Osteogenesis promoting composition

Abstract

The present invention addresses the problem of providing an osteogenesis promoting agent and a pharmaceutical composition for preventing or treating a disease or a symptom involving bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or bone hyperresorption.　The problem is solved by: a compound represented by general formula (I), a salt thereof, or a prodrug thereof; and a composition and a pharmaceutical composition containing the same.

Description

Composition for promoting bone formation

[0001] The present invention relates to a composition for promoting bone formation, a pharmaceutical composition for preventing or treating diseases or conditions associated with bone defects, osteogenesis imperfecta, osteogenesis disorders, and / or excessive bone resorption, and to a novel compound or salt thereof, and a method for producing the same.

[0002] Bone tissue undergoes remodeling by repeating bone formation by osteoblasts and bone resorption by osteoclasts, regulating bone and calcium metabolism. Normally, bone metabolism is carried out by maintaining a balance between bone formation and bone resorption. However, if the functional balance between osteoblasts and osteoclasts becomes abnormal, this dynamic equilibrium is disrupted, resulting in abnormalities in bone maintenance and regeneration. If bone resorption continues to exceed bone formation, bone mass and bone density decrease, which can lead to metabolic bone diseases such as osteoporosis.

[0003] Runx2 (runt-related transcription factor 2, also known as "Cbfa1") is a transcription factor belonging to the Runx family that contains the runt domain. Gene disruption experiments in mice have shown that it is essential for bone formation (Non-Patent Document 1). Runx2 directs the differentiation of undifferentiated mesenchymal cells, such as mesenchymal stem cells, into preosteoblasts, promoting the proliferation of preosteoblasts, the differentiation of preosteoblasts into mature osteoblasts, and the production of bone matrix proteins in mature osteoblasts (Non-Patent Documents 2-4). These factors promote bone formation.

[0004] On the other hand, Runx2 promotes the maturation of chondrocytes, but inhibits the formation or maintenance of permanent chondrocytes that form articular cartilage, etc. In mature chondrocytes, Runx2 also destroys the cartilage matrix and promotes ossification of cartilage (Non-Patent Document 5), which can lead to osteoarthritis.

[0005] Therefore, for the treatment of osteoporosis, it is desirable to promote Runx2 expression in osteoblasts and suppress it in chondrocytes. To achieve this, the present inventors studied the regulatory elements of the Runx2 gene and identified an enhancer ("osteoblast-specific enhancer") that enhances osteoblast-specific expression. This enhancer is a 343-bp fragment found approximately 30 kb upstream of the P1 promoter, the distal promoter of the Runx2 genome (Patent Document 1, Non-Patent Document 6).

[0006] WO2011 / 016561

[0007] Komori et al., (1997) Cell, 89, 755-764Kawane et al., (2018) Sci Rep, 8, 13551Qin et al., (2019) Hum Mol Genet, 28, 896-911Qin et al., (2021) J Bone Miner Res,36, 2081-2095Ueta ​​et al., (2001) J Cell Biol, 153, 87-99Kawane et al., (2014) J Bone Miner Res, 29, 1960-1969

[0008] An objective of the present invention is to provide an agent for promoting bone formation and a pharmaceutical composition for preventing or treating diseases or conditions associated with bone defects, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption.

[0009] In order to solve the above problems, the present invention includes the following inventions: [1] A composition for promoting bone formation, comprising a compound represented by the following general formula (I), a salt thereof, or a prodrug thereof: In the formula, A is any of the following tricyclic structures containing a 5- to 9-membered ring B which is a cycloalkyl ring optionally substituted with R, or a heterocycloalkyl ring having 1 to 3 heteroatoms selected from the group consisting of a nitrogen atom, a silicon atom, an oxygen atom, and a sulfur atom: X is NR ５ R ６ group, a hydroxyl group, or an O—C １－６an alkyl group, Y is a sulfur atom, a nitrogen atom, or an oxygen atom, R １ represents an amino group, an aryl, a heteroaryl, a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C １－６ Haloalkyl group, C １－６ a haloalkoxy group, a carboxyl group, a nitro group, a cyano group, a hydroxyl group, a CONR′ group, or a CO ２ R' group (wherein R' is a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ haloalkyl group, or amino group), R ２ represents an amino group, a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C ３－６ Cycloalkyl group, C １－６ Haloalkyl group, C １－６ haloalkoxy, nitro, cyano, or hydroxyl group; R ３ represents an amino group, an aryl, a heteroaryl, a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C １－６ Haloalkyl group, C １－６ a haloalkoxy group, a carboxyl group, a nitro group, a cyano group, a hydroxyl group, a CONR′ group, or a CO ２ R' group (R' is the same as above), and the aryl is selected from the group consisting of a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C １－６ Haloalkyl group, C １－６ Haloalkoxy group, hydroxyl group, acetyl group, C １－６ Alkoxy C １－６ Alkoxy group, biotin-added C １－６ Alkoxyamino group, biotin-added C １－６ R may be substituted with one or more substituents independently selected from the group consisting of an alkoxy group, a biotinylated ester group, a biotinylated amide group, and an amino group; ４ represents a hydrogen atom, a halogen atom, or C １－６Alkyl group, C １－６ a haloalkyl group or an amino group, R ５ represents a hydrogen atom, a halogen atom, or C １－６ Alkyl group, or C １－６ is a haloalkyl group, R ６ represents a hydrogen atom, a halogen atom, or C １－６ Alkyl group, or C １－６ is a haloalkyl group, and R ５ and R ６ may form a 4- to 8-membered ring together with a part of ring A and the carboxyl group, and R is a hydrogen atom, a halogen atom, C １－６ Alkyl group, or C １－６ [2] The composition according to [1], wherein A is the following structure: [3] The composition according to [1], wherein A is any one of the following structures: [4] R １ and R ３ each independently represents an aryl or heteroaryl optionally substituted with one or more substituents described in [1], a CONR′ group, or CO ２ [5] The composition according to [4], wherein the aryl is a phenyl group and the heteroaryl is a pyridyl group, a furanyl group, a thiophenyl group, a pyrrole group, a naphthyl group, or a quinoline group. [6] The composition according to [4], wherein R ２ is an amino group, or R ３ [7] The composition according to [1], wherein R is a phenyl group optionally substituted with one or more substituents. ５ and R ６ [8] The composition according to [1], wherein X is NR ５ R ６

[0023] The composition according to [1], wherein Y is a group and Y is a nitrogen atom. [9] The composition according to [1], wherein the prodrug is a bisphosphonate compound.

[10] A pharmaceutical composition for preventing or treating a disease or condition accompanied by bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, comprising the composition according to any one of [1] to [9].

[11] The pharmaceutical composition according to

[10] , wherein the disease or condition is selected from the group consisting of osteopenia, bone mass loss, osteoporosis, osteogenesis imperfecta, fibrous dysplasia, hypophosphatasia, osteomalacia, rickets, bone deformity, decreased bone strength, bone mineralization disorder, skeletal disease accompanied by bone mass loss, osteolytic bone lesion, fracture, nonunion of fracture, delayed fracture healing, bone defect, alveolar bone defect, and alveolar bone resorption.

[12] An osteoblast-specific enhancer activator comprising the compound represented by general formula (I) according to [1], or a salt thereof, or a prodrug thereof.

[13] A compound represented by the following general formula (II), a salt thereof, or a prodrug thereof: (B ring, R ３ , R ４ , R ５ , R ６ and R are defined as in [1].)

[14] A compound represented by the following formula, or a salt thereof, or a prodrug thereof:

[15] A composition for promoting bone formation, comprising the compound according to

[13] or

[14] , or a salt thereof, or a prodrug thereof.

[16] An osteoblast-specific enhancer activator, comprising the compound according to

[13] or

[14] , or a salt thereof, or a prodrug thereof.

[0010] The present invention provides a compound, a salt thereof, or a prodrug thereof that promotes bone formation when applied to undifferentiated mesenchymal cells such as mesenchymal stem cells and / or osteoblasts. It also provides a compound, a salt thereof, or a prodrug thereof that activates an osteoblast-specific enhancer. Furthermore, it provides a pharmaceutical composition for preventing or treating a disease or condition accompanied by bone defects, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, which contains the compound of the present invention as an active ingredient. It also provides a novel compound, a salt thereof, or a prodrug thereof, and methods for producing the same.

[0011] Graphs showing the results of reporter activity (A) using a 0.34 kb × 4 enhancer, Runx2 mRNA expression level (B), and reporter activity measurement (C) using enhancers, 0.34 kb × 4 enhancer and 0.42 kb × 4 enhancer, when evaluating the effect of compound G-9 on Runx2 in mesenchymal stem cells and osteoblasts. Graph showing the Runx2 mRNA expression level when evaluating the effect of compound G-9 on Runx2 in chondrocytes. Photographs showing the results of ALP staining to examine the induction of differentiation from primary osteoblasts (dPOB) to osteoblasts and von Kossa staining to examine the induction of bone mineralization in osteoblasts upon addition of compound G-9. Photographs showing the results of ALP staining to examine the induction of differentiation of primary osteoblasts (dPOB) when compound G-9 is added at different concentrations. These are three-dimensional images of the distal metaphyseal long axis plane obtained by micro-CT imaging of femoral samples from ovariectomized mice (OVX) in the compound G-9 + bisphosphonate co-administration group ("BP+G9") and the bisphosphonate-only administration group ("BP"). These are graphs showing parameters of trabecular bone (A) and cortical bone diaphysis (B) obtained by analysis of data obtained by micro-CT imaging of femoral samples from ovariectomized mice (OVX) and sham-operated mice (Sham) in the compound G-9 + bisphosphonate co-administration group ("BP+G9") and the bisphosphonate-only administration group ("BP"). These are graphs showing parameters of osteoblasts (A) and osteoclasts (B) obtained by bone histomorphometry of femoral samples from ovariectomized mice (OVX) in the compound G-9 + bisphosphonate co-administration group ("BP+G9") and the bisphosphonate-only administration group ("BP"). 1 is a graph showing the parameters of cancellous bone (A) and cortical bone diaphysis (B) obtained by analyzing data taken by micro-CT for femoral bone samples from a compound G-9-administered group ("G9") and a compound G-9-unadministered group ("vehicle") of ovariectomized mice (OVX) and sham-operated mice (Sham).1 is a graph showing osteoblast parameters obtained by bone histomorphometry for lumbar vertebral body samples from ovariectomized mice (OVX) and sham-operated mice (Sham) in a group administered with compound G-9 ("G9") and a group not administered with compound G-9 ("vehicle"). 2 is a graph showing osteoclast parameters obtained by bone histomorphometry for lumbar vertebral body samples from ovariectomized mice (OVX) and sham-operated mice (Sham) in a group administered with compound G-9 ("G9") and a group not administered with compound G-9 ("vehicle"). 3 is a graph showing bone formation parameters obtained by bone histomorphometry for lumbar vertebral body samples from ovariectomized mice (OVX) and sham-operated mice (Sham) in a group administered with compound G-9 ("G9") and a group not administered with compound G-9 ("vehicle"). 1 is a graph showing reporter activity when evaluating the effect of compounds G-9, R-3, R-10, NUK-44, NUK-46, NUK-67, NUK-76, and NUK-77 on Runx2 in osteoblasts. 2 is a graph showing the amount of Runx2 mRNA expression when evaluating the effect of compounds G-9, R-3, R-10, NUK-44, NUK-46, NUK-67, NUK-76, and NUK-77 on Runx2 in osteoblasts (A: G-9, R-3, and R-10; B: G-9, NUK-44, and NUK-46; C: G-9 and NUK-67; and D: G-9, NUK-76, and NUK-77). Graphs showing reporter activity when evaluating the effects of compounds G-9, R-3, R-10, KYH-2-R2, KYH-2-R3, R-17, NUK-24, and NUK-25 on Runx2 in osteoblasts (A: G-9, KYH-2-R2, and KYH-2-R3; B: G-9, R-3, R-10, and R-17; and C: G-9, NUK-24, and NUK-25). Graphs showing Runx2 mRNA expression levels when evaluating the effects of compounds G-9, R-3, R-10, R-17, KYH-2-R3, NUK-24, and NUK-25 on Runx2 in osteoblasts.Photographs show the results of alkaline phosphatase staining to examine the differentiation induction of (A) primary osteoblasts (dPOB) (2-day dPOB culture: G-9, R-3, NUK-24, and NUK-46, and 3-day dPOB culture: G-9 and NUK-44) and (B) primary osteoblast precursor cells (gPOB) (9-day gPOB culture: G-9, R-3, R-10, R-17, KYH-2-R3, NUK-67, and NUK-76) upon addition of each compound. Graphs show reporter activity when evaluating the effects of compounds G-9, NUK-30, NUK-31, NUK-35, NUK-38, NUK-40, NUK-41, NUK-42, and NUK-43 on Runx2 expression in osteoblasts. 1 is a graph showing the expression level of Runx2 mRNA when evaluating the effects of compounds G-9, NUK-30, NUK-31, NUK-35, NUK-38, NUK-40, NUK-41, NUK-42, and NUK-43 on Runx2 in osteoblasts.

[0023] Figure 1 shows a photograph (ALP stain) showing the results of ALP staining, which examined the induction of differentiation of primary osteoblast precursor cells (gPOB) upon addition of compounds G-9, R-3, NUK-30, NUK-31, NUK-35, NUK-38, NUK-40, NUK-41, and NUK-42, and a photograph (Kossa stain) showing the results of von Kossa staining, which examined the induction of bone mineralization in primary osteoblasts (dPOB) upon addition of compounds G-9, R-3, NUK-30, NUK-35, NUK-38, NUK-40, and NUK-42. Figure 2 shows a graph showing reporter activity when the effects of compounds G-9 and NUK-34 on Runx2 in osteoblasts were evaluated. Figure 3 shows a graph showing the level of Runx2 mRNA expression when the effects of compounds G-9 and NUK-34 on Runx2 in osteoblasts were evaluated. 1 is a graph showing reporter activity when the effects of compounds G-9, NUK-52, and NUK-54 on Runx2 in osteoblasts were evaluated. 2 is a graph showing reporter activity when the effects of compounds G-9, NUK-61, NUK-62, NUK-63, and NUK-64 on Runx2 in osteoblasts were evaluated. 3 is a graph showing the level of Runx2 mRNA expression when the effects of compounds G-9, NUK-61, NUK-62, NUK-63, and NUK-64 on Runx2 in osteoblasts were evaluated.1 is a graph showing reporter activity when the effects of compounds G-9, NUK-55, NUK-56, and NUK-57 on Runx2 in osteoblasts were evaluated. 2 is a graph showing the level of Runx2 mRNA expression when the effects of compounds G-9, NUK-55, NUK-56, and NUK-57 on Runx2 in osteoblasts were evaluated. 3D images were created from multi-sectional images obtained by micro-CT for femur samples from the bone-translocating bisphosphonate-conjugated compound-administered group ("BP-G9"), the bisphosphonate-administered group ("BP"), and the control group ("Vehicle") of ovariectomized mice (OVX) and sham-operated mice (Sham). 1 shows cross-sectional images (two-dimensional images) of femoral samples from ovariectomized mice (OVX) and sham-operated mice (Sham) administered a bone-translocating bisphosphonate-conjugated compound ("BP-G9"), a bisphosphonate-administered group ("BP"), and a control group ("Vehicle"), taken by micro-CT. 1 shows graphs showing parameters of the distal cancellous bone region obtained by analyzing data taken by micro-CT of femoral samples from ovariectomized mice (OVX) and sham-operated mice (Sham) administered a bone-translocating bisphosphonate-conjugated compound ("BP-G9"), a bisphosphonate-administered group ("BP"), and a control group ("Vehicle"). Graphs showing various parameters of the diaphyseal cortical bone region obtained by analyzing data acquired by micro-CT for femoral samples from ovariectomized (OVX) and sham-operated (Sham) mice in the bone-translocating bisphosphonate-conjugated compound group ("BP-G9"), the bisphosphonate-administered group ("BP"), and the control group ("Vehicle"). Micrographs showing the results of histological analysis of distal sagittal sections of tibia samples from sham-operated (Sham) mice in the bone-translocating bisphosphonate-conjugated compound group ("BP-G9"), the bisphosphonate-administered group ("BP"), and the control group ("Vehicle"), stained with hematoxylin and eosin. The bottom row shows a 10x magnification of the black-framed area in the top row.Graphs showing the results of measuring the bone resorption marker TRAP5b in the serum of ovariectomized mice (OVX) in a bisphosphonate-administered group ("BP") and a control group ("Vehicle"), as well as the results of measuring the bone formation marker P1NP in the serum of ovariectomized mice (OVX) and sham-operated mice (Sham) in a bone-translocating bisphosphonate-conjugated compound-administered group ("BP-G9"), a bisphosphonate-administered group ("BP"), and a control group ("Vehicle"). Graphs showing the results of measuring the bone resorption marker TRAP5b in the serum of ovariectomized mice (OVX) in a bone-translocating bisphosphonate-conjugated compound-administered group ("BP-G9"), a bisphosphonate-administered group ("BP"), and a control group ("Vehicle"). Fluorescence micrographs of whole embryos and frozen sections of EGFP reporter mice transfected with a 1.2-kb fragment containing a 0.42-kb core region located approximately 230 kb upstream of the P1 promoter.

[0012] In the present invention, the term "alkyl group" preferably refers to a C １ -C ６ Examples of the alkyl group include, but are not limited to, a straight-chain or branched-chain alkyl group such as a methyl group, an ethyl group, a propyl group, an isopropyl group, a butyl group, an isobutyl group, a tertiary butyl group, a pentyl group, an isopentyl group, a neopentyl group, a 2,3-dimethylpropyl group, and a benzyloxy group. The above explanation also applies to the alkyl moiety in an "alkyl group" (e.g., a haloalkyl group, an alkoxyalkyl group) and an "alkyl ester group" (e.g., an alkyl ester group). The same applies to the explanations of the following terms (alkoxy group, aryl, ...).

[0013] The term "cycloalkyl group" or "cycloalkyl ring" preferably refers to a C ３ -C ８ Preferred cycloalkyl groups (rings) include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cyclooctyl groups.

[0014] The term "heterocycloalkyl ring" preferably refers to a saturated or unsaturated heterocycloalkyl group having a heteroatom selected from the group consisting of a nitrogen atom, a silicon atom, an oxygen atom, and a sulfur atom, and more preferably refers to a 3- to 8-membered heterocycloalkyl group having a heteroatom selected from the group consisting of a nitrogen atom, an oxygen atom, and a sulfur atom, but is not limited thereto. Preferred saturated cycloalkyl groups (rings) include, but are not limited to, a pyrrolidyl group, a pyrazolidinyl group, an imidazolidinyl group, a 1,3-dioxonyl group, a furanyl group, a thiophenyl group, a tetrahydrothiophenyl group, a tetrahydrofuranyl group, a piperazinyl group, a 1,4-dioxanyl group, a morpholinyl group, a 1,4-dithianyl group, and the like.

[0015] The term "alkoxy group" preferably refers to a C １ -C ６ Preferred alkoxy groups include, but are not limited to, linear or branched alkoxy groups such as methoxy, ethoxy, propoxy, isopropoxy, butoxy, tertiary butoxy, pentyloxy, isopentyloxy, and neopentyloxy.

[0016] The term "halogen atom" preferably refers to a chlorine atom, a bromine atom, an iodine atom or a fluorine atom, more preferably a chlorine atom or a fluorine atom, but is not limited thereto.

[0017] The term "aryl" preferably refers to a 5- to 10-membered aromatic hydrocarbon, more preferably phenyl, naphthyl, etc., and even more preferably phenyl, etc., but is not limited thereto.

[0018] The term "heteroaryl" preferably refers to a 5- to 10-membered aromatic heterocycle containing 1 to 4 heteroatoms selected from the group consisting of nitrogen, sulfur, and oxygen atoms, more preferably a 5- or 6-membered aromatic heterocycle containing 1 to 3 heteroatoms, and even more preferably a 5- or 6-membered aromatic heterocycle containing 1 or 2 heteroatoms, but is not limited thereto. Preferred examples of heteroaryl include pyridyl, furanyl, thiophenyl, pyrrolyl, naphthyl, quinolyl, thiazolyl, isoxazolyl, pyrazolyl, pyrazyl, imidazolyl, oxazolyl, and isothiazolyl groups, and more preferably, pyridyl, furanyl, thiophenyl, pyrrolyl, naphthyl, and quinolyl groups, but are not limited thereto.

[0019] The term "ester group" in a narrow sense refers to a -C(=O)O- group, and in a broad sense also refers to a substituent containing an ester group. Preferred examples of such a substituent containing an ester group include: １ -C ６ Alkyl ester group, C １ -C ６ Examples of the alkoxy ester group include, but are not limited to, an alkoxy ester group.

[0020] The term "amide group" in a narrow sense refers to a -C(=O)N- group, and in a broad sense also refers to a substituent containing an amide group. Preferred examples of such a substituent containing an amide group include: １ -C ６ Alkylamide group, C １ -C ６ Examples include, but are not limited to, alkoxyamide groups.

[0021] [Compounds used in the present invention, salts thereof, and prodrugs thereof] In this specification, the compounds of the present invention are represented as "NUK-X" (for example, Example 3, etc.), "R-X" (for example, Example 1, etc.), or "G-X" (for example, Example 2, etc.), where "X" is an integer from about 1 to 100. The hyphen before X may be omitted in some cases.

[0022] The compounds preferably used in the present invention are as described above in [1] to

[16] .

[0023] In addition, X is NR ５ R ６ group, R ５ and R ６ may form a 4- to 8-membered ring together with a part of ring A and the carboxyl group, and preferably R ５ and R ６ However, the substituent A forms a saturated or unsaturated 5- or 6-membered ring together with one side of the ring A adjacent to the carboxyl group and the carboxyl group. Preferred examples of the compound having such a substituent include, but are not limited to, the following compound (see Example 8 below).

[0024] (Production Method) Compound 4, which is an intermediate, and compound 5 of the present invention can be produced, for example, by the method described in Scheme 1 below.

[0025] <Scheme 1> (In the formula, each symbol has the same meaning as defined above.)

[0026] In step a of scheme 1, compound 3 can be produced by reacting compound 1 and compound 2 in the presence of a base in a solvent that does not adversely affect the reaction. Examples of solvents that do not adversely affect the reaction include methanol, ethanol, acetonitrile, DMF, THF, DMSO, 1,4-dioxane, dichloromethane, and ethyl acetate. Examples of bases include N-methylmorpholine, Et ３ N, iPr ２ Examples of the base include, but are not limited to, NEt, DBU, alkali metal (Li, Na, K, Cs) carbonates, and alkali metal hydroxides. The amount of base used is usually, but is not limited to, 0.5 to 5.0 molar equivalents, preferably 1 to 2 molar equivalents, relative to Compound 1. The reaction temperature is usually, but is not limited to, room temperature to 150°C, preferably room temperature to 80°C. The reaction time is usually, but is not limited to, 5 minutes to 48 hours, preferably 10 minutes to 24 hours.

[0027] Step b of Scheme 1: Compound 4 can be produced by reacting Compound 3 with a cyclic ketone in the presence of a base in a solvent that does not adversely influence the reaction. Examples of solvents that do not adversely influence the reaction include, but are not limited to, methanol, ethanol, acetonitrile, DMF, THF, DMSO, 1,4-dioxane, dichloromethane, ethyl acetate, etc. Examples of bases include N-methylmorpholine, Et ３ N, iPr ２ Examples of suitable bases include, but are not limited to, NEt, DBU, alkali metal (Li, Na, K, Cs) carbonates, and alkali metal hydroxides. Examples of suitable cyclic ketones include, but are not limited to, cycloheptanone, cyclohexanone, cyclopentanone, etc. The amount of base used is usually, but is not limited to, 0.01 to 5.0 molar equivalents, preferably 0.1 to 2 molar equivalents, relative to Compound 1. The reaction temperature is usually, but is not limited to, room temperature to 150°C, preferably room temperature to 80°C. The reaction time is usually, but is not limited to, 5 minutes to 48 hours, preferably 10 minutes to 24 hours.

[0028] Step c of Scheme 1: Compound 5 can be produced by reacting Compound 4 with a 2-halocarboxylic acid derivative in the presence of a base in a solvent that does not adversely influence the reaction. Examples of solvents that do not adversely influence the reaction include, but are not limited to, methanol, ethanol, acetonitrile, DMF, THF, DMSO, 1,4-dioxane, dichloromethane, ethyl acetate, etc. Examples of 2-halocarboxylic acid derivatives include, but are not limited to, 2-chloroacetamide, methyl 2-bromoacetate, tert-butyl (2-bromoethyl)carbamate, tert-butyl 2-bromoacetate, and 2-chloroacetonitrile. The amount of the 2-halocarboxylic acid derivative used is usually 0.5 to 10 molar equivalents, preferably 0.8 to 5 molar equivalents, relative to Compound 4, but is not limited to these. Examples of bases include N-methylmorpholine, Et ３ N, iPr ２Examples of the base include, but are not limited to, NEt, DBU, alkali metal (Li, Na, K, Cs) carbonates, and alkali metal hydroxides. The amount of base used is usually, but is not limited to, 0.5 to 5.0 molar equivalents, preferably 1 to 2 molar equivalents, relative to Compound 1. The reaction temperature is usually, but is not limited to, room temperature to 150°C, preferably room temperature to 100°C. The reaction time is usually, but is not limited to, 5 minutes to 48 hours, preferably 10 minutes to 24 hours.

[0029] (Salt of Compound) As the salt of the compound represented by general formula (I) or general formula (II), pharmaceutically acceptable salts can be preferably used. The pharmaceutically acceptable salt is not particularly limited as long as it maintains the efficacy of the active ingredient and does not have any adverse effect on the human body, and examples thereof include acetic acid, propionic acid, butyric acid, formic acid, trifluoroacetic acid, maleic acid, tartaric acid, citric acid, stearic acid, succinic acid, ethylsuccinic acid, malonic acid, lactobionic acid, gluconic acid, glucoheptonic acid, benzoic acid, methanesulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, paratoluenesulfonic acid (tosylic acid), Examples of the salt include salts with acids such as lauryl sulfate, malic acid, aspartic acid, glutamic acid, adipic acid, cysteine, N-acetylcysteine, hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, hydroiodic acid, nicotinic acid, oxalic acid, picric acid, thiocyanic acid, undecanoic acid, acrylic acid polymers, and carboxyvinyl polymers; salts with inorganic bases such as lithium salts, sodium salts, potassium salts, and calcium salts; salts with organic amines such as morpholine and piperidine; and salts with amino acids.

[0030] (Prodrug) The term "prodrug" refers to a pharmaceutical agent that exhibits its effect after being metabolized in the body. A prodrug itself has no or little activity, but when administered, it is metabolized by the body to become an active form and exhibits medicinal effects. The prodrug of the present invention may be a compound that has a molecular structure that can be delivered in the body, preferably to bone, to release the compound represented by general formula (I) or general formula (II) or a salt thereof, and act on osteoblasts.

[0031] The prodrug of the present invention includes, for example, a conjugate of a compound represented by general formula (I) or general formula (II) or a salt thereof with a bisphosphonate (also referred to as a "bisphosphonate-type compound"). Bisphosphonates bind to calcium ions (Ca) in hydroxyapatite in bones. 2＋ ) can be coordinated to the bisphosphonate. This allows for efficient delivery of the bisphosphonate compound to bone, and the compound can also be referred to as a "bone-localizing bisphosphonate-linked compound." The bond between the compound and the bisphosphonate can be achieved by covalent bonding, optionally via a linker. This bond is preferably pH-dependently cleavable. An example of a bone-localizing bisphosphonate-linked compound is the compound in Example 53 described below. A pH-dependently cleavable prodrug of a bisphosphonate compound is delivered to bone, for example, and upon hydrolysis under acidic conditions releases the active compound (a compound with a bone formation-promoting effect), inducing osteoblast differentiation and promoting bone formation. For example, in osteoporosis model animals, bisphosphonates improve bone mass by inhibiting bone resorption, but can also suppress normal bone metabolism, whereas bisphosphonate compounds do not inhibit bone formation and also inhibit bone resorption, thereby improving bone metabolism balance.

[0032] [Composition for Promoting Bone Formation] The present invention provides a composition or agent for promoting bone formation containing a compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof. As used herein, "osteogenesis" refers to bone formation through the directed differentiation of undifferentiated mesenchymal cells, such as mesenchymal stem cells, into preosteoblasts (also called "osteoblast precursor cells"), the differentiation of preosteoblasts into mature osteoblasts, the proliferation of preosteoblasts and immature osteoblasts, the production of bone matrix proteins in mature osteoblasts, and the secretion and mineralization of bone matrix from mature osteoblasts. As used herein, "promotion of bone formation" refers to the promotion of bone formation by promoting at least one of the events involved in bone formation, as described above. As used herein, the term "osteoblast" refers to any of preosteoblasts, immature osteoblasts, and mature osteoblasts, unless otherwise specified. Runx2 is involved in bone formation, and application of the composition for promoting bone formation of the present invention to undifferentiated mesenchymal cells and / or osteoblasts can promote events caused by promoting Runx2 expression in these cells.

[0033] The osteogenesis-promoting composition of the present invention can promote osteogenesis by promoting the expression of Runx2 in undifferentiated mesenchymal cells and / or osteoblasts. The osteogenesis-promoting composition of the present invention can promote osteogenesis by activating the osteoblast-specific enhancer of Runx2 described below, thereby enhancing its function and promoting the expression of Runx2. The osteogenesis-promoting composition of the present invention preferably suppresses or does not substantially promote the expression of Runx2 in chondrocytes and chondroprogenitor cells, and does not inhibit the formation or maintenance of permanent chondrocytes.

[0034] The promotion of bone formation can be confirmed, for example, by using the mesenchymal stem cells and / or osteoblasts used in the examples below to observe cells that have been contacted with an active compound represented by general formula (I) or general formula (II) or a salt thereof, or a prodrug thereof, released in vivo by the compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof, and cells that have not been contacted. Alternatively, for example, using the animal model used in the examples below, it can be confirmed by observing animals that have been administered with a compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof, and animals that have not been administered with the compound. The test substance is administered orally or parenterally. Parenteral administration routes include, for example, systemic administration such as intravenous, intraarterial, intramuscular, subcutaneous, or intraperitoneal administration, or local administration into the airways or near target cells.

[0035] The bone formation-promoting composition or bone formation promoter of the present invention can promote bone formation by enhancing osteoblast activity and promoting differentiation. Furthermore, even in the presence of abnormal bone resorption (e.g., excessive bone resorption), the bone formation-promoting composition or bone formation promoter of the present invention can partially or completely offset net bone loss by increasing osteoblast function, thereby providing a bone mass increase effect. Excessive bone resorption can be caused by excessive osteoclast activity. The bone formation-promoting composition or bone formation promoter of the present invention can more effectively promote bone formation and inhibit bone resorption, particularly in combination with a bisphosphonate (e.g., by co-administering with a bisphosphonate or by administering a bisphosphonate-type compound).

[0036] [Osteoblast-Specific Enhancer Activators] Compounds represented by general formula (I) or general formula (II), salts thereof, or prodrugs thereof can activate the osteoblast-specific enhancer of Runx2 in vitro or in vivo and enhance its function. As used herein, "osteoblast-specific" refers to an action specific to osteoblasts, including both action on osteoblasts and action on undifferentiated mesenchymal cells, such as mesenchymal stem cells, for inducing differentiation into osteoblasts. Examples of Runx2 osteoblast-specific enhancers include a 343-bp fragment located approximately 30 kb upstream from the P1 promoter, the distal promoter of the Runx2 genome (described, for example, in Patent Document 1 and Non-Patent Document 6; see the Examples below), and a 420-bp fragment located approximately 230 kb upstream from the P1 promoter (see the Examples below). Activation of the osteoblast-specific enhancer of Runx2 (e.g., activation of the above-mentioned 343-bp and 420-bp fragment enhancers (multiple fragments can be arranged in tandem, as described in the Examples below, if necessary)) can promote the expression of genes under its control (e.g., the Runx2 gene) in an osteoblast-specific manner. Therefore, the present invention provides an osteoblast-specific enhancer activator or composition containing a compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof. An example of a gene under the control of an osteoblast-specific enhancer includes, but is not limited to, the Runx2 gene. Activation of the osteoblast-specific enhancer can be confirmed, for example, by measuring reporter activity using osteoblasts, by comparing cells contacted with an active compound represented by general formula (I) or general formula (II) or a salt thereof, or a prodrug thereof, released in vivo by a compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof, with cells not contacted with the active compound represented by general formula (I) or general formula (II) or a salt thereof.

[0037] [Pharmaceutical Composition] The composition for promoting bone formation of the present invention can be implemented as a pharmaceutical composition. Accordingly, the present invention provides a pharmaceutical composition for preventing or treating a disease or condition accompanied by bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, which contains the composition for promoting bone formation of the present invention. This pharmaceutical composition can be called a pharmaceutical composition for preventing or treating a disease or condition accompanied by bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, which contains a compound represented by general formula (I) or general formula (II) or a salt thereof, or a prodrug thereof as an active ingredient.

[0038] As used herein, "diseases or conditions associated with bone defects, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption" refers to pathological conditions characterized by structural or functional abnormalities of bone, resulting from a decrease in the number and / or activity of osteoblasts or an increase in the number and / or overactivation of osteoclasts, or associated with a disruption of the balance between these. Here, "disease" refers to a medically diagnosable pathological entity, and "condition" refers to a pathological condition or physiological change in which structural or functional abnormalities of bone are observed and which may be subject to treatment or prevention, even if a diagnostic name has not been given.

[0039] As used herein, "bone defect" refers to a condition involving one or more of congenital or acquired structural defects or absence of bone, and partial or total bone loss. "Osteogenesis imperfecta" refers to a condition in which normal bone formation is hindered due to insufficient osteoblast differentiation, activity, and / or matrix production. "Osteogenesis disorder" refers to a general abnormality related to bone development, growth, bone mass maintenance, and / or morphogenesis, resulting from a decrease in osteoblast number and / or decreased osteoblast activity, regardless of the cause. "Excessive bone resorption" refers to a condition in which excessive bone resorption progresses due to an increase in osteoclast number and / or increased osteoclast activity, regardless of the cause, resulting in a relative deficiency in osteoblast number and / or osteoblast activity. These conditions may occur alone or in combination. The diseases or conditions for which the pharmaceutical composition of the present invention is applicable are diseases or conditions involving bone defects, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, including those occurring alone or in any combination thereof. For example, structural bone abnormalities such as bone weakening, degeneration, and deformation fall under the category of "diseases or conditions associated with bone defects, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption." Such structural bone abnormalities (weakness, degeneration, deformation) may be associated with any one of osteogenesis imperfecta, osteogenesis disorder, and excessive bone resorption, but often result from the overlapping involvement of multiple different pathological conditions. The pharmaceutical composition of the present invention can be targeted at diseases or conditions in which promotion of bone formation or restoration or improvement of the balance with bone resorption is thought to be effective.

[0040] Diseases or conditions associated with bone defects, osteogenesis imperfecta, bone formation disorders, and / or excessive bone resorption include, but are not limited to, the following diseases or conditions: osteopenia, bone loss, osteoporosis, osteogenesis imperfecta, fibrous dysplasia, hypophosphatasia, osteomalacia, rickets, bone deformity, decreased bone strength, bone mineralization disorders, skeletal diseases associated with bone loss, osteolytic bone lesions, fractures, nonunions of fractures, delayed fracture healing, bone defects, alveolar bone defects, alveolar bone resorption, etc. In one embodiment, the disease or condition associated with bone defects, osteogenesis imperfecta, bone formation disorders, and / or excessive bone resorption is selected from the group consisting of the diseases or conditions listed above. "Osteopenia" or "bone loss" is a general term for a pathology characterized by a decrease in bone mass and / or bone density, and examples include, but are not limited to, osteopenia, disuse osteopenia, age-related bone loss, bone loss due to prolonged bed rest, cancer-related bone loss, and cancer treatment-related osteopenia (e.g., radiation therapy-induced osteopenia, chemotherapy-induced osteopenia). The present pharmaceutical composition can be used to treat any of these conditions. "Osteoporosis" refers to a disease in which bone fragility increases due to a decrease in bone mass or deterioration of the bone tissue microstructure, thereby increasing the risk of fracture. In the present invention, "osteoporosis" is a concept that encompasses both primary osteoporosis and secondary osteoporosis, and the present pharmaceutical composition can be used to treat either of these conditions. "Primary osteoporosis" refers to spontaneous osteoporosis without any underlying disease, and can be caused by any one of the following factors, or a combination of these: aging, a decrease in female hormones (after menopause, pregnancy, etc.), lifestyle habits (lack of exercise, being bedridden), nutrient deficiency (calcium, vitamin D and / or vitamin K), genetic predisposition, etc."Secondary osteoporosis" refers to osteoporosis that occurs secondarily due to a specific causative disease or drug administration. Examples of causative diseases or drugs include, but are not limited to, glucose metabolism disorders (diabetes), endocrine diseases (thyroid hormone abnormalities (hyperactivity or hypoactivity), parathyroid hormone abnormalities, and adrenal cortical hormone abnormalities (Cushing's syndrome, adrenal tumors, etc.)), arteriosclerosis, chronic obstructive pulmonary disease, visceral diseases (chronic kidney disease, liver disease, etc.), malnutrition (anorexia nervosa, post-gastrectomy, malabsorption syndrome, etc.), musculoskeletal diseases (rheumatoid arthritis, etc.), drug-induced diseases (steroids, antidepressants, warfarin, methotrexate, etc.), congenital or hereditary diseases (osteogenesis imperfecta, Marfan syndrome, etc.), and alcoholism. In the treatment of fractures and bone defects, the pharmaceutical composition of the present invention can be administered locally or can be used in cell therapy by adding it to a culture medium of bone marrow stem cells or adipose-derived stem cells, inducing their differentiation into osteoblasts, and then transplanting them into the affected area.

[0041] The pharmaceutical composition of the present invention can be formulated according to conventional methods. Specifically, it can be formulated into oral preparations such as tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, and emulsions; or parenteral preparations such as injections, infusions, suppositories, ointments, and patches. The proportion of carriers or additives may be appropriately determined based on the ranges commonly used in the pharmaceutical field. The carriers or additives that can be added are not particularly limited, and examples include various carriers such as water, physiological saline, other aqueous solvents, and aqueous or oily bases; and various additives such as excipients, binders, pH adjusters, disintegrants, absorption enhancers, lubricants, diluents, thickeners, wetting agents, emulsifiers, preservatives, colorants, flavorings, and fragrances.

[0042] Examples of additives that can be incorporated into tablets, capsules, etc. include binders such as gelatin, corn starch, tragacanth, and gum arabic, excipients such as crystalline cellulose, leavening agents such as corn starch, gelatin, and alginic acid, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose, and saccharin, and flavors such as peppermint, saffron oil, and cherry. When the dosage unit form is a capsule, a liquid carrier such as oil or fat may be further contained in addition to the above-mentioned types of materials. Sterile compositions for injection can be formulated according to conventional pharmaceutical practices, such as dissolving or suspending the active substance and natural vegetable oils such as sesame oil and coconut oil in a vehicle such as water for injection. Aqueous solutions for injection include, for example, saline, isotonic solutions containing glucose or other adjuvants (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.), and the like, which may be used in combination with appropriate solubilizers such as alcohols (e.g., ethanol), polyalcohols (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants (e.g., polysorbate 80, HCO-50). Oily solutions include, for example, olive oil, sesame oil, and soybean oil, which may be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol. They may also be formulated with buffers (e.g., phosphate buffer, sodium acetate buffer), soothing agents (e.g., benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g., human serum albumin, polyethylene glycol, etc.), preservatives (e.g., benzyl alcohol, phenol, etc.), antioxidants, etc.

[0043] The content of the compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof in the composition or in one preparation may be 0.001 mg to 1000 mg, or may be 0.01 mg to 100 mg. The composition or preparation thus obtained is safe and has low toxicity, and therefore can be administered to, for example, humans or mammals (e.g., rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.).

[0044] The dosage of the active ingredient of the pharmaceutical composition of the present invention is appropriately determined taking into consideration the purpose, type of disease, severity of disease, age, weight, sex, medical history, type of active ingredient, etc. For an average human weighing approximately 65 to 70 kg, the dosage is preferably approximately 0.02 mg to 5000 mg per day, more preferably approximately 0.1 mg to 200 mg. The total dosage per day may be a single dose or divided doses.

[0045] The pharmaceutical composition of the present invention may be used in combination with other therapeutic agents. For example, when used to prevent or treat osteoporosis, it may be used in combination with other therapeutic agents for osteoporosis. Examples of such therapeutic agents for osteoporosis include bone resorption inhibitors such as bisphosphonates, selective estrogen receptor modulators (SERMs), and anti-RANKL antibodies (denosumab); bone formation promoters such as teriparatide, romosozumab (anti-sclerostin antibodies), and abaloparatide; and drugs and supplements such as calcium preparations / supplements, female hormones, active vitamin D, and vitamin K. More specifically, examples of such therapeutic agents include calcium drugs (e.g., calcium L-aspartate, calcium hydrogen phosphate), female hormone drugs (e.g., estriol, conjugated estrogens, estradiol), active vitamin D drugs (e.g., alfacalcidol, calcitriol, eldecalcitol), vitamin K drugs (e.g., menatetrenone), bisphosphonate drugs (e.g., etidronic acid, alendronic acid, risedronic acid, minodronic acid, ibandronic acid), SERMs (e.g., raloxifene, bazedoxifene), calcitonin drugs (e.g., elcatonin, salmon calcitonin), parathyroid hormone drugs (e.g., teriparatide, teriparatide acetate), anti-RANKL antibody drugs (e.g., denosumab), ipriflavone, and nandrolone. The order of administration of the pharmaceutical composition of the present invention and the other therapeutic agent does not matter, and the other therapeutic agent may be administered before, simultaneously with, or after the pharmaceutical composition of the present invention. In one embodiment, the pharmaceutical composition of the present invention is used in combination with a bisphosphonate. More specifically, this embodiment includes, for example, the combined use of a pharmaceutical composition containing a compound represented by general formula (I) or general formula (II) or a salt thereof with a bisphosphonate preparation, and the use of a pharmaceutical composition containing a prodrug such as a bisphosphonate-type compound. The pharmaceutical composition of the present invention can more effectively promote bone formation and inhibit bone resorption by being combined with a bisphosphonate.

[0046] The present invention includes the following inventions. A method for preventing or treating a disease or condition accompanied by bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, which comprises administering to a mammal an effective amount of a compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof. A method for promoting bone formation, which comprises administering to a mammal an effective amount of a compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof. A method for activating an osteoblast-specific enhancer, which comprises administering to a mammal an effective amount of a compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof. A compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof, for use in preventing or treating a disease or condition accompanied by bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption. A compound represented by general formula (I) or general formula (II), a salt thereof, or a prodrug thereof, for use in promoting bone formation. A compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof, for use in activating an osteoblast-specific enhancer. Use of a compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof, for producing a medicament for preventing or treating a disease or condition accompanied by bone defect, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption. Use of a compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof, for producing an osteogenesis promoter. Use of a compound represented by general formula (I) or general formula (II), or a salt thereof, or a prodrug thereof, for producing an osteoblast-specific enhancer activator. A compound represented by general formula (I), or a salt thereof, or a prodrug thereof, a composition and formulation comprising said compound, or a salt thereof, or a prodrug thereof, and methods for producing them. A compound represented by general formula (II), or a salt thereof, or a prodrug thereof, a composition and formulation comprising said compound, or a salt thereof, or a prodrug thereof, and methods for producing them.

[0047] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0048] The present invention will be described in more detail below with reference to specific examples, but the present invention is not limited to these. Reagents for which no description of the preparation method is given are commercially available products or can be synthesized by methods known in the art. The abbreviations used in this specification have the following meanings. In addition to the following, abbreviations known in the art may also be used as appropriate. DMF: N,N-dimethylformamide THF: tetrahydrofuran DMSO: dimethyl sulfoxide Et ３ N: Triethylamine TFA: Trifluoroacetic acid iPr ２ NEt: Diisopropylethylamine EDCI: 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride HATU: 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium-3-oxide hexafluorophosphate Biotin NHS: 6aR-hexahydro-2-oxo-2,5-dioxo-1-pyrrolidinyl ester-1H-thieno[3aS,4d]imidazole-4S-pentane Ni(dppp)Cl ２ : [1,3-bis(diphenylphosphino)propane]dichloronickel(II) m-CPBA: m-chloroperbenzoic acid BzCl: benzoyl chloride TMSCN: cyanotrimethylsilane

[0049] Example 1: Preparation of 3-amino-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: G-9)

[0050] [Step 1-1] Preparation of (E)-2-cyano-3-(thiophen-2-yl)prop-2-enethioamide Thiophene-2-carbaldehyde (471 mg) and 2-cyanoethanethioamide (420 mg) were dissolved in ethanol (20 mL), and N-methylmorpholine (70 μL) was added thereto, followed by stirring for 12 hours at 60° C. After the reaction, the precipitated solid was filtered to obtain the title product (683 mg, yield 84%). １HNMR (500MHz, DMSO-d6) δ9.99 (br.s, 1H), 9.45 (br.s, 1H), 8.39 (s, 1H ), 8.13-8.12 (m, 1H), 7.89-7.88 (m, 1H), 7.33 (dd, J=3.9, 5.2Hz, 1H).

[0051] [Step 1-2] Preparation of 2-mercapto-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(thiophen-2-yl)prop-2-enethioamide (870 mg) obtained in Step 1-1 was dissolved in ethanol (30 mL), and cycloheptanone (650 μL) and piperidine (300 μL) were added. The mixture was heated to reflux (80°C; the same applies hereinafter unless otherwise specified) and stirred for 12 hours. After the reaction, the solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate:methanol = 10:1) to obtain the title compound (370 mg, yield 26%). １ HNMR (500MHz, DMSO-d6) δ7.85 (dd, J=1.7, 4.7Hz, 1H), 7.24-7.21 (m, 2H), 3.02-2.99 (m, 2H), 2.45-2.43 (m, 2H), 1.74-1.72 (m, 2H), 1.65-1.64 (m, 2H), 1.47-1.45 (m, 2H).

[0052] [Step 1-3] Preparation of 3-amino-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide 2-Mercapto-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (370 mg) obtained in Step 1-2 was dissolved in DMF (18 mL), and 2-chloroacetamide (148 mg) and potassium carbonate (370 mg) were added, followed by stirring for 12 hours at 60° C. After the reaction, distilled water was added, and the precipitated solid was filtered to obtain the title compound (300 mg, yield 68%). １HNMR (500MHz, DMSO-d6) δ7.87 (dd, J = 1.0, 5.2Hz, 1H), 7.28 (dd, J = 3.5, 4.9Hz, 1H), 7.20 (dd, J = 1.0, 3.5Hz, 1H), 7.14 (br.s, 2H), 5.73 (br.s, 2H), 3.13 (t, J=5.4Hz, 2H), 2.58 (t, J=4.4Hz, 2H), 1.83-1.74 (m, 2H), 1.73-1.60 (m, 2H), 1.58-1.43 (m, 2H).

[0053] [Example 2] Preparation of 3-amino-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: R-3)

[0054] [Step 2-1] Preparation of 2-mercapto-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(thiophen-2-yl)prop-2-enethioamide (680 mg) obtained in Step 1-1 of Example 1, cyclopentanone (650 μL), and piperidine (230 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to give the title compound (479 mg, yield 58%). １ HNMR (500MHz, CDCl ３ ) δ7.98 (dd, J=1.3, 5.2Hz, 1H), 7.67 (dd, J=1.2, 3.9Hz, 1H), 7.28 (dd, J=3.4Hz, 4 9Hz, 1H), 2.97 (t, J=7.6Hz, 2H), 2.79 (t, J=7.1Hz, 2H), 2.05 (quint, 7.4Hz, 2H).

[0055] [Step 2-2] Preparation of 3-amino-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide 2-Mercapto-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (470 mg) obtained in Step 2-1, 2-chloroacetamide (192 mg), and potassium carbonate (472 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (195 mg, yield 36%). １ HNMR (500MHz, DMSO-d6) δ7.87 (dd, J = 1.3, 5.2Hz, 1H), 7.28 (dd, J = 3.4, 5.1Hz, 1H), 7.25 (dd, J = 1.2, 3.4Hz, 1H ), 7.15 (br.s, 2H), 5.93 (br.s, 2H), 3.07 (t, J=7.6Hz, 2H), 2.76 (t, J=7.4Hz, 2H), 2.08 (quint, J=7.6Hz, 2H).

[0056] [Example 3] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-24)

[0057] [Step 3-1] Preparation of (E)-2-cyano-3-(4-methoxyphenyl)prop-2-enethioamide Anisaldehyde (1.36 g), 2-cyanoethanethioamide (1.00 g), and N-methylmorpholine (200 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (1.20 g, yield 55%). １ HNMR (500MHz, DMSO-d6) δ9.99 (br.s, 1H), 9.48 (br.s, 1H), 8.06 (s, 1H), 7.96 (d, J = 9.1Hz, 2H), 7.14 (d, J = 8.8Hz, 2H), 3.86 (s, 3H).

[0058] [Step 3-2] Preparation of 2-mercapto-4-(4-methoxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(4-methoxyphenyl)prop-2-enethioamide (170 mg) obtained in Step 3-1, cycloheptanone (100 μL), and piperidine (60 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (52 mg, yield 22%). １ HNMR (500MHz, DMSO-d6) δ7.86-7.84 (m, 2H), 7.24-7.22 (m, 2H), 3.33 (s, 3H), 3.02-3.0 0 (m, 2H), 2.44-2.43 (m, 2H), 1.77-1.70 (m, 2H), 1.67-1.60 (m, 2H), 1.50-1.42 (m, 2H).

[0059] [Step 3-3] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide 2-Mercapto-4-(4-methoxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (52 mg) obtained in Step 3-2, 2-chloroacetamide (19 mg), and potassium carbonate (47 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (33 mg, yield 53%). １ HNMR (500MHz, DMSO-d6) δ7.23 (d, J = 8.6Hz, 2H), 7.11 (d, J = 8.6Hz, 2H), 7.07 (br.s, 2H), 5.57 (br. s, 2H), 3.84 (s, 3H), 3.12-3.10 (m, 2H), 1.82-1.76 (m, 2H), 1.71-1.62 (m, 2H), 1.51-1.43 (m, 2H).

[0060] Example 4 Preparation of 3-amino-4-(4-(2-hydroxyethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-25) The compound of Example 4 can be prepared, for example, by the method and intermediates described in the following scheme.

[0061] <Scheme 2>

[0062] [Step 4-1] Preparation of (E)-2-(4-(2-hydroxyethoxy)benzylidene)cyclohept-1-one 4-(2-Hydroxyethoxy)benzaldehyde (830 mg) and cycloheptanone (1.65 g) were added to an aqueous sodium hydroxide solution (0.2 M, 35 mL) and stirred at 80°C for 48 hours. After the reaction, the mixture was extracted with dichloromethane. The extract was washed successively with water and saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate:hexane = 1:4) to obtain the title compound (1.0 g, yield 79%). １ HNMR (500MHz, CDCl ３ ) δ7.48 (s, 1H), 7.33 (d, J = 8.8Hz, 2H), 6.94 (d, J = 8.8Hz, 2H), 4.18-4 .11 (m, 2H), 4.01-3.97 (m, 2H), 2.72-2.71 (m, 4H), 1.81-1.77 (m, 6H).

[0063] [Step 4-2] Preparation of 4-(5-(2-hydroxyethoxy)pyridin-2-yl)-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (E)-2-(4-(2-hydroxyethoxy)benzylidene)cyclohept-1-one (1.0 g) obtained in Step 4-1 and 2-cyanoethanethioamide (384 mg) were dissolved in methanol (15 mL), and sodium methoxide (73 mg) was added thereto, followed by stirring at 50°C for 2 days. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed successively with water and saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate:hexane = 1:1) to obtain the title compound (80 mg, yield 6%). １ HNMR (500MHz, DMSO-d6) δ7.24 (d, J = 8.6Hz, 2H), 7.10 (d, J = 8.6Hz, 2H), 4.08-4.05 (m, 2H), 3.77-3.75 ( m, 2H), 3.06-3.02 (m, 2H), 2.62-2.56 (m, 2H), 1.81-1.74 (m, 2H), 1.67-1.57 (m, 2H), 1.54-1.45 (m, 2H).

[0064] [Step 4-3] Preparation of 3-amino-4-(4-(2-hydroxyethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide Using 4-(5-(2-hydroxyethoxy)pyridin-2-yl)-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (80 mg) obtained in Step 4-2, 2-chloroacetamide (26 mg), and potassium carbonate (65 mg), the title compound (20 mg, yield 21%) was obtained according to the method described in Step 1-3 of Example 1. １HNMR (500MHz, DMSO-d6) δ7.22 (d, J = 8.6Hz, 2H), 7.11 (d, J = 8.6Hz, 2H), 7.04 (br.s, 2H), 5.59 (br.s, 2H), 4.92 (t, J = 5.4Hz, 1H), 4.08 (t, J=4.9Hz, 2H), 3.78-3.75 (m, 2H), 3.12-3.10 (m, 2H), 1.82-1.75 (m, 2H), 1.71-1.64 (m, 2H), 1.50-1.44 (m, 2H).

[0065] [Example 5] Preparation of 3-amino-4-(pyridin-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-26)

[0066] [Step 5-1] Preparation of (E)-2-(pyridin-2-ylmethylene)cyclohept-1-one

[0123] 2-Pyridinecarboxaldehyde (479 μL) and cycloheptanone (1.65 g) were reacted and treated according to the method described in Step 1-1 of Example 4 to obtain the title compound (358 mg, yield 33%). １ HNMR (500MHz, CDCl ３ ) δ8.66-8.65 (m, 1H), 7.68 (dt, J=1.7, 7.9Hz, 1H), 7.34-7.33 (m, 2H), 7.1.7 (dd, J=4.9, 6.7Hz, 1H), 3.14-3.12 (m, 2H), 2.74 (m, 2H), 1.79-1.73 (m, 6H).

[0067] [Step 5-2] Preparation of 2-mercapto-4-(pyridin-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (E)-2-(pyridin-2-ylmethylene)cyclohept-1-one (174 mg) obtained in Step 5-1, 2-cyanoethanethioamide (80 mg), and sodium methoxide (15 mg) were reacted and treated according to the method described in Step 1-2 of Example 4 to obtain the title compound (22 mg, yield 10%). １HNMR (500MHz, DMSO-d6) δ8.60 (dd, J=1.5, 4.7Hz, 1H), 7.77 (dt, J=1.7, 7.6Hz, 1H), 7.29 (d, J=8.1Hz, 1H), 7.22 (ddd, J=1.0, 4.9 , 7.6Hz, 1H), 6.96 (br.s, 2H), 6.62 (br.s, 1H), 3.01 (t, J=6.4Hz, 2H), 2.62-2.60 (m, 2H), 1.87-1.82 (m, 2H), 1.75-1.71 (m, 2H).

[0068] [Step 5-3] Preparation of 3-amino-4-(pyridin-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide 2-Mercapto-4-(pyridin-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (22 mg) obtained in Step 5-2, 2-chloroacetamide (9 mg), and potassium carbonate (22 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (15 mg, yield 57%). １ HNMR (500MHz, DMSO-d6) δ8.30 (d, J = 7.1Hz, 1H), 7.05 (ddd, J = 1.0, 6.6, 9.1Hz, 1H), 6.86 (dt, J = 1.0, 6.8Hz , 1H), 6.45 (br.s, 2H), 3.16 (t, J=5.9Hz, 2H), 2.82 (t, J=6.6Hz, 2H), 1.99-1.95 (m, 2H), 1.92-1.87 (m, 2H).

[0069] Example 6: Preparation of tert-butyl 3-amino-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxylate (Compound Number: NUK-27)

[0070] The title compound (90 mg, yield 56%) was obtained by reacting 2-mercapto-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (115 mg) obtained in step 2-1 of Example 2, tert-butyl 2-bromoacetate (94 mg), and potassium carbonate (110 mg) according to the method described in step 1-3 of Example 1. １ HNMR (500MHz, DMSO-d6) δ7.86-7.82 (m, 1H), 7.26-7.22 (m, 2H), 3.99 (s, 2H), 3.08-3.06 (m, 2 H), 2.63-2.61 (m, 2H), 1.83-1.75 (m, 2H), 1.66-1.58 (m, 2H), 1.55-1.46 (m, 2H), 1.40 (s, 9H).

[0071] [Example 7] Preparation of 3-amino-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxylic acid (Compound Number: NUK-28)

[0072] tert-Butyl 3-amino-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxylate (50 mg) obtained in Example 6 was dissolved in dichloromethane (1 mL), and TFA (500 μL) was added, followed by stirring at room temperature for 2 hours. After the reaction, the solvent was evaporated under reduced pressure, and a mixed solvent of dichloromethane / diethyl ether / hexane (1:1:1) was added. The precipitated solid was filtered to obtain the title compound (20 mg, yield 47%). １ HNMR (500MHz, DMSO-d6) δ12.8 (br.s, 1H), 7.86-7.84 (m, 1H), 7.26-7.23 (m, 2H), 4.05 (br.s, 2H) , 3.07-3.06 (m, 2H), 2.64-2.62 (m, 2H), 1.83-1.76 (m, 2H), 1.66-1.61 (m, 2H), 1.57-1.50 (m, 2H).

[0073] [Example 8] Preparation of 12-(thiophen-2-yl)-8,9,10,11-tetrahydro-3H-cyclohepta[5',6']pyrido[3',2':4,5]thieno[3,2-d]pyrimidin-4(7H)-one (Compound Number: NUK-29)

[0074] 3-Amino-4-(thiophen-2-yl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (45 mg) obtained in Example 1 was dissolved in triethyl orthoformate (2 mL), and acetic acid (2 drops) was added, followed by stirring for 1 hour at 150° C. After the reaction, the solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: dichloromethane:methanol=98:2) to obtain the title compound (19 mg, yield 42%). １ HNMR (500MHz, DMSO-d6) δ8.01 (s, 1H), 7.72 (dd, J = 1.2, 4.9Hz, 1H), 7.19 (dd, J = 3.4, 5.1Hz, 1H), 7.02 (dd, J = 1. 2, 3.4Hz, 1H), 3.22-3.20 (m, 2H), 2.73-2.70 (m, 2H), 1.85-1.79 (m, 2H), 1.74-1.69 (m, 2H), 1.57-1.52 (m, 2H).

[0075] Example 9: Preparation of 3-amino-4-(4-(methoxymethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-30)

[0076] [Step 9-1] Preparation of (E)-2-cyano-3-(4-(methoxymethoxy)phenyl)prop-2-enethioamide

[0123] 4-(Methoxymethoxy)benzaldehyde (1.00 g), 2-cyanoethanethioamide (1.66 g), and N-methylmorpholine (150 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (1.80 g, yield 73%). １ HNMR (500MHz, CDCl ３) δ8.74 (s, 1H), 8.02 (d, J=9.1Hz, 2H), 7.15 (d, J=8.8Hz, 2H), 5.27 (s, 2H), 3.51 (s, 3H).

[0077] [Step 9-2] Preparation of 2-mercapto-4-(4-(methoxymethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(4-(methoxymethoxy)phenyl)prop-2-enethioamide (1.80 g) obtained in Step 9-1, cycloheptanone (960 μL), and piperidine (300 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (651 mg, yield 26%). 1 HNMR (500MHz, DMSO-d6) δ7.23 (d, J = 8.8Hz, 2H), 7.16 (d, J = 8.8Hz, 2H), 5,27 (s, 2H), 3.45 (s, 3H) , 3.01-2.99 (m, 2H), 2.36-2.34 (m, 2H), 1.76-1.69 (m, 2H), 1.66-1.61 (m, 2H), 1.46-1.41 (m, 2H).

[0078] [Step 9-3] Preparation of 3-amino-4-(4-(methoxymethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(4-(methoxymethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (600 mg) obtained in Step 9-2, 2-chloroacetamide (200 mg), and potassium carbonate (502 mg), the title compound (540 mg, yield 77%) was obtained according to the method described in Step 1-3 of Example 1. １ HNMR (500MHz, DMSO-d6) δ7.24 (d, J = 8.8Hz, 2H), 7.18 (d, J = 8.8Hz, 2H), 7.08 (br.s, 2H), 5.56 (br.s, 2H), 5.28 (s, 2H), 3.44 (s, 3H), 3.12-3.10 (m, 2H), 2.52-2.50 (m, 2H), 1.82-1.75 (m, 2H), 1.71-1.64 (m, 2H), 1.51-1.44 (m, 2H).

[0079] Example 10: Preparation of 3-amino-4-(4-hydroxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (Compound Number: NUK-31)

[0080] 3-amino-4-(4-(methoxymethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (520 mg) obtained in Example 9 was dissolved in methanol (15 mL), concentrated hydrochloric acid (1 mL) was added, and the mixture was stirred at 50° C. for 2 hours. After the reaction, the solvent was evaporated under reduced pressure to obtain the title product (495 mg, yield 97%). １ HNMR (500MHz, DMSO-d6) δ7.09 (d, J = 8.6Hz, 2H), 6.93 (dd, J = 2.3, 7.3Hz, 2H), 3.53 (br.s, 1H), 3 .16-3.08 (m, 2H), 2.53-2.50 (m, 2H), 1.81-1.75 (m, 2H), 1.70-1.64 (m, 2H), 1.49-1.44 (m, 2H).

[0081] Example 11: Preparation of ethyl 2-(2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethoxy)acetate (Compound Number: NUK-32)

[0082] [Step 11-1] Preparation of methyl (E)-2-(2-(4-(3-amino-2-cyano-3-oxoprop-1-en-1-yl)phenoxy)ethoxy)acetate Methyl 2-(4-formylphenoxy)ethoxyacetate (500 mg), 2-cyanoethanethioamide (216 mg), and N-methylmorpholine (35 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (277 mg, yield 41%). １ HNMR (500MHz, CDCl ３) δ8.73 (s, 1H), 8.03 (d, J=9.1Hz, 2H), 7.03 (d, J=8.8Hz, 2H), 4.29-4.27 (m, 2H), 4.25 (s, 2H), 4.00-3.98 (m, 2H), 3.77 (s, 3H).

[0083] [Step 11-2] Preparation of ethyl 2-(2-(4-(3-cyano-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-4-yl)phenoxy)ethoxy)acetate Methyl (E)-2-(2-(4-(3-amino-2-cyano-3-oxoprop-1-en-1-yl)phenoxy)ethoxy)acetate (277 mg) obtained in Step 11-1, cycloheptanone (112 μL), and piperidine (57 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (105 mg, yield 26%). １ HNMR (500MHz, DMSO-d6) δ7.22 (d, J = 8.8Hz, 2H), 7.08 (d, J = 8.8Hz, 2H), 4.21 (s, 2H), 4.21-4.18 (m, 2H), 4.11 (q, J = 7.1Hz, 2H) , 3.86-3.85 (m, 2H), 3.01-2.99 (m, 2H), 2.36-2.33 (m, 2H), 1.77-1.66, 1.67-1.58, 1.46-1.38 (m, 2H), 1.19 (t, J = 7.1Hz, 3H).

[0084] [Step 11-3] Preparation of ethyl 2-(2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethoxy)acetate Ethyl 2-(2-(4-(3-cyano-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridin-4-yl)phenoxy)ethoxy)acetate (100 mg) obtained in Step 11-2, 2-chloroacetamide (26 mg), and potassium carbonate (63 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (82 mg, yield 74%). １HNMR (500MHz, DMSO-d6) δ7.22 (d, J = 8.6Hz, 2H), 7.12 (d, J = 8.8Hz , 2H), 7.07 (br.s, 2H), 5.58 (br.s, 2H), 4.22 (s, 2H), 4.12 (q, J=7 .1Hz, 2H), 3.88-3.86 (m, 2H), 3.12-3.10 (m, 2H), 1.81-1.75 (m, 2H), 1.71-1.64 (m, 2H), 1.50-1.43 (m, 2H), 1.20 (t, J=7.1Hz, 3H).

[0085] Example 12: Preparation of 2-(2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethoxy)acetic acid (Compound Number: NUK-33)

[0086] Ethyl 2-(2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethoxy)acetate (48 mg) obtained in Example 11 was dissolved in a mixed solution of ethanol and water (mixing ratio 4:1, 3.0 mL), potassium hydroxide (20 mg) was added, and the mixture was stirred at 90°C for 4 hours. After the reaction, the pH was adjusted to 2 or less by adding a 1N aqueous hydrochloric acid solution, and the precipitated solid was filtered to obtain the title product (46 mg, yield 99%). １ HNMR (500MHz, DMSO-d6) δ12.7 (br.s, 1H), 7.22 (d, J=8.8Hz, 2H), 7. 12 (d, J=8.8Hz, 2H), 7.07 (br.s, 2H), 5.58 (br.s, 2H), 4.21-4.19 (m , 2H), 4.12 (s, 2H), 3.87-3.85 (m, 2H), 3.16-3.10 (m, 2H), 2.56-2.50 (m, 2H), 1.81-1.74 (m, 2H), 1.71-1.64 (m, 2H), 1.50-1.43 (m, 2H).

[0087] [Example 13] Preparation of 3-amino-4-(4-(dimethylamino)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-34)

[0088] [Step 13-1] Preparation of (E,Z)-2-cyano-3-(4-(dimethylamino)phenyl)prop-2-enethioamide

[0123] 4-(dimethylamino)benzaldehyde (627 mg), 2-cyanoethanethioamide (420 mg), and N-methylmorpholine (70 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (817 mg, yield 84%). １ HNMR (500MHz, CDCl ３ ) δ8.69 (s, 4 / 7H), 8.00 (d, J=9.0Hz, 8 / 7H), 7.82 (d, J=9.1Hz, 6 / 7H), 7.48 (s, 3 / 7H), 6.72 (d, J=9.1Hz, 8 / 7Hz), 6.69 (d, J=9.1Hz, 6 / 7H), 3.15 (s, 9 / 7H), 3.15 (s, 12 / 7H).

[0089] [Step 13-2] Preparation of 4-(4-(dimethylamino)phenyl)-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (E,Z)-2-cyano-3-(4-(dimethylamino)phenyl)prop-2-enethioamide (740 mg) obtained in Step 13-1, cycloheptanone (416 μL), and piperidine (200 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (157 mg, yield 15%). １ HNMR (500MHz, DMSO-d6) δ7.10 (d, J = 9.1Hz, 2H), 6.80 (d, J = 8.8Hz, 2H), 2.99-2.98 ( m, 8H), 2.43-2.41 (m, 2H), 1.76-1.70 (m, 2H), 1.66-1.60 (m, 2H), 1.48-1.42 (m, 2H).

[0090] [Step 13-3] Preparation of 3-amino-4-(4-(dimethylamino)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide The title compound (121 mg, yield 51%) was obtained using 4-(4-(dimethylamino)phenyl)-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-3-carbonitrile (200 mg) obtained in Step 13-2, 2-chloroacetamide (69 mg), and potassium carbonate (171 mg) in accordance with the method described in Step 1-3 of Example 1. １ HNMR (500MHz, DMSO-d6) δ7.08 (d, J=8.6Hz, 2H), 7.04 (br.s, 2H), 6.85 (d, J=8.8Hz, 2H), 5.68 (br.s, 2H), 3. 11-3.09 (m, 2H), 2.98 (s, 6H), 2.55-2.53 (m, 2H), 1.81-1.75 (m, 2H), 1.70-1.63 (m, 2H), 1.50-1.44 (m, 2H).

[0091] [Example 14] Preparation of 3-amino-4-(4-(2-amino-2-oxoethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-35)

[0092] 3-Amino-4-(4-hydroxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (50 mg) obtained in Example 10 was dissolved in DMF (2.0 mL), and 2-chloroacetamide (16 mg) and potassium carbonate (60 mg) were added, followed by stirring for 12 hours at 80° C. After the reaction, water was added, and the precipitated solid was filtered to obtain the title compound (38 mg, yield 66%). １HNMR (500MHz, DMSO-d6) δ7.61 (br.s, 1H), 7.44 (br.s, 1H), 7.25 (d, J = 8.6Hz, 2H), 7.13 (d, J = 8.3Hz, 2H), 7.08 (br. s, 2H), 5.56 (br.s, 2H), 4.52 (s, 2H), 3.12-3.10 (m, 2H), 1.81-1.75 (m, 2H), 1.71-1.64 (m, 2H), 1.50-1.44 (m, 2H).

[0093] [Example 15] Preparation of methyl 2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)acetate (Compound Number: NUK-36)

[0094] 3-Amino-4-(4-hydroxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (100 mg) obtained in Example 10, methyl 2-bromoacetate (38 μL), and potassium carbonate (116 mg) were reacted and treated according to the method described in Example 14 to give the title compound (65 mg, yield 55%). １ HNMR (500MHz, DMSO-d6) δ7.24 (d, J = 8.8Hz, 2H), 7.12 (d, J = 8.6Hz, 2H), 7.09 (br.s, 2H), 5.54 (br.s, 2H) , 4.90 (s, 2H), 3.73 (s, 3H), 3.12-3.10 (m, 2H), 1.81-1.75 (m, 2H), 1.71-1.65 (m, 2H), 1.50-1.44 (m, 2H).

[0095] Example 16: Preparation of 2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)acetic acid (Compound Number: NUK-37)

[0096] Methyl 2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)acetate (50 mg), prepared in a similar manner to that of Example 15, and potassium hydroxide (20 mg) were used for the reaction and treatment according to the method described in Example 12 to obtain the title compound (35 mg, yield 71%). １ HNMR (500MHz, DMSO-d6) δ13.1 (br.s, 1H), 7.24 (d, J = 8.6Hz, 2H), 7.11-7.08 (m, 4H), 5.53 (br.s, 2H), 4.7 7 (s, 2H), 3.12-3.10 (m, 2H), 2.53-2.50 (m, 2H), 1.81-1.75 (m, 2H), 1.71-1.65 (m, 2H), 1.51-1.44 (m, 2H).

[0097] Example 17: Preparation of tert-butyl 2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethyl)carbamate (Compound Number: NUK-38)

[0098] 3-Amino-4-(4-hydroxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (50 mg), prepared in the same manner as in Example 10, was dissolved in DMF (1.0 mL), and tert-butyl(2-bromoethyl)carbamate (38 mg) and potassium carbonate (60 mg) were added. The mixture was stirred at 80°C for 12 hours. After the reaction, water was added and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate:hexane = 2:1) to obtain the title compound (26 mg, yield 37%). １ HNMR (500MHz, CDCl ３) δ7.19 (d, J=7.4Hz, 2H), 7.04 (d, J=7.6Hz, 2H), 5.25 (br.s, 1H), 4.14-4.11 (m, 2H), 3.62- 3.60 (m, 2H) 3.20-3.18 (m, 2H), 2.58-2.56 (m, 2H), 1.87-1.76 (m, 4H), 1.52-1.46 (m, 11H).

[0099] [Example 18] Preparation of 3-amino-4-(4-(2-aminoethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-39)

[0100] tert-Butyl 2-(4-(3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethyl)carbamate (40 mg), prepared in a similar manner to Example 17, was dissolved in dichloromethane (2.0 mL), and TFA (500 μL) was added thereto, followed by stirring at room temperature for 3 hours. After the reaction, saturated aqueous sodium hydrogen carbonate solution was added, and the precipitated solid was filtered to obtain the title product (35 mg, yield 99%). １ HNMR (500MHz, DMSO-d6) δ7.22 (d, J = 8.6Hz, 2H), 7.11 (d, J = 8.6Hz, 2H), 7.07 (br.s, 2H), 5.58 (br.s, 2H), 4.00 (t, J = 7.1Hz, 2H), 3.12-3.10 (m, 2H), 2.92 (t, J = 5.6Hz, 2H), 1.82-1.75 (m, 2H), 1.71-1.64 (m, 2H), 1.51-1.43 (m, 2H).

[0101] [Example 19] Preparation of 3-amino-4-(4-(methoxymethoxy)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-40)

[0102] [Step 19-1] Preparation of 2-mercapto-4-(4-(methoxymethoxy)phenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(4-(methoxymethoxy)phenyl)prop-2-enethioamide (710 mg), prepared in a similar manner to Step 9-1 of Example 9, cyclopentanone (280 μL), and piperidine (250 μL) were used in a reaction and treatment according to the method described in Step 1-2 of Example 1 to obtain the title compound (148 mg, yield 17%). １ HNMR (500MHz, DMSO-d6) δ7.46 (d, J = 9.1Hz, 2H), 7.16 (d, J = 8.8Hz, 2H), 5.27 (s, 2H), 3 .41 (s, 3H), 2.96 (t, J=7.6Hz, 2H), 2.60 (t, J=7.4Hz, 2H), 2.02 (quint, J=7.3Hz, 2H).

[0103] [Step 19-2] Preparation of 3-amino-4-(4-(methoxymethoxy)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(4-(methoxymethoxy)phenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (148 mg) obtained in Step 19-1, 2-chloroacetamide (52 mg), and potassium carbonate (127 mg), the title compound (82 mg, yield 51%) was obtained according to the method described in Step 1-3 of Example 1. １ HNMR (500MHz, CDCl ３ ) δ7.28 (d, J=8.8Hz, 2H), 7.18 (d, J=9.2Hz, 2H), 5.86 (br.s, 2H), 5.29 (br.s, 2H), 5.26 (s, 2H), 3.55 (s, 3H), 3.16 (t, J=7.6Hz, 2H), 2.75 (t, J=7.4Hz, 2H), 2.15 (quint, J=7.6Hz, 2H).

[0104] [Example 20] Preparation of 3-amino-4-(4-hydroxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (Compound Number: NUK-41)

[0105] The title compound (82 mg, yield 95%) was obtained by reacting 3-amino-4-(4-(methoxymethoxy)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (82 mg) obtained in Example 19 and concentrated hydrochloric acid (100 μL) according to the method described in Example 10. １ HNMR (300MHz, DMSO-d6) δ7.20 (d, J = 8.2Hz, 2H), 6.93 (d, J = 8.8Hz, 2H) , 3.05 (t, J=7.1Hz, 2H), 2.67 (t, J=7.6Hz, 2H), 2.05 (t, J=7.6Hz, 2H).

[0106] [Example 21] Preparation of 3-amino-4-(4-(2-amino-2-oxoethoxy)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-42)

[0107] 3-Amino-4-(4-hydroxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (115 mg), prepared in the same manner as in Example 20, was dissolved in DMF (2.0 mL), and 2-chloroacetamide (36 mg) and potassium carbonate (138 mg) were added, followed by stirring at 80°C for 12 hours. After the reaction, water was added and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate) to obtain the title compound (61 mg, yield 50%). １ HNMR (300MHz, DMSO-d6) δ7.62 (br.s, 1H), 7.45 (br.s, 1H), 7.35 (d, J = 8.8Hz, 2H), 7.13-7.11 (br.s, 4H) , 5.77 (br.s, 2H), 4.51 (s, 2H), 3.05 (t, J=7.6Hz, 2H), 2.67 (t, J=7.0Hz, 2H), 2.05 (quint, J=7.6Hz, 2H).

[0108] [Example 22] Preparation of tert-butyl 2-(4-(3-amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridin-4-yl)phenoxy)ethyl)carbamate (Compound Number: NUK-43)

[0109] 3-Amino-4-(4-hydroxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide hydrochloride (50 mg), prepared in the same manner as in Example 20, was dissolved in DMF (1.0 mL), and tert-butyl(2-bromoethyl)carbamate (37 mg) and potassium carbonate (60 mg) were added, followed by stirring at 80°C for 12 hours. After the reaction, water was added and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate) to obtain the title compound (27 mg, yield 32%). １ HNMR (300MHz, DMSO-d6) δ7.33 (d, J = 8.8Hz, 2H), 7.09-7.06 (m, 4H), 5.76 (br.s, 2H), 4.02 ( t, J=5.3Hz, 2H), 3.03 (t, J=7.6Hz, 2H), 2.64 (t, J=7.0Hz, 2H), 2.03 (quint, J=7.1Hz, 2H).

[0110] Example 23 Preparation of ethyl 3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-carboxylate (Compound Number: NUK-44) The compound of Example 23 below can be prepared via the method and intermediates described in Scheme 3 below.

[0111] <Scheme 3>

[0112] [Step 23-1] Preparation of ethyl 3-cyano-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-4-carboxalate Sodium metal (271 mg) was added portionwise to ethanol (8.0 mL) and stirred at room temperature for 12 hours to prepare sodium methoxide. Diethyl oxalate (1.36 mL) and cycloheptanone (1.18 mL) were added, followed by stirring at room temperature for 3 hours. 2-Cyanoethanethioamide (1.00 g) was then added, followed by stirring at 80°C for 7 hours. After the reaction, the solvent was evaporated under reduced pressure, ice water was added to the residue, and the precipitated solid was filtered and washed with a mixture of ethyl acetate and hexane (mixing ratio 1:1) to obtain the title compound (1.52 g, yield 55%). １ HNMR (500MHz, DMSO-d6) δ4.40 (q, J = 7.1Hz, 2H), 2.98-2.96 (m, 2H), 2.50-2.47 (m, 2 H), 1.79-1.69 (m, 2H), 1.65-156 (m, 2H), 1.53-1.46 (m, 2H), 1.30 (t, J=7.1Hz, 3H).

[0113] [Step 23-2] Preparation of ethyl 3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-carboxylate (Compound Number: NUK-44) Ethyl 3-cyano-2-mercapto-6,7,8,9-tetrahydro-5H-cyclohepta[b]pyridine-4-carboxate (552 mg) obtained in Step 23-1, 2-chloroacetamide (224 mg), and potassium carbonate (552 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (318 mg, yield 48%). １ HNMR (500MHz, DMSO-d6) δ7.31 (br.s, 2H), 6.19 (br.s, 2H), 4.49 (q, J=7.1Hz, 2H), 3.12-3. 10 (m, 2H), 2.75-2.73 (m, 2H), 1.85-1.76 (m, 2H), 1.68-1.56 (m, 4H), 1.32 (t, J=7.3Hz, 3H).

[0114] [Example 24] Preparation of 3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-acetic acid (Compound Number: NUK-45)

[0115] Ethyl 3-amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-carboxylate (66 mg), which had been prepared in a similar manner to that of Example 23, and potassium hydroxide (40 mg) were used in the reaction and treatment described in Example 12 to obtain the title compound (50 mg, yield 82%). １ HNMR (500MHz, DMSO-d6) δ7.28 (br.s, 4H), 3.11-3.09 (m, 2H), 2.82-2.79 (m, 2H), 1.87-1.77 (m, 2H), 1.68-1.58 (m, 4H).

[0116] [Example 25] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-46)

[0117] [Step 25-1] Preparation of 2-mercapto-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(4-methoxyphenyl)prop-2-enethioamide (1.28 g), prepared in the same manner as in Step 3-1 of Example 3, cyclopentanone (570 μL), and piperidine (368 μL) were used in a reaction and treatment according to the method described in Step 1-2 of Example 1 to obtain the title compound (432 mg, yield 26%). １ HNMR (500MHz, DMSO-d6) δ7.45 (d, J = 8.8Hz, 2H), 7.07 (d, J = 8.8Hz, 2H), 3.81 (s , 3H), 2.94 (t, J=7.6Hz, 2H), 2.59 (t, J=7.6Hz, 2H), 2.01 (quint, J=7.6Hz, 2H).

[0118] [Step 25-2] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (450 mg) obtained in Step 25-1, 2-chloroacetamide (179 mg), and potassium carbonate (662 mg), the title compound (400 mg, yield 74%) was obtained according to the method described in Step 1-3 of Example 1. １ HNMR (500MHz, DMSO-d6) δ7.34 (d, J = 8.3Hz, 2H), 7.11 (d, J = 8.8Hz, 2H), 7.09 (br.s, 2H), 5.78 (b r.s, 2H), 3.84 (s, 3H), 3.05 (t, J=7.6Hz, 2H), 2.66 (t, J=7.4Hz, 2H), 2.05 (quint, J=7.6Hz, 2H).

[0119] [Example 26] 3-amino-N ４ Preparation of phenyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2,4-dicarboxamide (compound number: NUK-47)

[0120] 3-Amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-acetic acid (31 mg) prepared in the same manner as in Example 24 was dissolved in DMF (2.0 mL), and aniline (12 mg), iPr ２ NEt (60 μL) and EDCI (23 mg) were added and stirred at room temperature for 24 hours. After the reaction, water was added and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: dichloromethane:methanol=98:2) to obtain the title compound (14 mg, yield 37%). １HNMR (500MHz, DMSO-d6) δ10.8 (br.s, 1H), 7.70 (d, J = 7.6Hz, 2H), 7.39 (t, J = 7.6Hz, 2H), 7.26 (br.s, 2 H), 7.18 (t, J=7.6Hz, 1H), 6.28 (br.s, 2H), 3.16-3.12 (m, 2H), 2.86-2.81 (m, 2H), 1.88-1.62 (m, 6H).

[0121] [Example 27] Preparation of 3-amino-4-(morpholine-4-carbonyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-48)

[0122] 3-Amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-acetic acid (61 mg), prepared in the same manner as in Example 24, was dissolved in DMF (2.0 mL), and morpholine (22 μL) and HATU (91 mg) were added. The mixture was stirred at room temperature for 24 hours. After the reaction, water was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: dichloromethane:methanol=95:5) to obtain the title compound (28 mg, yield 37%). １ HNMR (500MHz, DMSO-d6) δ7.26 (br.s, 2H), 6.21 (br.s, 2H), 3.84-3.68 (m, 4H), 3.47-3. 44 (m, 2H), 3.12-3.08 (m, 2H), 2.76-2.73 (m, 2H), 1.83-1.81 (m, 2H), 1.71-1.57 (m, 4H).

[0123] [Example 28] 3-amino-N ４ Preparation of -(4-methoxyphenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2,4-dicarboxamide (Compound Number: NUK-49)

[0124] 3-Amino-2-carbamoyl-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-4-acetic acid (61 mg), which was prepared in a similar manner to that in Example 24, 4-methoxyaniline (30 mg), and HATU (91 mg) were used in a reaction and treatment in a similar manner to that in Example 27 to obtain the title compound (12 mg, yield 14%). １ HNMR (500MHz, DMSO-d6) δ10.67 (br.s, 1H), 7.58 (d, J = 9.0Hz, 2H), 7.23 (br.s, 2H), 6.94 (d, J = 8. 8Hz, 2H), 6.29 (br.s, 2H), 3.74 (s, 3H), 3.11-3.09 (m, 2H), 2.84-2.80 (m, 2H), 1.87-1.59 (m, 6H).

[0125] [Example 29] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]furo[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-50)

[0126] [Step 29-1] Preparation of (E)-2-cyano-3-(4-methoxyphenyl)acrylamide Anisaldehyde (2.04 g), 2-cyanoacetamide (1.16 g), and N-methylmorpholine (300 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (940 mg, yield 31%). １ HNMR (500MHz, CDCl ３ ) δ8.27 (s, 1H), 7.97 (d, J=8.6Hz, 2H), 7.00 (d, J=9.1Hz, 2H), 6.28 (br.s, 1H), 5.67 (br.s, 1H), 3.90 (s, 3H).

[0127] [Step 29-2] Preparation of 2-hydroxy-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(4-methoxyphenyl)acrylamide (808 mg) obtained in Step 29-1, cyclopentanone (389 μL), and piperidine (200 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (432 mg, yield 26%). １ HNMR (500MHz, DMSO-d6) δ7.44 (d, J = 8.5Hz, 2H), 7.07 (d, J = 8.6Hz, 2H), 3.82 (s , 3H), 2.85 (t, J=7.4Hz, 2H), 2.56 (t, J=7.1Hz, 2H), 1.98 (quint, J=7.1Hz, 2H).

[0128] [Step 29-3] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]furo[3,2-e]pyridine-2-carboxamide Using 2-hydroxy-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (273 mg) obtained in Step 29-2, 2-chloroacetamide (115 mg), and potassium carbonate (284 mg), the title compound (6.0 mg, yield 2%) was obtained according to the method described in Step 1-3 of Example 1. １ HNMR (500MHz, DMSO-d6) δ7.76 (br.s, 1H), 7.47 (d, J = 9.1Hz, 2H), 7.36 (br.s, 1H), 7.09 (d, J = 9.1Hz, 2H) , 4.63 (br.s, 2H), 3.83 (s, 3H), 2.98 (t, J=7.6Hz, 2H), 2.66 (t, J=7.1Hz, 2H), 2.01 (quint, J=8.8Hz, 2H).

[0129] [Example 30 (Intermediate Compound)] Preparation of 3,6-diamino-4-(4-chlorophenyl)-5-cyanothieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-51)

[0130] [Step 30-1] Preparation of 2-amino-4-(4-chlorophenyl)-6-mercaptopyridine-3,5-dicarbonitrile 4-Chlorobenzaldehyde (703 mg) was dissolved in ethanol (20 mL), and 2-cyanoacetamide (1.00 g) and N-methylmorpholine (1.1 mL) were added thereto, followed by stirring for 12 hours at 80° C. After the reaction, the precipitated solid was purified by column chromatography (developing solvent: ethyl acetate:methanol=10:1) to obtain the title product (200 mg, yield 19%). １ HNMR (500 MHz, DMSO-d6) δ7.63 (d, J=8.6 Hz, 2H), 7.53 (d, J=8.6 Hz, 2H).

[0131] [Step 30-2] Preparation of 3,6-diamino-4-(4-chlorophenyl)-5-cyanothieno[2,3-b]pyridine-2-carboxamide 2-Amino-4-(4-chlorophenyl)-6-mercaptopyridine-3,5-dicarbonitrile (200 mg) obtained in Step 30-1, 2-chloroacetamide (78 mg), and potassium carbonate (290 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (240 mg, yield 43%). １ HNMR (300MHz, DMSO-d6) δ7.66 (d, J=8.2Hz, 2H), 7.52 (d, J=8.8Hz, 2H), 7.32 (br.s, 2H), 7.00 (br.s, 2H), 5.63 (br.s, 2H).

[0132] [Example 31] Preparation of ethyl 3-amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-4-carboxylate (Compound Number: NUK-52)

[0133] [Step 31-1] Preparation of ethyl 3-cyano-2-mercapto-6,7-dihydro-5H-cyclopenta[b]pyridine-4-carboxalate Sodium metal (271 mg) was added portionwise to ethanol (8.0 mL) and stirred at room temperature for 12 hours to prepare sodium methoxide. Using diethyl oxalate (1.36 mL), cyclopentanone (932 μL), and 2-cyanoethanethioamide (1.00 g), the reaction was carried out according to the method described in Step 23-1 of Example 23 to obtain the title compound (218 mg, yield 9%). １ HNMR (500MHz, DMSO-d6) δ4.40 (q, J = 7.1Hz, 2H), 3.12 (t, J = 7.3Hz, 2H), 2 98 (t, J=7.9Hz, 2H), 2.06 (quint, J=7.6Hz, 2H), 1.35 (t, J=7.1Hz, 3H).

[0134] [Step 31-2] Preparation of ethyl 3-amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-4-carboxylate Ethyl 3-cyano-2-mercapto-6,7-dihydro-5H-cyclopenta[b]pyridine-4-carboxate (218 mg) obtained in Step 31-1, 2-chloroacetamide (99 mg), and potassium carbonate (364 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (61 mg, yield 23%). １ HNMR (500MHz, DMSO-d6) δ7.29 (br.s, 2H), 6.59 (br.s, 2H), 4.47 (q, J = 7.1Hz , 2H), 3.05-3.03 (m, 4H), 2.11 (quint, J=7.4Hz, 2H), 1.35 (t, J=7.1Hz, 3H).

[0135] [Example 32] Preparation of 3-amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-4-acetic acid (Compound Number: NUK-53) Ethyl 3-amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-4-carboxylate (60 mg), prepared in a similar manner to that of Example 31, and potassium hydroxide (40 mg) were used in the reaction and treatment described in Example 24 to obtain the title compound (42 mg, yield 77%). １ HNMR (500MHz, DMSO-d6) δ7.27 (br.s, 2H), 3.07-3.03 (m, 4H), 2.12 (quint, J=7.6Hz, 2H).

[0136] [Example 33] Preparation of methyl 3-amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-4-carboxylate (Compound Number: NUK-54) 3-Amino-2-carbamoyl-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-4-acetic acid (20 mg), prepared in the same manner as in Example 32, was dissolved in DMF (1.0 mL), and methyl iodide (7 μL) and potassium carbonate (20 mg) were added, followed by stirring at room temperature for 24 hours. After the reaction, water was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure to obtain the title compound (20 mg, yield 95%). １ HNMR (500MHz, DMSO-d6) δ7.32 (br.s, 2H), 6.60 (br.s, 2H), 4.00 (s, 3H), 3.07-3.03 (m, 4H), 2.13 (quint, J=7.6Hz, 2H).

[0137] [Example 34] Preparation of 4-(4-acetylphenyl)-3-amino-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-57)

[0138] [Step 34-1] Preparation of (E)-4-(3-amino-2-cyano-3-thioxoprop-1-en-1-yl)-N-methoxy-N-methylbenzamide 4-Formyl-N-methoxy-N-methylbenzamide (3.0 g), 2-cyanoethanethioamide (1.55 g), and N-methylmorpholine (260 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to give the title compound (3.5 g, yield 82%). １ HNMR (500MHz, DMSO-d6) δ7.61-7.55 (m, 3H), 6.97 (br.s, 2H), 3.52 (s, 3H), 3.23 (d, J = 4.2Hz, 2H).

[0139] [Step 34-2] Preparation of 4-(3-cyano-2-mercapto-6,7-dihydro-5H-cyclohepta[b]pyridin-4-yl)-N-methoxy-N-methylbenzamide (E)-4-(3-amino-2-cyano-3-thioxoprop-1-en-1-yl)-N-methoxy-N-methylbenzamide (3.0 g) obtained in Step 34-1, cyclopentane (1.1 mL), and piperidine (600 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (2.32 g, yield 63%). １ HNMR (500MHz, DMSO-d6) δ7.72 (d, J = 8.3Hz, 2H), 7.57 (d, J = 8.3Hz, 2H), 3.58 (s, 3H), 3 .29 (s, 3H), 2.98 (t, J=7.6Hz, 2H), 2.57 (t, J=7.1Hz, 2H), 2.03 (quint, J=7.4Hz, 2H).

[0140] [Step 34-3] Preparation of 3-amino-4-(4-(methoxy(methyl)carbamoyl)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 4-(3-cyano-2-mercapto-6,7-dihydro-5H-cyclohepta[b]pyridin-4-yl)-N-methoxy-N-methylbenzamide (2.3 g) obtained in Step 34-2, 2-chloroacetamide (767 mg), and potassium carbonate (1.9 g), the title compound (1.4 g, yield 52%) was obtained according to the method described in Step 1-3 of Example 1.１ HNMR (500MHz, DMSO-d6) δ7.76 (d, J = 8.3Hz, 2H), 7.50 (d, J = 8.3Hz, 2H), 7.16 (br.s, 2H), 5.69 (br.s, 2H) ), 3.58 (s, 3H), 3.31 (s, 2H), 3.07 (t, J=7.6Hz, 2H), 2.66 (t, J=7.6Hz, 2H), 2.07 (quint, J=7.8Hz, 2H).

[0141] [Step 34-4] Preparation of 4-(4-acetylphenyl)-3-amino-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide 3-Amino-4-(4-(methoxy(methyl)carbamoyl)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (400 mg) obtained in Step 34-3 was dissolved in THF (6.0 mL), and methylmagnesium bromide (3.0 M THF solution, 1.3 mL) was added, followed by stirring at 50°C for 12 hours. After the reaction, water was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by column chromatography (developing solvent: ethyl acetate) to obtain the title compound (37 mg, yield 11%). １ HNMR (500MHz, CDCl ３ ) δ8.11 (s, J=8.6Hz, 2H), 7.48 (d, J=8.4Hz, 2H), 5.98 (br.s, 2H), 5.67 (br.s, 2H), 3 .17 (t, J=7.6Hz, 2H), 2.70 (t, J7.4Hz, 2H), 2.69 (s, 3H), 2.16 (quint, J=7.6Hz, 2H).

[0142] [Example 35] Preparation of 3-amino-4-(5-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-61)

[0143] [Step 35-1] Preparation of (E)-2-cyano-3-(5-methylthiophen-2-yl)-prop-2-enethioamide

[0123] 5-Methylthiophene-2-carbaldehyde (1.64 mL), 2-cyanoethanethioamide (1.55 g), and N-methylmorpholine (260 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (3.0 g, yield 93%). １ HNMR (500MHz, CDCl ３ ) δ8.81 (s, 1H), 7.68 (d, J=3.9Hz, 1H), 7.57 (br.s, 1H), 7.37 (br.s, 1H), 6.93 (d, J=3.9Hz, 1H), 2.62 (s, 3H).

[0144] [Step 35-2] Preparation of 2-mercapto-4-(5-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(5-methylthiophen-2-yl)-prop-2-enethioamide (1.27 g) obtained in Step 35-1, cyclopentanone (594 μL), and piperidine (380 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (230 mg, yield 14%). １ HNMR (500MHz, DMSO-d6) δ7.51 (d, J = 3.4H, 1H), 7.00 (d, J = 3.7Hz, 1H), 2.94 (t, J=7.8Hz, 2H), 2.80 (t, J=7.3Hz, 2H), 2.54 (s, 3H), 2.04 (quint, J=7.4Hz, 2H).

[0145] [Step 35-3] Preparation of 3-amino-4-(5-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(5-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (230 mg) obtained in Step 35-2, 2-chloroacetamide (94 mg), and potassium carbonate (229 mg), the reaction was carried out according to the method described in Step 1-3 of Example 1 to obtain the title compound (87 mg, yield 32%). １HNMR (500MHz, DMSO-d6) δ7.15 (br.s, 2H), 7.03 (d, J = 3.4Hz, 1H), 6.96 (d, J = 3.4Hz, 1H), 6.04 (b r.s, 2H), 3.06 (t, J=7.6Hz, 2H), 2.79 (t, J=7.6Hz, 2H), 2.55 (s, 3H), 2.08 (quint, J=7.6Hz, 2H).

[0146] [Example 36] Preparation of 3-amino-4-(4-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-62)

[0147] [Step 36-1] Preparation of (E)-2-cyano-3-(4-methylthiophen-2-yl)-prop-2-enethioamide

[0123] 4-Methylthiophene-2-carbaldehyde (1.95 mL), 2-cyanoethanethioamide (1.55 g), and N-methylmorpholine (260 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (2.8 g, yield 87%). １ HNMR (500MHz, DMSO-d6) δ9.98 (br.s, 1H), 9.43 (br.s, 1H), 8.31 (s, 1H), 7.74 (s, 1H), 7.70 (s, 1H), 2.26 (s, 3H).

[0148] [Step 36-2] Preparation of 2-mercapto-4-(4-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(3-methylthiophen-2-yl)-prop-2-enethioamide (1.27 g) obtained in Step 36-1, cyclopentanone (594 μL), and piperidine (380 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (345 mg, yield 21%). １ HNMR (500MHz, DMSO-d6) δ7.56 (s, 1H), 7.48 (s, 1H), 2.95 (t, J = 6.8Hz , 2H), 2.79 (t, J=7.3Hz, 2H), 2.27 (s, 3H), 2.04 (quint, J=6.6Hz, 2H).

[0149] [Step 36-3] Preparation of 3-amino-4-(4-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(4-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (345 mg) obtained in Step 36-2, 2-chloroacetamide (140 mg), and potassium carbonate (342 mg), the product was reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (45 mg, yield 11%). １ HNMR (500MHz, DMSO-d6) δ7.45 (s, 1H), 7.15 (br.s, 2H), 7.06 (s, 1H), 6.00 (br.s, 2H), 3.06 (t, J=7.3Hz, 2H), 2.78 (t, J=7.6Hz, 2H), 2.29 (s, 3H), 2.08 (quint, J=7.6Hz, 2H).

[0150] [Example 37] Preparation of 3-amino-4-(3-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-63)

[0151] [Step 37-1] Preparation of (E)-2-cyano-3-(3-methylthiophen-2-yl)-prop-2-enethioamide

[0123] 3-Methylthiophene-2-carbaldehyde (1.64 mL), 2-cyanoethanethioamide (1.55 g), and N-methylmorpholine (260 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (2.9 g, yield 90%). １ HNMR (500MHz, DMSO-d6) δ9.92 (br.s, 1H), 9.36 (br.s, 1H), 8.32 (s, 1H), 7.71 (d, J = 3.7Hz, 1H), 7.06 (d, J = 3.7Hz, 1H), 2.57 (s, 3H).

[0152] [Step 37-2] Preparation of 2-mercapto-4-(3-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(3-methylthiophen-2-yl)-prop-2-enethioamide (1.27 g) obtained in Step 37-1, cyclopentanone (594 μL), and piperidine (380 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (430 mg, yield 26%). １ HNMR (500MHz, CDCl ３ ) δ7.45 (d, J = 5.2H, 1H), 6.99 (d, J = 5.0Hz, 1H), 3.17-3.11 (m, 2H), 2.93-2.88 (m, 1H), 2.66-2.60 (m, 1H), 2.62 (s, 3H), 2.22-2.14 (m, 2H).

[0153] [Step 37-3] Preparation of 3-amino-4-(3-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(3-methylthiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (430 mg) obtained in Step 37-2, 2-chloroacetamide (174 mg), and potassium carbonate (428 mg), the reaction was carried out according to the method described in Step 1-3 of Example 1 to obtain the title compound (77 mg, yield 15%). １ HNMR (500MHz, DMSO-d6) δ7.75 (d, J = 6.4Hz, 1H), 7.15 (br.s, 2H), 7.13 (d, J = 6.4Hz, 1H), 5.86 (br.s, 2H), 3.07 (t, J=7.1Hz, 2H), 2.78-2.72 (m, 1H), 2.62-2.56 (m, 1H), 2.13-2.04 (m, 2H).

[0154] [Example 38] Preparation of 3-amino-4-(thiophen-3-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-64)

[0155] [Step 38-1] Preparation of (E)-2-cyano-3-(thiophen-3-yl)-prop-2-enethioamide Thiophene-3-carbaldehyde (1.4 mL), 2-cyanoethanethioamide (1.55 g), and N-methylmorpholine (260 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (2.9 g, yield 70%). １ HNMR (500MHz, DMSO-d6) δ10.00 (br.s, 1H), 9.51 (br.s, 1H), 8.39 (t, J = 2.2Hz, 1H), 8,14 (s, 1H), 7.79 (d, J = 2.0Hz, 2H).

[0156] [Step 38-2] Preparation of 2-mercapto-4-(thiophen-3-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(thiophen-3-yl)-prop-2-enethioamide (1.27 g) obtained in Step 38-1, cyclopentanone (594 μL), and piperidine (380 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (200 mg, yield 7%). １ HNMR (500MHz, DMSO-d6) δ7.98 (d, J = 5.2H, 1H), 7.67 (d, J = 4.0Hz, 1H), 7.29 (t, J = 4. 2Hz, 1H), 2.96 (t, J=7.8Hz, 2H), 2.79 (t, J=7.8Hz, 2H), 2.05 (quint, J=7.6Hz, 2H).

[0157] [Step 38-3] Preparation of 3-amino-4-(thiophen-3-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(thiophen-3-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (200 mg) obtained in Step 38-2, 2-chloroacetamide (87 mg), and potassium carbonate (212 mg), the reaction was carried out according to the method described in Step 1-3 of Example 1 to obtain the title compound (22 mg, yield 9%). １HNMR (500MHz, DMSO-d6) δ7.82 (dd, J = 2.7, 4.7Hz, 1H), 7.74 (dd, J = 1.0, 3.0Hz, 1H), 7.25 (dd, J = 1.0, 4.7Hz, 1H ), 7.12 (br.s, 2H), 5.89 (br.s, 2H), 3.05 (t, J=7.3Hz, 2H), 2.72 (t, J=6.8Hz, 2H), 2.06 (quint, J=7.6Hz, 2H).

[0158] [Example 39] Preparation of 4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-74)

[0159] [Step 39-1] Preparation of 3-amino-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile 2-Mercapto-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (370 mg), 2-chloroacetonitrile (109 μL), and potassium carbonate (394 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (195 mg, yield 34%). １ HNMR (500MHz, DMSO-d6) δ7.93-7.92 (m, 1H), 7.30 (s, 2H), 5.69 (br.s, 2H) , 3.08 (d, J=7.9Hz, 2H), 2.77 (t, J=7.1Hz, 2H), 2.09 (quint, J=7.4Hz, 2H).

[0160] [Step 39-2] Preparation of 4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile 3-Amino-4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile (89 mg) obtained in Step 39-1 was dissolved in DMF (2.5 mL), tert-butyl nitrite (54 μL) was added, and the mixture was stirred at 65°C for 30 minutes. After the reaction, water was added, and the mixture was extracted with ethyl acetate. The extract was washed with saturated brine, dried over magnesium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by column chromatography (developing solvent: ethyl acetate:hexane = 1:4) to obtain the title compound (29 mg, yield 34%). １ HNMR (500MHz, CDCl ３ ) δ8.04 (s, 1H), 7.58 (d, J = 5.1Hz, 1H), 7.33 (d, J = 4.4Hz, 1H), 7.24 (t, J = 4.9Hz , 1H), 3.20 (t, J=7.9Hz, 2H), 3.16 (t, J=7.3Hz, 2H), 2.23 (sept, J=7.6Hz, 2H).

[0161] [Step 39-3] Preparation of 4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide 4-(thiophen-2-yl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile (27 mg) obtained in Step 39-2 was dissolved in a mixed solution of acetone and water (mixing ratio 5:3, 4.0 mL), sodium carbonate perhydride (77 mg) was added, and the mixture was stirred at 50° C. for 4 hours. After the reaction, water was added, and the precipitated solid was filtered to obtain the title compound (16 mg, yield 54%). １ HNMR (500MHz, DMSO-d6) δ8.35 (br.s, 1H), 2.20 (s, 1H), 7.90 (d, J = 4.9Hz, 1H), 7.61 (br.s, 1H), 7 .55 (d, J=2.9Hz, 1H), 7.30 (dd, J=3.7, 4.9Hz, 1H), 3.11-3.06 (m, 4H), 2.13 (sept, J=7.4Hz, 2H).

[0162] [Example 40] Preparation of 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-75)

[0163] [Step 40-1] Preparation of 3-amino-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile 2-mercapto-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (282 mg), prepared in a similar manner to Step 25-1 of Example 25, 2-chloroacetonitrile (76 μL), and potassium carbonate (276 mg) were reacted and treated according to the method described in Step 1-3 of Example 1 to obtain the title compound (173 mg, yield 54%). １ HNMR (500MHz, DMSO-d6) δ7.37 (d, J = 8.3Hz, 2H), 7.14 (d, J = 8.4Hz, 2H), 5.50 (br.s, 2H) , 3.85 (s, 3H), 3.07 (t, J=7.6Hz, 2H), 2.68 (t, J=7.4Hz, 2H), 2.07 (sept, J=7.4Hz, 2H).

[0164] [Step 40-2] Preparation of 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile Using 3-amino-4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile (80 mg) obtained in Step 40-1 and tert-butyl nitrite (45 μL), the reaction was carried out according to the method described in Step 39-2 of Example 39 to obtain the title compound (31 g, yield 41%). １ HNMR (500MHz, CDCl ３ ) δ7.73 (s, 1H), 7.37 (d, J = 8.6Hz, 2H), 7.06 (d, J = 8.6Hz, 2H), 3.91 (s, 3H) , 3.20 (t, J=7.6Hz, 2H), 3.00 (t, J=7.4Hz, 2H), 2.20 (sept, J=7.4Hz, 2H).

[0165] [Step 40-3] Preparation of 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carbonitrile (30 mg) obtained in Step 40-2 and sodium carbonate perhydride (77 mg), the product was reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (31 g, yield 98%). １ HNMR (500MHz, DMSO-d6) δ8.25 (br.s, 1H), 7.90 (s, 1H), 7.54 (br.s, 1H), 7.59 (d, J = 8.6Hz, 1H), 7.13 ( d, J=8.6Hz, 1H), 3.85 (s, 3H), 3.06 (t, J=7.6Hz, 2H), 2.93 (t, J=7.3Hz, 2H), 2.09 (sept, J=7.4Hz, 2H).

[0166] Example 41 Preparation of 3-amino-4-(4-(2-(5-((3aS,4S,6aR)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)pentamido)ethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-76)

[0167] 3-Amino-4-(4-(2-aminoethoxy)phenyl)-6,7,8,9-tetrahydro-5H-cyclohepta[b]thieno[3,2-e]pyridine-2-carboxamide (16 mg), produced in the same manner as in Example 18, was dissolved in DMF (1 mL), and Biotin NHS (46 mg) was added thereto, followed by stirring at room temperature for 12 hours. After the reaction, the solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: dichloromethane:methanol=2:1) ​​to obtain the title compound (25 mg, yield 40%). １HNMR (500MHz, DMSO-d6) δ8.10 (br.s, 1H), 7.21 (d, J = 8.6Hz, 2H), 7.11 (d, J = 8.1Hz , 2H), 7.09 (br.s, 2H), 8.43 (br.s, 1H), 6.35 (br.s, 1H), 5.57 (br.s, 2H), 3.11-3. 08 (m, 2H), 2.79 (dd, J = 4.9, 12.5Hz, 1H), 2.55 (d, J = 12.2Hz, 1H), 2.10 (t, J = 7.3Hz , 2H), 1.81-1.74 (m, 2H), 1.72-1.59 (m, 6H), 1.56-1.42 (m, 6H), 1.38-1.31 (m, 2H).

[0168] [Example 42] Preparation of 3-amino-4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-77)

[0169] [Step 42-1] Preparation of (E)-2-cyano-3-(4-methoxy-2-methylphenyl)-prop-2-enethioamide

[0123] 4-Methoxy-2-methylbenzaldehyde (1.5 g), 2-cyanoacetamide (1.0 g), and N-methylmorpholine (150 μL) were reacted and treated according to the method described in Step 1-1 of Example 1 to obtain the title compound (850 mg, yield 37%). １ HNMR (500MHz, CDCl ３ ) δ9.13 (s, 1H), 8.27 (d, J = 8.8Hz, 1H), 6.85 (d, J = 8.8Hz, 1H), 6.83 (s, 1H), 3.89 (s, 3H), 2.52 (s, 3H).

[0170] [Step 42-2] Preparation of 2-mercapto-4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (E)-2-cyano-3-(4-methoxy-2-methylphenyl)-prop-2-enethioamide (850 mg) obtained in Step 42-1, cyclopentanone (339 μL), and piperidine (240 μL) were reacted and treated according to the method described in Step 1-2 of Example 1 to obtain the title compound (225 mg, yield 21%). １HNMR (500MHz, DMSO-d6) δ7.10 (d, J = 8.3Hz, 1H), 6.94 (s, 1H), 6.80 (d, J = 8.3Hz, 1H), 3.7 9 (s, 3H), 3.01-2.94 (m, 2H), 2.43-2.29 (m, 2H), 2.11 (s, 3H), 2.03 (sept, J=7.4Hz, 2H).

[0171] [Step 42-3] Preparation of 3-amino-4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide Using 2-mercapto-4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[b]pyridine-3-carbonitrile (225 mg) obtained in Step 42-2, 2-chloroacetamide (115 mg), and potassium carbonate (276 mg), the title compound (149 mg, yield 55%) was obtained according to the method described in Step 1-3 of Example 1. １ HNMR (500MHz, DMSO-d6) δ7.14 (d, J = 8.6Hz, 1H), 7.09 (br.s, 2H), 7.00 (s, 1H), 6.93 (d, J = 8.3Hz, 1H), 5.64 (br.s, 2H), 3.81 (s, 3H), 3.06 (t, J=7.6Hz, 2H), 2.61-2.46 (m, 2H), 2.06 (sept, J=7.6Hz, 2H), 1.96 (s, 3H).

[0172] The compounds (including intermediates) of Examples 43 to 52 below can be produced by the methods and intermediates described below. <Scheme 4> (In Scheme 4, R is the above-mentioned R ３ (n is an integer from 1 to 5.)

[0173] [Example 43 (Intermediate Compound)] Preparation of 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (Compound Number: NUK-65)

[0174] 4-Chloro-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (160 mg) and 4-methoxyphenylboronic acid (240 mg) were dissolved in 1,4-dioxane (4.0 mL), and Ni(dppp)Cl ２ (8.8 mg) and tripotassium phosphate (680 mg) were added and stirred at 100°C for 18 hours under a nitrogen atmosphere. After the reaction, the reaction solution was diluted with water and extracted with ethyl acetate. The extract was washed successively with water and saturated brine and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate:hexane = 1:8) to obtain the title product (94 mg, yield 44%). １ HNMR (500MHz, CDCl ３ ) δ8.43 (d, J=4.9Hz, 1H), 7.34 (d, J=8.6Hz, 2H), 7.15 (d, J=4.9Hz, 1H), 7.00 (d, J=8.6Hz, 2H), 3.89 (s, 3H), 3.02 (t, J=6.9Hz, 2H), 2.48 (t, J=7.1Hz, 2H), 2.32 (sept, J=7.1Hz, 2H).

[0175] [Example 44 (Intermediate Compound)] Preparation of 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carbonitrile (Compound Number: NUK-66)

[0176] 4-(4-Methoxyphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (90 mg) was dissolved in dichloromethane (4.0 mL), m-CPBA (≦77%, 96 mg) was added, and the mixture was stirred at room temperature for 12 hours. After the reaction, the reaction solution was diluted with saturated aqueous sodium bicarbonate and extracted with dichloromethane. The extract was dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was dissolved in dichloromethane (5.0 mL), and benzoyl chloride (56 μL) was added. After stirring at room temperature for 20 minutes, cyanotrimethylsilane (60 μL) was added, and the mixture was further stirred at room temperature for 18 hours. After the reaction, the reaction solution was diluted with saturated aqueous sodium bicarbonate and extracted with dichloromethane. The extract was washed successively with water and saturated brine, and then dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (developing solvent: ethyl acetate:hexane=1:8) to obtain the title compound (20 mg, yield 20%). １ HNMR (500MHz, CDCl ３ ) δ7.52 (s, 1H), 7.31 (d, J = 7.8Hz, 2H), 7.02 (d, J = 8.6Hz, 2H), 3.90 (s, 3H) , 3.07 (t, J=7.1Hz, 2H), 2.51 (t, J=7.4Hz, 2H), 2.36 (sept, J=7.3Hz, 2H).

[0177] [Example 45] Preparation of 4-(4-methoxyphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-67)

[0178] 4-(4-Methoxyphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carbonitrile (20 mg), prepared in a similar manner to that in Example 44, and sodium carbonate perhydride (77 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (12 mg, yield 51%). １ HNMR (500MHz, CDCl ３) δ8.11 (s, 1H), 7.86 (br.s, 1H), 7.36 (d, J=8.6Hz, 2H), 7.00 (d, J=8.6Hz, 2H), 5.67 (br.s, 1H), 3.89 (s, 3H), 3.06 (t, J=6.9Hz, 2H), 2.52 (t, J=7.1Hz, 2H), 2.35 (sept, J=7.4Hz, 2H).

[0179] [Example 46] Preparation of 4-phenyl-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-68)

[0180] [Step 46-1] Preparation of 4-phenyl-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine 4-Chloro-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (150 mg), phenylboronic acid (163 mg), Ni(dppp)Cl ２ (8.8 mg) and tripotassium phosphate (600 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (80 mg, yield 48%). １ HNMR (500MHz, CDCl ３ ) δ8.27 (d, J = 4.6Hz, 1H), 7.29-7.27 (m, 3H), 7.22-7.19 (m, 2H), 6.98 (d, J = 4.7H) z, 1H), 2.83 (t, J=7.4Hz, 2H), 2.26 (t, J=7.1Hz, 2H), 2.13 (sept, J=7.3Hz, 2H).

[0181] [Step 46-2] Preparation of 4-phenyl-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-Phenyl-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (80 mg) obtained in Step 46-1 was dissolved in dichloromethane (3.0 mL), and m-CPBA (≦77%, 69 mg) was added. The mixture was stirred at room temperature for 12 hours. After the reaction, the reaction solution was diluted with saturated aqueous sodium bicarbonate and extracted with dichloromethane. The extract was dried over magnesium sulfate. The solvent was evaporated under reduced pressure, and the residue was dissolved in dichloromethane (3.0 mL), and benzoyl chloride (53 μL) was added. After stirring at room temperature for 20 minutes, cyanotrimethylsilane (58 μL) was added, and the mixture was further stirred at room temperature for 18 hours. After the reaction, the reaction mixture was diluted with saturated aqueous sodium bicarbonate and extracted with dichloromethane. The extract was washed with water and saturated brine, dried over magnesium sulfate, and used in the next reaction as a crude product (30 mg, crude yield: 47%).

[0182] [Step 46-3] Preparation of 4-phenyl-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-phenyl-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carbonitrile (30 mg) obtained in Step 46-2 and sodium carbonate perhydride (181 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (22 mg). １ HNMR (500MHz, CDCl ３ ) δ8.15 (s, 1H), 7.87 (br.s, 1H), 7.47-7.41 (m, 5H), 5.76 (br.s, 1H), 3.06 (t, J=6. 6Hz, 2H), 2.45 (t, J=6.6Hz, 2H), 2.45 (t, J=6.1Hz, 2H), 2.34 (sept, J=7.4Hz, 2H).

[0183] [Example 47] Preparation of 4-(4-fluorophenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-69)

[0184] [Step 47-1] Preparation of 4-(4-fluorophenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine 4-chloro-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (90 mg), 4-fluorophenylboronic acid (120 mg), Ni(dppp)Cl ２ (4.4 mg) and tripotassium phosphate (382 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (64 mg, yield 55%). １ HNMR (500MHz, CDCl ３ ) δ8.45 (d, J=4.9Hz, 1H), 7.37 (dd, J=5.4, 8.9Hz, 2H), 7.18 (t, J=8.6Hz, 2H), 7.15 (d, J=4.9Hz, 1H), 3.03 (t, J=6.9Hz, 2H), 2.42 (t, J=6.4Hz, 2H), 2.33 (sept, J=7.1Hz, 2H).

[0185] [Step 47-2] Preparation of 4-(4-fluorophenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-(4-Fluorophenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (86 mg) obtained in Step 47-1 and m-CPBA (≦77%, 96 mg) were reacted according to the method described in Step 46-2 of Example 46. Subsequently, benzoyl chloride (53 μL) and cyanotrimethylsilane (58 μL) were reacted according to the method described in Step 46-2 of Example 46, and the crude product (41 mg, crude yield 43%) was used in the next reaction.

[0186] [Step 47-3] Preparation of 4-(4-fluorophenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-(4-fluorophenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carbonitrile (41 mg) obtained in Step 47-2 and sodium carbonate perhydride (79 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (21 mg). １ HNMR (500MHz, CDCl ３ ) δ8.11 (s, 1H), 7.86 (br.s, 1H), 7.39 (dd, J=5.4, 8.8Hz, 2H), 7.17 (t, J=8.8Hz, 2H), 5. 78 (br, s, 1H), 3.07 (t, J=8.1Hz, 2H), 2.46 (t, J=7.3Hz, 2H), 2.36 (sept, J=7.1Hz, 2H).

[0187] [Example 48] Preparation of 4-phenyl-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-70)

[0188] [Step 48-1] Preparation of 4-phenyl-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine 4-Chloro-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (150 mg), phenylboronic acid (163 mg), Ni(dppp)Cl ２ (8.8 mg) and tripotassium phosphate (600 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (161 mg, yield 91%). １ HNMR (500MHz, CDCl ３ ) δ8.44 (d, J = 4.7Hz, 1H), 7.44-7.43 (m, 3H), 7.35-7.33 (m, 2H), 7.07 (d, J = 4.7Hz, 1H) , 2.88 (t, J=6.1Hz, 2H), 2.02 (t, J=6.4Hz, 2H), 1.84-1.83 (m, 2H), 1.62-1.59 (m, 2H).

[0189] [Step 48-2] Preparation of 4-phenyl-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-Phenyl-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (150 mg) obtained in Step 48-1 and m-CPBA (≦77%, 194 mg) were reacted according to the method described in Step 46-2 of Example 46. Subsequently, benzoyl chloride (130 μL) and cyanotrimethylsilane (140 μL) were reacted according to the method described in Step 46-2 of Example 46, and the crude product (95 mg, crude yield 58%) was used in the next reaction.

[0190] [Step 48-3] Preparation of 4-phenyl-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-phenyl-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile (95 mg) prepared in Step 48-2 and sodium carbonate perhydride (127 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (18 mg). １ HNMR (500MHz, CDCl ３ ) δ8.02 (s, 1H), 7.87 (br.s, 1H), 7.45-7.42 (m, 3H), 7.35-7.33 (m, 2H), 5.83 (br.s, 1H) ), 2.91 (t, J=6.4Hz, 2H), 2.06 (t, J=5.9Hz, 2H), 1.87-1.83 (m, 2H), 1.65-1.60 (m, 2H).

[0191] [Example 49] Preparation of 4-(4-fluorophenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-71)

[0192] [Step 49-1] Preparation of 4-(4-fluorophenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine 4-Chloro-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (150 mg), 4-fluorophenylboronic acid (186 mg), Ni(dppp)Cl ２ (8.8 mg) and tripotassium phosphate (600 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (183 mg, yield 96%). １ HNMR (500MHz, CDCl ３ ) δ8.42 (d, J = 4.7Hz, 1H), 7.31-7.28 (m, 2H), 7.14-7.10 (m, 2H), 7.03 (d, J = 4.9Hz, 1 H), 2.88-2.85 (m, 2H), 2.02 (t, J=6.1Hz, 2H), 1.84-1.82 (m, 2H), 1.63-1.61 (m, 2H).

[0193] [Step 49-2] Preparation of 4-(4-fluorophenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-(4-Fluorophenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (176 mg) obtained in Step 49-1 and m-CPBA (≦77%, 214 mg) were used in the reaction according to the method described in Step 46-2 of Example 46. Subsequently, benzoyl chloride (144 μL) and cyanotrimethylsilane (155 μL) were used in the reaction according to the method described in Step 46-2 of Example 46, and the crude product (62 mg, crude yield 33%) was used in the next reaction.

[0194] [Step 49-3] Preparation of 4-(4-fluorophenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-(4-fluorophenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile (62 mg) obtained in Step 49-2 and sodium carbonate perhydride (127 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (25 mg).１ HNMR (500MHz, CDCl ３ ) δ8.00 (s, 1H), 7.68 (br.s, 1H), 7.33-7.30 (m, 2H), 7.14 (t, J=8.5Hz, 2H), 5.92 (br.s, 1 H), 2.91 (t, J=6.1Hz, 2H), 2.06 (t, J=6.2Hz, 2H), 1.87-1.83 (m, 2H), 1.67-1.63 (m, 2H).

[0195] [Example 50] Preparation of 4-(4-methoxyphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-72)

[0196] [Step 50-1] Preparation of 4-(4-methoxyphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine 4-chloro-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (150 mg), 4-methoxyphenylboronic acid (202 mg), Ni(dppp)Cl ２ (8.8 mg) and tripotassium phosphate (600 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (197 mg, yield 99%). １ HNMR (500MHz, CDCl ３ ) δ8.42 (d, J=4.9Hz, 1H), 7.28-7.26 (m, 2H), 7.06 (d, J=4.7Hz, 1H), 6.99-6.97 (m, 2H). 3.90 (s, 3H), 2.89-2.87 (m, 2H), 2.09 (t, J=6.2Hz, 2H), 1.86-1.84 (m, 2H), 1.64-1.62 (m, 2H).

[0197] [Step 50-2] Preparation of 4-(4-methoxyphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-(4-Methoxyphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (183 mg) obtained in Step 50-1 and m-CPBA (≦77%, 214 mg) were used in the reaction according to the method described in Step 46-2 of Example 46. Subsequently, benzoyl chloride (144 μL) and cyanotrimethylsilane (155 μL) were used in the reaction according to the method described in Step 46-2 of Example 46, and the crude product (40 mg, crude yield 20%) was used in the next reaction.

[0198] [Step 50-3] Preparation of 4-(4-methoxyphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-(4-methoxyphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile (40 mg) obtained in Step 50-2 and sodium carbonate perhydride (98 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (19 mg). １ HNMR (500MHz, CDCl ３ ) δ8.00 (s, 1H), 7.86 (br.s, 1H), 7.26 (d, J=8.6Hz, 2H), 6.96 (d, J=8.6Hz, 2H), 5.80 (br.s, 1H), 3 .88 (s, 3H), 2.90 (t, J=5.4Hz, 2H), 2.11 (t, J=6.1Hz, 2H), 1.87-1.84 (m, 2H), 1.65-1.63 (m, 2H).

[0199] [Example 51] Preparation of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-73)

[0200] [Step 51-1] Preparation of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine 4-Chloro-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (150 mg), 4-methylphenylboronic acid (181 mg), Ni(dppp)Cl ２ (8.8 mg) and tripotassium phosphate (600 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (180 mg, yield 96%). １ HNMR (500MHz, CDCl ３ ) δ8.42 (d, J = 4.7Hz, 1H), 7.26-7.21 (m, 4H), 7.05 (d, J = 4.9Hz, 1H), 2.88 (t, J = 6.1 Hz, 2H), 2.45 (s, 3H), 2.06 (t, J=6.1Hz, 2H), 1.86-1.82 (m, 2H), 1.65-1.61 (m, 2H).

[0201] [Step 51-2] Preparation of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-(4-Methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine (165 mg) obtained in Step 51-1 and m-CPBA (≦77%, 203 mg) were used in the reaction according to the method described in Step 46-2 of Example 46. Subsequently, benzoyl chloride (137 μL) and cyanotrimethylsilane (148 μL) were used in the reaction according to the method described in Step 46-2 of Example 46, and the crude product (83 mg, crude yield 46%) was used in the next reaction.

[0202] [Step 51-3] Preparation of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile (83 mg) obtained in Step 51-2 and sodium carbonate perhydride (127 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title compound (14 mg).１ HNMR (500MHz, CDCl ３ ) δ8.01 (s, 1H), 7.86 (br.s, 1H), 7.27-7.21 (m, 4H), 5.80 (br.s, 1H), 2.91 (t, J=6.1 Hz, 2H), 2.45 (s, 3H), 2.09 (t, J=6.1Hz, 2H), 1.87-1.83 (m, 2H), 1.66-1.62 (m, 2H).

[0203] [Example 52] Preparation of 4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide (Compound Number: NUK-78)

[0204] [Step 52-1] Preparation of 4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine 4-Chloro-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (117 mg), 4-methoxy-2-methylphenylboronic acid (185 mg), Ni(dppp)Cl ２ (6.0 mg) and tripotassium phosphate (475 mg) were used in the reaction and treatment according to the method described in Example 43 to obtain the title compound (163 mg, yield 98%). １ HNMR (500MHz, CDCl ３ ) δ8.44 (d, J = 4.9Hz, 1H), 7.08-7.06 (m, 2H), 8.84 (s, 1H), 6.80 (dd, J = 2.5, 8.3Hz, 1H), 3.86 (s, 3H), 2.98 (t, J=5.7Hz, 2H), 2.29-2.24 (m, 2H), 2.21-2.18 (m, 2H), 2.04 (s, 3H).

[0205] [Step 52-2] Preparation of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile 4-(4-Methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine (160 mg) obtained in Step 52-1 and m-CPBA (≦77%, 162 mg) were used in the reaction according to the method described in Step 46-2 of Example 46. Subsequently, benzoyl chloride (125 μL) and cyanotrimethylsilane (135 μL) were used in the reaction according to the method described in Step 46-2 of Example 46, and the crude product (58 mg, crude yield 34%) was used in the next reaction.

[0206] [Step 52-3] Preparation of 4-(4-methoxy-2-methylphenyl)-6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-b]pyridine-2-carboxamide The crude product of 4-(4-methylphenyl)-5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-b]pyridine-2-carbonitrile (58 mg) obtained in Step 52-2 and sodium carbonate perhydride (143 mg) were reacted and treated according to the method described in Step 39-3 of Example 39 to obtain the title product (26 mg). １ HNMR (500MHz, CDCl ３ ) δ8.03 (s, 1H), 7.86 (br.s, 1H), 7.06 (d, J = 8.3Hz, 1H), 6.83 (s, 1H), 6.79 (d, J = 8.3Hz, 1H), 5.63 ( br.s, 1H), 3.87 (s, 3H), 3.03 (t, J=7.1Hz, 2H), 2.32-2.28 (m, 2H), 2.24-2.22 (m, 2H), 2.03 (s, 3H).

[0207] Example 53 Preparation of pH-dependently cleavable bisphosphonate prodrug: (E)-3-amino-4-(4-(1-(2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazinylidene)ethyl)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound Number: NUK-58)

[0208] The compound of Example 53 can be produced according to the following Scheme 5. <Scheme 5>

[0209] [Step 53-1] Preparation of (E)-3-amino-4-(4-(1-(2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazinylidene)ethyl)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (Compound 1 in Scheme 5 above) 4-(4-acetylphenyl)-3-amino-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (187 mg), prepared in the same manner as in Example 34, was dissolved in a mixed solution of methanol (1 mL) and acetic acid (1 mL), and 6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanehydrazine (120 mg) was added thereto, followed by stirring under reflux for 6 hours. After the reaction, the solvent was evaporated under reduced pressure, and the crude product (293 mg, crude yield 99%) was used in the next reaction. １ HNMR (500MHz, DMSO-d6) δ7.93 (d, J = 8.8Hz, 2H), 7.46 (d, J = 7.8Hz, 2H), 7.13 (br.s, 2H), 6.98 (s, 2H), 5.74 (br.s, 2H), 3.07 (t , J=7.9Hz, 2H), 2.71-2.63 (m, 4H), 2.35-2.32 (m, 2H), 2.29 (s, 3H), 2.08-2.03 (m, 2H), 1.64-1.41 (m, 4H), 1.28-1.24 (m, 2H).

[0210] [Step 53-2] Preparation of (E)-3-amino-4-(4-(1-(2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazinylidene)ethyl)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide To a solution of bisphosphonate compound 2 (53 mg) of Scheme 5 above in 50 mM aqueous ammonium carbonate solution (20 mL) was added dropwise a suspension of (E)-3-amino-4-(4-(1-(2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazinylidene)ethyl)phenyl)-6,7-dihydro-5H-cyclopenta[b]thieno[3,2-e]pyridine-2-carboxamide (112 mg) obtained in Step 53-1 in ethanol (20 mL), and the mixture was stirred at room temperature for 30 minutes. After the reaction, the ethanol was evaporated under reduced pressure and the mixture was lyophilized to obtain the title product (150 mg). １ H NMR (500 MHz, DMSO-d6) δ 7.94 (br.d, 2H), 7.45 (br.d, 2H), 7.13 (br.s, 2H), 5.74 (br.2H). HPLC analysis was performed using a Waters X-Bridge® C18 3.5 μm [4.6 × 150 mm] column and a precolumn X-Bridge® [3.9 × 5 mm]. (Chromatographic conditions: flow rate: 1.0 mL / min, mobile phase: methanol; injection volume: 5 μL; UV detector (245 nM); retention time t = 4.3 min.)

[0211] Reference example (NUK-55, NUK-56)

[0212] Reference example (NUK-59)

[0213] The bone formation promoting effect of the compounds of the present invention was evaluated as described in the following Test Examples 1 to 15. Here, the materials and methods used in these Test Examples will be explained.

[0214] 1. Cell Culture The pluripotent mesenchymal cell line C3H10T1 / 2 (mesenchymal stem cell line), human osteosarcoma cell line SaOS2 (osteoblast cell line), human chondrosarcoma SW1353, and OUMS27 (chondrocyte cell line) were cultured using Dulbecco's Modified Eagle's Medium-High glucose (DMEM) (Sigma). The mouse chondroprogenitor cell line ATDC5 was cultured using Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12 HAM (DMEM / F12 / HAM) (Sigma). Primary osteoblasts (dPOB) and primary osteoblast precursor cells (gPOB) were cultured using Minimum Essential Medium Eagle (Alpha) (αMEM) (Sigma). For reporter activity measurements, SaOS2 cells were cultured at 4 × 10 4 cells / cm 2 and other cells at a density of 1.5 × 10 4 cells / cm 2 For RT-qPCR, 10 × 10 4 cells / cm 2 The cells were seeded at a density of 100 μg / mL. Each culture was performed in a 48-well plate. DMEM and αMEM medium were prepared as a basal medium containing 10% fetal bovine serum (FBS), 100 units / mL penicillin G, and 100 μg / mL streptomycin. DMEM / F12 / HAM medium was prepared as a basal medium containing 5% fetal bovine serum (FBS), 10 μg / mL transferrin, 100 units / mL penicillin G, and 100 μg / mL streptomycin.

[0215] 2. Evaluation of Runx2 Enhancer Activation and Induction of Runx2 mRNA Expression 2-1. Reporter Activity Measurement A luciferase vector (pGL4.23) containing four tandemly linked 343-bp fragments (also referred to as "343-bp enhancers") located approximately 30 kb upstream of the P1 promoter, the distal promoter of the Runx2 genome (NPL 6), was introduced into cells, along with the internal control vector pRL-TK, using X-tremeGENE9 DNA Transfection Reagent (Roche). Alternatively, a pGL4.23 vector containing four tandemly linked 0.42-kb fragments (also referred to as "0.42-kb x 4 enhancers") located approximately 230 kb upstream of the P1 promoter was introduced into cells, along with pRL-TK, in the same manner (pGL4.23 vector was used as a control). The inventors have confirmed osteoblast-specific expression of EGFP in EGFP reporter transgenic mice using a 1.2 kb fragment containing the 0.42 kb core region (Reference Example 1). Construction of a vector containing the 0.42 kb × 4 enhancer is described in Reference Example 2 below. Twenty-four hours after vector introduction into cells, the medium was replaced with medium containing various concentrations of compounds and incubated for 8 to 72 hours. After incubation, the cells were washed twice with PBS and lysed by adding Passive Lysis Buffer. Activity was measured using the Dual-Luciferase Reporter Assay System (Promega) on an infinite F200 (TECAN).

[0216] 2-2. Measurement of Runx2 mRNA Expression Levels by RT-qPCR. The culture medium for cultured cells was replaced with medium containing various concentrations of compounds and incubated for 6 to 72 hours. After incubation, RNA was extracted from the cells using ISOGEN (Nippon Gene). 500 ng of RNA was subjected to RT-qPCR using a primer pair designed from the Runx2 base sequence (Forward: TCCACCACGCCGCTGTCT (SEQ ID NO: 1) and Reverse: TCAGTGAGGGATGAAATGCT (SEQ ID NO: 2)) with ReverTra Ace qPCR Master with gDNA Remover and THUNDERBIRD SYBR qPCR Mix (both from TOYOBO) to measure Runx2 mRNA levels.

[0217] 3. In Vitro Bone Formation Evaluation 3-1. Preparation of Primary Osteoblasts and Primary Osteoblast Progenitor Cells Primary osteoblasts (dPOB) were prepared by harvesting calvaria from embryonic day 18.5 C57BL / 6N mice, enzymatically treating them with 0.1% collagenase A / 0.2% dispase / PBS five times for 10 minutes at 37°C, and then filtering the fractions from the third to fifth enzymatic treatments through a 70 μm nylon mesh cell strainer. Primary osteoblast progenitor cells (gPOB) were prepared by harvesting calvaria from embryonic day 18.5 C57BL / 6N mice, mincing them with scissors, culturing them in a collagen gel three-dimensional culture medium using Cell Matrix (Nitta Gelatin) for 10–14 days, then enzymatically treating them with 0.2% collagenase / PBS for 30 minutes at 37°C, and filtering them through a 70 μm nylon mesh cell strainer.

[0218] 3-2. Alkaline phosphatase (ALP) staining and von Kossa staining dPOB or gPOB were placed in a 48-well plate at 10 × 10 4After overnight culture at a density of 1000 cells, the cells were transferred to αMEM medium (differentiation induction medium) containing 50 μg / mL ascorbic acid and 10 mM β-glycerophosphate and incubated with various concentrations of compounds for 2 to 9 days. To examine the effects on osteoblast differentiation, dPOB or gPOB were washed twice with PBS after incubation, fixed in 4% paraformaldehyde (PFA) for 5 minutes, and then stained for alkaline phosphatase (ALP) using 0.01% naphthol AS-MX phosphate salt, 0.06% Fast Blue RR salt, and 0.1M Tris-HCl (pH 8.5). To examine the effects on bone formation (calcification), dPOB were washed twice with PBS after incubation, fixed in 4% PFA for 5 minutes, and then stained with von Kossa staining using 5% silver nitrate solution.

[0219] 4. Evaluation of bone formation by animal administration 4-1. Animals and samples Ovariectomy was performed on 13-week-old C3H / HeN mice to obtain ovariectomized mice (OVX). Sham-operated mice (Sham) were used as controls. After compound administration, each test mouse was subcutaneously injected with 16 mg / kg of calcein 7 and 3 days before sample collection. Samples were collected from each mouse, including serum, femur, tibia, and lumbar vertebrae (L3-L5).

[0220] 4-2. Micro-CT analysis The collected bone samples were fixed in 70% (v / v) ethanol and photographed using a micro-CT system R mCT (Rigaku Corporation). The photographed data was analyzed using TRI / 3D-BON (Ratoc) software, and structural parameters of the cancellous and cortical bone diaphysis were calculated.

[0221] 4-3. Bone Histomorphometry. Collected bone samples were fixed in 70% (v / v) ethanol, dehydrated through graded ethanol, and then infiltrated and embedded in a mixture of methyl methacrylate and 2-hydroxyethyl methacrylate (Fujifilm Wako Pure Chemical Industries, Ltd.). Undecalcified, 4-μm-thick sections were used for bone histomorphometric analysis. Bone tissue specimens were observed under an optical microscope, and parameters were measured using a bone morphometry system, Histometry RT Camera (System Supply), including osteoblast surface area (Ob.S / B.Pm), osteoblast number (N.Ob / B.Pm), osteoid surface area (OS / BS), osteoid width (O.Th), osteoclast surface area (Oc.S / B.Pm), osteoclast number (N.Oc / B.Pm), erosion surface area (ES / BS), bone mineralization rate (MAR), bone mineralization surface area (MS / BS), and bone formation rate (BFR / BS).

[0222] 4-4. Histological analysis The collected bone samples were fixed in 4% PFA, decalcified in 10% EDTA, and embedded in paraffin. 4 μm tissue sections were prepared and stained with hematoxylin and eosin.

[0223] 4-5. Serum marker tests Serum levels of P1NP and TRAP5b were measured using the Rat / Mouse P1NP ELISA Kit and MouseTRAP (TRAcP 5b) ELISA (both Immunodiagnostic Systems).

[0224] Test Example 1: Evaluation of the Effect of Compound G-9 on Runx2 To evaluate the effect of compound G-9 in Example 1 on Runx2, reporter activity was measured for Runx2 enhancer activation, and mRNA expression levels were measured by RT-qPCR for Runx2 mRNA expression induction. Dimethyl sulfoxide (DMSO) was used as a negative control, bone morphogenetic protein BMP2 as a positive control, and phenamil was used as a comparison compound. All compounds were dissolved in DMSO at 10 mM. When adding compounds or BMP2, including the negative control (DMSO), DMSO was adjusted to a final concentration of 0.1%. For reporter activity measurements, a 0.34 kb x 4 enhancer-containing luciferase vector was introduced into osteoblasts (SaOS2), and the medium was replaced with medium adjusted to 10.0 μM compound G-9, 100 ng / mL BMP2, or 10.0 μM phenamil, and the cells were incubated for 24 hours. Separately, a 0.42 kb × 4 enhancer-containing luciferase vector was transfected into osteoblasts (SaOS2) under the same conditions as for the 0.34 kb × 4 enhancer-containing luciferase vector. To evaluate mRNA induction, mesenchymal stem cells (C3H10T1 / 2) were used, and the medium was replaced with 10.0 μM compound G-9, 100 ng / mL BMP2, or 10.0 μM phenamil, and incubated for 72 hours.

[0225] Figure 1 shows the results of reporter activity measurements using the 0.34 kb x 4 enhancer (A), Runx2 mRNA levels (B), and reporter activity measurements using the 0.34 kb x 4 enhancer and the 0.42 kb x 4 enhancer (C). (All results are expressed relative to the negative control (DMSO) as 1. In Figures 1(A) and 1(B), "a" represents the results for phenamil, and "b" represents the results for compound G-9. "*" indicates a significant difference compared to DMSO, and "#" indicates a significant difference compared to the control vector. Significance was determined by two-way analysis of variance (same below). One symbol indicates p<0.05, two symbols indicates p<0.01, and three symbols indicates p<0.001). These evaluations showed that the addition of G-9 significantly increased both reporter activity and Runx2 mRNA expression compared to DMSO (no compound added).

[0226] Furthermore, induction of mRNA expression in chondrocyte cell lines was evaluated. The culture medium for various chondrocytes was replaced with medium containing 10.0 μM compound G-9, and the expression levels of Runx2 mRNA were compared with and without the addition of compound G-9. For the negative control (DMSO), medium containing DMSO at a final concentration of 0.1% was used. The results are shown in Figure 2 ("G9" in Figure 2 represents the results for compound G-9). In chondrocyte cell lines, the addition of compound G-9 did not significantly increase the expression level of Runx2 mRNA.

[0227] Test Example 2: Evaluation of Compound G-9 in vitro for bone formation To evaluate the bone formation promoting effect of Compound G-9 in vitro, ALP staining and von Kossa staining were performed using primary osteoblasts (dPOB) in the presence of Compound G-9. For ALP staining, the medium in which dPOB were cultured was replaced with a differentiation-inducing medium containing 10.0 μM Compound G-9 or 100 ng / mL BMP2, and staining was performed after 3 days of culture. For von Kossa staining, the medium in which dPOB were cultured was replaced with a differentiation-inducing medium containing 10.0 μM Compound G-9 or 100 ng / mL BMP2, and staining was performed after 10 days of culture.

[0228] Figure 3 shows the results of ALP staining and von Kossa staining (in Figure 3, "G9" represents the results for compound G-9. "ALP" shows the results of ALP staining, and "Kossa" shows the results of von Kossa staining, and each row shows the results of tests carried out simultaneously under the same conditions). In the ALP staining, blue-purple staining was observed in the wells to which compound G-9 was added, indicating the induction of osteoblast differentiation. In the von Kossa staining, dark brown staining was observed in the wells to which compound G-9 was added, indicating calcification. Therefore, compound G-9 was found to have the effect of promoting osteoblast differentiation and bone formation.

[0229] Furthermore, to examine concentration dependence, compound G-9 (or 100 ng / mL BMP2) was added at 0, 0.1, 0.3, 0.6, 1.0, 3.0, 6.0, or 10.0 μM, and dPOB were cultured for 10 days, followed by ALP staining. The results are shown in Figure 4 (in Figure 4, "G9" represents the results for compound G-9, and each row represents the results of tests conducted simultaneously under the same conditions). Increased concentrations of compound G-9 promoted osteoblast differentiation.

[0230] Experimental Example 3: Animal Administration of Compound G-9 in Combination with Bisphosphonates In this experiment, the effect of compound G-9 in combination with bisphosphonates, which are used to treat osteoporosis, was investigated. OVX mice and sham mice were administered compound G-9 subcutaneously at 29.1 mg / kg BW (solvent: EtOH / Polysorbate 80 / citric acid) five times a week for five weeks, and bisphosphonate (BP) was administered intraperitoneally at 100 μg / kg BW two days a week. Both OVX mice and sham mice were divided into a group co-administered with compound G-9 and bisphosphonate and a group administered bisphosphonate only (no compound G-9) (10 mice each). Bone samples were collected after the administration period. Note that calcein was not administered before bone sample collection in this experiment. Micro-CT analysis and bone histomorphometry were performed to evaluate bone formation.

[0231] The results of the micro-CT analysis are shown in Figures 5 and 6. Figure 5 shows three-dimensional images of the distal metaphyseal long axis of femur samples from OVX mice treated with compound G-9 and bisphosphonate ("BP+G9") and bisphosphonate-only ("BP") groups, obtained by micro-CT imaging. Figure 6 shows graphs of the parameters of the trabecular bone (A) and cortical bone diaphysis (B) obtained by analyzing micro-CT data for femur samples from OVX mice and sham mice treated with compound G-9 and bisphosphonate ("BP+G9") and bisphosphonate-only ("BP") groups ("*" indicates a significant difference between BP+G9 and BP; *p<0.05, **p<0.01). This micro-CT analysis revealed that the OVX mice co-administered with compound G-9 and bisphosphonate had significantly increased cancellous bone mass, trabecular thickness, and bone mineral content, as well as significantly increased cortical bone thickness, compared to the OVX mice administered with bisphosphonate alone.

[0232] The results of bone histomorphometry are shown in Figure 7. Figure 7 graphically depicts the osteoblast (A) and osteoclast (B) parameters obtained by bone histomorphometry for femur samples from OVX mice treated with compound G-9 and bisphosphonate ("BP+G9") and those treated with bisphosphonate alone ("BP"). ("*" indicates a significant difference compared to BP; *p<0.05, **p<0.01). Bone histomorphometry revealed that osteoblast parameters were significantly increased in the compound G-9 and bisphosphonate co-administration group compared to the bisphosphonate alone administration group, but osteoclast parameters remained unchanged.

[0233] [Test Example 4] Animal Administration of Compound G-9 (without concomitant use of bisphosphonate) In this test example, the effect of administering Compound G-9 alone was investigated. Compound G-9 was subcutaneously administered at 29.1 mg / kg BW (solvent: EtOH / Polysorbate 80 / citric acid) to OVX mice and Sham mice, 5 times a week for 6 weeks. The animal administration test was conducted in the same manner as in Test Example 3, except that each group was divided into a Compound G-9 administration group and a Compound G-9 non-administration group (15 animals each).

[0234] The results of the micro-CT analysis are shown in Figure 8. Figure 8 shows graphs of the parameters of the trabecular bone (A) and cortical bone diaphysis (B) obtained by analyzing data acquired by micro-CT for femur samples from OVX mice and sham-treated mice treated with compound G-9 ("G9") and those not treated with compound G-9 ("vehicle"). ("*" indicates a significant difference between vehicle and G9; *p<0.05, **p<0.01). This micro-CT analysis revealed that, for trabecular bone, trabecular width was significantly increased in OVX mice treated with compound G-9, and bone mineral content was significantly increased in both mice. For cortical bone, cortical bone thickness was significantly increased in sham-treated mice treated with compound G-9.

[0235] The results of bone histomorphometry are shown in Figures 9 to 11. These figures graphically show the parameters of osteoblasts (Figure 9), osteoclasts (Figure 10), and bone formation (Figure 11) obtained by bone histomorphometry for lumbar vertebral body samples from OVX mice and Sham-treated mice in the compound G-9 administration group ("G9") and the compound G-9 non-administration group ("vehicle") ("*" indicates a significant difference compared to the vehicle in Sham-treated mice, "#" indicates a significant difference compared to G9 in Sham-treated mice, and "$" indicates a significant difference compared to the vehicle in OVX mice. Single symbols indicate p<0.05, and double symbols indicate p<0.01). Bone histomorphometry revealed that osteoblast parameters and bone mineralization rate were significantly increased in the OVX mice administered with compound G-9 compared to the OVX mice not administered with compound G-9, and that bone mineralization rate and bone formation rate were significantly increased in the sham mice administered with compound G-9 compared to the sham mice not administered with compound G-9, demonstrating promotion of bone formation.

[0236] Test Example 5: Evaluation of the effect of compounds on Runx2 Compounds G-9 (Example 1), R-3 (Example 2), R-10, NUK-44 (Example 23), NUK-46 (Example 25), NUK-67 (Example 45), NUK-76 (Example 41), and NUK-77 (Example 42) were tested. The structural formulas of these compounds are shown below.

[0237]

[0238] Compounds G-9, R-3, R-10, NUK-44, NUK-46, NUK-67, NUK-76, and NUK-77 were evaluated for their effect on Runx2 by measuring reporter activity using a 0.34 kb × 4 enhancer to assess Runx2 enhancer activation, and by measuring mRNA expression levels by RT-qPCR to assess Runx2 mRNA expression induction, as in Test Example 1. For reporter activity measurements, the culture medium was replaced with medium containing 10.0 μM of compound G-9, R-3, R-10, NUK-44, NUK-46, NUK-67, NUK-76, or NUK-77 during culture, and the cells were incubated for 24 hours. As a control, the medium was replaced with medium containing 100 ng / mL BMP2 or 100 ng / mL BMP2 + 5 μM phenamil. To evaluate induction of mRNA expression, osteoblasts (SaOS2) were used, and the medium was replaced with a medium containing 10.0 μM of compound G-9, R-3, R-10, NUK-44, NUK-46, NUK-67, NUK-76, or NUK-77, and the cells were incubated for 24 hours.

[0239] The results are shown in Figure 12 (reporter activity measurement) and Figure 13 (mRNA expression level measurement. A: G-9, R-3, and R-10; B: G-9, NUK-44, and NUK-46; C: G-9 and NUK-67; and D: G-9, NUK-76, and NUK-77). In Figures 12 and 13, "*" indicates a significant difference compared to DMSO (**p<0.01, ***p<0.001). These results show that all tested compounds exhibited Runx2 enhancer-enhancing activity and Runx2 expression-promoting effects in osteoblasts.

[0240] Test Example 6: Evaluation of the effect of compounds on Runx2 Compounds KYH-2-R2, KYH-2-R3, R-17, NUK-24 (Example 3), and NUK-25 (Example 4) were tested. The structural formulas of these compounds are shown below.

[0241]

[0242] Measurement of reporter activity and mRNA expression level using 0.34 kb × 4 enhancers was carried out in the same manner as in Test Example 5, except that the above compounds were used in addition to G-9, R-3, and R-10 (however, measurement of mRNA expression level was not carried out for KYH-2-R2).

[0243] The results are shown in Figure 14 (reporter activity measurements: A: G-9, KYH-2-R2, and KYH-2-R3; B: G-9, R-3, R-10, and R-17; C: G-9, NUK-24, and NUK-25) and Figure 15 (mRNA expression level measurements). In Figures 14 and 15, "*" indicates a significant difference compared to DMSO (*p<0.05, **p<0.01, ***p<0.001). These results show that all tested compounds exhibited Runx2 enhancer-enhancing activity and Runx2 expression-promoting effects in osteoblasts.

[0244] Test Example 7: Evaluation of in vitro bone formation by compounds Compounds G-9 (Example 1), R-3 (Example 2), NUK-24 (Example 3), NUK-44 (Example 23), NUK-46 (Example 25), R-10, R-17, KYH-2-R3, NUK-67 (Example 45), and NUK-76 (Example 41) were evaluated for their bone formation promoting effects, and the results are shown below. ALP staining was performed for this evaluation.

[0245] For compounds G-9, R-3, NUK-24, and NUK-46, the culture medium for primary osteoblasts (dPOB) was replaced with differentiation-inducing medium containing 10.0 μM of each compound, and staining was performed after two days of culture. For compounds G-9 and NUK-44, the culture medium for dPOB was replaced with differentiation-inducing medium containing 10.0 μM of each compound, and staining was performed after three days of culture. For compounds G-9, R-3, R-10, R-17, KYH-2-R3, NUK-67, and NUK-76, the culture medium for primary osteoblast precursor cells (gPOB) was replaced with differentiation-inducing medium containing 10.0 μM of each compound, and staining was performed after nine days of culture.

[0246] The results are shown in Figure 16 (A. dPOB culture for 2 days: G-9, R-3, NUK-24, and NUK-46, and dPOB culture for 3 days: G-9 and NUK-44. B. gPOB culture for 9 days: G-9, R-3, R-10, R-17, KYH-2-R3, NUK-67, and NUK-76). In Figure 16, each row shows the results of tests conducted simultaneously under the same conditions. Osteoblast differentiation induction was observed for all tested compounds.

[0247] Test Example 8: Evaluation of the effect of compounds on Runx2 The compounds NUK-30 (Example 9), NUK-31 (Example 10), NUK-35 (Example 14), NUK-38 (Example 17), NUK-40 (Example 19), NUK-41 (Example 20), NUK-42 (Example 21), and NUK-43 (Example 22) were tested. The structural formulas of these compounds are shown below.

[0248]

[0249] NUK-30, NUK-31, NUK-35 and NUK-38 each have a seven-membered ring like G-9, and NUK-40, NUK-41, NUK-42 and NUK-43 each have a five-membered ring like R-3.

[0250] Measurement of reporter activity and mRNA expression level using 0.34 kb × 4 enhancers was carried out in the same manner as in Test Example 5, except that NUK-30, NUK-31, NUK-35, NUK-38, NUK-40, NUK-41, NUK-42, and NUK-43 were used as compounds in addition to G-9.

[0251] The results are shown in Figure 17 (reporter activity measurement) and Figure 18 (mRNA expression level measurement). In Figures 17 and 18, "*" indicates a significant difference compared to DMSO (**p<0.01, ***p<0.001). As a result, all tested compounds were found to have Runx2 enhancer-enhancing activity and Runx2 expression-promoting effects in osteoblasts.

[0252] Test Example 9: Evaluation of in vitro bone formation by compounds The bone formation promoting effects of compounds NUK-30 (Example 9), NUK-31 (Example 10), NUK-35 (Example 14), NUK-38 (Example 17), NUK-40 (Example 19), NUK-41 (Example 20), and NUK-42 (Example 21) were evaluated and the results are shown below. Osteoblast differentiation was evaluated by ALP staining, and bone mineralization was evaluated by von Kossa staining.

[0253] For ALP staining, the culture medium for gPOB was replaced with differentiation-inducing medium containing 10.0 μM of each compound, and staining was performed after 7 days of culture. von Kossa staining was performed for NUK-30, NUK-35, NUK-38, NUK-40, and NUK-42. For dPOB, the culture medium was replaced with differentiation-inducing medium containing 10.0 μM of each compound, and staining was performed after 11 days of culture. ALP staining and von Kossa staining were also performed for compounds G-9 and R-3.

[0254] The results are shown in Figure 19 (ALP staining and von Kossa staining). As a result, induction of osteoblast differentiation was observed for all tested compounds. Calcification was also observed.

[0255] Test Example 10: Evaluation of the effect of compounds on Runx2 The compound NUK-34 (Example 13) was tested. The structural formula of this compound is shown below.

[0256]

[0257] Measurement of reporter activity and measurement of mRNA expression level using 0.34 kb × 4 enhancers were performed in the same manner as in Test Example 5, except that the above compound was used in addition to G-9 as a compound, and the reaction for measuring mRNA expression level was carried out for 6 hours, 12 hours, and 24 hours.

[0258] The results are shown in Figure 20 (reporter activity measurement) and Figure 21 (mRNA expression level measurement). In Figures 20 and 21, "*" indicates a significant difference compared to DMSO (*p<0.05, **p<0.01, ***p<0.001). These results indicate that this compound also exhibited Runx2 enhancer-enhancing activity and Runx2 expression-promoting effects in osteoblasts.

[0259] Test Example 11: Evaluation of the effect of compounds on Runx2 Compounds NUK-52 (Example 31) and NUK-54 (Example 33) were tested. The structural formulas of these compounds are shown below.

[0260]

[0261] Measurement of reporter activity using 0.34 kb × 4 enhancers was carried out in the same manner as in Test Example 5, except that the above compound was used in addition to G-9.

[0262] The results are shown in Figure 22 (reporter activity measurement). In Figure 22, "*" indicates a significant difference compared to DMSO (**p<0.01, ***p<0.001). As a result, these compounds also showed Runx2 enhancer-enhancing activity in osteoblasts.

[0263] Test Example 12: Evaluation of the effect of compounds on Runx2 Compounds NUK-61 (Example 35), NUK-62 (Example 36), NUK-63 (Example 37), and NUK-64 (Example 38) were tested. The structural formulas of these compounds are shown below.

[0264]

[0265] Measurement of reporter activity and mRNA expression level using 0.34 kb × 4 enhancers was carried out in the same manner as in Test Example 5, except that the above compound was used in addition to G-9 as the compound.

[0266] The results are shown in Figure 23 (reporter activity measurement) and Figure 24 (mRNA expression level measurement). In Figures 23 and 24, "*" indicates a significant difference compared to DMSO (*p<0.05, **p<0.01, ***p<0.001). These results showed that these compounds also had the effect of enhancing the Runx2 enhancer and promoting Runx2 expression in osteoblasts.

[0267] Test Example 13: Evaluation of the effect of compounds on Runx2 Compounds NUK-57 (Example 34), NUK-55 (Reference Example), and NUK-56 (Reference Example) were tested. The structural formulas of these compounds are shown below.

[0268]

[0269] Measurement of reporter activity and mRNA expression level using 0.34 kb × 4 enhancers was carried out in the same manner as in Test Example 5, except that NUK-55, NUK-56, and NUK-57 were used as compounds in addition to G-9.

[0270] Figure 25 is a graph showing the results of reporter activity measurements for compounds G-9, NUK-55, NUK-56, and NUK-57. Figure 26 is a graph showing the Runx2 mRNA expression levels for compounds G-9, NUK-55, NUK-56, and NUK-57. In Figure 26, "*" indicates a significant difference compared to DMSO (***p<0.001). The results of reporter activity measurements and mRNA expression induction evaluation showed that compounds G-9 and NUK-57 activated the Runx2 enhancer in osteoblasts (SaOS2) and induced Runx2 mRNA expression.

[0271] Test Example 14: Animal Administration of a Bone-Localizing Bisphosphonate-Conjugated Compound. OVX mice and Sham mice were subcutaneously administered a bone-localizing bisphosphonate-conjugated compound (NUK-58; Example 53; hereafter also referred to as "conjugated compound") or bisphosphonate at a dose of 19.4 μmol / kg (solvent: 0.96% DMSO / PBS) twice weekly for 11 weeks. Each group was divided into a conjugated compound group, a bisphosphonate group, and a control group (treated with vehicle only) (15 mice per group). NUK-58 was prepared as a prodrug of NUK-57 (Example 34). Similar to G-9, NUK-57 demonstrated Runx2 enhancer activation and Runx2 mRNA expression induction in osteoblasts (SaOS2) in Test Example 13. Therefore, this compound was used as a G-9-like compound to prepare a conjugate with bisphosphonate, which was designated "BP-G9." In this test example, micro-CT analysis, histological analysis, and serum marker tests were performed.

[0272] Figure 27 shows three-dimensional images created from multi-sectional images obtained by micro-CT of femur samples from OVX mice and Sham-ham mice in the conjugated compound-administered group ("BP-G9"), bisphosphonate-administered group ("BP"), and control group ("Vehicle"). For each group, the left side shows the results for Sham-ham mice, and the right side shows the results for OVX mice. The top row shows three-dimensional images of the distal metaphyseal cross section, and the bottom row shows three-dimensional images of the distal metaphyseal long axis section. These images demonstrate that administration of a bone-translocating bisphosphonate-conjugated compound increased cancellous bone mass in Sham-ham mice compared to the bisphosphonate-administered group.

[0273] 28 shows cross-sectional images (two-dimensional images) of femur samples from the OVX and Sham-treated mice in the conjugated compound-administered group ("BP-G9"), the bisphosphonate-administered group ("BP"), and the control group ("Vehicle"), taken by micro-CT. The results show that the Sham-treated mice had an increased cancellous bone mass in the conjugated compound-administered group compared to the bisphosphonate-administered group.

[0274] 29 and 30 are graphs showing the parameters of the distal cancellous bone region (FIG. 29) and the diaphyseal cortical bone region (FIG. 30), obtained by analyzing micro-CT data for femoral samples from OVX mice and Sham-treated mice in the conjugated compound (BP-G9), bisphosphonate (BP), and control (Vehicle) groups. ("*" indicates a significant difference compared to vehicle, and "#" indicates a significant difference compared to BP. One symbol indicates p<0.05, two symbols indicates p<0.01, and three symbols indicates p<0.001.) The results showed that the cancellous bone mass, trabecular width, trabecular number, and bone mineral content were significantly increased, and the trabecular space was significantly decreased, in both OVX and Sham-treated mice compared to the control group, demonstrating an increase in both bone mass and bone mineral density. Furthermore, in the group administered with the conjugated compound, the cancellous bone mass and bone mineral content of the cortical bone of the Sham mice were significantly increased compared to the group administered with the bisphosphonate, and the trabecular width and number of trabeculae in the cancellous bone tended to increase, while the trabecular space tended to decrease.

[0275] 31 shows micrographs showing the results of histological analysis of hematoxylin-eosin stained sagittal sections of the distal end of tibia samples from each of the sham-treated mouse groups ("BP-G9"), bisphosphonate-treated group ("BP"), and control group ("Vehicle"). The bottom row shows a 10x magnification of the black-framed area in the top row. Because a significant difference in cancellous bone volume was observed in the sham-treated group compared to the bisphosphonate-treated group, further histological analysis was performed on the sham-treated group. This demonstrates that administration of a bone-translocating bisphosphonate-conjugated compound increases normal cancellous bone.

[0276] 32 shows the results of measuring the bone resorption marker TRAP5b in the serum of OVX mice treated with a bisphosphonate ("BP") and a control ("vehicle") (10 mice per group), as well as the results of measuring the bone formation marker P1NP in the serum of OVX mice and sham mice treated with a conjugated compound ("BP-G9"), a bisphosphonate ("BP"), and a control ("vehicle") (15 mice per group). In FIG. 32, "*" indicates a significant difference compared to vehicle for TRAP5b, a significant difference compared to vehicle for P1NP, a significant difference between BP and BP-G9, a significant difference between BP and BP-G9, and a significant difference between vehicle and BP (single symbol: p<0.05, double symbol: p<0.01, triple symbol: p<0.001). In the bisphosphonate-treated group, both the bone resorption marker TRAP5b and the bone formation marker P1NP were significantly reduced compared to the control group ("vehicle"), supporting the inhibitory effects of bisphosphonates on bone resorption and bone formation. In the conjugated compound-treated groups, bone formation markers were significantly higher than in the bisphosphonate-treated group in both OVX and Sham mice, demonstrating that administration of a bone-translocating bisphosphonate-conjugated compound does not suppress bone formation.

[0277] Test Example 15: Animal Administration of Bone-Derived Bisphosphonate-Conjugated Compounds Similar to Test Example 14, OVX mice were administered the conjugated compound (NUK-58: Example 53), and then serum levels of the bone resorption marker TRAP5b were measured. In this test, a conjugated compound-treated group and a control group (administered only solvent) (9 animals each) were used. Figure 33 shows the results of TRAP5b measurement in this test, along with the results of the bisphosphonate-administered group (BP) in Test Example 14 for reference. Specifically, Figure 33 is a graph showing the results of measuring the serum bone resorption marker TRAP5b in the OVX mouse conjugated compound-administered group ("BP-G9"), the bisphosphonate-administered group ("BP"), and the control group ("vehicle"). The graph shows the results of the conjugated compound-administered group ("BP-G9", N=9) in this test example and the results of the bisphosphonate-administered group ("BP", N=10) in Test Example 14 shown for reference, relative to the value of the control group ("Vehicle") in each test. In Figure 33, "*" indicates a significant difference from vehicle (***p<0.001). As a result, bone resorption marker TRAP5b was significantly reduced in the conjugated compound-administered group ("BP-G9") compared to the control group ("vehicle"), demonstrating that the conjugated compound has the effect of suppressing bone resorption. Furthermore, the group administered with the conjugated compound (BP-G9) showed a relatively higher inhibitory effect on bone resorption than the group administered with the bisphosphonate (BP). Therefore, it was revealed that the bone-translocating bisphosphonate conjugated compound not only exhibits superior bone formation promoting effects compared to conventional bisphosphonate preparations in osteoporosis model mice (OVX mice), but also has bone resorption inhibitory effects.

[0278] [Reference Test Example 1] Induction of osteoblast-specific expression by a 1.2 kb fragment containing the 0.42 kb fragment as its core region. EGFP reporter mice were generated using a 1.2 kb fragment containing the 0.42 kb core region located approximately 230 kb upstream from the P1 promoter, and it was confirmed that EGFP was expressed in osteoblast-specific manner in the resulting mice.

[0279] (1.2 kb enhancer reporter mouse vector, generation of EGFP reporter transgenic mice) A 1.2 kb enhancer fragment was generated by PCR using mouse genomic DNA as a template and a primer pair (Forward: ctccaccgcggtggcggccgcGAAAACCATGCACATCGAGC (SEQ ID NO: 3) and Reverse: agctcggtacccggggatccTACTTTATCCCCAGTACACC (SEQ ID NO: 4)) containing restriction enzyme sites. This was then cloned into pBluescript 1600 with the mHsp68 minimal promoter and enhanced GFP (EGFP). The primer sequences were subcloned into vector II. The uppercase letters in the primer sequences indicate mouse genomic sequences, and the lowercase letters indicate restriction enzyme addition sequences and vector sequences. The region containing the 1.2 kb enhancer, mHsp68 minimal promoter, and EGFP was linearized using restriction enzymes. After agarose gel electrophoresis, the fragment DNA was extracted and purified from the gel and used as the injection fragment. This injection fragment was injected into fertilized eggs of B6C3F1 mice to generate EGFP reporter transgenic mice. Transgenic mice were identified by confirming the presence or absence of GFP signals in the bone and cartilage regions of the fetus using a fluorescence microscope.

[0280] (Frozen sections) Embryonic day 16.5 fetuses were fixed in 4% paraformaldehyde for 2 hours, washed in PBS for 1 hour, and shaken overnight in 20% sucrose solution. All procedures were performed at 4°C. Embryonic days 16.5 fetuses were embedded in a 2:1 mixture of OCT compound (Sakura Finetek, Japan) and 20% sucrose. 7-μm-thick frozen sections were prepared using a Leica CM3050S microscope, and GFP signals were observed using a Keyence BZ-X710 all-in-one fluorescence microscope.

[0281] (Results) Photographs of whole embryos and frozen sections of EGFP reporter transgenic mice into which the 1.2 kb fragment had been introduced are shown in Figure 34. In the EGFP reporter transgenic mice into which the 1.2 kb fragment had been introduced, green fluorescence was observed only in osteoblasts, confirming osteoblast-specific expression.

[0282] [Reference Test Example 2] Preparation of 0.42 kb x 4 enhancer reporter vector Using the 1.2 kb enhancer reporter mouse vector as a template, a 0.42 kb fragment of the en9 core region was prepared by PCR using a primer pair (Forward: cgatgacaagcttgcggccgcggatccATATGTAATTGAAAGAAAAT (SEQ ID NO: 5) and Reverse: atcagatctatcgatgaattcTGGCGACAGTGATGCGCATC (SEQ ID NO: 6)) containing restriction enzyme sites. This fragment was then inserted into the p3xFLAG-CMV vector (Sigma-Aldrich, The 0.42 kb fragment was subcloned into the NotI and EcoRI sites of the restriction enzymes (Berkeley, USA) to create 0.42 kb x 1-p3 x FLAG-CMV. At this time, a BamHI site was added downstream of the NotI site to the 0.42 kb fragment using PCR primers. In the primer sequence, capital letters indicate the mouse genome sequence, and lowercase letters indicate the restriction enzyme addition sequence and vector sequence. 0.42 kb x 1-p3 x FLAG-CMV was subcloned into the BglII and KpnI sites of the 0.42 kb x 1-p3 x FLAG-CMV. The BamHI-KpnI region containing 0.42 kb x 1 of LAG-CMV was subcloned to create 0.42 kb x 2-p3 x FLAG-CMV. Similarly, the BamHI-KpnI region containing 0.42 kb x 2 of 0.42 kb x 2-p3 x FLAG-CMV was subcloned into the BglII and KpnI sites of 0.42 kb x 2-p3 x FLAG-CMV to create 0.42 kb x 4-p3 x FLAG-CMV. pBluescript The 0.42 kb × 4 fragment was subcloned into the NotI and EcoRI sites of pBluescript II to create 0.42 kb × 4-pBluescript II. The 0.42 kb × 4 fragment of 0.42 kb × 4-pBluescript II was subcloned into the SacI and XhoI sites of the luciferase vector pGL4.23 (Promega, USA) to create the 0.42 kb × 4 enhancer reporter vector.

[0283] The present invention is not limited to the above-described embodiments and examples, and various modifications are possible within the scope of the claims. The technical scope of the present invention also includes embodiments obtained by appropriately combining the technical means disclosed in different embodiments. Furthermore, all academic literature and patent documents described in this specification are incorporated herein by reference.

Claims

1. A composition for promoting bone formation, comprising a compound represented by the following general formula (I) or a salt thereof, or a prodrug thereof: In the formula, A is any of the following tricyclic structures containing a 5- to 9-membered ring B which is a cycloalkyl ring optionally substituted with R, or a heterocycloalkyl ring having 1 to 3 heteroatoms selected from the group consisting of a nitrogen atom, a silicon atom, an oxygen atom, and a sulfur atom: X is NR ５ R ６ group, a hydroxyl group, or an O—C １－６ an alkyl group, Y is a sulfur atom, a nitrogen atom, or an oxygen atom, R １ represents an amino group, an aryl, a heteroaryl, a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C １－６ Haloalkyl group, C １－６ a haloalkoxy group, a carboxyl group, a nitro group, a cyano group, a hydroxyl group, a CONR′ group, or a CO ２ R' group (wherein R' is a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ haloalkyl group, or amino group), R ２ represents an amino group, a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C ３－６ Cycloalkyl group, C １－６ Haloalkyl group, C １－６ haloalkoxy, nitro, cyano, or hydroxyl group; R ３ represents an amino group, an aryl, a heteroaryl, a hydrogen atom, a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C １－６ Haloalkyl group, C １－６ a haloalkoxy group, a carboxyl group, a nitro group, a cyano group, a hydroxyl group, a CONR′ group, or a CO ２ R' group (R' is the same as above), and the aryl is selected from the group consisting of a halogen atom, C １－６ Alkyl group, C １－６ Alkoxy group, C １－６ Haloalkyl group, C １－６ Haloalkoxy group, hydroxyl group, acetyl group, C １－６ Alkoxy C １－６ Alkoxy group, biotin-added C １－６ Alkoxyamino group, biotin-added C １－６ R may be substituted with one or more substituents independently selected from the group consisting of an alkoxy group, a biotinylated ester group, a biotinylated amide group, and an amino group; ４ represents a hydrogen atom, a halogen atom, or C １－６ Alkyl group, C １－６ a haloalkyl group or an amino group, R ５ represents a hydrogen atom, a halogen atom, or C １－６ Alkyl group, or C １－６ is a haloalkyl group, R ６ represents a hydrogen atom, a halogen atom, or C １－６ Alkyl group, or C １－６ is a haloalkyl group, and R ５ and R ６ may form a 4- to 8-membered ring together with a part of ring A and the carboxyl group, and R is a hydrogen atom, a halogen atom, C １－６ Alkyl group, or C １－６ It is a haloalkyl group.

2. The composition of claim 1, wherein A is the following structure:

3. The composition of claim 1, wherein A is any of the following structures:

4. R １ and R ３ each independently represents an aryl or heteroaryl optionally substituted with one or more substituents according to claim 1, a CONR′ group, or CO ２ The composition of claim 1 wherein R' is a group.

5. The composition of claim 4, wherein the aryl is a phenyl group and the heteroaryl is a pyridyl group, a furanyl group, a thiophenyl group, a pyrrole group, a naphthyl group, or a quinoline group.

6. R ２ is an amino group, or R ３ The composition of claim 1 , wherein is a phenyl group optionally substituted with one or more substituents.

7. R ５ and R ６ The composition according to claim 1 , wherein each of 8. X is NR ５ R ６ 2. The composition of claim 1, wherein Y is a group and Y is a nitrogen atom.

9. The composition of claim 1, wherein the prodrug is a bisphosphonate-type compound.

10. A pharmaceutical composition for preventing or treating a disease or condition accompanied by bone defects, osteogenesis imperfecta, osteogenesis disorder, and / or excessive bone resorption, comprising the composition according to any one of claims 1 to 9.

11. The pharmaceutical composition of claim 10, wherein the disease or condition is selected from the group consisting of osteopenia, bone loss, osteoporosis, osteogenesis imperfecta, fibrous dysplasia, hypophosphatasia, osteomalacia, rickets, bone deformity, decreased bone strength, bone mineralization disorders, skeletal diseases accompanied by bone loss, osteolytic bone lesions, fractures, nonunions of fractures, delayed fracture healing, bone defects, alveolar bone defects, and alveolar bone resorption.

12. An osteoblast-specific enhancer activator comprising the compound represented by general formula (I) according to claim 1, or a salt thereof, or a prodrug thereof.

13. A compound represented by the following general formula (II), a salt thereof, or a prodrug thereof: (B ring, R ３ , R ４ , R ５ , R ６ , and R are defined as in claim 1).

14. A compound represented by the following formula, a salt thereof, or a prodrug thereof:

15. A composition for promoting bone formation, comprising the compound according to claim 13 or 14, or a salt thereof, or a prodrug thereof.

16. An osteoblast-specific enhancer activator comprising the compound according to claim 13 or 14, or a salt thereof, or a prodrug thereof.

Images