Tau-targeting RNA interference method, nucleic acid and application thereof

By using isolated nucleic acid molecules and vector delivery systems, specific miRNAs are delivered to target cells via exosomes, solving the problems of low efficiency and off-target effects in delivering artificial miRNAs, and achieving effective treatment for Tau protein-related diseases.

WO2026002277A1PCT designated stage Publication Date: 2026-01-02EXORNA BIOSCIENCE (NANJING) CO LTD +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/105696
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-30
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently and safely deliver artificial miRNAs to target tissues for the treatment of Alzheimer's disease, and there are also issues with off-target effects.

Method used

The isolated nucleic acid molecules, including the pri-miRNA sequence encoding the Tau gene repression, are delivered into cells via a vector for processing into specific miRNAs. These miRNAs are then delivered to target cells via exosomes to suppress Tau expression. The RNA fragments are enriched and encapsulated in mammalian tissues via the vector.

Benefits of technology

It achieves efficient and specific inhibition of Tau expression, reduces off-target effects, and significantly reduces symptoms of Tau protein-related diseases, especially Alzheimer's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025105696-FTAPPB-I100001
    Figure PCTCN2025105696-FTAPPB-I100001
  • Figure PCTCN2025105696-FTAPPB-I100002
    Figure PCTCN2025105696-FTAPPB-I100002
  • Figure PCTCN2025105696-FTAPPB-I100003
    Figure PCTCN2025105696-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention provides a nucleic acid molecule used for regulating the level or amount of Tau mRNA. Specifically, the present invention provides the delivery of a primary microRNA to form a precursor after in vivo processing, and a microRNA used for the in vivo inhibition of the expression of Tau mRNA. The present invention also provides a delivery system for the nucleic acid molecule, comprising a vector, an exosome and a cell, and a pharmaceutical composition containing same. The present invention also provides an application of the nucleic acid molecule and the delivery system in neurodegenerative disease treatment and drug preparation, in particular a method and a drug targeting Alzheimer's disease.
Need to check novelty before this filing date? Find Prior Art

Description

RNA interference methods, nucleic acids and uses thereof targeting tau

[0001] This application claims priority to the Chinese patent application with the application number 202410868501.5, filed on June 28, 2024, and the title “RNA interference methods, nucleic acids and uses thereof targeting tau”, the whole content of which is incorporated herein by reference. TECHNICAL FIELD

[0002] The present invention relates to the fields of molecular biology and medicine. In particular, the present invention relates to systems for delivering precursor miRNAs and their use in the treatment of diseases. BACKGROUND

[0003] The brains of patients with Alzheimer’s disease (AD) have a rich abundance of two abnormal structures, amyloid plaques and neurofibrillary tangles. This is especially true in certain regions of the brain that are important for memory. There is also a significant loss of neurons and synapses in the cerebral cortex and certain subcortical regions. Both neurofibrillary tangles and neuronal loss increase in parallel with the duration and severity of the disease, and neurofibrillary burden has been shown to correlate with cognitive decline.

[0004] Neurofibrillary tangles are intraneuronal lesions composed of hyperphosphorylated and insoluble accumulations of the microtubule-associated protein tau (MAPT, also known as Tau protein). These accumulations are a histopathological feature of many neurodegenerative diseases, collectively known as tauopathies. Tauopathies include, for example, Alzheimer’s disease (AD), Pick’s disease (PiD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and frontotemporal lobar degeneration (FTLD). Tau pathology is implicated in and can be the cause of many tauopathies. In its normal form, Tau is a highly soluble microtubule-associated protein that binds to and promotes microtubule assembly. However, in tauopathies, Tau becomes hyperphosphorylated, causing it to detach from microtubules, and ultimately to accumulate as neurofibrillary tangles. RNA interference (RNAi) is a gene silencing phenomenon at the mRNA level triggered by double-stranded RNA, widely existing in animals, plants and viruses, mainly including two action pathways of small interfering RNA (siRNA) and microRNA (miRNA).

[0005] Endogenous miRNAs are a hairpin secondary structure found in many primary RNA transcripts (pri-miRNAs). In the nucleus, the Drosha / DGCR8 complex binds and cleaves the base stem of the pri-miRNA to release the stem loop precursor miRNA (pre-miRNA). The pre-miRNAs are then exported from the nucleus, the loop is cleaved by Dicer / TRBP to form the mature RNA duplex. The guide strand, also known as the passenger strand, is separated from the passenger strand, loaded onto the argonaute protein in the RNA-induced silencing complex (RISC), and then targets the complementary mRNA transcript for degradation or translational inhibition.

[0006] Artificial miRNA (amiRNA) technology is to replace the mature sequence of natural miRNA with an antisense sequence designed to target other genes of interest, through the generation and action of natural miRNA to achieve the effect of RNAi, with obvious interference effect, rapid action, low toxicity, etc. It has broad application prospects. amiRNA is usually generated by transcription and processing in cells by an expression vector, and its mechanism of action is the same as or similar to that of natural miRNA. Since the precursor processing mechanism and action process of miRNA in vivo are not fully understood, how to make amiRNA expected to be normally synthesized and to achieve the best effect of its production still needs further research. In addition, factors affecting the silencing effect of amiRNA, in addition to sequence specificity, are also affected by the skeleton sequence of amiRNA, the cutting site, the synergistic effect with other small molecules or proteins, and other uncertain factors.

[0007] Various delivery systems have been employed in the art to safely and accurately deliver artificial miRNAs or siRNAs in the form of pri-miRNAs or pre-miRNAs to target tissues. However, there is still a need in the art for improved, more efficient and less off-target delivery of artificial miRNAs and methods thereof for use in medicaments for the treatment of Alzheimer's disease. SUMMARY

[0008] The present invention provides nucleic acid molecules and methods for modulating (increasing or decreasing) the level or amount of mRNA of microtubule-associated protein tau (MAPT, also known as Tau protein or simply Tau). In particular, the present invention provides nucleic acid molecules for delivering primary microRNA (pri-miRNA or pri-miR) to form, upon in vivo processing, precursor- and microRNA (miRNA or miR).

[0009] In particular, the present application provides an isolated nucleic acid comprising a nucleic acid sequence encoding an RNA that inhibits expression of a Tau gene, the nucleic acid sequence comprising a miRNA sequence that inhibits the Tau gene.

[0010] In one aspect, the present application provides a nucleic acid for delivering a primary microRNA or a precursor microRNA in vivo, which is processed in cells to produce a highly specific artificial microRNA or siRNA that reduces expression of Tau.

[0011] The term "microRNA (or miRNA or miR)" herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3' UTR of a nucleic acid molecule and down-regulates gene expression (by reducing nucleic acid molecule stability or by inhibiting translation). The regulatory polynucleotide of the present application can comprise one or more microRNA sequences, microRNA seeds or artificial microRNAs, e.g., sequences that function as microRNAs.

[0012] The term "pre-miRNA" herein refers to a precursor microRNA. A pre-miRNA is about 70 bases long and is generated in the nucleus after cleavage of a pri-miRNA by Drosha. The pre-miRNA is exported to the cytoplasm by the exportin 5, where they are processed by the nuclease Dicer to form mature miRNAs.

[0013] The term "siRNA" herein refers to small interfering RNA, which is also sometimes referred to as short interfering RNA or silencing RNA, is a double-stranded RNA of typically 17-24 base pairs in length. It interferes with the expression of specific genes by degrading mRNAs that have a complementary nucleotide sequence to the antisense strand (also known as the guide strand) of the siRNA, thereby preventing translation.

[0014] The polynucleotide provided by the present application can efficiently deliver an exogenous nucleotide sequence to an exosome, specifically inhibit a target gene in a target cell after the exosome reaches the target cell, and can maximize the avoidance of side effects caused by off-target.

[0015] In one aspect of the present application, an isolated nucleic acid comprising a nucleic acid sequence encoding a pri-miRNA that inhibits expression of a Tau gene is provided. The pri-miRNA comprises a miRNA sequence that inhibits the Tau gene, and one or more of a flanking structural sequence, a stem loop structure, and a complement sequence to the RNA sequence. In one embodiment of the present application, the nucleic acid sequence of the pri-miRNA in the nucleic acid comprises, in order from 5' to 3', a 5' flanking structural sequence, a miRNA sequence that inhibits expression of the gene, a stem loop sequence, a complement sequence, and a 3' flanking structural sequence.

[0016] As used herein, "isolated" means that the substance is separated from its original environment. For example, nucleic acids and polypeptides in their natural state within a living organism are not isolated, but the same nucleic acids or polypeptides are isolated when separated from other substances with which they are naturally present.

[0017] In one embodiment of the present application, the nucleic acid comprises multiple copies of the nucleic acid sequence of the pri-miRNA. In one embodiment of the present application, the multiple copies are 2-10 copies, preferably 2-5 copies, more preferably 2-3 copies. For example, it comprises 2, 3 or 4 copies.

[0018] In one embodiment of the present application, the aforementioned nucleic acid has a spacer sequence between the sequences of the pri-miRNA encoding the expression of the multiple copies of the suppressor gene. In another embodiment of the present application, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.

[0019] Specifically, in one aspect of the present application, the pri-miRNA has the following structure of Formula I:

[0020] wherein, "|" represents base pairing, (A1A2...A a-1 A a ) is the first RNA sequence; (B b B b-1 ...B2B1) is the second RNA sequence, (A1A2...A a-1 A a ) and (B b B b-1 ...B2B1) are completely complementary or substantially completely complementary, wherein a and b are each independently an integer of about 15-29, preferably an integer of about 18-22;

[0021] [M1M2...M m-1 M m ] is the 5' end flanking sequence; [N n N n-1 ...N2N1] is the 3' end flanking sequence, wherein m and n are each independently an integer of about 25-50, preferably m

[0022] is a spacer sequence forming a stem loop structure, referred to as a C stem loop,

[0023] wherein c is an integer of about 10-30, preferably an integer of about 16-20.

[0024] The pri-miRNA provided by the present application generates pre-miRNA or miRNA after biological processing (in vivo, in tissue, or in cells, etc.) (hereinafter can be referred to as "processing"), and finally generates RNA sequences targeting the target mRNA. In the present application, the structure composed of the 5' end flanking sequence (such as [M1M2...M m-1 M m ]) and the first RNA sequence (such as A1A2...A a-1 A a ) in formula I is also called 5' arm, and the first RNA sequence is called 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the structure composed of the 3' end flanking sequence (such as [N n N n-1 ...N2N1]) and the second RNA sequence (such as B b B b-1 ...B2B1) in formula I is also called 3' arm, and the second RNA sequence is called 3' arm RNA sequence or 3' arm miRNA. The pre-miRNA provided by the present application comprises RNA sequences targeting the target mRNA, which can be located or positioned on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, i.e. the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by the present application can generate one or two single-stranded mature miRNAs. According to the processing from the 5' end arm and the 3' end arm of the precursor, the single-stranded mature miRNA corresponding to the first miRNA sequence (A1A2...A a-1 A a ) can be called miRNA-5p, and the mature miRNA corresponding to the second miRNA sequence (B b B b-1 ...B2B1) can be called miRNA-3p.

[0025] The miRNA can be substantially complementary to at least a portion of the sequence of the mRNA of the gene. "Substantially complementary" means that the sequence of nucleotides is sufficiently complementary to interact in a predictable manner, such as forming secondary structures. Typically, two "substantially complementary" nucleotide sequences are at least 70% complementary to each other; preferably, at least 80% complementary; more preferably, at least 90% complementary; further preferably, at least 95% complementary; such as 98%, 99% or 100%. Functionally, the miRNA interferes with the post-transcriptional degradation of mRNA of the specific gene expressed with the complementary nucleotide sequence, thereby preventing translation.

[0026] In one aspect of the present application, the miRNA has a length of 15-29 nucleotides (nt), preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. A large number of experiments have shown that when the length of the RNA sequence is less than 18 nt, especially less than 15 nt, the RNA sequence is mostly ineffective and does not play a role, and when the length of the RNA sequence is greater than 22 nt, especially greater than 25 nt, not only the cost of the line is greatly increased, but also the effect is not superior to that of the RNA sequence with a length of 18-22 nt, and the economic benefit is poor. Therefore, when the length of the miRNA sequence is 15-25 nt, especially 18-22 nt, the effect is the best.

[0027] In one aspect of the present application, the pri-miRNA provided by the present application is biologically processed to obtain substantially only the miRNA with the sequence of the first miRNA sequence, and another RNA sequence does not form or almost does not form the miRNA. In one embodiment of the present application, the pri-miRNA provided by the present application is processed in vivo to obtain the miRNA with the sequence of the first miRNA sequence which has activity, i.e., the 5' arm miRNA has activity, and almost no miRNA with the sequence of the second miRNA sequence, i.e., the 3' arm miRNA does not have activity or almost does not have activity.

[0028] In one aspect of the present application, the almost-formed miRNA obtained by biologically processing the pri-miRNA provided by the present application accounts for less than 40%, preferably less than 10%, more preferably less than 5%, for example, less than or equal to 2% of the total miRNA obtained by processing the pri-miRNA.

[0029] In one aspect of the present application, the target KD of the mRNA of the miRNA sequence of the gene obtained by in vivo processing of the pri-miRNA of the nucleic acid provided by the present application is at least higher than about 30%, about 40%, 50%, 90%, 95%, or up to 99%.

[0030] In one aspect of the present application, the target KD of the protein of the expression of the gene obtained by in vivo processing of the pri-miRNA of the nucleic acid provided by the present application is at least higher than about 40%, 50%, 90%, 95%, or up to 99%.

[0031] In one aspect of the present application, the target KD achieved by the miRNA which is almost not formed by biologically processing the pri-miRNA provided by the present application is lower than about 40%, 10%, 5%, or close to 0.

[0032] In one aspect of the present application, the pri-miRNA provided by the present application is processed to produce miRNA which essentially does not cause off-target effect.

[0033] In one embodiment of the present application, the miRNA sequence for inhibiting the expression of Tau gene has the following nucleotide sequence: or

[0034] In one embodiment of the present application, the combination of the RNA sequence for inhibiting the expression of Tau gene and its complementary sequence has the following nucleotide sequence:

[0035] In one embodiment of the present application, the RNA for inhibiting the expression of Tau gene is a pri-miRNA which has a stem-loop structure. In one embodiment of the present application, the sequence of the stem-loop structure has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO: 12).

[0036] In one embodiment of the present application, the RNA for inhibiting the expression of Tau gene is a pri-miRNA which has a 5' end flanking sequence (such as [M1M2...Mn] in Formula I) and a 3' end flanking sequence (such as [N1N2...Nn] in Formula I). In one embodiment of the present application, the 5' end flanking sequence and the 3' end flanking sequence each independently or simultaneously has more than 80% identity, preferably more than 90% identity, preferably more than 95% identity, and preferably 100% identity to the pri-miR sequence of a mammal, in particular a human. In one embodiment of the present application, the pri-miR is pri-miR155. m-1 M m n N n-1

[0037] In one embodiment of the present application, the 5' end flanking sequence of the pri-miRNA has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 13).

[0038] In one embodiment of the present application, the 3' end flanking sequence of the pri-miRNA has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 14).

[0039] ​​In one aspect of the present application, the present application also provides a pre-miRNA processed from the aforementioned pri-miRNA of the present application.

[0040] The present application also provides an isolated nucleic acid encoding a combination of RNAs that inhibit expression of one or more target genes. The nucleic acid comprises (1) a nucleic acid sequence encoding an RNA that inhibits expression of a Tau gene, and (2) a nucleic acid sequence encoding an RNA that inhibits expression of a second gene.

[0041] In one aspect of the present application, the second gene comprises an APP gene, an LRRK2 gene, an EGFR gene, a KRAS gene, a VEGFR gene, an mTOR gene, a TNF-α gene, an integrin-α gene, a B7 gene, a TGF-β1 gene, a HER2 gene, a H2-K gene, a H2-D gene, a H2-L gene, an HLA gene, a GDF15 gene, miRNA-21, miRNA-214, a TNC gene, a PTP1B gene, PD-1, PD-L1, CTLA4, a PTGS2 gene, a TTR gene, a SNCA gene, a FUS gene, a FGFR4 gene, a FGF19 gene, a CTNNB1 gene, a KHK gene, an mHTT gene, and an α-synuclein gene, etc.

[0042] In one embodiment of the present application, the second gene is an APP gene.

[0043] In one embodiment of the present application, the isolated nucleic acid encoding a combination of RNAs that inhibit expression of one or more target genes has a spacer sequence between the nucleic acid sequence encoding the RNA that inhibits expression of a Tau gene and the nucleic acid sequence encoding the RNA that inhibits expression of the second gene. In another embodiment of the present application, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.

[0044] In another aspect of the present application, a vector comprising the aforementioned isolated nucleic acid of the present application comprising a nucleic acid sequence encoding an RNA that inhibits expression of a Tau gene and an RNA that inhibits expression of a Tau and a second gene is provided. In yet another aspect of the present application, the vector is an expression vector. The nucleic acid of the present application can be located downstream of a promoter of the vector (e.g., but not limited to, a CMV, U6, CBA, or CBA promoter with an SV40 intron).

[0045] In one embodiment of the application, the vector is a plasmid. In one embodiment of the application, the plasmid is enriched in a tissue (including: liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, in particular liver) after administration to a mammal, transcribes and / or expresses the RNA fragment of the application, and the RNA fragment is encapsulated in exosomes in the cells of the tissue.

[0046] In one embodiment of the application, the vector is a viral vector. For example, it can be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpes virus vector or a lentivirus vector. In one embodiment of the application, the vector is an adenovirus vector, for example an adenovirus associated virus type 5, an adenovirus associated virus type 8 or an adenovirus associated virus type 9.

[0047] In one embodiment of the application, the plasmid or viral vector is enriched and expressed in the liver after administration to a mammal, and the product is massively encapsulated in exosomes.

[0048] In one aspect of the application, a cell comprising the isolated nucleic acid of the application as described above is provided. The cell comprising the nucleic acid of the application as described above of the application can be obtained by transfecting a cell with a plasmid or a viral vector. Transfecting a cell with a nucleic acid construct can be performed using a variety of methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection and calcium phosphate transfection.

[0049] In one aspect of the application, an exosome with an RNA inhibiting the expression of a Tau gene is provided, comprising the pri-miRNA, the pre-miRNA or the RNA molecule of the application as described above. In one embodiment of the application, the exosome is an exosome of human tissue or cell origin. The tissue includes liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes. In one embodiment of the application, the exosome is an exosome of liver or liver cell origin.

[0050] The exosomes of the application can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example 100000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, for example immunoprecipitation using specific antibodies, magnetic bead purification, resin-based purification. The exosomes can then be quantified and characterized.

[0051] The RNA provided by the present application can be delivered to different tissues to inhibit specific target genes and treat related diseases. For example, siRNA targeting TAU and / or APP genes can be used to treat neurodegenerative diseases in the brain.

[0052] In one aspect of the present application, a pharmaceutical composition comprising the nucleic acid, vector or cell as described above is provided. The pharmaceutical composition further comprises a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, vector or cell to a subject.

[0053] The pharmaceutical composition can be administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously. That is, the pharmaceutical composition can be administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously. The pharmaceutical composition can be in the form of a tablet, capsule, powder, granule, pill, suppository, ointment, solution, suspension, lotion, gel, paste, etc. The plasmid or viral vector in the pharmaceutical composition is enriched in a tissue (including: liver, lung, gastrointestinal tract, breast, kidney, brain, spleen, lymph, thyroid, reproductive organs, blood cells or lymphocytes, particularly liver) of a mammal after administration, and the expressed product is packaged in exosomes in large quantities in the cells of the tissue and delivered to the target tissue to exert a therapeutic effect.

[0054] In one aspect of the present application, the pharmaceutical composition can be used to treat a neurodegenerative disease associated with Tau aggregation, such as a tauopathy. A "tauopathy" encompasses any neurodegenerative disease involving pathological aggregation of Tau in the brain. Tauopathies include, for example, Alzheimer's disease (AD), Pick's disease (PiD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and frontotemporal lobar degeneration (FTLD). In addition to familial and sporadic AD, other exemplary tauopathies are frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP17), progressive supranuclear palsy, corticobasal degeneration, Pick's disease, progressive subcortical gliosis, tangle only dementia, diffuse neurofibrillary tangle with calcification, argyrophilic grain dementia, amyotrophic lateral sclerosis, Parkinson-dementia complex, Down's syndrome, Gerstmann-Straussler disease, Hallervorden-Spatz disease, inclusion body myositis, Creutzfeldt-Jakob disease, multiple system atrophy, Niemann-Pick disease type C, prion protein cerebral amyloid angiopathy, subacute sclerosing panencephalitis, myotonic dystrophy, postencephalitic parkinsonism, and chronic traumatic encephalopathy (e.g., boxing disease). One indication of the present application is Alzheimer's disease.

[0055] The pharmaceutical composition can be used for treating various diseases, including tumors, acute and chronic infectious diseases or other acute and chronic diseases. The acute and chronic infectious diseases include viral diseases such as viral influenza, viral hepatitis, AIDS, SARS, bacterial diseases such as tuberculosis, bacterial pneumonia, and other acute and chronic infectious diseases caused by various pathogenic microorganisms. The other acute and chronic diseases include respiratory diseases, immune system diseases, blood and hematopoietic system diseases, circulatory system diseases such as cardiovascular and cerebrovascular diseases, endocrine system metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases, and motor system diseases. For example, the diseases are cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.

[0056] In one aspect of the present application, a method for treating a disease is provided, which comprises administering the nucleic acid, the vector or the exosome as described above to a subject. The disease includes tumors, acute and chronic infectious diseases or other acute and chronic diseases.

[0057] It is understood by those skilled in the art that the actual dose administered depends on a variety of factors, such as the carrier, the target cells or tissues, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the mode of administration, the type of transformation / modification sought, etc. DETAILED DESCRIPTION

[0058] The essence and beneficial effects of the present application will be further illustrated below in conjunction with examples, which are only used to illustrate the present application and not to limit the present application.

[0059] Example 1 Materials and Methods

[0060] Table 1 Cells, Materials and Kits:

[0061] Example 2 Nucleic Acid Synthesis and Plasmid Preparation

[0062] 1. Commission Suzhou Jinyuizhi Biotechnology Co., Ltd. to synthesize or prepare the nucleic acid fragments in the following Table 2.

[0063] Among them, the sequence of the pri-miRNA is as follows in the table

[0064] Table 2 Single Copy pri-miRNA Sequence and Structure

[0065] wherein miTau#1 to miTau#11 are nucleic acid fragments of pri-miRNA encoding proteins that express pri-miRNA that inhibit Tau gene, comprising an RNA sequence targeting mRNA of Tau.

[0066] The structure of the single pri-miRNA sequence from 5' to 3' includes: 5' flanking sequence TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 13); miRNA sequence; stem loop structure sequence GTTTTGGCCTCTGACTGAC (SEQ ID NO: 12); compensation sequence; 3' flanking sequence CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 14).

[0067] wherein the combination of miRNA sequence and compensation sequence of miTau#1 to miTau#11 are respectively:

[0068] Table 3 miRNA sequence of pri-miRNA

[0069] 2. Constructing plasmids containing the above-mentioned pri-miRNA nucleic acid fragments that inhibit Tau and expressing the contained miRNA

[0070] The above-mentioned nucleic acid fragments encoding pri-miRNA are respectively inserted into pcDNA6.2-EmGFP-mir9 vector to prepare plasmids carrying the sequence of pri-miRNA targeting Tau, and the obtained plasmid names are pc-miTau#1 to pc-miTau#11, respectively.

[0071] Example 3 Cell and exosome preparation and analysis

[0072] The plasmids prepared in Example 2 are transfected into HEK293T cells, and exosomes in the cell culture medium are observed. Nanoparticle tracking analysis (NTA) shows that the number of exosomes secreted by each group is similar, and the size distribution is similar, with a peak value between 128-131 nm. Transmission electron microscopy (TEM) confirms that the purified exosomes exhibit a typical round vesicle morphology and correct size. In addition, enrichment of specific exon markers (CD63, TSG101 and CD9) is only detected in purified exosomes, but not in cell culture medium. Exosomal RNA is extracted for miRNAseq to analyze miRNA composition and detect the amount and proportion of 5' arm miRNA (i.e. the first miRNA) and 3' arm miRNA (i.e. the second miRNA) in exosomal RNA.

[0073] The results are shown in Table 4 below.

[0074] Table 4 miRNA composition detection.

[0075] Example 4 miRNA activity

[0076] 1. Reporter gene detection of miRNA relative activity

[0077] The miRNA target sequence was inserted into the pmirGLO vector (Promega) to prepare Tau_pmirGLO, and the name of the obtained plasmid was named Tau_pmirGLO.

[0078] The pmirGLO vector (Promega) can express Firefly and Renilla luciferase at the same time, and the Tau gene target sequence is inserted into the 3'UTR downstream of the Firefly luciferase gene in the pmirGLO vector to construct Tau_pmirGLO, which is used to detect the activity of miRNA targeting Tau.

[0079] 293T cells (Chinese Academy of Sciences Cell Bank) were plated in 96-well white plates at a density of 20,000 cells per well overnight, and 20ul optiMEM, 100ng Tau_pmirGLO plasmid, 300ng miRNA plasmid, 0.8uL Lipofectamin 3000 (Thermo Fisher), 0.8uL P3000 (Thermo Fisher) were mixed and incubated at room temperature for 10 minutes, and the transfection complex was added to the 96-well plate cells, and each group had three replicate wells. After 24 hours, the reporter substrate (Promega) was added to detect the luminescence signal value, and the relative activity of miRNA was calculated by the Firefly / Renilla ratio.

[0080] The results are shown in Table 5 below

[0081] Table 5 Reporter gene activity detection

[0082] 2. Changes in Tau mRNA and protein levels

[0083] 293T cells were plated in 6-well plates at a density of 1.2E6 cells per well overnight, and Lipofectamin 3000 was used to transfect 293T cells with 3ug of miRNA plasmid per well, and the cells were collected 48 hours after transfection.

[0084] The Tau mRNA changes were detected using qPCR. The total RNA extraction kit (UE) was used to extract RNA according to the instructions, reverse transcription reagent (Takara) was added for reverse transcription, and Tau / GAPDH / β-actin primers were used for qPCR. The primer sequences are as follows:

[0085] The results are shown in Table 6 below.

[0086] Table 6 miRNA activity detection-mRNA target knockdown (KD)

[0087] In addition, Western Blotting was used to detect changes in cell Tau protein. Part of the cells were lysed using RIPA (Bi Yun Tian), the total protein concentration was measured by BCA method (Adamas life), the BSA standard was diluted, 20 μL of sample or standard was added to each well, 200 μL of reaction reagent was added, and the OD value was measured by enzyme marker (Thermo Fisher) 562m after incubation at 37°C for 30 minutes. According to the standard curve, the total protein concentration of the sample was calculated.

[0088] After adding 4X LDS (Thermo Fisher) to the sample, heating at 70°C for 10 min, using SDS-PAGE (Elabscience) for loading and transferring, adding Tau (Thermo Fisher) and Vinculin (Abeam) antibodies for incubation, and using TANON 5200 multi imager and software to image and analyze the gray scale of Tau and Vinculin bands.

[0089] The results are shown in Table 7 below.

[0090] Table 7 miRNA activity detection-protein target knockdown (KD)

[0091] The above is a description of the present application and cannot be considered as a limitation of the present application. Unless otherwise indicated, the practice of the present application will use conventional techniques of organic chemistry, polymer chemistry, biotechnology, etc. It is obvious that the present application can be implemented in other ways in addition to those specifically described in the above description and examples. Other aspects and improvements within the scope of the present application will be apparent to those skilled in the art. Many changes and modifications are possible according to the teachings of the present application, and therefore they are within the scope of the present application.

Claims

1. An isolated nucleic acid comprising a nucleic acid sequence encoding RNA that represses the expression of the Tau gene, said nucleic acid sequence comprising a miRNA sequence that represses the Tau gene.

2. The nucleic acid of claim 1, wherein the RNA is a pri-miRNA, which comprises, from 5' to 3', a 5' flanking structure sequence, a miRNA sequence that inhibits Tau gene expression, a stem-loop sequence, a compensation sequence, and a 3' flanking structure sequence.

3. The nucleic acid of claim 2, comprising a plurality of copies of the nucleic acid sequence of the pri-miRNA, wherein the plurality of copies is 2 to 10 copies, for example, 2, 3 or 4 copies.

4. The nucleic acid according to any one of claims 1-3, further comprising a nucleic acid sequence encoding RNA that inhibits the expression of a second gene, wherein the second gene is selected, for example, from the APP gene, LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, HER2 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, SNCA gene, FUS gene, FGFR4 gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene, and α-synuclein gene.

5. The nucleic acid according to claim 1, wherein the miRNA sequence that inhibits Tau gene expression has the following nucleotide sequence: TTTACAGCAACAGTCAGTGTA (SEQ ID NO: 15); TAGAAGCTGGTCTCTGTTGGG (SEQ ID NO: 17); TCACGTGACCAGCAGCTTCGT(SEQ ID NO:19); TAACTATCTTACACATTCCCTC(SEQ ID NO:21); TTCTACTGCCAAGTCCCTCAG(SEQ ID NO:23); AAAGAGAACTGGTTAGCCCTA(SEQ ID NO:25); TCGTTTTACCATCAGCCCCCT(SEQ ID NO:27); AACTGGTTTGTAGACTATTTG(SEQ ID NO:29); TTTTATGAAGCTGCAGGTCTG (SEQ ID NO: 31); TATGCATGTGGAGCTGAGCAG (SEQ ID NO:33); or TTGCTTTTACTGACCATGCGA (SEQ ID NO:35).

6. The nucleic acid according to claim 1, wherein the combination of the miRNA sequence that inhibits Tau gene expression and its compensating sequence constitutes a sequence group having the following nucleotide sequences:

7. The nucleic acid according to claim 1, wherein the RNA that inhibits Tau gene expression has a stem-loop structure, preferably having the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO:12).

8. The nucleic acid according to claim 1, wherein the RNA that inhibits Tau gene expression has a 5' flanking sequence and a 3' flanking sequence, each of which independently or simultaneously shares greater than 80% identity with the pri-miR sequence of mammals or humans, preferably greater than 95%, more preferably 100%.

9. The nucleic acid according to claim 1, wherein the 5' flanking structure sequence has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 13), And / or the 3' flanking structure sequence therein has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAG ATCTGGCCGCA (SEQ ID NO:14).

10. The nucleic acid of claim 3, wherein the nucleic acid sequences encoding the RNA that inhibits the expression of the Tau gene, and the nucleic acid sequences encoding the RNA that inhibits the expression of the second gene, have spacer sequences between them and between them.

11. A vector comprising encoding the isolated nucleic acid of any one of claims 1-10.

12. A cell comprising the nucleic acid of any one of claims 1-10 or the vector of claim 11. Optionally, the exosomes in the cells contain RNA obtained by in vivo processing of the pri-miRNA.

13. An exosome comprising RNA as defined in claim 12.

14. A method for regulating gene activity in target cells, comprising administering a nucleic acid according to any one of claims 1-10 or a vector according to claim 11, a cell according to claim 12 or an exosome secreted by said cell, or an exosome according to claim 13.

15. A pharmaceutical composition comprising the nucleic acid of any one of claims 1-10 or the carrier of claim 11, the cell of claim 12 or the exosome secreted by the cell, or the exosome of claim 13.

16. A method of treating a disease, comprising administering a nucleic acid according to any one of claims 1-20 or a vector according to claim 11, a cell according to claim 12 or an exosome secreted by said cell, or an exosome according to claim 13.

17. Use of the nucleic acid of any one of claims 1-10, or the vector of claim 11, the cell of claim 12, or the exosomes secreted by the cell, or the exosomes of claim 13, in the preparation of a medicament for treating a disease.

18. The use of claim 17, wherein the disease is a Tau aggregation-related neurodegenerative disease, such as a Tau protein lesion.

19. The use of claim 18, wherein the disease is Alzheimer's disease (AD), Pick's disease (PiD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and frontotemporal degeneration (FTLD).

20. The use of claim 18, wherein the disease is familial and sporadic AD, frontotemporal dementia linked to Parkinson's syndrome on chromosome 17 (FTDP17), progressive supranuclear palsy, corticobasal degeneration, Pick's disease, progressive subcortical gliosis, tangles-only dementia, diffuse neurofibrillary tangles and calcification, stylosin granulation dementia, amyotrophic lateral sclerosis, Parkinson-dementia complex, Down syndrome, Gistman-Suzousley disease, Hastings-Suzousley disease, inclusion body myositis, Creutzfeldt-Jakob disease, multiple system atrophy, Niemann-Pick disease type C, prion protein cerebral amyloid angiopathy, subacute sclerosing panencephalitis, myotonic dystrophy, post-encephalitis Parkinson's syndrome, and chronic traumatic encephalopathy (such as boxing disease).

Citation Information

Patent Citations

  • MicroRNAs that silence tau expression

    CN105431153A

  • Compositions for modulating tau expression

    US20160145617A1

  • Compounds and methods for reducing TAU expression

    WO2023064707A1