Oligonucleotide targeting irs-1 mRNA and use thereof

By designing modified oligonucleotides containing the continuous sequence GCGTGCTGGTG and using a spacer structure modified with thiophosphate ester bonds and 2'-O-methoxyethyl, the problems of membrane penetration and enzymatic degradation of ASO in the treatment of angiogenic diseases were solved, achieving stable inhibition of IRS-1 expression and angiogenesis, and improving the success rate of drug development.

WO2026000245A1PCT designated stage Publication Date: 2026-01-02SICAGENE BIOSCIENCE CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/101641
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-06-26
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing antisense oligonucleotides (ASOs) have problems such as poor membrane penetration and easy enzymatic metabolism when treating angiogenesis-related diseases. Furthermore, chemical modification methods have a significant impact on knockdown efficiency and toxicity, resulting in a low success rate in drug development.

Method used

A modified oligonucleotide containing a continuous sequence essentially identical to GCGTGCTGGTG was designed, linked by phosphate thioester bonds, and combined with a 2'-O-methoxyethyl modified nucleoside and 5-methylcytosine to form a spacer structure for targeting IRS-1 mRNA and inhibiting its expression.

Benefits of technology

It significantly and stably inhibits IRS-1 expression and angiogenesis, improves the drug-likeness of the drug under different modification methods, and effectively treats angiogenesis-related diseases such as neovascular ophthalmopathy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024101641_02012026_PF_FP_ABST
    Figure CN2024101641_02012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the field of drugs. Specifically, provided are an oligonucleotide targeting IRS-1 mRNA and use thereof in the preparation of a drug for preventing or treating vascular proliferation-related diseases or symptoms. By means of screening a series of antisense oligonucleotide sequences, it is found that when an oligonucleotide sequence contains a contiguous sequence that is substantially the same as GCTGCTGGTG, it has a significant and stable inhibitory effect on IRS-1 expression and angiogenesis under different modification modes. Said oligonucleotide can be used for preventing or treating vascular proliferation-related diseases or symptoms. Said oligonucleotide has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Oligonucleotide targeting IRS-1 mRNA and applications thereof

[0001] Oligonucleotide targeting IRS-1 mRNA and applications thereof TECHNICAL FIELD

[0002] The present application relates to the field of biological medicine, in particular, the present application relates to an oligonucleotide targeting IRS-1 mRNA and its use in the preparation of a medicament for preventing or treating blood vessel hyperplasia related diseases or symptoms. BACKGROUND

[0003] Insulin receptor substrate 1 (IRS-1) is a cytoplasmic docking protein, as an important signal transduction intermediate downstream of activated cell surface receptors, involved in signal transduction including insulin, insulin-like growth factor 1 (IGF-1), prolactin, growth hormone, vascular endothelial growth factor (VEGF) receptor, integrin receptor family members, and selected cytokine receptors, etc.

[0004] IRS-1 is the first discovered member of the IRS protein (or cytoplasmic adaptor protein) family known so far, which is widely expressed in various mammalian cells. It binds to its cognate receptors and acts as a key ligand to trigger insulin-induced responses in human cells. Like other members of the IRS protein family, IRS-1 does not have intrinsic enzymatic properties, but can be activated after phosphorylation. It plays a key role in life determination, cell resistance, lipogenesis under physiological and pathological conditions, glucose homeostasis and tumor metabolism. Increasing evidence suggests that IRS-1 plays an important role in the occurrence and development of angiogenesis.

[0005] Studies have shown that IRS-1 interacts with VEGFA, integrin and other pro-angiogenic cytokines such as IL-1b, and is involved in angiogenesis. Insulin increases the expression of VEGF in retinal pigment epithelial cells, and VEGF type 2 receptor recruits IRS-1 after its activation. In a hypoxia-induced retinal angiogenesis model in newborn mice, pathological vascular growth is reduced in IRS-1 knockout mice, suggesting that IRS-1 plays an important role in the development of retinal neovascularization. In human vascular endothelial cells, knockdown of IRS-1 expression inhibits angiogenesis, and further studies have found that VEGFA, IL1-b and phosphorylated Akt are reduced.

[0006] Antisense oligonucleotide (ASO) therapeutic drugs are usually 15-30 nucleotides in length, composed of chemically modified nucleotides, and mainly connected by phosphorothioate. After entering the cell, the ASO drug binds to the complementary target mRNA through the principle of splicing complementary pairing under the action of ribonuclease H1, thereby achieving the effect of inhibiting the expression of the target gene. In addition, the mechanism of action of ASO drugs also includes inhibition of translation, splicing regulation, and increased protein translation. Therefore, ASO targeting IRS-1 mRNA can reduce the expression of IRS-1, thereby treating blood vessel proliferation-related diseases.

[0007] However, the phosphodiester bond in ASO has significant electronegativity, which not only cannot pass through the cell membrane, but is also easily metabolized by enzymes widely present in the body and easily triggers an immune response. In order to improve the drugability of ASO, it needs to be further appropriately chemically modified. Chemical modification will have different degrees of influence on the knockdown efficiency and toxicity of ASO drugs of different sequences. Therefore, finding ASO sequences that can maintain stable knockdown efficiency under different modification methods and improve the success rate of drug research and development is a crucial step in the ASO research and development process.

[0008] The incidence of neovascular eye diseases is increasing year by year, with more than 40 million patients with ocular fundus neovascular diseases, and the number of patients is rising as the population ages. Patients with ocular fundus neovascular diseases almost have to be rechecked and injected with related drugs every month, otherwise the impairment of vision will seriously affect life. Ocular fundus neovascular diseases are an important cause of blindness, and traditional single anti-VEGF therapy still has limitations. Some studies have shown that intravitreal injection of bevacizumab (recombinant humanized monoclonal antibody targeting VEGF) in patients with proliferative diabetic retinopathy can cause adverse consequences of increased fibrous tissue, so the development of new treatment methods has important clinical significance.

[0009] SUMMARY

[0010] The inventors designed and screened a series of antisense oligonucleotide sequences and found that when the oligonucleotide sequence contains a continuous sequence substantially identical to GCTGCTGGTG, it has a significant and stable inhibitory effect on IRS-1 expression and angiogenesis under different modification methods. Based on this, the present application provides the following technical solutions:

[0011] In one aspect, the present application provides an oligonucleotide containing a continuous sequence substantially identical to GCTGCTGGTG. Preferably, the oligonucleotide contains a continuous sequence at least 80%, 90%, or completely (100%) identical to GCTGCTGGTG.

[0012] Preferably, the oligonucleotide consists of 12 to 27 linked nucleosides; further preferably, the oligonucleotide consists of 14-20 linked nucleosides.

[0013] Preferably, the modified oligonucleotide is a single-stranded modified oligonucleotide.

[0014] Preferably, at least one nucleoside in the modified oligonucleotide comprises a modified nucleobase. Preferably, the modified nucleobase is a 5-methylcytosine.

[0015] Preferably, the modified oligonucleotide is a gapmer, i.e., comprises a gap consisting of linked deoxynucleosides and 5' and 3' wing segments consisting of linked nucleosides, wherein the gap segment is located between the 5' wing segment and the 3' wing segment.

[0016] Preferably, at least one nucleoside of a wing segment of the gapmer comprises a modified sugar. Preferably, the modified sugar is a 2'-modified sugar. Preferably, the 2'-modified sugar is a 2'-0-methoxyethyl modification. Preferably, the modified sugar is a bicyclic sugar. Preferably, the modification is a 4'-CH(CH3)-0-2' modification (termed "constrained ethyl" or "cEt").

[0017] Preferably, the modified oligonucleotide comprises a gap consisting of linked deoxynucleosides and 5' and 3' wing segments consisting of linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment comprises a modified sugar. Preferably, the gap consists of 3-16 linked nucleosides. Preferably, the modified oligonucleotide comprises a gap consisting of 8-12 linked deoxynucleosides and 5' and 3' wing segments consisting of 2-6 linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. Preferably, the modified oligonucleotide comprises a gap consisting of 10 linked deoxynucleosides and 5' and 3' wing segments consisting of 5 linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar; wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar or a constrained ethyl sugar. Preferably, the modified oligonucleotide comprises a gap consisting of 10 linked deoxynucleosides and 5' and 3' wing segments consisting of 3 linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar; wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar or a constrained ethyl sugar. Preferably, 50%, 60%, 70%, 80%, 90%, or all of the sequences in the single-stranded modified oligonucleotide that are substantially identical to GCTGCTGGTG are in the gap segment. Preferably, the sequence of the gap segment is GCTGCTGGTG.

[0018] Preferably, at least one internucleoside linkage in the modified oligonucleotide is a modified internucleoside linkage. Preferably, all internucleoside linkages in the modified oligonucleotide are modified internucleoside linkages. Preferably, all internucleoside linkages in the modified oligonucleotide are phosphorothioate internucleoside linkages.

[0019] Preferably, the single-stranded modified oligonucleotide comprises a gap segment consisting of 10 linked deoxynucleosides and 5' and 3' wing segments consisting of 5 linked nucleosides, respectively, wherein the gap is positioned between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment is a 2'-0-methoxyethyl modified nucleoside, the internucleoside linkages throughout the modified oligonucleotide are phosphorothioate linkages, all cytosines throughout the modified oligonucleotide are 5-methylcytosines, and the sequence of the gap segment is GCTGCTGGTG.

[0020] Preferably, the modified oligonucleotide has the following structure:

[0021] comprises a gap consisting of 10 linked deoxynucleosides and 5' and 3' wing segments each consisting of 5 linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment is a 2'-0-methoxyethyl modified nucleoside, each internucleoside linkage is a phosphorothioate (P=S) linkage, and all cytosines in the entire modified oligonucleotide are 5-methylcytosines.

[0022] Preferably, the single-stranded modified oligonucleotide comprises a gap segment consisting of 10 linked deoxynucleosides and 5' and 3' wing segments each consisting of 3 linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment is a cEt modified nucleoside, each internucleoside linkage in the entire modified oligonucleotide is a phosphorothioate linkage, and all cytosines in the entire modified oligonucleotide are 5-methylcytosines, and the sequence of the gap segment is GCTGCTGGTG.

[0023] Preferably, the modified oligonucleotide has the following structure:

[0024] comprises a gap consisting of 10 linked deoxynucleosides and 5' and 3' wing segments each consisting of 3 linked nucleosides, wherein the gap is positioned between the 5' wing segment and the 3' wing segment, and wherein each nucleoside of each wing segment is a cEt modified nucleoside, each internucleoside linkage is a phosphorothioate (P=S) linkage, and all cytosines in the entire modified oligonucleotide are 5-methylcytosines.

[0025] In another aspect, the present application provides use of the modified oligonucleotide or a salt thereof for the manufacture of a medicament for preventing or treating a disease or condition associated with vascular proliferation. Wherein the disease or condition is cancer, vascular abnormality, infection, cardiovascular disease, and injury; preferably, the disease or condition is a neovascular ocular disease, including a corneal neovascularization, an iridal neovascularization, a retinal neovascularization, or a choroidal neovascularization related disease; preferably, the disease or condition is diabetic retinopathy, neovascular age-related macular degeneration, retinal vein occlusion, retinopathy of prematurity, choroidal neovascularization.

[0026] In another aspect, the present application provides a pharmaceutical composition comprising the modified oligonucleotide or a salt thereof and a pharmaceutically acceptable carrier. Preferably, the composition is a pharmaceutical composition for injection, such as a subcutaneous injection or intravenous injection pharmaceutical composition. BRIEF DESCRIPTION OF DRAWINGS

[0027] The accompanying drawings are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and are meant to explain the application without limiting the application to the embodiments. In the drawings:

[0028] Figure 1 is the effect of MOE modified antisense oligonucleotides on knockdown of IRS-1 gene expression in human dermal fibroblast (HDF) cells.

[0029] Figure 2 is the inhibitory effect of MOE modified antisense oligonucleotides on HUVEC cell mediated in vitro angiogenesis.

[0030] Figure 3 is the cytotoxicity assay of MOE modified antisense oligonucleotides in HepG2 cells.

[0031] Figure 4 is the inhibitory effect of MOE modified antisense oligonucleotides on in vitro angiogenesis after free uptake into human umbilical vein endothelial cells (HUVECs).

[0032] Figure 5 is the inhibitory effect of MOE modified antisense oligonucleotides on mouse corneal neovascularization.

[0033] Figure 6 is the inhibitory effect of MOE modified antisense oligonucleotides on mouse choroidal neovascularization.

[0034] Figure 7 is the inhibitory effect of IRS-1 ASO on tumor and tumor angiogenesis.

[0035] Figure 8 is the effect of cEt modified antisense oligonucleotides on knockdown of IRS-1 gene expression in human dermal fibroblast (HDF) cells.

[0036] Figure 9 is the inhibitory effect of cEt modified antisense oligonucleotides on in vitro angiogenesis after uptake into human umbilical vein endothelial cells (HUVECs).

[0037] Figure 10 is the inhibitory effect of cEt modified antisense oligonucleotides on in vitro angiogenesis after free uptake into human umbilical vein endothelial cells (HUVECs). DETAILED DESCRIPTION

[0038] The preferred embodiments of the application will be described herein below with reference to the accompanying drawings, in which preferred embodiments of the application are shown. It should be understood, however, that the preferred embodiments described herein are meant to be illustrative only and the present application is not intended to be limited to the preferred embodiments described herein.

[0039] The definitions involved in the present application are as follows:

[0040] "Antisense oligonucleotide" or "ASO" means an oligonucleotide having a nucleobase sequence complementary to a target nucleic acid or region or segment thereof. An antisense oligonucleotide can specifically hybridize to a target nucleic acid or region or segment thereof, which hybridization results in RNase H-mediated cleavage of the target nucleic acid.

[0041] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the method / device being employed to determine the value, or the variation that exists among the study subjects and / or variations that are inherent in their respective measurement systems. Typically, the term "about" connotes an approximation to plus or minus 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, as the particular circumstances dictate.

[0042] The use of the term "or" in the claims is used to mean "and / or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure

[0043] "2'-deoxyfuranosyl sugar moiety" or "2'-deoxyfuranosyl sugar" means a furanosyl sugar moiety having two hydrogens at the 2'-position. The 2'-deoxyfuranosyl sugar moiety can be unmodified or modified, and can be substituted or un-substituted at positions other than the 2'-position. In the context of an oligonucleotide, a beta-D-2'-deoxyribosyl sugar moiety is an un-substituted, un-modified 2'-deoxyfuranosyl sugar, and is found in naturally occurring deoxyribonucleic acid (DNA).

[0044] "2'-deoxynucleoside" means a nucleoside comprising a 2'-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside can comprise a modified nucleobase or can comprise an RNA nucleobase (uracil).

[0045] "2'-O-methoxyethyl" (also 2'-MOE) refers to 2'-0(CH2)2-OCH3 in place of the 2'-OH group of a ribosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0046] "2'-MOE nucleoside" (2'-O-methoxyethyl nucleoside) means a nucleoside comprising a 2'-MOE modified sugar moiety.

[0047] "2'-substituted nucleoside" or "2'-modified nucleoside" means a nucleoside comprising a 2'-substituted or 2'-modified sugar moiety. As used herein, "2'-substituted" or "2'-modified" with respect to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.

[0048] “Bicyclic sugar” means a furanose ring modified by a bridge of two atoms. Bicyclic sugars are modified sugars. “Bicyclic nucleic acid” or “BNA” refers to a nucleoside or nucleotide in which the furanose moiety of the nucleoside or nucleotide includes a bridge of two carbon atoms attached on the furanose ring that forms a bicyclic ring system.

[0049] “cEt” or “constrained ethyl” means a bicyclic nucleoside having a bicyclic sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the following formula: 4’-CH(CH3)-O-2’. “cEt modified nucleoside” means a bicyclic nucleoside having a bicyclic sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the following formula: 4’-CH(CH3)-O-2’. Its structural formula is as follows:

[0050] wherein Bx represents any nucleobase.

[0051] “Gapmer” means an antisense oligonucleotide comprising an internal region of a plurality of nucleosides that support RNAse H cleavage positioned between external regions of one or more nucleosides, wherein the nucleosides comprising the internal region are chemically different from the one or more nucleosides comprising the external regions. The internal region can be referred to as a “gap” or “gap segment,” and the external regions can be referred to as “wings.” In certain embodiments, the antisense oligonucleotide is a gapmer.

[0052] The term “complementary” is used to describe the relationship between nucleotide bases and / or polynucleotides that are capable of hybridizing to each other, e.g., the nucleotide sequence of such polynucleotide or region(s) thereof matches the nucleotide sequence of another polynucleotide or region(s) thereof when the two nucleotide sequences are aligned in opposite directions. As described herein, nucleobase matches or complementary nucleobases include the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (m5C) and guanine (G). Complementary polynucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside, and can include one or more nucleobase mismatches. Accordingly, the present disclosure also includes isolated polynucleotides complementary to sequences as disclosed or used herein, as well as those substantially similar nucleic acid sequences. The degree to which two polynucleotides have matching nucleobases can be expressed in terms of a “percent complementarity” or “percent complement.” Unless otherwise specified, the percent complementarity is the percent of nucleobases of a shorter sequence that are complementary to a longer sequence. m C) and guanine (G). Complementary polynucleotides and / or nucleic acids need not have nucleobase complementarity at every nucleoside, and can include one or more nucleobase mismatches. Accordingly, the present disclosure also includes isolated polynucleotides complementary to sequences as disclosed or used herein, as well as those substantially similar nucleic acid sequences. The degree to which two polynucleotides have matching nucleobases can be expressed in terms of a “percent complementarity” or “percent complement.” Unless otherwise specified, the percent complementarity is the percent of nucleobases of a shorter sequence that are complementary to a longer sequence.

[0053] “Mismatch” or “non-complementary” means that a nucleobase of a first polynucleotide is not complementary to a corresponding nucleobase of a second polynucleotide or target nucleic acid when the first and second polynucleotides are aligned. For example, a nucleobase (including but not limited to a universal nucleobase, inosine, and hypoxanthine) can be hybridized to at least one nucleobase, but is still a mismatch or non-complementary with respect to the nucleobase to which it is hybridized. As another example, a nucleobase of a first polynucleotide that is not capable of hybridizing to a corresponding nucleobase of a second polynucleotide or target nucleic acid when the first and second polynucleotides are aligned is a mismatch or non-complementary nucleobase.

[0054] Nucleobases can be naturally occurring or synthetic. Nucleobases and sugar bases can each independently be modified or unmodified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides can include abasic nucleosides lacking a nucleobase. For ease of expression, “modified nucleoside” can be denoted herein using the unmodified nucleoside abbreviation, i.e., adenine (A), thymine (T), uracil (U), cytosine (C), guanine (G), but with the caveat.

[0055] “5-methylcytosine” means a cytosine with a methyl group attached to the 5 position. 5-methylcytosine is a modified nucleobase.

[0056] In the context of an oligonucleotide, “contiguous” refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to one another in a sequence.

[0057] “Linked nucleosides” means adjacent nucleosides that are linked together by an internucleoside linkage.

[0058] “Internucleoside linkage” is a covalent linkage between adjacent nucleosides in a polynucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage.

[0059] “Polynucleotide” means a polymer of linked nucleosides, each of which can be modified or unmodified independently of one another. Unless otherwise specified, a polynucleotide consists of 8-80 linked nucleosides. “Modified polynucleotide” means a polynucleotide in which at least one sugar, nucleobase, or internucleoside linkage is modified. “Unmodified polynucleotide” means a polynucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.

[0060] Example 1 General method for preparing MOE-Gap antisense oligonucleotides by solid phase techniques

[0061] All reagents and solutions used in the synthesis of the oligomeric compounds in this application were purchased from commercial sources unless otherwise noted. Standard phosphoramidite building blocks and solid supports were used to incorporate nucleoside residues including, for example, T, A, G, and m C residues. All monomer (β-D-2' -deoxyribonucleoside and β-D-2' - (MOE) ribonucleoside) phosphoramidite solutions used were 0.06 M in anhydrous acetonitrile.

[0062] A 500 nmol synthesis column was packed on an LK-48E synthesizer using a Universal CPG solid support and the indicated sequence synthesis was performed using phosphoramidite coupling methodology. For the coupling steps, phosphoramidite monomers were delivered in 4-fold excess of the loading on the solid support and phosphoramidite condensations were performed for 10 min. All other steps were performed according to the standard protocols supplied by the manufacturer. A 3% solution of trichloroacetic acid in dichloromethane was used to remove the dimethoxytrityl (DMT) group from the 5'-hydroxyl of the nucleotides. 5-Benzylthio tetrazole (BTT, 0.35 M in anhydrous acetonitrile containing 0.5% N-methylimidazole (NMI)) was used as the activating agent during the coupling steps. Phosphorothioate linkages were introduced by a 3 min contact time with a 0.2 M solution of phenylacetyl disulfide (PADS) in 1 : 1 pyridine / acetonitrile.

[0063] After the synthesis of the indicated sequence, the solid support-bound indicated sequence was suspended in aqueous ammonia (25-30 wt%) and heated at 85°C for 2 h. The solid phase support was then filtered off and the ammonia was removed under reduced pressure. The residue was purified by high pressure liquid chromatography to produce the Gap antisense oligonucleotides (not including SG 19-23) as shown in Table 1.

[0064] Example 2 Real-time fluorescent quantitative PCR to detect the effect of antisense oligonucleotides of different sequences on reducing the expression of IRS-1 gene

[0065] The cells used in this experiment were human dermal fibroblast (HDF) cells (Promocell, CP-H103). The cells were seeded in 24-well plates at 1.5 x 10 5After 12 hours, different sequence oligonucleotides were transfected into the corresponding wells using Lipofectamine RNAiMax (Thermo Fisher) transfection reagent, with a final concentration of 100 nM, and DEPC water was transfected into the blank control group. After 24 hours of continuous culture at 37°C in a 5% CO2 environment, the cells were treated with Trizol (Invitrogen) to extract RNA, and cDNA was obtained using mmlv reverse transcriptase (Promega) as a template. Then, the expression of the IRS-1 gene was detected using real-time fluorescent quantitative PCR with ACTB as an internal reference gene, and the data were analyzed using the 2^-ΔΔCT method. Compared with the NC group, the knockdown efficiency of different concentrations of oligonucleotides was calculated, and the results are shown in Figure 1. SG19-23 (hereinafter referred to as 19-23, and the abbreviations of other oligonucleotides are used in the same manner) was used as a positive control, and a total of 42 antisense oligonucleotides were included in this example, of which 39 oligonucleotides significantly inhibited the expression of IRS-1 mRNA, with a knockdown efficiency of 10% to 90% (Table 1). The knockdown efficiency of 4 ASOs was higher than that of the positive control 19-23. The positive control SG19-23 has all phosphorothioate (P=S) bonds between the nucleotides, without other modifications.

[0066] Table 1. Description of antisense oligonucleotides used in Example 1

[0067] Note: The Gap antisense oligonucleotides in Table 1 are all 20 nucleotides in length and are designed as 5-10-5 gapmers. The gap contains 10 2’-deoxynucleosides and is flanked on both sides (in the 5’ and 3’ directions) by 5-nucleotide wings. Each nucleoside in the 5’ wing and each nucleoside in the 3’ wing is a 2’-MOE sugar modification, each nucleoside in the gap is a 2’ deoxy sugar modification, the internucleoside linkage throughout the gapmer is a phosphorothioate (P=S) bond, and all cytosine residues throughout the gapmer are 5-methylcytosines.

[0068] Example 3: In vitro angiogenesis experiment to detect the inhibitory effect of antisense oligonucleotides of different sequences on angiogenesis

[0069] The cells used in this experiment were human umbilical vein endothelial cells (HUVEC) (Pulno Sai, CP-H082). In a 96-well plate, 50 μL of pre-cooled Matrigel was added to each well to avoid air bubbles, and the plate was placed in a 37°C incubator for 30 minutes. The HUVEC cells were digested and counted, and 1.5 x 10 4The Lipofectamine RNAiMax transfection reagent was mixed with different sequence oligonucleotides, and then added to the HUVEC cells that had been counted, so that the final concentration of oligonucleotides was 100 nM. After mixing, they were dropped into the 96-well plate coated with Matrigel. After 18-24 hours, 1 μl of 1 μM calcein AM was added to 50 μl of serum-free medium to make the final concentration 20 nM. After incubation at room temperature for 30 minutes in the dark, the cells were washed with PBS for 2-3 times. Then, 485 nm / 529 nm was used for immunofluorescence imaging. AngioTool software was used to analyze and count the pictures. The results are shown in Figure 2 and Table 2. The average vessel length and junction density were detected. Compared with the negative control group (NC) PBS, among the 42 antisense oligonucleotides included in this example, 35 oligonucleotides significantly reduced the junction density, with an inhibition efficiency of 10%-80%; 28 oligonucleotides significantly reduced the average vessel length, with an inhibition efficiency of 10%-70%. 19-23, as a positive ASO, could significantly reduce the junction density and the average vessel length. Based on the results of Example 2 and Example 3, ASOs that could significantly inhibit HUVEC cell-mediated angiogenesis and inhibit IRS-1 mRNA expression were selected as candidate sequences (including 19-1, 19-2, 19-13, 19-14, 19-35, 19-36, 19-41, 19-44, 19-45) for subsequent experiments.

[0070] Table 2. Description of antisense oligonucleotides used in Example 2

[0071] Example 4 Real-time fluorescent quantitative PCR detection of the effect of different concentrations of antisense oligonucleotides on reducing IRS-1 gene expression

[0072] The cells used in this experiment are human dermal fibroblast (HDF) cells (Pronova, CP-H103). Antisense nucleotide sequences capable of knocking down IRS-1 mRNA expression and significantly inhibiting in vitro angiogenesis were transfected into HDF cells at final concentrations of 0.1 nM, 20 nM, 40 nM, 100 nM, 200 nM, and 500 nM, respectively. After 24 hours of incubation at 37°C in a 5% CO2 environment, RNA was extracted, and cDNA was obtained using reverse transcriptase with the obtained RNA as a template. Then, the expression of the IRS-1 gene was detected using real-time fluorescent quantitative PCR with ACTB as an internal reference gene, and data analysis was performed using the 2^-ΔΔCT method. Compared with the cell group treated with DEPC water, the knockdown efficiency of different concentrations of oligonucleotides was calculated, and the IC50 was calculated. The results are shown in Table 3.

[0073] Table 3. Description of antisense oligonucleotides used in Example 3

[0074] Example 5 Caspase-Glo 3 / 7 detection of cytotoxicity of antisense oligonucleotides of different sequences

[0075] Nine antisense nucleotide sequences capable of knocking down IRS-1 mRNA expression and significantly inhibiting in vitro angiogenesis were transfected into HepG2 cells, and the cytotoxicity was reflected by the content of Caspase 3 / 7. HepG2 cells were seeded in white opaque 96-well plates at 3x10 4 cells per well, and after 12 hours, different sequence oligonucleotides were transfected into the corresponding wells using Lipofectamine RNAiMax (ThermoFisher) transfection reagent, with the final concentration of oligonucleotides being 0.1 μM and 1 μM. The positive control group was transfected with a cEt modified sequence known to have strong cytotoxicity, and the wells transfected with DEPC water were recorded as 0 μM. Different sequences and different concentrations were each repeated three times. After 24 hours of incubation at 37°C in a 5% CO2 environment, the fresh medium was replaced, 50 μL of fresh medium was added to each well, and the same volume of Caspase-Glo 3 / 7 reagent was added to each well. After 1 hour of incubation at room temperature, the fluorescence signal value was detected using a microplate reader, and compared with the fluorescence value of the wells transfected with DEPC water to measure the cytotoxicity of different sequence oligonucleotides. The results are shown in Figure 3 and Table 4. The DEPC water (0 μM) group served as the negative control group, and its values at 0.1 μM and 1 μM were both 100. The 200-1 sequence, which is CTGGTGCTGCCTGTAG and is cEt modified, served as the positive control group and had strong cytotoxicity. Among the oligonucleotide sequences in this example, only 19-44 showed significant cytotoxicity, and 19-13 and 19-45 had slight upregulation at 1 μM, but there was no significant difference.

[0076] Table 4. Description of antisense oligonucleotides used in Example 4

[0077] Example 6 Inhibition of angiogenesis in vitro by antisense oligonucleotides of different sequences after free uptake into human umbilical vein endothelial cells (HUVECs)

[0078] In each well of a 96-well plate, 50 μL of Matrigel was added to avoid air bubbles, and the plate was left in a 37°C incubator for 30 minutes. The HUVEC cells were trypsinized and counted so that 1.5 x 10 4 The counted HUVEC cells were mixed with different concentrations of oligonucleotides so that the final concentrations were 0 μM, 1 μM, 5 μM and 10 μM, respectively. After thorough mixing, the mixture was added to the 96-well plate with Matrigel. After 18-24 hours, 1 μl of 1 μM calcein AM was added to 50 μl of serum-free medium so that the final concentration was 20 nM. After incubation at room temperature in the dark for 30 minutes, the plate was washed with PBS for 2-3 times. Immunofluorescence imaging was performed using 485 nm / 529 nm. The pictures were analyzed and counted using AngioTool software. The results are shown in Figure 4 and Table 5. Compared with the negative control group (PBS) (0 μM, 100%), almost all of the tested oligonucleotides at 5 μM and 10 μM inhibited angiogenesis to different extents, and 19-41 significantly inhibited angiogenesis at 5 μM.

[0079] Table 5. Description of antisense oligonucleotides used in Example 5

[0080] Example 7 Anti-angiogenic effect of antisense oligonucleotides in a mouse alkaline burn-induced corneal neovascularization model

[0081] C57 / B6 mice were used to construct the alkali burn-induced corneal neovascularization model. About 20-25 gram mice were anesthetized by intraperitoneal injection of 100 μl of 1% pentobarbital solution and 20 μl of 1% dexmedetomidine solution. A 4 mm filter paper was soaked in 1M NaOH solution for 10 seconds, and then the residual solution was removed. The filter paper was placed on the central surface of the eyeball, and after 20 seconds, the filter paper was removed. The cornea was immediately rinsed with normal saline until the pH of the cornea was 7.0. After 3-7 days, the neovascularization was observed under a slit lamp, and then the eyeball was taken out after cardiac perfusion with ink. The corneal smearing experiment was performed to detect the neovascularization, and the area of neovascularization was calculated by Image J. The results are shown in Figure 5 and Table 6. Compared with the positive control group 19-23, the antisense oligonucleotide of IRS-1 (19-41) significantly inhibited the generation of corneal neovascularization, and the inhibitory effect was better than that of the positive drug 19-23.

[0082] Table 6. Description of antisense oligonucleotides used in Example 6

[0083] Example 8 Anti-angiogenic effect of antisense oligonucleotide in rabbit corneal neovascularization model constructed by suture method

[0084] In this experiment, New Zealand rabbits weighing about 2.5 kg and aged 3-8 months were selected. The rabbits were anesthetized with 3% sodium pentobarbital, and the anesthetic dose was 30 mg / kg by intravenous injection or 40-50 mg / kg by intraperitoneal injection. After general anesthesia and local anesthesia of the eyes, 7-0 suture was selected, which passed through the corneal stroma layer 2 mm from the corneal limbus and was perpendicular to the corneal limbus, with a length of about 2 mm. After the modeling was completed, 1 mg of ASO 19-41 was injected subconjunctivally into the right eye, and PBS was injected subconjunctivally into the left eye. Oxygen fluoroquinolone eye ointment was dropped once a day for one week to prevent bacterial infection. On the seventh day, CNV was observed after anesthesia and photography, and 1 mg of ASO 19-41 was injected subconjunctivally into the right eye, and PBS was injected subconjunctivally into the left eye. On the fourteenth day, the eyelids were opened with an eyelid speculum and photographed for comparison. Compared with the control group, the results showed that 19-41 significantly inhibited the generation of rabbit corneal neovascularization, while 19-23 had no significant effect.

[0085] Table 7. Description of antisense oligonucleotides used in Example 6

[0086] Example 9 Anti-angiogenic effect of antisense oligonucleotide in krypton laser-induced mouse choroidal neovascularization model

[0087] In this embodiment, 10-12 week C57 / B6 mice were used to construct a krypton laser-induced mouse choroidal neovascularization model. The mice weighed 25-30 grams. The mice were anesthetized by intraperitoneal injection of 100 μl of 1% pentobarbital solution and 20 μl of 1% dexamethasone solution. The mice were then mydriated by eye drops of compound tropicamide eye drops. A small amount of 1% methyl cellulose was added to the cover glass placed in front of the mouse eye to contact the cornea. The krypton laser (wavelength 532 nm, spot diameter 50 um, power 120 mW, exposure time 100 ms) was 2-3 disc diameters from the optic disc and uniformly photocoagulated 8 points. The Bruch's membrane was punctured when bubbles were observed. After the model was established, 2 μl of normal saline was injected into the vitreous body of the left eye of the mouse, and 125 μg / 2 μl of antisense oligonucleotide was injected into the vitreous body of the right eye. After 3 and 7 days of drug injection, the mice were anesthetized and mydriated (as before). About 5 minutes after intraperitoneal injection of 1% fluorescein sodium injection, FFA examination was performed to observe the fundus neovascularization, and the area of neovascularization was calculated by Image J software. The results are shown in Figure 6. Compared with the negative control group (normal saline), the antisense oligonucleotide of IRS-1 (19-41) significantly inhibited the formation of choroidal neovascularization, with an inhibition rate of 62.45% for 19-41 and 16.10% for 19-23. The inhibition effect of 19-41 was better than that of 19-23.

[0088] Table 8. Description of antisense oligonucleotides used in Example 7

[0089] Example 10 Inhibition of tumor angiogenesis and tumor growth by antisense oligonucleotides of IRS-1

[0090] HepG2 cells (ATCC, HB-8065) cultured for 24 h were harvested, and the cells were mixed into a 50% Matrigel mixture to a concentration of 2.5 x 10 7 / ml. A volume of 0.2 ml of the cell mixture was subcutaneously injected into the flank of a 6-8 week old nude mouse. On days 0, 7, 14, and 21, the mice were intravenously injected with IRS-1 antisense oligonucleotide at a dose of 50 mg / kg. On day 21, the samples were collected, the tumors were measured for weight and volume, and RNA and protein were extracted to detect the knockdown efficiency and the expression of angiogenesis-related proteins. The results are shown in Figure 7. Compared with the control group (ASO scramble group, CCTATAGGACTATCCAGGAA), the IRS-1 antisense oligonucleotide significantly inhibited tumor angiogenesis and tumor growth.

[0091] Example 11 General method for preparing cEt-Gap antisense oligonucleotides by solid phase technology

[0092] Unless otherwise indicated, all reagents and solutions used in the synthesis of the oligomeric compounds in this application were purchased from commercial sources. Standard phosphoramidite building blocks and solid supports were used to incorporate nucleoside residues, including, for example, T, A, G, and mC residues. The phosphoramidite solution of beta-D-2'-deoxyribonucleoside monomers (DNA) used was a 0.06 M solution in anhydrous acetonitrile, and the phosphoramidite solution of 4'-CH(CH3)-0-2' (referred to as "cEt") ribonucleosides was a 0.1 M solution in anhydrous acetonitrile.

[0093] A 500 nmol synthesis column was packed on an LK-48E synthesizer with a Universal CPG solid support, and the specified sequence synthesis was performed using phosphoramidite coupling methodology. For the coupling steps, the DNA phosphoramidite monomers were delivered in 4-fold excess of the loading on the solid support and phosphoramidite condensation was carried out for 10 min; the cEt phosphoramidite monomers were delivered in 4-fold excess of the loading on the solid support and phosphoramidite condensation was carried out for 20 min. All other steps were according to the standard protocols supplied by the manufacturer. A 3% solution of trichloroacetic acid in dichloromethane was used to remove the dimethoxytrityl (DMT) group from the 5'-hydroxyl of the nucleotides. BTT (0.35 M with 0.5% NMI) in anhydrous acetonitrile was used as the activating agent during the coupling steps. Phosphorothioate linkages were introduced by a 3 minute contact time with a 0.2 M solution of diphenacyl disulfide (PADS) in 1 : 1 pyridine / acetonitrile.

[0094] After the specified sequence was synthesized, the solid support-bound specified sequence was suspended in aqueous ammonia (25-30 wt%) and heated at 85 °C for 2 h. The solid phase support was then filtered off and the ammonia was removed under reduced pressure. The residue was purified by high pressure liquid chromatography to produce the Gap antisense oligonucleotides as shown in Table 9.

[0095] The Gap antisense oligonucleotides in Table 9 are 16 nucleosides in length and are designed as 3-10-3 gapmers. The gap contains 10 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by 3-nucleoside wings. Each nucleoside in the 5' wing and each nucleoside in the 3' wing is a cEt sugar modification, each nucleoside in the gap is a 2' deoxy sugar modification, the internucleoside linkage throughout the gapmer is a phosphorothioate (P=S) linkage, and all cytosine residues throughout the gapmer are 5-methylcytosine.

[0096] Example 12 Real-time fluorescent quantitative PCR to detect the effect of cEt-modified antisense oligonucleotides on reducing IRS-1 gene expression

[0097] cEt modified ASOs were designed and synthesized according to the method of Example 11, and screened according to the method of Example 2, and the results are shown in Figure 8. Real-time fluorescent quantitative PCR results showed that a total of 9 cEt modified antisense oligonucleotides were included in this example, of which 9 oligonucleotides significantly inhibited the expression of IRS-1 mRNA, and the knockdown efficiency was between 17% and 92% (Table 9). Compared with the positive control 19-23, the knockdown efficiency of 4 ASOs was higher than 19-23.

[0098] Table 9. Description of corresponding cEt modified antisense oligonucleotides used in Example 13

[0099] Example 13 Inhibition of cEt modified antisense oligonucleotides in in vitro angiogenesis

[0100] According to the method in Example 3, after transfecting cEt modified ASOs into umbilical vein endothelial cells HUVEC (Promocell, CP-H082) using Lipofectamine RNAiMax transfection reagent, the inhibition of angiogenesis of umbilical vein cells was detected. The results are shown in Figure 9 and Table 10, and NC is the negative control group (0 μM, 100%); 19-23 as a positive control significantly inhibits the vascular node density and the average vessel length, thereby inhibiting angiogenesis. 19-41 significantly inhibits angiogenesis as the previous results. Among the cEt modified ASOs (19-76-19-84), 19-80 and 19-82 significantly inhibit the vascular node density, and 19-80, 19-81 and 19-82 significantly inhibit the average vessel length.

[0101] Table 10. Description of corresponding cEt modified antisense oligonucleotides used in Example 14

[0102] Example 14 Inhibition of cEt modified antisense oligonucleotides in in vitro angiogenesis after free uptake into umbilical vein endothelial cells (HUVEC)

[0103] The inhibitory effect of cEt modified ASOs on HUVEC cell mediated angiogenesis was detected after the ASOs were allowed to diffuse freely into the umbilical vein endothelial cells according to the method in Example 6. The results are shown in Figure 10. Con. is the negative control group (0 μΜ, 100%); 19-23 is the positive control group, which can significantly inhibit HUVEC cell mediated angiogenesis at 3.5 μΜ; 19-41 can significantly inhibit HUVEC cell mediated angiogenesis at 2.5 μΜ and 3.5 μΜ, including inhibiting the vascular node density and the average vascular length, and the effect is significantly better than that of the positive drug 19-23. Among the cEt modified ASOs (19-76-19-84), 19-82 can significantly inhibit HUVEC cell mediated angiogenesis at 2.5 μΜ and 3.5 μΜ, and has similar effect to 19-41. In summary, it can be found that the oligonucleotides containing the sequence GCTGCTGGTG have significant and stable inhibitory effect on IRS-1 expression and angiogenesis under different modification methods.

[0104] Table 11. Description of corresponding cEt modified antisense oligonucleotides used in Example 15

[0105] Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalent technologies, the present application also intends to include these modifications and variations.

Claims

1. An oligonucleotide, characterized in that, The oligonucleotide contains at least 80%, 90%, or 100% identical sequential sequences to GCGTGCTGGTG.

2. The oligonucleotide as described in claim 1, characterized in that, The oligonucleotide consists of 12 to 27 linked nucleosides; preferably, the oligonucleotide consists of 14 to 20 linked nucleosides.

3. The oligonucleotide as described in claim 1 or 2, characterized in that, The oligonucleotide is a modified oligonucleotide, and the modification is a single-stranded modification.

4. The oligonucleotide as described in claim 3, characterized in that, At least one nucleoside in the modified oligonucleotide contains a modified nucleic acid base, preferably, the modified nucleic acid base is 5-methylcytosine.

5. The oligonucleotide as described in claim 3 or 4, characterized in that, The modified oligonucleotide is a gamper, which includes a gap composed of a linked deoxynucleoside and 5' and 3' wings composed of linked nucleosides, with the gamper located between the 5' and 3' wings.

6. The oligonucleotide as described in claim 5, characterized in that, At least one nucleoside in the wing segment of the spacer contains a modified sugar.

7. The oligonucleotide as described in claim 6, characterized in that, The modified sugar is a 2'-modified sugar.

8. The oligonucleotide as described in claim 7, characterized in that, The 2'-modified sugar is 2'-O-methoxyethyl modified.

9. The oligonucleotide as described in claim 6 or 7, characterized in that, The modified sugar is a bicyclic sugar.

10. The oligonucleotide according to any one of claims 6-8, characterized in that, The modification is a 4'-CH(CH3)-O-2'(cEt) modification.

11. The oligonucleotide as claimed in claim 5, characterized in that, The gap consists of 3-16 linked nucleosides.

12. The oligonucleotide as described in claim 5, characterized in that, The modified oligonucleotide comprises: a nick consisting of 8-12 linked deoxynucleosides and 5' and 3' wings consisting of 2-6 linked nucleosides, wherein the nick is located between the 5' and 3' wings and wherein each nucleoside of each wing contains a modified sugar.

13. The oligonucleotide of claim 12, characterized in that, The modified oligonucleotide comprises: a nick consisting of 10 linked deoxynucleotides and 5' and 3' wings consisting of 5 linked nucleotides, wherein the nick is located between the 5' and 3' wings and wherein each nucleotide in each wing comprises a modified sugar; wherein each nucleotide in each wing comprises a 2'-O-methoxyethyl sugar or a restricted ethyl sugar.

14. The oligonucleotide of claim 13, characterized in that, The modified oligonucleotide comprises: a nick consisting of 10 linked deoxynucleotides and a 5' wing and a 3' wing consisting of 3 linked nucleotides, wherein the nick is located between the 5' wing and the 3' wing and wherein each nucleotide of each wing comprises a modified sugar; wherein each nucleotide of each wing comprises a 2'-O-methoxyethyl sugar or a restricted ethyl sugar.

15. The oligonucleotide as described in claim 3, characterized in that, 50%, 60%, 70%, 80%, 90%, or all of the sequence of the single-stranded modified oligonucleotide that is substantially the same as GCTGCTGGTG is located in the nick.

16. The oligonucleotide of claim 15, characterized in that, The sequence of the gap segment is GCTGCTGGTG.

17. The oligonucleotide of claim 15, characterized in that, At least one nucleoside internucleotide in the modified oligonucleotide is a modified nucleoside internucleotide.

18. The oligonucleotide of claim 17, characterized in that, All internucleotide bonds in the modified oligonucleotide are modified internucleotide bonds.

19. The oligonucleotide of claim 18, characterized in that, All internucleotide bonds in the modified oligonucleotide are phosphate thioester internucleotide bonds.

20. The oligonucleotide as claimed in claim 5, characterized in that, The single-stranded modified oligonucleotide comprises a nick consisting of 10 linked deoxynucleosides and 5' and 3' wings consisting of 5 linked nucleosides, respectively. The nick is located between the 5' and 3' wings, and each nucleoside in each wing is a 2'-O-methoxyethyl modified nucleoside. The internucleotide bonds in the entire modified oligonucleotide are phosphate thioester bonds, and all cytosines in the entire modified oligonucleotide are 5-methylcytosine. The sequence of the nick is GCTGCTGGTG.

21. The oligonucleotide of claim 20, characterized in that, The modified oligonucleotide structure is as follows: GAGGGGCTGCTGGTGTTGGA; It comprises a notch consisting of 10 linked deoxynucleosides and 5' wings and 3' wings consisting of 5 linked nucleosides, respectively, wherein the notch is located between the 5' wings and the 3' wings, and each nucleoside in each wing is a 2'-O-methoxyethyl modified nucleoside, the inter-nucleoside bonds are all phosphate thioester (P=S) bonds, and all cytosines in the entire modified oligonucleotide are 5-methylcytosine.

22. The oligonucleotide as described in claim 5, characterized in that, The single-stranded modified oligonucleotide comprises a nick consisting of 10 linked deoxynucleosides and 5' and 3' wings consisting of 3 linked nucleosides, respectively. The nick is located between the 5' and 3' wings, and each nucleoside in each wing is a cEt-modified nucleoside. The internucleotide bonds in the entire modified oligonucleotide are phosphate thioester bonds, and all cytosines in the entire modified oligonucleotide are 5-methylcytosine. The sequence of the nick is GCTGCTGGTG.

23. The oligonucleotide as claimed in claim 22, characterized in that, The modified oligonucleotide structure is as follows: GGGGCTGCTGGTGTTG (SEQ ID NO:49); It comprises a notch consisting of 10 linked deoxynucleosides and 5' wings and 3' wings consisting of 3 linked nucleosides, respectively, wherein the notch is located between the 5' wings and the 3' wings, and each nucleoside in each wing is a cEt-modified nucleoside, the inter-nucleoside bonds are phosphate thioester (P=S) bonds, and all cytosines in the entire modified oligonucleotide are 5-methylcytosine.

24. Use of the oligonucleotide or salt thereof as described in any one of claims 1-23 in the preparation of a medicament for the prevention or treatment of diseases or symptoms related to angiogenesis.

25. The use as described in claim 24, characterized in that, The disease or symptom is cancer, vascular abnormality, infection, cardiovascular disease, or injury; preferably, the disease or symptom is a neovascular eye disease, including corneal neovascularization, iris neovascularization, retinal neovascularization, or choroidal neovascularization-related diseases; preferably, the disease or symptom is diabetic retinopathy, neovascular age-related macular degeneration, retinal vein occlusion, retinopathy of prematurity, or choroidal angiogenesis.

26. A pharmaceutical composition, characterized in that, It comprises an oligonucleotide or a salt thereof as described in any one of claims 1-23, and a pharmaceutically acceptable carrier.

27. The pharmaceutical composition of claim 26, characterized in that, The composition is an injectable pharmaceutical composition.

28. The pharmaceutical composition of claim 27, characterized in that, The drug is administered via subcutaneous or intravenous injection.

Citation Information

Patent Citations

  • Injectable pharmaceutical composition for preventing, stabilising and / or inhibiting pathological neovascularization-related conditions

    CN103180444A

  • Composition comprising inhibitors of IRS-1 and of VEGF

    CN103764830A

  • Composition comprising inhibitors of IRS-1 and of VEGF

    CN108159426A

  • Sterile formulation comprising a stable phosphorothioate oligonucleotide

    CN110520134A

  • Antisense oligonucleotides capable of inhibiting the formation of capillary tubes by endothelial cells

    US20040162257A1