodiment, substituted phenyl means that one hydrogen of phenyl is substituted with trifluoromethyl.

[0057] In another preferred embodiment, R6is hydrogen, methyl, ethyl, propyl, butyl, or

[0058] wherein R 10 , R 11 , R 12 , R 13 and R 14 are each independently hydrogen, C1-C8alkyl, C3-C8cycloalkyl, C1-C8haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C8alkoxy, C1-C8alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C8haloalkoxy, C1-C8haloalkylthio, C6-C12aryl, 5-10 membered heteroaryl.

[0059] In another preferred embodiment, R 10 , R 11 , R 12 , R 13 and R 14 are each independently hydrogen, C1-C6alkyl, C3-C8cycloalkyl, C1-C6haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C6alkoxy, C1-C6alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C6haloalkoxy, C1-C6haloalkylthio, C6-C10aryl, 5-8 membered heteroaryl.

[0060] In another preferred embodiment, R 10 , R 11 , R 12 , R 13 and R 14 are each independently hydrogen, C1-C4alkyl, C3-C8cycloalkyl, C1-C4haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C4alkoxy, C1-C6alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C4haloalkoxy, C1-C4haloalkylthio, C6-C10aryl, 5-8 membered heteroaryl.

[0061] In another preferred embodiment, R 10 , R 11R 12 R 13 R 14 each independently is hydrogen, C1-C4 haloalkyl (e.g., trifluoromethyl).

[0062] In another preferred embodiment, R 10 R 11 R 12 R 13 R 14 each independently is hydrogen, C1-C2 haloalkyl (e.g., trifluoromethyl).

[0063] In another preferred embodiment, R 10 R 11 R 12 R 13 R 14 each independently is hydrogen, trifluoromethyl.

[0064] In another preferred embodiment, R 10 R 11 R 12 R 14 each independently is hydrogen.

[0065] In another preferred embodiment, R 13 is trifluoromethyl.

[0066] In another preferred embodiment, Z1is

[0067] In another preferred embodiment, Z1is

[0068] In another preferred embodiment, R9is a substituted or unsubstituted cyclohexyl.

[0069] In another preferred embodiment, the substituted cyclohexyl means that one or more (e.g., 2, 3, or 4) hydrogens of the cyclohexyl are each independently substituted with a C1-C4 alkyl group.

[0070] In another preferred embodiment, the substituted cyclohexyl means that one or more (e.g., 2, 3, or 4) hydrogens of the cyclohexyl are each independently substituted with a methyl, ethyl, propyl, butyl group.

[0071] In another preferred embodiment, the substituted cyclohexyl means that the hydrogens at positions 1 and 4 of the cyclohexyl are each independently substituted with a C1-C4 alkyl group.

[0072] In another preferred embodiment, the substituted cyclohexyl means that the hydrogens at positions 1 and 4 of the cyclohexyl are each independently substituted with a methyl, ethyl, propyl, butyl group.

[0073] In another preferred embodiment, R9is 1-propyl-4-methyl-cyclohexyl-.

[0074] In another preferred embodiment, R9is 1-isopropyl-4-methyl-cyclohexyl-.

[0075] In another preferred embodiment, R9is

[0076] wherein R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 21 , R 22 , R 23 and R 24 are each independently hydrogen, C1-C8alkyl, C3-C8cycloalkyl, C1-C8haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxy, mercapto, amino, C1-C8alkoxy, C1-C8alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C8haloalkoxy, C1-C8haloalkylthio, C6-C12aryl, 5-10 membered heteroaryl.

[0077] In another preferred embodiment, R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 21 , R 22 , R 23 and R 24 are each independently hydrogen, C1-C6alkyl, C3-C8cycloalkyl, C1-C6haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxy, mercapto, amino, C1-C6alkoxy, C1-C6alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C6haloalkoxy, C1-C6haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0078] In another preferred embodiment, R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 21 , R 22 , R 23 and R 24each independently is hydrogen, C1-C4alkyl, C3-C8cycloalkyl, C1-C4haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C4alkoxy, C1-C4alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C4haloalkoxy, C1-C4haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0079] In another preferred embodiment, R 15 , R 16 , R 17 , R 18 , R 19 , R 20 , R 21 , R 22 , R 23 and R 24 each independently is hydrogen, methyl, ethyl, propyl, butyl.

[0080] In another preferred embodiment, the propyl is isopropyl.

[0081] In another preferred embodiment, R9is

[0082] wherein R 16 , R 17 , R 18 , R 19 , R 20 , R 22 , R 23 and R 24 are as defined above.

[0083] In another preferred embodiment, R9is

[0084] In another preferred embodiment, R9is

[0085] In another preferred embodiment, when R5is null, the structure of the compound of formula I is as shown in formula I-1 below:

[0086] wherein R1, R2, R3, R4, R6, R7, R8, R9and Z1are as defined above.

[0087] In another preferred embodiment, when R5is not null, the structure of the compound of formula I is as shown in formula I-2 below:

[0088] wherein R1, R2, R3, R4, R5, R6, R7, R8, R9and Z1are as defined above.

[0089] In another preferred embodiment, the compound of formula I has the following structure of formula I-3:

[0090] wherein R1, R2, R3, R4, R5, R6, R7, R8, R9, and Z1are as defined above. as defined above.

[0091] In another preferred embodiment, the compound of formula I has the following structure of formula I-4:

[0092] wherein R1, R2, R3, R4, R5, R6, R7, R8, R9, and Z1are as defined above.

[0093] In another preferred embodiment, the compound of formula I includes:

[0094] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor includes a compound of formula II, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof;

[0095] wherein,

[0096] R 25 , R 26 , R 27 , R 28 , R 29 , R 30 , R 31 , R 32 , R 33 , R 34 , R 35 , R 36 , R 37 , R 38 , R 39 , R 40 , R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R60 R 61 R 62 R 63 R 64 R 65 R 66 R 67 and R 68 each independently is hydrogen, halogen, hydroxyl, hydroxyl-(C1-C12 alkyl)-, thiol, thiol-(C1-C12 alkyl)-, amino, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C1-C12 alkoxy, substituted or unsubstituted C1-C12 alkylthio, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 5-12 membered heteroaryl.

[0097] In another preferred embodiment, any "substituted" mentioned above means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl (such as trifluoromethyl), C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C8 alkoxy, C1-C8 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C8 haloalkoxy, C1-C8 haloalkylthio, C6-C12 aryl, 5-10 membered heteroaryl.

[0098] In another preferred embodiment, the heterocycloalkyl and heteroaryl each independently has 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0099] In another preferred embodiment, R 25 R 26 R 27 R 28 R 29 R 30 R 31 R 32 R 33 R 34 R 35 R 36 R 37 R 38 R 39 R 40 R 41 R 42 R 43 R 44 R 45 R 46 R 47 R48 R 49 R 50 R 51 R 52 R 53 R 54 R 55 R 56 R 57 R 58 R 59 R 60 R 61 R 62 R 63 R 64 R 65 R 66 R 67 and R 68 are each independently hydrogen, halogen, hydroxyl, hydroxyl-(C1-C10 alkyl)-, thiol, thiol-(C1-C10 alkyl)-, amino, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C1-C10 alkoxy, substituted or unsubstituted C1-C10 alkylthio, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-10 membered heteroaryl.

[0100] In another preferred embodiment, R 25 R 26 R 27 R 28 R 29 R 30 R 31 R 32 R 33 R 34 R 35 R 36 R 37 R 38 R 39 R 40 R 41 R 42 R 43 R 44 R 45 R 46 R 47 R 48 R 49 R 50 R 51 R 52 R 53 R 54 R 55 R 56 R57 , R 58 , R 59 , R 60 , R 61 , R 62 , R 63 , R 64 , R 65 , R 66 , R 67 and R 68 are each independently hydrogen, halogen, hydroxyl, hydroxyl-(Ci-C8alkyl)-, thiol, thiol-(Ci-C8alkyl)-, amino, substituted or unsubstituted Ci-C8alkyl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted Ci-C8alkoxy, substituted or unsubstituted Ci-C8alkylthio, substituted or unsubstituted C6-Cio aryl, substituted or unsubstituted 5-10 membered heteroaryl.

[0101] In another preferred embodiment, R 25 , R 26 , R 27 , R 28 , R 29 , R 30 , R 31 , R 32 , R 33 , R 34 , R 35 , R 36 , R 37 , R 38 , R 39 , R 40 , R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R 60 , R 61 , R 62 , R 63 , R 64 , R 65 , R 66 , R67 and R 68 each independently is hydrogen, halogen, hydroxy, hydroxy-(Ci-C6alkyl)-, thiol, thiol-(Ci-C6alkyl)-, amino, substituted or unsubstituted Ci-C6alkyl, substituted or unsubstituted Ci-C6alkoxy, substituted or unsubstituted Ci-C6alkylthio.

[0102] In another preferred embodiment, R 25 , R 26 , R 27 , R 28 , R 29 , R 30 , R 31 , R 32 , R 33 , R 34 , R 35 , R 36 , R 37 , R 38 , R 39 , R 40 , R 41 , R 42 , R 43 , R 44 , R 45 , R 46 , R 47 , R 48 , R 49 , R 50 , R 51 , R 52 , R 53 , R 54 , R 55 , R 56 , R 57 , R 58 , R 59 , R 60 , R 61 , R 62 , R 63 , R 64 , R 65 , R 66 , R 67 and R 68 each independently is hydrogen, hydroxy, hydroxy-(Ci-C4alkyl)-, thiol, thiol-(Ci-C4alkyl)-, substituted or unsubstituted Ci-C4alkyl, substituted or unsubstituted Ci-C4alkoxy, substituted or unsubstituted Ci-C4alkylthio.

[0103] In another preferred embodiment, R 25 , R 26 , R 27 , R 28 , R29 R 30 R 31 R 32 R 33 R 34 R 35 R 36 R 37 R 38 R 39 R 40 R 41 R 42 R 43 R 44 R 45 R 46 R 47 R 48 R 49 R 50 R 51 R 52 R 53 R 54 R 55 R 56 R 57 R 58 R 59 R 60 R 61 R 62 R 63 R 64 R 65 R 66 R 67 and R 68 each independently is hydrogen, methyl, ethyl, propyl, butyl, hydroxy-propyl-, mercapto-propyl-, hydroxy, mercapto.

[0104] In another preferred embodiment, the hydroxy-propyl- is monohydroxy-propyl-.

[0105] In another preferred embodiment, the hydroxy-propyl- is

[0106] In another preferred embodiment, the mercapto-propyl- is monomercapto-propyl-.

[0107] In another preferred embodiment, the mercapto-propyl- is

[0108] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C6alkyl, C3-C8cycloalkyl, C1-C6haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C6alkoxy, C1-C6alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C6haloalkoxy, C1-C6haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0109] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C4alkyl, C3-C8cycloalkyl, C1-C4haloalkyl (such as trifluoromethyl), C3-C8halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C4alkoxy, C1-C4alkylthio, C3-C8cycloalkoxy, C3-C8cycloalkylthio, C1-C4haloalkoxy, C1-C4haloalkylthio, C6-C10aryl, 5-10 membered heteroaryl.

[0110] In another preferred embodiment, the heterocycloalkyl and heteroaryl each independently have 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0111] In another preferred embodiment, the heterocycloalkyl has 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0112] In another preferred embodiment, the heteroaryl has 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0113] In another preferred embodiment, the compound of Formula II includes:

[0114] In another preferred embodiment, the pharmaceutically acceptable salt includes a salt of the compound with an acid.

[0115] In another preferred embodiment, the halogen is fluorine, chlorine, bromine, or iodine.

[0116] In another preferred embodiment, the halo is mono-halo, di-halo, tri-halo, or per-halo.

[0117] In another preferred embodiment, the halo is fluoro, chloro, bromo, iodo.

[0118] In another preferred embodiment, the deuterium is mono-deuterium, di-deuterium, tri-deuterium, or per-deuterium.

[0119] In another preferred embodiment, halo means that one or more (preferably 1, 2, or 3) hydrogen atoms on a group are each independently replaced with a halogen.

[0120] In another preferred embodiment, the acid comprises one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid, and glutamic acid.

[0121] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises:

[0122] In another preferred embodiment, the tumor is a human tumor.

[0123] In another preferred embodiment, the tumor is a human tumor.

[0124] In another preferred embodiment, the tumor is an animal tumor.

[0125] In another preferred embodiment, the tumor is a mammalian tumor.

[0126] In another preferred embodiment, the tumor is a non-human mammalian tumor.

[0127] In another preferred embodiment, the tumor comprises a tumor with high creatine kinase B expression.

[0128] In another preferred embodiment, the tumor with high creatine kinase B expression means that creatine kinase B can be detected by creatine kinase B antibody detection from 20 μg of protein extracted from the tumor, more preferably from 5 μg of protein extracted from the tumor, more preferably from 1 μg of protein extracted from the tumor, more preferably from 0.2 μg of protein extracted from the tumor, more preferably from 0.05 μg of protein extracted from the tumor, and more preferably from 0.01 μg of protein extracted from the tumor.

[0129] In another preferred embodiment, the tumor with high creatine kinase B expression means that the expression level of creatine kinase B in tumor cells is higher than the expression level of creatine kinase B in cells of the same type or normal cells.

[0130] In another preferred embodiment, the tumor with high expression of creatine kinase B means that the expression level El of creatine kinase B of the tumor cell is greater than the expression level E0 of creatine kinase B of the same type of cell or normal cell (El / E0 > 1.0), preferably > 1.2, more preferably > 1.5, more preferably > 2, more preferably > 3, more preferably > 5, more preferably > 8, more preferably > 10, more preferably > 15, more preferably > 20, more preferably > 30, more preferably > 50, such as 2-50.

[0131] In another preferred embodiment, the same type of cell includes the same type of cell.

[0132] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0133] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0134] In another preferred embodiment, the same type of cell has normal expression, no expression or low expression of creatine kinase B.

[0135] In another preferred embodiment, the same type of cell includes cells with normal expression, no expression or low expression of creatine kinase B (such as the same type of tumor cell or the same type of tumor cell).

[0136] In another preferred embodiment, the same type of cell includes the same type of tumor cell with normal expression, no expression or low expression of creatine kinase B.

[0137] In another preferred embodiment, the same type of cell includes the same type of tumor cell with normal expression, no expression or low expression of creatine kinase B.

[0138] In another preferred embodiment, the normal cell includes normal tissue cells (such as tumor origin cells, tumor adjacent cells or paracancer tissue cells).

[0139] In another preferred embodiment, the normal cell includes normal tissue cells (such as tumor origin cells, tumor adjacent cells or paracancer tissue cells) with normal expression of creatine kinase B.

[0140] In another preferred embodiment, E0 is the expression level of creatine kinase B of cells with normal expression, no expression or low expression of creatine kinase B.

[0141] In another preferred embodiment, the cells with normal expression, no expression or low expression of creatine kinase B are not sensitive to mitochondrial oxidative phosphorylation pathway inhibitors.

[0142] In another preferred embodiment, the tumor comprises one or more of lung cancer, renal cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, and prostate cancer.

[0143] In another preferred embodiment, the tumor comprises lung cancer and / or renal cancer.

[0144] In another preferred embodiment, the tumor is selected from the group consisting of lung cancer, renal cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0145] In another preferred embodiment, the lung cancer comprises one or more of non-small cell lung cancer and small cell lung cancer.

[0146] In another preferred embodiment, the lung cancer is selected from the group consisting of non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0147] In another preferred embodiment, the lung cancer cells comprise NCI-H82 cells.

[0148] In another preferred embodiment, the renal cancer comprises renal clear cell adenocarcinoma.

[0149] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0150] In another preferred embodiment, the rectal cancer comprises rectal adenocarcinoma.

[0151] In another preferred embodiment, the colorectal cancer comprises colorectal adenocarcinoma.

[0152] In another preferred embodiment, the breast cancer comprises triple negative breast cancer.

[0153] In another preferred embodiment, the brain tumor comprises one or more of brain glioblastoma, neurogliocytoma, brain medulloblastoma, and brain neuroblastoma.

[0154] In another preferred embodiment, the pancreatic cancer comprises pancreatic ductal carcinoma.

[0155] In another preferred embodiment, the expression comprises protein expression and / or mRNA expression.

[0156] In another preferred embodiment, the level comprises protein level and / or mRNA level.

[0157] In another preferred embodiment, the composition or formulation is the only active ingredient in the composition or formulation.

[0158] In another preferred embodiment, the composition is a pharmaceutical composition.

[0159] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0160] In another preferred embodiment, the composition or preparation is in the form of a solid preparation, a liquid preparation or a semi-solid preparation.

[0161] In another preferred embodiment, the composition or preparation is in the form of an oral preparation, a topical preparation or an injection preparation.

[0162] In a second aspect of the present application, there is provided a marker for determining whether a tumor patient is suitable for prevention and / or treatment of tumor by using a mitochondrial oxidative phosphorylation pathway inhibitor, wherein the marker comprises the expression level of creatine kinase B.

[0163] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0164] In another preferred embodiment, the expression level of creatine kinase B comprises the expression level of creatine kinase B in tumor cells.

[0165] In another preferred embodiment, the instruction or label indicates that:

[0166] When the tumor cells of a tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment by using a mitochondrial oxidative phosphorylation pathway inhibitor.

[0167] In another preferred embodiment, the instruction or label indicates that:

[0168] When the tumor cells of a tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment by using a mitochondrial oxidative phosphorylation pathway inhibitor.

[0169] In another preferred embodiment, the low expression or no expression of creatine kinase B means that the ratio of the expression level El of creatine kinase B in tumor cells to the expression level E0 of creatine kinase B in the same type of cells or normal cells (El / E0) is <1.0, preferably ≤0.7, more preferably ≤0.6, more preferably ≤0.5, more preferably ≤0.4, more preferably ≤0.3, more preferably ≤0.2, more preferably ≤0.1, more preferably ≤0.05, more preferably ≤0.01, more preferably ≤0.005, more preferably ≤0.001, more preferably ≤0.0001, more preferably ≤0.00001, more preferably ≤0.000001, more preferably ≤0.0000001.

[0170] In a third aspect of the present application, there is provided a detection kit, wherein the detection kit comprises:

[0171] (i) a detection reagent for detecting the expression level of creatine kinase B.

[0172] In another preferred embodiment, the detecting sample of the detecting kit comprises tumor cells.

[0173] In another preferred embodiment, the level comprises protein level and / or mRNA level.

[0174] In another preferred embodiment, the expression comprises mRNA and / or protein expression.

[0175] In a fourth aspect, the present application provides a use of the detecting kit according to the third aspect of the present application for preparing a companion diagnostic kit for determining whether a tumor patient is suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor.

[0176] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0177] In another preferred embodiment, the companion diagnostic kit further comprises an instruction or a label.

[0178] In another preferred embodiment, the instruction or the label indicates that:

[0179] When the tumor cells of the tumor patient overexpress creatine kinase B, the tumor patient is suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor.

[0180] In another preferred embodiment, the instruction or the label indicates that:

[0181] When the tumor cells of the tumor patient underexpress or do not express creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor.

[0182] In another preferred embodiment, the tumor patient suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor comprises that the tumor of the tumor patient is sensitive to the mitochondrial oxidative phosphorylation pathway inhibitor.

[0183] In another preferred embodiment, the tumor patient not suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor comprises that the tumor of the tumor patient is not sensitive to the mitochondrial oxidative phosphorylation pathway inhibitor.

[0184] In a fifth aspect, the present application provides a kit, which comprises:

[0185] (i) a detecting agent for detecting the expression level of creatine kinase B; and

[0186] (ii) a mitochondrial oxidative phosphorylation pathway inhibitor.

[0187] In another preferred embodiment, the inhibitor of mitochondrial oxidative phosphorylation pathway is as described in the first aspect of the present application.

[0188] In another preferred embodiment, the sample to be detected comprises a tumor.

[0189] In another preferred embodiment, the kit further comprises an instruction or a label.

[0190] In another preferred embodiment, the instruction or the label indicates that:

[0191] When the tumor cells of a tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the inhibitor of mitochondrial oxidative phosphorylation pathway.

[0192] In another preferred embodiment, the instruction or the label indicates that:

[0193] When the tumor cells of a tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the inhibitor of mitochondrial oxidative phosphorylation pathway.

[0194] In a sixth aspect of the present application, there is provided a use of the kit as described in the fifth aspect of the present application for the preparation of a pharmaceutical kit for preventing and / or treating a tumor.

[0195] In another preferred embodiment, the pharmaceutical kit further comprises an instruction or a label.

[0196] In another preferred embodiment, the instruction or the label indicates that:

[0197] When the tumor cells of a tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with the inhibitor of mitochondrial oxidative phosphorylation pathway.

[0198] In another preferred embodiment, the instruction or the label indicates that:

[0199] When the tumor cells of a tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with the inhibitor of mitochondrial oxidative phosphorylation pathway.

[0200] In a seventh aspect of the present application, there is provided a method for preventing and / or treating a tumor, the method comprising: administering an inhibitor of mitochondrial oxidative phosphorylation pathway to a subject in need, thereby preventing and / or treating the tumor.

[0201] In another preferred embodiment, the inhibitor of mitochondrial oxidative phosphorylation pathway is as described in the first aspect of the present application.

[0202] In another preferred embodiment, the tumor is as described in the first aspect of the present application.

[0203] In another preferred embodiment, the subject is a human and a non-human mammal (rodents, rabbits, monkeys, livestock, dogs, cats, etc.).

[0204] In another preferred embodiment, the method comprises the step of:

[0205] The subject is first administered a creatine kinase B promoter to increase the expression of creatine kinase B in the subject's tumor, and then administered the mitochondrial oxidative phosphorylation pathway inhibitor to prevent and / or treat the tumor.

[0206] In another preferred embodiment, the method comprises the step of:

[0207] The subject is first administered a creatine kinase B promoter to increase the expression of creatine kinase B in the subject's tumor, and then administered the mitochondrial oxidative phosphorylation pathway inhibitor to prevent and / or treat the tumor.

[0208] In another preferred embodiment, the promoter comprises a specific promoter.

[0209] In another preferred embodiment, the creatine kinase B promoter comprises a promoter capable of increasing the expression of creatine kinase B in the tumor.

[0210] In an eighth aspect of the present application, there is provided an apparatus or system comprising:

[0211] (i) a detection module for detecting the expression level of creatine kinase B;

[0212] (ii) an output module comprising outputting information that:

[0213] When the tumor cells of a tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor; and / or

[0214] When the tumor cells of a tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor.

[0215] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0216] In another preferred embodiment, the sample detected comprises tumor cells.

[0217] In another preferred embodiment, the apparatus comprises a gene detector or a protein detector.

[0218] In another preferred embodiment, the apparatus or system further comprises a sample input module.

[0219] In another preferred embodiment, the sample injection module is used for injecting tumor cell extract.

[0220] In another preferred embodiment, the device or system further comprises a data processing module.

[0221] In another preferred embodiment, the data processing module processes the expression level of creatine kinase B.

[0222] In a ninth aspect of the present application, there is provided a use of a creatine kinase B promoter for the preparation of a composition or preparation for enhancing the anti-tumor effect of an anti-tumor drug.

[0223] In another preferred embodiment, the anti-tumor drug comprises a mitochondrial oxidative phosphorylation pathway inhibitor.

[0224] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0225] In another preferred embodiment, the creatine kinase B promoter comprises a promoter capable of promoting high expression of creatine kinase B in a tumor.

[0226] In another preferred embodiment, the promoter comprises a specific promoter.

[0227] In another preferred embodiment, the tumor is as described in the first aspect of the present application.

[0228] In another preferred embodiment, the composition is a pharmaceutical composition.

[0229] In another preferred embodiment, the composition or preparation further comprises a pharmaceutically acceptable carrier.

[0230] In another preferred embodiment, the composition or preparation is in the form of a solid preparation, a liquid preparation, or a semi-solid preparation.

[0231] In another preferred embodiment, the composition or preparation is in the form of an oral preparation, a topical preparation, or an injection preparation.

[0232] In a tenth aspect of the present application, there is provided an active ingredient combination comprising:

[0233] (1) a first active ingredient comprising an anti-tumor drug; and

[0234] (2) a second active ingredient comprising a creatine kinase B promoter.

[0235] In another preferred embodiment, the anti-tumor drug comprises a mitochondrial oxidative phosphorylation pathway inhibitor.

[0236] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0237] In another preferred embodiment, the creatine kinase B promoting agent comprises an agent capable of causing high expression of creatine kinase B in the tumor.

[0238] In another preferred embodiment, the promoting agent comprises a specific promoting agent.

[0239] In another preferred embodiment, the molar ratio of the first active ingredient to the second active ingredient is 0.01-600:1, preferably 0.05-500:1, more preferably 0.1-400:1, more preferably 0.2-200:1, more preferably 0.5-100:1, more preferably 0.5-80:1, most preferably 1-50:1.

[0240] In another preferred embodiment, at least one of the active ingredients in the active ingredient combination is independent.

[0241] In another preferred embodiment, the first active ingredient and the second active ingredient in the active ingredient combination are independent of each other.

[0242] In an eleventh aspect of the present application, a composition is provided, the composition comprising:

[0243] (1) a first active ingredient, the first active ingredient comprising an antitumor agent; and

[0244] (2) a second active ingredient, the second active ingredient comprising a creatine kinase B promoting agent.

[0245] In another preferred embodiment, the antitumor agent comprises a mitochondrial oxidative phosphorylation pathway inhibitor.

[0246] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0247] In another preferred embodiment, the creatine kinase B promoting agent comprises an agent capable of causing high expression of creatine kinase B in the tumor.

[0248] In another preferred embodiment, the promoting agent comprises a specific promoting agent.

[0249] In another preferred embodiment, the composition is a pharmaceutical composition.

[0250] In another preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0251] In another preferred embodiment, the dosage form of the composition or preparation is a solid preparation, a liquid preparation, or a semi-solid preparation.

[0252] In another preferred embodiment, the composition or preparation is in the form of an oral preparation, a topical preparation, or an injectable preparation.

[0253] In a twelfth aspect of the present application, there is provided a kit comprising:

[0254] (A) a first preparation comprising a first active ingredient, the first active ingredient comprising an antitumor agent; and

[0255] (B) a second preparation comprising a second active ingredient, the second active ingredient comprising a creatine kinase B enhancer.

[0256] In another preferred embodiment, the antitumor agent comprises a mitochondrial oxidative phosphorylation pathway inhibitor.

[0257] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0258] In another preferred embodiment, the creatine kinase B enhancer comprises an enhancer capable of causing high expression of creatine kinase B in a tumor.

[0259] In another preferred embodiment, the enhancer comprises a specific enhancer.

[0260] In another preferred embodiment, the kit further comprises an instruction for use.

[0261] In another preferred embodiment, the first and second preparations are independent preparations.

[0262] In another preferred embodiment, the first and second preparations are combined preparations.

[0263] In another preferred embodiment, the instruction for use indicates that the first and second preparations are used in combination to enhance the antitumor activity of the antitumor agent.

[0264] In another preferred embodiment, the method of combination is to administer the second preparation comprising the creatine kinase B enhancer first, and then administer the antitumor agent.

[0265] In a thirteenth aspect of the present application, there is provided a method for inhibiting tumor cells, the method comprising the step of contacting the tumor cells with a mitochondrial oxidative phosphorylation pathway inhibitor, thereby inhibiting the tumor cells.

[0266] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0267] In another preferred embodiment, the method is an in vitro method or an in vivo method.

[0268] In another preferred embodiment, the method of inhibiting tumor cells comprises an in vitro non-therapeutic and non-diagnostic method of inhibiting tumor cells.

[0269] In another preferred embodiment, the contacting is in vitro culturing.

[0270] In another preferred embodiment, the tumor is as described in the first aspect of the present application.

[0271] In a fourteenth aspect of the present application, there is provided use of an AKT inhibitor for the manufacture of a composition or medicament for enhancing the preventive and / or therapeutic effect of a mitochondrial oxidative phosphorylation pathway inhibitor on a tumor.

[0272] In another preferred embodiment, the AKT inhibitor comprises a compound of Formula III, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof:

[0273] wherein,

[0274] R 69 , R 70 , R 71 , R 72 , R 73 , R 74 , R 75 , R 76 , R 77 and R 78 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl, substituted or unsubstituted C6-C12 aryl, substituted or unsubstituted 5-12 membered heteroaryl.

[0275] In another preferred embodiment, R 69 , R 70 , R 71 , R 72 , R 73 , R 74 , R 75 , R 76 , R 77 and R 78 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-10 membered heteroaryl.

[0276] In another preferred embodiment, R 69 , R 70R 71 R 72 R 73 R 74 R 75 R 76 R 77 R 78 each independently is hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C8alkyl, substituted or unsubstituted C3-C8cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl, substituted or unsubstituted C6-C8aryl, substituted or unsubstituted 5-8 membered heteroaryl.

[0277] In another preferred embodiment, R 69 R 70 R 71 R 72 R 73 R 74 R 75 R 76 R 77 R 78 each independently is hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C6alkyl, substituted or unsubstituted C3-C6cycloalkyl, substituted or unsubstituted 3-6 membered heterocycloalkyl, substituted or unsubstituted C6-C8aryl, substituted or unsubstituted 5-8 membered heteroaryl.

[0278] In another preferred embodiment, R 69 R 70 R 72 R 73 R 75 R 76 R 77 R 78 each independently is hydrogen.

[0279] In another preferred embodiment, R 71 is substituted or unsubstituted C3cycloalkyl, substituted or unsubstituted C4cycloalkyl, substituted or unsubstituted C5cycloalkyl, substituted or unsubstituted C6cycloalkyl, substituted or unsubstituted C7cycloalkyl, substituted or unsubstituted C8cycloalkyl, substituted or unsubstituted C9cycloalkyl, or substituted or unsubstituted C10cycloalkyl.

[0280] In another preferred embodiment, R 71 is substituted or unsubstituted 3 membered heterocycloalkyl, substituted or unsubstituted 4 membered heterocycloalkyl, substituted or unsubstituted 5 membered heterocycloalkyl, substituted or unsubstituted 6 membered heterocycloalkyl, substituted or unsubstituted 7 membered heterocycloalkyl, substituted or unsubstituted 8 membered heterocycloalkyl, substituted or unsubstituted 9 membered heterocycloalkyl, substituted or unsubstituted 10 membered heterocycloalkyl.

[0281] In another preferred embodiment, R 71 is a substituted or unsubstituted cyclobutyl group.

[0282] In another preferred embodiment, R 71 is a cyclobutyl group substituted with amino.

[0283] In another preferred embodiment, R 74 is a phenyl group.

[0284] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxy, mercapto, amino, C1-C8 alkoxy, C1-C8 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C8 haloalkoxy, C1-C8 haloalkylthio, C6-C12 aryl, 5-10 membered heteroaryl.

[0285] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxy, mercapto, amino, C1-C6 alkoxy, C1-C6 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C6 haloalkoxy, C1-C6 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0286] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C4 alkyl, C3-C8 cycloalkyl, C1-C4 haloalkyl, C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxy, mercapto, amino, C1-C4 alkoxy, C1-C4 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C4 haloalkoxy, C1-C4 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0287] In another preferred embodiment, the heterocycloalkyl and heteroaryl each independently have 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0288] In another preferred embodiment, the heterocycloalkyl has 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0289] In another preferred embodiment, the heteroaryl group has 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocycle.

[0290] In another preferred embodiment, the pharmaceutically acceptable salt includes a salt of the compound with an acid.

[0291] In another preferred embodiment, the acid includes one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid, and glutamic acid.

[0292] In another preferred embodiment, the compound of Formula III includes:

[0293] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the application.

[0294] In another preferred embodiment, the tumor is a human tumor.

[0295] In another preferred embodiment, the tumor is a human tumor.

[0296] In another preferred embodiment, the tumor is an animal tumor.

[0297] In another preferred embodiment, the tumor is a mammalian tumor.

[0298] In another preferred embodiment, the tumor is a non-human mammalian tumor.

[0299] In another preferred embodiment, the tumor includes a tumor that has low or no expression of creatine kinase B.

[0300] In another preferred embodiment, the tumor that has low or no expression of creatine kinase B means that creatine kinase B is not detectable by a creatine kinase B antibody from 1 μg of protein extracted from the tumor, more preferably from 5 μg of protein extracted from the tumor, more preferably from 10 μg of protein extracted from the tumor, more preferably from 100 μg of protein extracted from the tumor, and more preferably from 1000 μg of protein extracted from the tumor.

[0301] In another preferred embodiment, the tumor with low or no expression of creatine kinase B means that the expression level of creatine kinase B in the tumor cell is less than the expression level of creatine kinase B in the same type of cell or normal cell.

[0302] In another preferred embodiment, the tumor with low or no expression of creatine kinase B means that the expression level of creatine kinase B in the tumor cell is less than the expression level of creatine kinase B in the same type of cell or normal cell.

[0303] In another preferred embodiment, the same type of cell includes the same type of cell.

[0304] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0305] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0306] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0307] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0308] In another preferred embodiment, the same type of cell includes the same type of tumor cell.

[0309] In another preferred embodiment, the normal cell includes a normal tissue cell (such as a tumor origin cell, a tumor adjacent cell or a para-carcinoma tissue cell).

[0310] In another preferred embodiment, the normal cell includes a normal tissue cell (such as a tumor origin cell, a tumor adjacent cell or a para-carcinoma tissue cell).

[0311] In another preferred embodiment, L0 is the expression level of creatine kinase B in the normal tissue cell (such as a tumor origin cell, a tumor adjacent cell or a para-carcinoma tissue cell).

[0312] In another preferred embodiment, the tumor includes one or more of lung cancer, kidney cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer and prostate cancer.

[0313] In another preferred embodiment, the tumor comprises lung cancer and / or kidney cancer.

[0314] In another preferred embodiment, the tumor is selected from the group consisting of lung cancer, kidney cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer, prostate cancer, or a combination thereof.

[0315] In another preferred embodiment, the lung cancer comprises one or more of non-small cell lung cancer and small cell lung cancer.

[0316] In another preferred embodiment, the lung cancer is selected from the group consisting of non-small cell lung cancer, small cell lung cancer, or a combination thereof.

[0317] In another preferred embodiment, the lung cancer cells comprise NCI-H82 cells.

[0318] In another preferred embodiment, the kidney cancer comprises renal clear cell adenocarcinoma.

[0319] In another preferred embodiment, the colon cancer comprises colon adenocarcinoma.

[0320] In another preferred embodiment, the rectal cancer comprises rectal adenocarcinoma.

[0321] In another preferred embodiment, the colorectal cancer comprises colorectal adenocarcinoma.

[0322] In another preferred embodiment, the breast cancer comprises triple negative breast cancer.

[0323] In another preferred embodiment, the brain tumor comprises one or more of brain glioblastoma, neurogliocytoma, brain medulloblastoma, and brain neuroblastoma.

[0324] In another preferred embodiment, the pancreatic cancer comprises pancreatic ductal carcinoma.

[0325] In another preferred embodiment, the expression comprises protein expression and / or mRNA expression.

[0326] In another preferred embodiment, the level comprises protein level and / or mRNA level.

[0327] In another preferred embodiment, the molar ratio of the AKT inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is 5:(0.01-100), preferably 5:(0.02-50), more preferably 5:(0.05-30), more preferably 5:(0.08-20), more preferably 5:(0.1-10), more preferably 5:(0.1-5), more preferably 5:(0.185-5).

[0328] In another preferred embodiment, the AKT inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are present in a mass ratio of (0.05-30): 1, preferably (0.08-20): 1, more preferably (0.1-15): 1, more preferably (0.1-10): 1, more preferably (0.1-7.0): 1, more preferably (0.2-5.0): 1, more preferably (0.2-4.0): 1, more preferably (0.3-3.0): 1, more preferably (0.5-2.0): 1, more preferably (0.8-1.7): 1, more preferably (1.0-1.5): 1, more preferably (1.1-1.4): 1, more preferably (1.2-1.3): 1, most preferably 1.25: 1.

[0329] In another preferred embodiment, the AKT inhibitor is the only active ingredient in the composition or formulation.

[0330] In another preferred embodiment, the composition or formulation comprises a pharmaceutical composition or a pharmaceutical formulation.

[0331] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0332] In another preferred embodiment, the composition or formulation is in the form of a solid formulation, a liquid formulation, or a semi-solid formulation.

[0333] In another preferred embodiment, the composition or formulation is in the form of an oral formulation, a topical formulation, or an injectable formulation.

[0334] In another preferred embodiment, the subject of administration of the composition is a human.

[0335] In a fifteenth aspect, the present application provides a composition or formulation comprising an AKT inhibitor and a mitochondrial oxidative phosphorylation pathway inhibitor.

[0336] In another preferred embodiment, the AKT inhibitor is as described in the fourteenth aspect of the present application.

[0337] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0338] In another preferred embodiment, the composition or formulation is as described in the fourteenth aspect of the present application.

[0339] In another preferred embodiment, the AKT inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are present in a molar ratio of 5:(0.01-100), preferably 5:(0.02-50), more preferably 5:(0.05-30), more preferably 5:(0.08-20), more preferably 5:(0.1-10), more preferably 5:(0.1-5), more preferably 5:(0.185-5).

[0340] In another preferred embodiment, the AKT inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are administered to the subject in a mass ratio of (0.05-30): 1, preferably (0.08-20): 1, more preferably (0.1-15): 1, more preferably (0.1-10): 1, more preferably (0.1-7.0): 1, more preferably (0.2-5.0): 1, more preferably (0.2-4.0): 1, more preferably (0.3-3.0): 1, more preferably (0.5-2.0): 1, more preferably (0.8-1.7): 1, more preferably (1.0-1.5): 1, more preferably (1.1-1.4): 1, more preferably (1.2-1.3): 1, most preferably 1.25: 1.

[0341] In a sixteenth aspect of the present application, there is provided a method of enhancing the effect of a mitochondrial oxidative phosphorylation pathway inhibitor in preventing and / or treating a tumor, said method comprising administering to a subject in need thereof an AKT inhibitor, thereby enhancing the effect of the mitochondrial oxidative phosphorylation pathway inhibitor in preventing and / or treating the tumor.

[0342] In another preferred embodiment, the subject comprises a subject to which a mitochondrial oxidative phosphorylation pathway inhibitor is administered.

[0343] In another preferred embodiment, the AKT inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are administered to the subject simultaneously or sequentially.

[0344] In another preferred embodiment, the AKT inhibitor is administered to the subject prior to the administration of the mitochondrial oxidative phosphorylation pathway inhibitor.

[0345] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is administered to the subject prior to the administration of the AKT inhibitor.

[0346] In another preferred embodiment, the AKT inhibitor is as described in the fourteenth aspect of the present application.

[0347] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0348] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0349] In another preferred embodiment, the subject is a human or a non-human mammal (rodents, rabbits, monkeys, domestic animals, dogs, cats, etc.).

[0350] In a seventeenth aspect, the present application provides a use of a compound of Formula IV, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, for preparing a composition or a preparation for enhancing the preventive and / or therapeutic effect of a mitochondrial oxidative phosphorylation pathway inhibitor on a tumor.

[0351] wherein,

[0352] R 79 , R 80 , R 81 , and R 82 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C12 alkyl, substituted or unsubstituted C3-C12 cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl.

[0353] In another preferred example, R 79 , R 80 , R 81 , and R 82 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C3-C10 cycloalkyl, substituted or unsubstituted 3-10 membered heterocycloalkyl.

[0354] In another preferred example, R 79 , R 80 , R 81 , and R 82 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C8 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-8 membered heterocycloalkyl.

[0355] In another preferred example, R 79 , R 80 , R 81 , and R 82 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C6 cycloalkyl, substituted or unsubstituted 3-6 membered heterocycloalkyl.

[0356] In another preferred example, R 79 , R 80 , R 81 , and R 82 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C4 alkyl, substituted or unsubstituted C3-C6 cycloalkyl, substituted or unsubstituted 3-6 membered heterocycloalkyl.

[0357] In another preferred example, R 79R 80 R 81 R 82 each independently is hydrogen, methyl, ethyl, propyl, butyl.

[0358] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl, C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C8 alkoxy, C1-C8 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C8 haloalkoxy, C1-C8 haloalkylthio, C6-C12 aryl, 5-10 membered heteroaryl.

[0359] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, C1-C6 haloalkyl, C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C6 alkoxy, C1-C6 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C6 haloalkoxy, C1-C6 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0360] In another preferred embodiment, any "substituted" means that one or more (preferably 1, 2, 3, 4, or 5) hydrogen atoms of the group are each independently replaced with a substituent selected from the group consisting of C1-C4 alkyl, C3-C8 cycloalkyl, C1-C4 haloalkyl, C3-C8 halocycloalkyl, halogen, nitro, -CN, hydroxyl, thiol, amino, C1-C4 alkoxy, C1-C4 alkylthio, C3-C8 cycloalkoxy, C3-C8 cycloalkylthio, C1-C4 haloalkoxy, C1-C4 haloalkylthio, C6-C10 aryl, 5-10 membered heteroaryl.

[0361] In another preferred embodiment, the heterocycloalkyl group has 1-4 (preferably 1, 2, 3, or 4) heteroatoms selected from N, O, and S on the heterocyclic ring.

[0362] In another preferred embodiment, the pharmaceutically acceptable salt includes a salt of the compound with an acid.

[0363] In another preferred embodiment, the acid comprises one or more of hydrochloric acid, mucic acid, D-glucuronic acid, hydrobromic acid, hydrofluoric acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, formic acid, acetic acid, trifluoroacetic acid, propionic acid, oxalic acid, malonic acid, succinic acid, fumaric acid, maleic acid, lactic acid, malic acid, tartaric acid, citric acid, picric acid, methanesulfonic acid, benzenesulfonic acid, benzenesulfonic acid, trifluoromethanesulfonic acid, aspartic acid, and glutamic acid.

[0364] In another preferred embodiment, the IV compound comprises:

[0365] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the application.

[0366] In another preferred embodiment, the tumor comprises a tumor with low or no expression of creatine kinase B.

[0367] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the application.

[0368] In another preferred embodiment, the composition or formulation is as described in the fourteenth aspect of the application.

[0369] In another preferred embodiment, the molar ratio (mM: mM) of the IV compound, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof (mM) to the mitochondrial oxidative phosphorylation pathway inhibitor (mM) is 10: (0.01-100), preferably 10: (0.02-50), more preferably 10: (0.05-30), more preferably 10: (0.08-20), more preferably 10: (0.1-10), more preferably 10: (0.1-5), more preferably 10: (0.185-5).

[0370] In another preferred embodiment, the IV compound, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof is the only active ingredient in the composition or formulation.

[0371] In a eighteenth aspect of the application, there is provided a composition or formulation comprising an IV compound, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof as described in the seventeenth aspect of the application; and a mitochondrial oxidative phosphorylation pathway inhibitor.

[0372] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the application.

[0373] In another preferred embodiment, the composition or formulation is as described in the fourteenth aspect of the application

[0374] In another preferred embodiment, the molar ratio (mM: mM) of the compound of Formula IV, or optical isomer thereof, or racemate thereof, or solvate thereof, or pharmaceutically acceptable salt thereof, or deuterated compound thereof (mM) to the mitochondrial oxidative phosphorylation pathway inhibitor (mM) is 10:(0.01-100), preferably 10:(0.02-50), more preferably 10:(0.05-30), more preferably 10:(0.08-20), more preferably 10:(0.1-10), more preferably 10:(0.1-5), more preferably 10:(0.185-5).

[0375] In a nineteenth aspect of the present application, there is provided a method of enhancing the prophylactic and / or therapeutic effect of a mitochondrial oxidative phosphorylation pathway inhibitor on a tumor, said method comprising administering to a subject in need thereof a compound of Formula IV, or optical isomer thereof, or racemate thereof, or solvate thereof, or pharmaceutically acceptable salt thereof, or deuterated compound thereof as described in the seventeenth aspect of the present application, thereby enhancing the prophylactic and / or therapeutic effect of the mitochondrial oxidative phosphorylation pathway inhibitor on the tumor.

[0376] In another preferred embodiment, the subject is one to whom a mitochondrial oxidative phosphorylation pathway inhibitor is administered.

[0377] In another preferred embodiment, the compound of Formula IV, or optical isomer thereof, or racemate thereof, or solvate thereof, or pharmaceutically acceptable salt thereof, or deuterated compound thereof as described in the seventeenth aspect of the present application is administered to the subject simultaneously or sequentially with the mitochondrial oxidative phosphorylation pathway inhibitor.

[0378] In another preferred embodiment, the subject is administered the compound of Formula IV, or optical isomer thereof, or racemate thereof, or solvate thereof, or pharmaceutically acceptable salt thereof, or deuterated compound thereof as described in the seventeenth aspect of the present application first, and then administered the mitochondrial oxidative phosphorylation pathway inhibitor.

[0379] In another preferred embodiment, the subject is administered the mitochondrial oxidative phosphorylation pathway inhibitor first, and then administered the compound of Formula IV, or optical isomer thereof, or racemate thereof, or solvate thereof, or pharmaceutically acceptable salt thereof, or deuterated compound thereof as described in the seventeenth aspect of the present application.

[0380] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0381] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0382] In another preferred embodiment, the subject is a human and a non-human mammal (rodents, rabbits, monkeys, domestic animals, dogs, cats, etc.).

[0383] In a twentieth aspect of the present application, there is provided a use of a mitochondrial calcium uniporter inhibitor for the manufacture of a composition or medicament for enhancing the preventive and / or therapeutic effect of a mitochondrial oxidative phosphorylation pathway inhibitor on a tumor.

[0384] In another preferred embodiment, the mitochondrial calcium uniporter inhibitor comprises Ruthenium Red.

[0385] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0386] In another preferred embodiment, the tumor comprises a tumor with low or no expression of creatine kinase B.

[0387] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0388] In another preferred embodiment, the composition or medicament is as described in the fourteenth aspect of the present application.

[0389] In another preferred embodiment, the molar ratio of the mitochondrial calcium uniporter inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is 100:(0.01-100), preferably 100:(0.02-50), more preferably 100:(0.05-30), more preferably 100:(0.08-20), more preferably 100:(0.1-10), more preferably 100:(0.1-5), more preferably 100:(0.185-5).

[0390] In another preferred embodiment, the mitochondrial calcium uniporter inhibitor is the only active ingredient in the composition or medicament.

[0391] In a twenty-first aspect of the present application, there is provided a composition or medicament comprising a mitochondrial calcium uniporter inhibitor and a mitochondrial oxidative phosphorylation pathway inhibitor.

[0392] In another preferred embodiment, the mitochondrial calcium uniporter inhibitor comprises Ruthenium Red.

[0393] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0394] In another preferred embodiment, the composition or medicament is as described in the fourteenth aspect of the present application.

[0395] In another preferred embodiment, the molar ratio of the mitochondrial calcium unipporter inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is 100:(0.01-100), preferably 100:(0.02-50), more preferably 100:(0.05-30), more preferably 100:(0.08-20), more preferably 100:(0.1-10), more preferably 100:(0.1-5), more preferably 100:(0.185-5).

[0396] In a twenty-second aspect of the present application, there is provided a method of enhancing the prophylactic and / or therapeutic effect of a mitochondrial oxidative phosphorylation pathway inhibitor on a tumor, said method comprising administering to a subject in need thereof a mitochondrial calcium unipporter inhibitor, thereby enhancing the prophylactic and / or therapeutic effect of the mitochondrial oxidative phosphorylation pathway inhibitor on the tumor.

[0397] In another preferred embodiment, the mitochondrial calcium unipporter inhibitor comprises Ruthenium Red.

[0398] In another preferred embodiment, the subject comprises a subject to which a mitochondrial oxidative phosphorylation pathway inhibitor is administered.

[0399] In another preferred embodiment, the mitochondrial calcium unipporter inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are administered to the subject simultaneously or sequentially.

[0400] In another preferred embodiment, the mitochondrial calcium unipporter inhibitor is administered to the subject prior to the administration of the mitochondrial oxidative phosphorylation pathway inhibitor.

[0401] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is administered to the subject prior to the administration of the mitochondrial calcium unipporter inhibitor.

[0402] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0403] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0404] In another preferred embodiment, the subject is a human or a non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0405] In a twenty-third aspect of the present application, there is provided the use of a mitochondrial membrane permeability transition pore inhibitor for the manufacture of a composition or medicament for enhancing the prophylactic and / or therapeutic effect of a mitochondrial oxidative phosphorylation pathway inhibitor on a tumor.

[0406] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor comprises Cyclosporin A.

[0407] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the application.

[0408] In another preferred embodiment, the tumor comprises a tumor with low or no expression of creatine kinase B.

[0409] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the application.

[0410] In another preferred embodiment, the composition or formulation is as described in the fourteenth aspect of the application.

[0411] In another preferred embodiment, the molar ratio of the mitochondrial membrane permeability transition pore inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is 3:(0.01-100), preferably 3:(0.02-50), more preferably 3:(0.05-30), more preferably 3:(0.08-20), more preferably 3:(0.1-10), more preferably 3:(0.1-5), more preferably 3:(0.185-5).

[0412] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor is the only active ingredient in the composition or formulation.

[0413] In a twenty-fourth aspect of the application, there is provided a composition or formulation comprising a mitochondrial membrane permeability transition pore inhibitor and a mitochondrial oxidative phosphorylation pathway inhibitor.

[0414] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor comprises Cyclosporin A.

[0415] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the application.

[0416] In another preferred embodiment, the composition or formulation is as described in the fourteenth aspect of the application.

[0417] In another preferred embodiment, the molar ratio of the mitochondrial membrane permeability transition pore inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is 3:(0.01-100), preferably 3:(0.02-50), more preferably 3:(0.05-30), more preferably 3:(0.08-20), more preferably 3:(0.1-10), more preferably 3:(0.1-5), more preferably 3:(0.185-5).

[0418] In a twenty-fifth aspect of the present application, there is provided a method of enhancing the effect of a mitochondrial oxidative phosphorylation pathway inhibitor in preventing and / or treating a tumor, said method comprising administering to a subject in need thereof a mitochondrial membrane permeability transition pore inhibitor, thereby enhancing the effect of the mitochondrial oxidative phosphorylation pathway inhibitor in preventing and / or treating a tumor.

[0419] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor comprises Cyclosporin A.

[0420] In another preferred embodiment, the subject comprises a subject to which a mitochondrial oxidative phosphorylation pathway inhibitor is administered.

[0421] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor is administered to the subject simultaneously with or prior to the mitochondrial oxidative phosphorylation pathway inhibitor.

[0422] In another preferred embodiment, the mitochondrial membrane permeability transition pore inhibitor is administered to the subject prior to the mitochondrial oxidative phosphorylation pathway inhibitor.

[0423] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is administered to the subject prior to the mitochondrial membrane permeability transition pore inhibitor.

[0424] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0425] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0426] In another preferred embodiment, the subject is a human or a non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0427] In a twenty-sixth aspect of the present application, there is provided a composition or formulation comprising an AKT inhibitor and a mitochondrial oxidative phosphorylation pathway inhibitor.

[0428] In another preferred embodiment, the AKT inhibitor is as described in the fourteenth aspect of the present application.

[0429] In another preferred embodiment, the AKT inhibitor comprises:

[0430] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0431] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises:

[0432] In another preferred embodiment, the composition or formulation is as described in the fourteenth aspect of the present application.

[0433] In another preferred embodiment, the mass ratio of the AKT inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is (0.05-30): 1, preferably (0.08-20): 1, more preferably (0.1-15): 1, more preferably (0.1-10): 1, more preferably (0.1-7.0): 1, more preferably (0.2-5.0): 1, more preferably (0.2-4.0): 1, more preferably (0.3-3.0): 1, more preferably (0.5-2.0): 1, more preferably (0.8-1.7): 1, more preferably (1.0-1.5): 1, more preferably (1.1-1.4): 1, more preferably (1.2-1.3): 1, most preferably 1.25: 1.

[0434] In another preferred embodiment, the composition or formulation comprises a pharmaceutical composition or a pharmaceutical formulation.

[0435] In another preferred embodiment, the composition or formulation further comprises a pharmaceutically acceptable carrier.

[0436] In another preferred embodiment, the composition or formulation is in a solid formulation, a liquid formulation, or a semi-solid formulation.

[0437] In another preferred embodiment, the composition or formulation is in an oral formulation, a topical formulation, or an injectable formulation.

[0438] In another preferred embodiment, the subject of administration of the composition is a human.

[0439] In a twenty-seventh aspect of the present application, there is provided an active ingredient combination, the active ingredient combination comprising:

[0440] (1) a first active ingredient, the first active ingredient comprising an AKT inhibitor; and

[0441] (2) a second active ingredient, the second active ingredient comprising a mitochondrial oxidative phosphorylation pathway inhibitor.

[0442] In another preferred embodiment, the AKT inhibitor is as described in the fourteenth aspect of the present application.

[0443] In another preferred embodiment, the AKT inhibitor comprises:

[0444] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0445] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises:

[0446] In another preferred embodiment, the AKT inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are present in a mass ratio of (0.05-30): 1, preferably (0.08-20): 1, more preferably (0.1-15): 1, more preferably (0.1-10): 1, more preferably (0.1-7.0): 1, more preferably (0.2-5.0): 1, more preferably (0.2-4.0): 1, more preferably (0.3-3.0): 1, more preferably (0.5-2.0): 1, more preferably (0.8-1.7): 1, more preferably (1.0-1.5): 1, more preferably (1.1-1.4): 1, more preferably (1.2-1.3): 1, most preferably 1.25: 1.

[0447] In another preferred embodiment, at least one of the active ingredients in the combination is independent.

[0448] In another preferred embodiment, the first active ingredient and the second active ingredient in the combination are independent of each other.

[0449] In a twenty-eighth aspect of the present application, there is provided a kit comprising:

[0450] (A) a first formulation comprising a first active ingredient, the first active ingredient comprising an AKT inhibitor; and

[0451] (B) a second formulation comprising a second active ingredient, the second active ingredient comprising a mitochondrial oxidative phosphorylation pathway inhibitor.

[0452] In another preferred embodiment, the AKT inhibitor is as described in the fourteenth aspect of the present application.

[0453] In another preferred embodiment, the AKT inhibitor comprises:

[0454] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0455] In another preferred embodiment, the mitochondrial oxidative phosphorylation pathway inhibitor comprises:

[0456] In another preferred embodiment, the AKT inhibitor and the mitochondrial oxidative phosphorylation pathway inhibitor are in a mass ratio of (0.05-30): 1, preferably (0.08-20): 1, more preferably (0.1-15): 1, more preferably (0.1-10): 1, more preferably (0.1-7.0): 1, more preferably (0.2-5.0): 1, more preferably (0.2-4.0): 1, more preferably (0.3-3.0): 1, more preferably (0.5-2.0): 1, more preferably (0.8-1.7): 1, more preferably (1.0-1.5): 1, more preferably (1.1-1.4): 1, more preferably (1.2-1.3): 1, most preferably 1.25: 1.

[0457] In another preferred embodiment, the first agent and the second agent are separate agents.

[0458] In another preferred embodiment, the first agent and the second agent are combined agents.

[0459] In another preferred embodiment, the kit further comprises instructions for use.

[0460] In another preferred embodiment, the instructions for use indicate that the first agent and the second agent are to be used in combination.

[0461] In another preferred embodiment, the first agent and the second agent are used in combination.

[0462] In another preferred embodiment, the method of using in combination comprises administering to the subject the first agent comprising an AKT inhibitor and the second agent comprising a mitochondrial oxidative phosphorylation pathway inhibitor simultaneously or sequentially.

[0463] In another preferred embodiment, the method of using in combination comprises administering to the subject the first agent comprising an AKT inhibitor first and the second agent comprising a mitochondrial oxidative phosphorylation pathway inhibitor second.

[0464] In another preferred embodiment, the method of using in combination comprises administering to the subject the second agent comprising a mitochondrial oxidative phosphorylation pathway inhibitor first and the first agent comprising an AKT inhibitor second.

[0465] In another preferred embodiment, the subject is a tumor-bearing subject.

[0466] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0467] In another preferred embodiment, the subject is a human or a non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0468] In a twenty-ninth aspect of the present application, there is provided use of a composition or formulation according to the twenty-sixth aspect of the present application, a combination of active ingredients according to the twenty-seventh aspect of the present application, or a kit according to the twenty-eighth aspect of the present application, for the manufacture of a medicament or a pharmaceutical kit for preventing and / or treating a tumor.

[0469] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0470] In another preferred embodiment, the dosage form of the medicament is a solid preparation, a liquid preparation, or a semi-solid preparation.

[0471] In another preferred embodiment, the dosage form of the medicament is an oral preparation, a topical preparation, or an injection preparation.

[0472] In a thirtieth aspect of the present application, there is provided a method for preventing and / or treating a tumor, comprising administering to a subject in need thereof a composition or formulation according to the twenty-sixth aspect of the present application, a combination of active ingredients according to the twenty-seventh aspect of the present application, or a kit according to the twenty-eighth aspect of the present application, thereby preventing and / or treating a tumor.

[0473] In another preferred embodiment, the tumor is as described in the fourteenth aspect of the present application.

[0474] In another preferred embodiment, the subject is a human or a non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0475] In another preferred embodiment, the administration is oral administration, topical administration, or injection administration.

[0476] Within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described hereinafter can be combined with each other to form a new or preferred technical solution. BRIEF DESCRIPTION OF DRAWINGS

[0477] Figure 1 is the creatine kinase B expression level of NCI-H82 cells and 786-O cells.

[0478] Figure 2 is the relative viability of shATP5B knockdown NCI-H82 and 786-O cells after ATP5B expression. shCON refers to the relative viability of NCI-H82 or 786-O cells transfected with empty viral vector carrying no specific shRNA for knocking down ATP5B expression, as a control; shATP5B refers to the relative viability of NCI-H82 or 786-O cells transfected with viral vector carrying specific shRNA for knocking down ATP5B expression; ns refers to no significant difference, and *** refers to p<0.001.

[0479] Figure 3 is a Western Blot experiment to detect the expression level of creatine kinase B in shCON, shCKB and shCKB+Flag-CKB cells; wherein shCON is NCI-H82 cells transfected with empty viral vector without specific shRNA to knock down creatine kinase B, as a control; shCKB is NCI-H82 cells transfected with viral vector carrying specific shRNA to knock down creatine kinase B; shCKB+Flag-CKB cells are NCI-H82 cells with knockdown of creatine kinase B and re-expression of wild-type creatine kinase B carrying flag tag in shCKB cells.

[0480] Figure 4 is the relative cell viability of NCI-H82 cells without any treatment, shCON, shCKB and shCKB+Flag-CKB cells; wherein No infected is NCI-H82 cells without any treatment (i.e. NCI-H82 cells without viral vector transfection); shCON is NCI-H82 cells transfected with empty viral vector without specific shRNA to knock down creatine kinase B; shCKB is NCI-H82 cells transfected with viral vector carrying specific shRNA to knock down creatine kinase B; shCKB+Flag-CKB cells are NCI-H82 cells with knockdown of creatine kinase B and re-expression of wild-type creatine kinase B carrying flag tag in shCKB cells.

[0481] Figure 5 is the activity inhibition of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin (5A), Oligomycin (5B) and shATP5B (5C) on shCON, shCKB and shCKB+Flag-CKB cells; wherein shCON is NCI-H82 cells transfected with empty viral vector without specific shRNA to knock down creatine kinase B, as a control; shCKB is NCI-H82 cells transfected with viral vector carrying specific shRNA to knock down creatine kinase B; shCKB+Flag-CKB cells are NCI-H82 cells with knockdown of creatine kinase B and re-expression of wild-type creatine kinase B carrying flag tag in shCKB cells.

[0482] Figure 6 is the tumor volume size (M±SD, n=5) of shCON or shCKB tumor-bearing mice treated with mitochondrial oxidative phosphorylation pathway complex V inhibitor S-Gboxin on day 10, 13, 16, 19, 22 and 25, wherein shCON is a tumor-bearing mouse constructed with NCI-H82 cells transfected with empty viral vector without specific shRNA knocking down creatine kinase B; shCKB is a tumor-bearing mouse constructed with NCI-H82 cells transfected with viral vector carrying specific shRNA knocking down creatine kinase B.

[0483] Figure 7 is the Western Blot experiment detecting the expression level of creatine kinase B in OE-CON and OE-CKB cells, wherein OE-CON is 786-O cells transfected with empty viral vector without expressing flag-tagged wild-type creatine kinase B as a control; OE-CKB is 786-O cells transfected with viral vector carrying expression of flag-tagged wild-type creatine kinase B.

[0484] Figure 8 is the relative cell viability of OE-CON and OE-CKB cells, wherein OE-CON is 786-O cells transfected with empty viral vector without expressing flag-tagged wild-type creatine kinase B as a control; OE-CKB is 786-O cells transfected with viral vector carrying expression of flag-tagged wild-type creatine kinase B.

[0485] Figure 9 is the activity inhibition of OE-CON and OE-CKB cells by different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, wherein OE-CON is 786-O cells transfected with empty viral vector without expressing flag-tagged wild-type creatine kinase B as a control; OE-CKB is 786-O cells transfected with viral vector carrying expression of flag-tagged wild-type creatine kinase B.

[0486] Figure 10 is the tumor volume size (M±SD, n=5) of shCON or shCKB tumor-bearing mice treated with S-Gboxin, MK2206, and S-Gboxin+MK2206 on day 10, 13, 16, 19, 22 and 25, wherein shCON is a tumor-bearing mouse constructed with NCI-H82 cells transfected with empty viral vector without specific shRNA knocking down creatine kinase B; shCKB is a tumor-bearing mouse constructed with NCI-H82 cells transfected with viral vector carrying specific shRNA knocking down creatine kinase B.

[0487] Figure 11 shows cell viability of shCKB cells treated with phosphocreatine (PCr) aqueous solution (10 mM) or water vehicle for 3 days.

[0488] Figure 12 shows the activity inhibition of shCKB and shCON cells treated with different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin (M ± SD, n = 3), where shCKB-H2O refers to the activity inhibition of shCKB cells treated with water vehicle with different concentrations of Gboxin or Oligomycin; shCKB-PCr refers to the activity inhibition of shCKB cells treated with phosphocreatine (PCr) with different concentrations of Gboxin or Oligomycin; shCON-H2O refers to the activity inhibition of shCON cells treated with water vehicle with different concentrations of Gboxin or Oligomycin.

[0489] Figure 13 shows cell viability of shCKB cells treated with DMSO solution of Ruthenium Red (RuR) (100 mM) or DMSO vehicle for 3 days.

[0490] Figure 14 shows the activity inhibition of shCKB and shCON cells treated with different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin (M ± SD, n = 3), where shCKB-DMSO refers to the activity inhibition of shCKB cells treated with DMSO (dimethyl sulfoxide) vehicle with different concentrations of Gboxin or Oligomycin; shCKB-RuR refers to the activity inhibition of shCKB cells treated with Ruthenium Red (RuR) with different concentrations of Gboxin or Oligomycin; shCON-DMSO refers to the activity inhibition of shCON cells treated with DMSO (dimethyl sulfoxide) vehicle with different concentrations of Gboxin or Oligomycin.

[0491] Figure 15 shows cell viability of shCKB cells treated with DMSO solution of Cyclosporin A (CsA) (3 mM) or DMSO vehicle for 3 days.

[0492] Figure 16 is the activity inhibition of different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin on shCKB cells and shCON cells with different treatments (M ± SD, n = 3), wherein shCKB-DMSO refers to the activity inhibition of different concentrations of Gboxin or Oligomycin on shCKB cells pretreated with DMSO (dimethyl sulfoxide) solvent; shCKB-CsA refers to the activity inhibition of different concentrations of Gboxin or Oligomycin on shCKB cells pretreated with Cyclosporin A (CsA); shCON-DMSO refers to the activity inhibition of different concentrations of Gboxin or Oligomycin on shCON cells pretreated with DMSO (dimethyl sulfoxide) solvent.

[0493] Figure 17 is the activity inhibition of different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin on shCON cells with different treatments (M ± SD, n = 3), wherein DMSO refers to the activity inhibition of different concentrations of Gboxin or Oligomycin on shCON cells pretreated with DMSO solvent; CsA refers to the activity inhibition of different concentrations of Gboxin or Oligomycin on shCON cells pretreated with Cyclosporin A (CsA). DETAILED DESCRIPTION

[0494] The inventors have made a long-term and in-depth study, and for the first time accidentally found that tumors with high expression of creatine kinase B are highly sensitive to mitochondrial oxidative phosphorylation pathway inhibitors, that is, mitochondrial oxidative phosphorylation pathway inhibitors have more excellent therapeutic effects on tumors with high expression of creatine kinase B. Therefore, mitochondrial oxidative phosphorylation pathway inhibitors have excellent precision treatment effects on tumors with high expression of creatine kinase B, and creatine kinase B can be used as a marker for judging whether a tumor patient is suitable for precision prevention and / or treatment with mitochondrial oxidative phosphorylation pathway inhibitors. On this basis, the inventors completed the present application.

[0495] TERMS

[0496] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0497] As used herein, the terms "comprises", "comprising", "includes", "including", "contains", "containing", "has", "having", "may" and "including" are interchangeable with respect to the terms "consisting of", "consists of", "consists essentially of", and "consists essentially of". In other words, the terms include open- ended definitions.

[0498] As used herein, the terms "anti-cancer drug" and "anti-tumor drug" are used interchangeably.

[0499] As used herein, the terms "cancer", "carcinoma", "tumor" and "neoplasm" are used interchangeably.

[0500] As used herein, the term "a cell" refers to a cell (e.g., a single cancer cell) or a group of cells comprising multiple similar cells (e.g., a tumor tissue).

[0501] As used herein, "a tumor of a patient is susceptible to mitochondrial oxidative phosphorylation pathway inhibitors" includes that the tumor of the patient is sensitive to mitochondrial oxidative phosphorylation pathway inhibitors.

[0502] As used herein, "a tumor of a patient is not susceptible to mitochondrial oxidative phosphorylation pathway inhibitors" includes that the tumor of the patient is not sensitive to mitochondrial oxidative phosphorylation pathway inhibitors.

[0503] As used herein, the terms "IC50" and "IC 50 " are used interchangeably and refer to the half-inhibiting concentration, i.e., the concentration of an inhibitor at which 50% inhibition is achieved.

[0504] As used herein, the term "P / S" refers to the addition of Penicillin and Streptomycin to the relevant culture medium.

[0505] As used herein, the term "creatine kinase B" is abbreviated as CKB.

[0506] As used herein, the term "mitochondria permeability transition pore" is abbreviated as mPTP.

[0507] As used herein, the term "ATP5B" refers to mitochondrial ATP synthase beta subunit, which is abbreviated as ATP Synthase F1 Subunit Beta.

[0508] As used herein, the term "an allosteric AKT inhibitor" is abbreviated as AKT inhibitor.

[0509] As used herein, the term "Cyclosporin A" is abbreviated as CsA, and has a CAS registry number of 59865-13-3.

[0510] As used herein, the term "ruthenium red" has the English name Ruthenium red, abbreviated RuR, CAS Registry Number 11103-72-3.

[0511] As used herein, the term "solvate" refers to a compound coordinated with solvent molecules in a specific ratio to form a complex.

[0512] As used herein, the term "deuterated" refers to a compound or group in which one or more hydrogens are replaced by deuterium. Deuterated can be mono-substituted, di-substituted, poly-substituted, or per-substituted.

[0513] It is understood that one of ordinary skill in the art can select substituents and substitution patterns on the compounds of the present application to produce compounds that are chemically stable, which can be synthesized by techniques known in the art and methods set forth below. If substituted by more than one substituent group, it is understood that the multiple groups can be on the same carbon or on different carbons, as long as a stable structure results.

[0514] As used herein, the term "substituted" or "substitution" is the replacement of a hydrogen atom on a group with a non-hydrogen atom group, but with the proviso that the valence requirements are met and that a chemically stable compound results, i.e., a compound that does not spontaneously undergo transformation such as cyclization, elimination, etc.

[0515] As used herein, indicates the point of attachment of the group.

[0516] As used herein, the term "alkyl" refers to a straight chain (i.e., unbranched) or branched saturated hydrocarbon group that contains only carbon and hydrogen atoms, or a combination thereof. When preceded by a number designating the number of carbon atoms (e.g., C1-C6alkyl) it indicates that the alkyl group contains that number of carbon atoms (e.g., 1-6), for example, C1-C4alkyl refers to an alkyl group containing 1-4 carbon atoms. Representative examples of alkyl include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, or the like.

[0517] As used herein, the term "halogen" refers to F, Cl, Br, or I.

[0518] As used herein, the term "halo" refers to one or more (preferably 1, 2, or 3) hydrogen atoms on a group that are replaced with a halogen.

[0519] As used herein, the term "haloalkyl" refers to an alkyl group, as defined above, wherein one or more (preferably 1, 2, 3, or 4) of the hydrogen atoms have been replaced with a halogen, as defined above. When a haloalkyl group is preceded by a number of carbon atoms limitation (e.g., C1-C8haloalkyl), this refers to the number of carbon atoms (e.g., 1-8) contained in the haloalkyl group. For example, C1-C6haloalkyl refers to a haloalkyl group containing 1-6 carbon atoms. Representative examples of haloalkyl groups include, but are not limited to, -CF3, -CHF2, monofluoroisopropyl, difluorobutyl, or the like.

[0520] As used herein, the term "cycloalkyl" refers to a saturated or partially saturated monocyclic, bicyclic, or polycyclic (fused, bridged, or spirocyclic) ring carbocyclic hydrocarbon group. When a cycloalkyl group is preceded by a number of carbon atoms limitation (e.g., C3-C12), this refers to the number of ring carbon atoms (e.g., 3-12) contained in the cycloalkyl group. For example, the term "C3-C8cycloalkyl" refers to a saturated or partially saturated monocyclic or bicyclic alkyl group having from 3 to 8 ring carbon atoms, including cyclopropyl, cyclobutyl, cyclopentyl, cycloheptyl, or the like. "Spirocycloalkyl" refers to a bicyclic or polycyclic group in which single rings share a carbon atom (termed a spiro atom), which can contain one or more double bonds, but no ring has a fully conjugated pi-electron system. "Fused cycloalkyl" refers to a fully carbon bicyclic or polycyclic group in which each ring in the system shares an adjacent pair of carbon atoms with other rings in the system, in which one or more rings can contain one or more double bonds, but no ring has a fully conjugated pi-electron system. "Bridged cycloalkyl" refers to a fully carbon polycyclic group in which any two rings share two non-adjacent carbon atoms, which rings can contain one or more double bonds, but no ring has a fully conjugated pi-electron system. Representative examples of cycloalkyl groups include, but are not limited to, the following:

[0521] As used herein, the term "halocycloalkyl" refers to a cycloalkyl group, as defined above, wherein one or more (preferably 1, 2, 3, or 4) of the hydrogen atoms have been replaced with a halogen, as defined above. When a halocycloalkyl group is preceded by a number of carbon atoms limitation (e.g., C3-C8halocycloalkyl), this refers to the number of ring carbon atoms (e.g., 3-8 ring carbon atoms) contained in the halocycloalkyl group. For example, C3-C8halocycloalkyl refers to a halocycloalkyl group containing 3-8 ring carbon atoms. Representative examples of halocycloalkyl groups include, but are not limited to, monofluorocyclopropyl, monochlorocyclobutyl, monofluorocyclopentyl, difluorocycloheptyl, or the like.

[0522] As used herein, the term "alkoxy" refers to a R-O- group, wherein R is alkyl, alkyl being as defined herein above, when preceded by a number limit of carbon atoms, e.g. C1-C8 alkoxy means that the alkyl group in said alkoxy group has 1 to 8 carbon atoms. Representative examples of alkoxy groups include, but are not limited to: methoxy, ethoxy, n-propoxy, i-propoxy, t-butoxy, or the like.

[0523] As used herein, the term "alkylthio" refers to a R-S- group, wherein R is alkyl, alkyl being as defined herein above, when preceded by a number limit of carbon atoms, e.g. C1-C8 alkylthio means that the alkyl group in said alkylthio group has 1 to 8 carbon atoms. Representative examples of alkylthio groups include, but are not limited to: methylthio, ethylthio, n-propylthio, i-propylthio, t-butylthio, or the like.

[0524] As used herein, the term "haloalkoxy" refers to haloalkyl-O-, said haloalkyl being as defined above, when preceded by a number limit of carbon atoms, e.g. C1-C6 haloalkoxy means C1-C6 haloalkyl-O-, i.e. a haloalkoxy group containing 1 to 6 carbon atoms. Representative examples of haloalkoxy groups include, but are not limited to: monofluoromethoxy, monofluoroethoxy, difluorobutoxy, or the like.

[0525] As used herein, the term "haloalkylthio" refers to haloalkyl-S-, said haloalkyl being as defined above, when preceded by a number limit of carbon atoms, e.g. C1-C6 haloalkylthio means C1-C6 haloalkyl-S-, i.e. a haloalkylthio group containing 1 to 6 carbon atoms. Representative examples of haloalkylthio groups include, but are not limited to: monofluoromethylthio, monofluoroethylthio, difluorobutylthio, or the like.

[0526] As used herein, the term "cycloalkoxy" refers to a R-O- group, wherein R is cycloalkyl, cycloalkyl being as defined herein above, when preceded by a number limit of carbon atoms, e.g. C3-C8 cycloalkoxy means that the cycloalkyl group in said cycloalkoxy group has 3 to 8 ring carbon atoms. Representative examples of cycloalkoxy groups include, but are not limited to: cyclopropoxy, cyclobutoxy, or the like.

[0527] As used herein, the term "cycloalkylthio" refers to a R-S- group, wherein R is cycloalkyl, cycloalkyl being as defined herein above, when preceded by a number limit of carbon atoms, e.g. C3-C8 cycloalkylthio means that the cycloalkyl group in said cycloalkylthio group has 3 to 8 ring carbon atoms. Representative examples of cycloalkylthio groups include, but are not limited to: cyclopropylthio, cyclobutylthio, or the like.

[0528] As used herein, the term "heterocycloalkyl" refers to a fully saturated or partially unsaturated cyclic (including but not limited to, e.g., 3-7 membered monocyclic, 7-11 membered bicyclic, or 8-16 membered tricyclic ring systems) group in which at least one heteroatom is present in at least one carbon atom-containing ring, the point of attachment of the group being at a ring containing a heteroatom. When the number of members preceding heterocycloalkyl is limited, it refers to the number of ring atoms of the heterocycloalkyl group, e.g., 3-16 membered heterocycloalkyl refers to a heterocycloalkyl group having from 3 to 16 ring atoms. Each heteroatom-containing ring can have one or more (e.g., 1, 2, 3, or 4) heteroatoms each independently selected from the group consisting of nitrogen, oxygen, or sulfur, wherein the nitrogen or sulfur can be oxidized, and the nitrogen can be quaternized. Typical monocyclic heterocycloalkyl groups include, but are not limited to, azetidinyl, oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl. Polycyclic heterocycloalkyl groups include spiro, fused, and bridged ring heterocycloalkyl groups; wherein the spiro, fused, and bridged ring heterocycloalkyl groups are optionally connected to other groups by a single bond or further annulated to other cycloalkyl, heterocycloalkyl rings through any two or more atoms of the ring.

[0529] As used herein, the term "aryl" refers to a fully carbon monocyclic or fused polycyclic (that is, rings which share pairs of adjacent carbon atoms) group having a conjugated pi electron system, an aromatic cyclic hydrocarbon group, when the number of carbon atoms preceding aryl is limited, it refers to the number of ring carbon atoms of the aryl group, e.g., C6-C12 aryl refers to an aryl group having from 6 to 12 ring carbon atoms, for example, phenyl and naphthyl.

[0530] As used herein, the term "heteroaryl" refers to an aromatic heterocyclic ring system group having one to multiple (preferably 1, 2, 3, or 4) ring heteroatoms, wherein at least one heteroatom is present in at least one carbon atom-containing ring, which can be a monocyclic (monocyclic) or polycyclic (bicyclic, tricyclic, or polycyclic) group fused together or covalently linked, each heteroatom-containing ring can have one or more (e.g., 1, 2, 3, 4) heteroatoms each independently selected from the group consisting of oxygen, sulfur, and nitrogen. When the number of members preceding heteroaryl is limited, it refers to the number of ring atoms of the heteroaryl group, e.g., 5-12 membered heteroaryl refers to a heteroaryl group having from 5 to 12 ring atoms. Representative examples of heteroaryl groups include, but are not limited to: pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, furanyl, pyridyl, pyrimidinyl, and the like.

[0531] As used herein, the term "amino" alone or as part of another substituent is -NH2.

[0532] As used herein, the term "nitro" alone or as part of another substituent is -NO2.

[0533] As used herein, the term "cyano," alone or in part as a substituent, is -CN.

[0534] As used herein, the term "hydroxy," alone or in part as a substituent, is -OH.

[0535] As used herein, the term "mercapto," alone or in part as a substituent, is -SH.

[0536] In the present application, it should be construed that all substituents are unsubstituted, unless explicitly described as "substituted" herein. The term "substituted" means that one or more hydrogen atoms on a group are each independently replaced with a substituent. The substituent can be a substituent described in the foregoing, or a substituent appearing in each embodiment. Unless specifically stated, any arbitrary substituted group can be substituted at any substitutable site of the group, and the substituents can be the same or different at each position.

[0537] In the present application, the term "prevention" means a method of preventing the onset of a disease and / or its attendant symptoms or protecting a subject from acquiring a disease. As used herein, "prevention" also includes delaying the onset of a disease and / or its attendant symptoms and reducing the risk of a subject acquiring a disease.

[0538] In the present application, the term "treatment" includes slowing down and stopping the progression of a disease, or eliminating a disease, and does not require 100% inhibition, elimination, and reversal. In some embodiments, the mitochondrial oxidative phosphorylation pathway inhibitor reduces, inhibits, and / or reverses a relevant disease (such as a tumor) and its complications, for example, by at least about 30%, at least about 50%, or at least about 80%, at least about 90%, or 100%, compared to the level observed in the absence of the mitochondrial oxidative phosphorylation pathway inhibitor.

[0539] Mitochondrial oxidative phosphorylation pathway inhibitor

[0540] The mitochondrial oxidative phosphorylation pathway inhibitor described in the present application can be a gene, a protein, a compound, or the like.

[0541] Representatively, the mitochondrial oxidative phosphorylation pathway inhibitor described in the present application is as described above in the first aspect of the present application.

[0542] Creatine kinase B

[0543] In the present application, the English name of creatine kinase B is creatine kinase B, abbreviated as CKB.

[0544] A tumor with high expression of creatine kinase B is sensitive to a mitochondrial oxidative phosphorylation pathway inhibitor, and thus, the mitochondrial oxidative phosphorylation pathway inhibitor has an excellent precision treatment effect on a tumor with high expression of creatine kinase B.

[0545] tumor

[0546] In the present application, the terms "tumor", "cancer", "carcinoma" and "neoplasm" are used interchangeably.

[0547] In a preferred embodiment of the present application, the tumor according to the present application comprises a tumor with high expression of creatine kinase B.

[0548] Preferably, the tumor with high expression of creatine kinase B according to the present application is as described in the first aspect of the present application.

[0549] In a preferred embodiment of the present application, the tumor according to the present application comprises a tumor with low expression or no expression of creatine kinase B.

[0550] Preferably, the tumor with low expression or no expression of creatine kinase B according to the present application is as described in the fourteenth aspect of the present application.

[0551] In particular, the tumor according to the present application is as described in the first aspect of the present application or the fourteenth aspect of the present application.

[0552] In the present application, the tumor types corresponding to the representative tumor cell lines are shown in Table 1 below:

[0553] Table 1

[0554] Antitumor drug

[0555] In the present application, the antitumor drug can be a mitochondrial oxidative phosphorylation pathway inhibitor according to the present application.

[0556] Preferably, the mitochondrial oxidative phosphorylation pathway inhibitor is as described in the first aspect of the present application.

[0557] Use

[0558] The present application provides a use of a mitochondrial oxidative phosphorylation pathway inhibitor in the prevention and / or treatment of a tumor. In particular, a tumor with high expression of creatine kinase B is highly sensitive to a mitochondrial oxidative phosphorylation pathway inhibitor, i.e. the mitochondrial oxidative phosphorylation pathway inhibitor has a more excellent therapeutic effect on a tumor with high expression of creatine kinase B, and thus the mitochondrial oxidative phosphorylation pathway inhibitor has an excellent precision treatment effect on a tumor with high expression of creatine kinase B.

[0559] The present application also provides a method for preventing and / or treating a tumor by administering a mitochondrial oxidative phosphorylation pathway inhibitor to a subject in need thereof.

[0560] The mitochondrial oxidative phosphorylation pathway inhibitor has more significant and superior preventive and therapeutic effects on the tumor with high expression of creatine kinase B. In the prevention and / or treatment of the tumor, the creatine kinase B promoter can be administered to the subject first to make the tumor of the subject have high expression of creatine kinase B, and then the mitochondrial oxidative phosphorylation pathway inhibitor can be administered to prevent and / or treat the tumor, so that the tumor can be prevented and / or treated more significantly.

[0561] In a preferred embodiment of the present application, the subject is a human and a non-human mammal (rodent, rabbit, monkey, livestock, dog, cat, etc.).

[0562] Marker

[0563] The present application also provides a marker for judging whether a tumor patient is suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor, wherein the marker comprises the expression level of creatine kinase B.

[0564] In an embodiment of the present application, the expression level of creatine kinase B is used as a marker for judging whether a tumor patient is suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor, and the method comprises but is not limited to:

[0565] When the tumor cells of the tumor patient have high expression of creatine kinase B, the tumor patient is suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor; and / or

[0566] When the tumor cells of the tumor patient have low expression or no expression of creatine kinase B, the tumor patient is not suitable for prevention and / or treatment with a mitochondrial oxidative phosphorylation pathway inhibitor.

[0567] Specifically, the tumor with high expression of creatine kinase B according to the present application is as described above in the first aspect of the present application.

[0568] Composition or preparation

[0569] The composition or preparation according to the present application is preferably a pharmaceutical composition or a pharmaceutical preparation, and the composition or preparation according to the present application can comprise a pharmaceutically acceptable carrier.

[0570] As used herein, "pharmaceutically acceptable carrier" refers to one or more compatible solid, semi-solid, liquid or gel fillers, which are suitable for human or animal use and must have sufficient purity and sufficiently low toxicity. "Compatibility" means that the components and active ingredients in the composition and between them are blended without significantly reducing the drug efficacy.

[0571] It is to be understood that in the present application, the pharmaceutically acceptable carrier is not particularly limited, and can be selected from materials commonly used in the art, prepared by conventional methods, or purchased from the market. Examples of the pharmaceutically acceptable carrier include cellulose and its derivatives, gelatin, talc, solid lubricants, calcium sulfate, vegetable oils, polyhydric alcohols, emulsifiers, wetting agents, buffers, chelating agents, thickening agents, pH adjusting agents, coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, bacteriostatic agents, pyrogen-free water, and the like.

[0572] In a preferred embodiment of the present application, the composition or preparation is in the form of a solid preparation, a liquid preparation, or a semi-solid preparation.

[0573] In a preferred embodiment of the present application, the composition or preparation is in the form of an oral preparation, a topical preparation, or an injection preparation

[0574] Typically, the composition or preparation is in the form of a tablet, an injection, an infusion, a paste, a gel, a solution, a microsphere, or a film.

[0575] The pharmaceutical preparation should be matched with the administration method. The pharmaceutical preparation of the present application can also be used with other synergistic therapeutic agents (including before, during, or after use). When using the pharmaceutical composition or preparation, a safe and effective amount of the drug is administered to the subject (such as a human or a non-human mammal), which is usually at least about 10 μg / kg body weight, and in most cases no more than about 8 mg / kg body weight, preferably the dose is about 10 μg / kg body weight to about 1 mg / kg body weight. Of course, the specific dose should also take into account the administration route, the patient's health status, and the like, which are within the skill of a skilled physician.

[0576] The main technical effects of the present application include:

[0577] 1. The present application first accidentally discovers that tumors with high expression of creatine kinase B are highly sensitive to mitochondrial oxidative phosphorylation pathway inhibitors, i.e., mitochondrial oxidative phosphorylation pathway inhibitors have more excellent therapeutic effects on tumors with high expression of creatine kinase B, thus, mitochondrial oxidative phosphorylation pathway inhibitors have excellent precision treatment effects on tumors with high expression of creatine kinase B, and creatine kinase B can be used as a marker for judging whether a tumor patient is suitable for precision prevention and / or treatment with mitochondrial oxidative phosphorylation pathway inhibitors. Precision treatment of tumors with high expression of creatine kinase B with mitochondrial oxidative phosphorylation pathway inhibitors can improve the therapeutic effect on tumors and avoid administering mitochondrial oxidative phosphorylation pathway inhibitors to tumor patients who are not sensitive to them. Therefore, the precision treatment of tumors with high expression of creatine kinase B with mitochondrial oxidative phosphorylation pathway inhibitors has more excellent prevention and treatment effects on tumors, lower drug dosage, and fewer side effects, etc., which can improve the precision prevention and treatment effects of mitochondrial oxidative phosphorylation pathway inhibitors on tumors while reducing side effects and improving patient compliance.

[0578] 2. The present application accidentally discovers that AKT inhibitors (such as compound MK2206), phosphocreatine, calcium ion uniporter inhibitors (such as Ruthenium red), and mitochondrial membrane permeability transition pore inhibitors (such as Cyclosporin A) can enhance the effects of mitochondrial oxidative phosphorylation pathway inhibitors on tumors, such as tumors with low expression of creatine kinase B, thus, AKT inhibitors (such as compound MK2206), phosphocreatine, calcium ion uniporter inhibitors (such as Ruthenium red), and mitochondrial membrane permeability transition pore inhibitors (such as Cyclosporin A) can be used as antitumor synergists of mitochondrial oxidative phosphorylation pathway inhibitors to enhance the effects of mitochondrial oxidative phosphorylation pathway inhibitors on tumors, such as tumors with low expression of creatine kinase B.

[0579] 3. The present application also discovers that AKT inhibitors (such as compound MK2206) and mitochondrial oxidative phosphorylation pathway inhibitors (such as S-Gboxin) have excellent synergistic effects on tumors, such as tumors with low expression of creatine kinase B, thus, the combination of AKT inhibitors and mitochondrial oxidative phosphorylation pathway inhibitors has significantly excellent synergistic therapeutic effects on tumors, such as tumors with low expression of creatine kinase B.

[0580] The present application will be further described below in conjunction with specific examples. It should be understood that the following specific examples are given on the premise of the technical solution of the present application, and detailed implementation modes and specific operation processes are given, but the protection scope of the present application is not limited to the present examples.

[0581] Examples

[0582] Oligomycin, Gboxin and S-Gboxin are all known inhibitors of mitochondrial oxidative phosphorylation pathway complex V.

[0583] The structure of oligomycin compound is as follows:

[0584] The structure of Gboxin compound is as follows:

[0585] The structure of S-Gboxin compound is as follows:

[0586] ATP5B refers to mitochondrial ATP synthase beta subunit, and the English name is ATP Synthase F1 Subunit Beta.

[0587] The English name of AKT inhibitor is an allosteric AKT inhibitor.

[0588] Cyclosporin A is the Chinese name of Cyclosporin A, abbreviated as CsA, and the CAS accession number is 59865-13-3.

[0589] The English name of ruthenium red is Ruthenium red, abbreviated as RuR, and the CAS accession number is 11103-72-3.

[0590] Example 1

[0591] This example investigates the sensitivity of cells with different expression levels of creatine kinase B (abbreviated as CKB) to mitochondrial oxidative phosphorylation pathway complex V inhibitors.

[0592] Experimental method

[0593] 1. The Western Blot experiment was used to detect the expression level difference of creatine kinase B in NCI-H82 cells (human small cell lung cancer cells) and 786-O cells (renal clear cell adenocarcinoma cells), and the results are shown in Figure 1.

[0594] As can be seen from Figure 1, creatine kinase B is highly expressed in NCI-H82 cells, while creatine kinase B is lowly expressed in 786-O.

[0595] 2. Inhibition effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors on tumor cells with different expression levels of creatine kinase B

[0596] ATP5B is a component of mitochondrial oxidative phosphorylation pathway complex V, and knocking down the gene expression of ATP5B can effectively inhibit the activity of oxidative phosphorylation pathway complex V.

[0597] The gene expression of ATP5B of NCI-H82 and 786-O cells was knocked down by the method of transfecting shRNA (the nucleotide sequence of shATP5B is GTCTGCATTATTGGGCCGAAT (SEQ ID No: 1)) specific for knocking down the expression of ATP5B through a viral vector, while NCI-H82 and 786-O cells transfected with empty viral vectors carrying shRNA (shCON) specific for knocking down the expression of ATP5B were used as controls.

[0598] The relative viability of NCI-H82 and 786-O cells after knocking down the expression of ATP5B by shATP5B was detected by using Promega CellTiter-Glo cell viability assay kit (which detects cell viability by detecting the content of ATP in cells), and the results are shown in Figure 2. As can be seen from Figure 2, after knocking down the expression of ATP5B to inhibit the mitochondrial oxidative phosphorylation pathway complex V, the viability of NCI-H82 cells with high expression of creatine kinase B was significantly reduced, while the viability of 786-O cells with low expression of creatine kinase B was less affected, thereby indicating that the mitochondrial oxidative phosphorylation pathway complex V inhibitor has a more significant inhibitory effect on tumor cells with high expression of creatine kinase B, and the expression level of creatine kinase B in tumor cells is significantly positively correlated with its sensitivity to mitochondrial oxidative phosphorylation pathway complex V inhibitors, therefore, the mitochondrial oxidative phosphorylation pathway complex V inhibitor has an excellent precision treatment effect on tumor cells with high expression of creatine kinase B.

[0599] Example 2

[0600] 1. Construction of NCI-H82 cells with different expression levels of creatine kinase B

[0601] NCI-H82 cells with low expression of creatine kinase B (shCKB cells) were obtained by knocking down the expression of creatine kinase B in NCI-H82 cells by a method of transfecting shRNA specific for knocking down creatine kinase B (the nucleotide sequence of the shRNA was CCCTGCTGCTTCCTAACTTAT (SEQ ID No: 2)) through a viral vector; in the shCKB cells, wild-type creatine kinase B carrying a flag tag was further re-expressed by transfecting the wild-type creatine kinase B carrying a flag tag (wild-type creatine kinase B carrying a flag tag was cloned by using the primers flag-CKB-Fw: TCGAGCTCAAGCTTCGAATTCATGGACTACAAAGACGATGACGACAAGATGCCCTTCTCCAACAGCCA (SEQ ID No: 3) and flag-CKB-Rev: TTATCTAGAGTCGCGGGATCCTCATTTCTGGGCAGGCATGA (SEQ ID No: 4)) through a viral vector, thereby obtaining NCI-H82 cells in which creatine kinase B was knocked down and then re-expressed (shCKB+Flag-CKB cells); at the same time, NCI-H82 cells transfected with an empty viral vector not carrying shRNA specific for knocking down creatine kinase B (shCON cells) were used as a control. The expression level of creatine kinase B in the shCKB cells, shCKB+Flag-CKB cells and shCON cells was detected by Western Blot experiment, and the results are shown in FIG. 3. As can be seen from FIG. 3, compared with the shCON cells, the expression of creatine kinase B in the shCKB cells was knocked down (i.e., low expression), and the shCKB+Flag-CKB cells re-expressed creatine kinase B.

[0602] The viability of NCI-H82 cells without any treatment, shCON cells, shCKB cells and shCKB+Flag-CKB cells was detected using a Promega CellTiter-Glo cell viability assay kit (which detects cell viability by detecting the content of ATP in cells), and the results are shown in FIG. 4. As can be seen from FIG. 4, the viability of NCI-H82 cells without any treatment, shCON cells, shCKB cells and shCKB+Flag-CKB cells was almost the same, and the difference in cell viability was not statistically significant.

[0603] 2. Investigation of the correlation between the anti-tumor effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors and the expression level of creatine kinase B at the cellular level

[0604] Experimental background: Promega CellTiter-Glo cell viability assay kit was used to detect the cell viability by detecting the intracellular ATP content, and the activity inhibition of mitochondrial oxidative phosphorylation pathway complex V inhibitors on shCON cells, shCKB cells and shCKB+Flag-CKB cells constructed in the above steps.

[0605] 2.1 Activity inhibition of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin on cells with different expression levels of creatine kinase B

[0606] Experimental method and result: shCON cells, shCKB cells and shCKB+Flag-CKB cells constructed in the above steps were cultured in RPMI1640 medium containing 10% fetal bovine serum (+P / S), and the activity inhibition of different mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin or Oligomycin on shCON cells, shCKB cells and shCKB+Flag-CKB cells was determined, and the experimental results are shown in FIG. 5A and FIG. 5B.

[0607] 2.2 Method of investigating the activity inhibition of inhibiting mitochondrial oxidative phosphorylation pathway complex V on cells with different expression levels of creatine kinase B by shRNA knockdown of ATP5B gene expression

[0608] The method of transfecting shRNA (the nucleotide sequence of shATP5B is GTCTGCATTATTGGGCCGAAT (SEQ ID No: 1)) specifically knocking down the expression of ATP5B by a viral vector to knock down the gene expression of ATP5B of shCON cells, shCKB cells and shCKB+Flag-CKB cells, and shCON cells, shCKB cells and shCKB+Flag-CKB cells transfected by empty viral vectors carrying no shRNA specifically knocking down the expression of ATP5B were used as controls.

[0609] The relative activity of shATP5B knockdown shCON cells, shCKB cells and shCKB+Flag-CKB cells after the expression of ATP5B was detected by using Promega CellTiter-Glo cell viability assay kit (which detects the intracellular ATP content to reflect the cell viability), and the results are shown in FIG. 5C.

[0610] As can be seen from FIG. 5, the mitochondrial oxidative phosphorylation pathway complex V inhibitor Gboxin (FIG. 5A), Oligomycin (FIG. 5B), and shATP5B (FIG. 5C) had excellent inhibitory effect on shCON cells (NCI-H82 cells with high expression of creatine kinase B), poor inhibitory effect on shCKB cells (NCI-H82 cells with low expression of creatine kinase B), and excellent inhibitory effect on shCKB+Flag-CKB cells (NCI-H82 cells with high expression of creatine kinase B after knockdown of expression of creatine kinase B), thus indicating that NCI-H82 cells with low expression of creatine kinase B (shCKB cells) had poor sensitivity to mitochondrial oxidative phosphorylation pathway complex V inhibitors, and that NCI-H82 cells with high expression of creatine kinase B (shCON cells and shCKB+Flag-CKB cells) had high sensitivity to mitochondrial oxidative phosphorylation pathway complex V inhibitors. Therefore, mitochondrial oxidative phosphorylation pathway complex V inhibitors had excellent precision treatment effect on tumor cells with high expression of creatine kinase B.

[0611] 3. Investigation of correlation between anti-tumor effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors and expression level of creatine kinase B at animal level

[0612] Experimental method and results: 5x10 6 shCON cells or shCKB cells were inoculated subcutaneously in nude mice to construct tumor-bearing mice, and the tumor-bearing mice in each group were injected intraperitoneally with mitochondrial oxidative phosphorylation pathway complex V inhibitor compound S-Gboxin at a dose of 10 mg / kg / day, once a day, for 15 consecutive days, and the inhibitory effect of S-Gboxin on the tumors was detected. The control group was given a drug vehicle in the same manner, and the tumor volume of the mice was detected on days 10, 13, 16, 19, 22, and 25, wherein the tumor volume was calculated according to the formula: tumor volume = 1 / 2 length x width 2 , and the results are shown in FIG. 6.

[0613] As can be seen from FIG. 6, the mitochondrial oxidative phosphorylation pathway complex V inhibitor S-Gboxin had significant inhibitory effect on the growth of subcutaneously transplanted tumors of shCON cells (NCI-H82 cells with high expression of creatine kinase B), but the inhibitory effect on subcutaneously transplanted tumors of shCKB cells (NCI-H82 cells with low expression of creatine kinase B) was significantly weakened, thus indicating that the mitochondrial oxidative phosphorylation pathway complex V inhibitor had good inhibitory effect on cells with high expression of creatine kinase B and poor inhibitory effect on cells with low expression of creatine kinase B.

[0614] Therefore, as can be seen from FIGS. 5 and 6, the mitochondrial oxidative phosphorylation pathway complex V inhibitor has a more significant inhibitory effect on the tumor cells with high expression of creatine kinase B, and the expression level of creatine kinase B in the tumor cells is significantly positively correlated with the sensitivity to the mitochondrial oxidative phosphorylation pathway complex V inhibitor, and thus the mitochondrial oxidative phosphorylation pathway complex V inhibitor has an excellent precision treatment effect on the tumor cells with high expression of creatine kinase B.

[0615] Example 3

[0616] In the 786-O cells with low expression of creatine kinase B, wild-type creatine kinase B carrying a flag tag was expressed by transfection with a viral vector (wild-type creatine kinase B carrying a flag tag was cloned using the primers flag-CKB-Fw: TCGAGCTCAAGCTTCGAATTCATGGACTACAAAGACGATGACGACAAGATGCCCTTCTCCAACAGCCA (SEQ ID No: 3) and flag-CKB-Rev: TTATCTAGAGTCGCGGGATCCTCATTTCTGGGCAGGCATGA (SEQ ID No: 4)), thereby obtaining 786-O cells with high expression of creatine kinase B (OE-CKB cells); at the same time, 786-O cells transfected with an empty viral vector not carrying the wild-type creatine kinase B with a flag tag (OE-CON cells) were used as a control. The expression level of creatine kinase B in the OE-CKB cells and the OE-CON cells was detected by Western Blot experiment, and the results are shown in FIG. 7. As can be seen from FIG. 7, the OE-CKB cells have high expression of creatine kinase B compared with the OE-CON cells.

[0617] The cell viability of the OE-CON cells and the OE-CKB cells was detected using a Promega CellTiter-Glo cell viability assay kit (the kit reacts cell viability by detecting the content of ATP in cells), and the results are shown in FIG. 8. As can be seen from FIG. 8, the OE-CON cells and the OE-CKB cells have almost the same viability, and the difference in cell viability is not statistically significant.

[0618] The OE-CON cells and the OE-CKB cells constructed in the above steps were respectively cultured in RPMI1640 culture medium containing 10% fetal bovine serum (+P / S), and the inhibitory effect of different mitochondrial oxidative phosphorylation pathway complex V inhibitors, Gboxin and Oligomycin, on the activity of the OE-CON cells and the OE-CKB cells was determined, and the experimental results are shown in FIG. 9.

[0619] As can be seen from FIG. 9, the mitochondrial oxidative phosphorylation pathway complex V inhibitor Gboxin and Oligomycin have excellent inhibitory effects on OE-CKB cells (786-O cells in which creatine kinase B is highly expressed), and poor inhibitory effects on OE-CON cells (786-O cells in which creatine kinase B is lowly expressed), thereby indicating that 786-O cells in which creatine kinase B is lowly expressed (OE-CON cells) are less sensitive to mitochondrial oxidative phosphorylation pathway complex V inhibitors than 786-O cells in which creatine kinase B is highly expressed (and OE-CKB cells), and thus, mitochondrial oxidative phosphorylation pathway complex V inhibitors have more significant inhibitory effects on tumor cells in which creatine kinase B is highly expressed, and the expression level of creatine kinase B in tumor cells is significantly positively correlated with the sensitivity of the tumor cells to mitochondrial oxidative phosphorylation pathway complex V inhibitors, and thus, mitochondrial oxidative phosphorylation pathway complex V inhibitors have excellent precision treatment effects on tumor cells in which creatine kinase B is highly expressed.

[0620] Example 4

[0621] This example investigates the effect of AKT inhibitor MK2206 on the anti-tumor effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors.

[0622] The structure of MK2206 is as follows:

[0623] According to the method of Example 2, the expression of creatine kinase B in NCI-H82 cells was knocked down by transfecting a virus vector carrying shRNA specific for knocking down creatine kinase B (the nucleotide sequence of the shRNA is CCCTGCTGCTTCCTAACTTAT (SEQ ID No: 2)), and NCI-H82 cells not transfected with the empty virus vector carrying shRNA specific for knocking down creatine kinase B (shCON cells) were used as controls.

[0624] Experimental method and results: 5x10 6shCON cells or shCKB cells were inoculated subcutaneously in nude mice to construct tumor-bearing mice, and each group of tumor-bearing mice was intraperitoneally injected with vehicle, S-Gboxin (dose of 10 mg / kg / day), MK2206 (dose of 12.5 mg / kg / day), and S-Gboxin + MK2206 (dose of S-Gboxin 10 mg / kg / day, and dose of MK2206 12.5 mg / kg / day), once a day, for 14 consecutive days. The tumor volume of each group of mice was measured on the 10th, 13th, 16th, 19th, 22nd, and 25th day, and the calculation method of the tumor volume was: tumor volume = 1 / 2 long x wide 2 The results are shown in Figure 10.

[0625] As can be seen from Figure 10, the therapeutic effect of S-Gboxin and MK2206 alone on shCKB cells (NCI-H82 cells with low expression of creatine kinase B) is poor, but the combination of the two has a significantly better result, and the combination of S-Gboxin and MK2206 has a synergistic effect on the treatment of shCKB cells (NCI-H82 cells with low expression of creatine kinase B), so the combination of mitochondrial oxidative phosphorylation pathway complex V inhibitors and AKT inhibitors has a synergistic effect in the treatment of tumors with low expression of creatine kinase B, thereby having an excellent therapeutic effect on tumors with low expression of creatine kinase B.

[0626] Example 5

[0627] This example investigates the effect of phosphocreatine (PCr) on the anti-tumor effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors.

[0628] The structure of phosphocreatine (PCr) is as follows:

[0629] According to the method of Example 2, the expression of creatine kinase B in NCI-H82 cells was knocked down by transfecting a virus vector with a shRNA specific for knocking down creatine kinase B (the nucleotide sequence of the shRNA is CCCTGCTGCTTCCTAACTTAT (SEQ ID No: 2)), and NCI-H82 cells transfected with an empty virus vector without the shRNA specific for knocking down creatine kinase B (shCON cells) were used as a control.

[0630] shCKB cells and shCON cells were cultured in RPMI1640 medium containing 10% fetal bovine serum (+P / S), shCKB cells and shCON cells were pretreated with phosphocreatine aqueous solution (the concentration of phosphocreatine was 10 mM) or water vehicle for 60 min (the viability of shCKB cells with different pretreatments was shown in Figure 11), then the cells were incubated with different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, after 3 days, the viability of shCKB cells and shCON cells with different treatments was detected by using Promega CellTiter-Glo cell viability assay kit (the kit can detect the cell viability by detecting the ATP content in the cells), the experimental results were shown in Figure 12.

[0631] As shown in Figure 11, the viabilities of shCKB cells pretreated with phosphocreatine and water vehicle were almost the same, and the difference in cell viability was not statistically significant, indicating that phosphocreatine had no effect on the viability of shCKB cells (NCI-H82 cells with low expression of creatine kinase B).

[0632] As shown in Figure 12, phosphocreatine (PCr) can significantly enhance the sensitivity of shCKB cells (NCI-H82 cells with low expression of creatine kinase B) to mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, i.e. phosphocreatine (PCr) can significantly enhance the inhibitory effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors on tumor cells with low expression of creatine kinase B.

[0633] Example 6

[0634] This example investigates the effect of mitochondrial calcium ion uniporter inhibitor Ruthenium red (RuR) on the anti-tumor effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors

[0635] According to the method of Example 2, the expression of creatine kinase B in NCI-H82 cells was knocked down by transfecting a virus vector carrying shRNA specific for knocking down creatine kinase B (the nucleotide sequence of the shRNA was CCCTGCTGCTTCCTAACTTAT (SEQ ID No: 2)), to obtain NCI-H82 cells with low expression of creatine kinase B (shCKB cells), and NCI-H82 cells transfected with an empty virus vector without shRNA specific for knocking down creatine kinase B (shCON cells) were used as controls.

[0636] shCKB cells and shCON cells were cultured in RPMI1640 medium containing 10% fetal bovine serum (+P / S), shCKB cells and shCON cells were pretreated with DMSO solution of Ruthenium Red (RuR) (the concentration of RuR was 100 μM) or DMSO for 30 min (the activity of shCKB cells with different pretreatments was shown in Figure 13), then the cells were incubated with different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, after 3 days, the activity inhibition of shCKB cells and shCON cells with different treatments by different concentrations of Gboxin and Oligomycin was detected by using Promega CellTiter-Glo cell activity detection kit (the kit can detect the activity of cells by detecting the content of ATP in cells), the experimental results were shown in Figure 14.

[0637] As shown in Figure 13, the activity of shCKB cells pretreated with RuR and DMSO was almost the same, and the difference in cell activity was not statistically significant, indicating that RuR had no effect on the activity of shCKB cells (NCI-H82 cells with low expression of creatine kinase B).

[0638] As shown in Figure 14, the calcium ion transporter inhibitor RuR can significantly enhance the sensitivity of shCKB cells (NCI-H82 cells with low expression of creatine kinase B) to mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, that is, the calcium ion transporter inhibitor can significantly enhance the inhibitory effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors on tumor cells with low expression of creatine kinase B.

[0639] Example 7

[0640] This example investigates the effect of mitochondrial membrane permeability transition pore inhibitor Cyclosporin A (CsA) on the anti-tumor effect of mitochondrial oxidative phosphorylation pathway complex V inhibitors

[0641] According to the method of Example 2, the expression of creatine kinase B in NCI-H82 cells was knocked down by transfecting the shRNA (the nucleotide sequence of the shRNA was CCCTGCTGCTTCCTAACTTAT (SEQ ID No: 2)) specific for knocking down creatine kinase B, and NCI-H82 cells transfected with empty virus vectors without shRNA specific for knocking down creatine kinase B (shCON cells) were used as controls.

[0642] 1. Investigate the effect of mitochondrial permeability transition pore inhibitor Cyclosporin A (CsA) on the effect of mitochondrial oxidative phosphorylation pathway complex V inhibitor on anti-creatine kinase B low expression tumor

[0643] shCKB cells and shCON cells were cultured in RPMI1640 medium containing 10% fetal bovine serum (+P / S), shCKB cells and shCON cells were pretreated with Cyclosporin A (CsA) DMSO solution (CsA concentration was 3 μM) or DMSO for 30 min (the activity of shCKB cells with different pretreatments is shown in Figure 15), then incubated with different concentrations of mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, after 3 days, the activity inhibition of different concentrations of Gboxin and Oligomycin on shCKB cells and shCON cells with different treatments was detected by using Promega CellTiter-Glo cell activity detection kit (the kit detects the content of ATP in cells to reflect cell activity), the experimental results are shown in Figure 16.

[0644] As can be seen from Figure 15, the activity of shCKB cells treated with Cyclosporin A (CsA) and DMSO solvent is almost the same, and the difference in cell activity is not statistically significant, indicating that Cyclosporin A (CsA) has no effect on the activity of shCKB cells (creatine kinase B low expression NCI-H82 cells)

[0645] As can be seen from Figure 16, mitochondrial permeability transition pore inhibitor Cyclosporin A (CsA) can significantly enhance the sensitivity of shCKB cells (creatine kinase B low expression NCI-H82 cells) to mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin, therefore, mitochondrial permeability transition pore inhibitor can significantly enhance the inhibitory effect of mitochondrial oxidative phosphorylation pathway complex V inhibitor on creatine kinase B low expression tumor cells.

[0646] 2. Investigate the effect of mitochondrial permeability transition pore inhibitor Cyclosporin A (CsA) on the effect of mitochondrial oxidative phosphorylation pathway complex V inhibitor on anti-creatine kinase B low expression tumor

[0647] shCON cells were cultured in RPMI 1640 medium (+P / S) containing 10% fetal bovine serum. After 30 min of pretreatment with Cyclosporin A (CsA) in DMSO solution (CsA concentration of 3 μM) or DMSO, shCON cells were incubated with different concentrations of Gboxin and Oligomycin, inhibitors of the mitochondrial oxidative phosphorylation pathway complex V. After 3 days, the inhibitory effects of different concentrations of Gboxin and Oligomycin on the activity of shCON cells under different treatments were detected using the Promega CellTiter-Glo cell viability assay kit (which detects cell viability by measuring intracellular ATP content). The experimental results are shown in Figure 17.

[0648] As shown in Figure 17, shCON cells (NCI-H82 cells with high creatine kinase B expression) showed similar sensitivity to Gboxin and Oligomycin, inhibitors of the mitochondrial oxidative phosphorylation pathway complex V, whether or not they were pretreated with the mitochondrial membrane permeability transition pore inhibitor Cyclosporin A (CsA). This indicates that the mitochondrial membrane permeability transition pore inhibitor cannot enhance the sensitivity of NCI-H82 cells (shCON cells) with high creatine kinase B expression to the inhibition of the mitochondrial oxidative phosphorylation pathway complex V inhibitors Gboxin and Oligomycin. In other words, the mitochondrial membrane permeability transition pore inhibitor cannot enhance the inhibitory effect of the mitochondrial oxidative phosphorylation pathway complex V inhibitor on tumor cells with high creatine kinase B expression.

[0649] The above description is an implementation scheme designed for one case of the present invention. It should be noted that for those skilled in the art, several improvements can be made without departing from the principle of the present invention, and these improvements should also be considered within the scope of protection of the present invention.

Claims

1. Use of a mitochondrial oxidative phosphorylation pathway inhibitor, characterized in that, A composition or preparation for preparing a composition or preparation for preventing and / or treating a tumor with high expression of creatine kinase B.

2. Use according to claim 1, characterized in that, The tumor with high expression of creatine kinase B refers to the ratio of the expression level E1 of creatine kinase B of tumor cells to the expression level E0 of creatine kinase B in the same type of cells or normal cells (E1 / E0) > 1.0, preferably ≥ 1.2, more preferably ≥ 1.5, more preferably ≥ 2, more preferably ≥ 3, more preferably ≥ 5, more preferably ≥ 8, more preferably ≥ 10, more preferably ≥ 15, more preferably ≥ 20, more preferably ≥ 30, more preferably ≥ 50, for example 2-50.

3. Use according to claim 2, characterized in that, The same type of cells includes the same type of tumor cells with normal expression, no expression or low expression of creatine kinase B.

4. The use according to claim 1, characterized in that, The tumor includes one or more of lung cancer, kidney cancer, breast cancer, colon cancer, rectal cancer, colorectal cancer, lymphoma, leukemia, pancreatic cancer, brain tumor, liver cancer and prostate cancer.

5. A marker for judging whether a tumor patient is suitable for prevention and / or treatment of a tumor using a mitochondrial oxidative phosphorylation pathway inhibitor, characterized by, The marker includes the expression level of creatine kinase B.

6. Use of an AKT inhibitor characterized in that, A composition or preparation for preparing a composition or preparation for enhancing the effect of a mitochondrial oxidative phosphorylation pathway inhibitor on preventing and / or treating a tumor with low expression or no expression of creatine kinase B.

7. Use of a compound of Formula IV, or an optical isomer thereof, or a racemate thereof, or a solvate thereof, or a pharmaceutically acceptable salt thereof, or a deuterated compound thereof, characterized in that, Methods for preparing compositions or formulations for enhancing the prophylactic and / or therapeutic effects of mitochondrial oxidative phosphorylation pathway inhibitors on tumors with low or no expression of creatine kinase B; wherein, R 79 , R 80 , R 81 , and R 82 are each independently hydrogen, halogen, hydroxyl, thiol, amino, substituted or unsubstituted C1-C12alkyl, substituted or unsubstituted C3-C12cycloalkyl, substituted or unsubstituted 3-12 membered heterocycloalkyl.

8. Use of a mitochondrial calcium ion uniporter inhibitor, characterized in that, A composition or preparation for preparing a composition or preparation for enhancing the effect of a mitochondrial oxidative phosphorylation pathway inhibitor on preventing and / or treating a tumor with low expression or no expression of creatine kinase B.

9. Use of a mitochondrial membrane permeability transition pore inhibitor, characterized in that, A composition or preparation for preparing a composition or preparation for enhancing the effect of a mitochondrial oxidative phosphorylation pathway inhibitor on preventing and / or treating a tumor with low expression or no expression of creatine kinase B.

10. A composition or formulation characterized in that, The composition or preparation includes an AKT inhibitor and a mitochondrial oxidative phosphorylation pathway inhibitor; The mass ratio of the AKT inhibitor to the mitochondrial oxidative phosphorylation pathway inhibitor is (0.05-30): 1, preferably (0.08-20): 1, more preferably (0.1-15): 1, more preferably (0.1-10): 1, more preferably (0.1-7.0): 1, more preferably (0.2-5.0): 1, more preferably (0.2-4.0): 1, more preferably (0.3-3.0): 1, more preferably (0.5-2.0): 1, more preferably (0.8-1.7): 1, more preferably (1.0-1.5): 1, more preferably (1.1-1.4): 1, more preferably (1.2-1.3): 1, most preferably 1.25:

1. The AKT inhibitors include: The mitochondrial oxidative phosphorylation pathway inhibitors include:

Citation Information

Patent Citations

  • Scutellariae radix compound and application thereof in inhibiting mitochondrial oxidative phosphorylation

    CN113350329A

  • Application of compound for interfering interaction between integrin beta3 and Src

    CN113967210A

  • Marker for judging anticancer effect of mitochondrial oxidative phosphorylation pathway inhibitor

    CN114272236A

  • Triazole small-molecule organic compound for inhibiting mitochondrial oxidative phosphorylation by specific targeting complex I and application of triazole small-molecule organic compound

    CN118005608A

  • Marker for judging anticancer effect of mitochondrial oxidative phosphorylation pathway inhibitor

    CN118766897A