NAAO-related invention

Regulating NAAO levels through compositions and enzymes addresses the inadequate treatment of IBD by providing anti-inflammatory and tissue-protective effects, leveraging altered intestinal microbiota to manage IBD symptoms.

WO2026004856A1PCT designated stage Publication Date: 2026-01-02KEIO UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/022714
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-25
Filing Date
2025-06-24
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Current treatments for inflammatory bowel disease (IBD) such as Crohn's disease and ulcerative colitis are inadequate, and the underlying cause remains unknown, with alterations in intestinal microbiota composition, particularly a decrease in N-acyloxyacylornithine (NAAO) levels, contributing to the disease progression.

Method used

Regulating NAAO levels through compositions containing NAAO, NAAO-producing enzymes, or NAAO-synthesizing organisms to maintain intestinal homeostasis and provide anti-inflammatory and tissue-protective effects.

Benefits of technology

NAAO and its synthesizing enzymes demonstrate anti-inflammatory and tissue-protective roles, effectively reducing the severity of colitis and maintaining intestinal health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-T000001
    Figure JPOXMLDOC01-APPB-T000001
  • Figure JPOXMLDOC01-APPB-T000002
    Figure JPOXMLDOC01-APPB-T000002
  • Figure JPOXMLDOC01-APPB-T000003
    Figure JPOXMLDOC01-APPB-T000003
Patent Text Reader

Abstract

The present disclosure relates to a factor pertaining to autoimmune diseases such as inflammatory bowel disease (IBD) (e.g., ulcerative colitis (UC)). The present disclosure provides a composition for adjusting an immune state or for preventing or treating autoimmune / inflammatory diseases, the composition including a means for altering or maintaining N-acyloxyacyl ornithine (NAAO) to / at an appropriate level. The present disclosure also provides: a method for preventing or treating inflammatory diseases, disorders, or disease symptoms, the method comprising activating MRGPRX4, Mrgprb5, or an ortholog thereof; a related medicine; a medical device; and the like.
Need to check novelty before this filing date? Find Prior Art

Description

NAAO-related inventions

[0001] The present disclosure relates to NAAO-related compounds, agents, related enzymes, related organisms, and applications thereof.

[0002] Inflammatory bowel disease (hereinafter also abbreviated as "IBD") is a chronic disease that includes Crohn's disease (hereinafter also abbreviated as "CD") and ulcerative colitis (hereinafter also abbreviated as "UC"), and is characterized by abdominal pain, chronic diarrhea, and bloody stools, with repeated relapses and remissions. The number of IBD patients worldwide is estimated to be over 3.5 million, and has been increasing in recent years. The cause of IBD is still unknown, but it has been suggested that genetic and environmental factors play an important role in its development. No groundbreaking medication has been provided.

[0003] There are reports on analyses of mouse colitis (Non-Patent Document 1 (Lima SF et al., Gastroenterology. 2022 Jan;162(1):166-178.)) and on lipids (Non-Patent Document 2 (Zhang Q et al., Nat Microbiol. 2023 Mar;8(3):424-440.)).

[0004] Lima SF et al., Gastroenterology. 2022 Jan;162(1):166-178.Zhang Q et al., Nat Microbiol. 2023 Mar;8(3):424-440.

[0005] The present disclosure relates to factors related to autoimmune diseases such as inflammatory bowel disease (IBD) (e.g., ulcerative colitis (UC)). In particular, the present disclosure describes that changes in the composition of the intestinal microbiota, i.e., dysbiosis, are frequently observed in patients with autoimmune diseases such as inflammatory bowel disease (IBD). In the present disclosure, fecal untargeted lipidomics was performed on ulcerative colitis (UC) patients, and it was found that the lipid composition was altered compared to healthy individuals, and that NAA-related compounds such as N-acyloxyacylornithine (NAAO) were significantly reduced in the feces of UC patients. It was also identified that the intestinal bacterial strains that produce NAA-related compounds such as NAAO were altered in UC patients, and related enzymes were also identified. It is understood that enzymes and microorganisms expressing these enzymes may be effective in the treatment and prevention of autoimmune diseases such as inflammatory bowel disease (IBD).

[0006] The present disclosure provides the following: (Item 1) A composition, pharmaceutical, medical device, or regenerative medicine product for regulating the health condition of a subject, regulating the immune status, or preventing or treating an autoimmune or inflammatory disease, comprising a means for altering or maintaining N-acyloxyacylornithine (NAAO) at an appropriate level. (Item 2) The composition, pharmaceutical, medical device, or regenerative medicine product described above, wherein the means comprises at least one selected from the group consisting of: (a) NAAO, (b) an agent containing NAAO, (c) a precursor of NAAO, (d) an enzyme capable of synthesizing NAAO, (e) a cell or organism capable of synthesizing NAAO, and (f) a combination of (c) and (d) and / or (e). (Item 2A) The means includes: (a) a factor capable of regulating NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (b) an agent containing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (c) a precursor of a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (d) an enzyme capable of synthesizing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (e) a cell or organism capable of synthesizing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; and (f) a combination of (c) and (d) and / or (e). (Item 3) The composition, pharmaceutical, medical device, or regenerative medicine product according to any one of the above items, which comprises at least one selected from the group consisting of medicines, feed, foods (functional foods), food additives, supplements, and probiotics. (Item 3-1) The composition, pharmaceutical, medical device, or regenerative medicine product according to any one of the above items, wherein the composition comprises a probiotic (and its nutrient / substrate), an enzyme preparation (and its substrate), a compound preparation, or a combination thereof. (Item 4) A method for regulating the health condition of a subject, which comprises altering or maintaining NAAO at an appropriate level.(Item 4-1) The method according to any one of the above items, wherein the regulation of the health condition includes anti-inflammatory and tissue protective effects. (Item 4-2) The method according to any one of the above items, wherein the regulation of the health condition comprises administering to the subject an effective amount of the composition according to any one of the above items or a component thereof. (Item 5) The method according to any one of the above items for the prevention or treatment of autoimmune / inflammatory diseases (e.g., ulcerative colitis, etc.). (Item 5-1) The fatty acid group in the NAAO is C. 14 H 29 , C 15 H 31 , and C 16 H 33 and C 17 H 35 (Item 5-2) The composition, pharmaceutical, medical device, regenerative medicine product, or method according to any one of the above items, wherein the fatty acid group in the NAAO comprises one having a total carbon number of 28 to 34. (Item 5-3) The fatty acid group in the NAAO comprises one having a total carbon number of 28 to 34. 14 H 29 and C 16 H 33 (Item 5-4) The composition, pharmaceutical, medical device, or regenerative medicine product or method according to any one of the above items, comprising at least one selected from the group consisting of: 15 H 31 and C 17 H 35(Item 6) The composition, pharmaceutical, medical device, regenerative medicine product, or method according to any one of the above items, comprising at least one selected from the group consisting of: (1) a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof; (2) a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof; (3) a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof; (4) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof; (5) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6; (6) a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof; (7) a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof; (8) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof; (9) a cell comprising a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof; (9A) a cell comprising a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5; (10) an enzyme preparation comprising a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof; (10A) an enzyme preparation comprising a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6. (Item 10Z) The composition, pharmaceutical, medical device, or regenerative medicine product or method according to any one of the preceding items, wherein the enzyme capable of synthesizing NAAO is a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof and / or a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof. (Item 11) A method for preventing or treating an inflammatory disease, disorder, or symptom, comprising activating MRGPRX4 or Mrgprb5, or an orthologue thereof. (Item 12) A method for selecting a pharmaceutical for preventing or treating an inflammatory disease, disorder, or symptom, comprising selecting a candidate compound capable of modulating the activity of MRGPRX4 or Mrgprb5, or an orthologue thereof. (Item 13) A composition, pharmaceutical, medical device, or regenerative medicine product for preventing or treating an inflammatory disease, disorder, or symptom, comprising an activator of MRGPRX4 or Mrgprb5, or an orthologue thereof. (Item 14) A composition, pharmaceutical, medical device, or regenerative medicine product for gene therapy to prevent or treat inflammatory diseases, disorders, or symptoms, comprising a nucleic acid molecule containing a nucleic acid sequence encoding MRGPRX4 or Mrgprb5, or an orthologue thereof.(Item 15) The method, composition, pharmaceutical, medical device, or regenerative medicine product according to any one of the preceding items, wherein the MRGPRX4 or Mrgprb5, or an orthologue thereof, is encoded by the nucleic acid sequence set forth in SEQ ID NO: 25 or SEQ ID NO: 27, or a variant thereof, or comprises the amino acid sequence set forth in SEQ ID NO: 26 or SEQ ID NO: 28, or a variant thereof. (Item 16) The method, composition, pharmaceutical, medical device, or regenerative medicine product according to any one of the preceding items, wherein the method, composition, pharmaceutical, medical device, or regenerative medicine product is intended for humans.

[0007] It is contemplated that the present disclosure may provide one or more of the above-described features in combinations other than those explicitly stated. Still further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary.

[0008] In this disclosure, based on the changes in the composition of the intestinal microbiota, i.e., dysbiosis, frequently observed in patients with inflammatory bowel disease (IBD), fecal untargeted lipidomics was performed on ulcerative colitis (UC) patients, and it was found that the lipid composition was altered compared to healthy individuals. In particular, N-acyloxyacylornithine (NAAO) levels were significantly decreased in the feces of UC patients. Therefore, when a human-representative enterobacterial strain was cultured in vitro, it was identified that NAAO-producing bacteria were altered in UC patients. The product of Odosp_2289 was identified as the NAAO-producing enzyme of O. spanchnicus. In vivo administration of NAAO isolated from A. splanchnicus and monocolonization with E. coli expressing Odosp_2289 in gnotobiotic mice suppressed the severity of dextran sulfate sodium (DSS)-induced colitis. These results indicate that NAAO and NAAO-synthesizing enzymes have anti-inflammatory and tissue-protective roles in intestinal homeostasis.

[0009] Furthermore, screening of a panel of G protein-coupled receptors (GPCRs) demonstrated that NAAO functions as an agonist of MRGPRX4 and Mrgprb5. In particular, the anti-inflammatory activity of NAAO was abolished in Mrgprb5-deficient mice, indicating that microbiota-derived NAAO exerts anti-inflammatory and tissue-protective effects in maintaining intestinal homeostasis via Mrgprb5. Mrgprb5 or its corresponding human receptors may mediate anti-inflammatory and tissue-protective effects in maintaining intestinal homeostasis and contribute to the prevention or treatment of related diseases.

[0010] The present disclosure provides new treatment techniques for autoimmune diseases.

[0011] Figure 1 shows microbiome profiling in UC patients. (A) Shannon index of healthy volunteers (HV, n=5) or UC (n=19) is shown. Data are presented in box plots. (B) Principal coordinate analysis (PCoA) of microbial composition in clinical samples is shown. PCoA was calculated based on the Bray-Curtis distance at the mOTU genus level. Statistical significance was calculated using PERMANOVA. (C) Microbiota composition (genus level) is shown. Heatmap shows mean z-score. Statistical significance was calculated using the Mann-Whitney U test. *p<0.05, **p<0.01. Figure 2 shows lipidome profiling in UC patients. (A) Principal component analysis of fecal lipidome. (B) Volcano plot of fecal lipids (subclass level) in healthy volunteers and UC patients. Lipids significantly increased by more than two-fold or significantly decreased by less than half-fold in UC patients compared to healthy controls are shown in orange and blue, respectively. (C-D) Structures of NAAO and Cer-EBDS. (E-F) Quantities of NAAO and Cer-EBDS species detected in human stool samples. (G-K) Abundances of NAAO and Cer-EBDS detected in metabolomic data from the iHMP cohort. Accurate mass searches for all lipids shown in E and F revealed only a single peak in the iHMP dataset (acceptance limit <0.001 Da). Data are presented as mean ± SEM (E-F) or SD (G-K). Statistical analysis was performed using the Mann-Whitney U test (E-F) or one-way ANOVA post hoc Tukey's multiple comparison test (G-K). iHMP dataset: non-IBD n=134 (27 subjects), UC n=146 (29 subjects), CD n=266 (50 subjects). *p<0.05, **p<0.01, ****p<0.0001. Figure 3 shows the identification of UC-associated lipid-producing bacteria. (A) NAAO synthesis pathway reported in environmental bacteria. (B) Results of local blastp analysis against human representative bacteria. Bacteria are shown in a phylogenetic tree based on 16S rRNA sequence homology. White box: low homology, black box: high homology. (C) NAAO productivity of enteric bacteria (n=3).(D) MS / MS spectra of NAAO 17:0; O(FA 15:0) detected in Alistipes, Odoribacter, and Akkermansia. (E-G) Relative abundance of Odoribacter (E), Akkermansia (F), and Alistipes (G) in human fecal metagenomic data. Numbers in parentheses indicate the number of detected species. Statistical analysis was performed using one-way ANOVA with post hoc Tukey's multiple comparison test (C) or Mann-Whitney U test (E and G). ns is not significant, *p<0.05, ****p<0.0001. Figure 4 shows the identification of the NAAO-producing enzyme in O. splanchnicus. (A) Confirmation of protein expression by CBB staining. The band corresponding to His-tagged Odosp_2289 (69.6 kDa) is indicated by an asterisk. (B-C) Lipidomics of recombinant E. coli. Quantitative analysis of NAO (B) and NAAO (C). (D) MS / MS spectra of NAAO 16:0; O(FA 14:0) from Odosp_2289-expressing E. coli (top, black) and O. splanchnicus (bottom, red). (E-F) Normalized read counts of Odosp_2289-homologous sequences per 5 million reads. Two genes with 60% or greater identity to the query coverage were detected in Odosp_2289. UC108 was corrected for less than 5 million reads. (G) Schematic protein sequence of Odosp_2289 and alignment of Odosp_2289 (WT) (SEQ ID NO: 31) with HSM7J4NU_k119_6275_6 (N16D mutant) (SEQ ID NO: 32). (H) Confirmation of protein expression of empty, WT Odosp_2289, and the N16D mutant by CBB staining. (I-J) Lipidomics of recombinant E. coli. The amounts of NAO (I) and NAAO (J) increase with expression of WT and N16D. Statistical analysis was performed using the Mann-Whitney U test (B, C, F) or one-way ANOVA followed by Tukey's multiple comparison test (I-J). Results are shown in bar graphs as mean ± SEM. ***p<0.001, ****p<0.0001. Figure 5 shows that NAAO administration suppresses the onset of colitis. (A) Experimental design of DSS challenge (DSS-free group: n=5, DSS group: n=18). (B-H) Phenotypic observation.Body weight change (B), colon length (C) (DSS-free group: n = 5, DSS group: n = 18), and gene expression levels of Lipocalin-2, Ki67, Occludin, Zo-1, and Zo-2 in the control / DSS group with or without NAAO (DSS-free group: n = 4, DSS group: n = 14) (D–H). (I) H&E staining of colon tissue. The scale bar indicates 200 μm. Results are shown as mean ± SEM. For statistical analysis, a parametric test was applied to data showing p > 0.05 by Bartlett's test, and a nonparametric test was applied to data showing p < 0.05. Specifically, two-way ANOVA with post hoc Tukey's multiple comparison test (B), one-way ANOVA with post hoc Tukey's multiple comparison test (C, E-H), or Krusukal-Walis test with post hoc Dunn's multiple comparison test (D). *p<0.05, **p<0.01, ***p<0.001, ***p<0.0001. Figure 6 shows MS / MS spectra of NAAO. (A) NAAO 17:0_15:0 [M+H]+ and (B) Cer-EBDS 17:0:2O / 17:0; (3OH)(FA 15:0) [M+CH3COO]-. Figure 7 shows the NAAO signal in the feces of antibiotic-administered mice. We reanalyzed previously reported fecal lipidomics data from antibiotic-treated mice (Yasuda, S. et al. Elucidation of Gut Microbiota-Associated Lipids Using LC-MS / MS and 16S rRNA Sequence Analyses. iScience 23, 101841 (2020)). Statistical analysis was performed using the Mann-Whitney U test. Results are shown as mean ± SEM. **p<0.01. Figure 8 shows the correlation analysis between UC-associated lipids and bacterial abundance. (A) Correlation between Odoribacter abundance and NAAO abundance. (B) Correlation between Odosp_2289 homologous sequence abundance and NAAO abundance. Spearman's rank correlation coefficient and p-value calculated using the python scipy.stats.spearmanr module are displayed graphically. Figure 9 shows the correlation analysis between O. (A) Representative TLC image after development.(B-D) Lipids contained in the two ninhydrin-positive spots were extracted and analyzed using LC-qTOF / MS. Extraction ion chromatography of the major components, NAAO 17:0;O (FA 15:0) (B), PE 15:0_15:0 (C), and NAAGS 17:0;O (FA 15:0) (D), was performed. Figure 10 shows that NAAO is a novel ligand for MRGPRX4 and Mrgprb5. A) Results of GPCR ligand screening. Results are shown as mean values ​​(n = 3) with ranges. (B) Concentration-response curves for MRGPRX4 (n = 6) and Mrgprb5 (n = 4). Results are shown as mean values ​​± SEM. Figure 11 shows that NAAO did not exhibit anti-inflammatory effects in MrgB5-deficient mice. (A) Experimental design of the DSS colitis model (WT vehicle: n = 10, WT NAAO: n = 9, KO vehicle: n = 8, KO NAAO: n = 7). (B-F) Phenotypic observations. Body weight variation (B), colon length (C) (WT vehicle: n = 10, WT NAAO: n = 9, KO vehicle: n = 8, KO NAAO: n = 7), H&E staining of colonic tissue (D), and histological score (E) (WT vehicle: n = 10, WT NAAO: n = 9, KO vehicle: n = 8, KO NAAO: n = 6). One mouse in the KO NAAO group was excluded from histological analysis due to prolonged mortality. Scale bar = 200 μm. Gene expression levels of lipocalin-2 (F). Results are shown as mean ± SEM. Statistical analysis was performed using one-way ANOVA with post-hoc Tukey's multiple comparison test (C, E, F). Figure 12 shows dose-response curves of known MRGPRX4 ligands. (A) Structures of the ligands tested in this study. The partial structure of MS47134 was conserved in NAAO. (B) TGFα release assay of MRGPRX4 ligands. Results are shown as mean ± SEM. Figure 13 shows expression profiling of MrgB5. (A) MrgB5 mRNA expression levels in representative mouse tissues. (B) Mrgprb5-deficient mouse design. (C) Representative results of genotyping. (D) MrgB5 mRNA expression levels in whole colon tissues. (E) Reanalysis of the transcriptome atlas of enteric neurons. Results are shown as mean ± SEM. *p<0.05, **p<0.01.

[0012] Throughout this specification, singular expressions should be understood to include the plural concept unless otherwise specified. Thus, singular articles (e.g., "a," "an," "the," etc. in English) should be understood to include the plural concept unless otherwise specified. Furthermore, it should be understood that terms used in this specification are used in the sense commonly used in the art unless otherwise specified. Therefore, unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will control.

[0013] (Definitions) We first explain the terms and general techniques used in this disclosure.

[0014] As used herein, "NAAO" is an abbreviation for N-acyloxyacylornithine, and includes any type of NAAO. Specific examples of NAAO include the following: The fatty acid group in NAAO is C 14 H 29 , C 15 H 31 , and C 16 H 33 and C 17 H 35 and / or the fatty acid group in the NAAO has a total carbon number of 28 to 34, ... 14 H 29 and C 16 H 33 and / or the fatty acid group in the NAAO comprises at least one selected from the group consisting of C 15 H 31 and C 17 H 35More specifically, the following types may be included, and the unsaturated double bond may be included. Specifically, NAAO 29:1; 2O | NAAO 14:0; O (FA 15:0); NAAO 30:1; 2O | NAAO 15:0; O (FA 15:0); NAAO 30:1; 2O | NAAO 16:0; 31:1;2O|NAAO 16:0;O(FA 15:0);NAAO 32:1;2O|NAAO 17:0;O(FA 15:0);NAAO 32:2;2O|NAAO 17:1;O(FA 15:0);NAAO 33:1;2O|NAAO 17:0;O (FA 16:0);NAAO 33:2;2O|NAAO 18:1;0(FA 15:0);NAAO 34:1;20|NAAO 17:0;0(FA 17:0);NAAO 35:2;20|NAAO 17:0;0(FA 18:1), etc.

[0015] As used herein, the term "appropriate level (of NAAO, etc.)" refers to the level typically observed in the intestine of a healthy individual. Specifically, an appropriate level of NAAO in a mouse may be 118 to 208 pmol / mg, and the corresponding value in a human.

[0016] As used herein, the term "means for changing or maintaining (NAAO, etc.) at an appropriate level" refers to any means capable of changing the level typically observed in the intestine of a healthy individual to an appropriate level. In the case of NAAO, examples include NAAO itself, agents containing NAAO (e.g., compounds that become NAAO compounds when introduced into the body, such as NAAO containing protecting groups, and complexes and compositions containing NAAO), precursors of NAAO (e.g., enzyme substrates), enzymes capable of synthesizing NAAO, cells or organisms (including microorganisms and bacteria) capable of synthesizing NAAO, and combinations thereof (e.g., combinations of precursors and enzymes, combinations of precursors and cells or organisms, etc.). In the case of Cer-EBDS, examples of such substances include Cer-EBDS itself, agents containing Cer-EBDS (for example, compounds that become Cer-EBDS compounds when introduced into the body, such as Cer-EBDS containing a protecting group, and complexes and compositions containing Cer-EBDS), precursors of Cer-EBDS (for example, enzyme substrates), enzymes capable of synthesizing CER-EBDS, cells or organisms (including microorganisms and bacteria) capable of synthesizing Cer-EBDS, and combinations of these (for example, combinations of a precursor and an enzyme, or combinations of a precursor and a cell or organism, etc.).

[0017] As used herein, an "agent containing NAAO," also referred to as an "NAAO agent," refers to any substance, composition, or complex, other than the NAAO compound itself, that generates (is converted into) NAAO upon entry into the body. Examples include, but are not limited to, NAAO protected with a protecting group, a complex or composition containing NAAO, and the like.

[0018] As used herein, the term "NAAO precursor" refers to any substance that generates NAAO through the external action of an enzyme or the like, and includes, but is not limited to, substrates of enzymes that produce NAAO (e.g., ornithine, N-acyl ornithine (NAO), etc.).

[0019] As used herein, the term "enzyme capable of synthesizing NAAO" refers to any enzyme or group of enzymes that indirectly or directly produce NAAO through its action. Examples include a complex of OlsB (which converts ornithine to NAO) and OlsA, which are Odosp_2289 products, OlsA (an enzyme that converts NAO to NAAO), OlsF (an enzyme that converts ornithine to NAAO via NAO), Odosp_2289 (Protein id: WP_013612478.1 Gene id: 69855319), a polypeptide encoded by a nucleic acid molecule containing the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof (e.g., a functional variant), or a polypeptide containing the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof (e.g., a functional variant).

[0020] As used herein, the term "enzyme" is broadly understood as a general term for polymeric compounds, primarily proteins, that catalyze any reaction and mediate or promote chemical changes in the body without themselves changing or decomposing. A substance that reacts with an enzyme is called a "substrate," and in this specification, "substrate" is understood in the broadest sense. Each enzyme has a specific substrate and a specific type of substance that it converts into, which is called enzyme specificity. This disclosure can utilize such specificity. Furthermore, in this specification, the term "enzyme species" may refer to the origin of such an enzyme. As used herein, "substrate specificity" means that, in the cleavage of a substrate catalyzed by an enzyme, the enzyme does not catalyze the cleavage of substances other than the substrate, or the degree of catalysis is sufficiently weak.

[0021] As used herein, "cells or organisms capable of synthesizing NAAO" refers to any cell (individual cells of multicellular organisms such as animals and plants, or individual cells of microorganisms (particularly unicellular organisms)) or organism (including microorganisms, fungi, etc.) that produces NAAO as a result of biological activity. Such cells include cells or organisms that naturally have the ability to produce NAAO, as well as cells or organisms that have been modified by introducing exogenous factors through genetic engineering or by genetic modification (NGT = new gene technology (including genome editing, etc.)) in which endogenous factors acquire the ability to produce NAAO. The term "cell" includes individual cells, cells from a biological sample, or cell cultures. A cell includes the progeny of a single cell, and although the progeny may not necessarily be completely identical (in morphology or genomic sequence) to the original parent cell due to natural, accidental, or intentional mutations and / or changes, it is understood that the progeny are within the same scope as the cell in this disclosure as long as they have the ability to produce the NAAO of interest in this disclosure.

[0022] As used herein, the terms "endogenous" or "endogenous" are used to mean that the referenced (host) organism, in its unmodified form, functionally expresses the referenced gene or the protein (typically an enzyme) encoded thereby to the extent that it can carry out a dominant biochemical reaction within the (host) cell.

[0023] As used herein, the terms "foreign" or "exogenous" refer to the introduction of a gene or nucleic acid sequence according to the present disclosure into a host when the host microorganism does not have the gene to be introduced according to the present disclosure, does not substantially express the enzyme from that gene, or encodes the amino acid sequence of the enzyme from that gene or a different gene but does not express comparable endogenous enzyme activity after genetic modification. The term "foreign" is used interchangeably with the term "exogenous." A recombinant microorganism is a genetically modified microorganism in which an exogenous enzyme gene has been introduced into a host microorganism. A "genetically modified microorganism" is also simply referred to as a "recombinant microorganism" or a "modified microorganism." The present disclosure provides cells or organisms having a pathway for producing NAAO and / or Cer-EBDS.

[0024] In this specification, the host microorganism into which the foreign gene of interest is introduced is not particularly limited and may be either a prokaryote or a eukaryote. It can be arbitrarily selected from those that have already been isolated and preserved, those that have been newly isolated from nature, and those that have been genetically modified. Host microorganisms include, for example, Escherichia sp., Bacillus sp., Corynebacterium sp., Arthrobacter sp., Brev. Genus Ibacterium, Genus Clostridium, Genus Zymomonas, Genus Pseudomonas, Genus Burkholderia, Strept omyces, Rhodococcus, Synechocystis, Alkalihalobacillus, Saccharomyces Schizosaccharomyces, Yarrowia, Candida, Pichia, or Aspergillus. The host microorganism preferably belongs to the genus Escherichia, and more preferably is Escherichia coli.

[0025] As used herein, with respect to a compound, "having a production pathway" means that the genetically modified microorganism, etc. disclosed herein expresses sufficient amounts of enzymes for each reaction step in the production pathway of the compound to proceed and is capable of biosynthesizing the compound. The recombinant microorganism disclosed herein may be one that uses a host microorganism that originally has the ability to produce the compound, or may be one that has been modified to have the ability to produce the compound from a host microorganism that does not originally have the ability to produce the compound. Regarding the production pathway, the following are possible when NAAO is the target.

[0026] Conversion of ornithine to the intermediate NAO may involve enzymes such as OlsB and OlsF. Specifically, OlsB is the enzyme that transfers a fatty acid or hydroxylated fatty acid to the 2-amino group of ornithine to synthesize the intermediate NAO, and OlsB derived from Sinorhizobium meliloti can be used (Gao JL et al., Mol Microbiol. 2004Sep; 53(6): 1757-70.). OlsF is also known as a single enzyme that performs two reactions: producing NAO using ornithine as a substrate and then transferring a fatty acid to the hydroxylated fatty acid contained in NAO. This enzyme can be derived from Serratia proteamaculans (Vences-Guzman MA et al., Environ Microbiol. 2015 May; 17(5): 1487-96).

[0027] Examples of enzymes that can convert NAO to NAAO include OlsA and OlsF. Specifically, OlsA is an example of an enzyme that uses intermediate NAO as a substrate to produce NAAO through a fatty acid transfer reaction. This enzyme can be derived from Sinorhizobium meliloti (Weissenmaier B et al., Mol Microbiol. 2002 Aug; 45(3): 721-33). Furthermore, as mentioned above, OlsF is known as an enzyme that synthesizes NAAO by transferring a fatty acid from ornithine as a substrate in two steps (Vences-Guzman MA et al., Environ Microbiol. 2015 May; 17(5): 1487-96).

[0028] As used herein, "MRGPRX4" refers to Mas-related G protein-coupled receptor member X4 present in humans, a gene corresponding to NCBI Gene ID: 117196. The gene is located on the short arm of human chromosome 11 (11p15.1) and encodes a protein consisting of 322 amino acids described in UniProt ID: Q96LA9. MRGPRX4 belongs to the G protein-coupled receptor (GPCR) superfamily and is a typical seven-transmembrane class A rhodopsin-like GPCR. This receptor belongs to the MrgprX subfamily, which is specifically conserved in primates, and until the analysis of the present disclosure was provided, the existence of orthologs in rodents such as mice and rats was unknown. In mice, the MrgprB group is partially functionally similar, but from the perspective of sequence and evolutionary lineage, MRGPRX4 is considered an orphan receptor that evolved independently in primates. However, the analysis of this disclosure indicates that, in terms of reactivity with NAAO, there is a similar receptor, Mrgprb5, which may be an ortholog. MRGPRX4 is expressed in small-diameter C-fiber neurons in the sensory nervous system, particularly in the dorsal root ganglion (DRG), and is involved in pruriceptor receptors. These neurons are known to co-express the histamine H1 receptor (HRH1) and belong to a group of neurons mediating histamine-independent itch. Recent studies have revealed that MRGPRX4 is activated by endogenous ligands such as bile acids, particularly deoxycholic acid (DCA) and chenodeoxycholic acid (CDCA). Ligand binding activates the Gq / 11 G protein-mediated phospholipase C (PLC) pathway, which increases intracellular calcium concentration via IP3. This signaling pathway is directly linked to the expression of pruritus, and MRGPRX4 is thought to be the primary molecular target for nonhistamine-induced skin pruritus caused by cholestasis. Furthermore, drugs such as nateglinide act as MRGPRX4 agonists and have been shown to be involved in the mechanism of drug-induced pruritus. It has been reported that activation of MRGPRX4 induces pruritus that cannot be suppressed by antihistamines, and its effect is clinically clear.Furthermore, it is known that the expression and function of MRGPRX4 on the cell surface are regulated by interaction with RAMP2 (receptor activity-modifying protein 2), and RAMP2 binding results in a decrease in receptor surface expression level and signal intensity. As used herein, "MRGPRX4" includes not only the gene and its encoded product, but also variants such as mutants with 85% or more homology in amino acid sequence, domain deletions, conserved region substitutions, and tag fusion proteins. Also included are cDNAs, mRNAs, and artificially synthesized oligonucleotides encoding the protein, as well as delivery means such as expression vectors, expression cell lines, viral vectors, and nanoparticles incorporating them. Furthermore, agonists such as bile acids and nateglinide, or factors that function as inhibitors or regulatory molecules of MRGPRX4, are also components related to MRGPRX4 in a broad sense. In addition, cell-based assay systems for measuring or screening the activity of MRGPRX4 and disease model animals such as transgenic mice into which human MRGPRX4 has been introduced are also considered to be included in the technical configurations related to the receptor. As described above, "MRGPRX4" is defined as a human-specific GPCR involved in the onset of non-histamine itch, and is a concept that includes all of the gene, protein, its variants, ligands, regulatory factors, and related application means.

[0029] As used herein, "regulators," "factors capable of regulating expression or activity," or "activators" of "MRGPRX4" or "Mrgprb5" refer to endogenous or exogenous molecules that control the expression levels or activity of these receptors, and include at least the following compounds or physiologically active substances in addition to NAAO or its analogs. Specifically, MS47134 is a synthetic compound with a fatty acid derivative-like structure that has been reported to selectively bind to MRGPRX4 and directly stimulate the receptor through activation of calcium signals, thus functioning as a direct activator of MRGPRX4. Furthermore, deoxycholic acid (DCA) is an endogenous metabolite produced by intestinal bacteria from primary bile acids. It has been shown to induce receptor activity through interaction with MRGPRX4, and DCA is also considered an endogenous activator. Furthermore, N-acyloxyacylornithine (NAAO), a component derived from intestinal bacteria, is a fatty acid-modified amino acid produced by certain Bacteroidota bacteria (e.g., Odoribacteraceae family), and has been observed to bind to MRGPRX4. This suggests that NAAO may also function as a novel activator of MRGPRX4. These substances may also induce similar G protein-coupled receptor activation in Mrgprb5. In particular, Mrgprb5 in rodents is thought to be a functional homolog of human MRGPRX4, and therefore may similarly act as a modulator or activator. As described above, the modulators or activators of MRGPRX4 or Mrgprb5 described herein are useful as components of compositions, pharmaceuticals, or therapeutic devices aimed at controlling neural responses, immunomodulation, and inflammatory responses mediated by these receptors.

[0030] As used herein, "Mrgprb5" or "MrgB5" are used interchangeably and refer to the Mas-related G protein-coupled receptor family B member 5 (Mrgprb5) gene, which is located on mouse chromosome 7 and is a gene belonging to the G protein-coupled receptor (GPCR) family that is expressed primarily in the peripheral nervous system, particularly in dorsal root ganglion (DRG) neurons, and is specifically present in mice (Mus musculus), and corresponds to NCBI Gene ID: 404239. This gene is located on mouse chromosome 7 and belongs to the G protein-coupled receptor (GPCR) family that is expressed primarily in the peripheral nervous system, particularly in dorsal root ganglion (DRG) neurons. Mrgprb5 has been reported to be involved in signal transduction related to pain, itch, temperature sensation, etc., primarily in sensory neurons, and its expression pattern and function constitute part of the Mrgpr family, a group of receptors specialized for sensory reception. In particular, Mrgprb5 has been suggested to potentially alter neuronal responsiveness and regulate thresholds to specific endogenous peptides or exogenous stimuli. As used herein, "Mrgprb5" also encompasses the amino acid sequence corresponding to this gene (e.g., UniProt ID: Q8CIM3) and mutants having amino acid sequences highly homologous thereto (e.g., 85% or more), preferably 90% or more, and more preferably 95% or more, recombinant receptors expressed by transgenic introduction, humanized variants, and artificial analogs produced by molecular design. Also included are mutants, splice variants, and fusion proteins that retain the receptor's ligand binding ability and intracellular signal activation function. It is known that there is no direct human orthologue of Mrgprb5, which is due to the fact that this gene is a receptor that has evolved specifically in rodents.However, since functionally similar GPCRs exist in humans, such as MRGPRX1 to MRGPRX4, it is possible to estimate function or evaluate alternative activity through comparative analysis with these, and in the present disclosure, MRGPRX4 has been identified as a leading candidate in terms of its ligand binding activity with NAAO, etc. Furthermore, regulators of Mrgprb5 expression include transcription factors such as Runx1, Isl1, Brn3a, and NeuroD1, which are involved in sensory neuron differentiation, and methods such as regulating the activity of these factors or CRISPRa / CRISPRi, siRNA, and shRNA that act on the Mrgprb5 gene promoter region can also be included as means for regulating "Mrgprb5" in the present disclosure. In addition, compounds, peptides, and small molecule compounds mimicking them that have been identified as activators (agonists) or inhibitors (antagonists) of Mrgprb5 are also described as "factors acting on Mrgprb5," and may be used in applications such as neural response control, pain relief, and inflammatory response regulation, targeting Mrgprb5. Finally, expression vectors, delivery systems (viral vectors, nanoparticles, etc.), and expression cell lines containing the Mrgprb5 gene or its products, as well as screening systems, drug efficacy evaluation systems, and disease model construction systems that utilize these, are also encompassed as "technical configurations related to Mrgprb5." Thus, "Mrgprb5" refers to a GPCR belonging to the Mrgpr family involved in sensory reception in mice. While it does not have a direct ortholog corresponding to humans, it is used herein as a broad concept that includes its structural and functional characteristics, similar constructs, regulatory means, responsive factors, and the like.

[0031] Therefore, the recombinant microorganism according to the present disclosure, into which an exogenous gene has been introduced, is, for example, a host microorganism of the genus Escherichia, Bacillus, Corynebacterium, Arthrobacter, Brevibacterium, Clostridium, Zymomonas, Pseudomonas, Burkholderia, or the like. The recombinant microorganism according to the present disclosure preferably belongs to the genus Escherichia, and more preferably is Escherichia coli.

[0032] As used herein, the term "combination" refers to any entity consisting of two or more of various entities (e.g., compounds, precursors, agents, enzymes, cells, organisms, etc.). Examples include a combination of a precursor and an enzyme, or a combination of a precursor and a cell or organism. The combination may constitute a single composition, or may be a kit divided into separate compartments, or may be provided separately in a form that is combined when used.

[0033] As used herein, "modulating immune status" refers to modulating the status of immunity (the defense system against factors other than the self, and the immune system (sometimes referred to as the immune system) is composed of the "innate immune system" and the "adaptive immune system") and refers to the efficiency of a subject's immune system. Thus, a subject's immune status indicates whether the subject's immune system is normal, impaired (e.g., when the subject suffers from an immunodeficiency disorder), or hyperactive (e.g., when the subject suffers from a disease, autoimmune disorder, or illness) compared to a normal, healthy subject. The term "immune system" refers to the system of many biological structures and processes within an organism that protects against disease.

[0034] As used herein, the "immune status" can be measured, for example, by the "Mayo score" (see, for example, http: / / www.ibdjapan.org / for_medical / pdf / doc07.pdf) as a clinical scoring method by a doctor.

[0035] As used herein, "introducing or modifying" a gene refers to the introduction or alteration of a function of the gene that does not exist in the natural state into the organism, and includes complete loss of the gene, as well as alterations to the expression level, and also includes external introduction or changes of a single amino acid or nucleotide that result in a function different from the original function. For example, even a codon change is considered to be effective in the present disclosure as long as it affects the expression level.

[0036] As used herein, "modification" broadly refers to any structural, functional, or expression-related change made to a gene (including nucleic acids and their corresponding proteins), and includes naturally occurring or artificial modifications. Specifically, this includes sequence changes due to base sequence substitution, deletion, insertion, addition, or a combination thereof; changes to the amino acid sequence or properties of the encoded protein; or chemical modifications (e.g., glycosylation, phosphorylation, acetylation, etc.) aimed at adding or improving functionality. "Modification" also includes exogenous gene introduction (e.g., gene introduction via transfection or viral vector), transformation, knockout or knock-in of specific genes using genome editing technology, and suppression of gene expression (e.g., suppression by RNA interference or CRISPR technology). Furthermore, epigenetic modifications (e.g., DNA methylation, histone modification, etc.) and modifications of expression regulatory elements are also included. As used herein, "modification" refers comprehensively to any form of change that affects the structure, expression, function, or biological behavior of a gene, including both endogenous changes and changes that are exogenously introduced or manipulated.

[0037] It is understood that the acyltransferases (the nucleic acid sequence of which is shown in SEQ ID NO: 5 and the amino acid sequence of which is shown in SEQ ID NO: 6) of the present disclosure, MRGPRX (e.g., MRGPRX4), and Mrgprb5, as well as their orthologs and variants thereof, are all encompassed within the scope of the present disclosure. As used herein, "variant," which may also be referred to as "derivative," "analog," or "mutant," preferably includes, but is not limited to, molecules containing a region substantially homologous to a protein of interest (e.g., acyltransferase, MRGPRXr (e.g., MRGPR4), and Mrgprb5), which in various embodiments are at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% identical over the same size amino acid sequence or when compared to sequences aligned by computer homology programs known in the art, or nucleic acids encoding such molecules are capable of hybridizing to sequences encoding the component protein under (highly), moderately, or non-stringent conditions. This refers to proteins that are the product of modification of naturally occurring proteins by amino acid substitutions, deletions, and additions, respectively, and in which the derivative still exhibits the biological function of the naturally occurring protein, although not necessarily to the same degree. For example, the biological function of such proteins can be examined by suitable and available in vitro assays described herein or known in the art. As used herein, "functionally active" refers to a polypeptide, i.e., a fragment or derivative, that retains the structural, regulatory, or biochemical function of a protein, such as biological activity, according to the embodiment to which the polypeptide, i.e., fragment or derivative of the present disclosure relates. While this disclosure primarily discusses specific species of acyltransferase (the nucleic acid sequence of which is shown in SEQ ID NO:5 and the amino acid sequence of which is shown in SEQ ID NO:6), MRGPRX, and Mrgprb5, it is understood that many organisms other than those identified express genes with similar functions, and therefore genes from these other organisms are also within the scope of this disclosure.

[0038] Therefore, representative nucleic acid sequences (also referred to as nucleotide sequences or base sequences) of the acyltransferase of the present disclosure, including variants thereof, are as follows: (a) a polynucleotide having the base sequence set forth in SEQ ID NO: 5 or a fragment thereof; (b) a polynucleotide encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6 or a fragment thereof; (c) a polynucleotide encoding a variant polypeptide or a fragment thereof having one or more, preferably one or several, amino acid mutations selected from the group consisting of substitution, addition, and deletion in the amino acid sequence set forth in SEQ ID NO: 6, and having biological activity; (d) a polynucleotide that is a splice variant or allelic variant of the base sequence set forth in SEQ ID NO: 5 or a fragment thereof; (e) a polynucleotide encoding a species homologue of the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6 or a fragment thereof; (f) a polynucleotide that hybridizes under stringent conditions to any one of the polynucleotides (a) to (e) and encodes a polypeptide having biological activity; or (g) A polynucleotide consisting of a nucleotide sequence that has at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of the polynucleotides (a) to (e) or their complementary sequences, and that encodes a polypeptide having biological activity. Here, biological activity typically refers to the activity of an acyltransferase or the ability to be distinguished from other proteins present in the same organism and / or a host organism (typically, a human).The amino acid sequence of the acyltransferase of the present disclosure, including variants thereof, may be: (a) a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 6 or a fragment thereof; (b) a polypeptide in which one or more, preferably one or several, amino acid mutations in the amino acid sequence set forth in SEQ ID NO: 6 are selected from the group consisting of substitution, addition, and deletion, and which has biological activity; (c) a polypeptide encoded by a splice variant or allelic variant of the nucleotide sequence set forth in SEQ ID NO: 5; (d) a polypeptide that is a species homolog of the amino acid sequence set forth in SEQ ID NO: 6; or (e) a polypeptide that has an amino acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the polypeptides (a) to (d), and which has biological activity. Here, biological activity typically refers to the ability to distinguish an acyltransferase from other proteins present in the same organism and / or a host organism (typically, humans) as an activity or marker possessed by the acyltransferase (e.g., containing a region that can function as a specific epitope when used as an antigen). An important activity of the acyltransferase in the present disclosure can be the activity of acyltransferases, including Odosp_2289 (SEQ ID NOs: 5 and 6) discovered in the present disclosure, to acylate ornithine twice to produce acyloxyacyl lipids.

[0039] Therefore, representative nucleic acid sequences of MRGPRX4, including variants thereof, are as follows: (a) a polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 25 or a fragment thereof; (b) a polynucleotide encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 26 or a fragment thereof; (c) a polynucleotide encoding a variant polypeptide or a fragment thereof having one or more, preferably one or several, amino acid mutations selected from the group consisting of substitution, addition, and deletion in the amino acid sequence set forth in SEQ ID NO: 26, and having biological activity; (d) a polynucleotide which is a splice variant or allelic variant of the nucleotide sequence set forth in SEQ ID NO: 25 or a fragment thereof; (e) a polynucleotide encoding a species homologue of the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 26 or a fragment thereof; (f) a polynucleotide which hybridizes under stringent conditions to any one of the polynucleotides (a) to (e) and encodes a polypeptide having biological activity; or (g) A polynucleotide consisting of a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the polynucleotides (a) to (e) or their complementary sequences, and that encodes a polypeptide having biological activity. Here, biological activity typically refers to having binding activity to NAAO as a ligand, or being able to distinguish the activity of MRGPRX4 from other proteins present in the same organism as a marker.The amino acid sequence of MRGPRX4, including its variants, can be: (a) a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:26 or a fragment thereof; (b) a polypeptide in which one or more, preferably one or several, amino acids in the amino acid sequence set forth in SEQ ID NO:26 have a mutation selected from the group consisting of substitution, addition, and deletion, and which has biological activity; (c) a polypeptide encoded by a splice variant or allelic variant of the nucleotide sequence set forth in SEQ ID NO:25; (d) a polypeptide that is a species homolog of the amino acid sequence set forth in SEQ ID NO:26; or (e) a polypeptide that has an amino acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the polypeptides (a) to (d), and which has biological activity. Here, biological activity typically refers to the activity possessed by MRGPRX4 or the ability to be distinguished from other proteins present in the same organism as a marker (for example, having binding activity to NAAO as a ligand, or containing a region that can function as a specific epitope when used as an antigen).

[0040] Therefore, representative nucleic acid sequences of Mrgprb5, including variants thereof, are as follows: (a) a polynucleotide having the nucleotide sequence set forth in SEQ ID NO:27 or a fragment thereof; (b) a polynucleotide encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:28 or a fragment thereof; (c) a polynucleotide encoding a variant polypeptide or a fragment thereof having one or more, preferably one or several, amino acid mutations selected from the group consisting of substitution, addition, and deletion in the amino acid sequence set forth in SEQ ID NO:28, and having biological activity; (d) a polynucleotide which is a splice variant or allelic variant of the nucleotide sequence set forth in SEQ ID NO:27 or a fragment thereof; (e) a polynucleotide encoding a species homologue of the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:28 or a fragment thereof; (f) a polynucleotide which hybridizes under stringent conditions to any one of the polynucleotides (a) to (e) and encodes a polypeptide having biological activity; or (g) A polynucleotide consisting of a nucleotide sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the polynucleotides (a) to (e) or their complementary sequences, and that encodes a polypeptide having biological activity. Here, biological activity typically refers to having binding activity to NAAO as a ligand, or being able to distinguish the activity of Mrgprb5 from other proteins present in the same organism as a marker.The amino acid sequence of Mrgprb5, including variants thereof, may be: (a) a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:28 or a fragment thereof; (b) a polypeptide in which one or more, preferably one or several, amino acid mutations in the amino acid sequence set forth in SEQ ID NO:28 are selected from the group consisting of substitution, addition, and deletion, and which has biological activity; (c) a polypeptide encoded by a splice variant or allelic variant of the nucleotide sequence set forth in SEQ ID NO:27; (d) a polypeptide which is a species homolog of the amino acid sequence set forth in SEQ ID NO:28; or (e) a polypeptide which has an amino acid sequence that is at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of the polypeptides (a) to (d), and which has biological activity. Here, biological activity typically refers to the activity possessed by Mrgprb5 or the ability to be distinguished from other proteins present in the same organism as a marker (for example, having binding activity to NAAO as a ligand, or containing a region that can function as a specific epitope when used as an antigen).

[0041] As used herein, "gene" refers to a factor that determines a genetic trait, and "gene" can refer to "polynucleotide," "oligonucleotide," and "nucleic acid." Furthermore, as used herein, "nucleic acid sequence" can also be referred to as "nucleotide sequence" or "base sequence," which refer to the same thing.

[0042] As used herein, "homology" of genes refers to the degree of identity between two or more gene sequences. Generally, "homology" refers to a high degree of identity or similarity. Thus, the higher the homology between two genes, the higher the identity or similarity between their sequences. Whether two genes are homologous can be determined by direct sequence comparison or, in the case of nucleic acids, by hybridization under stringent conditions. When two gene sequences are directly compared, the genes are homologous if the DNA sequences between the gene sequences are typically at least 50% identical, preferably at least 70% identical, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical. Therefore, as used herein, "homolog" or "homologous gene product" refers to a protein in another species, preferably a mammal, that performs the same biological function as a protein component of a complex described further herein. Such a homolog may also be referred to as an "orthologous gene product." It will be understood that such homologs, homologous gene products, orthologous gene products, etc. may also be used as long as they are consistent with the purposes of the present disclosure.

[0043] Amino acids may be referred to herein by either their commonly known three-letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by their commonly accepted one-letter codes. Herein, comparisons of amino acid sequence and base sequence similarity, identity, and homology are calculated using the sequence analysis tool BLAST with default parameters. Identity searches can be performed, for example, using NCBI's BLAST 2.2.28 (published April 2, 2013). Identity values ​​herein generally refer to values ​​obtained when aligned using the above-mentioned BLAST under default conditions. However, if changing parameters results in a higher value, the highest value is used as the identity value. When identity is evaluated in multiple regions, the highest value among them is used as the identity value. Similarity is a numerical value that takes into account not only identity but also similar amino acids.

[0044] In one embodiment of the present invention, "several" may be, for example, 10, 8, 6, 5, 4, 3, or 2, or any of these values ​​or less. It is known that polypeptides that have one or several amino acid residues deleted, added, inserted, or substituted with other amino acids maintain their biological activity (Mark et al., Proc Natl Acad Sci U S A. 1984 Sep;81(18):5662-5666, Zoller et al., Nucleic Acids Res. 1982 Oct 25;10(20):6487-6500, Wang et al., Science. 1984 Jun 29;224(4656):1431-1433). Antibodies with deletions or other modifications can be produced, for example, by site-directed mutagenesis, random mutagenesis, or biopanning using an antibody phage library. Site-directed mutagenesis can be performed using, for example, the KOD-Plus-Mutagenesis Kit (TOYOBO CO., LTD.). Selection of antibodies with activity similar to that of the wild-type from mutant antibodies with deletions or other modifications can be achieved by performing various characterization techniques such as FACS analysis and ELISA.

[0045] Functional equivalents of the present invention can include amino acid sequences in which one or more amino acids have been inserted, substituted, or deleted, or added to one or both termini. As used herein, "insertion, substitution, or deletion of one or more amino acids in an amino acid sequence, or addition to one or both termini" refers to a modification that has been made by a well-known technical method such as site-directed mutagenesis, or by natural mutation, resulting in the substitution of a number of amino acids to the extent that would occur naturally. The modified amino acid sequence can be, for example, one in which 1 to 30, preferably 1 to 20, more preferably 1 to 9, even more preferably 1 to 5, and particularly preferably 1 to 2 amino acids have been inserted, substituted, or deleted, or added to one or both termini. The modified amino acid sequence may preferably be an amino acid sequence that has one or more (preferably one or several, or 1, 2, 3, or 4) conservative substitutions in the amino acid sequences of acyltransferase (the nucleic acid sequence of which is shown in SEQ ID NO: 5 and the amino acid sequence of which is shown in SEQ ID NO: 6), MRGPRX, and Mrgprb5. Here, "conservative substitution" refers to the substitution of one or more amino acid residues with other chemically similar amino acid residues so as not to substantially alter the function of the protein. For example, a hydrophobic residue may be substituted with another hydrophobic residue, or a polar residue may be substituted with another polar residue having the same charge. Functionally similar amino acids that can be used for such substitutions are known in the art for each amino acid. Specific examples of nonpolar (hydrophobic) amino acids include alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Positively charged (basic) amino acids include arginine, histidine, and lysine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0046] In one embodiment of the present invention, "X% or more" (X is an appropriate number) refers to any number equal to or greater than that number. For example, "90% or more" may mean, for example, 90, 95, 96, 97, 98, 99, or 100% or more, or may be within a range of any two of these values. The above-mentioned "homology" may be calculated by calculating the percentage of homologous amino acids between two or more amino acid sequences according to methods known in the art. Before calculating the percentage, the amino acid sequences of the amino acid sequences to be compared are aligned, and gaps are introduced into the amino acid sequences, if necessary, to maximize the percentage of identical amino acids. Methods for alignment, percentage calculation, comparison, and related computer programs are well known in the art (e.g., BLAST, GENETYX, etc.). In this specification, "homology" can be expressed as a value measured by NCBI BLAST unless otherwise specified. When comparing amino acid sequences using BLAST, the Blastp algorithm can be used with default settings. The measurement results are quantified as positives or identities. Several factors such as temperature and salt concentration are thought to affect stringency, and for details of stringency, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

[0047] As used herein, the terms "disease," "disorder," and "condition" are used interchangeably and are interpreted in the broadest sense to refer to a state of physical or mental illness or discomfort in a human or animal, including any condition that is not specifically defined as being unhealthy, such as an illness, disorder, or any of a variety of symptoms.

[0048] As used herein, "treatment" refers to the act of administering, for example, an active ingredient of the present disclosure to an individual (subject, patient) who has been diagnosed by a physician or equivalent practitioner as having a disease, for the purpose of, for example, alleviating, mitigating, or ameliorating the disease or symptoms, removing the causative agent of the disease in the subject, or restoring the subject to a state prior to the onset of the disease.

[0049] As used herein, "prevention" refers to the act of administering an active ingredient of the present disclosure to an individual who has not yet developed the target disease, for example, with the purpose of preventing the onset of the disease. A vaccine is a typical example of a pharmaceutical agent intended for prevention. In the present disclosure, prevention refers to the fact that even if a causative factor for a disease is present in a subject, if the disease has not developed, it is not usually considered to be a disease state. Therefore, even in such a state, the subject can be treated and can be said to be prevented.

[0050] As used herein, the term "autoimmune / inflammatory disease" refers to any disease classified as an autoimmune disease, an inflammatory disease, or both. As used herein, the term "autoimmune disease" refers to any disease in which the immune system mounts an unwanted immune response against the body's own cells, tissues, or organs.

[0051] As used herein, the phrase "inflammatory disease or disorder" refers to a disease, condition, or disorder associated with inflammation. As used herein, the term "inflammation" refers to the process by which a subject's immune system coordinates a response to tissue injury, infection, antigen challenge, and the like. Inflammation can be associated with increased blood supply to the tissue, increased capillary permeability of the tissue, and / or increased migration of leukocytes into the tissue. It refers to a disease, disorder, or pathological condition in which the pathology is due, in whole or in part, to, for example, changes in the number, migration rate, or activation of immune system cells. Immune system cells include, for example, T cells, B cells, monocytes or macrophages, innate lymphocytes, antigen-presenting cells (APCs), dendritic cells, microglia, NK cells, neutrophils, eosinophils, mast cells, or any other cells specifically associated with immunology, such as cytokine-producing endothelial or epithelial cells.

[0052] Examples of autoimmune and inflammatory diseases include rheumatoid arthritis, multiple sclerosis, type 1 diabetes, inflammatory bowel disease (e.g., Crohn's disease or ulcerative colitis), systemic lupus erythematosus, psoriasis, scleroderma, autoimmune thyroid disease, alopecia areata, Graves' disease, Guillain-Barré syndrome, celiac disease, Sjogren's syndrome, rheumatic fever, gastritis, autoimmune atrophic gastritis, autoimmune hepatitis, insulitis, Oophoritis, orchitis, uveitis, phacogenic uveitis, myasthenia gravis, primary myxedema, pernicious anemia, autoimmune hemolytic anemia, Addison's disease, Goodpasture's syndrome, nephritis (e.g., glomerulonephritis), pemphigus vulgaris, pemphigoid, sympathetic ophthalmia, idiopathic thrombocytopenic purpura, idiopathic leukopenia, Wegener's granulomatosis and polyp / dermatomyositis, asthma (steroid-resistant asthma, steroid-resistant asthma), Examples of the inflammatory bowel disease include, but are not limited to, inflammatory bowel disease (e.g., Crohn's disease or ulcerative colitis), chronic obstructive pulmonary disease (COPD, which may or may not be associated with, caused in part by, or attributable to exposure to first- or second-hand smoke), asthma and COPD overlap syndrome (ACOS), eosinophilic esophagitis, chronic bronchitis, emphysema, chronic rhinosinusitis with or without nasal polyps, lupus, atopic dermatitis and other fibrotic diseases, vasculitis (Behçet's disease, giant cell arteritis, Henoch-Schönlein purpura, and Churg-Strauss syndrome), inflammatory pain, and arthritis. Preferably, inflammatory bowel disease (IBD) is used, and in a specific embodiment, ulcerative colitis (UC) or Crohn's disease (CD) may be used.

[0053] As used herein, the term "medicine" is interpreted in the broadest sense in the art and is used to encompass any drug, including not only drugs and quasi-drugs under the Pharmaceutical Affairs Law, but also veterinary drugs and other drugs used in animals. It is understood to encompass any drug, composition, or other drug intended for the treatment or prevention of a disease, disorder, or condition requiring probiotics, prebiotics, or synbiotics, such as improving the balance of the intestinal flora. Examples of such applications include applications in the medical field and veterinary science. Pharmaceuticals typically contain solid or liquid excipients and, if necessary, may contain additives such as disintegrants, flavorings, delayed-release agents, lubricants, binders, and colorants. Pharmaceutical forms include, but are not limited to, tablets, injections, capsules, granules, powders, fine granules, sustained-release formulations, and the like. The components, microorganisms, compounds, probiotics, prebiotics, or synbiotics of the present disclosure can be combined with other components, such as pharmaceutically acceptable carriers or excipients, to form pharmaceutical compositions.

[0054] As used herein, the terms "feed" and "feed" are used interchangeably and have the meaning commonly used in the art. They refer to all foods (including beverages) that can be consumed by animals other than humans, and one embodiment of the term can be a processed product. For example, the components, microorganisms, compounds, probiotics, prebiotics, or synbiotics disclosed herein can be mixed into processed feed. Examples of such feed include, but are not limited to, feed that is given to animals such as livestock for a certain period of time before ingestion. In other words, the effects of the components disclosed herein, probiotics, prebiotics, or synbiotics, such as those for improving the balance of the intestinal flora, are also effective in animals, and therefore feed (such as pet food or livestock feed) containing the components, microorganisms, compounds, probiotics, prebiotics, or synbiotics disclosed herein can be combined with known general nutritional ingredients or further combined with other active ingredients.

[0055] As used herein, the term "food and beverage" has the meaning commonly used in the art and refers to all foods (including beverages) that can be consumed by humans, and one embodiment of the term can be a processed product. For example, processed foods such as confectionery, dairy products, and processed grain products can be mixed with the ingredients, microorganisms, compounds, probiotics, prebiotics, or synbiotics disclosed herein. Furthermore, the terms "health food" and "functional food" have the meaning commonly used in the industry and refer to a type of food that is specially formulated for probiotics, prebiotics, or synbiotics, such as for improving the balance of the intestinal microbiota, and is distinct from pharmaceuticals or general foods. Examples of such foods include, but are not limited to, foods that are ingested by a subject for a certain period of time before or with a meal.

[0056] As used herein, the term "food additive" refers to any agent added to a main ingredient for some purpose, such as additives for probiotics, prebiotics, or synbiotics, which improve the balance of intestinal flora.

[0057] In this specification, the term "supplement" does not only mean nutritional supplements for supplementing nutrients, etc., but also health functional foods that have functions useful for maintaining, restoring, improving, etc. health (for example, anti-obesity effects such as suppressing weight gain and suppressing body fat accumulation, or slimming effects).

[0058] In this specification, the term "viable bacteria" is interpreted in the broadest sense as meaning bacteria in a living state, and includes bacterial culture solutions, suspensions of the culture solutions, crudely purified products, purified products, and bacterial powders obtained by drying these live bacteria by freeze-drying, spray-drying, or the like, and is not limited as long as they are in a living state. Agents composed of viable bacteria are called viable agents. Whether or not a bacterium is viable can be confirmed, for example, by the formation of colonies on a solid medium containing nutrients on a support such as agar.

[0059] (Preferred Embodiments) Preferred embodiments of the present disclosure will be described below. The embodiments provided below are provided for a better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that those skilled in the art can make appropriate modifications within the scope of the present disclosure in light of the description herein. In addition, the following embodiments of the present disclosure can be used alone or in combination.

[0060] (NAAO-Related) In one aspect, the present disclosure provides a composition for regulating or maintaining a health state and / or regulating an immune state, or for preventing or treating an autoimmune or inflammatory disease, comprising a means for altering or maintaining an appropriate level of N-acyloxyacylornithine (NAAO).

[0061] This disclosure reports several findings that the presence and diversity of intestinal microbiota can affect health status, stress response, and behavioral patterns. The behavior of adult mice lacking a normal intestinal flora has been shown to be at higher health risk than adult mice with a normal intestinal flora, and the health status of mice with a normal intestinal flora is significantly different from that of mice with a normal intestinal flora (1aplan, GG, and Ng, SC (2017). Understanding and Preventing the Global Increase of Inflammatory Bowel Disease. Gastroenterology 152, 313-321.e2.; Khor, B., Gardet, A., and Xavier, RJ (2011). Genetics and pathogenesis of inflammatory bowel disease. Nature 474, 307-317.; 3. Ng, SC, Bernstein, CN, Vatn, MH, Lakatos, PL, Loftus, EV, Jr, Tysk, C., O'Morain, C., Moum, B., Colombel, J.-F., and Epidemiology and Natural History Task Force of the International Organization of Inflammatory Bowel Disease (IOIBD) (2013). Geographical variability and environmental risk factors in inflammatory bowel disease. Gut 62, 630-649.).The gut microbiota influences human health and disease and is an important factor in controlling IBD pathology (Caruso, R., Lo, BC, and Nunez, G. (2020). Host-microbiota interactions in inflammatory bowel disease. Nat. Rev. Immunol. 20, 411-426; Lloyd-Price, J., Arze, C., Ananthakrishnan, AN, Schirmer, M., Avila-Pacheco, J., Poon, TW, Andrews, E., Ajami, NJ, Bonham, KS, Brislawn, CJ, et al. (2019). Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662).IBD diagnosis is a diagnosis of dysbiosis in the liver dysbiosis and Lloyd-Price, J., Arze, 2005 . C. , Ananthakrishnan , AN , Schirmer , M. , Avila-Pacheco , J. , Poon , TW , Andrews , E. , Ajami , NJ , Bonham , KS , Brislawn , CJ , et al. (2019). Multi-omics of the gut microbial ecosystem(in inflammatory bowel diseases). Nature 569, 655-662.9 Sokol, H., Leducq, V., Aschard, H., Pham, H.-P., Jegou, S., Landman, C., Cohen, D., Liguori, G., Bourrier, A., Nion-Larmurier, I., et al. (2017). Fungal microbiota dysbiosis in IBD. Gut 66, 1039-1048.9 He, X.-X.,Li, Y.-H., Yan, P.-G., Meng, X.-C., Chen, C.-Y., Li, K.-M. (2021). Relationship between clinical features and intestinal microbiota in Chinese patients with ulcerative colitis. World J. Gastroenterol. 27, 4722–4737.).The diversity of the gut microbiota in IBD is generally characterized by an increase in facultative anaerobes, such as Escherichia, Streptococcus, and Actinomyces, and a decrease in obligate anaerobes, such as Faecalibacterium, Eubacterium, and Lachnospira (Rigottier-Gois, L. (2013). Dysbiosis in inflammatory bowel diseases: the oxygen hypothesis. ISME J. 7, 1256-1261.; Nascimento, R. de P. do, Machado, AP da F., Galvez, J., Cazarin, CBB, and Marostica Junior, MR (2020). Ulcerative colitis: Gut microbiota, immunopathogenesis, and application of natural products in animal models. Life Sci. 258, 118-129.). Recent studies have targeted the abnormal gut microbiota for IBD treatments, such as fecal microbiota transplantation (FMT). FMT responders showed a restoration of gut microbiota diversity and composition, characterized by the inclusion of specific bacterial species such as Bacteroides, Coprococcus, Eubacterium, Lachnospiraceae, Ruminococcus, and Odoribacter, which correlated with clinical efficacy against UC. In particular, monocolonization of mice with O. splanchnicus significantly suppressed colitis.

[0062] Lipid metabolism connects the gut microbiota and the host. Bacterial lipids have unique structures distinct from mammalian lipids and affect host tissue homeostasis. Some microbial lipids, including dihydroceramides and bile acids, play important roles in regulating host inflammatory processes. Thus, metabolic profiling encompassing the molecular diversity of host- and bacterial-derived metabolites is a new need for understanding the host-microbiota interactions in IBD. However, the characteristics of IBD-associated lipids and the causal relationship between these lipids and dysbiosis and the development of IBD remain unclear. This discovery has partially elucidated this mechanism.

[0063] As an example, in this disclosure, comprehensive lipidomics and microbiome profiling of feces collected from UC patients was performed to reveal changes in the specific gut bacteria and lipidome in these patients. In vitro culture of human-representative gut bacterial strains demonstrated that these patients exhibited alterations in bacteria producing specific lipids. Furthermore, in mice with dextran sulfate sodium (DSS)-induced colitis, the anti-inflammatory and tissue-protective activities of N-acyloxyacylornithine (NAAO), a metabolite significantly reduced in UC patients, were demonstrated.

[0064] Livestock production sites require husbandry management based on animal welfare. There is an urgent need to establish a system that maximizes livestock productivity in an appropriate and considerate husbandry environment. To protect livestock health and animal welfare, antibacterial substances are used to treat infectious diseases and are added to feed for the purpose of efficient production. However, due to drug-resistant bacteria caused by the overuse of antibacterial substances, the number of deaths from pandemic infectious diseases in 2050 is predicted to be 10 million worldwide, far exceeding the number of deaths from cancer.

[0065] In one embodiment, the means of the present disclosure is (a) a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (b) an agent comprising NAAO (containing a protecting group or the like, which becomes an NAAO compound when introduced into the body), or an agent comprising a factor capable of regulating the expression or activity of MRGPRX4 or Mrgprb5, or an orthologue thereof; (c) a precursor of NAAO (such as a substrate for an enzyme), or the expression or activity of MRGPRX4 or Mrgprb5, or an orthologue thereof. (d) an enzyme capable of synthesizing NAAO (such as the enzyme identified by SEQ ID NO: 5 or 6), or an enzyme capable of synthesizing a factor capable of regulating the expression or activity of MRGPRX4 or Mrgprb5, or an orthologue thereof; (e) a cell or organism (including a microorganism or fungus) capable of synthesizing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; and (f) a combination of (c) and (d) and / or (e).

[0066] In one embodiment, the means of the present disclosure may include (a) NAAO, (b) an agent containing NAAO (containing a protecting group or the like, which becomes an NAAO compound when introduced into the body), (c) a precursor of NAAO (such as an enzyme substrate), (d) an enzyme capable of synthesizing NAAO (such as the enzyme identified by SEQ ID NO: 5 or 6), (e) a cell or organism (including a microorganism or fungus) capable of synthesizing NAAO, and (f) a combination of (c) and (d) and / or (e).

[0067] In one embodiment, in the present disclosure, the composition of the present disclosure may be a medicine, feed, food (functional food), food additive, supplement, probiotic, or the like.

[0068] In one embodiment, the compositions of the present disclosure may be provided as live bacteria (and their nutrients / substrates), enzyme preparations (and their substrates), compound preparations, or combinations thereof.

[0069] In one embodiment, the compositions, pharmaceuticals, regenerative medicine products, medical devices, or therapeutic / preventive methods disclosed herein may be used in any organism that has a gut microbiota. The gut microbiota refers to a collection of microorganisms that primarily colonize the gastrointestinal tract and are involved in maintaining the host's physiological functions, immune system, and metabolic homeostasis. The gut microbiota has been observed in a wide range of organisms, including humans, mammals, birds, reptiles, fish, and insects. It is known that the composition and function of the gut microbiota in these organisms affect the host's disease susceptibility and drug response. Humans are the most preferred target populations. The human gut microbiota is composed of more than 1,000 bacterial species, forming a complex ecosystem that dynamically changes depending on genetic background, age, diet, disease state, medication history, and other factors. The human gut microbiota is deeply involved in host immune regulation, neuroendocrine system interaction, and various pathologies, including inflammatory diseases, metabolic diseases, neurological diseases, and skin diseases. The technology disclosed herein may have a direct or indirect impact on these diseases.

[0070] Furthermore, the usefulness of medical interventions via the human intestinal microbiota has been demonstrated in recent years through treatments using fecal microbial transplantation (FMT) and probiotics and prebiotics, and the novel compositions and methods disclosed herein are also likely to be applicable to human treatment and prevention. In particular, when specific metabolites or components derived from intestinal bacteria, or the microorganisms themselves that produce them, are targeted, their effects can be significantly manifested in disease-related pathways in humans.

[0071] In one aspect, the present disclosure provides a method for regulating the health status of a subject, comprising altering or maintaining NAAO at an appropriate level. Altering or maintaining NAAO at an appropriate level can be achieved by utilizing a means for altering or maintaining NAAO at an appropriate level. For example, an effective amount of (a) a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof, (b) an agent containing NAAO (containing a protecting group, etc., which becomes an NAAO compound when introduced into the body), or an agent containing a factor capable of regulating the expression or activity of MRGPRX4 or Mrgprb5, or an orthologue thereof, or (c) a precursor of NAAO (e.g., an enzyme substrate such as ornithine), or a factor capable of regulating the expression or activity of MRGPRX4 or Mrgprb5, or an orthologue thereof, can be used. This can be achieved by applying or administering to a subject (i) a precursor of NAAO (such as the enzyme identified by SEQ ID NO: 5 or 6), or an enzyme capable of synthesizing a factor capable of regulating the expression or activity of MRGPRX4 or Mrgprb5, or an orthologue thereof, (ii) a cell or organism (including a microorganism or fungus) capable of synthesizing a factor capable of regulating the expression or activity of NAAO, MRGPRX4 or Mrgprb5, or an orthologue thereof, and (iii) a combination of (c) and (d) and / or (e).

[0072] In one embodiment, the modulation of health conditions includes an anti-inflammatory effect and / or a tissue protective effect, where tissue protective effect refers to a protective effect against tissue destruction, specifically colonic crypt destruction, caused by chemicals that induce colitis.

[0073] In one embodiment, the present disclosure provides a method for the prevention or treatment of an autoimmune inflammatory disease (e.g., ulcerative colitis). In a preferred embodiment, the autoimmune inflammatory disease comprises ulcerative colitis.

[0074] In one embodiment, the acyl groups contained in the NAAO can be any, typically any naturally occurring combination of carbon numbers and straight or branched chains.

[0075] In certain embodiments, the fatty acid group in the NAAO comprises two fatty acid groups having a total carbon number between 28 and 34.

[0076] The fatty acid group in NAAO is C 14 H 29 , C 15 H 31 , and C 16 H 33 and C 17 H 35 The fatty acid group in NAAO includes one in which the total number of carbon atoms in the two groups is between 28 and 34. The fatty acid group in NAAO includes one in which the total number of carbon atoms in the two groups is between 28 and 34. 14 H 29 and C 16 H 33 The fatty acid group in NAAO comprises at least one selected from the group consisting of: 15 H 31 and C 17 H 35 The composition includes at least one selected from the group consisting of:

[0077] More specifically, the following types may be used, and may contain unsaturated double bonds: NAAO 29:1;2O | NAAO 14:0;O (FA 15:0) NAAO 30:1;2O | NAAO 15:0;O (FA 15:0) NAAO 30:1;2O | NAAO 16:0;O (FA 14:0) NAAO 31:1;2O | NAAO 16:0;O (FA 15:0) NAAO 32:1;2O | NAAO 17:0;O (FA 15:0) NAAO 32:2;2O | NAAO 17:1;O (FA 15:0) NAAO 33:1;2O | NAAO 17:0;O (FA 16:0) NAAO 33:2;2O | NAAO 18:1;O (FA 15:0) NAAO 34:1;2O | NAAO 17:0;O (FA 17:0) NAAO 35:2;2O | NAAO 17:0;O (FA 18:1)

[0078] Examples of enzymes that may be involved in the production of NAAO include ornithine-related enzymes such as OlsA, OlsB, and OlsF, as well as enzymes that synthesize N-acyloxyacyl lipids using amino acids other than ornithine as substrates, such as GlsB (glycine → NAG) and GlsA (NAG → NAAG).

[0079] Examples of diseases associated with NAAO include inflammatory bowel disease (ulcerative colitis and Crohn's disease), other autoimmune diseases such as rheumatoid arthritis and systemic lupus erythematosus, and intestinal diseases such as irritable bowel syndrome.

[0080] Examples of types of fatty acids that can be included in NAAO include fatty acids with 14 to 18 carbon atoms and 0 to 1 degree of unsaturation.

[0081] (Receptor) In another aspect, the present invention relates to a method for preventing or treating an inflammatory disease, disorder, or symptom, a pharmaceutical product, a regenerative medicine product, or a method for selecting a candidate substance thereof, which method comprises regulating (e.g., activating or inhibiting) a receptor that has NAAO as a ligand.

[0082] More particularly, the present invention relates to pharmaceuticals, therapeutic methods, and screening methods for the prevention or treatment of inflammatory diseases, disorders, or symptoms by targeting MRGPRX4 (Mas-related G-protein-coupled receptor member X4) and / or Mrgprb5 (Mas-related G-protein-coupled receptor member B5), or orthologs thereof that are homologous thereto.

[0083] As used herein, "MRGPRX4" and "Mrgprb5" are G protein-coupled receptors (GPCRs) identified in humans and mice, respectively, and are known to be expressed in the sensory nervous system and immune cells. These receptors are activated by specific exogenous or endogenous ligands and have the function of regulating cytokine secretion, cell migration, inflammatory responses, and the like through downstream signaling pathways. Furthermore, "orthologs" of MRGPRX4 and / or Mrgprb5 (sometimes referred to as "orthologs" in Japanese) refer to genes with similar sequence structures and functions that have evolved in different species or in parallel (e.g., orthologs are sometimes defined based on ligand commonality; in the present disclosure, they are typically receptors acted upon by NAAO), and include corresponding genes from monkeys, rats, dogs, etc. Recent studies have reported that MRGPRX4 is involved in the control of inflammatory skin diseases and itch symptoms, and other Mrgprb family members have been reported to be involved in pain transmission and immune responses, suggesting that Mrgprb5 may also have similar functions. Based on these findings, the present inventors conceived the idea that inflammatory diseases, disorders, or symptoms may be controlled by actively activating or regulating these receptors.

[0084] In one embodiment, the present disclosure relates to a therapeutic or preventive method comprising a step of activating MRGPRX4, Mrgprb5, or an orthologue thereof, or a composition, pharmaceutical, regenerative medicine product, medical device, etc. comprising an active ingredient used therein. For example, oral or topical administration of an agonist of MRGPRX4, Mrgprb5, or an orthologue thereof is expected to alleviate the symptoms of dermatitis and allergic diseases.

[0085] In another embodiment, the present disclosure relates to a method for selecting a candidate compound capable of regulating the activity of MRGPRX4, Mrgprb5, or an orthologue thereof. For example, in a cell-based assay system, a compound library can be added to cells expressing MRGPRX4, Mrgprb5, or an orthologue thereof, and screening can be performed using calcium influx, cAMP response, or changes in gene expression as an index.

[0086] In a further embodiment, the present disclosure relates to pharmaceutical compositions comprising small molecule compounds, peptides, antibodies, etc. that have the effect of activating MRGPRX4, Mrgprb5, or their orthologues. These activators may exert therapeutic effects in various pathologies such as local inflammation, airway hyperresponsiveness, and autoimmune diseases.

[0087] In yet another embodiment, the present disclosure relates to a gene therapy drug or a regenerative medicine product using a vector, plasmid, viral vector (e.g., AAV), or the like, containing a nucleic acid sequence encoding MRGPRX4, Mrgprb5, or an orthologue thereof, which, when introduced into target cells, promotes functional expression of the receptor, thereby controlling inflammatory responses and inducing tissue repair.

[0088] It is desirable that the nucleic acid molecule used in the present disclosure contains, in addition to the native sequence, an enhancer, a promoter, and a sequence that increases translation efficiency (e.g., a Kozak sequence). Viral vectors, liposomes, nanoparticles, etc. can be used as delivery means.

[0089] As described above, the present disclosure provides novel therapeutic targets such as MRGPRX4, Mrgprb5, or their orthologues, which belong to the GPCR family, and proposes new therapeutic strategies for inflammatory diseases.

[0090] In another aspect, the present disclosure provides companion drugs or technologies relating thereto that use the receptors and ligands identified in the present disclosure as indicators.

[0091] In one embodiment, detection of MRGPRX4 ligands can be used. This embodiment includes a step of detecting the presence of MRGPRX4 from a sample, such as a biopsy sample, feces, or intestinal contents, derived from a subject. Nucleic acid is extracted from the test sample, and reverse transcription quantitative PCR (RT-qPCR) is performed using a primer set having a sequence complementary to the MRGPRX4 gene sequence or its orthologous sequence, thereby quantitatively detecting the presence of MRGPRX4 transcripts in the host organism. Furthermore, nucleic acid molecules encoding candidate enzymes that synthesize MRGPRX4 ligands (e.g., NAAO) can be extracted from the entire bacterial flora by metagenomic sequencing or shotgun sequencing. The bacteria to be detected may be, for example, gram-negative anaerobic bacteria belonging to the genera Alistipes, Odoribacter, or Akkermansia.

[0092] In another embodiment, a companion drug is provided for use in subjects with MRGPRX4 expression. Here, for subjects in whom the presence of MRGPRX4 has been confirmed, it is desirable to administer a pharmaceutical agent that exhibits efficacy by activating or regulating MRGPRX4, such as an MRGPRX4 agonist or a composition containing N-acyloxyacylornithine (NAAO). These pharmaceutical agents exert effects such as controlling inflammatory cytokines, strengthening barrier function, and inducing regulatory immune cells via the MRGPRX4 pathway in dermatitis, allergic rhinitis, IBD (inflammatory bowel disease), or autoimmune diseases. Since companion drugs exert their maximum effect in the presence of the bacteria, they are preferably used in conjunction with diagnostics. Furthermore, for subjects in whom the presence of MRGPRX4 is denied, therapeutic agents targeting other immune pathways can be switched to.

[0093] In another embodiment, personalized treatment is provided by complementing and eliminating MRGPRX4 expression. The present disclosure includes a means of artificially complementing MRGPRX4 activity in a host by administering MRGPRX4 as a gene therapy agent or the like to a subject in whom MRGPRX4 expression is not naturally present or is insufficient. In this case, by using MRGPRX4 in combination with a MRGPRX4 ligand or precursor, an immunoregulatory environment can be created in the intestinal mucosa, skin, or respiratory tract.

[0094] In another embodiment, the technology disclosed herein is used as a diagnostic-therapeutic collaboration platform. The technology disclosed herein can be provided as an integrated diagnostic-therapeutic companion medical system consisting of a diagnostic kit for intestinal flora bacteria that possess MRGPRX4 and / or its ligand synthase (e.g., gram-negative anaerobic bacteria belonging to the genera Alistipes, Odoribacter, and Akkermansia) and a corresponding therapeutic drug. This enables optimal treatment selection based on the intestinal flora information of each individual patient, thereby simultaneously achieving improved pharmaceutical efficacy and reduced side effects.

[0095] The above embodiments make it possible to realize personalized treatment based on the expression status of MRGPRX4 and the intestinal flora, making this invention highly clinically useful, particularly in the fields of inflammatory diseases and autoimmune diseases.

[0096] In another embodiment, the present disclosure provides a healthcare improvement strategy that takes into account the crosstalk between NAAO and its receptor. The compositions, pharmaceuticals, medical devices, or regenerative medicine products according to this embodiment aim to regulate the health status of a human or animal subject, normalize the immune status, and prevent or treat autoimmune or inflammatory diseases by altering or maintaining NAAO at an appropriate level. NAAO is a fatty acid-modified amino acid biosynthesized by certain intestinal bacteria (e.g., certain Bacteroidota bacteria (e.g., Odoribacteraceae)). NAAO can act via the G protein-coupled receptor MRGPRX4 expressed in the host and its functional ortholog in rodents, Mrgprb5. When activated by NAAO, these receptors transmit anti-inflammatory and homeostatic signals to innate immune cells, particularly dendritic cells, macrophages, and mucosal epithelial cells, which are involved in immune regulation, and are involved in anti-inflammatory responses, intestinal barrier function, and mucosal immune homeostasis.

[0097] In this embodiment, the in vivo or local concentration of NAAO is adjusted to an appropriate range by any of the following means: (a) a single-compound formulation containing NAAO itself as the active ingredient; (aa) a factor capable of modulating the expression or activity of MRGPRX4 or Mrgprb5, or their orthologues; (b) a preparation containing NAAO; (c) a precursor of NAAO (e.g., N-acylamino acid, fatty acid ester-type ornithine derivative, etc.); (d) an enzyme involved in the biosynthesis of NAAO (e.g., N-acyltransferase, oxidase, etc.); (e) a microorganism (viable bacteria) that biosynthesizes NAAO; or (f) a combination thereof. Examples of (aa) "factors capable of modulating MRGPRX4 or Mrgprb5, or their orthologues" include transcription factors, epigenetic modifiers, or miRNAs that increase the transcription level or membrane surface expression of these receptors, as well as bile acid derivatives and fatty acid-like compounds that enhance ligand affinity. Since the physiological effects of NAAO can be modified by inducing the expression or changing the sensitivity of MRGPRX4 or Mrgprb5, this embodiment may also contain factors that can regulate these receptors (e.g., specific short-chain fatty acids, bile acid metabolites, transcriptional regulators, or anti-inflammatory cytokines, etc.).

[0098] The compositions containing these means can be provided in the form of medicines, feeds, foods (including functional foods), food additives, supplements, or probiotics. In particular, probiotic preparations containing live bacteria capable of producing NAAO, live bacteria preparations combined with a nutrient source or substrate, or combinations with enzyme preparations containing NAAO-synthesizing enzymes are useful in that they can achieve continuous production of NAAO in the intestine. The above compositions can be provided as medicines, feeds, foods (including functional foods), food additives, supplements, or probiotics. In particular, probiotic compositions containing intestinal bacteria capable of producing NAAO (e.g., Odoribacter splanchnicus, Alistipes indistincutus, etc.), or combinations with prebiotic ingredients that activate them, contribute to the continuous and safe regulation of NAAO levels. Furthermore, these compositions can contain live bacteria or their nutrients or substrates, enzyme preparations or their substrates, compound preparations, or combinations thereof, and are designed to promote or complement local production of NAAO in the intestinal tract.

[0099] Methods for using the composition include those comprising administering an effective amount of the composition or its active ingredient to a subject to regulate NAAO levels and induce anti-inflammatory effects, mucosal protective effects, immune homeostasis maintenance effects, and the like. This can contribute to the prevention or treatment of autoimmune or inflammatory diseases such as ulcerative colitis, Crohn's disease, rheumatoid arthritis, autoimmune dermatitis, autoimmune hepatitis, multiple sclerosis, and type I diabetes. Specifically, promotion of IL-10 and TGF-β production, suppression of inflammatory cytokines, and activation of mucosal immune cells (e.g., regulatory T cells and cDC1, etc.) are anticipated. This is expected to suppress the onset or alleviate symptoms of inflammatory or autoimmune diseases such as ulcerative colitis, Crohn's disease, autoimmune dermatitis, autoimmune hepatitis, type I diabetes, and multiple sclerosis.

[0100] Furthermore, in addition to its use as a pharmaceutical, the above-described administration method can also be applied to general foods and nutritional supplements for the purposes of disease prevention and health promotion, and can be individualized depending on the subject's age, disease state, intestinal flora composition, etc. The method according to this embodiment can also be deployed as a gene therapy or regenerative medicine product. For example, by administering or transplanting cells capable of NAAO biosynthesis into tissue, a regenerative medicine strategy can be established that enables long-term localized NAAO supply. Another application of this composition as a regenerative medicine product can be, for example, implemented in a biomaterial containing cells that continuously supply NAAO while regulating the expression of MRGPRX4, or cells capable of NAAO production, or in a device for sustained NAAO release.

[0101] As described above, this embodiment provides a novel therapeutic or preventive means that contributes to the control of inflammation and autoimmune responses by regulating microbe-host interactions centered on NAAO through the regulation of NAAO and the receptors that make up its signaling pathway, thereby suppressing excessive immune activation and promoting the maintenance of homeostasis.

[0102] (General Techniques) The molecular biological, biochemical and microbiological techniques used herein are well known and commonly used in the art, and can be found in, for example, Sambrook J. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F. M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F. M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, M. A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F. M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, FM(1995).Short Protocols in Molecular Biology: A CompendiuMof Methods from MCurrent Protocols in Molecular Biology, Greene Pub. Associates; Innis, MA et al.(1995).PCR Strategies, Academic Press; Ausubel, FM(1999).Short Protocols in Molecular Biology: A CompendiuMof Methods froMCurrent Protocols in Molecular Biology, Wiley, and annual updates; Sninsky, JJet al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, Gait, MJ (1985). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Gait, MJ (1990). Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991).Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, RL et al.(1992).The Biochemistry of the Nucleic Acids, Chapman & Hall; Shabarova, Z. et al.(1994).Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, GM et al.(1996).Nucleic Acids in Chemistry and These methods are described in, for example, "Biology," Oxford University Press; "Hermanson, GT (1996)," "Bioconjugate Techniques," Academic Press; and "Experimental Methods for Gene Transfer and Expression Analysis," a special edition of Experimental Medicine, Yodosha, 1997. These are incorporated herein by reference in their entirety and in relevant portions.

[0103] All references cited herein, including scientific literature, patents, patent applications, and the like, are incorporated by reference in their entirety to the same extent as if each were specifically set forth.

[0104] The present disclosure has been described above by showing preferred embodiments for ease of understanding. Hereinafter, the present disclosure will be described based on examples. However, the above description and the following examples are provided for illustrative purposes only and are not intended to limit the present disclosure. Therefore, the scope of the present disclosure is not limited to the embodiments or examples specifically described herein, but is limited only by the scope of the claims.

[0105] The present disclosure will be illustrated and described below with reference to examples.

[0106] (Experimental Methods) Ethics Statement Regarding Human Experiments All experiments involving human subjects were approved by RIKEN, Keio University School of Medicine, and Takeda Pharmaceutical Company Limited.

[0107] Patient Recruitment and Sample Collection: Five healthy individuals and 25 patients with active UC were recruited. Three dropouts and three patients with poor metagenomic data quality were subsequently excluded, leaving 19 patients for analysis (Table 1). Stool samples collected from patients were sealed in Anaeropacks (Mitsui Gas Co., Ltd.) and ice packs and shipped by refrigerated delivery. Approximately 1 g of feces was dispensed into 15 mL Falcon tubes. Samples were flash-frozen in liquid nitrogen and stored at -80°C until analysis.

[0108]

[0109] For UC, fecal samples collected from UC patients before treatment were used for analysis.

[0110] Lipidomics Total lipid extraction from human fecal samples was performed using a method established in a previous study (Okahashi, N., Ueda, M., Yasuda, S., Tsugawa, H., and Arita, M. (2021). Global profiling of gut microbiota-associated lipid metabolites in antibiotic-treated mice by LC-MS / MS-based analyses. STAR Protoc 2, 100492.). Briefly, 1 g of human fecal sample was weighed, dissolved in 6 mL of methanol, and vortexed. 1 mL of this fecal methanol solution was transferred to a new vial and concentrated overnight at 4 °C using a centrifugal evaporator. The residue was redissolved in 200 μL of methanol and transferred to a 2 mL glass jacketed tube (FCR & Bio Co.). 100 μL of chloroform was then added, gently vortexed, and stored at room temperature for 2 hours. Then, 20 μL of water was added, vortexed, and kept at room temperature for another 10 minutes. The sample mixture was centrifuged (2000 × g, 4 °C) for 10 minutes. 200 μL of the lipid-containing monophasic layer was transferred from the jacketed tube to a 250 μL glass insert in a 2 mL screw-type Agilent HPLC vial (Agilent).

[0111] For bacterial or mouse fecal lipidomics, 200 μL of methanol and 100 μL of chloroform were added to 1 mg (bacterial pellet) or 10 mg (mouse feces) samples and incubated at room temperature for 2 hours. Then, 20 μL of water per mg of sample was added and centrifuged at 1680 × g for 10 minutes. The supernatant was transferred to a measurement vial and analyzed by LC-QTOF / MS. EquiSPLASH (Avanti) was incorporated as an internal standard.

[0112] Untargeted lipidomics was performed as previously described (ibid.). Briefly, an ACQUITY UPLC system (I-Class; Waters) was coupled to a QTOF-MS (TripleTOF 6600; Sciex). Lipids were separated on an Acquity UPLC Peptide BEH C18 column (50 × 2.1 mm, 1.7 μm; Waters). The column was maintained at 45°C and a flow rate of 0.3 mL / min. The mobile phases were (A) 1:1:3 (v / v / v) acetonitrile:methanol:water and (B) 100% 2-propanol. Both solvents were supplemented with ammonium acetate (5 mM) and 10 nM EDTA. The gradient was as follows: 0 min 0% (B), 1 min 0% (B), 5 min 40% (B), 7.5 min 64% (B), 12 min 64% (B), 12.5 min 82.5% (B), 19 min 85% (B), 20 min 95% (B), 20.1 min 0% (B), 25 min 0% (B). Data-dependent MS / MS acquisition was applied. 1 μL of the lipid extract was injected into the LC-QTOF / MS system.

[0113] For bacterial or mouse fecal lipidomics, 200 μL of methanol and 100 μL of chloroform were added to 1 mg (bacterial pellet) or 10 mg (mouse feces) samples and incubated at room temperature for 2 hours. Then, 20 μL of water per mg of sample was added and centrifuged at 1680 × g for 10 minutes. The supernatant was transferred to a measurement vial and analyzed by LC-QTOF / MS. EquiSPLASH (Avanti, USA) was incorporated as an internal standard.

[0114] Untargeted lipidomics was performed as previously described (Okahashi, N., Ueda, M., Yasuda, S., Tsugawa, H. & Arita, M. Global profiling of gut microbiota-associated lipid metabolites in antibiotic-treated mice by LC-MS / MS-based analyses. STAR Protoc 2, 100492 (2021)). Briefly, an ACQUITY UPLC system (I-Class; Waters) was coupled to a QTOF-MS (TripleTOF 6600; Sciex). Lipids were separated on an Acquity UPLC Peptide BEH C18 column (50 × 2.1 mm, 1.7 μm; Waters). The column was maintained at 45°C and a flow rate of 0.3 mL / min. The mobile phase consisted of (A) 1:1:3 (v / v / v) acetonitrile:methanol:water and (B) 100% 2-propanol. Both solvents were supplemented with ammonium acetate (5 mM) and 10 nM EDTA. The gradient was as follows: 0 min 0% (B), 1 min 0% (B), 5 min 40% (B), 7.5 min 64% (B), 12 min 64% (B), 12.5 min 82.5% (B), 19 min 85% (B), 20 min 95% (B), 20.1 min 0% (B), and 25 min 0% (B). Data-dependent MS / MS acquisition was applied. 1 μL of the lipid extract was injected into the LC-QTOF / MS system.

[0115] Data analysis was performed using MS-DIAL Bootstrap version 4.5 (human feces) or 5.1.231129 (bacteria) (Tsugawa, H. et al. A lipidome atlas in MS-DIAL 4. Nat. Biotechnol. 38, 1159-1163 (2020)). Most of the analysis parameters were left at the default values, with only minor changes: the retention time tolerance in the Identification tab was set to 1.25 min, the reference file in the Alignment tab was set to the HV101 sample, and the 'Remove features based on blank information' check box was selected.

[0116] For bacterial lipidomics, lipid concentrations were calculated using internal standards. Lipids were quantified at LSI level 2 or 3 using internal standards of the same or similar lipid class or representative standard compounds (https: / / lipidomicstandards.org / ). NAO and NAAO concentrations were calculated using deuterium-labeled LPE and PE as internal standards (LSI level 3).

[0117] DNA Extraction and Metagenomic Sequencing of Fecal Samples. Fecal sampling and DNA extraction from subjects were performed as previously reported (Kim, S.-W. et al. Robustness of gut microbiota of healthy adults in response to probiotic intervention revealed by high-throughput pyrosequencing. DNA Res. 20, 241-253 (2013)). 100 ng of extracted DNA was sheared to obtain fragments of 350-470 bp. Libraries constructed using the Ion Xpress Plus Fragment Library Kit (Thermo Fisher Scientific Inc.) were sequenced using an Ion 530 chip (Thermo Fisher Scientific Inc.) with an Ion Proton system. Duplicate reads resulting from sequencing process artifacts, reads with an average QV score less than 20, and reads shorter than 75 bp were filtered out using PRINSEQ-lite (version 0.20.4) (Schmieder, R. & Edwards, R. Quality control and preprocessing of metagenomic datasets. Bioinformatics 27, 863-864 (2011)). Human reads were also filtered by mapping reads to the Genome Reference Consortium Human Build 38 patch release 13 (GRCh38.p13) using minimap2 (version 2.24-r1122) (Li, H. Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34, 3094-3100 (2018)).

[0118] Functional composition analysis of bacteria and prokaryotes. Each metagenomic read was randomly subsampled to 5 million reads using seqtk (v.2-r102-dirty), and the subsampled reads were used for composition analysis. However, the metagenomic reads of UC108 (1,109,444 reads) were fully mapped due to the lack of available reads.

[0119] Bacterial composition was analyzed using the Metagenomic Operational Taxonomic Units (mOTUs) Profiler (version 3.0.1) (Ruscheweyh, H.-J. et al. Cultivation-independent genomes greatly expand taxonomic-profiling capabilities of mOTUs across various environments. Microbiome 10, 212 (2022).) mOTUs were used to calculate the relative abundance of bacteria at the phylum, genus, and mOTU levels.

[0120] Functional composition analysis was performed as previously described with minor modifications (Nagata, N. et al. Human gut microbiota and its metabolites impact immune responses in COVID-19 and its complications. Gastroenterology 164, 272-288 (2023)). The filtered reads were assembled using MEGAHIT (version 1.2.4-β) to construct contigs. Contigs shorter than 500 bps were removed using seqkit (version 2.3.0) (Shen, W., Le, S., Li, Y. & Hu, F. SeqKit: A cross-platform for Mand ultrafast toolkit for FASTA / Q file manipulation. PLoS One 11, e0163962 (2016)). Prokaryotic gene sequences were predicted using Prodigal (version 2.6.3) (Hyatt, D. et al. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 11, 119 (2010)). Predicted genes were concatenated, and genes shorter than 100 bps were removed using seqkit. The integrated prokaryotic gene sequences were clustered using CD-HIT (version 4.6) (Fu, L., Niu, B., Zhu, Z., Wu, S. & Li, W. CD-HIT: accelerated for clustering the next-generation sequencing data. Bioinformatics 28, 3150-3152 (2012).) with a threshold of 95% identity and 90% coverage to construct an in-house gene catalog. Two additional gene catalogs were also constructed from publicly available data. One was constructed using a similar approach from the entire metagenomic data of UC patients registered in the IBDMDB for HMP2 5.The other gene catalog was constructed from all metagenomic assembled genomes (MAGs) in the HumGut database (Hiseni, P., Rudi, K., Wilson, R. C., Hegge, F. T. & Snipen, L. HumGut: a comprehensive human gut prokaryotic genomes collection filtered by metagenome data. Microbiome 9, 165 (2021).) using prodigal, seqkit, and CD-HIT. These three gene catalogs were concatenated and further clustered using CD-HIT version 4.6 (Fu, L., Niu, B., Zhu, Z., Wu, S. & Li, W. CD-HIT: accelerated for clustering the next-generation sequencing data. Bioinformatics 28, 3150-3152 (2012).) with thresholds of 95% identity and 90% coverage to create an integrated gene catalog.

[0121] To calculate gene abundance, metagenomic reads were mapped to the integrated gene catalog using Bowtie2 (version 2.4.5). The integrated gene catalog was then annotated to the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (downloaded on 2022 / 09 / 25). KEGG functional gene abundance was calculated using DIAMOND blastp version v2.0.11.14956, ultra-sensitive mode, with a threshold e-value of 1e-05. On the other hand, to calculate the abundance of a gene (Odosp_2289) involved in ornithine lipid synthesis, the amino acid sequence of Odosp_2289 was annotated in the integrated gene catalog, and the threshold e-value was set to ≧60% identity and ≧60% coverage using the ultra-sensitive mode of DIAMOND blastp version v2.0.11.14956.

[0122] Reanalysis of metabolomics data from the iHMP cohort or antibiotic-treated mice. Metabolomics data from the iHMP cohort were obtained from a previous study (Lloyd-Price, J. et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662 (2019).) (ST000923) using Metabolomics workbench (https: / / www.metabolomicsworkbench.org / ). Lipids were searched by m / z matching in positive ion mode (AN001516, C8-pos). Overall, this dataset included n = 546 individuals (106 individuals). This included n = 134 (27) non-IBD patients, n = 146 (29) UC patients, and n = 266 (50) CD patients. NAAO 16:0;O (FA15:0) and NAAO 17:0;O (FA15:0) used mass searches of 611.535749814 and 625.551399879, respectively. Mass searches for Cer18:0;2O / 17:0;(3OH)(FA15:0), Cer17:0;2O / 17:0;(3OH)(FA15:0), and Cer17:0;2O / 16:0;(3OH)(FA15:0) were performed using 794.759601744, 780.74395168, and 766.728301615, respectively. NAAO 16:0;0(FA14:0) and NAAO 15:0;0(FA14:0) were also searched, but no peaks matched within a tolerance of 0.001.

[0123] Antibiotic administration was performed as previously described (Yasuda, S. et al. Elucidation of Gut Microbiota-Associated Lipids Using LC-MS / MS and 16S rRNA Sequence Analyses. iScience23, 101841 (2020)). Briefly, ampicillin (1 g / L), vancomycin (0.5 g / L), neomycin (1 g / L), and metronidazole (1 g / L) were administered in drinking water for two weeks. This dataset was analyzed using MS-DIAL Bootstrap version 4.535.

[0124] Ethical statement regarding mouse studies All animal experiments were approved by the RIKEN Yokohama Institute Animal Care and Use Committee (approval number: AEY2023-002(5)) and institutional guidelines: All animal experiments were approved by the RIKEN Yokohama Institute Animal Care and Use Committee (approval number: AEY2023-002(5)) and institutional guidelines.

[0125] Animals and Colitis Model: Male C57BL / 6J mice (purchased from CLEA, Tokyo, Japan) aged 6 to 8 weeks were housed under specific pathogen-free conditions at the RIKEN Animal Facility. Experimental colitis was induced by adding 2.5% DSS (w / v, M.W. 36,000-50,000, MP Biomedicals) to the drinking water and allowing it to be consumed ad libitum for 5 days. Purified NAAO (10 μg / mouse) or corn oil (Sigma) was administered intraperitoneally daily during the DSS administration period. Subsequently, DSS-free water was administered for 3 days. 150 μL of 50 mM NaOH was added to the tip of the tail and incubated at 95°C for 30 minutes. Then, 15 μL of Tris-HCl (pH 7.5) was added and the mice were centrifuged at 500 rpm for 1 minute. The PCR conditions and primer information for genotyping are listed in Tables 1A and 1B.

[0126]

[0127]

[0128] H&E staining. Mouse colons were embedded in FSC 22 frozen section medium (Leica Biosystems). Sections were prepared using a cryostat (Leica CM3050 S, Leica Biosystems). The sections were fixed in mild foam (10N, Wako) for 15 minutes. The sections were stained with hematoxylin (WAKO) for 10 minutes and eosin (Muto Chemical Co., Ltd.) for 2 minutes, and then observed under a microscope (Keyence BZ-X710, Keyence Corporation).

[0129] Quantitative Real-Time PCR: RNA was extracted from colon tissue using TRIZOL and chloroform. RNA was purified using the RNeasy Mini Kit (Qiagen). The tissue was homogenized twice for 15 seconds at 6500 rpm using 3.0 mm and 5.0 mm zirconia beads (TOMY SEIKO) in a Precellys 24 homogenizer (Bertin Technologies). Reverse transcription was performed using PrimeScript RT Master Mix (Takara Bio Inc.). Real-time PCR was performed using TB Green® Premix Ex Taq TM II (Takara Bio Inc., Shiga, Japan) and StepOne TM PCR was performed using a Plus real-time PCR system (Thermo Fisher Scientific, Inc.). The expression level of target mRNA was adjusted by the expression level of glyceraldehyde-3-phosphate dehydrogenase (Gapdh). Relative expression levels were calculated using the ΔΔCT method. Target amplification primers are shown in Table 2.

[0130]

[0131] Bacterial culture. Representative human intestinal bacteria were purchased from RIKEN BRC (https: / / web.brc.riken.jp / ja / ) or ATCC (https: / / www.atcc.org / ). Bacteria were grown in modified GAM broth (Nissui, Japan) or cerebromyocardial infusion solution (BD, USA) supplemented with 0.5 mg ml-1 hemin, vitamin K1 solution, and L-cysteine. Growth curves were recorded using a plate reader (Sunrise TM The cells were monitored using a centrifuge (TECAN, Mennedorf, Switzerland) and harvested during the logarithmic growth phase. The bacterial solution was centrifuged at 2280 × g and 4°C for 10 minutes to obtain a bacterial pellet. The bacterial pellet was washed twice with PBS (Wako, Osaka, Japan) and flash-frozen in liquid nitrogen. The frozen bacterial pellet was dried overnight at 4°C in a Labconco concentrator centrifuge and stored at -80°C until use in lipid analysis.

[0132] Bacterial Genome Analysis: Protein sequences for OlsA (F7X5V8_SINMM) from Sinorhizobium meliloti, OlsB (F7X5U6_SINMM) from S. meliloti, and OlsF (A8GEY0_SERP5) from Serratia proteamaculans were downloaded from Uniprot (https: / / www.uniprot.org / ). The O. splanchnicus genome information was obtained from NCBI (Assembly: ASM19053v1). Local Protein Blast (version 2.13.0) was performed on the O. splanchnicus genome using OlsA, OlsB, and OlsF as queries. The 16s rRNA sequences for each gene in the phylogenetic tree are shown in Table 3.

[0133]

[0134] The phylogenetic tree was constructed using NGphylogeny (Lemoine, F. et al. NGPhylogeny.fr: new generation phylogenetic services for non-specialists. Nucleic Acids Res. 47, W260-W265 (2019).) and iTOL (Letunic, I. & Bork, P. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 49, W293-W296 (2021).) (FastME / OneClick mode) and iTOL59.

[0135] Lipids were extracted from the cell pellet of O. splanchnicus with chloroform:methanol = 1:2 (v / v). The supernatant was collected and dried using a concentrator centrifuge (Labconco). The resulting suspension was suspended in 500 μL of a 1:2 chloroform:methanol solution and applied to a preparative TLC plate (0.5 mm, 20 × 20 cm, Merck). The plate was developed with a 2.5:2.5:1 (v / v / v / v) mixture of chloroform, isopropanol, ethyl acetate, methanol, and water, as previously described (Kim, S.-K. et al. Bacterial ornithine lipid, a surrogate membrane lipid under phosphate-limiting conditions, plays important roles in bacterial persistence and interaction with the host. Environ. Microbiol. 20, 3992-4008 (2018)). This process was repeated. Subsequently, ninhydrin (Tokyo Chemical Industry Co., Ltd.) was sprayed onto both sides of the TLC plate (1 cm) and charcoaled at 150 °C for several minutes to visualize the lipid bands. The second ninhydrin-positive spot from the top was scraped off and extracted three times with a chloroform:methanol solution (1:2, v / v). NAAO was dissolved in corn oil (Sigma) before administration to mice. Silica was removed using a Millex®-LG syringe filter (Merck Millipore) before LC-MS / MS analysis. For GPCR ligand screening, the concentration of NAAO was quantified using HPLC-PDA (Prominence, Shimadzu Corporation). A calibration curve was calculated using the peak area value at 210 nm absorption wavelength of the structurally similar compound, oleoyl-d-lysine (Cayman).

[0136] TGFα shedding assay GPCR ligand assays were performed according to a previously described method (Inoue, A., Ishiguro, J., Kitamura, H., Arima, N., Okutani, M., Shuto, A., Higashiyama, S., Ohwada, T., Arai, H., Makide, K., et al. (2012). TGFα shedding assay: an accurate and versatile method for detecting GPCR activation. Nat. Methods 9, 1021-1029.). Briefly, the test GPCR, alkaline phosphatase (AP)-tagged TGFα (AP-TGFα), and a mixture of Gα proteins (Gαq / s, Gαq / il, Gαq / i3, Gαq / o, Gαq / z, Gα(q / s), Gα(q / il), Gα(q / i3), Gα(q / o), Gα(q / z), Gα(q / 12), Gαq / 13 chimera, and Gα16) were transiently expressed in HEK293 cells using Lipofectamine 3000 (ThermoFisher) or polyethyleneimine (PEI) Max solution (Polysciences). Cells were suspended in HBSS containing 5 mM HEPES and seeded into a 96-well plate (90 μL per well) and incubated at 37°C for 30 minutes. Then, lipid metabolites (10 μL) were added and incubated at 37°C for 60 minutes. The supernatant (80 μL) was transferred to a new 96-well plate. The cells were incubated in HBSS containing 120 mM Tris-HCl (pH 9.5), 40 mM NaCl, and 10 mM MgCl. 2 AP solution (80 μL) containing 10 mM p-nitrophenyl phosphate (p-NPP) in PBS was dispensed into the cell plate and supernatant plate. The absorbance of the plates was measured at 405 nm before and after 1 hour of incubation at room temperature (25°C). The percent AP-TGFα release was calculated by subtracting the value from the mock-transfected cell condition. EC50 values ​​were calculated using a four-parameter sigmoidal concentration-response curve in GraphPad PrisM10 software.

[0137] Heterologous Expression in E. coli The Odosp_2289 gene was obtained from an O. splanchnicus culture by PCR using the following tagged primers: Fw: GAAGGAGATACATATGAATCTGATAGACTCGAACGATA (SEQ ID NO: 1), Rv: GTGGTGGTGCTCGAGTACTTCCAGATTATCCGAAGAGAAA (SEQ ID NO: 2). The PCR program consisted of 35 cycles of denaturation at 94°C for 2 minutes, denaturation at 94°C for 10 seconds, extension at 68°C for 100 seconds, and a final temperature of 4°C. The Odosp_2289 gene was integrated into pET21a plasmid treated with NdeI and ThoI by infusion reaction (In-Fusion® HD Cloning Kit, Takara Bio Inc.). A sequence (CTCGAG) for creating a His tag and a restriction enzyme sequence was inserted into the C-terminus of the Odosp_2289 gene. The Odosp_2289 integrated plasmid was transformed into competent Escherichia coli BL21 DE3 strain (Nippon Gene). The E. coli DE3 Odosp_2289-containing strain was inoculated into 10 ml of Luria-Bertani (LB) medium supplemented with ampicillin (100 μg / ml) and grown to an OD of 0.05. The cells were cultured at 37°C with shaking at 150 rpm until the RI value reached approximately 0.5. Next, 1 mM ornithine (WAKO), 1 mM acetic acid (Tokyo Chemical Industry Co., Ltd.), and 0.4 mM isopropyl β-D-thiogalactopyranoside (IPTG, WAKO) were added, and the cells were shaken continuously for 6 hours. Protein expression was confirmed by CBB staining. Briefly, RIPA buffer containing cComplete™ mini EDTA-free protease inhibitor cocktail (Roche) at 1 / 20 the culture volume was added to the bacterial pellet. After sonication, the sample was centrifuged at 12,000 × g for 30 minutes at 4°C. Proteins were denatured with SDS-PAGE sample buffer and applied to the gel. Protein expression was visualized using Quick CBB plus (WAKO).

[0138] Construction of Odosp_2289 N16D Mutant. PCR was performed using the pET21a:Odosp_2289 vector as a template and the following primers: forward: GGGAATCTGGGCGGAAGCCTGGTG (SEQ ID NO: 3); and reverse: ccccaaaaccgatccaactttgaggc (SEQ ID NO: 4). The location of the point mutation is underlined in the reverse primer. Mutagenesis was performed using the KOD-Plus-Mutagenesis kit (Toyobo). The PCR program consisted of seven cycles of denaturation at 94°C for 2 minutes, 98°C for 10 seconds, and extension at 68°C for 7 minutes, followed by a final temperature hold at 4°C. The PCR product was digested with DpnI to remove any remaining methylated vector. The remaining PCR product was phosphorylated and ligated. This vector was transformed into competent Escherichia coli JM109 strain and amplified. Point mutations were confirmed by Sanger sequencing. The plasmid was transformed into competent Escherichia coli DE3 (Nippon Gene) strain, and lipid analysis was performed as described above.

[0139] Statistical Analysis Results were presented as mean ± standard error of the mean (SEM), standard deviation (SD), or bar graphs with boxplots. Statistical analysis was performed using the Python module Scipy (version 1.9.1), GraphPad Prism (version 6.07 or later), or R. Tukey's honestly significant difference (HSD) was used to compare differences between multiple groups. Statistical significance was defined as p<0.05. Graphs were visualized using Python, GraphPad Prism, R, Excel, etc.

[0140] Example 1: Changes in the microbiome and lipidome in UC patients In this example, changes in the microbiome and lipidome in UC patients were investigated.

[0141] (Methods and Materials) See Experimental Methods

[0142] (Results) In this example, fecal metagenomic analysis and lipidomic analysis were performed on five healthy individuals and 19 active UC patients (Table 4).

[0143]

[0144] Shotgun metagenomics identified 562 metagenomic taxonomic units (mOTUs), and 134 bacterial species were identified at the genus level. Microbial alpha diversity was significantly lower in UC patients compared with healthy controls (Fig. 1A). Beta diversity, based on the Bray-Curtis distance, showed a disease-related shift along the principal coordinate axis 1 (Fig. 1B). The abundance of 14 bacterial species decreased and 3 increased in UC patients compared with healthy controls (Fig. 1C). The decrease in Eubacterium, Ruminococcus, Dorea, and Lachnospira, and the increase in Streptococcus and Actinomyces in IBD patients were consistent with known results (Sokol, H. et al. Fungal microbiota dysbiosis in IBD. Gut 66, 1039-1048 (2017)., Nascimento, R. de P. do, Machado, A. P. da F., Galvez, J., Cazarin, C. B. B. & Marostica Junior, M. R. Ulcerative colitis: Gut microbiota, immunopathogenesis and application of natural products in animal models. Life Sci. 258, 118129 (2020)., Ning, L. et al. Microbiome and metabolome features in inflammatory bowel disease via multi-omics integration analyzes across cohorts. Nat. Commun. 14, 7135 (2023).).An increased prevalence of facultative anaerobic bacteria, such as Escherichia and Enterococcus, which are often increased in IBD, was also observed in UC patients (p = 0.081 and 0.051, respectively) (Ning, L. et al., Santoru, M. L. et al. Cross sectional evaluation of the gut-microbiome metabolome axis in an Italian cohort of IBD patients. Sci. Rep. 7, 9523 (2017)., Seishima, J. et al. Gut-derived Enterococcus faecium from ulcerative colitis patients promotes colitis in a genetically susceptible mouse host. Genome Biol. 20, 252 (2019).). These results clearly confirm the previously identified relationship between active UC and dysbiosis (Lloyd-Price, J. et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662 (2019).; Sokol, H. et al. Fungal microbiota dysbiosis in IBD. Gut 66, 1039-1048 (2017).; He, X.-X. et al. Relationship between clinical features and intestinal microbiota in Chinese patients with ulcerative colitis. World J. Gastroenterol. 27, 4722-4737 (2021).; Clooney, A. G. et al. Ranking microbiome variance in inflammatory bowel disease: a large longitudinal intercontinental study. Gut 70, 499-510 (2021)).

[0145] A total of 1,414 lipid molecular species across 86 lipid subclasses were profiled in stool samples using liquid chromatography-tandem mass spectrometry (LC-MS / MS). Results showed that 130 lipids were significantly decreased in the UC group (less than half-fold, Tables 5-1 to 5-3), and 176 lipids were increased (more than two-fold, Tables 6-1 to 6-4).

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153] A score plot of principal component analysis (PCA) demonstrated lipidome alterations in UC patients (Fig. 2A). A volcano plot of UC vs. healthy controls revealed that seven lipid subclasses, including dihexosylceramide (Hex2Cer), sphingomyelin (SM), and ether-linked phospholipids, were increased in UC patients (Fig. 2B). Increased lactosylceramide levels in serum and in the inflamed colon, and increased SM concentrations in feces, have been reported in UC (Franzosa, E. A. et al. Gut microbiome structure and metabolic activity in inflammatory bowel disease. Nat Microbiol 4, 293-305 (2019)., Brown, E. M. et al. Bacteroides-Derived Sphingolipids Are Critical for Maintaining Intestinal Homeostasis and Symbiosis. Cell Host Microbe 25, 668-680.e7 (2019)., Filimoniuk, A., Blachnio-Zabielska, A., Imierska, M., Lebensztejn, D. M. & Daniluk, U. Sphingolipid Analysis Indicate Lactosylceramide as a Potential Biomarker of Inflammatory Bowel Disease in Children. Biomolecules 10, (2020), Bazarganipour, S. et al. The Lipid Status in Patients with Ulcerative Colitis: Sphingolipids are Disease-Dependent Regulated. J. Clin. Med. Res. 8, (2019).) An increase in ether phospholipids, which has not been reported previously, was also observed in UC (Figure 2B).Recent studies have identified Hex2Cer and ether phospholipids as lipids characteristic of neutrophils (Morgan, P. K. et al. A lipid atlas of human and mouse immune cells provides insights into ferroptosis susceptibility. Nat. Cell Biol. 26, 645-659 (2024)). Increased levels of these lipids in UC are presumably associated with increased neutrophil numbers in the colon. Volcano plots showed decreased levels of lipid subclasses, including unconjugated bile acids and ceramide β-hydroxy fatty acid-dihydrosphingosine (Cer-BDS) (Li, W. et al. A bacterial bile acid metabolite modulates Treg activity through the nuclear hormone receptor NR4A1. Cell Host Microbe 29, 1366-1377.e9 (2021)), in UC (Figure 2B). Fecal unconjugated bile acids and dihydroceramide levels have been shown to be decreased in both UC and CD patients (Lloyd-Price, J. et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662 (2019).; Brown, E. M. et al. Bacteroides-derived sphingolipids are critical for maintaining intestinal homeostasis and symbiosis. Cell Host Microbe 25, 668-680.e7 (2019).; Weng, Y. J. et al. Correlation of diet, microbiota, and metabolite networks in inflammatory bowel disease. J. Dig. Dis. 20, 447-459 (2019)).

[0154] Untargeted lipidomics also highlighted significant decreases in N-acyloxyacylornithine (NAAO, also known as ORN-FAHFA or ornithine lipids (Weng, YJ et al. Correlation of diet, microbiota and metabolite networks in inflammatory bowel disease. J. Dig. Dis. 20, 447-459 (2019)., Wood, PL Fatty Acyl Esters of Hydroxy Fatty Acid (FAHFA) Lipid Families. Metabolites 10, (2020).) and ceramide-esterified β-hydroxy fatty acid-dihydrosphingosine (Cer-EBDS) levels (Figure 2B-D). The MS / MS spectra were consistent with a previous report on NAAO detected in mouse feces (Figure 6) (Zhang, Q. et al. Genetic mapping of microbial and host traits reveals production of immunomodulatory lipids by Akkermansia muciniphila in the murine gut. Nat Microbiol 8, 424-440 (2023)). The levels of the two identified NAAO and three Cer-EBDS molecular species were reduced in UC patients (Figure 2E, F). The levels of NAAO molecules were also significantly reduced in UC patients from the Integrated Human Microbiome Project (iHMP) (Lloyd-Price, J. et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662 (2019)) (Figure 2G, H). Interestingly, fecal NAAO levels were not reduced in CD patients. In contrast, Cer-EBDS levels were decreased in both UC and CD compared with healthy controls. These findings indicate that UC patients exhibit an abnormal fecal lipidome with significant decreases in NAAO and Cer-EBDS.

[0155] (Example 2) Production of UC-related lipids by indigenous intestinal bacteria In this example, it was demonstrated that UC-related lipids are produced by indigenous intestinal bacteria.

[0156] (Materials and Methods) See experimental section

[0157] (Results) Because NAAO and Cer-EBDS have been reported as bacterial-associated lipids, we investigated whether these UC-associated lipids are produced by the gut microbiota. Reanalysis of fecal lipidome data from antibiotic-treated mice (Yasuda, S. et al. Elucidation of Gut Microbiota-Associated Lipids Using LC-MS / MS and 16S rRNA Sequence Analyses. iScience23, 101841 (2020)) revealed a more than 10-fold decrease in the levels of NAAO and Cer-EBDS in the antibiotic-treated group (Figure 7). This suggests that fecal NAAO and Cer-EBDS are of bacterial origin. NAAO is synthesized from ornithine by OlsB and OlsA from the soil bacterium Sinorhizobium meliloti (Gao, J.-L. et al. Identification of a gene required for the formation of lyso-ornithine lipid, an intermediate in the biosynthesis of ornithine-containing lipids. Mol. Microbiol. 53, 1757-1770 (2004)). OlsF from Serratia proteamaculans is a bifunctional protein that can catalyze the two-step reaction of NAAO synthesis (Fig. 3A) (Vences-Guzman, M. A. et al. Discovery of a bifunctional acyltransferase responsible for ornithine lipid synthesis in Serratia proteamaculans. Environ. Microbiol. 17, 1487-1496). (2015).

[0158] To predict the NAAO-producing enzyme genes in gut bacteria, we used Blastp to select 43 representative human microbial genomes (Zou, Y. et al. 1,520 reference genomes from cultivated human gut bacteria enable functional microbiome analyses. Nat. Biotechnol. 37, 179-185 (2019)). A homology search was performed. OlsF homologs were detected in Odoribacter splanchnicus, Odoribacter laneus, Alistipes indistinctus, and Akkermansia muciniphila with query coverage of 60% or higher and e-values ​​of less than 10-50 (Figure 3B). No homologous sequences were detected for OlsA or OlsB. To investigate the NAAO productivity of closely related species, commonly available Odoribacter, Alistipes, and Akkermancia strains were cultured anaerobically and subjected to lipidomics. As a result, NAAO production was observed in O. splanchnicus, A. muciniphila, O. laneus, and A. indistinctus, which have highly homologous OlsF sequences (Figure 3C-D). Among these, O. splanchnicus, which possesses Odosp_2289, produced abundant NAAO (Figure 3C-D). On the other hand, A. finegoldii and A. senegalensis, which have partial OlsF homology, showed significantly lower NAAO levels (Figure 3C-D). Metagenomic data indicated that O. The abundance of O. splanchnicus was significantly decreased in UC patients, whereas the abundance of Akkermansia and Alistipes remained unchanged in this study (Fig. 3E-G). The abundance of Odoribacter was positively correlated with the total NAAO level in human fecal samples (Fig. 8A). These results suggest that a reduction in O. splanchnicus in UC patients may lead to a reduction in NAAO in feces.

[0159] Example 3: Identification of Odosp_2289 as the NAAO-producing enzyme in O. spanchnicus. Recombinant Odosp_2289 was expressed in E. coli and lipidomics analysis revealed in vitro production of NAAO and its precursor NAO (Figures 4A-C). The MS / MS spectrum of NAAO 14:0;O(FA 16:0) was identical to that of O. spanchnicus (Figure 4D). Two homologous sequences of Odosp_2289 were detected in human fecal metagenomic data at thresholds of at least 60% coverage and 60% identity (Figure 4E). HSM7J4NU_k119_6275_6 and kraken:taxid|3010607|HumGut_10607_101_4 showed 99.8% and 73.3% similarity, respectively. As expected, these genes were more frequently detected in healthy individuals than in UC patients (Fig. 4E, F). HSM7J4NU_k119_6275_6 contained a single N16D mutation compared to Odosp_2289 derived from O. splanchnicus strain JCM15291 (Fig. 4G). The recombinant Odosp_2289 N16D mutant expressed in E. coli catalyzed NAO and NAAO production comparable to that of wild-type Odosp_2289 (Fig. 4H-J). Furthermore, the abundance of these genes in stool samples was positively correlated with the amount of total NAAO (Fig. 4B). These results emphasize that the reduction of O. splanchnicus in UC patients is associated with a reduction in NAAO.

[0160] The enzymes containing the N16D mutation for Odosp_2289 derived from O. splanchnicus strain JCM15291 of O. splanchnicus are SEQ ID NO: 5 and SEQ ID NO: 6 (nucleic acid and protein, respectively).

[0161] Example 4: NAAO exhibits anti-inflammatory and tissue-protective effects in colitis. Next, we investigated the biological activity of NAAO in vivo. NAAO purified from cultured O. splanchnicus was intraperitoneally administered to mice treated with 2.5% dextran sodium sulfate (DSS) (Figures 9A-D, 5A). NAAO-administered mice exhibited reduced weight loss and rapidly regained weight by the third day after water administration (Figure 5B). Furthermore, NAAO administration inhibited DSS-induced colonic regression (Figure 5C).

[0162] In the NAAO-treated group, decreased expression of lipocalin-2 and increased expression of Ki67, Occludin, Zo-1, and Zo-2 were observed (Figures 5D-H). Histologically, crypt loss and immune cell infiltration were significantly suppressed in the NAAO-treated group (Figure 5I). These results suggest that NAAO produced by O. splanchnicus, which is reduced in UC, exerts anti-inflammatory and tissue-protective effects in colitis.

[0163] Example 5: Identification of the receptor for NAAO

[0164] This example demonstrates the identification of the receptor for NAAO and demonstrates that NAAO is a ligand for MRGPRX4 and Mrgprb5.

[0165] To elucidate the mechanism underlying NAAO-mediated suppression of colitis, we investigated potential target receptors of NAAO expressed in host cells. Because microbial N-acyl amino acids are known to affect intestinal homeostasis via GPCRs, we focused on GPCRs and examined the activity of NAAO against 333 GPCRs using a TGFα shedding assay (Inoue, A., Ishiguro, J., Kitamura, H., Arima, N., Okutani, M., Shuto, A., Higashiyama, S., Ohwada, T., Arai, H., Makide, K., et al. (2012). TGFα shedding assay: an accurate and versatile method for detecting GPCR activation. Nat. Methods 9, 1021-1029.) (Table 7).

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175] Comprehensive screening showed that NAAO activated human MAS-related GPR member X4 (MRGPRX4) and mouse MAS-related GPR member B5 (MrgB5), both of which belong to the same family as MRGPRX4 (Fig. 10A). Concentration-response curves for MRGPRX4 and MrgB5 revealed that NAAO activated these two receptors in a concentration-dependent manner (Fig. 10B). The half-maximal effective concentrations (EC50s) were 16.6 μM for MRGPRX4 and 7.5 μM for MrgB5, significantly lower than the estimated concentrations of NAAO in mouse feces (approximately 118-208 μM), suggesting the physiological relevance of this interaction. MRGPRX4 is an itch receptor (Cao, C., Kang, HJ, Singh, I., Chen, H., Zhang, C., Ye, W., Hayes, BW, Liu, J., Gumpper, RH, Bender, BJ, et al. (2021). Structure, function and pharmacology of human itch GPCRs. Nature 600, 170-175.), and although several ligands have been identified, the cross-reactivity of these ligands with mouse Mrgprs remains largely unknown. We tested whether known MRGPRX4 ligands can activate MrgB5. The synthetic MRGPRX4 ligand MS47134 and the endogenous ligand DCA (Meixiong, J., Vasavda, C., Snyder, SH, and Dong, X. (2019). MRGPRX4 is a G protein-coupled receptor activated by bile acids that may contribute to cholestatic pruritus. Proc. Natl. Acad. Sci. U.S.A. 116, 10525-10530.) activated MRGPRX4 (EC50 values ​​of MS47134 and DCA were 12.94 μM and 9.52 μM, respectively) and MrgB5 (EC50 values ​​of MS47134 and DCA were 42.3 μM and 15.6 μM, respectively) (Figure 12A-C).In particular, ornithine did not activate MRGPRX4, suggesting that hydrophobic groups such as acyl chains are required for MRGPRX4 recognition, consistent with the observation that both MS47134 and NAAO have two hydrophobic groups and a structurally similar polar head group (Fig. 12D). These results indicate that human MRGPRX4 and mouse MrgB5 share common ligand recognition properties, including with NAAO produced by O. splanchnicus.

[0176] (Example 6) The anti-inflammatory effect of NAAO is not exhibited in MrgB5-deficient mice In this example, in order to clarify the role of the NAAO receptor in vivo, the relationship with the anti-inflammatory effect was investigated.

[0177] Finally, we investigated the role of MrgB5 in NAAO-mediated suppression of DSS-induced colitis in mice. Profiling of MrgB5 mRNA expression levels in multiple mouse tissues revealed that MrgB5 was highly expressed in the colon of wild-type mice (Fig. 13A). We confirmed that MrgB5 was not expressed in the colon of MrgB5-deficient (MrgB5 KO) mice, in which a 296-bp MrgB5 sequence was deleted and a 3-bp MrgB5 insertion was performed (Fig. 13B-D). NAAO obtained from O. splanchnicus was administered to MrgB5 wild-type and KO mice treated with 2.5% DSS (Fig. 11A). Although there was no significant change in body weight loss during the acute phase of DSS-induced colitis in WT and KO mice, the suppression of colonic regression by NAAO was reversed in MrgB5 KO mice (Fig. 11B, C).Similarly, the attenuation of inflammatory phenotypes, such as histological loss of crypts, immune cell infiltration, and inflammatory marker expression, by NAAO supplementation in WT mice was also reversed in MrgB5 KO mice (Fig. 11D-F). To gain insight into the intestinal cells expressing MrgB5, we analyzed publicly available RNA-Seq data (Forster, PM, Jakob, MO, Yusuf, D., Bubeck, M., Limberger, H., Luo, Y., Thieme, P., Polici, A., Sterczyk, N., Boulekou, S., et al. (2025). A transcriptional atlas of gut-innervating neurons reveals activation of interferon signaling and ferroptosis during intestinal inflammation. Neuron S0896-6273, 00136-00139.). The transcriptional atlas of gut-innervating neurons revealed high expression of MrgB5 in the vagus ganglion (VG) and dorsal root ganglion (DRG) (Figure 12E). Furthermore, the expression level of MrgB5 in the large intestine was increased in the DSS-treated group compared with the control group, suggesting that MrgB5 is involved in sensing microbial lipids in the inflammatory response (Fig. 12E).These findings reveal that the NAAO-MrgB5 axis is involved in intestinal homeostasis, which may be mediated by the enteric nervous system.

[0178] (Results) To summarize the above examples, previous studies have shown that synthetic NAAO suppresses LPS-induced inflammatory responses in BMDM. To evaluate the anti-inflammatory effects of NAAO on colitis, total NAAO was isolated from O. splanchnicus cultures by thin-layer chromatography and intraperitoneally administered to mice with 2.5% dextran sulfate sodium (DSS)-induced colitis (Figs. 9A–D, 4A). After 5 days of co-administration of DSS and NAAO, recovery phenotypes were assessed. NAAO-administered mice exhibited reduced weight loss and rapidly regained weight on the third day of water administration (Fig. 4B). DSS-induced colonic regression, histological loss of crypts, and immune cell infiltration were significantly suppressed (Fig. 4C, E). Furthermore, increased expression levels of Ki67, a marker of cell proliferation, were observed with co-administration of NAAO and DSS (Fig. 4D). These results indicate that NAAO is one of the bacterial-derived tissue protective factors.

[0179] (Discussion) In this study, we comprehensively profiled lipidome changes associated with dysbiosis in UC patients. The characteristic microbiome changes in UC patients, including an increase in facultative anaerobes and a decrease in obligate anaerobes, were consistent with known values ​​(Figure 1C) (Rigottier-Gois, L. Dysbiosis in inflammatory bowel diseases: the oxygen hypothesis. ISME J. 7, 1256-1261 (2013). Ning, L. et al. Microbiome and metabolome features in inflammatory bowel disease via multi-omics integration analyses across cohorts. Nat. Commun. 14, 7135 (2023)). Dysbiosis of the gut microbiota may affect colitis through changes in microbial metabolites. Representative examples are short-chain fatty acid and tryptophan metabolites, which exhibit anti-inflammatory effects and improve epithelial barrier function through the induction of regulatory T (Treg) cell and aryl hydrocarbon receptor activation (Furusawa, Y. et al. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature 504, 446-450 (2013); Scott, S. A., Fu, J. & Chang, P. V. Microbial tryptophan metabolites regulate gut barrier function via the aryl hydrocarbon receptor. Proc. Natl. Acad. Sci. U. S. A. 117, 19376-19387 (2020)). However, these are limited observations on bacterial metabolites. In particular, the relationship between bacterial-derived lipid metabolites and IBD remains unclear.Although some bacterial-specific metabolic products are sensed by the host immune system and receptors (Morozumi, S., Ueda, M., Okahashi, N. & Arita, M. Structures and functions of the gut microbial lipidome. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 1867, 159110 (2022)), current IBD research primarily focuses on host-derived lipids (Franzosa, E. A. et al. Gut microbiome structure and metabolic activity in inflammatory bowel disease. Nat Microbiol 4, 293-305 (2019)). Several pioneering studies focusing on bacterially produced unconjugated bile acids and Cer-BDS have demonstrated their close association with IBD and emphasized the importance of comprehensive profiling of bacterial lipids (Lloyd-Price, J. et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662 (2019)., Brown, E. M. et al. Bacteroides-Derived Sphingolipids Are Critical for Maintaining Intestinal Homeostasis and Symbiosis. Cell Host Microbe 25, 668-680.e7 (2019).).To address this issue, we analyzed stool samples from HV and UC patients using a previously developed untargeted lipidomics technique targeting microbial lipids (Yasuda, S. et al. Elucidation of Gut Microbiota-Associated Lipids Using LC-MS / MS and 16S rRNA Sequence Analyses. iScience 23, 101841 (2020). Tsugawa, H. et al. A lipidome atlas in MS-DIAL 4. Nat. Biotechnol. 38, 1159-1163 (2020).). The results suggested that alterations in lipid signatures in UC patients are closely related not only to the inflammatory state of the host but also to microbial dysregulation (Figure 2A, B).Similar to previous studies (Franzosa, E. A. et al. Gut microbiome structure and metabolic activity in inflammatory bowel disease. Nat Microbiol 4, 293-305 (2019)., Brown, E. M. et al. Bacteroides-Derived Sphingolipids Are Critical for Maintaining Intestinal Homeostasis and Symbiosis. Cell Host Microbe 25, 668-680.e7 (2019).), the amount of host-derived Hex2Cer and SM increased, and Cer-BDS produced by Bacteroides (Brown, E. M. et al. Bacteroides-Derived Sphingolipids Are Critical for Maintaining Intestinal Homeostasis and Symbiosis. Cell Host Microbe 25, 668-680.e7 (2019).) and bacterial bile acid hydrolase (Grill, J., Schneider, The amounts of microbial lipids, such as bile acids, deconjugated by Bifidobacterium longum BB536 (F., Crociani, J. & Ballongue, J. Purification and Characterization of Conjugated Bile Salt Hydrolase from Bifidobacterium longum BB536. Appl. Environ. Microbiol. 61, 2577-2582 (1995)), were decreased in UC (Fig. 2B). Some of the bacterial species associated with the production of these lipids were altered, which may be involved in the UC condition (Fig. 1C).

[0180] Untargeted lipidomics also revealed novel decreases in the bacterial lipids Cer-EBDS and NAAO in UC patients. Cer-EBDS was previously detected in mouse feces (Yasuda, S. et al. Elucidation of Gut Microbiota-Associated Lipids Using LC-MS / MS and 16S rRNA Sequence Analyses. iScience 23, 101841 (2020)), but the producing bacteria, enzyme gene, and function remain unknown. NAAO-producing bacteria have mainly been studied in environmental soil bacteria (Gao, J.-L. et al. Identification of a gene required for the formation of lyso-ornithine lipid, an intermediate in the biosynthesis of ornithine-containing lipids. Mol. Microbiol. 53, 1757-1770 (2004)., Vences-Guzman, M. A. et al. Discovery of a bifunctional acyltransferase responsible for ornithine lipid synthesis in Serratia proteamaculans. Environ. Microbiol. 17, 1487-1496 (2015).), but only A. muciniphila (Zhang, Q. et al. Genetic mapping of microbial and host traits reveals production of immunomodulatory lipids by Akkermansia muciniphila in the murine gut. Nat Microbiol 8, 424-440 (2023).), but the NAAO-producing enzyme has not been identified.A sequence homology search of the NAAO-producing enzyme OlsF from S. proteamaculans suggested that Odosp_2289 from O. splanchnicus and AKMU_06360 from A. muciniphila are potential NAAO-producing enzymes in enterobacteria (Fig. 3B, C). Importantly, fecal metagenomic analysis of healthy volunteers revealed a highly homologous N16D variant of Odosp_2289, which was nearly depleted in UC patients (Fig. 4E). As expected, heterologous expression of Odosp_2289 and its N16D variant in E. coli resulted in the production of NAAO (Fig. 4C, J). Since other NAAO-producing bacteria, Alistipes and Akkermansia, were not reduced or were not detected (Fig. 3F, G), it is possible that NAAO was mainly produced by the Odosp_2289 N16D mutant of Odoribacter in this human sample study.

[0181] Furthermore, administration of NAAO fractionated from O. splanchnicus inhibited the progression of colitis in mice (Figure 5). This anti-inflammatory effect was confirmed by a recent report showing that synthetic NAAO suppressed LPS-induced inflammatory responses in bone marrow-derived macrophages (BMDMs) (Zhang, Q. et al. Genetic mapping of microbial and host traits reveals production of immunomodulatory lipids by Akkermansia muciniphila in the murine gut. Nat Microbiol 8, 424-440 (2023).). Taken together, these findings suggest that NAAO produced by the Odosp_2289 N16D mutant of O. splanchnicus may suppress the development of UC in healthy individuals.

[0182] Several studies have demonstrated that Odoribacter has anti-inflammatory and tissue-protective properties, but the mechanisms are still limited. A decrease in Odoribacter abundance has been reported in patients with IBD (Lloyd-Price, J. et al. Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases. Nature 569, 655-662 (2019)). Another study showed that O. splanchnicus was frequently detected in responders and donors in clinical trials of fecal transplantation (FMT) for UC patients (Lima, S. F. et al. Transferable Immunoglobulin A-Coated Odoribacter splanchnicus in Responders to Fecal Microbiota Transplantation for Ulcerative Colitis Limits Colonic Inflammation. Gastroenterology162, 166-178 (2022)). A study investigating the relationship between gut barrier function and the microbiota in patients with acute myeloid leukemia showed that the amount of O. splanchnicus was negatively correlated with the amount of plasma lipopolysaccharide-binding protein. These studies suggest that O. splanchnicus is a positive regulator of barrier function (Potgens, S. A. et al. Gut microbiota alterations induced by intensive chemotherapy in acute myeloid leukemia patients are associated with gut barrier dysfunction and body weight loss. Clin. Nutr. 42, 2214-2228 (2023)). Despite these plausible observations, the bioactive molecules of O. splanchnicus related to barrier function remain unknown.Another study showed that outer membrane vesicles of O. splanchnicus dose-dependently suppressed lipopolysaccharide (LPS)-induced IL-8 production in HT-29 cells (Hiippala, K. et al. Novel Odoribacter splanchnicus Strain and Its Outer Membrane Vesicles Exert Immunoregulatory Effects in vitro. Front. Microbiol. 11, 575455 (2020)). The mechanism by which O. splanchnicus monocolonization suppresses DSS-induced colitis has been explained by short-chain fatty acids (SCFA) (Lima, S. F. et al. Transferable Immunoglobulin A-Coated Odoribacter splanchnicus in Responders to Fecal Microbiota Transplantation for Ulcerative Colitis Limits Colonic Inflammation. Gastroenterology162, 166-178 (2022)). However, in A. finegoldii monocolonization, although a certain amount of SCFA was detected compared to germ-free mice, no protective effect against DSS susceptibility was observed, suggesting the presence of other intestinal protective factors in O. splanchnicus. This suggests that O. splanchnicus produces NAAO, but A. This is also explained by our data that it is not produced by S. finegoldii (Fig. 3C), highlighting a novel lipid-bacteria axis in colitis.These findings may provide new insights into the mechanisms underlying other Odoribacter-dependent diseases, such as non-alcoholic fatty liver disease and cystic fibrosis (Li, F. et al. Characteristics of fecal microbiota in non-alcoholic fatty liver disease patients. Sci. China Life Sci.61, 770-778 (2018)., Burke, D. G. et al. The altered gut microbiota in adults with cystic fibrosis. BMC Microbiol. 17, 58 (2017).). Outside of IBD and barrier dysfunction, the anti-inflammatory effects of Odoribacter are explained by isoallo-lithocholic acid (LCA), a functional stereoisomer of LCA that is enriched in centenarians (Sato, Y. et al. Novel bile acid biosynthetic pathways are enriched in the microbiome of centenarians. Nature 599, 458-464(2021).), promoting the induction of Treg cells (Hang, S. et al. Bile acid metabolites control TH17 and Treg cell differentiation. Nature 576, 143-148 (2019).) and anti-inflammatory Kupffer cells (Miyamoto, Y. et al. Periportal macrophages protect against commensal-driven liver inflammation. Nature (2024)doi:10.1038 / s41586-024-07372-6.). Although our untargeted lipidomics system did not allow us to quantify isoallo-LCA separately from LCA, two unspecified LCA isomers (ST 24:1 O3) showed a tendency to decrease in UC (p = 0.063 and 0.075, respectively). The differences in the bioactivity and synergistic effects of isoallo-LCA and NAAO are intriguing.

[0183] These results demonstrate that dysregulation of the fecal lipidome, including NAAO, in UC patients is associated with gut bacterial dysbiosis, and that NAAO exerts anti-inflammatory and tissue-protective effects in colitis. These findings provide a basis for safe FMT treatment and quality control of FMT by measuring NAAO, as well as the possibility of a novel postbiotic therapeutic strategy for UC.

[0184] Our findings demonstrate functional similarities in the ligand recognition profiles and tissue expression patterns of the human MRGPRX4 and mouse MrgB5 receptors, suggesting evolutionary conservation of their roles in sensory signaling and intestinal homeostasis. MRGPRX4 recognizes negatively charged ligands, including MS4713434, a selective MRGPRX4 chemical ligand. The polar head structure of MS47134 is conserved in NAAO, indicating that NAAO shares similar properties with MS47134. Importantly, MS47134, DCA, and NAAO all activate both MRGPRX4 and MrgB5, providing strong evidence that MrgB5 is the mouse ortholog of human MRGPRX4. Recently, ornithine-containing lipids have been reported to be partial agonists / antagonists of TLR4 and inhibit LPS-induced cytokine production (Zhang, Q., Linke, V., Overmyer, KA, Traeger, LL, Kasahara, K., Miller, IJ, Manson, DE, Polaske, TJ, Kerby, RL, Kemis, JH, et al. (2023). Genetic mapping of microbial and host traits reveals production of immunomodulatory lipids by Akkermansia muciniphila in the murine gut. Nat Microbiol 8, 424-440., Pizzuto, M., Hurtado-Navarro, L., Molina-Lopez, C., Soubhye, J., Gelbcke, M., Rodriguez-Lopez, S., Ruysschaert, J.-M., Schroder, K., and Pelegrin, P. (2024). Ornithine lipid is a partial TLR4 agonist and NLRP3 activator. Cell Rep. 43, 114788.).In contrast to TLR4 (effective concentration: 100-200 μM), NAAO was able to activate MRGPRX4 and MrgB5 at low concentrations (approximately 10 μM), suggesting that NAAO is a potent endogenous ligand for MRGPR. The role of MRGPRX4 and MrgB5 expressed in neurons during colitis remains unclear. Previous reports have shown that vagotomy affects the development of oral tolerance and increases susceptibility to develop colitis independently of the alpha-7 nicotinic receptor. Mol. Med. 22, 464-476., Teratani, T., Mikami, Y., Nakamoto, N., Suzuki, T., Harada, Y., Okabayashi, K., Hagihara, Y., Taniki, N., Kohno, K., Shibata, S., et al. (2020). The liver-brain-gut neural arc maintains the Treg cell niche in the gut. Nature 585, 591-596.) Vagus nerve stimulation, on the other hand, ameliorates murine colitis (Youssef, A., Rehman, A.U., Elebasy, M., Roper, J., Sheikh, S.Z., Karhausen, J., Yang, W., and Ulloa, L. (2024). Vagal stimulation ameliorates murine colitis by regulating SUMOylation. Sci. Transl. Med. 16, eadl2184.).This suggests that the NAAO-MrgB5 axis in the VG may contribute to the suppression of colitis. Stimulation with DCA, a ligand of MRGPRX4 and Mrgprb5, increases Ca in vagal sensory neurons. 2+ It has been reported that bile acids induce Ca influx (Mamedova, E., Arting, LB, and Rekling, JC (2022). 2+Signaling and membrane permeabilizations in vagal nodose ganglion neurons. Biochem. Biophys. Rep. 31, 101288.) These findings suggest that similar ligands, including NAAO, may stimulate vagal sensory neurons. Previous scRNA-seq analysis showed that both Mrgprb5 and MRGPRX4 are expressed in non-peptidylergic neurons of the DRG, suggesting that Mrgprb5 and MRGPRX4 are expressed in both mice and humans (Hockley, JRF, Taylor, TS, Callejo, G., Wilbrey, AL, Gutteridge, A., Bach, K., Winchester, WJ, Bulmer, DC, McMurray, G., and Smith, ESJ (2019). Single-cell RNAseq reveals seven classes of colonic sensory neurons. Gut 68, 633-644, Yu, H., Nagi, SS, Usoskin, D., Hu, Y., Kupari, J., Bouchatta, O., Yan, H., Cranfill, SL, Gautam, M., Su, Y., et al. (2024). Leveraging deep These results suggest that MRGPRX4 is expressed in tissues similar to those of the somatosensory system (single-soma RNA sequencing to explore the neural basis of human somatosensation. Nat. Neurosci. 27, 2326-2340.). Although MRGPRX4 ligands 5, including NAAO and DCA, are decreased in UC patients, further detection of MRGPRX4-expressing cells and analysis of their expression levels in UC patients are needed to understand whether MRGPRX4 itself is involved in the pathogenesis of UC. Collectively, these results demonstrate that dysregulation of the fecal lipidome, including NAAO, in UC patients is associated with dysbiosis, and that NAAO exerts anti-inflammatory and tissue-protective effects in colitis.Our findings, in addition to safe FMT treatment and quality control by NAAO measurement, suggest the possibility of a novel postbiotic treatment strategy for UC.

[0185] Example 7: Evaluation of immunomodulatory effect of NAAO alone In this example, synthetic NAAO was used to evaluate changes in immune response in a mouse model of inflammatory bowel disease. C57BL / 6 mice were administered dextran sulfate sodium (DSS) to induce enteritis, and NAAO was orally administered in parallel (10 mg / kg / day, for 7 consecutive days). As a result, the expression of inflammatory markers (TNF-α, IL-1β) in intestinal tissue was significantly reduced in the NAAO-administered group compared to the control group, and CD4 + Foxp3 + The proportion of regulatory T cells was confirmed to increase, indicating that NAAO contributes to maintaining intestinal immune homeostasis and alleviating inflammation.

[0186] Example 8: Development and Application of a Formulation Containing NAAO In this example, an oral capsule formulation containing NAAO was prepared using techniques available in the art and administered to MRL / lpr mice, an autoimmune disease model, to examine its effect on disease progression. Repeated administration over an 8-week period confirmed a decrease in nephritis score, a decrease in serum anti-dsDNA antibody titer, and a decrease in the number of IL-17-positive cells in the spleen. This demonstrates that this formulation has a disease-modifying effect on autoimmune inflammatory diseases.

[0187] Example 9: Regulation of endogenous NAAO concentration by using NAAO precursor. To promote the endogenous production of NAAO, an oxyacylated ornithine derivative (precursor P) was synthesized and administered to germ-free mice to induce NAAO production in vivo. LC-MS / MS analysis confirmed that precursor P was rapidly acylated and hydrolyzed in the liver to be converted to active NAAO. Increased NAAO concentration was associated with increased expression of regulatory macrophages (CD206) in gut-associated lymphoid tissues. + ) is observed, and a suppressive shift in immune response is observed.

[0188] Example 10: Identification and Application of an Enzyme Capable of Synthesizing NAAO A novel acyltransferase involved in NAAO synthesis, identified from a specific strain of the enterobacterial genus Odoribacter (the nucleic acid sequence is shown in SEQ ID NO: 5 and the amino acid sequence is shown in SEQ ID NO: 6), was expressed in BL21(DE3) Escherichia coli. Biosynthesis of NAAO from ornithine and fatty acid CoA substrates was confirmed in vitro using the purified enzyme. Oral administration of the resulting NAAO-containing reaction solution to mice resulted in significant improvements in skin erythema scores in an autoimmune dermatitis model.

[0189] Example 11: Disease prevention effect of administration of NAAO-producing organisms. The enzyme used in Example 10 was a modified strain (high-NAAO expression strain) of the human intestinal flora of the genus Odoribacter, and was orally administered once a week to germ-free mice. After four weeks, NAAO concentrations were significantly elevated in feces and plasma, and reductions in inflammatory cytokines (IL-6, MCP-1) and strengthening of the intestinal mucosal barrier were confirmed. Furthermore, reductions in joint swelling scores and suppression of osteoclast numbers were observed in an arthritis model, indicating a microorganism-mediated autoimmune suppression effect.

[0190] Example 12: Multistage NAAO supplementation strategy using a combination of precursors, enzymes, and organisms. In this example, a complex supplementation system combining the aforementioned precursor P, NAAO-synthase enzyme, and a modified strain of Odoribacter bacteria was constructed and applied to a humanized mouse model. The precursor was absorbed and metabolized in the liver, and the modified bacteria colonized the intestine, where exogenously administered enzymes promoted local NAAO production. During the treatment period, pathology scores in inflammatory bowel disease model mice were significantly improved, and IL-10-producing cells increased. This combination product demonstrates the potential for development as a regenerative medicine product or medical device.

[0191] Example 13: Examination of the effect of MRGPRX4 activation on the suppression of inflammatory cytokines (in vitro test) Human peripheral blood mononuclear cells (PBMCs) were separated by Ficoll-Paque density gradient centrifugation and cultured in RPMI-1640 medium (containing 10% FBS). Compound A, a candidate MRGPRX4 agonist, was added to the cells at final concentrations of 1 μM, 10 μM, and 100 μM. The cells were then stimulated with lipopolysaccharide (LPS, 100 ng / mL) and incubated for 6 hours.

[0192] The concentrations of TNF-α, IL-6, and IL-1β in the culture supernatant were then measured by ELISA. In the Compound A-treated group, a significant decrease in cytokines was observed at all concentrations compared to the control group (p<0.01). This result indicates that activation of MRGPRX4 has the effect of suppressing the production of inflammatory cytokines.

[0193] Example 14 Screening for MRGPRX4 Agonists (Cell-Based Assay) HEK293 cells are transfected with an expression vector (pcDNA3.1-MRGPRX4) encoding human MRGPRX4, and selected with G418 to establish a stable expression line. The cells are loaded with the calcium indicator Fluo-4AM, and a compound library (e.g., n = 1,280 species) is sequentially added, and changes in fluorescence intensity due to calcium influx are measured in real time.

[0194] Screening results show that multiple compounds induce an MRGPRX4-dependent increase in fluorescence intensity. Compounds previously shown to have activity (e.g., MS47134) are used as positive controls to confirm efficacy. In particular, candidate substances may be confirmed to exhibit a dose-dependent response, and their EC50 values ​​can be calculated, e.g., between 10 and 100 nM.

[0195] Example 15: Verification of the anti-inflammatory effect of Mrgprb5 activation (mouse ear edema model) Chloroacetophenone (CAP) was applied to C57BL / 6J mice (equal numbers of males and females) to create an ear inflammation model. Simultaneously, the Mrgprb5 agonist synthetic peptide P was subcutaneously administered (10 mg / kg, n=6).

[0196] After 24 hours, the thickness of the ear is measured with a vernier caliper, and the tissue is fixed with formalin and then stained with HE staining to observe the infiltration of inflammatory cells. It is confirmed that the swelling of the ear is suppressed in the peptide P-administered group compared to the non-administered control group, and the infiltration of inflammatory cells is significantly reduced.

[0197] Example 16: Construction of a gene therapy formulation using the MRGPRX4 gene and evaluation of its expression. An expression cassette containing the MRGPRX4 cDNA was constructed under the control of the CAG promoter and incorporated into an AAV2 vector. The resulting pAAV-CAG-MRGPRX4 vector was transfected into bone marrow-derived murine dendritic cells (BMDCs) at an MOI of 10. 4 The mice were infected with MRGPRX4. 48 hours after infection, RNA was extracted and the expression level of MRGPRX4 was evaluated by RT-qPCR. The results confirmed a 100-fold increase in expression compared to uninfected controls. Furthermore, the expression of inflammatory cytokines following LPS stimulation tended to decrease significantly.

[0198] Example 17: Synergistic anti-inflammatory effects of combined use of NAAO and MRGPRX4 or functional orthologue agonists. NAAO (10 mg / kg) and a compound (e.g., MS47134) (1 mg / kg) selective for Mrgprb5, a functional orthologue of MRGPRX4, were orally administered simultaneously to C57BL / 6 mice, and biological responses were assessed in an LPS-induced systemic inflammation model. The combination group showed significantly lower blood IL-6 and TNF-α concentrations and increased splenic regulatory T cell (Treg) levels compared to the single-drug administration group. This indicates that activation of NAAO and MRGPRX4 cooperatively contributes to maintaining immune homeostasis.

[0199] (Example 18) Gene therapy strategy combining NAAO-producing bacteria and MRGPRX4 expression vector

[0200] Mice colonized with a modified strain of Odoribacter bacteria (high NAAO production) were overexpressed using an AAV vector, which overexpresses Mrgprb5, a functional ortholog of MRGPRX4, in immune cells of the intestinal lamina propria. In the combined treatment group, inflammatory cytokines (IFN-γ, IL-17) were suppressed in the intestinal immune response, and the expression of mucosal barrier-related genes (Muc2, RegIIIγ) was increased. This indicates the establishment of a mucosal immune control mechanism through tripartite cooperation between microorganisms, receptors, and immune cells.

[0201] Example 19: Development of a topical skin formulation containing both NAAO synthase and MRGPRX4 activator. A topical ointment formulation containing NAAO synthase (liposome-encapsulated) and an MRGPRX4 agonist compound (e.g., MS47134) was prepared and applied to atopic dermatitis mouse models (NC / Nga). Daily application for two weeks confirmed improvement in skin barrier function (TEWL), suppression of epidermal thickening, and a significant reduction in eosinophil infiltration into the dermis. MRGPRX4 expression was localized in keratinocytes and immune cells, suggesting that local interaction with NAAO regulates inflammation.

[0202] Example 20: Companion diagnostic using MRGPRX4 as a diagnostic biomarker RT-qPCR is performed on a nucleic acid sample extracted from a human intestinal sample using specific primers designed based on the nucleic acid sequence set forth in SEQ ID NO: 25 to confirm the presence of MRGPRX4, and / or RT-qPCR is performed on microbial RNA extracted from a human fecal sample using specific primers to quantify the expression level of a sequence homologous to a gene encoding an enzyme that synthesizes an MRGPRX4 ligand (e.g., SEQ ID NO: 5). Patients who test positive for MRGPRX4 tend to exhibit a high therapeutic response to therapeutic agents that target MRGPRX4 (e.g., MRGPRX4 agonists and NAAO preparations). Thus, the presence of enterobacteria expressing MRGPRX4 and / or NAAO synthase functions as a biomarker for predicting therapeutic response, making it possible to use the companion diagnostic.

[0203] Example 21: Provision of a companion drug depending on the presence of MRGPRX4 and NAAO synthase In this example, to patients with MRGPRX4, depending on the presence or absence of intestinal bacteria expressing NAAO synthase, an NAAO preparation, an MRGPRX4 agonist, and / or bacteria expressing NAAO synthase are administered to improve the symptoms of inflammatory skin diseases. In contrast, if MRGPRX4 expression is not observed, switching to a drug targeting a different immune pathway (e.g., an IL-17 inhibitor) is recommended.

[0204] Thus, information on the presence of intestinal bacteria expressing MRGPRX4 and NAAO synthase is useful for determining individualized treatment strategies, and can be applied clinically as a combination of companion pharmaceuticals and diagnostic agents.

[0205] (Note) As described above, the present disclosure has been illustrated using preferred embodiments thereof, but it is understood that the scope of the present disclosure should be interpreted solely by the claims. It is understood that the patents, patent applications, and other documents cited in this specification are incorporated by reference into this specification in their entirety as if the contents themselves were specifically set forth herein. This application claims priority to Japanese Patent Application No. 2024-102442, filed with the Japan Patent Office on June 25, 2024, the specification of which is incorporated by reference in its entirety into this application.

[0206] The present disclosure has applications in the pharmaceutical industry.

[0207]

Claims

1. A composition, pharmaceutical, medical device, or regenerative medicine product for regulating the health condition, regulating the immune status, or preventing or treating autoimmune or inflammatory diseases in a subject, which comprises a means for altering or maintaining an appropriate level of N-acyloxyacylornithine (NAAO).

2. The means include: (a) a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (b) an agent containing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (c) a precursor of a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (d) an enzyme capable of synthesizing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; (e) a cell or organism (including a microorganism or fungus) capable of synthesizing a factor capable of regulating the expression or activity of NAAO, or MRGPRX4 or Mrgprb5, or an orthologue thereof; and (f) a combination of (c) and (d) and / or (e). The composition, pharmaceutical, medical device, or regenerative medicine product according to claim 1, comprising at least one selected from the group consisting of:

3. The composition, pharmaceutical product, medical device, or regenerative medicine product according to claim 1 or 2, which is selected from medicines, feed, foods (functional foods), food additives, supplements, and probiotics.

4. A method for regulating the health status of a subject, comprising altering or maintaining NAAO at an appropriate level.

5. The method according to claim 4 for the prevention or treatment of autoimmune / inflammatory diseases.

6. The method of any one of claims 4 or 5, wherein the autoimmune / inflammatory disease comprises ulcerative colitis.

7. A nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof.

8. A polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof.

9. A cell comprising a nucleic acid molecule comprising the nucleic acid sequence set forth in SEQ ID NO: 5 or a variant thereof.

10. An enzyme preparation comprising a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6 or a variant thereof.

11. A method for preventing or treating an inflammatory disease, disorder or condition, comprising activating MRGPRX4 or Mrgprb5, or an orthologue thereof.

12. A method for selecting a pharmaceutical agent for preventing or treating an inflammatory disease, disorder or condition, comprising selecting a candidate compound having the ability to modulate the activity of MRGPRX4 or Mrgprb5, or an orthologue thereof.

13. A pharmaceutical for preventing or treating an inflammatory disease, disorder or condition, comprising an activator of MRGPRX4 or Mrgprb5, or an orthologue thereof.

14. Pharmaceuticals, medical devices, or regenerative medicine products for gene therapy to prevent or treat inflammatory diseases, disorders, or symptoms, which contain a nucleic acid molecule containing a nucleic acid sequence encoding MRGPRX4 or Mrgprb5, or an ortholog thereof.

15. The method, composition, pharmaceutical, medical device, or regenerative medicine product according to any one of claims 11 to 14, wherein the MRGPRX4 or Mrgprb5, or an orthologue thereof, is encoded by the nucleic acid sequence set forth in SEQ ID NO: 25 or SEQ ID NO: 27, or a variant thereof, or comprises the amino acid sequence set forth in SEQ ID NO: 26 or SEQ ID NO: 28, or a variant thereof.

16. The method, composition, pharmaceutical, medical device, or regenerative medicine product according to any one of claims 1 to 15, wherein the method, composition, pharmaceutical, medical device, or regenerative medicine product is intended for humans.

Citation Information

Patent Citations

  • Modulators of MAS-related G protein receptor X4 and related products and methods

    JP2022529615A

  • Modulators of Mas-related G protein receptor X4, related products and methods of use thereof

    JP2023523545A

  • Modulators of MAS-associated G protein receptor X4 and related products and methods

    JP2023541944A

  • Transferable microbiota for the treatment of ulcerative colitis

    WO2021163672A1