Inhibitors of HDAC11 and malat1, methods of treating diseases, and biomarkers related thereto

Abstract

Disclosed herein are methods of treating an airway disease by therapeutically targeting Histone deacetylase 11 (HDAC11) or Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT1). In certain embodiments, the targeting of HDAC11 or MALAT1 is by delivery of a therapeutic that binds to and / or cleaves a HDAC11 or MALAT1 gene product contained within extracellular vesicles. In certain embodiment, the therapeutic is a nucleic acid, peptide, antibody, or small molecule.

Description

[0001] INHIBITORS OF HDAC11 AND MALAT1, METHODS OF TREATING DISEASES, AND BIOMARKERS RELATED THERETO

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 662,666 filed June 21, 2024. The entirety of this application is hereby incorporated by reference for all purposes.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with government support under HL 159058 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED AS AN XML FILE VIA THE OFFICE ELECTRONIC FILING SYSTEM

[0007] The Sequence Listing associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is 24184PCT.xml. The XML file is 19,201 bytes, was created on June 17, 2025, and is being submitted electronically via the USPTO patent center.

[0008] BACKGROUND

[0009] Polymorphonuclear neutrophils (PMNs) are the most abundant leukocyte in the bone marrow and circulation. PMNs are central to the pathogenesis of many airway diseases including cystic fibrosis (CF), chronic obstructive pulmonary disease (COPD), and asthma. In CF, airway PMNs adopt a fate associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) and fail to completely clear invading pathogens. The large number of airway PMNs in a GRIM state is an indication of sever disease.

[0010] Forrest et al. report the pathological conditioning of human neutrophils recruited to the airway milieu in cystic fibrosis. J Leukoc Biol, 2018, 104(4):665-67.

[0011] Wang et al. report overexpression of Mai at 1 relates to lung injury. Can Respir J, 2019, 1871394. Cao et al. report HDAC11 regulates type I interferon signaling through defatty-acylation of SHMT2. Proc Natl Acad Sci U S A, 2019, 116(12):5487-5492.

[0012] Margaroli et al. report transcriptional firing represses bactericidal activity in cystic fibrosis airway neutrophils. Cell Reports Medicine, 2021, 2, 100239.

[0013] Amjadi et al. report neutrophil-derived extracellular vesicles modulate the phenotype of naive human neutrophils. J Leukoc Biol, 2021, 110(5): 917-925.

[0014] Dobosh et al. report mass production of human airway-like neutrophils. STAR Protoc, 2021, 2, 100892.

[0015] Zhou et al. report insights into Malatl function as a microRNA sponge. Front Oncol, 2021, 11, 758653.

[0016] Kumar et al. report Malatl as a master regulator of biomarkers predictive of pan-cancer multi-drug resistance. Sci Rep, 2022, 12, 7540.

[0017] Mu et al. report LncRNA-Malatl regulates cancer glucose metabolism in prostate cancer. Oxid Med Cell Longev, 2022, 8693259.

[0018] Shyu et al. report exosomal Malatl derived from high glucose-treated macrophages up- regulates Resistin expression by miR-150-5p downregulation. Int J Mol Sci, 2022, 23.

[0019] Laucirica et al., report Pseudomonas aeruginosa modulates neutrophil granule exocytosis in an in vitro model of airway infection. Immunol Cell Biol, 2022, 100(5):352-370.

[0020] References cited herein are not an admission of prior art.

[0021] SUMMARY

[0022] Disclosed herein are compositions and methods for treating an airway disease or cancer by therapeutically targeting Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT1) or Histone deacetylase 11 (HDAC11). In certain embodiments, this disclosure relates to methods for treating an airway disease by therapeutically targeting Histone deacetylase 11 (HDACl l) or Metastasis Associated Lung Adenocarcinoma Transcript 1 (MALAT1) expression in extracellular vesicles of the airways or lungs. In certain embodiments, targeting MALAT1 or HDACll is by delivery of a therapeutic that binds to and / or cleaves a MALAT1 or HDACll gene product contained within extracellular vesicles. In certain embodiment, the therapeutic is a nucleic acid, peptide, antibody, or small molecule. In certain embodiments, this disclosure relates to methods of treating an airway disease or condition comprising administering an effective amount of an inhibitor of the defatty-acylase activity of HD AC 11 to a subject in need thereof optionally in combination with an antibiotic agent. In certain embodiments, the inhibitor of the defatty-acylase activity of HD AC 11 is N'- hexadecylthiophene-2-carbohydrazide (SIS 17) or derivative thereof.

[0023] In certain embodiment, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves HD AC 11 mRNA, DNA, or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent.

[0024] In certain embodiments, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of N'-hexadecylthiophene-2-carbohydrazide (SIS 17) or derivative thereof to a subject in need thereof optionally in combination with an antibiotic agent.

[0025] In certain embodiment, the therapeutic is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), gapmer, microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0026] In certain embodiments, this disclosure relates to methods of detecting, measuring, quantifying, or correlating levels of MALAT1, MALAT1 RNA, HDAC11 and / or HD AC11 RNA in airway derived extracellular vesicles as a biomarker for lung health and to guide therapeutic treatments.

[0027] In certain embodiment, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves MALAT1, MALAT1RNA, HDAC11 and / or HDAC11 RNA, DNA or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent.

[0028] In certain embodiment, the therapeutic agent that binds or cleaves MALAT1, MALAT1 RNA, DNA, or protein expressed therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), gapmer, microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0029] In certain embodiment, the therapeutic agent is a small molecule, oligonucleotide, or other therapeutic in a lipid nanoparticle or extracellular vesicle.

[0030] In certain embodiment, the subject is diagnosed with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and / or metabolic licensing (GRIM).

[0031] In certain embodiment, the PMNs are CD66b positive and produce extracellular vesicles (EVs) containing a long non-coding RNA (IncRNA) that encodes MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript 1) MALAT1.

[0032] In certain embodiment, the PMNs express histone deacetylase 11 (HDAC11) mRNA or protein expressed therefrom.

[0033] In certain embodiment, the therapeutic agent that binds or cleaves MALAT1, MALAT1 RNA, DNA, or protein product thereof is administered in combination with a histone deacetylase inhibitor.

[0034] In certain embodiment, an HD AC 11 inhibitor is administered in combination with the therapeutic agent that binds or cleaves MALAT1, MALAT1 RNA, DNA, or protein product thereof.

[0035] In certain embodiments, the therapeutic agent is administered as contained in a lipid nanoparticle or extracellular vesicle.

[0036] In certain embodiments, the airway disease is cystic fibrosis (CF). In certain embodiments, the airway disease is sinusitis, chronic rhinosinusitis, CF bronchiectasis, non-CF bronchiectasis, or chronic obstructive pulmonary disease (COPD). In certain embodiments, the airway disease is asthma. In certain embodiments, the airway disease is persistent airway obstruction. In certain embodiments, the airway disease is virus-induced airway restriction. In certain embodiments, the virus is a coronavirus, respiratory syncytial virus, influenza, or parainfluenza virus (PIV).

[0037] In certain embodiments, the subject is diagnosed with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM). In certain embodiments, the PMNs are CD66b positive and produce extracellular vesicles (EVs) containing a long non-coding RNA (IncRNA) that encodes MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript 1) MALAT 1.

[0038] In certain embodiments, this disclosure relates to method for detecting airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) in warm-blooded animals comprising the steps of: assaying a body fluid for extracellular vesicles excreting elevated levels of MALAT1 mRNA, IncRNA MALAT1, and / or; and correlating elevated level of MALAT1 mRNA, IncRNA MALAT 1, HD AC 11 and / or HD AC 11 mRNA; in said body fluid with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) folate.

[0039] In certain embodiments, synthetic RNA sequences induce or inhibit the release of neutrophil elastase (NE) from tissue-recruited neutrophils. In certain embodiments, the RNA sequences are administered directly or packaged in delivery vehicles like lipid nanoparticles or exosomes.

[0040] In certain embodiments, this disclosure relates to vectors encoding sequences derived from the MALAT 1 long non-coding RNA, with modifications to enhance delivery and packaging for therapeutic purposes, such as removing the binding site for miRNA145-5p and trimming additional nucleotides.

[0041] BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0042] Figures 1A and IB shows data indicating HDAC11 inhibition can prevent the induction of the GRIM phenotype. HDAC11 mRNA is upregulated in PMNs. The small molecule drug SIS 17 (25 uM), an inhibitor of HD AC 11 deacetylase activity was included in the apical transmigration fluid. PMNs were transmigrated for 4 hours under each condition.

[0043] Figure 1A shows data on surface expression of CD63 as measured by flow cytometry.

[0044] Figure IB shows data on bacteria-killing capacity.

[0045] Figures 2A-2B shows data indicating the expression or knockdown of MALAT 1 or HD AC 11 modulate the GRIM phenotype in airway-like PMNs. In experiments, a dual expression plasmid was used to encode two parts. In position 1, MALAT1, HDAC11, or a control fluorescent protein mScarlet were expressed under the control of an EFla promoter or siRNAs targeting MALAT1 or HDAC11 or a scramble control were included downstream of a U6 promoter. For all plasmids, EGFP was expressed off of the CMV promoter in position 2. Blood PMNs were electroporated with each plasmid and then transmigrated for 4 hours. Cells expressing EGFP were detected by flow cytometry.

[0046] Figure 2A shows data on percent killed bacteria with or without SIS 17 and HD AC 11 and MALATE The population of transmigrated PMNs were incubated at an MOI of 1 and then the amount of bacteria remaining after 1 hour incubation was calculated

[0047] Figure 2B shows data on percent killed with or without HD AC 11 siRNA and MALAT1 siRNA.

[0048] Figures 3A and 3B show data indicating MALAT1 in EVs from CF sputum strongly correlates with exacerbation status and lung function. Sputum was collected during inpatient visits and evaluations were conducted 1-4 days after an acute pulmonary exacerbation. Outpatient visits were conducted in stable condition at least 3-12 months from the exacerbation. Lung function as a measurement of forced expiratory volume relative to forced vital capacity (%FEV1) decreases following acute pulmonary exacerbations (APE).

[0049] Figure 3A shows data wherein MALAT1 transcripts were purified from total EVs and concentrations were measured by qRT-PCR.

[0050] Figure 3B shows data indicating MALAT1 transcript concentrations in EVs correlated with %FEV lung function.

[0051] Figure 4 shows data when using synthetic RNA fragments that induce primary granule release by human tissue neutrophils. The human MALAT1 long non-coding RNA sequence was synthesized along with a fragment wherein the miRNA 145-5p binding sequence was deleted. RNA A is the full length 1-8780 bp human long non-coding MALAT1 (SEQ ID NO: 1). RNA B is the full length with the miRNA binding site deletion from 1924-1936. RNA C contains deletions on the 5’ and 3’ ends providing a truncated nucleotide sequence of 1841-3474 (SEQ ID NO: 2). RNA D is the truncated RNA C truncated nucleotide sequence of 1841-3474 with the additional deletion of the miRNA 145-5p binding sequence from 1924-1936 (SEQ ID NO: 3). Transfection of tissue recruited human neutrophils with RNA forms followed by quantitation of primary granule release (CD63 median fluorescent intensity) as determined by flow cytometry indicate efficient induction of primary granule release by all forms. DETAILED DISCUSSION

[0052] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims or as amended during prosecution.

[0053] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

[0054] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0055] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described as illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0056] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of medicine, organic chemistry, biochemistry, molecular biology, pharmacology, and the like, which are within the skill of the art. Such techniques are explained fully in the literature.

[0057] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. In this specification and in the claims that follow reference will be made to a number of terms that shall be defined to have the following meanings unless a contrary intention is apparent.

[0058] As used herein, the term “about” or “approximately” refers to plus or minus 10 or 20 percent of the recited value, so that, for example, “about 0.125” means 0.125 plus / minus 0.025, and “about 1.0” means 1.0 plus / minus 0.2. As used in this disclosure and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") have the meaning ascribed to them in U.S. Patent law in that they are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. The term “comprising” in reference to an oligonucleotide or peptide sequence refers to an oligonucleotide or peptide that may contain additional 5’ (5’ terminal end) or 3’ (3’ terminal end) nucleotides or N- or C-terminal amino acids, i.e., the term is intended to include the oligonucleotide sequence or peptide sequence within a larger nucleic acid or peptide.

[0059] "Consisting essentially of' or "consists of' or the like, when applied to methods and compositions encompassed by the present disclosure refers to compositions like those disclosed herein that exclude certain prior art elements to provide an inventive feature of a claim, but which may contain additional composition components or method steps, etc., that do not materially affect the basic and novel character! stic(s) of the compositions or methods, compared to those of the corresponding compositions or methods disclosed herein. The term “consisting of’ in reference to an oligonucleotide or peptide having a nucleotide or peptide sequence refers an oligonucleotide or peptide having the exact number of nucleotides or amino acids in the sequence and not more or having not more than a range of nucleotide expressly specified in the claim. For example, “5’ sequence consisting of’ is limited only to the 5’ end, i.e., the 3’ end may contain additional nucleotides. Similarly, a “3’ sequence consisting of’ is limited only to the 3’ end, and the 5’ end may contain additional nucleotides.

[0060] As used herein, the term “small molecule” refers to any variety of covalently bound molecules with a molecular weight of less than about 900 or 1000. Typically, the majority of atoms include carbon, hydrogen, oxygen, nitrogen, and to a lesser extent sulfur and / or a halogen. Examples include steroids, short peptides, mono or polycyclic aromatic or non-aromatic, heterocyclic compounds.

[0061] As used herein, the term “derivative” refers to a structurally similar compound that retains sufficient functional attributes of the identified analogue. The derivative may be structurally similar because it is lacking one or more atoms, substituted, a salt, in different hydration / oxidation states, or because one or more atoms within the molecule are switched, such as, but not limited to, replacing an oxygen atom with a sulfur atom or replacing an amino group with a hydroxyl group or vice versa. The derivative may be a prodrug. Derivatives may be prepared by any variety of synthetic methods or appropriate adaptations presented in synthetic or organic chemistry textbooks, such as those provide in March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, Wiley, 6th Edition (2007) Michael B. Smith or Domino Reactions in Organic Synthesis, Wiley (2006) Lutz F. Tietze hereby incorporated by reference.

[0062] The term "substituted" refers to a molecule wherein at least one hydrogen atom is replaced with a substituent. When substituted, one or more of the groups are "substituents." The molecule may be multiply substituted. In the case of an oxo substituent ("=O"), two hydrogen atoms are replaced. Example substituents within this context may include halogen, hydroxy, alkyl, alkoxy, nitro, cyano, oxo, carbocyclyl, carbocycloalkyl, heterocarb ocyclyl, heterocarbocycloalkyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, -NRaRb, -NRaC(=O)Rb, -NRaC(=O)NRaNRb, -NRaC(=O)ORb, -NRaSChRb, -C(=O)Ra, -C(=O)ORa, -C(=O)NRaRb, -OC(=O)NRaRb, -ORa, -SRa, -SORa, - S(=O)2Ra, -OS(=O)2Ra and -S(=O)2ORa. Ra and Rb in this context may be the same or different and independently hydrogen, halogen hydroxyl, alkyl, alkoxy, alkyl, amino, alkylamino, dialkylamino, carbocyclyl, carbocycloalkyl, heterocarb ocyclyl, heterocarbocycloalkyl, aryl, arylalkyl, heteroaryl, and heteroarylalkyl.

[0063] A "subject" refers any animal, preferably a human patient, livestock, or domestic pet.

[0064] As used herein, the terms "treat" and "treating" are not limited to the case where the subject (e g. patient) is cured and the disease is eradicated. Rather, embodiments of the present disclosure also contemplate treatment that merely reduces symptoms, and / or delays disease progression.

[0065] As used herein, the terms "prevent" and "preventing" include the prevention of the recurrence, spread or onset. It is not intended that the present disclosure be limited to complete prevention. In some embodiments, the onset is delayed, or the severity is reduced.

[0066] The term “effective amount” refers to that amount of a compound or pharmaceutical composition described herein that is sufficient to effect the intended application including, but not limited to, disease treatment, as illustrated below. The therapeutically effective amount can vary depending upon the intended application (in vitro or in vivo), or the subject and disease condition being treated, e.g., the weight and age of the subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The specific dose will vary depending on, for example, the particular compounds chosen, the dosing regimen to be followed, whether it is administered in combination with other agents, timing of administration, the tissue to which it is administered, and the physical delivery system in which it is carried.

[0067] The term "recombinant" when made in reference to a nucleic acid molecule refers to a nucleic acid molecule which is comprised of segments of nucleic acid joined together by means of molecular biological techniques. The term "recombinant" when made in reference to a protein or a polypeptide refers to a protein molecule which is expressed using a recombinant nucleic acid molecule.

[0068] The terms "vector" or " expression vector " refer to a recombinant nucleic acid containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism or expression system, e.g., cellular or cell-free. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.

[0069] As used herein, a "lipid" group refers to a hydrophobic group that is naturally or non- naturally occurring and is highly insoluble in water. As used herein a lipid group is considered highly insoluble in water when the point of connection on the lipid is replaced with a hydrogen and the resulting compound has a solubility of less than 0.63 x 10'4% w / w (at 25 °C) in water, which is the percent solubility of octane in water by weight. See Solvent Recovery Handbook, 2nd Ed, Smallwood, 2002 by Blackwell Science, page 195. Examples of naturally occurring lipids include saturated or unsaturated long hydrocarbon chains found in fatty acids, glycerolipids, cholesterol, steroids, polyketides, and derivatives. Non-naturally occurring lipids include derivatives of naturally occurring lipids, acrylic polymers, aromatic, and alkylated compounds and derivatives thereof.

[0070] A “lipid nanoparticle” refers to a particle with an average diameter of about 60 to 1000 nm containing one of more lipid components. Contemplated lipid nanoparticles typically comprise a drug or other cargo as reported herein and the lipid particle components, e.g., a phospholipid, a sterol, a polyethylene glycol lipid, and an ionizable lipid.

[0071] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as attachment of / with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p- acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art.

[0072] A "heterologous" nucleic acid sequence or peptide sequence refers to a nucleic acid sequence or a peptide sequence that does not naturally occur, e.g., because the whole sequence contains a segment from other plants, bacteria, viruses, other organisms, or joinder of two sequences that occur in the same organism but are joined together in a manner that does not naturally occur in the same organism or any natural state.

[0073] In certain contexts, an “antibody” refers to a protein-based molecule that is naturally produced by animals in response to the presence of a protein or other molecule or that is not recognized by the animal’s immune system to be a “self’ molecule, i.e., recognized by the animal to be a foreign molecule, i.e., an antigen to the antibody. The immune system of the animal will create an antibody to specifically bind the antigen (or any cell or organism attached to the antigen) and thereby targeting the antigen for degradation or elimination. It is well recognized by skilled artisans that the molecular structure of a natural antibody can be synthesized and altered by laboratory techniques. Recombinant engineering can be used to generate fully synthetic antibodies or fragments thereof providing control over variations of the amino acid sequences of the antibody. Thus, the term “antibody” is intended to include natural antibodies, monoclonal antibody, or non- naturally produced synthetic antibodies, such as specific binding single chain antibodies, bispecific antibodies, or fragments thereof. These antibodies may have chemical modifications.

[0074] In humans, from a structural standpoint, an antibody is a combination of proteins: two heavy chain proteins and two light chain proteins. Alternatively, other animals produce antibodies from nucleic acids that encode a single protein. In humans, the heavy chains are longer than the light chains. The two heavy chains typically have the same amino acid sequence. Similarly, the two light chains typically have the same amino acid sequence. Each of the heavy and light chains contain a variable segment that contains amino acid sequences which participate in binding to the antigen. The variable segments of the heavy chain do not have the same amino acid sequences as the light chains. The variable segments are often referred to as the antigen binding domains. The antigen and the variable regions of the antibody may physically interact with each other at specific smaller segments of an antigen often referred to as the "epitope." Epitopes usually consist of surface groupings of molecules, for example, amino acids or carbohydrates. The terms “variable region,” "antigen binding domain," and "antigen binding region" refer to that portion of the antibody molecule which contains the amino acid residues that interact with an antigen and confer on the antibody its specificity and affinity for the antigen. Small binding regions within the antigenbinding domain that typically interact with the epitope are also commonly alternatively referred to as the "complementarity-determining regions, or CDRs."

[0075] "Single chain antibodies" refer to a single peptide containing naturally or non-naturally occurring sequences, including synthetically modified peptide sequences, derived from an antibody variable region that specifically binds an antigen of interest. Single chain antibodies are sometimes fragments or variants of naturally occurring mammalian antibodies. Such antibodies are sometimes referred to as single-domain antibodies (sdAbs or VHHs), or camelid single-domain antibodies, e.g., when derived from an animal of Camelidae family, e.g., lamas, camels.

[0076] The term "sample" is used in its broadest sense, in that it has chemical makeup that is physical for analysis, i.e., analyte. In one sense it can refer to a nasal fluid, saliva, cough droplets, or expelled droplets of saliva into the air, e.g., produced by speaking, or other lung fluid or blood. In another sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples include bodily fluids, urine, feces, nasal drip, seminal fluid, hair, skin (dead or epithelial layer of skin), finger or toenail clipping, and blood products such as plasma, serum, and the like.

[0077] "Cancer" refers any of various cellular diseases with malignant neoplasms characterized by the proliferation of cells. It is not intended that the diseased cells must actually invade surrounding tissue and metastasize to new body sites. Cancer can involve any tissue of the body and have many different forms in each body area. Within the context of certain embodiments, whether "cancer is reduced" may be identified by a variety of diagnostic manners known to one skill in the art including, but not limited to, observation the reduction in size or number of tumor masses or if an increase of apoptosis of cancer cells observed, e.g., if more than a 5 % increase in apoptosis of cancer cells is observed for a sample compound compared to a control without the compound. It may also be identified by a change in relevant biomarker or gene expression profile, such as PSA for prostate cancer, HER2 for breast cancer, or others. A “chemotherapy agent,” “chemotherapeutic,” “anti-cancer agent,” or the like, refer to molecules that are recognized to aid in the treatment of a cancer. Contemplated examples include the following molecules or derivatives such as abemaciclib, abiraterone acetate, methotrexate, paclitaxel, adriamycin, acalabrutinib, brentuximab vedotin, ado-trastuzumab emtansine, aflibercept, afatinib, netupitant, palonosetron, imiquimod, aldesleukin, alectinib, alemtuzumab, pemetrexed disodium, copanlisib, melphalan, brigatinib, chlorambucil, amifostine, aminolevulinic acid, anastrozole, apalutamide, aprepitant, pamidronate disodium, exemestane, nelarabine, arsenic trioxide, ofatumumab, atezolizumab, bevacizumab, avelumab, axicabtagene ciloleucel, axitinib, azacitidine, carmustine, belinostat, bendamustine, inotuzumab ozogamicin, bevacizumab, bexarotene, bicalutamide, bleomycin, blinatumomab, bortezomib, bosutinib, brentuximab vedotin, brigatinib, busulfan, irinotecan, capecitabine, fluorouracil, carboplatin, carfilzomib, ceritinib, daunorubicin, cetuximab, cisplatin, cladribine, cyclophosphamide, clofarabine, cobimetinib, cabozantinib-S-malate, dactinomycin, crizotinib, ifosfamide, ramucirumab, cytarabine, dabrafenib, dacarbazine, decitabine, daratumumab, dasatinib, defibrotide, degarelix, denileukin diftitox, denosumab, dexamethasone, dexrazoxane, dinutuximab, docetaxel, doxorubicin, durvalumab, rasburicase, epirubicin, elotuzumab, oxaliplatin, eltrombopag olamine, enasidenib, enzalutamide, eribulin, vismodegib, erlotinib, etoposide, everolimus, raloxifene, toremifene, panobinostat, fulvestrant, letrozole, filgrastim, fludarabine, flutamide, pralatrexate, obinutuzumab, gefitinib, gemcitabine, gemtuzumab ozogamicin, glucarpidase, goserelin, propranolol, trastuzumab, topotecan, palbociclib, ibritumomab tiuxetan, ibrutinib, ponatinib, idarubicin, idelalisib, imatinib, talimogene laherparepvec, ipilimumab, romidepsin, ixabepilone, ixazomib, ruxolitinib, cabazitaxel, palifermin, pembrolizumab, ribociclib, tisagenlecleucel, lanreotide, lapatinib, olaratumab, lenalidomide, lenvatinib, leucovorin, leuprolide, lomustine, trifluridine, olaparib, vincristine, procarbazine, mechlorethamine, megestrol, trametinib, temozolomide, methylnaltrexone bromide, midostaurin, mitomycin C, mitoxantrone, plerixafor, vinorelbine, necitumumab, neratinib, sorafenib, nilutamide, nilotinib, niraparib, nivolumab, tamoxifen, romiplostim, sonidegib, omacetaxine, pegaspargase, ondansetron, osimertinib, panitumumab, pazopanib, interferon, pertuzumab, pomalidomide, mercaptopurine, regorafenib, rituximab, rolapitant, rucaparib, siltuximab, sunitinib, thioguanine, temsirolimus, thalidomide, thiotepa, trabectedin, valrubicin, vandetanib, vinblastine, vemurafenib, vorinostat, zoledronic acid, or combinations thereof such as cyclophosphamide, methotrexate, 5 -fluorouracil (CMF); doxorubicin, cyclophosphamide (AC); mustine, vincristine, procarbazine, prednisolone (MOPP); adriamycin, bleomycin, vinblastine, dacarbazine (ABVD); cyclophosphamide, doxorubicin, vincristine, prednisolone (CHOP); bleomycin, etoposide, cisplatin (BEP); epirubicin, cisplatin, 5- fluorouracil (ECF); epirubicin, cisplatin, capecitabine (ECX); methotrexate, vincristine, doxorubicin, cisplatin (MVAC). In certain embodiments, the chemotherapy agent is an anti-PD-1, anti-PD-Ll anti-CTLA4 antibody or combinations thereof, such as an anti-CTLA4 (e.g., ipilimumab, tremelimumab) and anti-PDl (e.g., nivolumab, pembrolizumab, cemiplimab) and anti-PD-Ll (e.g., atezolizumab, avelumab, durvalumab).

[0078] In certain embodiments, methods disclosed herein may make quantitative or qualitative measurements that are compared to a normal or reference value. As used herein, a “reference value” can be an absolute value; a relative value; an average value; a median value, a mean value, or a value as compared to a particular control or baseline value. A reference value can be based on an individual sample or a large number of samples, such as from patients or normal individuals.

[0079] A “normalized measured” value refers to a measurement taken and adjusted to take background into consideration. Background subtraction to obtain total fluorescence is considered a normalized measurement. The background subtraction allows for the correction of background fluorescence that is inherent in the optical system and assay buffers.

[0080] In certain embodiments, methods disclosed herein include measurements that are compared to a normal or reference value. As used herein, a “reference value” can be an absolute value; a relative value; an average value; a median value, a mean value, or a value as compared to a particular control or baseline value. A reference value can be based on an individual sample or a large number of samples, such as from patients or normal individuals.

[0081] A “normalized measured” value refers to a measurement taken and adjusted to take background into consideration. Background subtraction to obtain total fluorescence is considered a normalized measurement. The background subtraction allows for the correction of background fluorescence that is inherent in the optical system and assay buffers.

[0082] Unless stated otherwise as apparent from the following discussion, it will be appreciated that terms such as “detecting,” “receiving,” “quantifying,” “mapping,” “generating,” “registering,” “determining,” “obtaining,” “processing,” “computing,” “deriving,” “estimating,” “calculating,” “inferring” or the like may refer to the actions and processes of a computer system, or similar electronic computing device, that manipulates and transforms data represented as physical (e.g., electronic) quantities within the computer system's registers and memories into other data similarly represented as physical quantities within the computer system memories or registers or other such information storage, transmission or display devices. Embodiments of the methods described herein may be implemented using computer software and information or data can be recorded on a non-transitory computer readable media or a non-transient carrier capable of retaining information in a machine-readable format. If written in a programming language conforming to a recognized standard, sequences of instructions designed to implement the methods may be compiled for execution on a variety of hardware platforms and for interface to a variety of operating systems. In addition, embodiments are not described with reference to any programming language. It will be appreciated that a variety of programming languages may be used to implement embodiments of the disclosure.

[0083] Antisense, RNA induced silencing (RNAi), and Cas nuclease therapies

[0084] Antisense therapy is a form of treatment for genetic disorders or infections. When the genetic sequence of a particular gene is known to be causative of a particular disease, it is possible to synthesize a strand of nucleic acid (DNA, RNA or a chemical analogue) that will bind to the messenger RNA (mRNA) produced by that gene and inactivate it, effectively turning that gene "off1. This is because mRNA has to be single stranded for it to be translated. Alternatively, the nucleic acid might be designed to target / bind a specific site on pre-mRNA and modify the exon content of an mRNA. This synthesized nucleic acid is termed an "anti-sense" oligonucleotide (AON) because its base sequence is complementary to the messenger RNA (mRNA), which is called the "sense" sequence. Because nucleases that cleave the phosphodiester linkage in DNA and RNA are expressed in almost every cell, unmodified nucleic acid are generally degraded before they reach their targets. Therefore, antisense therapeutics are generally chemically modified to prevent degradation.

[0085] Modifications include morpholino oligomers, peptide nucleic acids, and locked nucleic acids. A morpholino oligomer or a phosphorodiamidate morpholino oligomer (PMO) has nucleotide bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Peptide nucleic acids (PNAs) are composed of repeating N-(2- aminoethyl)-glycine units linked by peptide bonds. The various purine and pyrimidine bases are linked to the backbone by a methylene bridge (-CH2-) and a carbonyl group (-(C=O)-). Locked nucleic acids (LNA) have a ribose moiety modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo conformation,

[0086] Double stranded RNA (“dsRNA”) can used to inhibit protein expression. Double stranded RNA induced gene silencing that can occur on at different levels. RNA-guided DNA or histone methylation is a mechanism of transcription inactivation. In this process, small RNA molecules like small interfering RNAs (siRNAs) guide protein complexes, such as the RNA-induced silencing complex (RISC), to specific DNA sequences. Once bound to the DNA, these complexes can direct DNA methylation or induce histone methylation. Direct DNA methylation involves adding methyl groups to certain cytosine bases within the DNA, particularly in the regions known as CpG dinucleotides. DNA methylation in gene promoters and surrounding regions can inhibit transcription factor binding and stabilize nucleosomes, thereby preventing transcription.

[0087] Histone proteins are components of chromatin, which is the complex of DNA and proteins that forms chromosomes. Specific histone modifications, including methylation, can either activate or repress transcription depending on the particular site modified. RNA-guided mechanisms can lead to the recruitment of histone methyltransferases, which add methyl groups to specific histone residues, leading to transcriptional repression

[0088] When short (18-30 bp) RNA duplexes are introduced into mammalian cells in culture, sequence-specific inhibition of target mRNA can be realized. Certain of these short double stranded RNAs, referred to as small inhibitory RNAs (“siRNAs”), can act catalytically to cleave a majority of the target mRNA in the cell. The siRNAs are useful as therapeutic agents against: (1) diseases that are caused by over-expression or misexpression of genes; and (2) diseases brought about by expression of genes that contain mutations.

[0089] The term “siRNA” refers to small inhibitory RNA duplexes that induce the RNA interference (RNAi) pathway. These molecules can vary in length (e.g., 17-30 base pairs) and contain varying degrees of complementarity to their target mRNA in the antisense strand. Some, but not all, siRNA have unpaired overhanging bases on the 5' or 3' end of the sense strand and / or the antisense strand. The term “siRNA” includes duplexes of two separate strands, as well as single strands that can form hairpin structures comprising a duplex region.

[0090] Nuclease enzymes, also referred to as “endonucleases” and “exonucleases” are capable of hydrolyzing polynucleotide chains such as DNA and RNA. Endonucleases cleave the internal phosphodiester bond present in the polynucleotide chain, whereas exonucleases cleave the phosphodiester bond from the 5’ and / or 3’ ends.

[0091] CRISPR / Cas systems, based on an immune system currently found in most bacteria, can be adapted to cut DNA or RNA. In the CRISPR / Cas system, CRISPR is the abbreviation of clustered regularly interspaced short palindromic repeats, which refers to a unique DNA region in the bacterial genome that stores fragments used to guide an immune defense against targets. Cas is the abbreviation for CRISPR-associated proteins (Cas). The Cas proteins cut the target DNA or RNA. The targeting RNA sequence (also referred to as crRNA) produced by CRISPR's transcription recognizes / guides the Cas to target the foreign genetic material for cleavage (endonuclease activity). Cas 12a, Cas 12b, Casl2fl, Cas9, Cpfl, C2cl and C2c2 (also known as Cas 13 a) are other known Cas enzymes known to have endonuclease activity.

[0092] The CRISPR associated endonuclease 9, abbreviated as “Cas9” belongs to the type II CRISPR / Cas system and has endonuclease activity to cut target DNA. Cas9 is guided by a mature crRNA that contains about 20 base pairs (bp) of unique target sequence (called spacer) and a transactivated small RNA (tracrRNA) that serves as a guide for ribonuclease-aided processing of pre- crRNA. The crRNA:tracrRNA duplex directs Cas9 to target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence (called protospacer) on the target DNA. Cas9 recognizes a trinucleotide protospacer adjacent motif (PAM) to specify the cut site (the 3rdnucleotide from PAM). Recombinant crRNA for targeting is typically referred to as “guide RNA” or “gRNA.” The crRNA and tracrRNA may be expressed separately or engineered into an artificial fusion small guide RNA (gRNA) via a synthetic stem loop to mimic the natural crRNA / tracrRNA duplex. Such single stranded guide RNAs (gRNA) typically contain short hairpin (shRNA) motif that can be synthesized or in vitro transcribed for direct RNA transfection or expressed from an RNA expression vector. Typically, the gRNA or crRNA sequence is designed to have a segment with complementarity to a nucleic acid sequence in a target gene. If the target gene is double stranded, complementarity to a sequence in the target gene will necessarily include a sequence segment in the target gene that is the same sequence as in the gRNA or crRNA sequence. Casl2a is capable of directly detecting both DNAand RNA targets and possesses target- activated trans-RNase activity, enabling it to nonspecifically cleave collateral RNA. Targeting MALAT1 mRNA, IncRNA MALAT1

[0093] In certain embodiments, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves MALAT1, MALAT1 RNA, or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent. In certain embodiments, sequences disclosed herein were generated by removing the binding site for miRNA145-5p from the MALAT-1 long non-coding RNA (IncRNA) and by trimming additional nucleotides from MALAT-1 (IncRNA fragmented form), to enable easier delivery / packaging for therapeutic use and removing potential off-target effects.

[0094] In certain embodiments, the MALAT1 IncRNA has the sequence CGCAGCCTGCAGCCCGAGACTTCTGTAAAGGACTGGGGCCCCGCAACTGGCCTCTCC TGCCCTCTTAAGCGCAGCGCCATTTTAGCAACGCAGAAGCCCGGCGCCGGGAAGCCT CAGCTCGCCTGAAGGCAGGTCCCCTCTGACGCCTCCGGGAGCCCAGGTTTCCCAGAG TCCTTGGGACGCAGCGACGAGTTGTGCTGCTATCTTAGCTGTCCTTATAGGCTGGCCA TTCCAGGTGGTGGTATTTAGATAAAACCACTCAAACTCTGCAGTTTGGTCTTGGGGTT TGGAGGAAAGCTTTTATTTTTCTTCCTGCTCCGGTTCAGAAGGTCTGAAGCTCATACC TAACCAGGCATAACACAGAATCTGCAAAACAAAAACCCCTAAAAAAGCAGACCCAG AGCAGTGTAAACACTTCTGGGTGTGTCCCTGACTGGCTGCCCAAGGTCTCTGTGTCTT CGGAGACAAAGCCATTCGCTTAGTTGGTCTACTTTAAAAGGCCACTTGAACTCGCTTT CCATGGCGATTTGCCTTGTGAGCACTTTCAGGAGAGCCTGGAAGCTGAAAAACGGTA GAAAAATTTCCGTGCGGGCCGTGGGGGGCTGGCGGCAACTGGGGGGCCGCAGATCA GAGTGGGCCACTGGCAGCCAACGGCCCCCGGGGCTCAGGCGGGGAGCAGCTCTGTG GTGTGGGATTGAGGCGTTTTCCAAGAGTGGGTTTTCACGTTTCTAAGATTTCCCAAGC AGACAGCCCGTGCTGCTCCGATTTCTCGAACAAAAAAGCAAAACGTGTGGCTGTCTT GGGAGCAAGTCGCAGGACTGCAAGCAGTTGGGGGAGAAAGTCCGCCATTTTGCCAC TTCTCAACCGTCCCTGCAAGGCTGGGGCTCAGTTGCGTAATGGAAAGTAAAGCCCTG AACTATCACACTTTAATCTTCCTTCAAAAGGTGGTAAACTATACCTACTGTCCCTCAAG AGAACACAAGAAGTGCTTTAAGAGGTATTTTAAAAGTTCCGGGGGTTTTGTGAGGTG TTTGATGACCCGTTTAAAATATGATTTCCATGTTTCTTTTGTCTAAAGTTTGCAGCTCA AATCTTTCCACACGCTAGTAATTTAAGTATTTCTGCATGTGTAGTTTGCATTCAAGTTC CATAAGCTGTTAAGAAAAATCTAGAAAAGTAAAACTAGAACCTATTTTTAACCGAAGA ACTACTTTTTGCCTCCCTCACAAAGGCGGCGGAAGGTGATCGAATTCCGGTGATGCG

[0095] AGTTGTTCTCCGTCTATAAATACGCCTCGCCCGAGCTGTGCGGTAGGCATTGAGGCAG

[0096] CCAGCGCAGGGGCTTCTGCTGAGGGGGCAGGCGGAGCTTGAGGAAACCGCAGATAA

[0097] GTTTTTTTCTCTTTGAAAGATAGAGATTAATACAACTACTTAAAAAATATAGTCAATAG

[0098] GTTACTAAGATATTGCTTAGCGTTAAGTTTTTAACGTAATTTTAATAGCTTAAGATTTTA

[0099] AGAGAAAATATGAAGACTTAGAAGAGTAGCATGAGGAAGGAAAAGATAAAAGGTTT

[0100] CTAAAACATGACGGAGGTTGAGATGAAGCTTCTTCATGGAGTAAAAAATGTATTTAAA

[0101] AGAAAATTGAGAGAAAGGACTACAGAGCCCCGAATTAATACCAATAGAAGGGCAATG

[0102] CTTTTAGATTAAAATGAAGGTGACTTAAACAGCTTAAAGTTTAGTTTAAAAGTTGTAG

[0103] GTGATTAAAATAATTTGAAGGCGATCTTTTAAAAAGAGATTAAACCGAAGGTGATTAA

[0104] AAGACCTTGAAATCCATGACGCAGGGAGAATTGCGTCATTTAAAGCCTAGTTAACGC

[0105] ATTTACTAAACGCAGACGAAAATGGAAAGATTAATTGGGAGTGGTAGGATGAAACAA

[0106] TTTGGAGAAGATAGAAGTTTGAAGTGGAAAACTGGAAGACAGAAGTACGGGAAGGC

[0107] GAAGAAAAGAATAGAGAAGATAGGGAAATTAGAAGATAAAAACATACTTTTAGAAGA

[0108] AAAAAGATAAATTTAAACCTGAAAAGTAGGAAGCAGAAGAAAAAAGACAAGCTAGG

[0109] AAACAAAAAGCTAAGGGCAAAATGTACAAACTTAGAAGAAAATTGGAAGATAGAAA

[0110] CAAGATAGAAAATGAAAATATTGTCAAGAGTTTCAGATAGAAAATGAAAAACAAGCT

[0111] AAGACAAGTATTGGAGAAGTATAGAAGATAGAAAAATATAAAGCCAAAAATTGGATA

[0112] AAATAGCACTGAAAAAATGAGGAAATTATTGGTAACCAATTTATTTTAAAAGCCCATC

[0113] AATTTAATTTCTGGTGGTGCAGAAGTTAGAAGGTAAAGCTTGAGAAGATGAGGGTGT

[0114] TTACGTAGACCAGAACCAATTTAGAAGAATACTTGAAGCTAGAAGGGGAAGTTGGTT

[0115] AAAAATCACATCAAAAAGCTACTAAAAGGACTGGTGTAATTTAAAAAAAACTAAGGC

[0116] AGAAGGCTTTTGGAAGAGTTAGAAGAATTTGGAAGGCCTTAAATATAGTAGCTTAGTT

[0117] TGAAAAATGTGAAGGACTTTCGTAACGGAAGTAATTCAAGATCAAGAGTAATTACCA

[0118] ACTTAATGTTTTTGCATTGGACTTTGAGTTAAGATTATTTTTTAAATCCTGAGGACTAG

[0119] CATTAATTGACAGCTGACCCAGGTGCTACACAGAAGTGGATTCAGTGAATCTAGGAA

[0120] GACAGCAGCAGACAGGATTCCAGGAACCAGTGTTTGATGAAGCTAGGACTGAGGAG

[0121] CAAGCGAGCAAGCAGCAGTTCGTGGTGAAGATAGGAAAAGAGTCCAGGAGCCAGTG

[0122] CGATTTGGTGAAGGAAGCTAGGAAGAAGGAAGGAGCGCTAACGATTTGGTGGTGAA

[0123] GCTAGGAAAAAGGATTCCAGGAAGGAGCGAGTGCAATTTGGTGATGAAGGTAGCAG

[0124] GCGGCTTGGCTTGGCAACCACACGGAGGAGGCGAGCAGGCGTTGTGCGTAGAGGAT CCTAGACCAGCATGCCAGTGTGCCAAGGCCACAGGGAAAGCGAGTGGTTGGTAAAA

[0125] ATCCGTGAGGTCGGCAATATGTTGTTTTTCTGGAACTTACTTATGGTAACCTTTTATTTA

[0126] TTTTCTAATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATTTATATGGGGACGT

[0127] AGGCCGATTTCCGGGTGTTGTAGGTTTCTCTTTTTCAGGCTTATACTCATGAATCTTGT

[0128] CTGAAGCTTTTGAGGGCAGACTGCCAAGTCCTGGAGAAATAGTAGATGGCAAGTTTG

[0129] TGGGTTTTTTTTTTTTACACGAATTTGAGGAAAACCAAATGAATTTGATAGCCAAATT

[0130] GAGACAATTTCAGCAAATCTGTAAGCAGTTTGTATGTTTAGTTGGGGTAATGAAGTAT

[0131] TTCAGTTTTGTGAATAGATGACCTGTTTTTACTTCCTCACCCTGAATTCGTTTTGTAAA

[0132] TGTAGAGTTTGGATGTGTAACTGAGGCGGGGGGGAGTTTTCAGTATTTTTTTTTGTGG

[0133] GGGTGGGGGCAAAATATGTTTTCAGTTCTTTTTCCCTTAGGTCTGTCTAGAATCCTAAA

[0134] GGCAAATGACTCAAGGTGTAACAGAAAACAAGAAAATCCAATATCAGGATAATCAGA

[0135] CCACCACAGGTTTACAGTTTATAGAAACTAGAGCAGTTCTCACGTTGAGGTCTGTGG

[0136] AAGAGATGTCCATTGGAGAAATGGCTGGTAGTTACTCTTTTTTCCCCCCACCCCCTTA

[0137] ATCAGACTTTAAAAGTGCTTAACCCCTTAAACTTGTTATTTTTTACTTGAAGCATTTTG

[0138] GGATGGTCTTAACAGGGAAGAGAGAGGGTGGGGGAGAAAATGTTTTTTTCTAAGATT

[0139] TTCCACAGATGCTATAGTACTATTGACAAACTGGGTTAGAGAAGGAGTGTACCGCTGT

[0140] GCTGTTGGCACGAACACCTTCAGGGACTGGAGCTGCTTTTATCCTTGGAAGAGTATTC

[0141] CCAGTTGAAGCTGAAAAGTACAGCACAGTGCAGCTTTGGTTCATATTCAGTCATCTCA

[0142] GGAGAACTTCAGAAGAGCTTGAGTAGGCCAAATGTTGAAGTTAAGTTTTCCAATAAT

[0143] GTGACTTCTTAAAAGTTTTATTAAAGGGGAGGGGCAAATATTGGCAATTAGTTGGCAG

[0144] TGGCCTGTTACGGTTGGGATTGGTGGGGTGGGTTTAGGTAATTGTTTAGTTTATGATTG

[0145] CAGATAAACTCATGCCAGAGAACTTAAAGTCTTAGAATGGAAAAAGTAAAGAAATAT

[0146] CAACTTCCAAGTTGGCAAGTAACTCCCAATGATTTAGTTTTTTTCCCCCCAGTTTGAAT

[0147] TGGGAAGCTGGGGGAAGTTAAATATGAGCCACTGGGTGTACCAGTGCATTAATTTGG

[0148] GCAAGGAAAGTGTCATAATTTGATACTGTATCTGTTTTCCTTCAAAGTATAGAGCTTTT

[0149] GGGGAAGGAAAGTATTGAACTGGGGGTTGGTCTGGCCTACTGGGCTGACATTAACTA

[0150] CAATTATGGGAAATGCAAAAGTTGTTTGGATATGGTAGTGTGTGGTTCTCTTTTGGAAT

[0151] TTTTTTCAGGTGATTTAATAATAATTTAAAACTACTATAGAAACTGCAGAGCAAAGGA

[0152] AGTGGCTTAATGATCCTGAAGGGATTTCTTCTGATGGTAGCTTTTGTATTATCAAGTAA

[0153] GATTCTATTTTCAGTTGTGTGTAAGCAAGTTTTTTTTTAGTGTAGGAGAAATACTTTTC

[0154] CATTGTTTAACTGCAAAACAAGATGTTAAGGTATGCTTCAAAAATTTTGTAAATTGTTT ATTTTAAACTTATCTGTTTGTAAATTGTAACTGATTAAGAATTGTGATAGTTCAGCTTG

[0155] AATGTCTCTTAGAGGGTGGGCTTTTGTTGATGAGGGAGGGGAAACTTTTTTTTTTTCT

[0156] ATAGACTTTTTTCAGATAACATCTTCTGAGTCATAACCAGCCTGGCAGTATGATGGCCT

[0157] AGATGCAGAGAAAACAGCTCCTTGGTGAATTGATAAGTAAAGGCAGAAAAGATTATA

[0158] TGTCATACCTCCATTGGGGAATAAGCATAACCCTGAGATTCTTACTACTGATGAGAAC

[0159] ATTATCTGCATATGCCAAAAAATTTTAAGCAAATGAAAGCTACCAATTTAAAGTTACGG

[0160] AATCTACCATTTTAAAGTTAATTGCTTGTCAAGCTATAACCACAAAAATAATGAATTGA

[0161] TGAGAAATACAATGAAGAGGCAATGTCCATCTCAAAATACTGCTTTTACAAAAGCAG

[0162] AATAAAAGCGAAAAGAAATGAAAATGTTACACTACATTAATCCTGGAATAAAAGAAG

[0163] CCGAAATAAATGAGAGATGAGTTGGGATCAAGTGGATTGAGGAGGCTGTGCTGTGTG

[0164] CCAATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTT

[0165] CATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAACAGATAAGTTTAACTTGCATCTG

[0166] CAGTATTGCATGTTAGGGATAAGTGCTTATTTTTAAGAGCTGTGGAGTTCTTAAATATC

[0167] AACCATGGCACTTTCTCCTGACCCCTTCCCTAGGGGATTTCAGGATTGAGAAATTTTT

[0168] CCATCGAGCCTTTTTAAAATTGTAGGACTTGTTCCTGTGGGCTTCAGTGATGGGATAG

[0169] TACACTTCACTCAGAGGCATTTGCATCTTTAAATAATTTCTTAAAAGCCTCTAAAGTGA

[0170] TCAGTGCCTTGATGCCAACTAAGGAAATTTGTTTAGCATTGAATCTCTGAAGGCTCTAT

[0171] GAAAGGAATAGCATGATGTGCTGTTAGAATCAGATGTTACTGCTAAAATTTACATGTTG

[0172] TGATGTAAATTGTGTAGAAAACCATTAAATCATTCAAAATAATAAACTATTTTTATTAGA

[0173] GAATGTATACTTTTAGAAAGCTGTCTCCTTATTTAAATAAAATAGTGTTTGTCTGTAGTT

[0174] CAGTGTTGGGGCAATCTTGGGGGGGATTCTTCTCTAATCTTTCAGAAACTTTGTCTGC

[0175] GAACACTCTTTAATGGACCAGATCAGGATTTGAGCGGAAGAACGAATGTAACTTTAA

[0176] GGCAGGAAAGACAAATTTTATTCTTCATAAAGTGATGAGCATATAATAATTCCAGGCA

[0177] CATGGCAATAGAGGCCCTCTAAATAAGGAATAAATAACCTCTTAGACAGGTGGGAGAT

[0178] TATGATCAGAGTAAAAGGTAATTACACATTTTATTTCCAGAAAGTCAGGGGTCTATAAA

[0179] TTGACAGTGATTAGAGTAATACTTTTTCACATTTCCAAAGTTTGCATGTTAACTTTAAA

[0180] TGCTTACAATCTTAGAGTGGTAGGCAATGTTTTACACTATTGACCTTATATAGGGAAGG

[0181] GAGGGGGTGCCTGTGGGGTTTTAAAGAATTTTCCTTTGCAGAGGCATTTCATCCTTCA

[0182] TGAAGCCATTCAGGATTTTGAATTGCATATGAGTGCTTGGCTCTTCCTTCTGTTCTAGT

[0183] GAGTGTATGAGACCTTGCAGTGAGTTTATCAGCATACTCAAAATTTTTTTCCTGGAATT

[0184] TGGAGGGATGGGAGGAGGGGGTGGGGCTTACTTGTTGTAGCTTTTTTTTTTTTTACAG ACTTCACAGAGAATGCAGTTGTCTTGACTTCAGGTCTGTCTGTTCTGTTGGCAAGTAA

[0185] ATGCAGTACTGTTCTGATCCCGCTGCTATTAGAATGCATTGTGAAACGACTGGAGTAT

[0186] GATTAAAAGTTGTGTTCCCCAATGCTTGGAGTAGTGATTGTTGAAGGAAAAAATCCA

[0187] GCTGAGTGATAAAGGCTGAGTGTTGAGGAAATTTCTGCAGTTTTAAGCAGTCGTATTT

[0188] GTGATTGAAGCTGAGTACATTTTGCTGGTGTATTTTTAGGTAAAATGCTTTTTGTTCAT

[0189] TTCTGGTGGTGGGAGGGGACTGAAGCCTTTAGTCTTTTCCAGATGCAACCTTAAAATC

[0190] AGTGACAAGAAACATTCCAAACAAGCAACAGTCTTCAAGAAATTAAACTGGCAAGT

[0191] GGAAATGTTTAAACAGTTCAGTGATCTTTAGTGCATTGTTTATGTGTGGGTTTCTCTCT

[0192] CCCCTCCCTTGGTCTTAATTCTTACATGCAGGAACACTCAGCAGACACACGTATGCGA

[0193] AGGGCCAGAGAAGCCAGACCCAGTAAGAAAAAATAGCCTATTTACTTTAAATAAACC

[0194] AAACATTCCATTTTAAATGTGGGGATTGGGAACCACTAGTTCTTTCAGATGGTATTCTT

[0195] CAGACTATAGAAGGAGCTTCCAGTTGAATTCACCAGTGGACAAAATGAGGAAAACA

[0196] GGTGAACAAGCTTTTTCTGTATTTACATACAAAGTCAGATCAGTTATGGGACAATAGT

[0197] ATTGAATAGATTTCAGCTTTATGCTGGAGTAACTGGCATGTGAGCAAACTGTGTTGGC

[0198] GTGGGGGTGGAGGGGTGAGGTGGGCGCTAAGCCTTTTTTTAAGATTTTTCAGGTACC

[0199] CCTCACTAAAGGCACCGAAGGCTTAAAGTAGGACAACCATGGAGCCTTCCTGTGGCA

[0200] GGAGAGACAACAAAGCGCTATTATCCTAAGGTCAAGAGAAGTGTCAGCCTCACCTGA

[0201] TTTTTATTAGTAATGAGGACTTGCCTCAACTCCCTCTTTCTGGAGTGAAGCATCCGAA

[0202] GGAATGCTTGAAGTACCCCTGGGCTTCTCTTAACATTTAAGCAAGCTGTTTTTATAGCA

[0203] GCTCTTAATAATAAAGCCCAAATCTCAAGCGGTGCTTGAAGGGGAGGGAAAGGGGGA

[0204] AAGCGGGCAACCACTTTTCCCTAGCTTTTCCAGAAGCCTGTTAAAAGCAAGGTCTCC

[0205] CCACAAGCAACTTCTCTGCCACATCGCCACCCCGTGCCTTTTGATCTAGCACAGACCC

[0206] TTCACCCCTCACCTCGATGCAGCCAGTAGCTTGGATCCTTGTGGGCATGATCCATAATC

[0207] GGTTTCAAGGTAACGATGGTGTCGAGGTCTTTGGTGGGTTGAACTATGTTAGAAAAG

[0208] GCCATTAATTTGCCTGCAAATTGTTAACAGAAGGGTATTAAAACCACAGCTAAGTAGC

[0209] TCTATTATAATACTTATCCAGTGACTAAAACCAACTTAAACCAGTAAGTGGAGAAATAA

[0210] CATGTTCAAGAACTGTAATGCTGGGTGGGAACATGTAACTTGTAGACTGGAGAAGAT

[0211] AGGCATTTGAGTGGCTGAGAGGGCTTTTGGGTGGGAATGCAAAAATTCTCTGCTAAG

[0212] ACTTTTTCAGGTGAACATAACAGACTTGGCCAAGCTAGCATCTTAGCGGAAGCTGATC

[0213] TCCAATGCTCTTCAGTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAACAACACGTA

[0214] TTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAGCAAA AGATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAATCCCTGCGGCGT CTTTGCTTTGACTACTAATCTGTCTTCAGGACTCTTTCTGTATTTCTCCTTTTCTCTGCA GGTGCTAGTTCTTGGAGTTTTGGGGAGGTGGGAGGTAACAGCACAATATCTTTGAAC TATATACATCCTTGATGTATAATTTGTCAGGAGCTTGACTTGATTGTATATTCATATTTAC ACGAGAACCTAATATAACTGCCTTGTCTTTTTCAGGTAATAGCCTGCAGCTGGTGTTTT GAGAAGCCCTACTGCTGAAAACTTAACAATTTTGTGTAATAAAAATGGAGAAGCTCTA AATTGTTGTGGTTCTTTTGTGAATAAAAAAATCTTGATTGGGGAAAAAA (SEQ ID NO:1).

[0215] In certain embodiments, this disclosure relates to compositions comprising a nucleic acid comprising SEQ ID NOs: 1-3. In certain embodiments, the composition is in the form of an aqueous pH buffer saline solution.

[0216] In certain embodiments, the therapeutic agent that binds or cleaves the MALAT1 RNA is siRNA comprising a sense region and an antisense region, wherein said sense region and said antisense region together form a duplex region, said antisense and said sense regions are each are between 18-30 nucleotides in length within SEQ ID NOs: 1-3.

[0217] In certain embodiments, the nucleic acid that targets MALAT1 is a nucleic acid that hybridizes with or binds to a segment of the MALAT1 RNA of SEQ ID NOs: 1-3. In certain embodiments, the MALAT1 inhibitor is siRNA or an antisense therapy.

[0218] In certain embodiments, the MALAT1 RNA has the sequence CATTTACTAAACGCAGACGAAAATGGAAAGATTAATTGGGAGTGGTAGGATGAAACA ATTTGGAGAAGATAGAAGTTTGAAGTGGAAAACTGGAAGACAGAAGTACGGGAAGG CGAAGAAAAGAATAGAGAAGATAGGGAAATTAGAAGATAAAAACATACTTTTAGAAG AAAAAAGATAAATTTAAACCTGAAAAGTAGGAAGCAGAAGAAAAAAGACAAGCTAG GAAACAAAAAGCTAAGGGCAAAATGTACAAACTTAGAAGAAAATTGGAAGATAGAA ACAAGATAGAAAATGAAAATATTGTCAAGAGTTTCAGATAGAAAATGAAAAACAAGC TAAGACAAGTATTGGAGAAGTATAGAAGATAGAAAAATATAAAGCCAAAAATTGGATA AAATAGCACTGAAAAAATGAGGAAATTATTGGTAACCAATTTATTTTAAAAGCCCATC AATTTAATTTCTGGTGGTGCAGAAGTTAGAAGGTAAAGCTTGAGAAGATGAGGGTGT TTACGTAGACCAGAACCAATTTAGAAGAATACTTGAAGCTAGAAGGGGAAGTTGGTT AAAAATCACATCAAAAAGCTACTAAAAGGACTGGTGTAATTTAAAAAAAACTAAGGC AGAAGGCTTTTGGAAGAGTTAGAAGAATTTGGAAGGCCTTAAATATAGTAGCTTAGTT TGAAAAATGTGAAGGACTTTCGTAACGGAAGTAATTCAAGATCAAGAGTAATTACCA ACTTAATGTTTTTGCATTGGACTTTGAGTTAAGATTATTTTTTAAATCCTGAGGACTAG CATTAATTGACAGCTGACCCAGGTGCTACACAGAAGTGGATTCAGTGAATCTAGGAA GACAGCAGCAGACAGGATTCCAGGAACCAGTGTTTGATGAAGCTAGGACTGAGGAG CAAGCGAGCAAGCAGCAGTTCGTGGTGAAGATAGGAAAAGAGTCCAGGAGCCAGTG CGATTTGGTGAAGGAAGCTAGGAAGAAGGAAGGAGCGCTAACGATTTGGTGGTGAA GCTAGGAAAAAGGATTCCAGGAAGGAGCGAGTGCAATTTGGTGATGAAGGTAGCAG GCGGCTTGGCTTGGCAACCACACGGAGGAGGCGAGCAGGCGTTGTGCGTAGAGGAT CCTAGACCAGCATGCCAGTGTGCCAAGGCCACAGGGAAAGCGAGTGGTTGGTAAAA ATCCGTGAGGTCGGCAATATGTTGTTTTTCTGGAACTTACTTATGGTAACCTTTTATTTA TTTTCTAATATAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATTTATATGGGGACGT AGGCCGATTTCCGGGTGTTGTAGGTTTCTCTTTTTCAGGCTTATACTCATGAATCTTGT CTGAAGCTTTTGAGGGCAGACTGCCAAGTCCTGGAGAAATAGTAGATGGCAAGTTTG TGGGTTTTTTTTTTTTACACGAATTTGAGGAAAACCAAATGAATTTGATAGCCAAATT GAGACAATTTCAGCAAATCTGTAAGCAGTTTGTATGTTTAGTTGGGGTAATGAAGTAT TTCAGTTTTGTGAATAGATGACCTGTTTTTACTTCCTCACCCTGAATTCGTTTTGTAAA TGTAGAGTTTGGATGTGTAACTGAGGCGGG (SEQ ID NO: 2, IncRNA MALATl fragment)

[0219] In certain embodiments, this disclosure relates to pharmaceutical compositions comprising a nucleic acid comprising SEQ ID NO: 2 or 3 or fragment thereof and a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition is in the form of an aqueous pH buffer saline solution. In certain embodiments, the pharmaceutical composition is in the form of lipid nanoparticles.

[0220] In certain embodiments, the therapeutic agent that binds or cleaves the MALAT1 inhibitor is siRNA comprising a sense region and an antisense region, wherein said sense region and said antisense region together form a duplex region, said antisense region and said sense region are each are between 18-30 nucleotides in length within SEQ ID NO: 2.

[0221] In certain embodiments, the nucleic acid that target MALAT1 RNA is a nucleic acid that hybridizes with or binds to a segment of the RNA MALAT1 of SEQ ID NO: 2. In certain embodiments, the MALAT1 inhibitor is siRNA or an antisense therapy. In certain embodiments, the MALAT1 RNA inhibitor is siRNA or an antisense therapy comprising a segment of SEQ ID NO: 2. In certain embodiments, the nucleic acid that targets MALAT1 RNA is a nucleic acid that hybridizes with or binds to a segment of the MALAT1 RNA of SEQ ID NO: 3. In certain embodiments, the MALAT1 inhibitor is siRNA or an antisense therapy. In certain embodiments, the nucleic acid is IncRNAMALATl fragment with a deletion having the sequence

[0222] CATTTACTAAACGCAGACGAAAATGGAAAGATTAATTGGGAGTGGTAGGATGA AACAATTTGGAGAAGATAGAAGTTTGAAGTGACAGAAGTACGGGAAGGCGAAGAAA AGAATAGAGAAGATAGGGAAATTAGAAGATAAAAACATACTTTTAGAAGAAAAAAGA TAAATTTAAACCTGAAAAGTAGGAAGCAGAAGAAAAAAGACAAGCTAGGAAACAAA AAGCTAAGGGCAAAATGTACAAACTTAGAAGAAAATTGGAAGATAGAAACAAGATA GAAAATGAAAATATTGTCAAGAGTTTCAGATAGAAAATGAAAAACAAGCTAAGACAA GTATTGGAGAAGTATAGAAGATAGAAAAATATAAAGCCAAAAATTGGATAAAATAGCA CTGAAAAAATGAGGAAATTATTGGTAACCAATTTATTTTAAAAGCCCATCAATTTAATT TCTGGTGGTGCAGAAGTTAGAAGGTAAAGCTTGAGAAGATGAGGGTGTTTACGTAGA CCAGAACCAATTTAGAAGAATACTTGAAGCTAGAAGGGGAAGTTGGTTAAAAATCAC ATCAAAAAGCTACTAAAAGGACTGGTGTAATTTAAAAAAAACTAAGGCAGAAGGCTT TTGGAAGAGTTAGAAGAATTTGGAAGGCCTTAAATATAGTAGCTTAGTTTGAAAAATG TGAAGGACTTTCGTAACGGAAGTAATTCAAGATCAAGAGTAATTACCAACTTAATGTT TTTGCATTGGACTTTGAGTTAAGATTATTTTTTAAATCCTGAGGACTAGCATTAATTGA CAGCTGACCCAGGTGCTACACAGAAGTGGATTCAGTGAATCTAGGAAGACAGCAGC AGACAGGATTCCAGGAACCAGTGTTTGATGAAGCTAGGACTGAGGAGCAAGCGAGC AAGCAGCAGTTCGTGGTGAAGATAGGAAAAGAGTCCAGGAGCCAGTGCGATTTGGT GAAGGAAGCTAGGAAGAAGGAAGGAGCGCTAACGATTTGGTGGTGAAGCTAGGAAA AAGGATTCCAGGAAGGAGCGAGTGCAATTTGGTGATGAAGGTAGCAGGCGGCTTGG CTTGGCAACCACACGGAGGAGGCGAGCAGGCGTTGTGCGTAGAGGATCCTAGACCA GCATGCCAGTGTGCCAAGGCCACAGGGAAAGCGAGTGGTTGGTAAAAATCCGTGAG GTCGGCAATATGTTGTTTTTCTGGAACTTACTTATGGTAACCTTTTATTTATTTTCTAATA TAATGGGGGAGTTTCGTACTGAGGTGTAAAGGGATTTATATGGGGACGTAGGCCGATT TCCGGGTGTTGTAGGTTTCTCTTTTTCAGGCTTATACTCATGAATCTTGTCTGAAGCTT TTGAGGGCAGACTGCCAAGTCCTGGAGAAATAGTAGATGGCAAGTTTGTGGGTTTTTTTTTTTTACACGAATTTGAGGAAAACCAAATGAATTTGATAGCCAAATTGAGACAATTTCAGCAAATCTGTAAGCAGTTTGTATGTTTAGTTGGGGTAATGAAGTATTTCAGTTTTG TGAATAGATGACCTGTTTTTACTTCCTCACCCTGAATTCGTTTTGTAAATGTAGAGTTT GGATGTGTAACTGAGGCGGG (SEQ ID NO: 3, IncRNAMALATl fragment with deletion).

[0223] In certain embodiments, this disclosure relates to pharmaceutical compositions comprising a nucleic acid comprising SEQ ID NOs: 1, 2 and / or 3 and a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition is in the form of an aqueous pH buffer saline solution. In certain embodiments, the pharmaceutical composition is in the form of lipid nanoparticles.

[0224] In certain embodiments, the therapeutic agent that binds or cleaves the MALAT1 RNA fragment with deletion inhibitor is siRNA comprising a sense region and an antisense region, wherein said sense region and said antisense region together form a duplex region, said antisense region and said sense region are each are between 18-30 nucleotides in length within SEQ ID NOs: 1, 2, or 3.

[0225] In certain embodiments, the therapeutic agent that binds or cleaves MALAT1 RNA as in any of SEQ ID NO: 1-3 or protein expressed therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), gapmer, microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0226] In certain embodiments, this disclosure relates to methods of treating or preventing lung fibrosis comprising administering by inhalation to the lung an effective amount of therapeutic agents disclosed herein to a subject in need thereof.

[0227] In certain embodiments, this disclosure relates to methods of treating or preventing chronic lung disease or interstitial lung disease comprising administering by inhalation to the lung an effective amount of therapeutic agents disclosed herein to a subject in need thereof.

[0228] In certain embodiments, administration is by inhalation of an aerosol of therapeutic agents disclosed herein in the pulmonary airway. In certain embodiments, administration is by inhalation of therapeutic agents disclosed herein through the mouth and / or nose.

[0229] In certain embodiments, administration is by a metered-dose inhaler. In certain embodiments, administration is by a single or multiple dose dry powder inhaler. In certain embodiments, administration is by a nebulizer. In certain embodiments, is a jet nebulizer driven by compressed air. In certain embodiments, the nebulizer is an ultrasonic nebulizer having a piezoelectric transducer for creating droplets from a liquid reservoir. In certain embodiments, the nebulizer is vibrating mesh nebulizer having perforated membranes actuated by an annular piezo element that vibrates in resonant bending mode.

[0230] In certain embodiments, administration is by intratracheal instillation, e.g., using a syringe.

[0231] In certain embodiments, therapeutic agents disclosed herein are administered in combination with another active agent such as a bronchodilator, corticosteroid, antimuscarinic, antibiotic, nintedanib, pirfenidone, or combinations thereof.

[0232] In certain embodiments, the bronchodilator is a beta-2 agonist, such as salbutamol, salmeterol, formoterol and vilanterol or an anticholinergic, such as ipratropium, tiotropium, aclidinium, or glycopyrronium, or an antimuscarinic such as atropine or scopolamine, or theophylline.

[0233] In certain embodiments, therapeutic agents disclosed herein are administered in combination with a bronchodilator such as albuterol, formoterol, or levalbuterol or salts thereof.

[0234] In certain embodiments, therapeutic agents disclosed herein are administered in combination with a mucolytic agent such as bromhexine or salts thereof.

[0235] In certain embodiments, therapeutic agents disclosed herein are administered in combination with is administered in combination with an anti-inflammatory agent such as a corticosteroid, fluticasone, or salts thereof.

[0236] In certain embodiments, therapeutic agents disclosed herein are administered in combination with an antibiotic agent such as macrolides, azithromycin, antipseudomonal, fluoroquinolones, ciprofloxacin, levofloxacin, ceftazidime, piperacillin and tazobactam, imipenem, aminoglycosides, aztreonam, tobramycin, colistin, colistimethate sodium, or salt thereof.

[0237] In certain embodiments, therapeutic agents disclosed herein are administered in combination with a cystic fibrosis drug such as lumacaftor, elexacaftor, ivacaftor, tezacaftor, cavosonstat, olacaftor, posenacaftor, galicaftor, navocaftor, deutivacaftor, nesolicaftor, or combinations thereof.

[0238] In certain embodiments, therapeutic agents disclosed herein are administered in combination with other pharmaceutically active agents. These compounds include but are not limited to analgesics, anti-inflammatory drugs, antipyretics, antidepressants, antiepileptics, antihistamines, antimigraine drugs, antimuscarinics, anxiolytics, sedatives, hypnotics, antipsychotics, bronchodilators, anti-asthma drugs, cardiovascular drugs, corticosteroids, dopaminergics, electrolytes, gastro-intestinal drugs, muscle relaxants, nutritional agents, vitamins, parasympathomimetics, stimulants, anorectics, and anti-narcoleptics.

[0239] In certain embodiments, therapeutic agents disclosed herein are can be adjunctively administered with aceclofenac, acetaminophen, atomoxetine, almotriptan, alprazolam, amantadine, amcinonide, aminocyclopropane, amitriptyline, amlodipine, amoxapine, amphetamine, aripiprazole, aspirin, atomoxetine, azasetron, azatadine, beclomethasone, benactyzine, benoxaprofen, bermoprofen, betamethasone, bicifadine, bromocriptine, budesonide, buprenorphine, bupropion, buspirone, butorphanol, butriptyline, caffeine, carbamazepine, carbidopa, carisoprodol, celecoxib, chlordiazepoxide, chlorpromazine, choline salicylate, citalopram, clomipramine, clonazepam, clonidine, clonitazene, clorazepate, clotiazepam, cloxazolam, clozapine, codeine, corticosterone, cortisone, cyclobenzaprine, cyproheptadine, demexiptiline, desipramine, desomorphine, dexamethasone, dexanabinol, dextroamphetamine sulfate, dextromoramide, dextropropoxyphene, dezocine, diazepam, dibenzepin, diclofenac sodium, diflunisal, dihydrocodeine, dihydroergotamine, dihydromorphine, dimetacrine, divalproex, dizatriptan, dolasetron, donepezil, dothiepin, doxepin, duloxetine, ergotamine, escitalopram, estazolam, ethosuximide, etodolac, femoxetine, fenamates, fenoprofen, fentanyl, fludiazepam, fluoxetine, fluphenazine, flurazepam, flurbiprofen, flutazolam, fluvoxamine, frovatriptan, gabapentin, galantamine, gepirone, granisetron, haloperidol, huperzine A, hydrocodone, hydrocortisone, hydromorphone, hydroxyzine, ibuprofen, imipramine, indiplon, indomethacin, indoprofen, iprindole, ipsapirone, ketanserin, ketoprofen, ketorolac, lesopitron, levodopa, lipase, lofepramine, lorazepam, loxapine, maprotiline, mazindol, mefenamic acid, melatonin, melitracen, memantine, meperidine, meprobamate, mesalamine, metapramine, metaxalone, methadone, methadone, methamphetamine, methocarbamol, methyldopa, methylphenidate, methylsalycylate, metoclopramide, mianserin, mifepristone, milnacipran, minaprine, mirtazapine, moclobemide, molindone, morphine, morphine hydrochloride, nabumetone, nadolol, naproxen, naratriptan, nefazodone, neurontin, nomifensine, nortriptyline, olanzapine, olsalazine, ondansetron, opipramol, orphenadrine, oxaflozane, oxaprozin, oxazepam, oxitriptan, oxycodone, oxymorphone, pancrelipase, parecoxib, paroxetine, pemoline, pentazocine, pepsin, perphenazine, phenacetin, phendimetrazine, phenmetrazine, phenylbutazone, phenytoin, phosphatidyl serine, pimozide, pirlindole, piroxicam, pizotifen, pizotyline, pramipexole, prednisolone, prednisone, pregabalin, propranolol, propizepine, propoxyphene, protriptyline, quazepam, quinupramine, reboxetine, reserpine, risperidone, ritanserin, rivastigmine, rizatriptan, rofecoxib, ropinirole, rotigotine, salsalate, sertraline, sibutramine, sildenafil, sulfasalazine, sulindac, sumatriptan, tacrine, temazepam, tetrabenazine, thiazides, thioridazine, thiothixene, tiapride, taziprinone, tizanidine, tofenacin, tolmetin, toloxatone, topiramate, tramadol, trazodone, triazolam, trifluoperazine, trimethobenzamide, trimipramine, tropisetron, valdecoxib, valproic acid, venlafaxine, viloxazine, vitamin E, zimeldine, ziprasidone, zolmitriptan, zolpidem, zopiclone, and combinations thereof.

[0240] In certain embodiments, this disclosure relates to compositions and devices disclosed herein that contain the therapeutic agents disclosed herein.

[0241] Therapeutic agents that bind or cleave HDAC11 mRNA

[0242] Although it is contemplated that embodiments of this disclosure function by inhibiting the defatty -acylase activity of HD AC 11, it is not intended that the claims to a “HDAC11 inhibitor” be limited by any particular mechanism. It is contemplated that the HDAC11 inhibitor functions has its therapeutic effect as an inhibitor of lysine defatty-acylase, histone deacetylase activity, or by some other unappreciated mechanism, or combinations thereof.

[0243] In certain embodiments, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves an HD AC, HD AC 11 mRNA or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent. In certain embodiments, the inhibitor of defatty-acylase activity HD AC 11 is N'-hexadecylthiophene-2-carbohydrazide (SIS 17), salt, or derivative thereof.

[0244] In certain embodiments, the inhibitor of defatty-acylase HDAC activity is 5-(2-(3,4- di chi orobenzamido)ethyl)-N-hydroxyisoxazole-3 -carboxamide (SS-208), salt, or derivative thereof.

[0245] In certain embodiments, the HDAC inhibitor is N-(((3r,5r,7r)-adamantan-l-yl)methyl)-l- (4-(hydroxycarbamoyl)-3-methoxybenzyl)-lH-indole-5-carboxamide (PB94), salt, or derivative thereof.

[0246] In certain embodiments, the HDAC inhibitor is 5-((6-([l,l'-biphenyl]-4-yl)-4-oxo-l,4- dihydropyrimidin-2-yl)thio)-N-hydroxypentanamide (MCI 742), salt, or derivative thereof. In certain embodiments, the HD AC inhibitor is 3-(3'-(adamantan-l-yl)-4'-((l- (hydroxyamino)-l-oxopropan-2-yl)oxy)-[l,l'-biphenyl]-4-yl)acrylic acid (GEM144), salt, or derivative thereof.

[0247] In certain embodiments, the HDAC inhibitor is 4-(N-(4-(tert-butyl)benzyl)-2-((4-fluoro- N-((perfluorophenyl)methyl)phenyl)sulfonamido)acetamido)-N-hydroxybenzamide (AES- 135), salt, or derivative thereof.

[0248] In certain embodiments, the HDAC inhibitor is 6-((9S,12S,15S)-12-((S)-sec-butyl)- 8,11,14, 17-tetraoxo- 15-(2-(trifluoromethyl)benzyl)-3 ,20-dithia-7, 10, 13 , 16-tetraaza- 1 (2,6)- pyridinacyclohenicosaphane-9-yl)-N-hexyl-N-hydroxyhexanamide (HDAC 11 -IN- 1), salt, or derivative thereof.

[0249] In certain embodiments, the HDAC inhibitor is N-((6-(hydroxyamino)-6-oxohexyl)oxy)- 3,5-dimethylbenzamide (LMK-235), salt, or derivative thereof.

[0250] In certain embodiments, the HDAC inhibitor is N-(4-(2-(5-(pentyloxy)pentyl)hydrazine-l- carbonyl)benzyl)benzamide (HDAC11-IN-2), salt, or derivative thereof.

[0251] In certain embodiments, the HDAC inhibitor is N-hydroxy-l,l-dimethyl-2-(5- (trifluoromethyl)pyrazin-2-yl)isoindoline-4-carboxamide (FT895), salt, or derivative thereof.

[0252] In certain embodiments, the HDAC inhibitor is 4-((6-chloro-3,4-dihydroquinolin-l(2H)- yl)methyl)-N-hydroxybenzamide (SW-100), salt, or derivative thereof.

[0253] In certain embodiments, the HDAC inhibitor is elevenostat, domatinostat, bavarostat, leuxinostat, purinostat, vorinostat, mocetinostat, quisinostat, givinostat, fimepinostat, pracinostat, nexturastat A, tubacin, salt, or derivative thereof.

[0254] In certain embodiments, the therapeutic agent binds or cleaves HDAC 11 RNA having the sequence

[0255] GGTCGCGGAGCTGCGGCCAGCTTTGGGAGGGCCGGCCCCGGGATGTGAGTGC CGCGGGGCGAGGGCGGGGGTGGGCTCCCAGGGGTCCCGGTGGGCGGGCGCGCTAGG GCGAGGGCGGGGACGGCCGGGCGGGCGCGCCAGGCTACACACAACCCAGCTGTACC AGCATGTGCCAGAGACACGCTGGCCAATCGTGTACTCGCCGCGCTACAACATCACCT TCATGGGCCTGGAGAAGCTGCATCCCTTTGATGCCGGAAAATGGGGCAAAGTGATCA ATTTCCTAAAAGAAGAGAAGCTTCTGTCTGACAGCATGCTGGTGGAGGCGCGGGAGG CCTCGGAGGAGGACCTGCTGGTGGTGCACACGAGGCGCTATCTTAATGAGCTCAAGA GGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACCATAATGGCGGGGAAG CTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCTCC

[0256] AGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTT

[0257] CTGTTTGAGCGTGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATC

[0258] AGGGCAATGGGCATGAGCGAGACTTCATGGACGACAAGCGTGTGTACATCATGGATG

[0259] TCTACAACCGCCACATCTACCCAGGGGACCGCTTTGCCAAGCAGGCCATCAGGCGGA

[0260] AGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGTGGAGAGG

[0261] AACATCAAGAAATCCCTCCAGGAGCACCTGCCCGACGTGGTGGTATACAATGCAGGC

[0262] ACCGACATCCTCGAGGGGGACCGCCTTGGGGGGCTGTCCATCAGCCCAGCGGGCATC

[0263] GTGAAGCGGGATGAGCTGGTGTTCCGGATGGTCCGTGGCCGCCGGGTGCCCATCCTT

[0264] ATGGTGACCTCAGGCGGGTACCAGAAGCGCACAGCCCGCATCATTGCTGACTCCATA

[0265] CTTAATCTGTTTGGCCTGGGGCTCATTGGGCCTGAGTCACCCAGCGTCTCCGCACAGA

[0266] ACTCAGACACACCGCTGCTTCCCCCTGCAGTGCCCTGACCCTTGCTGCCCTGCCTGTC

[0267] ACGTGGCCCTGCCTATCCGCCCCTTAGTGCTTTTTGTTTTCTAACCTCATGGGGTGGTG

[0268] GAGGCAGCCTTCAGTGAGCATGGAGGGGCAGGGCCATCCCTGGCTGGGGCCTGGAG

[0269] CTGGCCCTTCCTCTACTTTTCCCTGCTGGAAGCCAGAAGGGCTTGAGGCCTCTATGGG

[0270] TGGGGGCAGAAGGCAGAGCCTGTGTCCCAGGGGGACCCACACGAAGTCACCAGCCC

[0271] ATAGGTCCAGGGAGGCAGGCAGTTAACTGAGAATTGGAGAGGACAGGCTAGGTCCC

[0272] AGGCACAGCGAGGGCCCTGGGCTTGGGGTGTTCTGGTTTTGAGAACGGCAGACCCA

[0273] GGTCGGAGTGAGGAAGCTTCCACCTCCATCCTGACTAGGCCTGCATCCTAACTGGGC

[0274] CTCCCTCCCTCCCCTTGGTCATGGGATTTGCTGCCCTCTTTGCCCCAGAGCTGAAGAG

[0275] CTATAGGCACTGGTGTGGATGGCCCAGGAGGTGCTGGAGCTAGGTCTCCAGGTGGGC

[0276] CTGGTTCCCAGGCAGCAGGTGGGAACCCTGGGCCTGGATGTGAGGGGCGGTCAGGA

[0277] AGGGGTACAGGTGGGTTCCCTCATCTGGAGTTCCCCCTCAATAAAGCAAGGTCTGGA

[0278] CCTGCCTTCCCAGGCCCTTCTGTGGGGGTGAAGGTGGGGAAGGCCTGCGGCGCCCA

[0279] GATCACTGCCTTAGCAGTAGTCTTGCCTGTTCAGTGCAAGGGGCAGGTTTTGGGGGG

[0280] AGGAATTCTTAGCGCAAGGACGGGCCTCAGCCCTGTCGCCTCCAGGGGGCCGCTGAC

[0281] CCAGGTGGGGAGAGGGCAGAAGAAGGGTGGGGGACGTGGGCAGGCCAGGCTCACA

[0282] GGTGGAAATCAGGGATGCAGGGTGGTGCCCAAGCCAGGTCCTGCAGGAACCCAGGC

[0283] CCAGGGAGGGACCCAGACACTGGTGAGGCGGGGCAGGGGTTCCTGGAGAGAGGGC

[0284] AGCGAGGATCTCTATCCTGGCCTGGGGATTATGAACATAGGTAGCCGGGGCAGGGCC

[0285] CTGGGTGGGACTGTGGCCTCCACTGGCCTCACCAAAGTGCCTGGGCCCCAATCCTTC TCCATGCCCAGGGGCCCCAGGTGGGCCAGACCTCTGGCCTGTTCCTCAGCCCTACTC ATGGGGACATTCAGGGACCTCCAGGAAGTGGGCGGGGGAGCATCCACCCCTGCTAGC CGGCAGCTGTGGCCCTGATCAAATCAGGGGCTGGGGAGGGAAAGTGGGTCCATTGA GGTGGCCCTGCTCCATCAGCCCCCTACGGGACTTGTGTTCATTACAGTGAGGGGGTG CTCCCACTGTCTCCCGGCCTCCCTAATGCTCCCTCTGCTGCAGGGAGAAGGGTTCCAA GATCACAAAATGTCAACAATGCTGGCCTCCTGGACCAGACCCCGAGGCTCTAACAAT GCACTCTGAGATCCCTACCCTTGCCGTTGGTCTCTGTCGCTGACTCGAGGCACCTAAC ATCCATTCACACCCAACACAGGCCAGCGACTTCTGGGGCTCAGCCACAGACATGGTT TGTCACTGTTGAGCTTCTGTTCCTAGAGAATCCTAGAGGCTTGATTGGCCCAGGCTGC TGTGTGTGCTGGAGGCAAAGAATCCCTACCTCCTAGGGGTGAAAGGAAATGAAAATG GAAAGTTCTTGTAGCGCAAGGCCTGACATGGGTAGCTGCTCAATAAATGCTAGTGTGT TATTTCA (SEQ ID NO: 4, NCBI Reference Sequence: NM_001136041.3).

[0286] In certain embodiments, the therapeutic agent that binds or cleaves HD AC 11 mRNA inhibitor is siRNA comprising a sense region and an antisense region, wherein said sense region and said antisense region together form a duplex region, said antisense region and said sense region are each are between 18-30 nucleotides in length within SEQ ID NO: 4.

[0287] In certain embodiments, the therapeutic agent is an oligonucleotide administered in a lipid nanoparticle or extracellular vesicle. In certain embodiments, the airway disease is cystic fibrosis (CF). In certain embodiments, the airway disease is sinusitis, chronic rhinosinusitis, CF bronchiectasis, non-CF bronchiectasis, or chronic obstructive pulmonary disease (COPD). In certain embodiments, the airway disease is asthma. In certain embodiments, the airway disease is persistent airway obstruction. In certain embodiments, the airway disease is virus-induced airway restriction.

[0288] In certain embodiments, the virus is a coronavirus, respiratory syncytial virus, influenza, or parainfluenza virus (PIV). In certain embodiments, the subject is diagnosed with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM).

[0289] In certain embodiments, the PMNs are CD66b+ and produce extracellular vesicles (EVs) containing a long non-coding RNA(IncRNA) that encodes MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript 1) MALAT1 and the PMNs express histone deacetylase (HDAC11) and wherein the therapeutic agent that binds or cleaves IncRNA MALAT1 is administered in combination with a histone deacetylase inhibitor.

[0290] In certain embodiments, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves HD AC 11 mRNA or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent.

[0291] In certain embodiments, the agent binds or cleaves HD AC 11 DNA or RNA having the sequence SEQ ID NO: 4 (NCBI Reference Sequence: NM_001136041.3).

[0292] In certain embodiments, the therapeutic agent that binds or cleaves HD AC 11 DNA, binds or cleaves within a DNA promoter region, within a protein coding region, or at or within 10 nucleotides of a start codon.

[0293] In certain embodiments, the therapeutic agent that binds or cleaves HDAC11 RNA or protein encoded therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0294] Therapeutic and diagnostic methods

[0295] In certain embodiments, this disclosure relates to methods of detecting, measuring, quantifying, or correlating levels of MALAT1, MALAT1 RNA, IncRNA MALAT1, HDAC11 and / or HDAC11 RNA in airway derived extracellular vesicles as a biomarker for lung health and to guide therapeutic treatments.

[0296] In certain embodiment, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves MALAT1 RNA or IncRNA MALAT,1 HD AC 11 and / or HD AC 11 RNA, or associated DNA or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent.

[0297] In certain embodiment, the therapeutic agent that binds or cleaves MALAT1 RNA is an agent that binds or cleaves a segment of RNA within SEQ ID NO:1 (IncRNA MALAT1). In certain embodiment, the therapeutic agent that binds or cleaves MALAT1 RNA is an agent that binds or cleaves a segment of RNA within SEQ ID NO: 2 (Inc RNAMALAT1 fragment).

[0298] In certain embodiment, the therapeutic agent that binds or cleaves MALAT1 RNA is an agent that binds or cleaves a segment of RNA within SEQ ID NO: 3 (RNA MALAT1 fragment with deletion).

[0299] In certain embodiment, the therapeutic agent binds or cleaves a MALAT1 nucleic acid or binds or cleaves a segment of DNA within a promoter region, within a protein coding region, or at or within 10 nucleotides of a start codon.

[0300] In certain embodiment, the therapeutic agent binds or cleaves MALAT1 RNA or IncRNA MALAT1, DNA, or protein expressed therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), gapmer, microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0301] In certain embodiment, the therapeutic agent is an oligonucleotide administered in a lipid nanoparticle or extracellular vesicle.

[0302] In certain embodiment, the airway disease is cystic fibrosis (CF), e.g., evaluated from sample obtained from a subject suspected of having or diagnosed with CF. In certain embodiment, the airway disease is sinusitis, chronic rhinosinusitis, CF bronchiectasis, non-CF bronchiectasis, or chronic obstructive pulmonary disease (COPD), e.g., evaluated from sample obtained from a subject suspected of having or diagnosed with sinusitis, chronic rhinosinusitis, CF bronchiectasis, non-CF bronchiectasis, or chronic obstructive pulmonary disease (COPD). In certain embodiment, the airway disease is asthma, e.g., evaluated from sample obtained from a subject suspected of having or diagnosed with asthma. In certain embodiment, the airway disease is persistent airway obstruction, e.g., evaluated from sample obtained from a subject suspected of having or diagnosed with persistent airway obstruction.

[0303] In certain embodiment, the airway disease is virus-induced airway restriction. In certain embodiment, the virus is a coronavirus, respiratory syncytial virus, influenza, or parainfluenza virus (PIV), e.g., evaluated from sample obtained from a subject suspected of having or diagnosed with a virus, coronavirus (CO VID 19), respiratory syncytial virus, influenza, or parainfluenza virus (PIV). In certain embodiment, the subject is diagnosed with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and / or metabolic licensing (GRIM). In certain embodiment, the PMNs are CD66b positive and derived from extracellular vesicles (EVs) containing an incomplete RNA(lncRNA) that encodes MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript 1) MALAT1. In certain embodiment, the PMNs express histone deacetylase 11 (HD AC 11) mRNA or protein expressed therefrom.

[0304] In certain embodiment, the therapeutic agent that binds or cleaves IncRNA MALAT1, MALAT1 mRNA, DNA, or protein product thereof is administered in combination with an inhibitor of defatty-acylase activity (HDAC11).

[0305] In certain embodiment, the inhibitor of HDAC11 defatty-acylase activity is N'- hexadecylthiophene-2-carbohydrazide (SIS 17) or derivative thereof.

[0306] In certain embodiment, this disclosure relates to methods of treating an airway disease comprising administering an effective amount of a therapeutic agent that binds or cleaves HD AC 11 RNA, DNA, or protein encoded therefrom to a subject in need thereof optionally in combination with an antibiotic agent.

[0307] In certain embodiments, the subject is a human patient. In certain embodiments, the subject is diagnosed with rhinosinusitis, chronic obstructive pulmonary disease (COPD), chronic bronchitis, emphysema, CF bronchiectasis, non-CF bronchiectasis, asthma, idiopathic pulmonary fibrosis, acute respiratory distress syndrome (ARDS), cystic fibrosis, or respiratory syncytial virus (RSV) infection or other virus.

[0308] In certain embodiments, administration is by a nebulizer. In certain embodiments, the nebulizer is a jet nebulizer driven by compressed air. In certain embodiments, the nebulizer is an ultrasonic nebulizer having a piezoelectric transducer for creating droplets from a liquid reservoir.

[0309] In certain embodiments, the nebulizer is vibrating mesh nebulizer having perforated membranes actuated by an annular piezo element to vibrate. In certain embodiments, administration is a pressurized or unpressurized inhaler. In certain embodiments, administration is a metered-dose inhaler.

[0310] Rhinosinusitis, also referred to as “sinusitis,” refers to a condition where paranasal sinuses become inflamed and often swollen. Viral or bacterial infections typically cause rhinosinusitis; however, rhinosinusitis can also be a result of growths in the sinuses or other conditions (e.g., allergies). Symptoms typically include obstructed nasal passages, pain, tenderness, runny nose, drainage down the back of the throat (post-nasal drip), and / or swelling around eyes, cheeks, nose, forehead. Acute sinusitis is often short-lasting sinusitis; however, chronic sinusitis, also referred to as longer-lasting sinusitis, often results in bacterial infections necessitating antibiotic therapies.

[0311] “Chronic obstructive pulmonary disease (COPD)” refers to a progressive airflow limitation caused by an abnormal inflammatory reaction to the inhalation of particles such as cigarette smoke or asbestos. Doctors diagnose COPD by observing symptoms of a patient, evaluating life-style choices such as smoking and occupation, and conducting spirometry tests to measure airflow of a patient. A diagnostic parameter of COPD is the observation of a declining forced expiratory volume in 1 second (FEV1) as measured by spirometry. Lung function declines more rapidly than normal, leading to an accelerated limitation in physical performance (poor exercise tolerance) and dyspnea. An increased rate of decline in FEV1 is typically observed (less than 20 ml / year).

[0312] "Non-CF Bronchiectasis" refers to a condition not linked to CF where the walls of the bronchi are thickened which can result in periodic flare-ups of breathing difficulties, also referred to as exacerbations. Cylindrical (tubular) bronchiectasis is characterized by cylinder-shaped bronchi / bronchioles. Cylindrical bronchiectasis is a morphologic type of bronchiectasis where there is smooth uniform enlargement of bronchi with loss of the normal distal tapering of the airways without focal outpouchings. Bronchial dilatation is typically evaluated in relation to the accompanying pulmonary artery. A broncho to arterial ratio greater than El is typically considered abnormal. Normal bronchi are narrower in diameter the further they are from the lung hilum. Lack of normal bronchial tapering over 2 cm in length, distal from an airway bifurcation, is a sign of bronchiectasis. Varicose bronchiectasis bronchi are irregular, and the airways may be wide or constricted. In cystic bronchiectasis, cysts can occur in the subpleural areas, where they typically represent paraseptal emphysema, bullae, or honeycombing. Bronchiectasis is typically a chronic respiratory condition, characterized by frequent cough and shortness of breath due to a range of conditions that include inherited mucociliary defects, inhalational airway injury, immunodeficiency states and prior respiratory infections. Bronchiectasis is characterized as a thickening and dilation of the walls of the bronchi from inflammation, infection, or other etiologies which result in the inability to clear mucus from the airway. Affected individuals are then more susceptible to repeated lung infections.

[0313] Bronchiectasis is otherwise commonly found in individuals with cystic fibrosis. Cystic fibrosis is typically diagnosed in human patients having one or more mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. CF patients are typically diagnosed with persistent pulmonary infections, elevated sweat chloride, and pancreatic insufficiency. In certain embodiments, elevated sweat chloride is in a concentration above 30 or 60 millimoles per liter (mEq / L).

[0314] In certain embodiments, this disclosure relates to methods of diagnosing and treating a subject with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM). In certain embodiments, the PMNs are CD66b positive.

[0315] In certain embodiments, the method of detecting airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) in warm-blooded animals comprising the steps of: assaying a body fluid for extracellular vesicles excreting elevated levels of MALAT1 mRNA, IncRNA MALAT1, and / or HDAC11 and / or HDAC11; and correlating elevated level ofMALATl mRNA, IncRNAMALATl, HDAC1 1 and / or HDAC11 mRNA; in said body fluid with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) folate.

[0316] In certain embodiments, the method of detecting airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) in warm-blooded animals comprising the steps of: assaying a body fluid for extracellular vesicles excreting elevated levels of MALAT1, MALAT1 mRNA, MALAT1 IncRNA, HDAC11 and / or HD AC 11 mRNA; and correlating elevated level ofMALATl, MALAT1 mRNA, MALAT1 IncRNA, HDAC11 and / or HDAC11 mRNA in said body fluid with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM) folate.

[0317] In certain embodiments, disclosed herein are synthetic RNA sequences induce or inhibit the release of neutrophil elastase (NE) from tissue-recruited neutrophils. In certain embodiments, the RNA or other nucleic acid sequences are administered directly or packaged in delivery vehicles like lipid nanoparticles or exosomes. In certain embodiments, the sequences are derived from the MALAT1 long non-coding RNA, with modifications to enhance delivery and packaging for therapeutic purposes, such as removing the binding site for miRNA145-5p and trimming additional nucleotides. In certain embodiment, this disclosure relates to methods of treating cancer or a tumor comprising administering an effective amount of MALAT1 RNAor IncRNAMALATl, or IncRNA MALAT1 fragment as disclosed herein to a subject in need thereof optionally in combination with an anticancer agent. In certain embodiment, this disclosure contemplates use for induction of granule exocytosis and removal of small particles or other agents.

[0318] In certain embodiments, the cancer is lung cancer, small cell lung cancer (SCLC), nonsmall cell lung cancer (NSCLC), another cancer that has spread to the lungs, or other cancer.

[0319] In certain embodiment, the therapeutic agent is MALAT1 RNA having or having segment of RNA within SEQ ID NO: 1.

[0320] In certain embodiment, the therapeutic agent is MALAT1 RNA having or having segment of RNA within SEQ ID NO: 2.

[0321] In certain embodiment, the therapeutic agent is MALAT1 RNA having or having segment of RNA within SEQ ID NO: SEQ ID NO: 3.

[0322] In certain embodiment, the therapeutic agent that binds or cleaves MALAT1 RNA, DNA, or protein expressed therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), gapmer, microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0323] In certain embodiments, the therapeutic is a recombinant DNA or RNA vector encoding MALAT 1 RNA or IncRNA MALAT 1.

[0324] In certain embodiment, the therapeutic agent is a recombinant vector, mRNA or other oligonucleotide contained in or administered in a lipid nanoparticle or extracellular vesicle.

[0325] In certain embodiments, this disclosure relates to methods comprising, a) isolating an airway sample from a subject, b) contacting the sample with a labeling reagent that binds with MALAT 1, MALAT 1 mRNA, MALAT 1 IncRNA, HD AC 11 and / or HD AC 11 mRNA; and c) measuring MALAT 1, MALAT 1 mRNA, MALAT 1 IncRNA, HDAC11 and / or HDAC11 mRNA providing measured MALAT1, MALAT1 mRNA, MALAT1 IncRNA, HDAC11 and / or HDAC11 mRNA levels and diagnosing the subject as sensitive to or in need of an anti-MALATl or anti-HDACH therapy if the measured MALAT1, MALATI mRNA, MALATI IncRNA, HD AC 11 and / or HD AC 11 mRNA levels are higher than a control level or reference level.

[0326] In certain embodiments, the method further comprises administering an effective amount of anti-MALATl or anti -HD AC therapy as reported herein to the subject.

[0327] In certain embodiments, the anti -HD AC therapy is administering an inhibitor of HD AC defatty-acylase activity such as N'-hexadecylthiophene-2-carbohydrazide (SIS 17) or derivative thereof to the subject.

[0328] In certain embodiments, the anti -HD AC therapy is a therapeutic agent that binds or cleaves HD AC 11 mRNA or protein encoded therefrom which can be is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

[0329] In certain embodiments, the anti-MALATl or anti -HD AC therapy is administered to the lungs through the nose or mouth.

[0330] In certain embodiment, the therapeutic agent is a recombinant vector, mRNA or other oligonucleotide contained in or administered in a lipid nanoparticle or extracellular vesicle.

[0331] In certain embodiments, this disclosure relates to methods comprising, a) isolating an airway sample from a subject, b) contacting the sample with a labeling reagent that binds with MALAT1, MALAT1 mRNA, MALAT I IncRNA, HD AC 11 and / or HD AC 11 mRNA; and c) measuring MALATI, MALATI mRNA, MALATI IncRNA, HDAC11 and / or HDAC11 mRNA providing measured MALATI, MALATI mRNA, MALATI IncRNA, HDAC11 and / or HDAC11 mRNA levels and diagnosing the subject as sensitive to or in need of an anti-MALATl or anti-HDACH therapy if the measured MALATI, MALATI mRNA, MALATI IncRNA, HD AC 11 and / or HDAC11 mRNA levels are higher than a control level or reference level.

[0332] In certain embodiments, the methods further comprise the step of recording the measurements. In certain embodiments, the measurements are recorded in an electronic format on a non-transient computer readable medium.

[0333] In certain embodiments, the methods further comprise the step of recording the diagnosis. In certain embodiments, the diagnosis is recorded in an electronic format on a non-transient computer readable medium.

[0334] In certain embodiments, the methods further comprise the step the step of reporting the measurements or diagnosis to a medical professional, the subject, or representative thereof.

[0335] In certain embodiments, the samples may be tested without prior processing or the samples will be processed prior to testing. Processing of biological fluids in the sample may include elimination of cells, such as platelets, in blood samples, and may also include the elimination of certain proteins from the sample. In some examples, sample is a biological fluid collected in a container comprising EDTA.

[0336] The process of comparing a measured value and control, e.g., normal or a reference value can be carried out in any convenient manner appropriate to the type of measured value and reference value for the protein or nucleic acid at issue. As discussed above, measuring can be performed using quantitative or qualitative measurement techniques, and the mode of comparing a measured value and a reference value can vary depending on the measurement technology employed. For example, when a qualitative calorimetric assay is used to measure protein levels, the levels may be compared by visually comparing the intensity of the colored reaction product, or by comparing data from densitometric or spectrometric measurements of the colored reaction product (e.g., comparing numerical data or graphical data, such as bar charts, derived from the measuring device).

[0337] The process of comparing may be manual (such as visual inspection by the practitioner of the method) or it may be automated. For example, an assay device (such as a luminometer for measuring chemiluminescent signals) may include circuitry and software enabling it to compare a measured value with a reference value. Alternately, a separate device (e.g., a digital computer) may be used to compare the measured value(s) and the reference value(s). Automated devices for comparison may include stored reference values for the protein(s) or nucleic acid(s) being measured, or they may compare the measured value(s) with reference values that are derived from contemporaneously measured reference samples.

[0338] In some embodiments, the methods of the disclosure utilize simple or binary comparison between the measured level(s) and the reference level(s) (e.g., the comparison between a measured level and a reference level determines whether the measured level is higher or lower than the reference level). As described herein, samples / biological fluid may be measured quantitatively (absolute values) or qualitatively (relative values). In certain aspects of the disclosure, the comparison is performed to determine the magnitude of the difference between the measured and reference values (e.g., comparing the fold or percentage difference between the measured value and the reference value).

[0339] Extracellular vesicle IncRNA MALAT1 drives HDAC11 dependent chronic inflammation in airway neutrophils

[0340] Sputum from patients with cystic fibrosis (CF) were fractionated to determine what components of the lung milieu condition PMNs to become inflammatory. Experiments indicated extracellular vesicles (EVs) derived from CD66b+ polymorphonuclear neutrophils (PMNs) contained the IncRNA MALAT1, which induced the expression of the histone deacetylase HD AC 11 in PMNs. Either component was necessary and sufficient to differentiate naive PMNs into GRIMPMNs. HDAC11 plus GRIM PMNs secreted MALAT 1 and EVs that were able to cause other PMNs to become GRIM in a cycle of feed-forward inflammation. Knockdown or inhibition of both MALAT 1 and HD AC 11 prevented the induction of the GRIM phenotype. Thus, agents that target HD AC 11 and MALAT 1 are can be developed into therapeutics for the treatment of diseases featuring inflammatory airway PMNs. The presence of or concentration of MALAT 1 and HDAC11 in PMNs may also serve as a biomarker of lung disease as the amount of MALAT1 relative to the concentration of EVs strongly correlated with lung function (%FEV1).

[0341] Polymorphonuclear neutrophils (PMNs) are an abundant leukocyte in the bone marrow. The traditional view is that these cells are only capable of phagocytosis or releasing DNA and histones in the form of neutrophil extracellular traps (NETosis). However, experiments indicate that there is heterogeneity of PMNs in the bone marrow, circulation, and tissues. Experiments indicate that during the process of swarming into a tissue PMNs are able to initiate a transcriptional program to adapt to their environment. In addition, secreted products from PMNs are implicated in the severity of diseases such as cystic fibrosis (CF), chronic obstructive pulmonary disease (COPD), asthma, and respiratory infections caused by influenza virus and severe acute respiratory syndrome coronavirus (SARS-CoV-2), the causative agent of coronavirus disease 2019 (COVID- 19). This disclosure relates to using compositions to alter PMNs for host-directed therapeutic management of inflammatory diseases and conditions. Progressive lung disease is the leading cause of mortality in cystic fibrosis (CF), a chronic condition characterized by impaired mucociliary clearance, mucus plugging the small airways, bacterial and fungal colonization of the lungs, and chronic recruitment of inflammatory PMNs into the airways. Airway PMNs actively hyperexocytose their primary granules and release damaging, inflammatory mediators such as neutrophil elastase (NE) and myeloperoxidase (MPO). PMN-related measurements, including the number of PMNs and concentration of NE and MPO in the airways, are the strongest negative correlates with CF-disease severity and lung function. Despite the large numbers of activated inflammatory PMNs present in the airways of patients diagnosed with CF, common bacterial pathogens such as P. aeruginosa and S. aureus persist. These airway PMNs are non-apoptotic and actively fuse their primary granules to the membrane, while also featuring high rates of glucose uptake and glycolysis as well as anabolic mTOR and CREB signaling. In addition, CF airway PMNs downregulate the activity of T-cells and airway macrophages through the production of arginase. Furthermore, CF airway PMNs are metabolically active. This fate of PMNs has been described based on the above profound changes as granule-releasing, immunomodulatory, and metabolically active (GRIM) PMNs and have decreased bactericidal capabilities.

[0342] GRIM PMNs undergo a transcriptional program that results in a high rate of release of extracellular vesicles (EVs), which therein can transfer active caspase-1 to other cells bypassing the need for a stress stimulus. Notably, the heterogenous population of EVs in CF sputum, which are contemplated to be derived from airway epithelial cells and PMNs, as well as T-cells, monocytes, macrophages and bacteria are able to induce exocytosis in transmigrating PMNs.

[0343] Agonists such as N-formylmethionyl-leucyl-phenylalanine (fMLF) prime-PMNs release of EVs that activate naive PMNs in turn. However, it was unclear if this mechanism occurs in the airways and in activated GRIM PMNs. To this end, it was contemplated that GRIM PMNs might create chronic inflammation by secreting pathological EVs that differentiate future waves of naive PMNs into GRIM PMNs resulting in a cycle of feed-forward inflammation.

[0344] PMN-derived EVs are abundant in CF sputum

[0345] Neutrophil-derived EVs are abundant in CF airway fluid and track with disease severity. EVs were purified of from CF airway supernatant and immunoprecipitation and depletion of cell- type specific EVs. EVs were purified from expectorated sputum from patients diagnosed with CF using a combination of differential centrifugation and tangential flow filtration with a 300 kDa molecular weight cutoff (MWCO) column. CF sputum was differentially centrifuged at 800 xg to remove cells, 3,000 xg to remove bacteria and large debris, 20,000 xg to remove other debris and apoptotic blebs. The supernatant was loaded onto a 300 kDa MWCO to remove small proteins, metabolites and other low molecular weight contaminants (filtrate). The high MW fraction (EV- containing) was normalized to le10EVs / mall Cell-type specific EVs can be depleted by immunoprecipitation with 8 um streptavidin beads conjugated to anti-CD66b-biotin.

[0346] This method is easily applicable to patient samples and scalable for cell culture-generated material. EDTAwas first added to the sputum to a final concentration of 2.5 mM in order to prevent spontaneous activation of the PMNs and other immune cells present, then dissociated and aspirated using an 18G 1.5” needle. The sample was then centrifuged at 800 xg to pellet the cells and the supernatant was then centrifuged at 3,000 xg to remove bacteria and apoptotic cells. Supernatants were then frozen at -80 °C so that all EV samples could be analyzed with minimal batch effects. After thawing, the samples were centrifuged at 20,000 xg to remove larger debris which generated CF airway supernatant (CFASN), a mixture of EVs, soluble proteins, nucleic acids, and metabolites. The supernatant was separated on a 300 kDa MWCO column into a retentate (high MW) fraction and a filtrate (low MW) fraction. The high MW fraction contains EVs.

[0347] The high MW fraction contains particles that resemble EVs as measured by two orthogonal methods. Transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) show particles of the expected size range and concentration. Sputum from adult patients with CF contained EVs at a concentration of about 5e10EVs / mL by nanoparticle tracking analysis and that the particle size ranged from about 100-200 nm in diameter. The CFASN samples had a median concentration of 3.30c11EVs / mL, while the healthy control (HC) airway supernatant had a median of 3.47e9EVs / mL and a modal average diameter of about 156 nm. The EV fraction of CFASN contains tetraspanin, CD63, and TSG101, a component of the ESCRT machinery involved in EV biogenesis, and does not contain calnexin, which is specific to the endoplasmic reticulum. Since EVs are ubiquitously released by all cells, including bacteria, it was desirable to determine the percentage of the total EV population that was PMN-derived. PMN-derived EVs present surface- accessible CD66b, a granulocyte-specific marker. To accomplish this, EVs were stained with anti- CD66b-AF488 and analyzed by fluorescent NTA. About 62% of the EVs in CFASN were CD66b positive. Taken together these results indicate that the high molecular weight fraction of CFASN contains pure EVs and not cell debris, with over half of the EVs originating from PMNs or complexed with PMN-derived EVs. CD66b+ NE+ PMN EVs have been shown to cause emphysema and transfer a COPD-like phenotype to mice. Thus, it was investigated whether NE on PMN-derived EVs correlated with lung function, as measured by the forced exhaled volume in one second compared to the full, forced vital capacity (%FEV1). Anti-CD66b-biotin were conjugated to 8 pm magnetic beads coated with streptavidin and the complex was incubated with the total population of EVs to immunoprecipitate just the PMN-derived EVs. Then, the EV-bead complexes were counterstained with an antibody against NE and quantified by flow cytometry. The total amount of NE on the CD66b+ EVs correlated negatively with %FEV1. Since PMNs stimulated with fMLF release EVs that can activate naive PMNs, it was investigated whether the CFASN EVs, with the majority being PMN-derived, had effects on naive airway PMNs.

[0348] GRIM PMN-derived EVs are sufficient to transmit the GRIM phenotype to naive PMNs

[0349] The induction of the GRIM phenotype in vivo is not observed in circulating PMNs and requires transmigration into a tissue. To this end, a validated organotypic transmigration model allows for the conditioning of primary blood leukocytes into an airway-like phenotype (See Dobosh et al., 2021). Human lung (HLE) monolayers are grown at air-liquid interface (ALI) for two weeks, followed by transmigration of primary human blood PMNs into the apical fluid, which is either CFASN or fractions of CFASN or chemical stimuli and chemoattractants. The amount of time allotted for the transmigration step may vary. Up to 18 hours (h) or more in order ensure fully stimulated, airway-like PMNs. However, therapeutic interventions are more likely to succeed if applied to a naive PMN, or early migrant, rather than a PMN that is terminally GRIM. Indeed, a time-course of PMN transmigration revealed that PMNs over 1 h, 2 h, 4 h, 6 h, and 10 h had dynamic transcriptional changes. The transmigration for 4 h showed high CD63, correlating with primary granule exocytosis, and transcriptional activity and was an earlier timepoint. Therefore, 4 h transmigrations were use for each of these experiments to understand what factors result in the early commitment to the GRIM fate particularly in regard to primary granule release, which positively correlates with surface CD63 as measured by flow cytometry, and a bacteria killing assay generally with P. aeruginosa (PA01) at a multiplicity of infection (MOI) of 1 for one hour. Leukotriene B4 (LTB4; 100 nM) was used as a control to stimulate transmigration without any pathological material present akin to PMNs patrolling tissues during homeostatic and noninflammatory conditions. PMN EVs contain LTB4 as well as the enzyme LTA4H and could induce migration of PMNs. Noted were inefficient transmigration efficiencies when the apical fluid contained only CFASN EVs. LTB4 (100 nM) was added to all EV conditions to induce PMN transmigration. PMNs transmigrated towards CFASN presented with low CD63 and killed about 60% of P. aeruginosa. In contrast, PMNs transmigrated towards CFASN or the total EVs derived from CFASN had increased CD63 and cleared about 40% and 20% of P aeruginosa, respectively. As a control, PMNs transmigrating towards the filtrate (no EVs) did not show primary granule exocytosis and were able to kill P. aeruginosa equally as efficient as LTB4 transmigrated PMNs. Interestingly, GRIM PMNs transmigrated towards the high MW fraction (EVs) cleared less bacteria than the transmigration towards total CFASN, a more complex fluid. This suggests that the low MW fraction contains factors that condition PMN to kill bacteria efficiently or are bactericidal and associate with transmigrating PMNs. GRIM PMNs have also been shown to have low surface CD 16, likely as a result of NE-mediated cleavage of the epitope, and high CD66b correlating with secondary granule release.

[0350] Using bead immunoprecipitation, CD66b+ EVs (PMN-derived) were depleted from the total CFASN EV population. The remaining EVs were no longer able to induce primary granule release in transmigrating PMNs, although a moderate decrease in CD 16 and CD66b was observed. In line with the data linking bacteria killing ability with measurement of surface CD63, PMNs transmigrated towards CD66b-depleted EVs were able to efficiently clear bacteria whereas CD326- and CD115-depleted EVs showed a slight reduction in bacterial clearance, which confirms the pathological role of PMN-derived EVs in causing naive PMNs to become GRIM.

[0351] The loss of the pathological GRIMming factor as a result of depleting CD66b+ EVs suggests that GRIM PMNs are able to impart the GRIM phenotype upon naive, newly arrived PMNs. To confirm this, after PMNs were transmigrated towards LTB4 alone or CFASN EVs the PMNs were purified and allowed to condition plain RPMI media for 12 hours. After which the PMNs were removed and the EVs were purified as before. GRIM PMNs released approximately 3 times the number of EVs over the 12 hour incubation than LTB4-transmigrated PMNs although there was no difference in the size. The total amount of EVs released is difficult to determine since some EVs may have been taken up by the PMNs and the rate of EV synthesis may not be constant throughout the incubation. Based on the hypothesis that EVs released by GRIM PMNs can cause naive PMNs to differentiate into GRIM PMNs, EVs that comprised the conditioned media as the apical fluid were used in a new transmigration. EVs purified from the conditioned media are referred to as “secondary EVs” and can be generated from either LTB4 or CFASN EV transmigrated PMNs. Naive blood PMNs were applied to the basal side of the model and were transmigrated towards either LTB4 secondary EVs (EVs generated by LTB4 transmigrated PMNs) or towards CFASN secondary EVs (EVs generated by GRIM, CFASN EV transmigrated, PMNs). PMNs that transmigrated towards GRIM PMN-generated EVs showed heightened surface CD63 compared to PMNs that transmigrated towards LTB4 secondary EVs. Furthermore, PMNs that transmigrated towards CFASN secondary EVs also had lower bacterial killing ability compared to the PMNs that transmigrated towards LTB4 secondary EVs. These data demonstrate the transfer of a pathological phenotype between different waves of recruited PMNs.

[0352] HDAC11 and MALAT1 expression regulates induction of the GRIM phenotype

[0353] The RNA-seq data of PMNs transmigrating towards CFASN was revisited for 1-10 hours to determine the differential expression of transcription factors or transcriptional regulators. It was observed that the histone deacetylase HD AC 11 was continually upregulated over the entire dataset. HD AC 11 is also known to suppress the expression of the anti-inflammatory cytokine, IL-10, which is notably absent or at low concentrations in the CF airways. From the RNA-seq data, it was confirmed that cofilin was an appropriate loading control for relative mRNA quantification in PMNs. Quantitative RT-PCR and western blot were performed to confirm the expression of HD AC 11 in PMNs that become GRIM as a consequence of CFASN EVs. HD AC 11 mRNA and protein were present in all transmigrating cells, at about 2-4 fold higher in CFASN- and CFASN EV-transmigrated PMNs than LTB4 PMNs.

[0354] In addition to its activities as a deacetylase, HD AC 11 is also a lysine defatty-acylase. The defatty-acylase activity, which focuses on long-chain fatty acyl chains is also more active than the deacetylase activity. See Cao et al. PNAS, 2019. A small-molecule inhibitor of the deacylase activity is SIS 17.

[0355] Inclusion of SIS 17 in the apical fluid (25 pM) of LTB4-transmigrating PMNs showed no differences in the amount of degranulation or bacterial killing ability compared to the LTB4 positive vehicle controls. In contrast, CFASN EVs plus SIS17 transmigrated PMNs were CD63med, which was significantly lower than PMNs transmigrated towards only CFASN EVs. To confirm that SIS 17 acts upon HD AC 11 in PMNs and not the epithelial cells in the transmigration model, H441 HDAC11- / - cells were generated using CRISPR-Cas9. PMNs that transmigrated across H441 HDAC11- / - showed lower CD 16, but had the same CD66b and CD63 MFI as the transmigration across wild-type (WT) H441 cells as well as the same bacterial clearance ability. In addition, CFASN EVs plus SIS 17 transmigrated PMN showed equal bacterial killing capacity as LTB4-transmigrated PMNs. SIS 17 treatment did not change the rate of EV release. Taken together, inhibition of HDAC11 in PMNs via SIS17 allows normally pathological PMNs from committing to the GRIM fate and efficient bacterial clearance.

[0356] Based on these data, HD AC 11 is part of the pathway that induces the GRIM phenotype in PMNs. Since CD66b positive PMN-derived EVs induce the GRIM phenotype, experiments were performed to determine whether the CFASN EVs contained HDAC11 protein. However, even when loaded up to 60 ug of total protein, HDAC11 could not be detected by western blot. Thus, it was decided to narrow down the class of macromolecules that contributed to the ability of EVs to confer the GRIM phenotype. To identify the nature of EV contents that play a role in GRIMming of PMNs, the purified CFASN EVs were treated with UV light to denature and inhibit potential activity of nucleic acids, trypsin to degrade proteins associated with the surface of the EV, or TritonX-100 to degrade the membrane. After treatment, samples were washed with PBS and 2.5 mM EDTA and then immediately used in the transmigration model. Each treatment had an effect compared to the PBS-treated sample on primary granule release as measured by CD63. These effects could be explained by the following 1) The vesicular nature of the EV aids in delivery. Whatever the pathological factor is, the lack of encapsulation or association with an EV renders it inactive or unable to enter the recipient PMN; 2) UV-inactivation having an effect suggests that the pathological factor is a nucleic acid, likely RNA; and 3) trypsin, which can only degrade surface proteins because the EV protects intra-EV protein content may decrease efficacy of the EV to deliver the pathological cargo. In summary, the pathological factor that causes a PMN to become GRIM is likely an RNA, but delivery is enhanced by EV “carrier effects.” The surface proteins of EVs facilitate the effective delivery and the EV protects the RNA cargo from degradation. These carrier effects enhance the efficiency in which EVs become GRIM.

[0357] In order to determine what RNAs could be differentially expressed in transmigrating PMNs, total RNA was extracted using TRIzol™ from PMNs transmigrated towards either CFASN EVs or LTB4 control after 4 hours. The originating blood PMNs were used as a baseline for normalization. Each transcriptional profde was distinct from the others by principle component analysis (PCA), but that PCI, which also accounted for the largest variation (65.9%) between the groups was mostly as a result of the transmigration process. In accordance with this, LTB4 and CFASN EV transmigrated PMNs showed little variation in PCI.

[0358] It was noted that the top 100 contributors to PC2 between CFASN EV and LTB4 transmigrated PMNs were significantly enriched for GO cellular component terms relating to mitochondria function and vesicle formation, including extracellular vesicles. In line with this, there were many mitochondria RNAs differentially expressed in between GRIM PMNs and LTB4 PMNs including 12 / 13 of the proteins encoded by the mitochondrial DNA. Of the proteins encoded by the mitochondrial genome, 10 were differentially expressed and in greater abundance in CFASN EV transmigrated PMNs. MT-ATP8 is present equally both populations of cells, while MT-RNR2 and MT-RNR1 were more highly expressed in LTB4 transmigrated PMNs. This likely contributes to the increase in reactive oxygen species (ROS) production, from which PMNs are the most potent producers, and oxidative stress that is observed in the CF airways. High concentration of mitochondrial transcripts may be a sign of apoptotic cells however, GRIM cells are alive and non- apoptotic and were greater than 80% viable after the 4 h transmigration as measured by ethidium bromide / acridine orange staining as well as flow cytometry. The strongest contributor to the differences between LTB4 and CFASN EV transmigrated PMNs outside of the mitochondrial genes was the long noncoding RNA (IncRNA), MALAT1, which was much higher expressed in LTB4-transmgirated PMNs than CFASN EV-transmigrated PMNs.

[0359] Plasmid therapy

[0360] An electroporation protocol was developed to transfect primary blood PMNs with endotoxin-free plasmid DNA. The plasmids were a two-part expression vector in which position one was either a strong CMV promoter for the expression of mRNAs or IncRNAs or a U6 promoter for siRNAs, while position two expressed GFP under the control of the EFl a promoter with a mutated Bsal site to facilitate Golden Gate cloning. Since the transfection of PMNs was not 100% efficient the positive expression of EGFP was used to demarcate cells that successfully received the plasmid, and presumably expressed the transgene in position one, while cells that were GFP negative were not expressing the transgene. When expressing the control fluorescent protein mScarlet in position 1, there were no differences in CD63, CD16, or CD66b between EGFP positive and EGFP negative cells. In addition, at the population level there were no differences in bacteria killing ability. Notably, when HD AC 11 was expressed in position 1, EGFP positive cells showed higher surface CD63 than the EGFP negative PMNs when transmigrating towards LTB4, indicating that HD AC 11 is related to the ability of PMNs to exocytose their primary granules. In addition, inclusion of SIS 17 in the apical fluid resulted in both EGFP negative and EGFP positive cells presenting equal amounts of surface CD63 when HD AC 11 was being expressed. Alignment of the contigs aligning with MALAT1 resulted in only a portion of the IncRNA being expressed in PMNs. When this fragment of MALAT1 was expressed in transmigrating PMNs towards LTB4 increased degranulation was observed compared to the EGFP negative cells as well as the mScarlet-expressing controls. SIS 17 in the apical fluid abrogated the effect of expressing either HD AC 11 or MALAT1 on the amount of CD63 present on the surface of transmigrating PMNs.

[0361] Although it is unclear whether HD AC 11 protein and MALAT1 RNA are direct binding partners they both appear in the same pathway related to PMN degranulation and bacterial killing ability based on the ability of SIS17 to mitigate the effects of MALAT1 overexpression. Taken together, this suggests that MALAT1 and HDAC11 are both relevant in the induction of the GRIM phenotype in transmigrating PMNs. In line with this reasoning, expression of siRNAs targeting HD AC 11 or MALAT 1 under control of the U6 promoter in PMNs transmigrating towards CFASN EVs did not increase surface CD63 nor CD66b in EGFP positive PMNs. However, CD16 decreased regardless of whether the transmigrating PMNs received the plasmid. Notably, electroporated PMNs expressing MALAT or HD AC 11 transmigrated towards LTB4 showed reduced bacteria killing capacity, which was rescued by the addition of SIS 17. Similarly, knockdown of HD AC 11 or MALAT1 by siRNAs increased bacteria killing capacity in PMNs transmigrated towards CFASN EVs compared to the scramble siRNA control.

[0362] The expression of IncRNA MALAT1 is sufficient to cause PMNs to become GRIM

[0363] In addition, GRIM PMNs are able to release pathological EVs that can differentiate naive PMNs into GRIM PMNs. Based on evidence of MALAT1 being packaged into EVs from other cell types, experiments were performed to determine the amount of MALAT1 transcript in both the cellular and EV compartments of GRIM PMNs and LTB4 control PMNs. The knockdown and overexpression of MALAT1 were successful by qRT-PCR. However, when quantifying MALAT1 in the cellular compartment, lower levels of MALAT1 were observed in PMNs transmigrated towards CFASN EVs than LTB4. Yet, paradoxically, CFASN secondary EVs had more MALAT1 than LTB4 secondary EVs. This suggests that MALAT1 is actively loaded into EVs from GRIM PMNs but retained intracellularly by LTB4-transmgirated PMNs. It was also observed that MALAT1 was significantly higher in LTB4 transmigrated PMNs than CFASN EV transmigrated PMNs by RNA-seq.

[0364] CFASN EV transmigrated PMNs released EVs that were then able to differentiate naive PMNs into GRIM PMNs. EVs from MALAT1- and HDAC11 -transfected PMNs were isolated and then used in the apical fluid to condition naive PMNs. PMNs that transmigrated towards EVs from MALAT1 -transfected and HD AC 11 -transfected PMNs showed elevated surface CD63. As before, the effects of the transfection were mitigated when SIS17 was included. In addition, EVs from CFASN EV transmigrated PMNs transfected with MALAT1 or HD AC 11 siRNA were unable to condition naive PMNs into the GRIM phenotype as shown by surface CD63 and bacteria killing. MALAT1- and HD AC 11 -induced PMNs were both able to generate feed-forward activation of naive PMNs, while inhibition or knockdown prevented transfer of the GRIM phenotype.

[0365] Since MALAT1 was readily packaged into EVs by GRIM PMNs and could condition naive PMNs in the in vitro transmigration system, MALAT1 transcript in EVs can be used as a biomarker of disease severity. To this end, EVs were isolated from the expectorated sputum of adult patients that had been admitted to the hospital for an acute pulmonary exacerbation (APE) in the past year. Sputum that was collected within 1-4 days. Lung function as a measurement of forced expiratory volume relative to forced vital capacity (%FEV1) decreases following an APE. In addition, PMN- related factors such as NE and methionine sulfoxide concentration correlate with the decline in %FEV1. MALAT1 concentration in EVs isolated from patient sputa strongly correlated with %FEV1. MALAT1 may be transcribed by multiple cell types present in the airways including various epithelial cells. The role of MALAT1+ EVs on PMNs both in early pathogenesis of airway disease as well as late-stage disease is contemplated.

Claims

CLAIMS1. A method of treating an airway disease or condition comprising administering an effective amount of an HD AC 11 inhibitor to a subject in need thereof.

2. The method of claim 1, wherein the HD AC 11 inhibitor is N'-hexadecylthiophene-2- carbohydrazide (SIS 17), salt, or derivative thereof.

3. The method of claim 1, wherein the HD AC 11 inhibitor is a therapeutic agent that binds or cleaves HDAC11 RNA or protein encoded therefrom.

4. The method of claim 3, wherein the HDAC11 RNA has the sequence (SEQ ID NO: 4, NCBI Reference Sequence: NM_001136041.3).

5. The method of claim 3, wherein the therapeutic agent that binds or cleaves HDAC11 mRNA or protein encoded therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

6. The methods of any of claims 1-5, wherein the therapeutic agent is contained in a lipid nanoparticle or extracellular vesicle.

7. The methods of any of claims 1-6, wherein the airway disease is cystic fibrosis (CF).

8. The methods of any of claims 1-6, wherein the airway disease is sinusitis, chronic rhinosinusitis, CF bronchiectasis, non-CF bronchiectasis, or chronic obstructive pulmonary disease (COPD).

9. The methods of any of claims 1-6, wherein the airway disease is asthma.

10. The methods of any of claims 1-6, wherein the airway condition is a persistent airway obstruction.

11. The methods of any of claims 1-6, wherein the airway condition is virus-induced airway restriction.

12. The method of claim 11, wherein the virus is a coronavirus, respiratory syncytial virus, influenza, or parainfluenza virus (PIV).

13. The methods of any of claims 1-11, wherein the subject is diagnosed with airway polymorphonuclear neutrophils (PMNs) in state associated with granule release, immunomodulatory activity, and metabolic licensing (GRIM).

14. The method of claim 13, wherein PMNs are CD66b positive and produce extracellular vesicles (EVs) containing a IncRNA that encodes MALAT1 (Metastasis Associated Lung Adenocarcinoma Transcript 1) MALAT1.

15. A method of treating an airway disease comprising administering an effective amount of a MALAT1 inhibitor to a subject in need thereof optionally in combination with an antibiotic agent.

16. The method of claim 14, wherein the MALAT1 inhibitor is a therapeutic agent that binds or cleaves MALAT1 RNA or protein encoded therefrom.

17. The methods claims 15 or 16, wherein the therapeutic agent that binds or cleaves MALAT 1 RNA or protein expressed therefrom is a small molecule, antibody, aptamer, antisense oligonucleotide (ASO), gapmer, microRNA, small interfering RNA (siRNA), plasmid DNA, small activating RNA (saRNA), splicing-modulatory ASOs, or single guide or crRNA / tracrRNA of a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas (CRISPR-associated protein) recombinant system.

18. A recombinant vector encoding MALAT1 RNA having SEQ ID NO: 2.

19. A recombinant vector encoding MALAT 1 RNAhaving SEQIDNO: 3.

20. A somatic cell comprising a recombinant vector of claims 18 or 19.

Images