Antisense oligonucleotide conjugates targeting peripheral myelin protein 22 (PMP22) and methods of use thereof

Antisense oligonucleotide conjugates targeting PMP22, with a PMO and cell penetrating peptide, effectively inhibit PMP22 expression in Schwann cells, providing a therapeutic solution for CMT disease by reducing protein and RNA levels, and can be combined with additional therapies for enhanced treatment.

WO2025264554A1PCT designated stage Publication Date: 2025-12-26PEPGEN INC
View PDF 26 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/033773
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-17
Filing Date
2025-06-16
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Current treatments are lacking for Charcot-Marie-Tooth (CMT) disease, a hereditary neuropathy caused by mutations in the PMP22 gene, which affects myelin sheath function and leads to muscle and sensory loss, with no curative therapies available.

Method used

Development of antisense oligonucleotide conjugates targeting PMP22, comprising a phosphorodiamidate morpholino oligomer (PMO) conjugated to a cell penetrating peptide, to inhibit PMP22 expression in Schwann cells, using specific nucleotide sequences and peptide domains for effective delivery.

Benefits of technology

The conjugates achieve significant inhibition of PMP22 expression, offering a therapeutic approach for CMT disease by reducing protein and RNA levels, and can be combined with additional therapies for enhanced treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000010_0001
    Figure IMGF000010_0001
  • Figure IMGF000010_0002
    Figure IMGF000010_0002
  • Figure IMGF000011_0001
    Figure IMGF000011_0001
Patent Text Reader

Abstract

The present invention provides antisense oligonucleotide conjugates targeting the PMP22 gene, and methods of using such antisense oligonucleotide conjugates to inhibit expression of PMP22 and to treat subjects having a disease, such as Charcot-Marie-Tooth (CMT) disease, e.g., CMT1A disease.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.: 140101-00120 ANTISENSE OLIGONUCLEOTIDE CONJUGATES TARGETING PERIPHERAL MYELIN PROTEIN 22 (PMP22) AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. provisional patent application No.63 / 660,628, filed on June 17, 2024. The entire contents of the aforementioned patent application are incorporated herein by this reference. FIELD OF THE INVENTION The present invention relates to antisense oligonucleotide conjugates, compositions comprising such conjugates, and methods of use thereof. BACKGROUND OF THE INVENTION Peripheral Myelin Protein 22 (PMP22) is a membrane protein that is encoded by the PMP22 gene in humans, which plays an essential role in the formation and maintenance of compact myelin. Compact myelin is the bulk of the peripheral neuron's myelin sheath, a protective fatty layer that provides electrical insulation for the neuronal axon. PMP22 protein is glycosylated with an N terminus-linked sugar and co-localized with the chaperone protein calnexin in the endoplasmic reticulum. After the protein is transported to the Golgi apparatus it can then become incorporated in the plasma membrane of the cell. Schwann cells exhibit a high expression of PMP22, wherein approximately 2-5% of the total protein content in myelin is PMP22 (Watila et al., J Neurol Sci.2015 Aug 15;355(1-2):18-24). Mutations in PMP22 cause changes in the expression of peripheral myelin protein 22 which can result in several neuropathies. Inherited peripheral neuropathies, also known as Charcot-Marie-Tooth (CMT) disease, are one of the most common heritable diseases of the nervous system, affecting approximately 1 in 2,500 individuals (Krajewski et al., Brain.2000 Jul:123 (Pt 7):1516-27). Progression of this disease is characterized by loss of muscle tissue and touch sensation across the body. CMT1A disease, the most common form of CMT disease, is a demyelinating neuropathy caused by genetic duplication of the PMP22 gene (Matsunami et al., Nat Genet. 1992 Jun;1(3):176-9). Since, PMP22 is an essential structural component of the myelin sheath that surrounds axons, it helps myelin act as a biological insulator that facilitates the efficient transmission of electrical impulses along an axon (Snipes et al., J Cell Biol.1992 Apr;117(1):225-38). While PMP22 overexpression results in the development of CMT1A, an autosomal dominant disease, it is equally important to maintain sufficient PMP22 expression as the loss of PMP22 results in a distinct neuropathy called hereditary neuropathy with predisposition to pressure palsy. 1 ME148775155v.1 Attorney Docket No.: 140101-00120 PMP22 is an essential component of the myelin sheath and maintaining the delicate homeostatic balance of this gene is paramount in the development of effective therapeutics. Currently, there are no curative treatments available for CMT disease. Accordingly, there remains a need in the art to develop novel and effective therapies for treatment of CMT disease. SUMMARY OF THE INVENTION The present invention provides antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting Peripheral Myelin Protein 22 (PMP22) conjugated to a cell penetrating peptide, and compositions comprising such conjugates, which target nucleic acids encoding PMP22, and interfere with the normal function of the targeted nucleic acid.The PMP22 nucleic acid may be within a cell, e.g., a cell within a subject, such as a humansubject. The present invention also provides effective methods and combination therapies for treating a subject having Charcot-Marie-Tooth (CMT) disease using the antisense oligonucleotide conjugates and compositions of the invention. The specific design of the antisense oligonucleotide conjugates of the present invention allows effective delivery of the conjugates to a target cell, e.g., a Schwann cell. The methods of the present invention are both simple and efficient, and provide a great advantage when used in treating CMT disease, e.g., CMT1A disease, a demyelinating neuropathy caused by PMP22 overexpression in Schwann cells. Accordingly, in one aspect, the present invention provides an antisense oligonucleotide conjugate for inhibiting expression of peripheral myelin protein 22 (PMP22), comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO), and wherein the cell penetrating peptide comprises at least one cationic domain comprising at least 4 amino acid residues and at least one hydrophobic domain comprising at least 3 amino acid residues, wherein the cell penetrating peptide comprises a total of 7 to 40 amino acid residues and the at least one cationic domain comprises a beta-alanine residue in combination with arginine and / or histidine residues. In another aspect, the present invention provides an antisense oligonucleotide conjugate for inhibiting expression of peripheral myelin protein 22 (PMP22), comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, wherein the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising at least 10 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NOs: 102-284, and wherein the cell penetrating peptide comprises at least one cationic domain comprising at least 4 amino acid residues and at least one hydrophobic domain comprising at least 3 amino acid residues, wherein the cell 2 ME148775155v.1 Attorney Docket No.: 140101-00120 penetrating peptide comprises a total of 7 to 40 amino acid residues and the at least one cationic domain comprises a beta-alanine residue in combination with arginine and / or histidine residues. In some embodiments, the antisense oligonucleotide is 10 to 40 nucleotides in length, 10 to 30 nucleotides in length, 10 to 20 nucleotides in length, 18 to 30 nucleotides in length, 10 to 25 nucleotides in length, or 18 to 25 nucleotides in length. In some embodiments, the antisense oligonucleotide is 15 nucleotides in length, 20 nucleotides in length, or 25 nucleotides in length. In some embodiments, the antisense oligonucleotide is 25 nucleotides in length. In some embodiments, the antisense oligonucleotide comprises at least 10, at least 15, at least 20, or at least 25 contiguous nucleotides complementary to a target sequence in a human PMP22 gene as set forth in SEQ ID NO: 95, or a PMP22 mRNA selected from any one of the nucleotide sequences of SEQ ID NOs: 96-101. In some embodiments, the antisense oligonucleotide comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide comprises at least 15 contiguous nucleotides of any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the target sequence is located in an exon, an intron, the 5’UTR, or the 3’UTR of a PMP22 gene or a PMP22 transcript. In some embodiments, the target sequence is located in an exon-intron junction of a PMP22 gene or a PMP22 transcript. In some embodiments, the target sequence is located entirely within an intron of a PMP22 gene or a PMP22 transcript. In some embodiments, the target sequence is located entirely within an intron of a PMP22 gene or a PMP22 transcript selected from the group consisting of intron 1, intron 2, intron 3, and intron 4. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence that targets or is complementary to a target sequence that is located entirely within an intron of a PMP22 gene or a PMP22 transcript. In some embodiments, the antisense oligonucleotide has a nucleotide sequence that targets or is complementary to a target sequence that is located entirely within an intron of a PMP22 gene or a PMP22 transcript selected from the group consisting of intron 1, intron 2, intron 3, and intron 4. In some embodiments, the target sequence is located entirely within an exon of a PMP22 gene or a PMP22 transcript. In some embodiments, the target sequence is located 3 ME148775155v.1 Attorney Docket No.: 140101-00120 entirely within an exon of a PMP22 gene or a PMP22 transcript selected from the group consisting of exon 1, exon 2, exon 3, exon 4, and exon 5. In some embodiments, the antisense oligonucleotide has a nucleotide sequence that targets or is complementary to a target sequence that is located entirely within an exon of a PMP22 gene or a PMP22 transcript. In some embodiments, the antisense oligonucleotide has a nucleotide sequence that targets or is complementary to a target sequence that is located entirely within an exon of a PMP22 gene or a PMP22 transcript selected from the group consisting of exon 1, exon 2, exon 3, exon 4, and exon 5. In some embodiments, the target sequence is located in or spans an exon-intron junction of a PMP22 gene or a PMP22 transcript, which is selected from the group consisting of intron 1-exon 2 junction, exon 2-intron 2 junction, intron 2-exon 3 junction, exon 3-intron 3 junction, and intron 3-exon 4 junction of a PMP22 gene or a PMP22 transcript. In some embodiments, the antisense oligonucleotide has a nucleotide sequence that targets or is complementary to a target sequence that is located in an exon-intron junction of a PMP22 gene or a PMP22 transcript, which is selected from the group consisting of intron 1- exon 2 junction, exon 2-intron 2 junction, intron 2-exon 3 junction, exon 3-intron 3 junction, and intron 3-exon 4 junction of a PMP22 gene or a PMP22 transcript. In some embodiments, the target sequence is located entirely within the 5'UTR of a PMP22 gene or a PMP22 transcript. In some embodiments, the antisense oligonucleotide has a nucleotide sequence that targets or is complementary to a target sequence that is located entirely within the 5'UTR of a PMP22 gene or a PMP22 transcript. In some embodiments, the target sequence is located entirely within the 3'UTR of a PMP22 gene or a PMP22 transcript. In some embodiments, the antisense oligonucleotide has a nucleotide sequence that targets or is complementary to a target sequence that is located entirely within the 3'UTR of a PMP22 gene or a PMP22 transcript. In some embodiments, all the internucleoside linkages of the PMO are - P(O)(NMe2)O-. In some embodiments, each cationic domain is 4 to 12 amino acid residues in length, or 4 to 7 amino acid residues in length. In some embodiments, each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% cationic amino acids. In some embodiments, each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues. In some embodiments, each cationic domain comprises a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID 4 ME148775155v.1 Attorney Docket No.: 140101-00120 NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), and any combination thereof. In some embodiments, each cationic domain consists of a sequence selected from the group consisting of: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), and any combination thereof. In some embodiments, the cell penetrating peptide comprises two cationic domains. In some embodiments, each hydrophobic domain is 3 to 6 amino acid residues in length. In some embodiments, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acids. In some embodiments, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues. In some embodiments, the cell penetrating peptide comprises one hydrophobic domain. In some embodiments, the hydrophobic domain comprises a sequence selected from the group consisting of: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), and any combination thereof. In some embodiments, the hydrophobic domain consists of a sequence selected from the group consisting of: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), and any combination thereof. In some embodiments, the cell penetrating peptide comprises two cationic domains and one hydrophobic domain. In some embodiments, the cell penetrating peptide comprises one hydrophobic domain flanked by two cationic domains. In some embodiments, the cell penetrating peptide comprises one hydrophobic domain comprising a sequence selected from the group consisting of YQFLI (SEQ ID NO: 5 ME148775155v.1 Attorney Docket No.: 140101-00120 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), and WWPW (SEQ ID NO: 26); flanked by two cationic domains, each comprising a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), and R[Hyp]RR[Hyp]R (SEQ ID NO: 19). In some embodiments, the cell penetrating peptide comprises a sequence selected from the group consisting of RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RBRRBRRFQILYHBHBR (SEQ ID NO: 38), and RBRRBRFQILYRBHBH (SEQ ID NO: 44). In some embodiments, the cell penetrating peptide comprises the amino acid sequence RBRRBRFQILYBRBR (SEQ ID NO: 35). In some embodiments, the cell penetrating peptide comprises the amino acid sequence RBRRBRFQILYBRBRE (SEQ ID NO: 471). In some embodiments, the cell penetrating peptide comprises the amino acid sequence RBRRBRRFQILYRBHBH (SEQ ID NO: 37). In some embodiments, the cell penetrating peptide comprises the amino acid sequence RBRRBRFQILYRBHBH (SEQ ID NO: 44). In some embodiments, the cell penetrating peptide is conjugated to the antisense oligonucleotide at its N-terminus. In some embodiments, the C-terminus of the cell penetrating peptide is -NH2. In some embodiments, the cell penetrating peptide is conjugated to the antisense oligonucleotide at its C-terminus. In some embodiments, the cell penetrating peptide is acylated at its N-terminus. In some embodiments, the cell penetrating peptide is conjugated to one or more internal nucleotides of the antisense oligonucleotide. In some embodiments, the antisense oligonucleotide is conjugated to the cell penetrating peptide via a linker. In some embodiments, the antisense oligonucleotide is conjugated to the linker at its 3’ terminus. In some embodiments, the conjugate comprises a structure selected from the group consisting of: 6 ME148775155v.1 Attorney Docket No.: 140101-00120 [cell penetrating peptide] — [oligonucleotide]; [oligonucleotide] — [cell penetrating peptide]; [cell penetrating peptide] — [linker] — [oligonucleotide]; and [oligonucleotide] — [linker] — [cell penetrating peptide]. In some embodiments, the conjugate is of the following structure: . In some embodiments, the conjugate is of the following structure: [cell penetrating peptide] — [linker] — [cell penetrating peptide] — [linker] — [oligonucleotide] In some embodiments, the linker is of formula (I): T1- (CR1R2)n-T2. (I) wherein 7 ME148775155v.1 Attorney Docket No.: 140101-00120 T1 is a divalent group for attachment to the cell penetrating peptide and is selected from the group consisting of - NH- and carbonyl; T2 is a divalent group for attachment to an oligonucleotide and is selected from the group consisting of -NH- and carbonyl; n is 1 , 2 or 3; each R1is independently -Y1-X1-Z1, wherein Y1is absent or -(CRA1RA2)m-, wherein m is 1 , 2, 3 or 4, and RA1and RA2are each independently hydrogen, OH, or (1-2C)alkyl; X1is absent, -O-, -C(O)-, -O(O)O-, -OC(O)-, -CH(ORA3)-, -N(RA3)-, -N(RA3)- C(O)-, -N(RA3)-C(O)O-, -C(O)-N(RA3)-, -N(RA3)C(O)N(RA3)-, -N(RA3)C(N RA3)N(RA3)-, -SO-, -S-, -SO2-, -S(O)2N(RA3)-, or -N(RA3)SO2-, wherein each RA3is independently selected from the group consisting of hydrogen and methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2- 6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1 -6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3- 6C)cycloalkenyl, and heteroaryl is optionally substituted with one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRA4RA5, and (1-4C)alkoxy, wherein RA4and RA5are each independently selected from the group consisting of hydrogen and (1-4C)alkyl; and each R2is independently -Y2-X2-Z2, wherein Y2is absent or a group of the formula -[CRB1RB2]m- in which m is an integer selected from 1 , 2, 3 or 4, and RB1and RB2are each independently selected from hydrogen, OH or (1 -2C)alkyl; X2is absent, -O-, -C(O)-, -O(O)O-, -OC(O)-, -CH(ORB3)-, -N(RB3)-, -N(RB3)- C(O)-, - N(RB3)-C(O)O-, -C(O)-N(RB3)-, -N(RB3)C(O)N(RB3)-, -N(RB3)C(NRB3)N(RB3)-, -SO-, -S- - SO2-, - S(O)2N(RB3)-, or -N(RB3)SO2-, wherein each RB3is independently selected from hydrogen or methyl; and Z2is selected from hydrogen, (1 -6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3- 6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl, wherein each (1 -6C)alkyl, (2- 6C)alkenyl, (2- 6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRB4RB5, and (1- 4C)alkoxy, wherein RB4and RB5are each independently hydrogen or (1-2C)alkyl; with the 8 ME148775155v.1 Attorney Docket No.: 140101-00120 proviso that; when n=1 and T1 and T2 are different to one another, then R1and R2are not both H; when n=1 , T1 and T2 are different to one another and one of R1and R2is H then the other of R1and R2is not methyl; or when n=2 and each occurrence of R1and R2is H, then T1 and T2 are both -C(O)- or are both -NH-. In some embodiments, T2 is -C(O)-. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent or -(CRA1RA2)m-, wherein m is 1, 2, 3 or 4, and RA1and RA2are each hydrogen or (1- 2C)alkyl; X1is absent, -O-, -C(O)-, -O(O)O-, -N(RA3)-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, -N(RA3)C(O)N(RA3)-, -N(RA3)C(N RA3)N(RA3)- or -S-, wherein each RA3is independently hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2- 6C)alkynyl, aryl, (3- 6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1- 6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRA4RA5, and (1-4C)alkoxy, wherein RMand RA5are each independently hydrogen or (1- 2C)alkyl. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent or -(CRA1RA2)m-, wherein m is 1 , 2, 3, or 4, and RA1and R" are each independently hydrogen or (1-2C)alkyl; X1is absent, C(O)-, -C(O)- -N(RA3)C(O) wherein each independently hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, halo, and hydroxy. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent or a group of the formula -(CRA1RA2)m-, wherein m is 1 , 2, 3 or 4, and RA1and RA2are each independently hydrogen or (1-2C)alkyl; X1is absent, -C(O)-, -C(O)O-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, wherein each RA3is hydrogen or methyl; and 9 ME148775155v.1 Attorney Docket No.: 140101-00120 Z1is a further oligonucleotide or is hydrogen, (1 - 6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3- 6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, halo, and hydroxy. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent, -(CH2)-, or-(CH2CH2)-; X1is absent, -N(RA3)-C(O)-, -C(O)-N(RA3)-, wherein each RA3is independently hydrogen or methyl; and Z1is hydrogen or (1-2C)alkyl. In some embodiments, each R2is independently -Y2-Z2, wherein Y2is absent or - (CRB1RB2)m-, wherein m is 1 , 2, 3 or 4, and RB1and RB2are each independently hydrogen or (1-2C)alkyl; and Z2is hydrogen or (1-6C)alkyl. In some embodiments, each R2is hydrogen. In some embodiments, n is 2 or 3. In some embodiments, n is 1. In some embodiments, the linker is an amino acid residue selected from the group consisting of glutamic acid, succinic acid, and gamma-aminobutyric acid residues. In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the linker is: 10 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: 11 ME148775155v.1 Attorney Docket No.: 140101-00120 In another aspect, the present invention provides a pharmaceutical composition comprising one or more of the antisense oligonucleotide conjugates described herein. In yet another aspect, the present invention provides a method of inhibiting PMP22 expression in a cell, the method comprising contacting the cell with one or more of the antisense oligonucleotide conjugates and / or one or more of the pharmaceutical compositions described herein, thereby inhibiting PMP22 expression in the cell. In some embodiments, the method comprises contacting and / or exposing the cell with one or more of the antisense oligonucleotide conjugates and / or one or more of the pharmaceutical compositions described herein, thereby inhibiting PMP22 expression in the cell. In some embodiments, the antisense oligonucleotide conjugate inhibits PMP22 protein expression in the cell. In some embodiments, the antisense oligonucleotide conjugate inhibits PMP22 mRNA and / or pre-mRNA expression in the cell. In some embodiments, the cell is within a subject. In some embodiments, the subject is a human. In some embodiments, the cell is selected from the group consisting of a Schwann cell, a peripheral nerve axon, an endothelial cell, a muscle cell, a myocyte, a myoblast, a myocardial cell, a smooth muscle cell, a podocyte or any type of a kidney cell, a hepatocyte or any type of a liver cell, a neuronal cell, a microglial cell, any cell type of the central nervous system and peripheral nervous system, a stem cell, an embryonic stem cell, an induced pluripotent stem cell, and any combination thereof. In some embodiments, the PMP22 expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%. In yet another aspect, the present invention provides a method of treating Charcot- Marie-Tooth (CMT) disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more of the antisense 12 ME148775155v.1 Attorney Docket No.: 140101-00120 oligonucleotide conjugates and / or one or more of the pharmaceutical compositions described herein, thereby treating the CMT disease in the subject. In some embodiments, the CMT disease is selected from the group consisting of CMT disease type 1 (CMT1), CMT disease type 2 (CMT2), CMT disease type 3 (CMT3), CMT disease type 4 (CMT4), CMT disease type 5 (CMT5), CMT disease type 6 (CMT6), CMT disease type 7 (CMT7), CMT disease type X (CMTX), and subtypes thereof. In some embodiments, the CMT disease is CMT disease type 1A (CMT1A). In some embodiments, the CMT disease is CMT disease type 1E (CMT1E). In some embodiments, the subject is human. In some embodiments, the conjugate is administered to the subject via an intramedullary route, an intrathecal route, an intracerebroventricular route, an intraventricular route, an intravitreal route, an enteral route, a parenteral route, an intravenous route, an intra- arterial route, an intramuscular route, an intratumoral route, a subcutaneous route, an oral route, or a nasal route. In some embodiments, the conjugate is administered at a dose of about 5 mg / kg to about 60 mg / kg to the subject. In some embodiments, the conjugate is administered at a dose of about 25 mg / kg to about 60 mg / kg to the subject. In some embodiments, the conjugate is administered at a dose of about 45 mg / kg to the subject. In some embodiments, the conjugate is administered to the subject at a frequency that is weekly, biweekly, monthly, quarterly, semi-annually, annually, or a combination thereof. In some embodiments, the conjugate is administered to the subject biweekly. In some embodiments, the methods of the present invention further comprise administering an additional therapeutic to the subject. In some embodiments, the additional therapeutic is selected from the group consisting of nonsteroidal anti-inflammatory drugs, cyclooxygenase-2 inhibitors, tricyclic antidepressants, anticonvulsants, analgesics, vitamins, concomitant surgery, occupational therapy, physical therapy, exercise program, and any combination thereof. In another aspect, the present invention provides a kit comprising one or more of the antisense oligonucleotide conjugates and / or one or more of the pharmaceutical compositions described herein, and instructions for use thereof. 13 ME148775155v.1 Attorney Docket No.: 140101-00120 In another aspect, the present invention provides a syringe comprising one or more of the antisense oligonucleotide conjugates and / or one or more of the pharmaceutical compositions described herein. BRIEF DESCRIPTION OF THE DRAWINGS FIGURE 1 is a histogram depicting hotspots of PMP22 targeting sites identified byperforming an in vitro K>J@@G DG 6@I<)&. >@EEK LJ<GKA@>L@? ODLC -S8 HA <GLDK@GK@oligonucleotides targeting PMP22. FIGURE 2 depicts histograms identifying hotspots of PMP22 targeting sites byperforming an in vitro K>J@@G DG 6@I<)&. >@EEK LJ<GKA@>L@? ODLC -S8 HA <GLDK@GK@oligonucleotides targeting PMP22. FIGURE 3 is a histogram depicting inhibition of PMP22 expression in A549 cellsLJ<GKA@>L@? ODLC -S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K L<JB@LDGB :8:**'FIGURE 4 is a histogram depicting inhibition of PMP22 expression in A549 cellsLJ<GKA@>L@? ODLC *-S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K L<JB@LDGB :8:**'FIGURE 5 is a histogram depicting inhibition of PMP22 expression in Hepa1-6 cellsLJ<GKA@>L@? ODLC -S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K L<JB@LDGB :8:**'FIGURE 6 is a histogram depicting inhibition of PMP22 expression in A549 cellsLJ<GKA@>L@? ODLC *-S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K L<JB@LDGB :8:**1 <G? DG 38;)2 I<LD@GL?@JDN@? AD=JH=E<KLK LJ<GKA@>L@? ODLC / '+S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K L<JB@LDGB :8:**'FIGURE 7 is a histogram depicting that antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide exhibit increased inhibition of PMP22 expression in A549 cells. FIGURE 8 is a histogram depicting a dose response of inhibiting PMP22 expression in A549 cells by use of varying concentrations of antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. FIGURE 9 is a histogram depicting effective inhibition of PMP22 expression in sNF02.2 human Schwann cells transfected with antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. FIGURE 10 is a plot depicting a dose response of inhibiting PMP22 expression in human spinal nerve derived Schwann cells by use of varying concentrations of antisense 14 ME148775155v.1 Attorney Docket No.: 140101-00120 oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. FIGURE 11 is a plot depicting a dose response of inhibiting PMP22 protein expression in human spinal nerve derived Schwann cells by use of varying concentrations of antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. FIGURE 12 is a histogram depicting PMP22 protein expression in sNF02.2 Schwann cells by use of antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. FIGURE 13 is a histogram depicting effective inhibition of PMP22 transcript levels in biceps of C3 mice treated with an antisense oligonucleotide conjugate comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. DETAILED DESCRIPTION OF THE INVENTION The present invention provides antisense oligonucleotide conjugates and compositions comprising such conjugates which target nucleic acids encoding Peripheral Myelin Protein 22 (PMP22) and interfere with the normal function of the targeted nucleic acid. The PMP22nucleic acid may be within a cell, e.g., a cell within a subject, such as a human subject.The present invention also provides effective methods and combination therapies for treating a subject having Charcot-Marie-Tooth (CMT) disease using the antisense oligonucleotide conjugates and compositions of the invention. In particular, the specific design of the antisense oligonucleotide conjugates of the present invention allows effective delivery of the conjugates to a target cell, e.g., a Schwann cell. The methods of the present invention are simple, efficient and effective, and provide a great advantage when used in treating CMT disease, e.g., CMT1A disease, a demyelinating neuropathy caused by PMP22 overexpression in Schwann cells. The antisense oligonucleotide conjugates of the invention include an antisense oligonucleotide targeting PMP22 (e.g., a phosphorodiamidate morpholino oligomer (PMO)) which is about 10 to about 40 nucleotides or less in length, and which comprises at least 10, at least 15, at least 20, or at least 25 contiguous nucleotides complementary to a target sequence in a human PMP22 gene (SEQ ID NO: 95) or PMP22 mRNA (SEQ ID NOs: 96- 101). The use of these antisense oligonucleotide conjugates enables the targeted inhibition of protein and / or RNA expression and / or activity of a PMP22 gene. The PMP22 gene may bewithin a cell (e.g., a Schwann cell), e.g., a cell within a subject, such as a human.The present inventors have demonstrated that antisense oligonucleotide conjugates targeting PMP22 can mediate antisense inhibition resulting in significant inhibition of 15 ME148775155v.1 Attorney Docket No.: 140101-00120 expression of a PMP22 gene in a cell (e.g., a Schwann cell). The methods of the invention inhibit PMP22 expression levels in the cell (e.g., by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%) by targeting PMP22 with an antisense oligonucleotide conjugate of the invention and, accordingly, allow treatment of a subject in need thereof, e.g., a subject having CMT disease (e.g., CMT1A disease). The present invention also provides methods and combination therapies for treating a subject having CMT disease using the antisense oligonucleotide conjugates and compositions of the invention. The combination therapies of the present invention include administering to the subject, e.g., a subject having CMT disease (e.g., CMT1A disease), an antisense oligonucleotide conjugate comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, and an additional therapeutic, such as nonsteroidal anti-inflammatory drugs, cyclooxygenase-2 inhibitors, tricyclic antidepressants, anticonvulsants, analgesics, vitamins, concomitant surgery, occupational therapy, physical therapy, exercise program, or any therapeutic that may prevent and / or reduce a symptom associated with the disease (e.g., CMT disease), for example, by modulating PMP22 expression directly and / or indirectly. The following detailed description discloses how to make and use antisense oligonucleotide conjugates to inhibit the mRNA and / or protein expression of a PMP22 gene, as well as compositions, uses, and methods for treating subjects having diseases and disorders that would benefit from inhibition and / or reduction of the expression of this gene. I. Definitions In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to". The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless context clearly indicates otherwise. As used herein, the term “PMP22,” used interchangeably with the term “GAS3” refers to the well-known gene and polypeptide, also known in the art as HMSNIA, Sp110, HNPP, Growth Arrest-Specific Protein 3, GAS-3, Peripheral Myelin Protein 22 KDa, PMP-22, CMT1E, CIDP, or DSS. PMP22 is a 22 kDa transmembrane glycoprotein made up of 160 amino acids, and is mainly expressed in the Schwann cells of the peripheral nervous system. 16 ME148775155v.1 Attorney Docket No.: 140101-00120 Schwann cells show high expression of PMP22, where it can constitute 2-5% of total protein content in compact myelin. Compact myelin is the bulk of the peripheral neuron's myelin sheath, a protective fatty layer that provides electrical insulation for the neuronal axon. The level of PMP22 expression is relatively low in the central nervous system of adults. Like other membrane proteins, newly translated PMP22 protein is temporarily sequestered to the endoplasmic reticulum (ER) and Golgi apparatus for post-translational modifications. PMP22 protein is glycosylated with an N terminus-linked sugar and co-localized with the chaperone protein calnexin in the ER. After the protein is transported to the Golgi apparatus it can then become incorporated in the plasma membrane of the cell. In humans, the PMP22 gene is located on chromosome 17p12 and spans approximately 40kb. The gene contains six exons conserved in both humans and rodents, two of which are 5’ untranslated exons (1a and 1b) and result in two different RNA transcripts with identical coding sequences. The two transcripts differ in their 5' untranslated regions and have their own promoter regulating expression. The remaining exons (2 to 5) include the coding region of the PMP22 gene, and are joined together after post-transcriptional modification (i.e., alternative splicing). The PMP22 protein is characterized by four transmembrane domains, two extracellular loops (ECL1 and ECL2), and one intracellular loop. Exon 2 codes for the first transmembrane domain, located on the N-terminus of the PMP22 protein. Exon 3 codes for the first extracellular loop. Exon 4 corresponds to the second transmembrane domain and half of the third. Exon 5 is responsible for the rest of the third and the fourth transmembrane domain, the second extracellular loop, and the 3'UTR. PMP22 plays an essential role in the formation and maintenance of compact myelin. When Schwann cells come into contact with a neuronal axon, expression of PMP22 is significantly up-regulated, whereas PMP22 is down-regulated during axonal degeneration or transection. The sequence of a human PMP22 mRNA transcript can be found at, for example, NCBI Reference Sequences (RefSeq) (NM_000304.4, NM_001281455.2, NM_001281456.2, NM_001330143.2, NM_153321.3, or NM_153322.3). Additional examples of PMP22 mRNA sequences are readily available using publicly available databases, e.g., GenBank. The term“PMP22,” as used herein, also refers to naturally occurring DNA sequence variations of the PMP22 gene, such as a single nucleotide polymorphism in the PMP22 gene. Numerous SNPs within the PMP22 gene have been identified and may be found at, for example, NCBI dbSNP (see, e.g., ncbi.nlm.nih.gov / snp). As used herein, a “cell penetrating peptide,” refers to a relatively short peptide capable of promoting uptake of antisense oligonucleotides, such as PMOs, by cells, thereby delivering the antisense oligonucleotides to the interior (cytoplasm) of the cells. The cell penetrating peptide typically is about 12 to about 40 amino acids long. The length of the cell penetrating peptide is not particularly limited and varies in different embodiments. In some embodiments, the cell penetrating peptide comprises from 4 to 40 amino acid subunits. In 17 ME148775155v.1 Attorney Docket No.: 140101-00120 some embodiments, the cell penetrating peptide comprises from 6 to 30, from 6 to 20, from 8 to 25 or from 10 to 20 amino acid subunits. In some embodiments, the cell penetrating peptide comprises a sequence selected from the group consisting of RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RBRRBRRFQILYHBHBR (SEQ ID NO: 38), and RBRRBRFQILYRBHBH (SEQ ID NO: 44). In some embodiments, the cell penetrating peptide, when conjugated to an antisense oligonucleotide having a substantially uncharged backbone, is effective to enhance the activity of the antisense oligonucleotide, relative to the antisense oligonucleotide in unconjugated form, as evidenced by a decrease in expression of an encoded protein, relative to that provided by the unconjugated oligonucleotide, when binding of the antisense oligonucleotide to its target sequence is effective to block a translation start codon for the encoded protein. In some embodiments, conjugation of the cell penetrating peptide provides this activity in a cell-free translation assay. In some embodiments, activity is enhanced by a factor of at least two, a factor of at least five or a factor of at least ten. Alternatively or in addition, the cell penetrating peptide is effective to enhance the transport of a nucleic acid analog into a cell, relative to the analog in unconjugated form. In some embodiments, transport is enhanced by a factor of at least two, a factor of at least two, a factor of at least five or a factor of at least ten. As used herein, the terms “antisense oligonucleotide conjugate,” or “conjugate,” as used interchangeably herein, refer to a conjugate comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO). The PMO conjugated to the cell penetrating peptide is also referred to herein as a peptide conjugated PMO (PPMO). The cell penetrating peptide promotes uptake of the antisense oligonucleotide, such as a PMO, by cells (e.g., Schwann cells), thereby delivering the antisense oligonucleotide to the interior (cytoplasm) of the cells. In some embodiments, the cell penetrating peptide is conjugated to the antisense oligonucleotide at its N-terminus. In some embodiments, the cell penetrating peptide is conjugated to the antisense oligonucleotide at its C-terminus. In some embodiments, the cell penetrating peptide is conjugated to one or more internal nucleotides of the antisense oligonucleotide. A cell penetrating peptide can be generally effective or it can be specifically or selectively effective for PMO delivery to a particular type or particular types of cells. The antisense oligonucleotide and the cell penetrating peptide are typically linked at their ends, e.g., the C-terminal end of the cell penetrating peptide can be linked to the 5' end of the antisense oligonucleotide, or the 3' end of the antisense oligonucleotide can be linked to the 18 ME148775155v.1 Attorney Docket No.: 140101-00120 N-terminal end of the cell penetrating peptide. In some embodiments, the cell penetrating peptide is conjugated to an internal nucleotide of the antisense oligonucleotide. Antisense oligonucleotide conjugates can include uncharged antisense oligonucleotides, charged (e.g., cationic) antisense oligonucleotides, and mixtures thereof. In some embodiments, the cell penetrating peptide may be linked to the antisense oligonucleotide either directly or via an optional linker, e.g., one or more linkers described herein. The antisense oligonucleotide conjugates comprise antisense oligonucleotides that specifically bind to the target nucleic acid molecules via hydrogen bonding (e.g., Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) and interfere with the normal function of the targeted nucleic acid (e.g., by an antisense mechanism of action). This interference with or modulation of the function of a target nucleic acid by the antisense oligonucleotide conjugates of the present invention is referred to as “antisense inhibition.” The functions of the target nucleic acid molecule to be interfered with may include functions such as, for example, translocation of the RNA to the site of protein translation, translation of protein from the RNA, splicing of the RNA to yield one or more mRNA species, and catalytic activity which may be engaged in or facilitated by the RNA. In some embodiments, antisense inhibition refers to “inhibiting the expression” of target nucleic acid levels and / or target protein levels in a cell, e.g., a cell within a subject, such as a human, in the presence of the antisense oligonucleotide conjugate complementary to a target nucleic acid as compared to target nucleic acid levels and / or target protein levels in the absence of the antisense oligonucleotide conjugate. As used herein, “target sequence,” refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of a PMP22 gene, including mRNA that is a product of RNA processing of a primary transcription product. A target sequence may be from about 4-50 nucleotides in length, e.g., 8-45, 10-45, 10-40, 10-35, 10- 30, 10-20, 11-45, 11-40, 11-35, 11-30, 11-20, 12-45, 12-40, 12-35, 12-30, 12-25, 12-20, 13- 45, 13-40, 13-35, 13-30, 13-25, 13-20, 14-45, 14-40, 14-35, 14-30, 14-25, 14-20, 15-45, 15- 40, 15-35, 15-30, 15-25, 15-20, 16-45, 16-40, 16-35, 16-30, 16-25, 16-20, 17-45, 17-40, 17- 35, 17-30, 17-25, 17-20, 18-45, 18-40, 18-35, 18-30, 18-25, 18-20, 19-45, 19-40, 19-35, 19- 30, 19-25, 19-20, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides of the nucleotide sequence of an mRNA molecule formed during the transcription of a PMP22 gene. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention. The terms “complementary,” “fully complementary” and “substantially complementary,” are used herein with respect to the base matching between an antisense oligonucleotide and a target sequence. As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a 19 ME148775155v.1 Attorney Docket No.: 140101-00120 second nucleotide sequence, refers to the ability of a oligonucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the second nucleotide sequence, as will be understood by the skilled person. Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the nucleotides. “Complementary” sequences, as used herein, can also include, or be formed entirely from, non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. As used herein, “target nucleic acid” refers to a nucleic acid molecule to which an antisense oligonucleotide specifically hybridizes. References to “X” throughout the disclosure denote any form of the amino acid aminohexanoic acid, such as 6- aminohexanoic acid. References to “B” throughout the disclosure denote the amino acid beta-alanine. Refences to “[Hyp]” throughout the disclosure denote the amino acid hydroxyproline. References to “Ac” throughout the disclosure denote an acetyl group (CH3-C(O)-). References to other capital letters throughout the disclosure denote the relevant genetically encoded amino acid residue in accordance with the accepted alphabetic amino acid code. The term “alkyl,” as used herein, refers to a straight or branched chain hydrocarbon group containing a total of one to twenty carbon atoms, unless otherwise specified (e.g., (1- 6C) alkyl, (1-4C) alkyl, (1-3C) alkyl, or (1-2C) alkyl). Non-limiting examples of alkyls include methyl, ethyl, 1-methylethyl, propyl, 1-methylbutyl, 1-ethylbutyl, etc. References to individual alkyl groups such as “propyl” are specific for the straight chain version only, and references to individual branched chain alkyl groups such as “isopropyl” are specific for the branched chain version only. The term "alkenyl," as used herein, refers to an aliphatic group containing having one, two, or three carbon-carbon double bonds and containing a total of two to twenty carbon atoms, unless otherwise specified (e.g., (2-6C) alkenyl, (2-4C) alkenyl, or (2-3C) alkenyl). Non-limiting examples of alkenyl include vinyl, allyl, homoallyl, isoprenyl, etc. Unless otherwise specified, alkenyl may be optionally substituted by one, two, three, four, or five groups selected from the group consisting of carbocyclyl, aryl, heterocyclyl, heteroaryl, oxo, halogen, and hydroxyl. The term "alkynyl," as used herein, refers to an aliphatic group containing one, two, or three carbon-carbon triple bonds and containing a total of two to twenty carbon atoms, 20 ME148775155v.1 Attorney Docket No.: 140101-00120 unless otherwise specified (e.g., (2-6C) alkynyl, (2-4C) alkynyl, or (2-3C) alkynyl). Non- limiting examples of alkynyl include ethynyl, propargyl, homopropargyl, but-2-yn-1-yl, 2- methyl-prop-2-yn-1-yl, etc. Unless otherwise specified, alkynyl may be optionally substituted by one, two, three, four, or five groups selected from the group consisting of carbocyclyl, aryl, heterocyclyl, heteroaryl, oxo, halogen, and hydroxyl. By “arginine rich” with respect to a cationic domain is meant that at least 40% of the cationic domain is formed of arginine residues. The term “artificial amino acid,” as used herein, refers to an abiogenic amino acid (e.g., non- proteinogenic). For example, artificial amino acids may include synthetic amino acids, modified amino acids (e.g., those modified with sugars), non-natural amino acids, man- made amino acids, spacers, and non-peptide bonded spacers. Synthetic amino acids may be those that are chemically synthesized by man. For the avoidance of doubt, aminohexanoic acid (X) is an artificial amino acid in the context of the present invention. For the avoidance of doubt, beta-alanine (B) and hydroxyproline (Hyp) occur in nature and therefore are not artificial amino acids in the context of the present invention but are natural amino acids. Artificial amino acids may include, for example, 6-aminohexanoic acid (X), tetrahydroisoquinoline- 3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), 3-azetidine-carboxylic acid (Az), and 11-aminoundecanoic acid. The term “aryl,” as used herein, refers to a carbocyclic ring system containing one, two, or three rings, at least one of which is aromatic. An unsubstituted aryl contains a total of 6 to 14 carbon atoms. The term aryl includes both monovalent species and divalent species. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, indanyl, and the like. In particular embodiments, an optionally substituted aryl is optionally substituted phenyl. The term “bridged ring systems,” as used herein, refers to meant ring systems in which two rings share more than two atoms, see for example Advanced Organic Chemistry, by Jerry March, 4th Edition, Wiley Interscience, pages 131 -133, 1992. Examples of bridged heterocyclyl ring systems include, aza- bicydo[2.2.1]heptane, 2-oxa-5- azabicyclo[2.2.1]heptane, aza-bicyclo[2.2.2]octane, aza- bicyclo[3.2.1]octane, quinuclidine, etc. The term “carbonyl,” as used herein, refers to a group of the following structure - C(O)-. Nonlimiting examples of carbonyl groups include those found, e.g., in acetone, ethyl acetate, proteinogenic amino acids, acetamide, etc. References made herein to “cationic” denote an amino acid or domain of amino acids having an overall positive charge at physiological pH. The term "(m-nC)" or "(m-nC) group" used alone or as a prefix, refers to a group having a total of m to n carbon atoms, when unsubstituted. 21 ME148775155v.1 Attorney Docket No.: 140101-00120 The term "complementary," as used herein in reference to a nucleobase sequence, refers to the nucleobase sequence having a pattern of contiguous nucleobases that permits an oligonucleotide having the nucleobase sequence to hybridize to another oligonucleotide or nucleic acid to form a duplex structure under physiological conditions. Complementary sequences include Watson-Crick base pairs formed from natural and / or modified nucleobases. Complementary sequences can also include non- Watson-Crick base pairs, such as wobble base pairs (guanosine-uracil, hypoxanthine-uracil, hypoxanthine-adenine, and hypoxanthine-cytosine) and Hoogsteen base pairs. The term “cycloalkyl,” as used herein, refers to a saturated carbocyclic ring system containing one or two rings, and containing a total of 3 to 10 carbon atoms, unless otherwise specified. The two-ring cycloalkyls may be arranged as fused ring systems (two bridgehead carbon atoms are directly bonded to one another), bridged ring systems (two bridgehead carbon atoms are linked to one another via a covalent linker containing at least one carbon atom), and spiro-ring (two rings are fused at the same cabron atom) systems. Non-limiting examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, bicyclo[2.2.1]heptyl. The term “cycloalkenyl,” as used herein, refers to a non-aromatic, unsaturated, carbocyclic ring system containing one or two rings; containing one, two, or three endocyclic double bonds; and containing a total of 3 to 10 carbon atoms, unless otherwise specified. The two-ring cycloalkenyls may be arranged as fused ring systems (two bridgehead carbon atoms are directly bonded to one another), bridged ring systems (two bridgehead carbon atoms are linked to one another via a covalent linker containing at least one carbon atom), and spiro- ring (two rings are fused at the same cabron atom) systems. Non-limiting examples of cycloalkenyl include cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 3- cyclohexen-1-yl, cyclooctenyl. An “exon” refers to a defined section of nucleic acid that encodes for a protein, or a nucleic acid sequence that is represented in the mature form of an RNA molecule after either portions of a pre- processed (or precursor) RNA have been removed by splicing. The mature RNA molecule can be a messenger RNA (mRNA) or a functional form of a non-coding RNA, such as rRNA or tRNA. “Exon skipping” refers generally to the process by which an entire exon, or a portion thereof, is removed from a given pre-processed RNA, and is thereby excluded from being present in the mature RNA, such as the mature mRNA that is translated into a protein. Hence, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein, typically creating an altered, though still functional, form of the protein. The term “halo” or “halogeno,” as used herein, refer to fluoro, chloro, bromo, and iodo. 22 ME148775155v.1 Attorney Docket No.: 140101-00120 By “histidine rich” with respect to a cationic domain it is meant that at least 40% of the cationic domain is formed of histidine residues. The terms “heteroaryl” or “heteroaromatic,” as used interchangeably herein, refer to a ring system containing one, two, or three rings, at least one of which is aromatic and containing one to four (e.g., one, two, or three) heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. An unsubstituted heteroaryl group contains a total of one to nine carbon atoms. The term heteroaryl includes both monovalent species and divalent species. Examples of heteroaryl groups are monocyclic and bicyclic groups containing from five to twelve ring members, and more usually from five to ten ring members. The heteroaryl group can be, for example, a 5- or 6-membered monocyclic ring or a 9- or 10- membered bicyclic ring, for example, a bicyclic structure formed from fused five and six membered rings or two fused six membered rings. Each ring may contain up to about four heteroatoms typically selected from nitrogen, sulfur and oxygen. Typically, the heteroaryl ring will contain up to 3 heteroatoms, more usually up to 2, for example, a single heteroatom. In some embodiments, the heteroaryl ring contains at least one ring nitrogen atom. The nitrogen atoms in the heteroaryl rings can be basic, as in the case of an imidazole or pyridine, or essentially non-basic as in the case of an indole or pyrrole nitrogen. In general, the number of basic nitrogen atoms present in the heteroaryl group, including any amino group substituents of the ring, will be less than five. Examples of heteroaryl include furyl, pyrrolyl, thienyl, oxazolyl, isoxazolyl, imidazolyl, pyrazolyl, thiazolyl, isothiazolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1 ,3,5-triazenyl, benzofuranyl, indolyl, isoindolyl, benzothienyl, benzoxazolyl, benzimidazolyl, benzothiazolyl, benzothiazolyl, indazolyl, purinyl, benzofurazanyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, cinnolinyl, pteridinyl, naphthyridinyl, carbazolyl, phenazinyl, benzisoquinolinyl, pyridopyrazinyl, thieno[2,3-b]furanyl, 2H-furo[3,2-b]-pyranyl, 5H-pyrido[2,3-d]-o-oxazinyl, 1 H- pyrazolo[4,3-d]-oxazolyl, 4H-imidazo[4,5-d]thiazolyl, pyrazino[2,3-d]pyridazinyl, imidazo[2,1-b]thiazolyl, imidazo[1 ,2-b][1 ,2,4]triazinyl. “Heteroaryl” also covers partially aromatic bi- or polycyclic ring systems wherein at least one ring is an aromatic ring and one or more of the other ring(s) is a non-aromatic, saturated or partially saturated ring, provided at least one ring contains one or more heteroatoms selected from nitrogen, oxygen or sulfur. Examples of partially aromatic heteroaryl groups include for example, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 2-oxo-1.2.3.4-tetrahydroquinolinyl, dihydrobenzthienyl, dihydrobenzfuranyl, 2,3-dihydro- benzo[1 ,4]dioxinyl, benzo[1 ,3]dioxolyl, 2,2-dioxo-1 ,3-dihydro-2- benzothienyl, 4, 5,6,7- tetrahydrobenzofuranyl, indolinyl, 1 ,2,3, 4-tetrahydro-1 ,8-naphthyridinyl,1.2.3.4- tetrahydropyrido[2,3-b]pyrazinyl and 3,4-dihydro-2W-pyrido[3,2-b][1 ,4]oxazinyl. Examples of five membered heteroaryl groups include but are not limited to pyrrolyl, furanyl, thienyl, imidazolyl, furazanyl, 23 ME148775155v.1 Attorney Docket No.: 140101-00120 oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, triazolyl and tetrazolyl groups. Examples of six membered heteroaryl groups include but are not limited to pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl and triazinyl. A bicyclic heteroaryl group may be, for example, a group selected from: a benzene ring fused to a 5- or 6-membered ring containing 1 , 2 or 3 ring heteroatoms; a pyridine ring fused to a 5- or 6-membered ring containing 1 , 2 or 3 ring heteroatoms; a pyrimidine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrrole ring fused to a 5- or 6-membered ring containing 1 , 2 or 3 ring heteroatoms; a pyrazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a pyrazine ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an imidazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an oxazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isoxazole ring fused to a 5- or 6- membered ring containing 1 or 2 ring heteroatoms; a thiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; an isothiazole ring fused to a 5- or 6-membered ring containing 1 or 2 ring heteroatoms; a thiophene ring fused to a 5- or 6-membered ring containing 1 , 2 or 3 ring heteroatoms; a furan ring fused to a 5- or 6-membered ring containing 1 , 2 or 3 ring heteroatoms; a cyclohexyl ring fused to a 5- or 6-membered heteroaromatic ring containing 1 , 2 or 3 ring heteroatoms; and a cyclopentyl ring fused to a 5- or 6-membered heteroaromatic ring containing 1 , 2 or 3 ring heteroatoms. Particular examples of bicyclic heteroaryl groups containing a six membered ring fused to a five membered ring include but are not limited to benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl (e.g., adeninyl, guaninyl), indazolyl, benzodioxolyl and pyrazolopyridinyl groups. Particular examples of bicyclic heteroaryl groups containing two fused six membered rings include but are not limited to quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, chromenyl, isochromenyl, chromanyl, isochromanyl, benzodioxanyl, quinolizinyl, benzoxazinyl, benzodiazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl and pteridinyl groups. The terms “heterocyclyl,” as used herein, refer to a ring system containing one, two, or three rings, at least one of which containing one to four (e.g., one, two, or three) heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur, provided that the ring system does not contain aromatic rings that also include an endocyclic heteroatom. An unsubstituted heterocyclyl group contains a total of two to nine carbon atoms. The term heterocyclyl includes both monovalent species and divalent species. Examples of heterocyclyl groups are monocyclic and bicyclic groups containing from five to twelve ring members, and more usually from five to ten ring members. The heterocyclyl group can be, for example, a 5- or 6-membered monocyclic ring or a 9- or 10-membered bicyclic ring, for example, a bicyclic structure formed from fused five and six membered rings or two fused six 24 ME148775155v.1 Attorney Docket No.: 140101-00120 membered rings. Each ring may contain up to about four heteroatoms typically selected from nitrogen, sulfur and oxygen. Non-limiting examples of heterocyclyl groups include, e.g., pyrrolidine, piperazine, piperidine, azepane, 1 ,4-diazepane, tetrahydrofuran, tetrahydropyran, oxepane, 1 ,4-dioxepane, tetrahydrothiophene, tetrahydrothiopyran, indoline, benzopyrrolidine, 2,3-dihydrobenzofuran, phthalan, isochroman, and 2,3- dihydrobenzothiophene. The term “internucleoside linkage,” as used herein, represents a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. An internucleoside linkage is an unmodified internucleoside linkage or a modified internucleoside linkage. An “unmodified internucleoside linkage” is a phosphate phosphodiester (-O-P(O)(OH)-O-) internucleoside linkage (“phosphate phosphodiester”). A “modified internucleoside linkage” is an internucleoside linkage other than a phosphate phosphodiester. The two main classes of modified internucleoside linkages are defined by the presence or absence of a phosphorus atom. Non-limiting examples of phosphorus-containing internucleoside linkages include phosphodiester linkages, phosphotriester linkages, phosphorothioate diester linkages, phosphorothioate triester linkages, morpholino internucleoside linkages (also known as phosphorodiamidate linkages and of the structure - P(O)(NMe2)O-), methylphosphonates, and phosphoramidate. Non- limiting examples of non- phosphorus internucleoside linkages include methylenemethylimino ( — CH2 — N(CH3)— O— CH2— ), thiodiester ( — O — C(O) — S — ), thionocarbamate (— O— C(O)(NH)— S— ), siloxane ( — O — Si(H)2 — O — ), and N,N'-dimethylhydrazine ( — CH2 — N(CH3) — N(CH3) — ). Phosphorothioate linkages are phosphodiester linkages and phosphotriester linkages in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. In some embodiments, an internucleoside linkage is a group of the following structure: where Z is O, S, or Se; Y is -X-L-R1; each X is independently -O-, -S-, -N(-L-R1)-, or L; each L is independently a covalent bond or a linker (e.g., optionally substituted C1-60 aliphatic linker or optionally substituted C2-60 heteroaliphatic linker); each R1 is independently hydrogen, - S-S-R2, -O-CO-R2, -S-CO-R2, optionally substituted C1-9 heterocyclyl, or a hydrophobic moiety; and each R2 is independently optionally substituted C1-10 alkyl, optionally substituted C2-10 heteroalkyl, optionally substituted C6-10 aryl, optionally substituted C6-10 25 ME148775155v.1 Attorney Docket No.: 140101-00120 aryl C1-6 alkyl, optionally substituted C1-9 heterocyclyl, or optionally substituted C1-9 heterocyclyl C1-6 alkyl. When L is a covalent bond, R1 is hydrogen, Z is oxygen, and all X groups are -O-, the internucleoside group is known as a phosphate phosphodiester. When L is a covalent bond, R1 is hydrogen, Z is sulfur, and all X groups are -O-, the internucleoside group is known as a phosphorothioate diester. When Z is oxygen, all X groups are -O-, and either (1) L is a linker or (2) R1 is not a hydrogen, the internucleoside group is known as a phosphotriester. When Z is sulfur, all X groups are -O-, and either (1) L is a linker or (2) R1 is not a hydrogen, the internucleoside group is known as a phosphorothioate triester. Non- limiting examples of phosphorothioate triester linkages and phosphotriester linkages are described in US 2017 / 0037399, the disclosure of which is incorporated herein by reference. An “intron” refers to a nucleic acid region (within a gene) that is not translated into a protein. An intron is a non-coding section that is transcribed into a precursor mRNA (pre- mRNA), and subsequently removed by splicing during formation of the mature RNA. The term “phosphorodiamidate morpholino oligomer (PMO),” used interchangeably with the term “morpholino” or just "PMO" is used herein in reference to a class of oligonucleotides, represents an oligomer of at least 5 morpholino monomer units interconnected by morpholino internucleoside linkages (phosphorodiamidate linkages). A morpholino includes a 5’ group and a 3’ group. A 5’ group in morpholino may be, e.g., hydroxyl, a hydrophobic moiety, phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, disphorodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a bond to a cell penetrating peptide, a bond to a cell penetrating peptide / linker combination, an endosomal escape moiety, or a neutral organic polymer. A 3’ group in morpholino may be, e.g., hydrogen, a hydrophobic moiety, phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, disphorodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a bond to a cell penetrating peptide, a bond to a cell penetrating peptide / linker combination, an endosomal escape moiety, or a neutral organic polymer. In a conjugate of an oligonucleotide that is a morpholino and a cell penetrating peptide that is covalently bonded or linked to the oligonucleotide, the preferred 3’ group is a bond to a cell penetrating peptide or a bond to a cell penetrating peptide / linker combination. The term “nucleobase,” as used herein, represents a nitrogen-containing heterocyclic ring bound at either the 1’ position of the ribofuranose / 2’-deoxyribofuranose in the case of a sugar-based nucleoside or at the carbon atom that is alpha to the oxygen in a morpholine ring of a morpholino subunit in the case of a PMO. Nucleobases are unmodified or modified. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified 26 ME148775155v.1 Attorney Docket No.: 140101-00120 nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines, as well as synthetic and natural nucleobases, e.g., 5-methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl) adenine and guanine, 2- alkyl (e.g., 2-propyl) adenine and guanine, 2-thiouracil, 2- thiothymine, 2-thiocytosine, 5- halouracil, 5-halocytosine, 5-propynyl uracil, 5-propynyl cytosine, 5- trifluoromethyl uracil, 5-trifluoromethyl cytosine, 7-methyl guanine, 7-methyl adenine, 8-azaguanine, 8- azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine. Certain nucleobases are particularly useful for increasing the binding affinity of nucleic acids, e g., 5- substituted pyrimidines; 6- azapyrimidines; N2-, N6-, and / or 06-substituted purines. Nucleic acid duplex stability can be enhanced using, e.g., 5-methylcytosine. Non-limiting examples of nucleobases include: 2-aminopropyladenine, 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil, 5-propynylcytosine, 6- azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7- methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3- deazaguanine, 3- deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N- benzoylcytosine, 4-N-benzoyluracil, 5- methyl 4-N-benzoylcytosine, 5-methyl 4-N- benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1 ,3-diazaphenoxazine-2-one, 1 ,3-diazaphenothiazine-2-one and 9-(2- aminoethoxy)-1,3- diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7- deazaadenine, 7- deazaguanine, 2-aminopyridine, or 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No.3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991 , 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442- 443; the entire contents of each of which are hereby incorporated herein by reference. The term “nucleoside,” as used herein, represents sugar-nucleobase compounds and groups known in the art, modified or unmodified 2’-deoxyribofuranrpose-nucleobase compounds and groups known in the art, as well as known derivatives of such sugar- nucleobase compounds such as morpholino subunits that have a morpholine ring bound to a nucleobase. The sugar may be ribofuranose. The sugar may be modified or unmodified. An 27 ME148775155v.1 Attorney Docket No.: 140101-00120 unmodified ribofuranose-nucleobase is ribofuranose having an anomeric carbon bond to an unmodified nucleobase. Unmodified ribofuranose-nucleobases are adenosine, cytidine, guanosine, and uridine. Unmodified 2’-deoxyribofuranose-nucleobase compounds are 2’- deoxyadenosine, 2’-deoxycytidine, 2’- deoxyguanosine, and thymidine. The modified compounds and groups include one or more modifications selected from the group consisting of nucleobase modifications and sugar modifications described herein. A nucleobase modification is a replacement of an unmodified nucleobase with a modified nucleobase. A sugar modification may be, e.g., a 2’-substitution, locking, carbocyclization, or unlocking. A 2’-substitution is a replacement of 2’-hydroxyl in ribofuranose with 2’-fluoro, 2’-methoxy, or 2’-(2-methoxy)ethoxy. Alternatively, a 2’-substitution may be a 2’-(ara) substitution, which corresponds to the following structure: where B is a nucleobase, and R is a 2’-(ara) substituent (e.g., fluoro). 2’-(ara) substituents are known in the art and can be same as other 2’-substituents described herein. In some embodiments, 2’-(ara) substituent is a 2’-(ara)-F substituent (R is fluoro). A locking modification is an incorporation of a bridge between 4’-carbon atom and 2’-carbon atom of ribofuranose. Nucleosides having a locking modification are known in the art as bridged nucleic acids, e.g., locked nucleic acids (LNA), ethylene-bridged nucleic acids (ENA), and cEt nucleic acids. The bridged nucleic acids are typically used as affinity enhancing nucleosides. The term “nucleotide,” as used herein, represents a nucleoside bonded to an internucleoside linkage or a monovalent group of the following structure -X1-P(X2)(R1), where X1is O, S, NH, or absent, and X2is absent, =O, or =S, and each R1is independently - OH, -N(R2)2, or -O-CH2CH2CN, where each R2is independently an optionally substituted alkyl, or both R2groups, together with the nitrogen atom to which they are attached, combine to form an optionally substituted heterocyclyl. The term “internucleoside linkage of the PMO,” as used herein, represents a divalent group of the following structure: where Z is O or S; X1is a bond, -CH2-, or -O-; X2is a bond, -CH2-O-, or -O-; and 28 ME148775155v.1 Attorney Docket No.: 140101-00120 Y is -NR2, where each R is independently H or C1 -6 alkyl (e.g., methyl), or both R combine together with the nitrogen atom to which they are attached to form a C2-9 heterocyclyl (e.g., N-piperazinyl); provided that both X1and X2are not simultaneously a bond. The term “oligonucleotide,” as used herein, represents a structure containing 5 or more contiguous nucleosides covalently bound together by internucleoside linkages; a morpholino containing 5 or more morpholino subunits; or a nucleic acid containing 10 or more morpholino subunits. Preferably, an oligonucleotide is a PMO. The term “morpholino subunit,” as used herein, refers to the following structure: where B is a nucleobase. The term "optionally substituted" refers to groups, structures, or molecules that may be substituted or unsubstituted as described for each respective group. The term “wherein a / any CH, CH2, CH3 group or heteroatom (i.e. , NH) within a R1group is optionally substituted” means that (any) one of the hydrogen radicals of the R1group is substituted by a relevant stipulated group. The term "operably linked" may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence are covalently linked in such a way as to place the expression of a nucleotide coding sequence under the control of the regulatory sequence, as such, the regulatory sequence is capable of effecting transcription of a nucleotide coding sequence which forms part or all of the selected nucleotide sequence. Where appropriate, the resulting transcript may then be translated into a desired peptide. The term “pharmaceutically acceptable,” as used herein, refers to those compounds, materials, compositions, and / or dosage forms, which are suitable for contact with the tissues of an individual (e.g., a human), without excessive toxicity, irritation, allergic response and other problem complications commensurate with a reasonable benefit / risk ratio. The term “pharmaceutical composition,” as used herein, represents a composition containing an oligonucleotide described herein, formulated with a pharmaceutically acceptable excipient, and manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a subject. The term “pharmaceutically acceptable salt,” as used herein, means any pharmaceutically acceptable salt of a conjugate, oligonucleotide, or peptide disclosed herein. Pharmaceutically acceptable salts of any of the compounds described herein may include those that are within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and are 29 ME148775155v.1 Attorney Docket No.: 140101-00120 commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, pharmaceutically acceptable salts are described in: Berge et al., J. Pharmaceutical Sciences 66:1 -19, 1977 and in Pharmaceutical Salts: Properties, Selection, and Use, (Eds. P.H. Stahl and C.G. Wermuth), Wiley-VCH, 2008; the entire contents of each of which are hereby incorporated herein by reference. The salts can be prepared in situ during the final isolation and purification of the compounds described herein or separately by reacting a free base group with a suitable acid. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy- ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The term “reduce” or “inhibit” may relate generally to the ability of one or more compounds of the invention to “decrease” a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured according to routine techniques in the diagnostic art. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to persons skilled in the art, and may include reductions in the symptoms or pathology of CMT, or reductions in the expression of defective forms of PMP22, such as the altered forms of PMP22 that are expressed in individuals with CMT. A “decrease” in a response may be statistically significant as compared to the response produced by no antisense compound or a control composition, and may include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease, including all integers in between. The term “subject,” as used herein, represents a human or non-human animal (e.g., a mammal) that is suffering from, or is at risk of, disease, disorder, or condition, as determined by a qualified professional (e.g., a doctor or a nurse practitioner) with or without known in the art laboratory test(s) of sample(s) from the subject. Non-limiting examples of diseases, disorders, and conditions include CMT disease, such as CMT1A disease. 30 ME148775155v.1 Attorney Docket No.: 140101-00120 A “sugar” or “sugar moiety,” includes naturally occurring sugars having a furanose ring or a structure that is capable of replacing the furanose ring of a nucleoside. Sugars included in the nucleosides of the invention may be non-furanose (or 4'-substituted furanose) rings or ring systems or open systems. Such structures include simple changes relative to the natural furanose ring (e.g., a six- membered ring). Alternative sugars may also include sugar surrogates wherein the furanose ring has been replaced with another ring system such as, e.g., a morpholino or hexitol ring system. Non-limiting examples of sugar moieties useful thatF<Q =@ DG>EM?@? DG LC@ HEDBHGM>E@HLD?@K HA LC@ DGN@GLDHG DG>EM?@ =& 4&JD=HK@% R&4&*"&deoxyribose, substituted sugars (e.g., 2', 5', and bis substituted sugars), 4'-S-sugars (e.g., 4'-S- ribose, 4'-S-2'-deoxyribose, and 4'-S-2'-substituted ribose), bicyclic sugar moieties (e.g., the 2'- O — CH2-4' or 2'-O — (CH2)2-4' bridged ribose derived bicyclic sugars) and sugar surrogates (when the ribose ring has been replaced with a morpholino or a hexitol ring system). “Treatment” and "treating," as used herein, refer to the medical management of a subject with the intent to improve, ameliorate, or stabilize a disease, disorder, or condition (e.g., CMT). This term includes active treatment (treatment directed to improve CMT); palliative treatment (treatment designed for the relief of symptoms of CMT); and supportive treatment (treatment employed to supplement another therapy). The term “Charcot–Marie–Tooth (CMT) disease,” or “CMT disease,” as used interchangeably herein, refers to a hereditary motor and sensory neuropathy of the peripheral nervous system characterized by progressive loss of muscle tissue and touch sensation across various parts of the body. This disease is the most commonly inherited neurological disorder, affecting about one in 2,500 people. People with CMT may have muscle weakness in their feet, ankles, legs and hands an awkward way of walking (gait), highly arched or very flat feet, numbness in the feet, arms and hands. The symptoms of CMT usually start to appear between the ages of 5 and 15, although they sometimes do not develop until well into middle age or later. There is currently no cure for CMT. CMT disease is classified as CMT disease type 1 (CMT1), CMT disease type 2 (CMT2), CMT disease type 3 (CMT3), CMT disease type 4 (CMT4), CMT disease type 5 (CMT5), CMT disease type 6 (CMT6), CMT disease type 7 (CMT7), and CMT disease type X (CMTX). Within each category, a specific disease associated with a particular gene is assigned a letter (e.g., CMT1A, CMT1B, etc.). Gene duplication of PMP22 is the most common genetic cause of CMT. Up to half of all cases confirmed by a genetic diagnosis are caused by a 1.4 Mb duplication on chromosome 17, which contains the PMP22 gene. Overproduction of PMP22 results in defects in multiple signaling pathways and dysfunction of transcriptional factors like KNOX20, SOX10 and EGR2. Alterations of PMP22 gene expression are associated with Charcot–Marie–Tooth type 1A (CMT1A) disease, and Charcot-Marie-Tooth type 1E 31 ME148775155v.1 Attorney Docket No.: 140101-00120 (CMT1E) disease. Too much PMP22 (e.g., caused by gene duplication) results in CMT1A disease, and point mutations in PMP22 can result in CMT1E disease. In some embodiments, the CMT disease is CMT1A disease. In some embodiments, the CMT disease is CMT1E disease. Charcot-Marie-Tooth disease type 1A (CMT1A) is a type of inherited neurological disorder that affects the peripheral nerves. People with this disease experience weakness and wasting (atrophy) of the muscles of the lower legs beginning in adolescence; later they can also have hand weakness and sensory loss. CMT1A is caused by having an extra copy (a duplication) of the PMP22 gene. It is inherited in an autosomal dominant manner. Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to,” and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. All references to “conjugates” also refer to solvates thereof, including pharmaceutically acceptable solvates thereof. All references to “oligonucleotides” also refer to salts and / or solvates thereof, including pharmaceutically acceptable salts and / or solvates thereof. Unless otherwise specified, all peptides are shown herein in N-terminus to C-terminus direction (left to right). Unless otherwise specified, all oligonucleotides are shown herein in 5’ to 3’ direction (left to right). Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. II. Antisense Oligonucleotides of the Invention The present invention provides antisense oligonucleotides that target a PMP22 gene and inhibit the expression of the PMP22 gene (e.g., inhibit PMP22 transcript expression, and / or PMP22 protein expression). In some embodiments, the antisense oligonucleotides are suitable to be conjugated to a carrier peptide. The present invention further provides antisense oligonucleotide conjugates comprising an antisense oligonucleotide comprising a 32 ME148775155v.1 Attorney Docket No.: 140101-00120 nucleotide sequence targeting PMP22, wherein the antisense oligonucleotide is conjugated to a cell penetrating peptide, and compositions comprising such conjugates, which target a PMP22 gene and inhibit the expression of the PMP22 gene (e.g., inhibit PMP22 transcript expression, and / or PMP22 protein expression). In one embodiment, the antisense oligonucleotide conjugates inhibit the expression of a PMP22 gene in a cell (e.g., a Schwann cell), which is for example, within a subject, e.g., a human having a disease, e.g., CMT disease, such as CMT1A disease. The antisense oligonucleotide conjugates of the invention comprise an antisense oligonucleotide (e.g., a PMO) targeting PMP22 that includes a region of complementarity, which is complementary to a target sequence in a human PMP22 gene (SEQ ID NO: 95) or PMP22 mRNA (SEQ ID NOs: 96-101), for example, at least a part of an mRNA formed in the expression of a PMP22 gene. The region of complementarity may be about 50 nucleotides or less in length (e.g., about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, or 4 nucleotides or less in length). Upon contact with a cell expressing the PMP22 gene, the antisense oligonucleotide inhibits the expression of the PMP22 gene (e.g., a human PMP22 gene) by at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%. The target sequence can be derived from the sequence of an mRNA formed during the expression of a PMP22 gene. Accordingly, in one aspect, an antisense oligonucleotide of the invention specifically hybridizes to a target nucleic acid molecule, such as the mRNA encoding PMP22, and comprises a contiguous nucleotide sequence which corresponds to the reverse complement of a nucleotide sequence of PMP22 mRNA, or a fragment thereof. In some embodiments, the antisense oligonucleotide of the invention may be substantially complementary to the target sequence. For example, an antisense oligonucleotide that is substantially complementary to the target sequence may include a contiguous nucleotide sequence comprising no more than 5 mismatches (e.g., no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 mismatches) when hybridizing to a target sequence, such as to the corresponding region of a nucleic acid which encodes a PMP22 mRNA. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, such as the corresponding region of a nucleic acid which encodes a PMP22 mRNA. In some embodiments, the antisense oligonucleotides of the invention that are substantially complementary to the target sequence comprise a contiguous nucleotide sequence which is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs: 95-101, or a fragment thereof, such as about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 85%, about 86%, 33 ME148775155v.1 Attorney Docket No.: 140101-00120 about 87%, about 88%, about 89%, about 90%, about % 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% complementary. In some embodiments, the antisense oligonucleotide comprises at least 10, at least 15, at least 20, or at least 25 contiguous nucleotides complementary to a target sequence in a human PMP22 gene (SEQ ID NO: 95) or PMP22 mRNA (SEQ ID NOs: 96-101). In some embodiments, the antisense oligonucleotide targets the 5’UTR, the 3’UTR, an exon, an intron, or an exon-intron junction of the PMP22 pre-mRNA. In some embodiments, the antisense oligonucleotide targets the 5’UTR of the PMP22 pre-mRNA. In some embodiments, the antisense oligonucleotide targets the 3’UTR of the PMP22 pre- mRNA. In some embodiments, the antisense oligonucleotide targets an exon of the PMP22 pre-mRNA. In some embodiments, the antisense oligonucleotide targets an intron of the PMP22 pre-mRNA. In some embodiments, the antisense oligonucleotide targets an exon- intron junction of the PMP22 pre-mRNA. In some embodiments, the antisense oligonucleotides of the invention have a nucleotide sequence that targets or is complementary to a target sequence of any one of the nucleotide sequences of SEQ ID NOs: 285-467. In some embodiments, the target sequence is any one of the nucleotide sequences of SEQ ID NOs: 285-467 with the proviso that the nucleotide sequence is not SEQ ID NO: 445, SEQ ID NO: 446, SEQ ID NO: 448, SEQ ID NO: 449, SEQ ID NO: 450, or SEQ ID NO: 451. In certain preferred embodiments, the target sequence is any one of the nucleotide sequences of SEQ ID NOs: 435, 436, 437, 452, 453, 455, 456, 458, 463. In certain preferred embodiments, the target sequence is any one of the nucleotide sequences of SEQ ID NOs: 382, 383, and 385. In some embodiments, the target sequence comprises at least 10 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NOs: 285-467. In some embodiments, the target sequence comprises at least 15 contiguous nucleotides of any one of the nucleotide sequences of SEQ ID NOs: 285-467. In some embodiments, the target sequence comprises a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 285-467. In some embodiments, the target sequence consists of a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 285-467. In some embodiments, the antisense oligonucleotide of the invention inhibits PMP22 expression (e.g., transcript expression and / or protein expression) by inducing one or more of exon skipping, steric clocking regulatory regions, nonsense-mediated decay, destabilizing full length and / or pre-mRNA transcript, inhibiting protein production etc., all leading to a decrease in the expression of PMP22 full-length mRNA and or functional protein, or expression of healthy, non-mutant or mutant functional protein. In some embodiments, the antisense oligonucleotide induces exon skipping in the PMP22 mRNA. “Exon skipping” refers generally to the process by which an entire exon, or a 34 ME148775155v.1 Attorney Docket No.: 140101-00120 portion thereof, is removed from a given pre-processed RNA, and is thereby excluded from being present in the mature RNA, such as the mature mRNA that is translated into a protein. Hence, the portion of the protein that is otherwise encoded by the skipped exon is not present in the expressed form of the protein, typically creating an altered, though still functional, form of the protein. As described herein, the exon being skipped is one or more of exon 1a, exon 1b, exon 2, exon 3, exon 4, or exon 5 of the human PMP22 gene. In some embodiments, the exon is exon 1a. In some embodiments, the exon is exon 1b. In some embodiments, the exon is exon 2. In some embodiments, the exon is exon 3. In some embodiments, the exon is exon 4. In some embodiments, the exon is exon 5. An antisense oligonucleotide may comprise a contiguous nucleotide sequence of about 4 to about 50 nucleotides in length, e.g., 8-49, 8-48, 8-47, 8-46, 8-45, 8-44, 8-43, 8-42, 8-41, 8-40, 8-39, 8-38, 8-37, 8-36, 8-35, 8-34, 8-33, 8-32, 8-31, 8-30, 8-29, 8-28, 8-27, 8-26, 8-25, 8-24, 8-23, 8-22, 8-21, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 10-49, 10-48, 10-47, 10-46, 10-45, 10-44, 10-43, 10-42, 10-41, 10-40, 10-39, 10-38, 10- 37, 10-36, 10-35, 10-34, 10-33, 10-32, 10-31, 10-30, 10-29, 10-28, 10-27, 10-26, 10-25, 10- 24, 10-23, 10-22, 10-21, 10-20, 10-19, 10-18, 10-17, 10-16, 10-15, 10-14, 10-13, 10-12, 10- 11,11-49, 11-48, 11-47, 11-46, 11-45, 11-44, 11-43, 11-42, 11-41, 11-40, 11-39, 11-38, 11- 37, 11-36, 11-35, 11-34, 11-33, 11-32, 11-31, 11-30, 11-29, 11-28, 11-27, 11-26, 11-25, 11- 24, 11-23, 11-22, 11-21, 11-20, 11-19, 11-18, 11-17, 11-16, 11-15, 11-14, 11-13, 11-12, 12- 49, 12-48, 12-47, 12-46, 12-45, 12-44, 12-43, 12-42, 12-41, 12-40, 12-39, 12-38, 12-37, 12- 36, 12-35, 12-34, 12-33, 12-32, 12-31, 12-30, 12-29, 12-28, 12-27, 12-26, 12-25, 12-24, 12- 23, 12-22, 12-21, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-49, 13-48, 13- 47, 13-46, 13-45, 13-44, 13-43, 13-42, 13-41, 13-40, 13-39, 13-38, 13-37, 13-36, 13-35, 13- 34, 13-33, 13-32, 13-31, 13-30, 13-29, 13-28, 13-27, 13-26, 13-25, 13-24, 13-23, 13-22, 13- 21, 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-49, 14-48, 14-47, 14-46, 14-45, 14- 44, 14-43, 14-42, 14-41, 14-40, 14-39, 14-38, 14-37, 14-36, 14-35, 14-34, 14-33, 14-32, 14- 31, 14-30, 14-29, 14-28, 14-27, 14-26, 14-25, 14-24, 14-23, 14-22, 14-21, 14-20, 14-19, 14- 18, 14-17, 14-16, 14-15, 15-49, 15-48, 15-47, 15-46, 15-45, 15-44, 15-43, 15-42, 15-41, 15- 40, 15-39, 15-38, 15-37, 15-36, 15-35, 15-34, 15-33, 15-32, 15-31, 15-30, 15-29, 15-28, 15- 27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 15-16,16-49, 16- 48, 16-47, 16-46, 16-45, 16-44, 16-43, 16-42, 16-41, 16-40, 16-39, 16-38, 16-37, 16-36, 16- 35, 16-34, 16-33, 16-32, 16-31, 16-30, 16-29, 16-28, 16-27, 16-26, 16-25, 16-24, 16-23, 16- 22, 16-21, 16-20, 16-19, 16-18, 16-17, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17- 42, 17-41, 17-40, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-32, 17-31, 17-30, 17- 29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-23, 17-22, 17-21, 17-20, 17-19, 17-18, 18-49, 18- 48, 18-47, 18-46, 18-45, 18-44, 18-43, 18-42, 18-41, 18-40, 18-39, 18-38, 18-37, 18-36, 18- 35, 18-34, 18-33, 18-32, 18-31, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18- 22, 18-21, 18-20, 19-49, 19-48, 19-47, 19-46, 19-45, 19-44, 19-43, 19-42, 19-41, 19-40, 19- 35 ME148775155v.1 Attorney Docket No.: 140101-00120 39, 19-38, 19-37, 19-36, 19-35, 19-34, 19-33, 19-32, 19-31, 19-30, 19-29, 19-28, 19-27, 19- 26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-49, 20-48, 20-47, 20-46, 20-45, 20-44, 20- 43, 20-42, 20-41, 20-40, 20-39, 20-38, 20-37, 20-36, 20-35, 20-34, 20-33, 20-32, 20-31, 20- 30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-49, 21-48, 21-47, 21- 46, 21-45, 21-44, 21-43, 21-42, 21-41, 21-40, 21-39, 21-38, 21-37, 21-36, 21-35, 21-34, 21- 33, 21-32, 21-31, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, 21-22, 22-49, 22- 48, 22-47, 22-46, 22-45, 22-44, 22-43, 22-42, 22-41, 22-40, 22-39, 22-38, 22-37, 22-36, 22- 35, 22-34, 22-33, 22-32, 22-31, 22-30, 22-29, 22-28, 22-27, 22-26, 22-25, 22-24, 22-23, 23- 49, 23-48, 23-47, 23-46, 23-45, 23-44, 23-43, 23-42, 23-41, 23-40, 23-39, 23-38, 23-37, 23- 36, 23-35, 23-34, 23-33, 23-32, 23-31, 23-30, 23-29, 23-28, 23-27, 23-26, 23-25, 23-24, 24- 49, 24-48, 24-47, 24-46, 24-45, 24-44, 24-43, 24-42, 24-41, 24-40, 24-39, 24-38, 24-37, 24- 36, 24-35, 24-34, 24-33, 24-32, 24-31, 24-30, 24-29, 24-28, 24-27, 24-26, 24-25, 25-49, 25- 48, 25-47, 25-46, 25-45, 25-44, 25-43, 25-42, 25-41, 25-40, 25-39, 25-38, 25-37, 25-36, 25- 35, 25-34, 25-33, 25-32, 25-31, 25-30, 25-29, 25-28, 25-27, 25-26,26-49, 26-48, 26-47, 26- 46, 26-45, 26-44, 26-43, 26-42, 26-41, 26-40, 26-39, 26-38, 26-37, 26-36, 26-35, 26-34, 26- 33, 26-32, 26-31, 26-30, 26-29, 26-28, 26-27, 27-49, 27-48, 27-47, 27-46, 27-45, 27-44, 27- 43, 27-42, 27-41, 27-40, 27-39, 27-38, 27-37, 27-36, 27-35, 27-34, 27-33, 27-32, 27-31, 27- 30, 27-29, 27-28, 28-49, 28-48, 28-47, 28-46, 28-45, 28-44, 28-43, 28-42, 28-41, 28-40, 28- 39, 28-38, 28-37, 28-36, 28-35, 28-34, 28-33, 28-32, 28-31, 28-30, 28-29, 29-49, 29-48, 29- 47, 29-46, 29-45, 29-44, 29-43, 29-42, 29-41, 29-40, 29-39, 29-38, 29-37, 29-36, 29-35, 29- 34, 29-33, 29-32, 29-31, 29-30, 30-49, 30-48, 30-47, 30-46, 30-45, 30-44, 30-43, 30-42, 30- 41, 30-40, 30-39, 30-38, 30-37, 30-36, 30-35, 30-34, 30-33, 30-32, or 30-31 nucleotides in length, e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, the antisense oligonucleotide may comprise a contiguous nucleotide sequence of no more than 22 nucleotides, such as no more than 21 nucleotides, 20 nucleotides, 19 nucleotides, or no more than 18 nucleotides. In some embodiments the antisense oligonucleotides of the invention comprises less than 20 nucleotides. In other embodiments, the antisense oligonucleotides of the invention comprise 20 nucleotides. In other embodiments, the antisense oligonucleotides of the invention comprise 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises at least 10 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide comprises at least 15 contiguous nucleotides of any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide 36 ME148775155v.1 Attorney Docket No.: 140101-00120 comprises a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284. In some embodiments, the antisense oligonucleotide has a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284 with the proviso that the nucleotide sequence is not SEQ ID NO: 262, SEQ ID NO: 263, SEQ ID NO: 265, SEQ ID NO: 266, SEQ ID NO: 267, SEQ ID NO: 268. In some embodiments, the antisense oligonucleotide has a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 252, 253, 262-270, 272, 273, 275, and 280. In certain preferred embodiments, the antisense oligonucleotide has a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 252, 253, 264, 269, 270, 272, 273, 275, and 280. In certain preferred embodiments, the antisense oligonucleotide has a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 198, 200, and 202. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 102. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 103. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 104. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 105. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 106. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 107. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 108. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 109. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 110. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 111. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 112. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 113. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 114. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 115. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 116. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 117. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 118. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 119. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 120. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 121. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of 37 ME148775155v.1 Attorney Docket No.: 140101-00120 SEQ ID NO: 122. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 123. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 124. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 125. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 126. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 127. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 128. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 129. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 130. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 131. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 132. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 133. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 134. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 135. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 136. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 137. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 138. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 139. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 140. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 141. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 142. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 143. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 144. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 145. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 146. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 147. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 148. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 149. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 150. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 151. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 152. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 153. In some embodiments, the antisense 38 ME148775155v.1 Attorney Docket No.: 140101-00120 oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 154. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 155. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 156. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 157. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 158. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 159. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 160. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 161. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 162. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 163. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 164. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 165. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 166. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 167. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 168. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 169. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 170. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 171. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 172. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 173. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 174. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 175. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 176. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 177. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 178. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 179. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 180. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 181. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 182. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 183. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 184. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 185. In some 39 ME148775155v.1 Attorney Docket No.: 140101-00120 embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 186. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 187. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 188. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 189. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 190. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 191. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 192. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 193. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 194. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 195. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 196. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 197. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 198. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 199. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 200. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 201. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 202. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 203. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 204. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 205. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 206. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 207. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 208. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 209. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 210. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 211. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 212. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 213. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 214. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 215. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 216. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of 40 ME148775155v.1 Attorney Docket No.: 140101-00120 SEQ ID NO: 217. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 218. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 219. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 220. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 221. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 222. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 223. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 224. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 225. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 226. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 227. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 228. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 229. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 230. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 231. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 232. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 233. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 234. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 235. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 236. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 237. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 238. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 239. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 240. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 241. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 242. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 243. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 244. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 245. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 246. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 247. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 248. In some embodiments, the antisense 41 ME148775155v.1 Attorney Docket No.: 140101-00120 oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 249. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 250. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 251. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 252. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 253. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 254. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 255. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 256. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 257. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 258. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 259. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 260. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 261. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 262. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 263. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 264. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 265. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 266. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 267. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 268. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 269. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 270. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 271. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 272. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 273. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 274. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 275. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 276. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 277. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 278. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 279. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 280. In some 42 ME148775155v.1 Attorney Docket No.: 140101-00120 embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 281. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 282. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 283. In some embodiments, the antisense oligonucleotide comprises a nucleotide sequence of SEQ ID NO: 284. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 102. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 103. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 104. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 105. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 106. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 107. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 108. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 109. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 110. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 111. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 112. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 113. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 114. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 115. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 116. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 117. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 118. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 119. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 120. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 121. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 122. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 123. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 124. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 125. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 126. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 127. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 128. In some embodiments, the antisense 43 ME148775155v.1 Attorney Docket No.: 140101-00120 oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 129. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 130. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 131. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 132. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 133. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 134. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 135. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 136. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 137. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 138. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 139. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 140. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 141. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 142. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 143. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 144. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 145. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 146. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 147. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 148. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 149. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 150. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 151. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 152. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 153. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 154. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 155. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 156. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 157. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 158. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 159. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 160. In some 44 ME148775155v.1 Attorney Docket No.: 140101-00120 embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 161. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 162. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 163. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 164. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 165. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 166. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 167. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 168. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 169. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 170. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 171. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 172. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 173. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 174. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 175. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 176. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 177. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 178. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 179. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 180. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 181. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 182. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 183. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 184. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 185. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 186. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 187. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 188. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 189. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 190. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 191. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of 45 ME148775155v.1 Attorney Docket No.: 140101-00120 SEQ ID NO: 192. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 193. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 194. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 195. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 196. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 197. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 198. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 199. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 200. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 201. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 202. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 203. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 204. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 205. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 206. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 207. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 208. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 209. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 210. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 211. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 212. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 213. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 214. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 215. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 216. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 217. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 218. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 219. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 220. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 221. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 222. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 223. In some embodiments, the antisense 46 ME148775155v.1 Attorney Docket No.: 140101-00120 oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 224. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 225. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 226. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 227. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 228. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 229. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 230. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 231. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 232. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 233. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 234. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 235. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 236. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 237. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 238. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 239. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 240. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 241. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 242. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 243. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 244. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 245. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 246. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 247. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 248. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 249. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 250. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 251. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 252. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 253. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 254. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 255. In some 47 ME148775155v.1 Attorney Docket No.: 140101-00120 embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 256. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 257. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 258. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 259. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 260. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 261. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 262. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 263. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 264. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 265. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 266. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 267. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 268. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 269. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 270. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 271. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 272. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 273. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 274. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 275. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 276. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 277. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 278. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 279. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 280. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 281. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 282. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 283. In some embodiments, the antisense oligonucleotide consists of a nucleotide sequence of SEQ ID NO: 284. Further, antisense oligonucleotides having a sequence of at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides derived from one of the sequences of Table 3 and differing in their ability to inhibit the expression of a PMP22 gene 48 ME148775155v.1 Attorney Docket No.: 140101-00120 by not more than about 5%, 10%, 15%, 20%, 25%, or 30% inhibition from an antisense oligonucleotide comprising the full sequence, are contemplated to be within the scope of the present invention. In some embodiments, the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO). PMO refers to a class of oligonucleotides, represents an oligomer of at least 5 morpholino monomer units interconnected by morpholino internucleoside linkages (phosphorodiamidate linkages). A morpholino includes a 5’ group and a 3’ group. For example, a morpholino may be of the following structure: n is an integer from 5 to 40, preferably at least 10 (e.g., 12 to 30) indicating the number of morpholino subunits and associated groups L; each B is independently a nucleobase; R1is a 5’ group (R1may be referred to herein as a 5’ terminus); R2is a 3’ group (R2may be referred to herein as a 3’ terminus); and L is (i) a phosphorodiamidate linkage when not covalently bonded to R2or, (ii) absent when covalently bonded to R2. A 5’ group in morpholino may be, e.g., hydroxyl, a hydrophobic moiety, phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, disphorodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a bond to a cell penetrating peptide, a bond to a cell penetrating peptide / linker combination, an endosomal escape moiety, or a neutral organic polymer. In some embodiments, the 5’ group is an EG3 group or a standard Gene Tools group of the following structure, respectively: Preferred 5’ group are hydroxyl and groups of the following structure: 49 ME148775155v.1 Attorney Docket No.: 140101-00120 A more preferred 5’ group is the standard Gene Tools group of the following structure: The term "EG3 tail" refers to triethylene glycol moieties conjugated to the antisense oligonucleotide, e.g., at its 3'- or 5'-end. A 3’ group in morpholino may be, e.g., hydrogen, a hydrophobic moiety, phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, disphorodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a bond to a cell penetrating peptide, a bond to a cell penetrating peptide / linker combination, an endosomal escape moiety, or a neutral organic polymer. In a conjugate of an oligonucleotide that is a morpholino and a cell penetrating peptide that is covalently bonded or linked to the oligonucleotide, the preferred 3’ group is a bond to a cell penetrating peptide or a bond to a cell penetrating peptide / linker combination. In some embodiments, all the internucleoside linkages of the PMO are - P(O)(NMe2)O-. Representative patent documents that teach the structure and / or preparation of the antisense oligonucleotides, such as PMOs, of the present invention include, but are not limited to, International PCT Publication No. WO 2022192749; International PCT Publication No. WO 2022192754; and US Patent Publication No.2021 / 0299264, the entire contents of each of which are hereby incorporated herein by reference. 50 ME148775155v.1 Attorney Docket No.: 140101-00120 III. Cell Penetrating Peptides of the Invention In one aspect, the present invention provides antisense oligonucleotide conjugates for inhibiting expression of PMP22, comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, wherein the cell penetrating peptide comprises at least one cationic domain comprising at least 4 amino acid residues and at least one hydrophobic domain comprising at least 3 amino acid residues, wherein the cell penetrating peptide comprises a total of 7 to 40 amino acid residues and the at least one cationic domain comprises a beta-alanine residue in combination with arginine and / or histidine residues. Preferably, peptides included in the conjugates described herein include no artificial amino acid residues. In some embodiments, the cell penetrating peptide does not contain aminohexanoic acid residues. In some embodiments, the cell penetrating peptide does not contain any form of aminohexanoic acid residues. In some embodiments, the cell penetrating peptide does not contain 6-aminohexanoic acid residues. In some embodiments, the cell penetrating peptide contains only natural amino acid residues, and therefore consists of natural amino acid residues. In some embodiments, artificial amino acids such as 6-aminohexanoic acid that are typically used in cell- penetrating peptides are replaced by natural amino acids. In some embodiments, the artificial amino acids such as 6-aminohexanoic acid that are typically used in cell penetrating peptides are replaced by amino acids selected from beta-alanine, serine, proline, arginine and histidine or hydroxyproline. In some embodiments, aminohexanoic acid is replaced by beta-alanine. In some embodiments, 6-aminohexanoic acid is replaced by beta-alanine In some embodiments, aminohexanoic acid is replaced by histidine. In some embodiments, 6- aminohexanoic acid is replaced by histidine. In some embodiments, aminohexanoic acid is replaced by hydroxyproline. In some embodiments, 6-aminohexanoic acid is replaced by hydroxyproline. In some embodiments, the artificial amino acids such as 6-aminohexanoic acid that are typically used in cell penetrating peptides may be replaced by a combination of any of beta-alanine, serine, proline, arginine and histidine or hydroxyproline, e.g., a combination of any of beta-alanine, histidine, and hydroxyproline. In some embodiments, the present invention provides a cell penetrating peptide having a total length of 40 amino acid residues or less, the cell penetrating peptide comprising: two or more cationic domains each comprising at least 4 amino acid residues; and one or more hydrophobic domains each comprising at least 3 amino acid residues; wherein at least one cationic domain comprises histidine residues. In some embodiments, wherein at least one cationic domain is histidine rich. 51 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, what is meant by histidine rich is defined herein in relation to the cationic domains. Cationic Domain The present invention relates to short cell penetrating peptides having a particular structure in which there are at least two cationic domains having a certain length. In some embodiments, the cell penetrating peptide comprises up to 4 cationic domains, up to 3 cationic domains. In some embodiments, the cell penetrating peptide comprises 2 cationic domains. As defined above, the cell penetrating peptide comprises two or more cationic domains each having a length of at least 4 amino acid residues. In some embodiments, each cationic domain has a length of between 4 to 12 amino acid residues, e.g., a length of between 4 to 7 amino acid residues. In some embodiments, each cationic domain has a length of 4, 5, 6, or 7 amino acid residues. In some embodiments, each cationic domain is of similar length, e.g., each cationic domain is the same length. In some embodiments, each cationic domain comprises cationic amino acids and may also contain polar and or nonpolar amino acids. Non-polar amino acids may be selected from: alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. In some embodiments, non-polar amino acids do not have a charge. Polar amino acids may be selected from: serine, asparagine, hydroxyproline, histidine, lysine, arginine, threonine, tyrosine, and glutamine. In some embodiments, the selected polar amino acids do not have a negative charge. Cationic amino acids may be selected from: arginine, histidine, and lysine. In some embodiments, cationic amino acids have a positive charge at physiological pH. In some embodiments, each cationic domain does not comprise anionic or negatively charged amino acid residues. In some embodiments, each cationic domain comprises arginine, histidine, lysine, beta-alanine, hydroxyproline, and / or serine residues. In some embodiments, each cationic domain comprises or consists of arginine, histidine, lysine, beta-alanine, hydroxyproline, and / or serine residues. In some embodiments, each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 40%, at least 45%, or at least 50% cationic amino acids. In some embodiments, each cationic domain comprises a majority of cationic amino acids. In some embodiments, each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at 52 ME148775155v.1 Attorney Docket No.: 140101-00120 least 65% at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% cationic amino acids. In some embodiments, each cationic domain comprises an isoelectric point (pi) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, or at least 12.0. In some embodiments, each cationic domain comprises an isoelectric point (pi) of at least 10.0. In some embodiments, each cationic domain comprises an isoelectric point (pi) of between 10.0 and 13.0 In some embodiments, each cationic domain comprises an isoelectric point (pi) of between 10.4 and 12.5. In some embodiments, the isoelectric point of a cationic domain is calculated at physiological pH by any suitable means available in the art, such as by using the I PC (isoelectric.org) a web-based algorithm developed by Lukasz Kozlowski, Biol Direct.2016; 11 :55; the entire contents of which are incorporated herein by reference. In some embodiments, each cationic domain comprises at least 1 cationic amino acid, e.g., 1-5 cationic amino acids. In some embodiments, each cationic domain comprises at least 2 cationic amino acids, e.g., 2-5 cationic amino acids. In some embodiments, each cationic domain is arginine rich and / or histidine rich and / or lysine rich. In some embodiments, a cationic domain may contain both histidine and arginine. In some embodiments, each cationic domain comprises a majority of arginine and / or histidine and / or lysine residues. In some embodiments, each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, or at least 70% arginine and / or histidine residues. In some embodiments, a cationic domain may comprise at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, or at least 70% arginine residues. In some embodiments, a cationic domain may comprise at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, or at least 70% histidine residues. In some embodiments, a cationic domain may comprise a total of between 1-5 histidine and 1-5 arginine residues. In some embodiments, a cationic domain may comprise between 1-5 arginine residues. In some embodiments, a cationic domain may comprise between 1-5 histidine residues. In some embodiments, a cationic domain may comprise a total of between 2-5 histidine and 3-5 arginine residues. In some embodiments, a cationic domain may comprise between 3-5 arginine residues. In some embodiments, a cationic domain may comprise between 2-5 histidine residues. 53 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, each cationic domain comprises one or more beta-alanine residues. In some embodiments, each cationic domain may comprise a total of between 2-5 beta-alanine residues, e.g., a total of 2 or 3 beta-alanine residues. In some embodiments, a cationic domain may comprise one or more hydroxyproline residues or serine residues. In some embodiments, a cationic domain may comprise between 1-2 hydroxyproline residues. In some embodiments, a cationic domain may comprise between 1-2 serine residues. In some embodiments, all of the cationic amino acids in a given cationic domain may be histidine, alternatively, e.g., all of the cationic amino acids in a given cationic domain may be arginine. In some embodiments, all of the cationic amino acids in a given cationic domain may be lysine. In some embodiments, the cell penetrating peptide may comprise at least one histidine rich cationic domain. In some embodiments, the cell penetrating peptide may comprise at least one arginine rich cationic domain. In some embodiments, the cell penetrating peptide may comprise at least one arginine rich cationic domain and at least one histidine rich cationic domain. In some embodiments, the cell penetrating peptide comprises two arginine rich cationic domains. In some embodiments, the cell penetrating peptide comprises two histidine rich cationic domains. In some embodiments, the cell penetrating peptide comprises two arginine and histidine rich cationic domains. In some embodiments, the cell penetrating peptide comprises one arginine rich cationic domain and one histidine rich cationic domain. In some embodiments, each cationic domain comprises no more than 3 contiguous arginine residues, e.g., no more than 2 contiguous arginine residues. In some embodiments, each cationic domain comprises no contiguous histidine residues. In some embodiments, each cationic domain comprises arginine, histidine and / or beta-alanine residues. In some embodiments, each cationic domain comprises a majority of arginine, histidine and / or beta-alanine residues. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the amino acid residues in each cationic domain are arginine, histidine and / or beta-alanine residues. In some embodiments, each cationic domain comprises or consists of arginine, histidine and / or beta- alanine residues. 54 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the cell penetrating peptide comprises a first cationic domain comprising arginine and beta-alanine residues and a second cationic domain comprising arginine and beta-alanine residues. In some embodiments, the cell penetrating peptide comprises a first cationic domain comprising arginine and beta-alanine resides, and a second cationic domain comprising histidine, beta-alanine, and optionally arginine residues. In some embodiments, the cell penetrating peptide comprises a first cationic domain comprising arginine and beta-alanine resides, and a second cationic domain comprising histidine and beta-alanine residues. In some embodiments, the cell penetrating peptide comprises a first cationic domain consisting of arginine and beta-alanine residues and a second cationic domain consisting of arginine and beta-alanine residues. In some embodiments, the cell penetrating peptide comprises a first cationic domain consisting of arginine and beta-alanine residues and a second cationic domain consisting of arginine, histidine and beta- alanine residues. In some embodiments, the cell penetrating peptide comprises at least two cationic domains, e.g., these cationic domains form the arms of the cell penetrating peptide. In some embodiments, the cationic domains are located at the N and C terminus of the cell penetrating peptide. In some embodiments, therefore, the cationic domains may be known as the cationic arm domains. In some embodiments, the cell penetrating peptide comprises two cationic domains, wherein one is located at the N-terminus of the cell penetrating peptide and one is located at the C-terminus of the cell penetrating peptide. In some embodiments, at either end of the cell penetrating peptide. In some embodiments, no further amino acids or domains are present at the N- terminus and C-terminus of the cell penetrating peptide, with the exception of other groups such as a terminal modification, linker and / or oligonucleotide. For the avoidance of doubt, such other groups may be present in addition to ‘the cell penetrating peptide’ described and claimed herein. In some embodiments, therefore each cationic domain forms the terminus of the cell penetrating peptide. In some embodiments, this does not preclude the presence of a further linker group as described herein. In some embodiments, the cell penetrating peptide may comprise up to 4 cationic domains. In some embodiments, the cell penetrating peptide comprises two cationic domains. In some embodiments, the cell penetrating peptide comprises two cationic domains that are both arginine rich. In some embodiments, the cell penetrating peptide comprises one cationic domain that is arginine rich. In some embodiments, the cell penetrating peptide comprises two cationic domains that are both arginine and histidine rich. 55 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the cell penetrating peptide comprises one cationic domain that is arginine rich and one cationic domain that is histidine rich. In some embodiments, the cationic domains comprise amino acid units selected from the following: R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof. In some embodiments, a cationic domain may also include serine, proline and / or hydroxyproline residues. In some embodiments, the cationic domains may further comprise amino acid units selected from the following: RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS, or any combination thereof, or any combination with the above listed amino acid units. In some embodiments, each cationic domain comprises any one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), or any combination thereof. In some embodiments, each cationic domain comprises or consists of any one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO: 19), or any combination thereof. In some embodiments, each cationic domain comprises or consists of one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), or HBHBR (SEQ ID NO: 9). In some embodiments, each cationic domain in the cell penetrating peptide may be identical or different. In some embodiments, each cationic domain in the cell penetrating peptide is different. Hydrophobic Domain The present invention relates to short cell penetrating peptides having a particular structure in which there is at least one hydrophobic domain having a certain length. 56 ME148775155v.1 Attorney Docket No.: 140101-00120 References to ‘hydrophobic’ herein denote an amino acid or domain of amino acids having the ability to repel water or which do not mix with water. In some embodiments, the cell penetrating peptide comprises up to 3 hydrophobic domains or up to 2 hydrophobic domains. In some embodiments, the cell penetrating peptide comprises 1 hydrophobic domain. As defined above, the cell penetrating peptide comprises one or more hydrophobic domains each having a length of at least 3 amino acid residues. In some embodiments, each hydrophobic domain has a length of between 3-6 amino acids. In some embodiments, each hydrophobic domain has a length of 5 amino acids. In some embodiments, each hydrophobic domain may comprise nonpolar, polar, and hydrophobic amino acid residues. Hydrophobic amino acid residues may be selected from: alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine, and tryptophan. Non-polar amino acid residues may be selected from: proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, and methionine. Polar amino acid residues may be selected from: serine, asparagine, hydroxyproline, histidine, lysine, arginine, threonine, tyrosine, and glutamine. In some embodiments, the hydrophobic domains do not comprise hydrophilic amino acid residues. In some embodiments, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. In some embodiments, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acids. In some embodiments, each hydrophobic domain consists of hydrophobic amino acid residues. In some embodiments, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1 , at least 1.2, or at least 1.3. In some embodiments, each hydrophobic domain comprises a hydrophobicity of at least 0.3, at least 0.35, at least 0.4, or at least 0.45. In some embodiments, each hydrophobic domain comprises a hydrophobicity of at least 1.2, at least 1.25, at least 1.3, or at least 1.35. In some embodiments, each hydrophobic domain comprises a hydrophobicity of between 0.4 and 1.4 In some embodiments, each hydrophobic domain comprises of a hydrophobicity of between 0.45 and 0.48. In some embodiments, each hydrophobic domain comprises a hydrophobicity of between 1.27 and 1.39 57 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, hydrophobicity is as measured by White and Wimley: W.C. Wimley and S.H. White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842 (1996); the entire contents of which are incorporated herein by reference. In some embodiments, each hydrophobic domain comprises at least 3 or at least 4 hydrophobic amino acid residues. In some embodiments, each hydrophobic domain comprises phenylalanine, leucine, Isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues. In some embodiments, each hydrophobic domain comprises or consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues. In some embodiments, each hydrophobic domain comprises or consists of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine residues. In some embodiments, each hydrophobic domain comprises or consists of tryptophan and / or proline residues. In some embodiments, the cell penetrating peptide comprises one hydrophobic domain. In some embodiments, the or each hydrophobic domain is located in the center of the cell penetrating peptide. In some embodiments, therefore, the hydrophobic domain may be known as a core hydrophobic domain. In some embodiments, the or each hydrophobic core domain is flanked on either side by an arm domain. In some embodiments, the arm domains may comprise one or more cationic domains and one or more further hydrophobic domains. In some embodiments, each arm domain comprises a cationic domain. In some embodiments, the cell penetrating peptide comprises two arm domains flanking a hydrophobic core domain, wherein each arm domain comprises a cationic domain. In some embodiments, the cell penetrating peptide comprises or consists of two cationic arm domains flanking a hydrophobic core domain. In some embodiments, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), or any combination thereof. In some embodiments, the or each hydrophobic domain comprises or consists of one of the following sequences: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), or any combination thereof. In some embodiments, the or each hydrophobic domain comprises or consists of one of the following sequences FQILY (SEQ ID NO: 21), YQFLI (SEQ ID NO: 20), or ILFQY (SEQ ID NO: 22). In some embodiments, the or each hydrophobic domain comprises or consists of FQILY (SEQ ID NO: 21). 58 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, each hydrophobic domain in the cell penetrating peptide may have the same sequence or a different sequence. The present invention relates to short cell penetrating peptides for use in transporting therapeutic molecules in the treatment of medical conditions. The cell penetrating peptide has a sequence that is a contiguous single molecule, therefore the domains of the cell penetrating peptide are contiguous. In some embodiments, the cell penetrating peptide comprises several domains in a linear arrangement between the N-terminus and the C-terminus. In some embodiments, the domains are selected from cationic domains and hydrophobic domains described above. In some embodiments, the cell penetrating peptide comprises or consists of cationic domains and hydrophobic domains wherein the domains are as defined above. Each domain has common sequence characteristics as described in the relevant sections above, but the exact sequence of each domain is capable of variation and modification. Thus, a range of sequences is possible for each domain. The combination of each possible domain sequence yields a range of peptide structures, each of which form part of the present invention. Features of the cell penetrating peptide structures are described below. In some embodiments, a hydrophobic domain separates any two cationic domains. In some embodiments, each hydrophobic domain is flanked by cationic domains on either side thereof. In some embodiments, no cationic domain is contiguous with another cationic domain. In some embodiments, the cell penetrating peptide comprises one hydrophobic domain flanked by two cationic domains in the following arrangement: [cationic domain] - [hydrophobic domain] - [cationic domain] In some embodiments, the hydrophobic domain may be known as the core domain and each of the cationic domains may be known as an arm domain. In some embodiments, the hydrophobic arm domains flank the cationic core domain on either side thereof. In some embodiments, the cell penetrating peptide comprises or consists of two cationic domains and one hydrophobic domain. In some embodiments, the cell penetrating peptide comprises or consists of one hydrophobic core domain flanked by two cationic arm domains. In some embodiments, the cell penetrating peptide comprises or consists of one hydrophobic core domain comprising a sequence selected from: YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), and WWPW (SEQ ID NO: 26), flanked by two cationic arm domains each comprising a sequence selected from: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 59 ME148775155v.1 Attorney Docket No.: 140101-00120 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), and R[Hyp]RR[Hyp]R (SEQ ID NO: 19). In some embodiments, the cell penetrating peptide comprises or consists of one hydrophobic core domain comprising a sequence selected from: FQILY (SEQ ID NO: 21), YQFLI (SEQ ID NO: 20), and ILFQY (SEQ ID NO: 22), flanked by two cationic arm domains comprising a sequence selected from: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), and HBHBR (SEQ ID NO: 9). In some embodiments, the cell penetrating peptide comprises or consists of one hydrophobic core domain comprising the sequence: FQILY (SEQ ID NO: 21), flanked by two cationic arm domains comprising a sequence selected from: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), and RBHBH (SEQ ID NO: 8). In any such embodiment, further groups may be present such as a linker, terminal modification and / or oligonucleotide. In some embodiments, the cell penetrating peptide is N-terminally modified. In some embodiments, the cell penetrating peptide is N-acetylated, N-methylated, N- trifluoroacetylated, N- trifluoromethylsulfonylated, or N-methylsulfonylated. In some embodiments, the cell penetrating peptide is N-acetylated. Optionally, the N-terminus of the cell penetrating peptide may be unmodified. In some embodiments, the cell penetrating peptide is N-acetylated. In some embodiments, the cell penetrating peptide is C-terminal modified. In some embodiments, the cell penetrating peptide comprises a C-terminal modification selected from: carboxy-, thioacid-, aminooxy-, hydrazino-, thioester-, azide, strained alkyne, strained alkene, aldehyde-, thiol or haloacetyl-group. Advantageously, the C-terminal modification provides a means for linkage of the cell penetrating peptide to the oligonucleotide. Accordingly, the C-terminal modification may comprise the linker and vice versa. In some embodiments, the C-terminal modification may consist of the linker or vice versa. Suitable linkers are described herein elsewhere. In some embodiments, the cell penetrating peptide comprises a C-terminal carboxyl group. In some embodiments, the C-terminal carboxyl group is provided by a glycine or beta-alanine residue. In some embodiments, the C terminal carboxyl group is provided by a beta-alanine residue. In some embodiments, the C terminal beta-alanine residue is a linker. 60 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, therefore each cationic domain may further comprise an N or C terminal modification. In some embodiments, the cationic domain at the C terminus comprises a C-terminal modification. In some embodiments, the cationic domain at the N terminus comprises a N-terminal modification. In some embodiments, the cationic domain at the C terminus comprises a linker group, In some embodiments, the cationic domain at the C terminus comprises a C-terminal beta-alanine. In some embodiments, the cationic domain at the N terminus is N-acetylated. The cell penetrating peptide of the present invention is defined as having a total length of 40 amino acid residues or less. The cell penetrating peptide may therefore be regarded as an oligopeptide. In some embodiments, the cell penetrating peptide has a total length of 3-30 amino acid residues, e.g., of 5-25 amino acid residues, of 10-25 amino acid residues, of 13-23 amino acid residues, or of 15-20 amino acid residues. In some embodiments, the cell penetrating peptide has a total length of at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 amino acid residues. In some embodiments, the cell penetrating peptide is capable of penetrating cells. The cell penetrating peptide may therefore be regarded as a cell penetrating peptide. In some embodiments, the cell penetrating peptide is for attachment to an oligonucleotide. In some embodiments, the cell penetrating peptide is for transporting an oligonucleotide into a target cell. In some embodiments, the cell penetrating peptide is for delivering an oligonucleotide into a target cell. The cell penetrating peptide may therefore be regarded as a cell penetrating peptide. In some embodiments, the cell penetrating peptide is capable of penetrating into cells and tissues, e.g., into the nucleus of cells. In some embodiments, into muscle tissues. In some embodiments, the cell penetrating peptide may comprise or consist of a cell penetrating peptide selected from any one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRFQILYRBRR (SEQ ID NO: 28) RBRRBRFQILYRRBRBR (SEQ ID NO: 29) RBRBRFQILYRBRRBRR (SEQ ID NO: 30) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRI LFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYRBRBR (SEQ ID NO: 33) RBRRBFQILYRBRRBR (SEQ ID NO: 34) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBFQILYRBRBR (SEQ ID NO: 36) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) 61 ME148775155v.1 Attorney Docket No.: 140101-00120 RBRRBRRFQILYHBRBH (SEQ ID NO: 39) RBRRBRRYQFLIRBHBH (SEQ ID NO: 40) RBRRBRRILFQYRBHBH (SEQ ID NO: 41) RBRHBHRFQILYRBRBR (SEQ ID NO: 42) RBRBBHRFQILYRBHBH (SEQ ID NO: 43) RBRRBRFQILYRBHBH (SEQ ID NO: 44) RBRRBRFQILYHBHBH (SEQ ID NO: 45) RBRRBHFQILYRBHBH (SEQ ID NO: 46) HBRRBRFQILYRBHBH (SEQ ID NO: 47) RBRRBFQILYRBHBH (SEQ ID NO: 48) RBRRBRFQILYBHBH (SEQ ID NO: 49) RBRRBRYQFLIHBHBH (SEQ ID NO: 50) RBRRBRILFQYHBHBH (SEQ ID NO: 51) RBRRBRRFQILYHBHBH (SEQ ID NO: 52) In some embodiments, the cell penetrating peptide may comprise or consist of a cell penetrating peptide selected from any one of the following additional sequences: RBRRBRFQILYBRBS (SEQ ID NO: 53) RBRRBRFQILYBRB[Hyp] (SEQ ID NO: 54) RBRRBRFQILYBR[Hyp]R (SEQ ID NO: 55) RRBRRBRFQILYBRBR (SEQ ID NO: 56) BRRBRRFQILYBRBR (SEQ ID NO: 57) RBRRBRWWWBRBR (SEQ ID NO: 58) RBRRBRWWPWWBRBR (SEQ ID NO: 59) RBRRBRWPWWBRBR (SEQ ID NQ:60) RBRRBRWWPWBRBR (SEQ ID NO: 61) RBRRBRRWWWRBRBR (SEQ ID NO: 62) RBRRBRRWWPWWRBRBR (SEQ ID NO: 63) RBRRBRRWPWWRBRBR (SEQ ID NO: 64) RBRRBRRWWPWRBRBR (SEQ ID NO: 65) RBRRBRRFQILYBRBR (SEQ ID NO: 66) RBRRBRRFQILYRBR (SEQ ID NO: 67) BRBRBWWPWWRBRRBR (SEQ ID NO: 68) RBRRBRRFQILYBHBH (SEQ ID NO: 69) RBRRBRRFQIYRBHBH (SEQ ID NO: 70) RBRRBRFQILYBRBH (SEQ ID NO: 71) RBRRBRFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 72) R[Hyp]RR[Hyp]RFQILYRBHBH (SEQ ID NO: 73) R[Hyp]RR[Hyp]RFQILYR[Hyp]H[Hyp]H (SEQ ID NO: 74) 62 ME148775155v.1 Attorney Docket No.: 140101-00120 RBRRBRWWWRBHBH (SEQ ID NO: 75) RBRRBRWWPRBHBH (SEQ ID NO: 76) RBRRBRPWWRBHBH (SEQ ID NO: 77) RBRRBRWWPWWRBHBH (SEQ ID NO: 78) RBRRBRWWPWRBHBH (SEQ ID NO: 79) RBRRBRWPWWRBHBH (SEQ ID NO: 80) RBRRBRRWWWRBHBH (SEQ ID NO: 81) RBRRBRRWWPWWRBHBH (SEQ ID NO: 82) RBRRBRRWPWWRBHBH (SEQ ID NO: 83) RBRRBRRWWPWRBHBH (SEQ ID NO: 84) RRBRRBRFQILYRBHBH (SEQ ID NO: 85) BRRBRRFQILYRBHBH (SEQ ID NO: 86) RRBRRBRFQILYBHBH (SEQ ID NO: 87) BRRBRRFQILYBHBH (SEQ ID NO: 88) RBRRBHRFQILYRBHBH (SEQ ID NO: 89) RBRRBRFQILY[Hyp]R[Hyp]R (SEQ ID NO: 90) R[Hyp]RR[Hyp]RFQILYBRBR (SEQ ID NO: 91) R[Hyp]RR[Hyp]RFQILY[Hyp]R[Hyp]R (SEQ ID NO: 92) RBRRBRWWWBRBR (SEQ ID NO: 93) RBRRBRWWPWWBRBR (SEQ ID NO: 94) In some embodiments, the cell penetrating peptide may comprise or consist of a cell penetrating peptide selected from one of the following sequences: RBRRBRRFQILYRBRBR (SEQ ID NO: 27) RBRRBRRYQFLIRBRBR (SEQ ID NO: 31) RBRRBRRI LFQYRBRBR (SEQ ID NO: 32) RBRRBRFQILYBRBR (SEQ ID NO: 35) RBRRBRRFQILYRBHBH (SEQ ID NO: 37) RBRRBRRFQILYHBHBR (SEQ ID NO: 38) RBRRBRFQILYRBHBH (SEQ ID NO: 44) In some embodiments, the cell penetrating peptide comprises or consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO: 35). In some embodiments, the cell penetrating peptide comprises or consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 37). In some embodiments, the cell penetrating peptide comprises or consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 44). Further peptide designs suitable for use in the conjugates, compositions, and methods of the invention are disclosed in, for example, U.S. Patent Nos.7,687,617 and 8,580,756; U.S. Patent Publication Nos.20060128646, 20090209748, 20140128586, 20140128591, 63 ME148775155v.1 Attorney Docket No.: 140101-00120 20100210712, and 20080015162A1; and International Publication No. WO 2013 / 159108, the entire contents of each of which are incorporated herein by reference. Further, cell penetrating peptides that may be used in the conjugates described herein also include those disclosed in International Application No. PCT / US2023 / 080778, and International Publication Nos. WO 2016 / 08784, WO 2018 / 150196, WO 2020 / 030927, WO 2020 / 030928, WO 2020 / 115494, and WO 2022 / 172019; the entire contents of each of which are incorporated herein by reference. Peptides of the invention may be produced by any standard protein synthesis method, for example chemical synthesis, semi-chemical synthesis or through the use of expression systems. Accordingly, the present invention also relates to the nucleotide sequences comprising or consisting of the DNA coding for the cell penetrating peptides, expression systems, e.g., vectors comprising said sequences accompanied by the necessary sequences for expression and control of expression, and host cells and host organisms transformed by said expression systems. Accordingly, a nucleic acid encoding a cell penetrating peptide according to the present invention is also provided. In some embodiments, the nucleic acids may be provided in isolated or purified form. An expression vector comprising a nucleic acid encoding a cell penetrating peptide according to the present invention is also provided. In some embodiments, the vector is a plasmid. In some embodiments, the vector comprises a regulatory sequence, e.g. promoter, operably linked to a nucleic acid encoding a cell penetrating peptide according to the present invention. In some embodiments, the expression vector is capable of expressing the cell penetrating peptide when transfected into a suitable cell, e.g., mammalian, bacterial, or fungal cell. A host cell comprising the expression vector of the invention is also provided. Expression vectors may be selected depending on the host cell into which the nucleic acids of the invention may be inserted. Such transformation of the host cell involves conventional techniques such as those taught in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA, 2001; the entire contents of which are incorporated herein by reference. Selection of suitable vectors is within the skills of the person knowledgeable in the field. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses. The cell penetrating peptides produced may be isolated and purified from the host cell by any suitable method, e.g., precipitation or chromatographic separation, e.g., affinity chromatography. Suitable vectors, hosts, and recombinant techniques are well known in the art. 64 ME148775155v.1 Attorney Docket No.: 140101-00120 IV. Linkers for Use in the Antisense Oligonucleotide Conjugates of the Invention In another aspect, the present invention provides an antisense oligonucleotide conjugate for inhibiting expression of PMP22, comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, wherein the antisense oligonucleotide is conjugated to the cell penetrating peptide via a linker. The conjugates of the present invention may include a linker covalently linking a cell penetrating peptide described herein to an oligonucleotide described herein. Suitable linkers include, for example, a C-terminal cysteine residue that permits formation of a disulfide, thioether or thiol-maleimide linkage, a C-terminal aldehyde to form an oxime, a click reaction or formation of a morpholino linkage with a basic amino acid on the cell penetrating peptide or a carboxylic acid moiety on the cell penetrating peptide covalently conjugated to an amino group to form a carboxamide linkage. In some embodiments, the linker is of formula (I): T1- (CR1R2)n-T2. (I) wherein T1is a divalent group for attachment to the cell penetrating peptide and is selected from the group consisting of - NH- and carbonyl; T2is a divalent group for attachment to an oligonucleotide and is selected from the group consisting of -NH- and carbonyl; n is 1 , 2 or 3; each R1is independently -Y1-X1-Z1, wherein Y1is absent or -(CRA1RA2)m-, wherein m is 1 , 2, 3 or 4, and RA1and RA2are each independently hydrogen, OH, or (1-2C)alkyl; X1is absent, -N(RA3)-C(O)O-, -C -SO2-, -S(O)2N(RA3)-, or -N(RA3)SO2-, wherein each RA3is independently selected from the group consisting of hydrogen and methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2- 6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1 -6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3- 6C)cycloalkenyl, and heteroaryl is optionally substituted with one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, 65 ME148775155v.1 Attorney Docket No.: 140101-00120 nitro, hydroxy, carboxy, NRA4RA5, and (1-4C)alkoxy, wherein RA4and RA5are each independently selected from the group consisting of hydrogen and (1-4C)alkyl; and each R2is independently -Y2-X2-Z2, wherein Y2is absent or a group of the formula -[CRB1RB2]m- in which m is an integer selected from 1 , 2, 3 or 4, and RB1and RB2are each independently selected from hydrogen, OH or (1 -2C)alkyl; X2is absent, -O-, -C(O)-, -O(O)O-, -OC(O)-, -CH(ORB3)-, -N(RB3)-, -N(RB3)- C(O)-, - N(RB3)-C(O)O-, -C(O)-N(RB3)-, -N(RB3)C(O)N(RB3)-, -N(RB3)C(NRB3)N(RB3)-, -SO-, -S- - SO2-, - S(O)2N(RB3)-, or -N(RB3)SO2-, wherein each RB3is independently selected from hydrogen or methyl; and Z2is selected from hydrogen, (1 -6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3- 6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl, wherein each (1 -6C)alkyl, (2- 6C)alkenyl, (2- 6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRB4RB5, and (1- 4C)alkoxy, wherein RB4and RB5are each independently hydrogen or (1-2C)alkyl; with the proviso that; when n=1 and T1and T2are different to one another, then R1and R2are not both H; when n=1 , T1 and T2 are different to one another and one of R1and R2is H then the other of R1and R2is not methyl; or when n=2 and each occurrence of R1and R2is H, then T1 and T2 are both -C(O)- or are both -NH-. In some embodiments, T2 is -C(O)-. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent or -(CRA1RA2)m-, wherein m is 1, 2, 3 or 4, and RA1and RA2are each hydrogen or (1- 2C)alkyl; X1is absent, -O-, -C(O)-, -O(O)O-, -N(RA3)-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, -N(RA3)C(O)N(RA3)-, -N(RA3)C(N RA3)N(RA3)- or -S-, wherein each RA3is independently hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2- 6C)alkynyl, aryl, (3- 6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1- 6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRA4RA5, and (1-4C)alkoxy, wherein RMand RA5are each independently hydrogen or (1- 2C)alkyl. 66 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent or -(CRA1RA2)m-, wherein m is 1 , 2, 3, or 4, and RA1and R" are each independently hydrogen or (1-2C)alkyl; X1is absent, C(O)-, -C(O)-N(RA3)-, -N(RA3)C(O) wherein each RA3is independently hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, halo, and hydroxy. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent or a group of the formula -(CRA1RA2)m-, wherein m is 1 , 2, 3 or 4, and RA1and RA2are each independently hydrogen or (1-2C)alkyl; X1is absent, -C(O)-, -C(O)O-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, wherein each RA3is hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1 - 6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3- 6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, halo, and hydroxy. In some embodiments, each R1is independently -Y1-X1-Z1, wherein: Y1is absent, -(CH2)-, or-(CH2CH2)-; X1is absent, -N(RA3)-C(O)-, -C(O)-N(RA3)-, wherein each RA3is independently hydrogen or methyl; and Z1is hydrogen or (1-2C)alkyl. In some embodiments, each R2is independently -Y2-Z2, wherein Y2is absent or - (CRB1RB2)m-, wherein m is 1 , 2, 3 or 4, and RB1and RB2are each independently hydrogen or (1-2C)alkyl; and Z2is hydrogen or (1-6C)alkyl. In some embodiments, each R2is hydrogen. In some embodiments, n is 2 or 3. In some embodiments, n is 1. In some embodiments, the linker is an amino acid residue selected from the group consisting of glutamic acid, succinic acid, and gamma-aminobutyric acid residues. In some embodiments, the linker is: 67 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the linker is: In some embodiments, the linker is: 68 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the linker is between 1-5 amino acids in length. In some embodiments, the linker may comprise any linker that is known in the art. In some embodiments, the linker is selected from any of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX and XB. In some embodiments, wherein X is 6- aminohexanoic acid. In some embodiments the linker is a Glu linker. In some embodiments, the linker may be a polymer, such as for example PEG. In some embodiments, the linker is beta-alanine. Additional linkers useful in the present invention can be found in WO 2020 / 115494, the entire contents of which are incorporated herein by reference. V. Antisense Oligonucleotide Conjugates of the Invention The conjugates of the present invention may comprise any therapeutic molecule that may be used for treatment of a disease, e.g., CMT disease. In some embodiments, the therapeutic molecule is conjugated to one or more cell penetrating peptides described herein. Such a therapeutic molecule may be selected from: a nucleic acid, an antisense oligonucleotide (such as a PNA, LNA or a PMO), a short interfering RNA, a micro RNA, an mRNA, a gRNA (for example in the use of CRISPR / Cas9 technology), an antagomiRNA, a peptide, a cyclic peptide, aprotein, a pharmaceutical, a drug, or a nanoparticle. In preferred embodiments, the therapeutic molecule is an antisense oligonucleotide. In one aspect the present invention provides an antisense oligonucleotide conjugate for inhibiting expression of PMP22, comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide. In some embodiments, the conjugate comprises a cell penetrating peptide selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), and RBRRBRFQILYRBHBH (SEQ ID NO: 44). In some embodiments, the cell penetrating peptide may further comprise one or more N-terminal modifications as described herein. In some embodiments, the cell penetrating peptide is conjugated to the antisense oligonucleotide at its N-terminus. In some embodiments, the cell penetrating peptide is conjugated to the antisense oligonucleotide at its C-terminus. In some embodiments, the cell penetrating peptide is conjugated to one or more internal nucleotides of the antisense oligonucleotide. 69 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the antisense oligonucleotide is conjugated to the cell penetrating peptide via a linker. In some embodiments, the antisense oligonucleotide is conjugated to the linker at its 3’ terminus. In some embodiments, the conjugate comprises a structure selected from the group consisting of: [cell penetrating peptide] — [oligonucleotide]; [oligonucleotide] — [cell penetrating peptide]; [cell penetrating peptide] — [linker] — [oligonucleotide]; and [oligonucleotide] — [linker] — [cell penetrating peptide]. In some embodiments, the conjugate is of the following structure: . In some embodiments, the conjugate is of the following structure: [cell penetrating peptide] — [linker] — [cell penetrating peptide] — [linker] — [oligonucleotide] In some embodiments, the conjugate is of the following structure: 70 ME148775155v.1 Attorney Docket No.: 140101-00120 In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: In some embodiments, the conjugate is of the following structure: In some embodiments, the cell penetrating peptide of the foregoing depicted conjugates is oriented from the N-terminus to the C-terminus such that the C-terminus is bonded to the linker. In certain of these embodiments, the cell penetrating peptide is acylated at the N-terminus. In some embodiments, the oligonucleotide of the foregoing depicted conjugates is oriented in the 5' to 3' direction such that the 3' end of the oligonucleotide is bonded to the linker. In certain of these embodiments, the oligonucleotide is a PMO as described with a modification or tail at the 5' end as described herein (e.g., hydroxyl, EG3 group or a standard Gene Tools group of the following structure). In some embodiments, the cell penetrating peptide is conjugated to the oligonucleotide through a carboxamide linkage. The linker of the conjugate may form part of the oligonucleotide to which the cell penetrating peptide is attached. Alternatively, the attachment of the oligonucleotide may be 71 ME148775155v.1 Attorney Docket No.: 140101-00120 directly linked to the C-terminus or side-chain of the cell penetrating peptide or amino acid linker. In some embodiments, no linker is required. Alternatively, the cell penetrating peptide may be chemically conjugated to the oligonucleotide. Chemical linkage may be via a disulfide, alkenyl, alkynyl, aryl, ether, thioether, triazole, amide, carboxamide, urea, thiourea, semicarbazide, carbazide, hydrazine, oxime, phosphate, phosphoramidate, thiophosphate, boranophosphate, iminophosphates, or thiol-maleimide linkage. In some embodiments, a cysteine residue may be added at the N-terminus of a cell penetrating peptide to allow for disulfide bond formation to the cell penetrating peptide, or the N-terminus may undergo bromoacetylation for thioether conjugation to the cell penetrating peptide. In some embodiments, the antisense oligonucleotide conjugate is capable of penetrating into cells and tissues, e.g., into the nucleus of cells, e.g., into muscle tissues. In some embodiments, the antisense oligonucleotide conjugate comprises one or more of the cell penetrating peptides described herein. In some embodiments, the antisense oligonucleotide conjugate comprises one or more of the antisense oligonucleotides described herein. In some embodiments, the oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO). In certain embodiments, the antisense oligonucleotide conjugate is of the general formula: [cell penetrating peptide (N-terminus # C-terminus)]-[amino acid linker (N-terminus terminus)]-[PMO (3'# 5')]-5'-group; or H3C-C(O)-[cell penetrating peptide (N-terminus # C-terminus)]-[amino acid linker (N-terminus # C-terminus)]-[PMO (3'# 5')]-5'- group; wherein the cell penetrating peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 27-94 and 471; wherein the amino acid linker is selected from the group consisting of glutamic acid, succinic acid, and gamma-aminobutyric acid; wherein the PMO either comprises a nucleotide sequence that is complementary to a PMP22 target region selected from the group consisting of SEQ ID NOs: 285-467 or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 102-284; and wherein the 5'-group is the standard Gene Tools PMO 5’-group of the following structure: 72 ME148775155v.1 Attorney Docket No.: 140101-00120 In certain preferred embodiments, the antisense oligonucleotide conjugate is of the general formula: H3C-C(O)-[cell penetrating peptide (N-terminus # C-terminus)]-[amino acid linker (N-terminus # C-terminus)]-[PMO (3'# 5')]-5'-group; wherein the cell penetrating peptide comprises the amino acid sequence SEQ ID NO: 35; wherein the amino acid linker is glutamic acid; wherein the PMO is bonded to the side- chain of the glutamic acid linker and consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 102-284; and wherein the 5'-group is the standard Gene Tools PMO 5’-group of the following structure: VI. Delivery of Antisense Oligonucleotide Conjugates of the Invention The delivery of an antisense oligonucleotide conjugate of the invention to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having a disease, e.g., CMT disease) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an antisense oligonucleotide conjugate of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an antisense oligonucleotide conjugate of the invention to a subject. The cell penetrating peptide component of the antisense oligonucleotide conjugates promotes uptake of antisense oligonucleotides, such as PMOs, by cells (e.g., Schwann cells), thereby delivering the antisense oligonucleotides to the interior (cytoplasm) of the cells. In some embodiments, the cell penetrating peptide, when conjugated to an antisense oligonucleotide having a substantially uncharged backbone, is effective to enhance the activity of the antisense oligonucleotide, relative to the antisense oligonucleotide in unconjugated form, as evidenced by a decrease in expression of an encoded protein, relative to that provided by the unconjugated oligonucleotide, when binding of the antisense oligonucleotide to its target sequence is effective to block a translation start codon for the encoded protein. In some embodiments, conjugation of the cell penetrating peptide provides this activity in a cell-free translation assay. In some embodiments, activity is enhanced by a 73 ME148775155v.1 Attorney Docket No.: 140101-00120 factor of at least two, a factor of at least five or a factor of at least ten. Alternatively or in addition, the cell penetrating peptide is effective to enhance the transport of a nucleic acid analog into a cell, relative to the analog in unconjugated form. In some embodiments, transport is enhanced by a factor of at least two, a factor of at least two, a factor of at least five or a factor of at least ten. In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with an antisense oligonucleotide conjugate of the invention. For in vivo delivery, factors to consider in order to deliver an antisense oligonucleotide conjugate include, for example, biological stability of the delivered molecule, prevention of non- specific effects, and accumulation of the delivered molecule in the target tissue. The non- specific effects of an antisense oligonucleotide conjugate can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation. Local administration to a treatment site maximizes local concentration of the conjugate, limits the exposure of the conjugate to systemic tissues that can otherwise be harmed by the conjugate or that can degrade the conjugate, and permits a lower total dose of the antisense oligonucleotide conjugate to be administered. In one aspect, the present invention provides methods comprising contacting a cell (e.g., a Schwann cell) with one or more antisense oligonucleotide conjugates described herein, and / or the pharmaceutical compositions described herein, thereby inhibiting PMP22 expression in the cell. The phrase “contacting a cell with an antisense oligonucleotide conjugate,” as used herein, includes contacting a cell by any possible means. Contacting a cell with an antisense oligonucleotide conjugate includes contacting a cell in vitro with the antisense oligonucleotide conjugate or contacting a cell in vivo with the antisense oligonucleotide conjugate. The contacting may be done directly or indirectly. Thus, for example, the antisense oligonucleotide conjugate may be put into physical contact with the cell by the individual performing the method, or alternatively, the antisense oligonucleotide conjugate may be put into a situation that will permit or cause it to subsequently come into contact with the cell. Contacting a cell in vitro may be done, for example, by incubating the cell with the antisense oligonucleotide conjugate. Contacting a cell in vivo may be done, for example, by injecting the antisense oligonucleotide conjugate into or near the tissue where the cell is located, or by injecting the antisense oligonucleotide conjugate into another area, e.g., the bloodstream or the subcutaneous space, such that the conjugate will subsequently reach the tissue where the cell to be contacted is located. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell may also be contacted in vitro with an antisense oligonucleotide conjugate and subsequently transplanted into a subject. 74 ME148775155v.1 Attorney Docket No.: 140101-00120 In one embodiment, contacting a cell with an antisense oligonucleotide conjugate includes “introducing” or “delivering the antisense oligonucleotide conjugate into the cell” by facilitating or effecting uptake or absorption into the cell. Absorption or uptake of an antisense oligonucleotide conjugate can occur through unaided diffusive or active cellular processes, or by auxiliary conjugates or devices. Introducing an antisense oligonucleotide conjugate into a cell may be in vitro and / or in vivo. In vitro introduction into a cell includes methods known in the art such as electroporation. Further approaches are described herein below and / or are known in the art. In order to ensure in vivo delivery of the conjugate to the target tissue (e.g., peripheral nervous system) and / or cell (e.g., Schwann cell), the conjugate can be administered to a subject via an intramedullary route, an intrathecal route, an intracerebroventricular route, an intraventricular route, an intravitreal route, an enteral route, a parenteral route, an intravenous route, an intra-arterial route, an intramuscular route, an intratumoral route, a subcutaneous route, an oral route, or a nasal route. Further, for administering an antisense oligonucleotide conjugate systemically for the treatment of a disease, the conjugate can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the antisense oligonucleotide conjugate in vivo. Modification of the conjugate or a pharmaceutical carrier can also permit targeting of the antisense oligonucleotide conjugate composition to the target tissue and avoid undesirable off-target effects. VII. Pharmaceutical Compositions of the Invention The present invention also provides pharmaceutical compositions and formulations which include one or more antisense oligonucleotide conjugates described herein. In one embodiment, provided herein are pharmaceutical compositions containing an antisense oligonucleotide conjugate, as described herein, and a pharmaceutically acceptable carrier. The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples 75 ME148775155v.1 Attorney Docket No.: 140101-00120 of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating conjugates, such as magnesium state, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering conjugates, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and / or polyanhydrides; (22) bulking conjugates, such as polypeptides and amino acids (23) serum components, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. The pharmaceutical compositions containing the antisense oligonucleotide conjugates are useful for treating a disease or disorder associated with the expression or activity of a PMP22 gene, e.g. CMT disease, such as CMT1A disease. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via an intramedullary route, an intrathecal route, an intracerebroventricular route, an intraventricular route, an intravitreal route, an enteral route, a parenteral route, an intravenous route, an intra-arterial route, an intramuscular route, an intratumoral route, a subcutaneous route, an oral route, or a nasal route. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a PMP22 gene. In general, a suitable dose of an antisense oligonucleotide conjugate of the invention will be in the range of about 0.001 to about 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of about 1 to 50 mg per kilogram body weight per day. For example, subjects can be administered, e.g., via an intramedullary route, an intrathecal route, an intracerebroventricular route, an intraventricular route, an intravitreal route, an enteral route, a parenteral route, an intravenous route, an intra-arterial route, an intramuscular route, an intratumoral route, a subcutaneous route, an oral route, or a nasal route. A single and / or a repeat-dose regimen may include administration of a therapeutically effective amount of the antisense oligonucleotide conjugate at a frequency that is weekly, biweekly, monthly, quarterly, semi-annually, annually, or a combination thereof. In some embodiments, the administration is once every 1 week, every 2 weeks, every 3 weeks, every 4 weeks, every 8 weeks, every 12 weeks, every 24 weeks, every 36 weeks, or every 52 76 ME148775155v.1 Attorney Docket No.: 140101-00120 weeks. In some embodiments, the administration is once every 1 month, every 2 months, every 3 months, every 4 months, every 6 months, or every 12 months. The pharmaceutical composition can be administered over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21, 22, 23, 24, or about a 25 minute period. After an initial treatment regimen, the treatments can be administered on a less frequent basis. For example, after administration weekly or biweekly for three months, administration can be repeated once per month, for six months or a year or longer. The pharmaceutical composition can be administered once daily, or the antisense oligonucleotide conjugate can be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual antisense oligonucleotide conjugates encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein. The antisense oligonucleotide conjugate can be delivered in a manner to target a particular tissue, such as the nervous system (e.g., the peripheral nervous system). The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. In any event, the administering physician can adjust the amount and timing of antisense oligonucleotide conjugate administration on the basis of results observed using standard measures of efficacy known in the art or described herein. VIII. Methods for Inhibiting PMP22 Expression The present invention also provides methods of inhibiting expression of PMP22 in a cell (e.g., inhibit PMP22 transcript expression, and / or PMP22 protein expression). The methods include contacting a cell with an antisense oligonucleotide conjugate of the invention in an amount effective to inhibit expression of the PMP22 in the cell, thereby inhibiting expression of PMP22 (e.g., inhibit PMP22 transcript expression, and / or PMP22 protein expression) in the cell. A cell suitable for treatment using the methods of the invention may be any cell that expresses a PMP22 gene. In some embodiments, the cell is selected from the group consisting 77 ME148775155v.1 Attorney Docket No.: 140101-00120 of a Schwann cell, a peripheral nerve axon, an endothelial cell, a muscle cell, a myocyte, a myoblast, a myocardial cell, a smooth muscle cell, a podocyte or any type of a kidney cell, a hepatocyte or any type of a liver cell, a neuronal cell, a microglial cell, any cell type of the central nervous system and peripheral nervous system, a stem cell, an embryonic stem cell, an induced pluripotent stem cell, and any combination thereof. In some embodiments, the cell is any cell type of the central nervous system and peripheral nervous system. In some embodiments, the cell is a cell of the central nervous system. In some embodiments, the cell is a cell of the peripheral nervous system. In some embodiments, the cell is a Schwann cell. Contacting of a cell with an antisense oligonucleotide conjugate may be performed in vitro or in vivo. Contacting a cell in vivo with the antisense oligonucleotide conjugate includes contacting a cell or group of cells within a subject, e.g., a human subject, with the antisense oligonucleotide conjugate. Combinations of in vitro and in vivo methods of contacting are also possible. Contacting may be direct or indirect, as discussed above. The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating” and other similar terms, and includes any level of inhibition. The phrase “inhibiting expression of PMP22” is intended to refer to inhibition of expression of any PMP22 gene (such as, e.g., a mouse PMP22 gene, a rat PMP22 gene, a monkey PMP22 gene, or a human PMP22 gene) as well as variants or mutants of a PMP22 gene. Thus, the PMP22 gene may be a wild-type PMP22 gene, a mutant PMP22 gene, or a transgenic PMP22 gene in the context of a genetically manipulated cell, group of cells, or organism. In some embodiments, the “inhibiting expression of PMP22” refers to inhibiting PMP22 transcript (e.g., pre-mRNA, processed or mature mRNA, or a combination thereof) expression, and / or PMP22 protein expression. In some embodiments, the “inhibiting expression of PMP22” refers to inhibiting PMP22 transcript expression. In some embodiments, the “inhibiting expression of PMP22” refers to inhibiting PMP22 protein expression. “Inhibiting expression of a PMP22 gene” includes any level of inhibition of a PMP22 gene, e.g., at least partial suppression of the expression of a PMP22 gene. The expression of the PMP22 gene may be assessed based on the level, or the change in the level, of any variable associated with PMP22 gene expression, e.g., PMP22 mRNA level, or PMP22 protein level. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject. Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with PMP22 expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose 78 ME148775155v.1 Attorney Docket No.: 140101-00120 baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive conjugate control). In some embodiments, the expression of a PMP22 gene is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%. at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100%. A control cell or group of cells that may be used to assess the inhibition of the expression of a PMP22 gene includes a cell or group of cells that has not yet been contacted with an antisense oligonucleotide conjugate of the invention. For example, the control cell or group of cells may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an antisense oligonucleotide conjugate described herein. The level of PMP22 mRNA that is expressed by a cell or group of cells may be determined using any method known in the art. In one embodiment, the level of expression of PMP22 in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the PMP22 gene. RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol / guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA preparation kits (Qiagen) or PAXgene (PreAnalytix, Switzerland) or cells to cT kit (Thermofisher). Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, Northern blotting, in situ hybridization, and microarray analysis. In one embodiment, the level of expression of PMP22 is determined using a nucleic acid probe. The term "probe", as used herein, refers to any molecule that is capable of selectively binding to a specific PMP22. Probes can be synthesized by one of skill in the art, or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules. Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction (PCR) analyses and probe arrays. One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to PMP22 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for 79 ME148775155v.1 Attorney Docket No.: 140101-00120 example, in an Affymetrix gene chip array. A skilled artisan can readily adapt known mRNA detection methods for use in determining the level of PMP22 mRNA. An alternative method for determining the level of expression of PMP22 in a sample involves the process of nucleic acid amplification and / or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Pat. No. 4,683,202; the entire contents of each of which are hereby incorporated herein by reference), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193; the entire contents of each of which are hereby incorporated herein by reference), self-sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878; the entire contents of each of which are hereby incorporated herein by reference), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177; the entire contents of each of which are hereby incorporated herein by reference), Q-Beta Replicase (Lizardi et al. (1988) Bio / Technology 6:1197; the entire contents of each of which are hereby incorporated herein by reference), rolling circle replication (Lizardi et al., U.S. Pat. No.5,854,033; the entire contents of each of which are hereby incorporated herein by reference) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers. In particular aspects of the invention, the level of expression of PMP22 is determined by quantitative fluorogenic RT- PCR (i.e., the TaqManTMSystem). The level of PMP22 protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, fluid or gel precipitin reactions, absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like. In some embodiments, the antisense oligonucleotide conjugate is administered to a subject such that the antisense oligonucleotide conjugate is delivered to a specific site within the subject. The inhibition of expression of PMP22 may be assessed using measurements of the level or change in the level of PMP22 mRNA or PMP22 protein in a sample derived from fluid or tissue from the specific site within the subject. In some embodiments, the site is the peripheral nervous system. The site may also be a subsection or subgroup of cells from any one of the aforementioned sites. The site may also include cells, such as Schwann cells. 80 ME148775155v.1 Attorney Docket No.: 140101-00120 IX. Methods of Treatment The present invention also provides effective methods and combination therapies for treating a subject having Charcot-Marie-Tooth (CMT) disease using the antisense oligonucleotide conjugates and compositions of the invention. The specific design of the antisense oligonucleotide conjugates of the present invention allows effective delivery of the conjugates to a target cell, e.g., a Schwann cell. The methods of the present invention are both simple and efficient, and provide a great advantage when used in treating CMT disease, e.g., CMT1A disease, a demyelinating neuropathy caused by PMP22 overexpression in Schwann cells. In some aspects of the invention, the methods further include administering to the subject an additional therapeutic, such as nonsteroidal anti-inflammatory drugs, cyclooxygenase-2 inhibitors, tricyclic antidepressants, anticonvulsants, analgesics, vitamins, concomitant surgery, occupational therapy, physical therapy, exercise program, or any combination thereof. In one aspect, the present invention provides methods of treating Charcot-Marie- Tooth (CMT) disease in a subject in need thereof, by administering to the subject a therapeutically effective amount of the antisense oligonucleotide conjugate or the pharmaceutical composition of the invention, thereby treating the CMT disease in the subject. In some embodiments, the CMT disease is selected from the group consisting of CMT disease type 1 (CMT1), CMT disease type 2 (CMT2), CMT disease type 3 (CMT3), CMT disease type 4 (CMT4), CMT disease type 5 (CMT5), CMT disease type 6 (CMT6), CMT disease type 7 (CMT7), and CMT disease type X (CMTX). In some embodiments, the CMT disease is CMT disease type 1A (CMT1A). In some embodiments, the CMT disease is CMT disease type 1E (CMT1E). The term "therapeutically effective amount," as used herein, is intended to include the amount of an antisense oligonucleotide conjugate, that, when administered to a subject having a disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on the antisense oligonucleotide conjugate, how the conjugate is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated. A "therapeutically effective amount" also includes an amount of an antisense oligonucleotide conjugate that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The antisense oligonucleotide conjugates employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment. 81 ME148775155v.1 Attorney Docket No.: 140101-00120 In another aspect, the present invention provides use of an antisense oligonucleotide conjugate of the invention targeting a PMP22 gene or a pharmaceutical composition comprising an antisense oligonucleotide conjugate targeting a PMP22 gene in the manufacture of a medicament for treating a subject, e.g., a subject a disease, e.g., CMT disease. In another aspect, the present invention provides uses of an antisense oligonucleotide conjugate of the invention targeting a PMP22 gene or a pharmaceutical composition comprising an antisense oligonucleotide conjugate targeting a PMP22 gene in the manufacture of a medicament, optionally for use in combination with an additional therapeutic, for treating a subject, e.g., a subject having a disease, e.g., CMT disease. In one embodiment, an antisense oligonucleotide conjugate targeting PMP22 is administered to a subject having a disease, such as CMT disease, such that PMP22 levels, e.g., in a cell (e.g., a Schwann cell), tissue or fluid of the subject are reduced by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% or more. In some embodiments, the methods further comprise administering an additional therapeutic, e.g., nonsteroidal anti-inflammatory drugs, cyclooxygenase-2 inhibitors, tricyclic antidepressants, anticonvulsants, analgesics, vitamins, concomitant surgery, occupational therapy, physical therapy, exercise program, or any combination thereof, to the subject. The additional therapeutic may be administered to the subject at the same time as the antisense oligonucleotide conjugate of the invention, or at a different time. Moreover, the additional therapeutic, may be administered to the subject in the same formulation as the antisense oligonucleotide conjugate or in a different formulation as the antisense oligonucleotide conjugate. The methods and uses of the invention include administering a composition described herein such that expression of the target PMP22 gene is decreased, such as for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72, 76, or about 80 hours. In one embodiment, expression of the target PMP22 gene is decreased for an extended duration, e.g., at least about two, three, four, five, six, seven days or more, e.g., about one week, two weeks, three weeks, or about four weeks or longer. Administration of the antisense oligonucleotide conjugate according to the methods and uses of the invention may result in a reduction of the severity, signs, symptoms, and / or markers of such diseases or disorders in a patient with a disease, e.g., CMT disease. By “reduction” in this context is meant a statistically significant decrease in such level. The 82 ME148775155v.1 Attorney Docket No.: 140101-00120 reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%. Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters. Subjects can be administered a therapeutic amount of antisense oligonucleotide conjugate, such as about 0.01 mg / kg to about 50 mg / kg. Values and ranges intermediate to the recited values are also intended to be part of this invention. The antisense oligonucleotide conjugate may be administered to the subject at a frequency that is weekly, biweekly, monthly, quarterly, semi-annually, annually, or a combination thereof. In some embodiments, the administration is once every 1 week, every 2 weeks, every 3 weeks, every 4 weeks, every 8 weeks, every 12 weeks, every 24 weeks, every 36 weeks, or every 52 weeks. In some embodiments, the administration is once every 1 month, every 2 months, every 3 months, every 4 months, every 6 months, or every 12 months. The mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated. The route and site of administration may be chosen to enhance targeting. X. Kits of the Invention In another aspect, the present invention provides a kit comprising one or more of the antisense oligonucleotide conjugates described herein, and / or the pharmaceutical compositions described herein, and instructions for use thereof. The instructions may include instructions for administering a fixed dose of the antisense oligonucleotide conjugate or the pharmaceutical composition of the invention. The antisense oligonucleotide conjugate may be in a vial or a pre-filled syringe. The kits may optionally further comprise means for administering the antisense oligonucleotide conjugate (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of PMP22 (e.g., means for measuring the inhibition of PMP22 mRNA, PMP22 protein, and / or PMP22 activity). Such means for measuring the inhibition of PMP22 may comprise a means for obtaining a sample from a subject. The kit may be packaged in a number of different configurations such as one or more containers in a single box. The different components can be combined, e.g., according to instructions provided with the kit. 83 ME148775155v.1 Attorney Docket No.: 140101-00120 The kits of the invention may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount. The present invention also provides syringes comprising one or more of the antisense oligonucleotide conjugates described herein, and / or the pharmaceutical compositions described herein. In some embodiments, the syringe is made of glass. In some embodiments the syringe is made of plastic. The present invention further provides vials comprising the antisense oligonucleotide conjugates described herein, and / or the pharmaceutical compositions described herein. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the antisense oligonucleotide conjugates and methods featured in the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. EXAMPLES Example 1. Synthesis of peptide-PMO conjugates 1.1 Synthesis of peptide variants via Microwave Synthesizer Peptides were synthesized on a 100 µmol scale using a CEM Liberty Blue™ microwave Peptide Synthesizer and Fmoc chemistry following manufacturer’s recommendations. Peptides synthesized with a glutamic acid linker were synthesized with a Rink amide resin to afford an amide on the carboxyl terminus of the peptide after TFA cleavage. A full list of the peptides synthesized with their methods and linkers are summarized in Table 1. The side chain protecting groups used were labile to TFA treatment and the peptide was synthesized using a 5-fold excess of Fmoc-protected amino acids (0.25 mmol) that were activated using PyBOP (5-fold excess) in the presence of DIPEA. Piperidine (20% v / v in DMF) was used to remove N-Fmoc protecting groups. The coupling was carried out once at 75 °C for 5 min at 60-watt microwave power except for arginine residues, which were coupled twice each. Each deprotection reaction was carried out at 75°C twice, once for 30 sec and then once for 3 min at 35-watt microwave power. Once the synthesis was complete, the resin was washed with DMF (3 x 50 mL) and the N-terminus of the solid phase bound peptide was acetylated with acetic anhydride in the presence of DIPEA at room 84 ME148775155v.1 Attorney Docket No.: 140101-00120 temperature for 15 min. After acetylation of the N-terminus, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). For DPEP peptides with succinic acid on the N-terminus, acetylation of the N-terminus was not performed. Instead, the free N-terminus of the peptide was treated with succinic anhydride in the presence of DIPEA at room temperature for 30 min followed by washing with DMF (3 x 20 mL). For DPEP peptides carrying glutamic acid on the N-terminus as a linker, the N-terminus was acetylated as described, but attachment of the PMO was performed on the side chain carboxylic group. For DPEP peptides carrying glutamic acid on the C-terminus as a linker, attachment of the PMO was performed on the side chain carboxylic group. Table 1. Synthesis method and resins used of the peptides with different linkers and the resulting C-terminal modification. 1.2 Cleavage from the solid support and purification of the peptide via Semi-Prep HPLC The peptide was cleaved from the solid support by treatment with a cleavage cocktail consisting of TFA / H2O / triisopropylsilane (TIPS) (95:2.5:2.5, 10 mL) for 3 h at room temperature. Excess TFA was removed by sparging with nitrogen. The cleaved peptide was precipitated via the addition of ice-cold diethyl ether and centrifuged at 3000 rpm for 5 min. The crude peptide pellet was washed thrice with cold diethyl ether (3 c 40 mL) and purified by RP-HPLC using a Varian 940-LC HPLC System fitted with a 445-LC Scale-up module and 440-LC fraction collector. Peptides were purified by semi-preparative HPLC on an RP- C18 column (10 x 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1 % TFA / H2O (0-99%, 0.1 % TFA in CH3CN) with a flow rate of 15 mL-min-1 over 15 min. Detection was performed at 220 nm and 260 nm. Table 2. Peptide sequences as synthesized. aLinkers are listed as their single amino acid abbreviations.bLinker attachment is with respect to the peptide, C-term= carboxyl terminus, N-term = amino terminus. The SEQ ID NO refers to the sequence of the peptide without any additional N and C terminal modifications or the linkers. 85 ME148775155v.1 Attorney Docket No.: 140101-00120 1.3 Synthesis of Peptide-PMO conjugates PMOs with PMP22 targeting nucleotide sequences based on the antisense sequences shown in Table 3 were purchased from Gene Tools LLC and were used to make the antisense oligonucleotide conjugates shown in Table 4. The 3’-end of the PMO was conjugated to the carboxyl side-chain of the glutamic acid linker as described in this example, which in turn was covalently bound to the C-terminal end of the peptide (SEQ ID NO: 35). This was achieved using 2.3 and 2-fold equivalents of PyBOP and HOAt in NMP respectively in the presence of 2.3 equivalents of DIPEA over peptide and a 2.5-fold excess of peptide over PMO dissolved in DMSO. In general, to a solution of peptide (10 µmol) in N- methylpyrrolidone (NMP, 100 µL) were added PyBOP (76.6 µL of 0.3 M in NMP), HOAt in (66.7 µL of 0.3 M NMP), DIPEA (4.0 µL) and PMO (4 µmol, 400 µL of 10 mM in DMSO). The mixture was left for 2 h at 40°C and the reaction was quenched by the addition of H2O (1 mL). The reaction was purified on a cation exchange chromatography column (Resource S 6 mL column, GE Healthcare) using a linear gradient of sodium chloride (0 to 1 M) in sodium phosphate buffer (25 mM, pH 7.0) containing 20% CH3CN at a flow rate of 6 mL-min-1. The removal of excess salts from the peptide-PMO (P-PMO) conjugate was afforded through the filtration of the fractions collected after ion exchange using an Amicon® ultra-153K centrifugal filter device. The conjugate was lyophilized and analyzed by MALDI-TOF. The conjugates were dissolved in sterile water and filtered through a 0.22 µm cellulose acetate membrane before use. The concentration of P-PMO was determined by the molar absorption of the conjugates at 265 nm in 0.1 M HCl solution. A detailed list of antisense oligonucleotides targeting PMP22 is depicted in Table 3. A list of antisense oligonucleotide conjugates targeting PMP22 is depicted in Table 4. The observed molecular weights of the antisense oligonucleotide conjugates as determined by LC-MS (MS+1) are listed in Table 5. Example 2. In vitro screening An in vitro screening of the antisense oligonucleotides targeting PMP22 was performed by transfecting different cell types with a single dose (at varying concentrations) of an antisense oligonucleotide, or an antisense oligonucleotide conjugate comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide using methods well known in the art. Briefly, in a first study, a luciferase screening assay was performed in Hepa1-6 cellsLJ<GKA@>L@? ODLC -S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K #:89K$ L<JB@LDGB :8:**% DG HJ?@J LHidentify hotspots of PMP22 targeting sites in the exon 1b transcript (FIGURE 1), and the exon 1a transcript (FIGURE 2). Briefly, Hepa1-6 cells were treated with a F-luc plasmid expressing the PMP22 transcript, and PMOs targeting PMP22 at 5 µM, for 24 hours, and the 86 ME148775155v.1 Attorney Docket No.: 140101-00120 percentage of F-luc / R-luc normalized activity was observed. Positive control of luciferase reduction was established with a siRNA targeting luciferase. The results demonstrate the identification of 3 different hotspots of PMP22 targeting sites. In a further study, real time PCR analysis was performed to demonstrate inhibition of:8:** @PIJ@KKDHG DG 2-,0 >@EEK #< EMGB ><G>@J >@EE EDG@$ LJ<GKA@>L@? ODLC -S8 #FIGURE 3)HJ *-S8 #FIGURE 4) of antisense oligonucleotides targeting PMP22 or a gapmer chemistryantisense oligonucleotide as control. Briefly, an in vitro endogenous screen was performed, wherein A549 cells were plated in a 96 well plate (2,0000 cells / well). Following overnight incubation, cells were treated with PMOs targeting PMP22 at 5 µM or 25 µM, with 0.9 µL per well EndoPorter reagent for 24 hours in technical triplicate. Cell were lysed using Cells- to-CT kit and mRNA expression was measured by qRT-PCR and normalized to GAPDH expression. Mean Relative Quantification (RQ) was observed as the average of technical quadruplicates (n=4). In a further study, a luciferase screening assay was performed in Hepa1-6 cellsLJ<GKA@>L@? ODLC -S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@K L<JB@LDGB :8:**% DG HJ?@J LH D?@GLDAQPMP22 targeting sites in the PMP22 transcript (FIGURE 5). Briefly, Hepa1-6 cells were treated with a F-luc plasmid expressing the PMP22 transcript, and PMOs targeting PMP22 at 5 µM, for 24 hours, and the percentage of F-luc / R-luc normalized activity was observed. Positive control of luciferase reduction was established with a siRNA targeting luciferase. 7G < AMJLC@J KLM?Q% < K>J@@GDGB O<K I@JAHJF@? DG 2-,0 >@EEK LJ<GKA@>L@? ODLC *-S8 HAantisense oligonucleotides targeting PMP22; and in CMT1A patient derived fibroblasts#58(-), / I<LD@GL EDG@% 3HJD@EE$ LJ<GKA@>L@? ODLC / '+S8 HA <GLDK@GK@ HEDBHGM>E@HLD?@Ktargeting PMP22 near or in junctions of exon 2-intron 2, intron 2-exon 3, exon 3-intron 3, intron 3-exon 4, and exon 4-intron 4 (FIGURE 6). Briefly, A549 cells or patient derived fibroblasts were plated in a 96 well plate (2,0000 cells / well). Following overnight incubation, cells were treated with PMOs targeting PMP22 for 24 hours in technical triplicate. Cell were lysed using Cells-to-CT kit and mRNA expression was measured by qRT-PCR and normalized to GAPDH expression. Mean Relative Quantification (RQ) was observed as the average of biological replicates (mean ± s.d., n = 2). Approximately 40-70% PMP22 transcript knockdown was observed in A549 cells and approximately 40-50% PMP22 transcript knockdown was observed in PMP22 duplicated patient derived fibroblasts. 7G < AMJLC@J KLM?Q% 2-,0 >@EEK O@J@ LJ<GKA@>L@? ODLC *-S8 HA <GLDK@GK@oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide for 24 hours (FIGURE 7). Briefly, A549 cells were plated in a 96 well plate (2,0000 cells / well). Following overnight incubation, cells were treated with PMOs targeting PMP22 or antisense oligonucleotide conjugates comprising a PMO targeting PMP22 conjugated to a cell penetrating peptide at 25 µM or a gapmer chemistry antisense oligonucleotide as control, for 24 hours in technical triplicate. Cell were 87 ME148775155v.1 Attorney Docket No.: 140101-00120 lysed using Cells-to-CT kit and mRNA expression was measured by qRT-PCR and normalized to GAPDH expression. Mean Relative Quantification (RQ) was observed as the average of technical triplicates (n=3). The results of this study demonstrate that antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide exhibit a significantly increased inhibition of PMP22 expression in A549 cells, relative to non-conjugated (naked) antisense oligonucleotides targeting PMP22. In a further study, a dose-response assay was performed in A549 cells transfected with varying concentrations of antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide or a gapmer chemistry antisense oligonucleotide as control (FIGURE 8). Briefly, A549 cells were plated in a 96 well plate (2,0000 cells / well). Following overnight incubation, cells were treated with the antisense oligonucleotide conjugates at 25 µM, 16 µM, or 8.3 µM for 24 hours in technical triplicate. Cell were lysed using Cells-to-CT kit and mRNA expression was measured by single-plex qRT-PCR and normalized to GAPDH expression. Mean Relative Quantification (RQ) was observed as the average of three biological replicates (mean ± s.d., n = 3). The results of this study demonstrate the efficacy of antisense oligonucleotide conjugates for inhibiting PMP22 expression. In a further study, sNF02.2 Schwann cells were transfected with antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide (FIGURE 9). Briefly, Schwann cells were plated in a 96 well plate (2,0000 cells / well). Following overnight incubation, cells were treated with antisense oligonucleotide conjugates at 25 µM or 8.3 µM for 24 hours in technical duplicate. Cell were lysed using Cells-to-CT kit and mRNA expression was measured by qRT-PCR and normalized to GAPDH expression. Mean Relative Quantification (RQ) was observed as the average of biological replicates (mean ± s.d., n = 2). Approximately 40-70% PMP22 transcript knockdown was observed in A549 cells and approximately 40-50% PMP22 transcript knockdown was observed in PMP22 duplicated patient derived fibroblasts. Approximately 50% of PMP22 transcript knockdown was observed in the sNF02.2 Schwann cells. These results demonstrate an effective inhibition of PMP22 expression in Schwann cells by the antisense oligonucleotide conjugates. In a further study, a dose-response assay was performed in human spinal nerve derived Schwann cells transfected with varying concentrations of antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide (FIGURE 10). Briefly, Schwann cells were plated in a 96 well plate (8000 cells / well). Following overnight incubation, cells were treated with antisense oligonucleotide conjugates at 50 µM, 25 µM, 16 µM, 8.3 µM, 2.7 µM, and 0.926 µM for 24 hours in technical triplicate. Cell were lysed using Cells-to-CT kit and mRNA expression was 88 ME148775155v.1 Attorney Docket No.: 140101-00120 measured by qRT-PCR and normalized to GAPDH expression. Mean Relative Quantification (RQ) was observed as the average of technical triplicate (n=3). A dose responsive reduction in PMP22 transcript levels were observed demonstrating the efficacy of antisense oligonucleotide conjugates for inhibiting PMP22 expression in human Schwann cells. Example 3. Dose response of knocking down PMP22 protein In a further study, a dose-response assay was performed in human spinal nerve derived Schwann cells transfected with varying concentrations of antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide (FIGURE 11). Briefly, Schwann cells were plated in a 96 well plate (8000 cells / well). Following overnight incubation, Schwann cells were treated with the indicated antisense oligonucleotide conjugates at 50 µM, 25 µM, 16 µM, 8.3 µM, 5 µM, 1 µM, and 0.5 µM or a comparator gapmer chemistry antisense oligonucleotide molecule at 16 µM at 0 h and 30 hours later (at 30 h) in technical duplicate. Cell were collected at 72 h and lysed using RIPA buffer. Protein expression was measured by JESS Simple Western Assay and normalized to beta-actin expression. Percentage (%) of protein remaining relative to mock control was observed as the average of technical duplicate (mean ± s.d., n = 2). Dose- dependent responses were observed with antisense oligonucleotide conjugates. These results demonstrate an effective inhibition of PMP22 protein expression in Schwann cells by the antisense oligonucleotide conjugates. In a further study, an assay was performed in sNF02.2 Schwann cells transfected with antisense oligonucleotide conjugates comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide (FIGURE 12). Briefly, sNF02.2 Schwann cells were plated in a 96 well plate (8000 cells / well). Following overnight incubation, sNF02.2 Schwann cells were treated with the indicated antisense oligonucleotide conjugates at 5 µM or a comparator gapmer chemistry antisense oligonucleotide molecule at 0 h and 30 hours later (at 30 h). Cell were collected at 72 h and lysed using RIPA buffer. Protein expression was measured by JESS Simple Western Assay and normalized to beta-actin expression. Percentage (%) of protein remaining relative to mock control was observed as the average of technical duplicate (mean ± s.d., n = 2). These results demonstrate an effective inhibition of PMP22 protein expression in sNF02.2 Schwann cells by the antisense oligonucleotide conjugates.Example 4. In vivo activityIn vivo activity was tested using a C3 transgenic mouse model (expressing multiple copies of human PMP22). C3 mice were selected as the animal model since the CMT pathology and deficits observed in this model are very similar to the human CMT1A pathophysiology. They also express the human PMP22 gene with all the regulatory regions 89 ME148775155v.1 Attorney Docket No.: 140101-00120 (Huxley C, et al., Construction of a mouse model of Charcot-Marie-Tooth disease type 1A by pronuclear injection of human YAC DNA. Human molecular genetics.1996;5(5):563-9; the entire contents of which are hereby incorporated herein by reference). C3 mice were bred and genotyped according to established protocols. Starting at 6-7 weeks, animals (n=8) were injected intravenous bolus with 45 mg / kg PPMO at day 1, 15, and 29. Saline (vehicle control) treated wildtype and C3 mice were included as a control. Animals were sacrificed 7 days after the last injection and frozen biceps tissue was processed for RNA extraction using Maxwell RSC simplyRNA Tissue Kit (Promega, AS1340). Tissue was homogenized by bead homogenization using Precellys evolution homogenizer. Total RNA (300 ng) was used as input for cDNA synthesis using SuperScript III First-Strand Synthesis Kit (Life Technologies, 18080-400) with oligo dT primers. Droplet digital PCR was performed using ddPCR Multiplex Supermix for probes (Bio- Rad, 12005909) and a custom TaqMan Gene Expression assay for human PMP22 (forward primer 5’- GAAAACCAAAGTGTGGGTAGAAACC - 3’ (SEQ ID NO: 468), reverse primer 5’- GGCTGTTTCTGTTGGATGCA - 3’ (SEQ ID NO: 469), and probe 5’- AAATGTCCAAAAGCCC - 3’ (SEQ ID NO: 470)). Gene expression was analyzed using QX Manager Software (Bio-Rad). Copies per microliter of human PMP22 were normalized to mouse GLDN endogenous control gene (Mm00616548_m1), before assessing changes between control and treatment, and percentage (%) of PMP22 transcript from biceps of PPMO-treated animal relative to saline-treated control was calculated. Decrease in PMP22 transcript levels was observed in biceps of PPMO-treated animals relative to saline-treated control (FIGURE 13). These results demonstrate an effective inhibition of PMP22 expression in vivo by antisense oligonucleotides targeting PMP22 conjugated to a cell penetrating peptide. 90 ME148775155v.1 02100-101041:.oNtekcoDyenrottA .22 P M P g nitegrat sen e A A C G G T C G C C C G G T C G C T C disC C t A G G T T C G C A T T T C G C A T G T oeG G G T G C T T T l G G T C A T G C G T c T G A T G C T T A T T G G G C unogil83 17 56 36 95 85 75 65 55 44 54 o 1 es_ 1_ 1_ 1_ 1_ 1_ 1_ 1_ 1_ 1_ 1 3 n 0 1 s 2 0 1 2 0 1 2 0 1 2 0 1 2 0 1 2 0 10 10 3 _ 0 30 e 2 2 2 2 2 itn A.3 86 9 el0 6 0 0 7 1 0 7 2 0 7 3 0 7 47 57 67 77 87 0 0 0 0 0 00 0 0 0 0 0 baDI0 0 0 0 0 0 0 00 00 00 00 001.-0-0-0-0-0-0-0-0-0-0- v5 T N N N N N N N N N N N 51 G G G G G G 5 P P P P P P G P G P G P G P G P 778 41E M 02100-10 31 4 10 1 11 41:.A o CNAteA GkcG o ADAyAeCnrC o CttG A A C G T C T T T G A G G 69 7 2 92 C C T C A A A G A C G T C G G G T G G G C T G C A A A C G A G T T T T G G G C T G G A A A G G A T A G A A A G G C T T G G G C T T G G G C C A G A C G G C C T T T G G G G C A G A A G T C C T T T G G T C G C A T C A T T C T T C T C T C T T G G A G T C C T T T G C T G G T A T G T T C C T T G G C T A T T 6 7 8 9 0 1 2 6 4 3 4 4 4 4 5 5 5 35 6 7 8 9 2 2 2 1 1 1 1 1 1 1 1 5 5 5 5 3 3 3 _ _ _ _ _ _ _ _ 1 1 1 1 5 5 5 3 3 3 3 3 3 3 3 _ _ _ _ 6 6 6 0 0 0 0 0 0 0 0 30 3 3 3 2 2 2 2 2 2 2 2 2 2 2 2 02 02 02 51 51 51 97 08 18 28 38 48 58 68 78 88 98 0 1 3 0 0 0 0 0 0 0 0 0 0 0 90 90 9 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 9 01.-0-0-0-0-0-0-0-00 0 0 -0-0-0-0- 0 0 0 v5 N N N N N N N N N N N N N 0 - 0- N 51 G G G G G G G 5 P P P P P P P G P G P G P G P G P G P N G 77 G P 8 P41E M 02100-10 82 9 10 1 21 41:.o TNGtTeCkcC C o TDCyeG TnrG ottG T A G G T C C C T T G T A G 11 2 3 13 C T A C A A G G G A C C A C C A C A C T G C A A G A A T G C A G G C T G C A G G T A G C C G G A T G G C T G C A G G A G A G G T A G C T G C C T G G A A G T G T A A G C T T G C G G G G C T G T G A A G C T G T A G G G C C G G A G G T T G G A A G C A G T G T G G A A G T A T A C A A A C T T T G G A A C T 22 1 0 7 0 8 7 4 3 2 1 0 9 0 9 3 23 2 0 0 8 8 8 8 8 8 8 7 7 6 5 5 3 3 3 2 2 2 2 2 2 2 2 2 2 6 6 56 5 5 5 5 5 5 5 5 5 5 5 5 2 2 2 62 6 6 6 6 6 6 6 6 6 6 6 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 49 59 69 79 89 99 00 1 2 3 4 5 6 7 8 0 0 0 0 0 0 1 01 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 34 4 10 1 41 41:.A o T CNtAeGkcA o CDAyGeCnrC o GttA A C G C C C A G A G A C T 62 7 3 23 A G T C T C T G G G C G T C G G C A C T T C T G C C T A A C C T T T G G G T T C T G C C T C C C C T G G G T T T G C T A T C C C T G C G G G T T T G C A A T C C C C T T C A T C T G T A G G G T C T C T T C A T G A G G G T G A G G C T C A C A G G A G G G A A T T T C T A A C T C G G G A G G G C G T T A A 86 8 3 2 1 0 9 8 7 5 2 9 8 7 6 2 32 3 3 3 3 2 2 2 2 2 1 1 1 1 5 5 2 2 2 2 2 2 2 2 2 2 2 2 2 6 6 56 5 5 5 5 5 5 5 5 5 5 5 5 2 2 2 62 6 6 6 6 6 6 6 6 6 6 6 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 90 01 11 21 31 41 51 6 7 8 9 0 1 2 3 1 1 1 1 1 1 1 11 1 1 1 2 2 2 2 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 85 9 10 1 51 41:.T o ANGteGkGcA o ADCyeG TnrA ottA A A C C G A C G T T T C T T 14 2 3 43 A A G A A A C G T C G G T T T A C A T T A G G G G C G A G G G A A G A T T A G G G A T A A G G T A T C T G T A G G C A G A G G T T G C A T A A G C G A T G A A G A G G C G A A A C T A C T G A A A A C C T A A C C G T C G A G A G A A T C T T T G C A T G G A G T C G T T A G A A A T T G A A T T C G T 41 10 49 0 9 3 2 1 9 8 7 6 3 2 1 2 2 1 91 8 8 8 8 7 7 8 8 8 8 8 5 5 5 5 1 1 1 1 1 1 5 5 5 5 5 6 6 6 6 56 5 5 5 5 5 2 2 2 2 2 2 2 2 2 2 6 6 6 6 6 6 6 6 6 6 5 5 5 5 5 25 2 2 2 2 2 2 2 2 2 1 1 1 1 1 1 51 51 51 51 51 51 51 51 51 42 52 62 72 82 92 03 13 2 3 4 5 6 7 8 1 1 1 1 1 1 1 1 31 3 3 3 3 3 3 0 0 0 0 0 0 0 0 0 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 37 4 10 1 71 41:.C o CNTteC GkcG o TDTyGeCnrG o TttG A G G C T C A A A C A C A 65 7 3 53 T G T G T T T G A G C C C A C G C A C C C G A G T A T C A C C C T G A G T G G A G A T G C A C C T C G A G T T G A C T C G C A C C C A G T T T G C G A C G C A C C C G A G T T T G C G C C G T T A A A C C G A T A C A C G C T G A A C C C G T G G C C A A C G C A C C C G T G T G G C C A A C G C A C C T T G 59 2 1 0 9 8 7 6 5 4 3 2 6 5 4 4 94 9 9 8 8 8 8 8 8 8 8 7 7 7 2 2 4 4 4 4 4 4 4 4 4 4 4 4 4 6 6 26 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 62 6 6 6 6 6 6 6 6 6 6 6 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 93 04 14 24 34 44 54 6 7 8 9 0 1 2 3 1 1 1 1 1 1 1 41 4 4 4 5 5 5 5 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 88 9 10 1 81 41:.A o CNAteAkAcC o TDCyCeGnrG o TttG A G G A C T C C T A G C C 17 2 3 73 G G C T A G G A G T C C C A C C G G G T A C A G G C C G A G A T G A G G A C A C G C G A G G C C T G A A G G A C G C A G T G G G G G A T C T C G G C T G T C T A C G G G C T C C C T C T A C T G T C C G G C C C C G A T A A C G T C T C G T C G C G A T A A C G A C C A C T C C T C A C G G A T G A A A C T C 37 3 2 0 5 4 3 2 8 7 6 5 4 3 2 4 64 6 6 5 5 5 5 5 5 5 5 5 5 5 2 2 4 4 4 4 4 4 7 7 7 7 7 7 7 6 6 26 2 2 2 2 2 0 0 0 0 0 0 0 2 2 2 62 6 6 6 6 6 6 6 6 6 6 6 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 45 55 65 75 85 95 06 1 2 3 4 5 6 7 8 1 1 1 1 1 1 1 61 6 6 6 6 6 6 6 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 30 4 10 2 02 41:.G o CNGteAkcC T o CDGyeT CnrT o TttG A A A C G G C G G T C T T 68 7 3 83 A A G A C C G C C G T T C A A G A T T G C C A A T C C T A C T G C T G C C A G C G C C A G A A G T G T A A C G C C G C C A G A C A T T G A A C G C C G C C A G A G T T G C C A A T A G A A C T G C C T C G C C C C C A G A A C T G C T C C G C C G G C A G A A C T G T G C C G A C A G C A G A A C T T G C C T 15 6 5 4 3 2 1 0 9 8 7 6 5 4 8 7 47 4 4 4 4 4 4 3 3 3 3 3 3 2 0 0 7 7 7 7 7 7 7 7 7 7 7 7 8 6 6 06 0 0 0 0 0 0 0 0 0 0 0 9 2 2 2 62 6 6 6 6 6 6 6 6 6 6 2 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 96 07 17 27 37 47 57 6 7 8 9 0 1 2 3 1 1 1 1 1 1 1 71 7 7 7 8 8 8 8 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 81 9 10 2 12 41:.T o GNGteTkTcG o ADCyeA CnrA ottC C A T G A T T C T A C G T A 10 2 4 04 T A C G T A G A A T C A G G T G T G T G G A C T A A G A A A T G T G T G A C T A A G A C A T G G T G A C T A A A C C T T G T G G G T G C A T A T A A G T G A A C T T A C T A A A A A C T G G G G T T G A C A T A C A A C T G G T G T G G A A A T C C A A C G T G T G T G G A A A A C C A A C T G T G T G T A A 72 6 5 4 3 2 1 0 9 8 7 6 2 0 9 8 28 2 2 2 2 2 2 1 1 1 1 0 0 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 7 2 2 92 9 9 9 9 9 9 9 9 9 9 9 9 2 2 2 22 2 2 2 2 2 2 2 2 2 2 2 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 48 58 68 78 88 98 09 1 2 3 4 5 6 7 8 1 1 1 1 1 1 1 91 9 9 9 9 9 9 9 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 33 4 10 2 32 41:.o T ANTteTkTcG o TDAyeG TnrC o TttC A A T T G A G T G A C C A 61 7 4 14 T G G T C A C T C A A T G A G A C A G A C G G C T T C A G T C C C G C A T A G C A A T C A T T C C C G C A C C A G C A T C C T T C C G A C T C G A C A T T C T T C G G T G T T A A A C A C T C C C C T C C G C C A A A C G C T C T C T C C T C T T A A C C A C A G T C T C T C C A T A A G C G C T C T G A T A 89 7 6 5 6 5 4 3 2 1 0 9 8 8 2 7 97 9 9 7 7 7 7 7 7 7 5 5 2 2 9 9 7 7 7 7 7 7 7 7 7 6 6 2 2 2 2 92 9 0 0 0 0 0 0 0 0 0 9 9 2 2 2 22 6 6 6 6 6 6 6 6 6 5 5 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 99 00 10 20 46 30 40 5 6 7 8 9 0 1 2 1 2 2 2 0 2 2 02 0 0 0 0 1 1 1 0 0 0 0 0 0 0 0 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 84 9 10 2 42 41:.T o CNCtTeAkcT o ADG AyeTnrA o GttA A C T A A G A G A G A T C 13 2 4 34 G A T C T C T C T T A G T C T A T A A T C G A A C G C T C T C A T T T T A G C A A C T C G C C T T C T C T A C A A A A T G T T A C T A T C T C T A C A A A T T C G T T C C T T C C C A A T T A T T C C T C T A C C G A T A C G A T T T C T A C A C G G C T T T G A T C T C C T C A A G T C A C T G A T T T A T C 81 7 2 1 9 7 6 5 4 3 2 6 4 3 2 2 12 1 1 0 0 0 0 0 0 0 0 0 0 0 9 9 2 2 2 2 2 2 2 2 2 1 1 1 1 5 5 95 9 9 9 9 9 9 9 9 9 9 9 9 2 2 2 52 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 72 3 4 5 2 1 1 1 61 7 8 9 0 1 2 3 4 5 6 0 2 2 2 2 12 1 1 2 2 2 2 2 2 2 0 00 0 0 0 00 0 2 2 2 2 2 2 2 2 200 0 0 0 0 0 0 0 0 0 0 -1.-0-0-00 0 0 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0-0-0- N v G 5 N N N N N N N N N N N N N N P 51 G G G 5 P P P G P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 36 4 10 2 62 41:.T o GNGteT TkcT o GDCyCeAnrC o TttC C A G A C C A A A A C A C 64 7 4 44 G T G T T T T G G T C G G A G T G T G A G G C T G G T G A G G C C T C A A T T G C C G G T G A G G C T T A T C T G A C G G T G A G C C T C T T T A A C G G T G A T C C C T C T T A C G G T C T C A A T G C T A T C A A A C G G T G C C T T A A T C A A C G G C C A G A C T A A A A C C A A A C G C A G C C A A 10 0 9 8 7 6 5 4 4 3 2 1 3 2 1 1 01 9 9 9 9 9 9 4 4 4 4 8 8 8 9 9 0 0 0 0 0 0 6 6 6 6 4 4 4 5 5 95 9 9 9 9 9 9 9 9 9 9 9 9 2 2 2 52 5 5 5 5 3 3 3 3 3 3 3 5 5 5 5 25 2 2 2 2 2 2 2 2 2 2 1 1 1 1 1 51 51 51 51 51 51 51 51 51 51 82 92 03 13 23 33 43 5 6 7 8 9 0 1 2 2 2 2 2 2 2 2 32 3 3 3 3 4 4 4 0 0 0 0 0 0 0 0 2 2 2 2 2 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 01.-0-0-0-0-0-00 0 0 0 0 0 0 0 -0-0-0-0-0-0-0-0- v5 N N N N N N N N N N N N N N N 51 G G G G G 5 P P P P P G P G P G P G P G P G P G P G P G P G P 778 41E M 02100-10 8 9 1 72 7 0 2 41:.T o ANAteGkAcA o CDGyeA CnrC ottA T A T C A A C A C A C T A C C C T C A C C T A C C C C T A A C T A C C A T A C C C A T C C T T A C A A T T C C T A T T T C C A T T T C A 16 26 36 46 5 6 7 4 4 4 4 64 64 64 G T A A A G T G G T A A A G T G G T A A A 3 A T G G T A A 0 G A T G G T A 1 G G A T G G T T G G A T G G G T G G A T G T A T T G T G G T G T G G A G T T G T G G A G T T T G A A G T G T G T T A A G T T G G T A A G T T G G T A A G T T T A G C G G A T G G T A A G C T G G T A T G C T G G T T T G C T G G C C T G T T T G T C T T C T G T C T T G C A T T C T T G 08 97 87 77 6 5 4 4 4 4 4 7 7 7 9 9 9 9 49 4 4 3 3 3 3 3 9 9 2 2 2 2 2 3 3 5 5 5 5 5 2 2 1 1 1 1 1 51 51 34 44 54 64 74 8 9 2 2 2 2 2 4 4 0 0 0 0 0 20 2 0 0 0 -00 -00 0 0 001.-0-0-0-0- v5 N N N N N N N 51 G G G G G G 5 P P P P P P G P 778 41E M Attorney Docket No.: 140101-00120 Table 4. Antisense oligonucleotide conjugates targeting PMP22. Table 5. Molecular weights of the synthesized antisense oligonucleotide conjugates 104 ME148775155v.1 Attorney Docket No.: 140101-00120 105 ME148775155v.1 Attorney Docket No.: 140101-00120 EQUIVALENTS Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims. 106 ME148775155v.1

Claims

Attorney Docket No.: 140101-00120 We claim:

1. An antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, for inhibiting expression of peripheral myelin protein 22 (PMP22), comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO), and wherein the cell penetrating peptide comprises at least one cationic domain comprising at least 4 amino acid residues and at least one hydrophobic domain comprising at least 3 amino acid residues, wherein the cell penetrating peptide comprises a total of 7 to 40 amino acid residues and the at least one cationic domain comprises a beta-alanine residue in combination with arginine and / or histidine residues.

2. An antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, for inhibiting expression of peripheral myelin protein 22 (PMP22), comprising an antisense oligonucleotide targeting PMP22 conjugated to a cell penetrating peptide, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO) comprising at least 10 contiguous nucleotides differing by no more than 3 nucleotides from any one of the nucleotide sequences of SEQ ID NOs: 102-284, and wherein the cell penetrating peptide comprises at least one cationic domain comprising at least 4 amino acid residues and at least one hydrophobic domain comprising at least 3 amino acid residues, wherein the cell penetrating peptide comprises a total of 7 to 40 amino acid residues and the at least one cationic domain comprises a beta-alanine residue in combination with arginine and / or histidine residues.

3. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-2, wherein the antisense oligonucleotide is 10 to 40 nucleotides in length, 10 to 30 nucleotides in length, 10 to 20 nucleotides in length, 18 to 30 nucleotides in length, 10 to 25 nucleotides in length, or 18 to 25 nucleotides in length. 107 ME148775155v.1Attorney Docket No.: 140101-00120 4. The antisense oligonucleotide conjugate, or asalt or solvate thereof, of any one of claims 1-2, wherein the antisense oligonucleotide is 15 nucleotides in length, 20 nucleotides in length, or 25 nucleotides in length.

5. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-2, wherein the antisense oligonucleotide is 25 nucleotides in length.

6. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-2, wherein the antisense oligonucleotide comprises at least 10, at least 15, at least 20, or at least 25 contiguous nucleotides complementary to a target sequence in a human PMP22 gene as set forth in SEQ ID NO: 95, or a PMP22 mRNA selected from any one of the nucleotide sequences of SEQ ID NOs: 96-101.

7. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-6, wherein the antisense oligonucleotide comprises at least 15 contiguous nucleotides of any one of the nucleotide sequences of SEQ ID NOs: 102-284.

8. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 7, wherein the antisense oligonucleotide comprises a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284.

9. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 7, wherein the antisense oligonucleotide consists of a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 102-284.

10. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-6, wherein the antisense oligonucleotide comprises at least 15 contiguous nucleotides of any one of the nucleotide sequences of SEQ ID NOs: 198, 200, 202, 252, 253, 262-270, 272, 273, 275, and 280. 108 ME148775155v.1Attorney Docket No.: 140101-00120 11. The antisense oligonucleotide conjugate, or a pharmaceuticallysalt or solvate thereof, of claim 10, wherein the antisense oligonucleotide comprises a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 198, 200, 202, 252, 253, 262- 270, 272, 273, 275, and 280.

12. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 10, wherein the antisense oligonucleotide consists of a nucleotide sequence of any one of the nucleotide sequences of SEQ ID NOs: 198, 200, 202, 252, 253, 262- 270, 272, 273, 275, and 280.

13. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-12, wherein the target sequence is located in an exon, an intron, the 5’UTR, or the 3’UTR of a PMP22 gene or a PMP22 transcript.

14. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 13, wherein the exon of a PMP22 gene or a PMP22 transcript is selected from the group consisting of exon 1, exon 2, exon 3, exon 4, and exon 5 of a PMP22 gene or a PMP22 transcript.

15. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 13, wherein the intron of a PMP22 gene or a PMP22 transcript is selected from the group consisting of intron 1, intron 2, intron 3, and intron 4 of a PMP22 gene or a PMP22 transcript.

16. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-12, wherein the target sequence is located in or spans an exon-intron junction of a PMP22 gene or a PMP22 transcript.

17. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 16, wherein the exon-intron junction of a PMP22 gene or a PMP22 transcript is selected from the group consisting of intron 1-exon 2 junction, exon 2-intron 2 109 ME148775155v.1Attorney Docket No.: 140101-00120 junction, intron 2-exon 3 junction, exon 3-intron 3 junction, and intron 3-exon 4 junction of a PMP22 gene or a PMP22 transcript.

18. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-17, wherein all the internucleoside linkages of the PMO are -P(O)(NMe2)O-.

19. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-18, wherein each cationic domain is 4 to 12 amino acid residues in length, or 4 to 7 amino acid residues in length.

20. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-19, wherein each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% cationic amino acids.

21. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-20, wherein each cationic domain comprises at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

22. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-21, wherein each cationic domain comprises a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), and any combination thereof. 110 ME148775155v.1Attorney Docket No.: 140101-00120 23. The antisense oligonucleotide conjugate, orsalt or solvate thereof, of any one of claims 1-22, wherein each cationic domain consists of a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), and any combination thereof.

24. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-23, wherein the cell penetrating peptide comprises two cationic domains.

25. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-24, wherein each hydrophobic domain is 3 to 6 amino acid residues in length.

26. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-25, wherein each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% hydrophobic amino acids.

27. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-26, wherein each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline, and / or glutamine residues.

28. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-27, wherein the cell penetrating peptide comprises one hydrophobic domain. 111 ME148775155v.1Attorney Docket No.: 140101-00120 29. The antisense oligonucleotide conjugate, oracceptable salt or solvate thereof, of any one of claims 1-28, wherein the hydrophobic domain comprises a sequence selected from the group consisting of YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), and any combination thereof.

30. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-29, wherein the hydrophobic domain consists of a sequence selected from the group consisting of YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), WWPW (SEQ ID NO: 26), and any combination thereof.

31. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-30, wherein the cell penetrating peptide comprises two cationic domains and one hydrophobic domain.

32. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-31, wherein the cell penetrating peptide comprises one hydrophobic domain flanked by two cationic domains.

33. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-32, wherein the cell penetrating peptide comprises one hydrophobic domain comprising a sequence selected from the group consisting of YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID NO: 25), and WWPW (SEQ ID NO: 26); flanked by two cationic domains, each comprising a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B 112 ME148775155v.1Attorney Docket No.: 140101-00120 19).

34. The antisense oligonucleotide conjugate of any one of claims 1-33, wherein the cell penetrating peptide comprises a sequence selected from the group consisting of RBRRBRRFQILYRBRBR (SEQ ID NO: 27), RBRRBRRYQFLIRBRBR (SEQ ID NO: 31), RBRRBRRILFQYRBRBR (SEQ ID NO: 32), RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37), RBRRBRRFQILYHBHBR (SEQ ID NO: 38), and RBRRBRFQILYRBHBH (SEQ ID NO: 44).

35. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-34, wherein the cell penetrating peptide comprises the amino acid sequence RBRRBRFQILYBRBR (SEQ ID NO: 35).

36. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-34, wherein the cell penetrating peptide comprises the amino acid sequence RBRRBRFQILYBRBRE (SEQ ID NO: 471).

37. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-34, wherein the cell penetrating peptide comprises the amino acid sequence RBRRBRRFQILYRBHBH (SEQ ID NO: 37).

38. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-34, wherein the cell penetrating peptide comprises the amino acid sequence RBRRBRFQILYRBHBH (SEQ ID NO: 44).

39. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-38, wherein the cell penetrating peptide is conjugated to the antisense oligonucleotide at its N-terminus.

40. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 39, wherein the C-terminus of the cell penetrating peptide is -NH2. 113 ME148775155v.1Attorney Docket No.: 140101-00120 41. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-40, wherein the cell penetrating peptide is conjugated to the antisense oligonucleotide at its C-terminus.

42. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 41, wherein the cell penetrating peptide is acylated at its N-terminus.

43. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any of claims 1-42, wherein the antisense oligonucleotide is conjugated to the cell penetrating peptide via a linker.

44. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 43, wherein the antisense oligonucleotide is conjugated to the linker at its 3’ terminus.

45. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-44, wherein the conjugate comprises a structure selected from the group consisting of: [cell penetrating peptide] — [oligonucleotide]; [oligonucleotide] — [cell penetrating peptide]; [cell penetrating peptide] — [linker] — [oligonucleotide]; and [oligonucleotide] — [linker] — [cell penetrating peptide].

46. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-44, wherein the conjugate is of the following structure: 114 ME148775155v.1Attorney Docket No.: 140101-00120.

47. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-44, wherein the conjugate is of the following structure: [cell penetrating peptide] — [linker] — [cell penetrating peptide] — [linker] — [oligonucleotide] 48. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is of formula (I): T1- (CR1R2)n-T2. (I) wherein 115 ME148775155v.1Attorney Docket No.: 140101-00120 T1is a divalent group for attachment to the cell penetrating peptide and is selected from the group consisting of - NH- and carbonyl; T2is a divalent group for attachment to an oligonucleotide and is selected from the group consisting of -NH- and carbonyl; n is 1 , 2 or 3; each R1is independently -Y1-X1-Z1, wherein Y1is absent or -(CRA1RA2)m-, wherein m is 1 , 2, 3 or 4, and RA1and RA2are each independently hydrogen, OH, or (1-2C)alkyl; X1is absent, -O-, -C(O)-, -O(O)O-, -OC(O)-, -CH(ORA3)-, -N(RA3)-, -N(RA3)- C(O)-, - N(RA3)-C(O)O-, -C(O)-N(RA3)-, -N(RA3)C(O)N(RA3)-, -N(RA3)C(N RA3)N(RA3)-, -SO-, -S-, -SO2-, -S(O)2N(RA3)-, or -N(RA3)SO2-, wherein each RA3is independently selected from the group consisting of hydrogen and methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1 -6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3- 6C)cycloalkenyl, and heteroaryl is optionally substituted with one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRA4RA5, and (1-4C)alkoxy, wherein RA4and RA5are each independently selected from the group consisting of hydrogen and (1-4C)alkyl; and each R2is independently -Y2-X2-Z2, wherein Y2is absent or a group of the formula -[CRB1RB2]m- in which m is an integer selected from 1 , 2, 3 or 4, and RB1and RB2are each independently selected from hydrogen, OH or (1 - 2C)alkyl; X2is absent, -O-, -C(O)-, -O(O)O-, -OC(O)-, -CH(ORB3)-, -N(RB3)-, -N(RB3)- C(O)-, - N(RB3)-C(O)O-, -C(O)-N(RB3)-, -N(RB3)C(O)N(RB3)-, -N(RB3)C(NRB3)N(RB3)-, -SO-, -S- -SO2-, - S(O)2N(RB3)-, or -N(RB3)SO2-, wherein each RB3is independently selected from hydrogen or methyl; and Z2is selected from hydrogen, (1 -6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3- 6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl, wherein each (1 -6C)alkyl, (2- 6C)alkenyl, (2- 6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl or heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1- 116 ME148775155v.1Attorney Docket No.: 140101-00120 4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy,wherein RB4and RB5are each independently hydrogen or (1-2C)alkyl; with the proviso that; when n=1 and T1and T2are different to one another, then R1and R2are not both H; when n=1 , T1and T2 are different to one another and one of R1and R2is H then the other of R1and R2is not methyl; or when n=2 and each occurrence of R1and R2is H, then T1 and T2 are both -C(O)- or are both -NH-.

49. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein T2is -C(O)-.

50. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein each R1is independently -Y1-X1-Z1, wherein: Y1is absent or -(CRA1RA2)m-, wherein m is 1, 2, 3 or 4, and RA1and RA2are each hydrogen or (1- 2C)alkyl; X1is absent, -O-, -C(O)-, -O(O)O-, -N(RA3)-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, -N(RA3)C(O)N(RA3)-, -N(RA3)C(N RA3)N(RA3)- or -S-, wherein each RA3is independently hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1-6C)alkyl, (2-6C)alkenyl, (2-6C)alkynyl, aryl, (3- 6C)cycloalkyl, (3-6C)cycloalkenyl, or heteroaryl, wherein each (1-6C)alkyl, (2- 6C)alkenyl, (2-6C)alkynyl, aryl, (3-6C)cycloalkyl, (3-6C)cycloalkenyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, oxo, halo, cyano, nitro, hydroxy, carboxy, NRA4RA5, and (1- 4C)alkoxy, wherein RMand RA5are each independently hydrogen or (1-2C)alkyl.

51. The antisense oligonucleotide conjugate of claim 48, wherein each R1is independently -Y1-X1-Z1, wherein: Y1is absent or -(CRA1RA2)m-, wherein m is 1 , 2, 3, or 4, and RA1and R" are each independently hydrogen or (1-2C)alkyl; X1is absent, -O-, -C(O)-, -C(O)O-, -N(RA3)-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, -N(RA3)C(O)N(RA3)-, -N(RA3)C(NRA3)N(RA3)-, or -S-, wherein each RA3is independently hydrogen or methyl; and 117 ME148775155v.1Attorney Docket No.: 140101-00120 Z1is a further oligonucleotide or is hydrogen, (1-aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3-6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, halo, and hydroxy.

52. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein each R1is independently -Y1-X1-Z1, wherein: Y1is absent or a group of the formula -(CRA1RA2)m-, wherein m is 1 , 2, 3 or 4, and RA1and RA2are each independently hydrogen or (1-2C)alkyl; X1is absent, -C(O)-, -C(O)O-, -N(RA3)-C(O)-, -C(O)-N(RA3)-, wherein each RA3is hydrogen or methyl; and Z1is a further oligonucleotide or is hydrogen, (1 - 6C)alkyl, aryl, (3-6C)cycloalkyl, or heteroaryl, wherein each (1-6C)alkyl, aryl, (3- 6C)cycloalkyl, and heteroaryl is optionally substituted by one or more (e.g., 1 , 2, 3, 4, or 5) substituent groups selected from the group consisting of (1-4C) alkyl, halo, and hydroxy.

53. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein each R1is independently -Y1-X1-Z1, wherein: Y1is absent, -(CH2)-, or-(CH2CH2)-; X1is absent, -N(RA3)-C(O)-, -C(O)-N(RA3)-, wherein each RA3is independently hydrogen or methyl; and Z1is hydrogen or (1-2C)alkyl.

54. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein each R2is independently -Y2-Z2, wherein Y2is absent or - (CRB1RB2)m-, wherein m is 1 , 2, 3 or 4, and RB1and RB2are each independently hydrogen or (1- 2C)alkyl; and Z2is hydrogen or (1-6C)alkyl.

55. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein each R2is hydrogen. 118 ME148775155v.1Attorney Docket No.: 140101-00120 56. The antisense oligonucleotide conjugate, orsalt or solvate thereof, of claim 48, wherein n is 2 or 3.

57. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of claim 48, wherein n is 1.

58. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is an amino acid residue selected from the group consisting of glutamic acid, succinic acid, and gamma-aminobutyric acid residues.

59. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is:

60. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is:

61. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is:

62. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is: 119 ME148775155v.1Attorney Docket No.: 140101-0012063. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is:

64. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 43-47, wherein the linker is:

65. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-42, wherein the conjugate is of the following structure:

66. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-42, wherein the conjugate is of the following structure:120 ME148775155v.1Attorney Docket No.: 140101-00120 67. The antisense oligonucleotide conjugate, or a pharmaceuticallysalt or solvate thereof, of any one of claims 1-42, wherein the conjugate is of the following structure:

68. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-42, wherein the conjugate is of the following structure:

69. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-42, wherein the conjugate is of the following structure:

70. The antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-9, wherein the antisense oligonucleotide conjugate is of the following structure: H3C-C(O)-[cell penetrating peptide (N-terminus # C-terminus)]-[amino acid linker (N- terminus C-terminus)]-[antisense oligonucleotide (3'# 5')]-5'-group; wherein the cell penetrating peptide comprises the amino acid sequence SEQ ID NO: 35; wherein the amino acid linker is glutamic acid; wherein the antisense oligonucleotide is conjugated to the side-chain of the glutamic acid linker and consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 102-284; and wherein the 5'-group is of the following structure: 121 ME148775155v.1Attorney Docket No.: 140101-0012071. A pharmaceutical composition comprising an antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-70, and a pharmaceutically acceptable carrier.

72. A method of inhibiting PMP22 expression in a cell, the method comprising contacting the cell with the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-70, or the pharmaceutical composition of claim 71, thereby inhibiting PMP22 expression in the cell.

72. The method of claim 72, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, inhibits PMP22 protein expression in the cell.

73. The method of claim 72, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, inhibits PMP22 mRNA expression in the cell.

74. The method of any one of claims 72-73, wherein the cell is within a subject.

75. The method of any one of claims 72-74, wherein the subject is a human.

76. The method of any one of claims 72-75, wherein the cell is selected from the group consisting of a Schwann cell, a peripheral nerve axon, an endothelial cell, a muscle cell, a myocyte, a myoblast, a myocardial cell, a smooth muscle cell, a podocyte or any type of a kidney cell, a hepatocyte or any type of a liver cell, a neuronal cell, a microglial cell, any cell type of the 122 ME148775155v.1Attorney Docket No.: 140101-00120 central nervous system and peripheral nervous system, a stem cell, anstem cell, an induced pluripotent stem cell, and any combination thereof.

77. The method of any one of claims 72-76, wherein the PMP22 expression is inhibited by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

78. A method of treating Charcot-Marie-Tooth (CMT) disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-70, or the pharmaceutical composition of claim 71, thereby treating the CMT disease in the subject.

79. The method of claim 78, wherein the CMT disease is selected from the group consisting of CMT disease type 1 (CMT1), CMT disease type 2 (CMT2), CMT disease type 3 (CMT3), CMT disease type 4 (CMT4), CMT disease type 5 (CMT5), CMT disease type 6 (CMT6), CMT disease type 7 (CMT7), CMT disease type X (CMTX), and subtypes thereof.

80. The method of any one of claims 78-79, wherein the CMT disease is CMT disease type 1A (CMT1A).

81. The method of any one of claims 78-80, wherein the subject is human.

81. The method of any one of claims 78-81, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, is administered to the subject via an intramedullary route, an intrathecal route, an intracerebroventricular route, an intraventricular route, an intravitreal route, an enteral route, a parenteral route, an intravenous route, an intra-arterial route, an intramuscular route, an intratumoral route, a subcutaneous route, an oral route, or a nasal route. 123 ME148775155v.1Attorney Docket No.: 140101-00120 82. The method of any one of claims 78-81,conjugate, or a pharmaceutically acceptable salt or solvate thereof, is administered at a dose of about 5 mg / kg to about 60 mg / kg to the subject.

83. The method of claim 82, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, is administered at a dose of about 25 mg / kg to about 60 mg / kg to the subject.

84. The method of claim 83, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, is administered at a dose of about 45 mg / kg to the subject.

85. The method of any one of claims 78-84, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, is administered to the subject at a frequency that is weekly, biweekly, monthly, quarterly, semi-annually, annually, or a combination thereof.

86. The method of any one of claims 85, wherein the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, is administered to the subject biweekly.

87. The method of any one of claims 78-86, further comprising administering an additional therapeutic to the subject.

88. The method of claim 87, wherein the additional therapeutic is selected from the group consisting of nonsteroidal anti-inflammatory drugs, cyclooxygenase-2 inhibitors, tricyclic antidepressants, anticonvulsants, analgesics, vitamins, concomitant surgery, occupational therapy, physical therapy, exercise program, and any combination thereof.

89. A kit comprising the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-70, or the pharmaceutical composition of claim 71, and instructions for use thereof. 124 ME148775155v.1Attorney Docket No.: 140101-00120 90. A syringe comprising the antisense oligonucleotide conjugate, or a pharmaceutically acceptable salt or solvate thereof, of any one of claims 1-70, or the pharmaceutical composition of claim 71. 125 ME148775155v.1

Citation Information

Patent Citations

  • Antisense design

    US20060128646A1

  • Compounds and methods for modulating gene expression

    US20080015162A1

  • Oligonucleotides with alternating segments of locked and non-locked nucleotides

    US20090209748A1

  • Short RNA Antagonist Compounds for the Modulation of Target mRNA

    US20100210712A1

  • Amino-LNA, thio-LNA and alpha-l-oxy-ln

    US20140128586A1