An isothermal crispr-CAS based rapid viral diagnostic

An isothermal CRISPR-Cas 12-based detection system using padlock probes addresses the limitations of traditional herpesvirus diagnostics by enabling rapid, sensitive, and specific detection directly from clinical samples, suitable for diverse pathogens.

WO2026006339A2PCT designated stage Publication Date: 2026-01-02THE ADMINISTRATORS OF THE TULANE EDUCATIONAL FUND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035090
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-24
Filing Date
2025-06-24
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Current diagnostic methods for herpesviruses, particularly cytomegalovirus (CMV), are limited by their reliance on centralized laboratory infrastructure, need for trained personnel, and lack of standardization, hindering timely detection in immunocompromised patients and requiring complex thermal cycling equipment.

Method used

An isothermal CRISPR-Cas 12-based detection system using padlock probes, ligase, polymerase, and reporter molecules operates in a single reaction vessel without pre-incubation, enabling rapid and sensitive detection of herpesviruses directly from clinical samples without nucleic acid isolation.

Benefits of technology

The system provides rapid, sensitive, and specific detection of herpesviruses at the point-of-care, reducing turnaround time and costs, and is applicable to a wide range of pathogens including DNA, RNA, bacterial, and fungal species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035090_02012026_PF_FP_ABST
    Figure US2025035090_02012026_PF_FP_ABST
Patent Text Reader

Abstract

A one-pot isothermal CRISPR-Cas12a assay rapidly detects human pathogenic viruses, using padlock probes and reporter cleavage for sensitive, specific nucleic acid detection directly from clinical samples, enabling point-of-care diagnostics without complex instrumentation.
Need to check novelty before this filing date? Find Prior Art

Description

AN ISOTHERMAL CRISPR-CAS BASED RAPID VIRAL DIAGNOSTICCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 663,484 filed June 24, 2024. The entire contents of the above-identified application is hereby fully incorporated herein by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant No.(s) HD107790 and CA260581 granted by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] The contents of the electronic sequence listing (“TUL-0061WP_ST26.xml”; Size is 223,179 bytes and it was created on June 24, 2025) is herein incorporated by reference in its entirety.TECHNICAL FIELD

[0004] The subject matter disclosed herein is generally directed to the field of molecular diagnostics, particularly to rapid and sensitive nucleic acid detection methods for use in clinical diagnostics and point-of-care testing. More specifically, the invention pertains to one-pot isothermal amplification and CRISPR-Cas 12-based detection systems for identifying viral nucleic acids, including herpesviruses such as cytomegalovirus (CMV), in clinical samples.BACKGROUND

[0005] Herpesviruses, such as cytomegalovirus (CMV) and Epstein-Barr virus (EBV), are widespread DNA viruses that establish lifelong latent infections and can reactivate under specific clinical conditions. Among these, CMV presents a particularly significant challenge in both immunocompromised patients, such as those with solid organ and hematopoietic stem cell transplants, and in the context of congenital infection. Congenital CMV infection affects approximately 1 in 150 live births and is a leading non-genetic cause of neurodevelopmental impairment, including hearing loss and cognitive dysfunction. Whileup to 80% of congenital infections may be asymptomatic at birth, early detection is critical for intervention and improved outcomes. Recent studies also suggest that CMV reactivation during pregnancy can lead to adverse fetal and maternal health outcomes, underscoring the importance of sensitive detection techniques (Yue et al., 2023).

[0006] In transplant patients, CMV reactivation remains a major cause of morbidity and mortality, contributing to organ rejection and graft failure. However, current diagnostic methods, such as quantitative PCR (qPCR), although highly specific, are limited by their reliance on centralized laboratory infrastructure, the need for trained personnel, and a lack of standardization across different laboratories. These limitations hinder timely detection, especially of early reactivation events (Chandler H. Monk et al., 2024). Consequently, the development of point-of-care (POC) diagnostic tools that combine high sensitivity, rapid results, and ease of use is an urgent need.

[0007] An ideal diagnostic platform would enable the rapid and accurate detection of low-level viral DNA during the early stages of infection or reactivation. Isothermal nucleic acid amplification technologies present promising alternatives to traditional PCR, operating at a constant temperature and eliminating the need for complex thermal cycling equipment. When integrated with CRISPR-Cas 12-based detection, which offers high specificity via collateral cleavage activity upon target recognition, these technologies hold great potential for portable, rapid, and inexpensive diagnostics. However, most current CRISPR-based assays involve multiple steps and are not yet optimized for single-tube, one-pot formats suitable for true POC use.SUMMARY

[0008] In some aspects, the techniques described herein relate to a nucleic acid detection system including: (a) one or more padlock probes, each padlock probe including a 5' hybrid arm with a sequence complementary to a first region of a target nucleic acid and a 3' hybrid arm with a sequence complementary to a second, adjacent region of the target nucleic acid, wherein the padlock probe includes a linker region between the 5' hybrid arm and the 3' hybrid arm, and guide molecule target sequence; (b) a Cast 2 polypeptide; (c) a guide molecule specific to the guide molecule target sequence; (d) a ligase for circularizing the padlock probe; (e) a polymerase for amplifying the circularized padlock probe; and (f) areporter molecule capable of generating a detectable signal when cleaved by the Cast 2 polypeptide.

[0009] In an embodiment, the Casl2 polypeptide is at a concentration between 0.1 mM to 10 nM.

[0010] In an embodiment, the Casl2 polypeptide concentration is between 0.1 mM to 1 mM.

[0011] In an embodiment, the system does not include polyethylene glycol (PEG).

[0012] In an embodiment, the polymerase facilitates isothermal amplification between24-40 °C.

[0013] In an embodiment, the padlock probe does not include a PAM sequence in guide molecule target sequence.

[0014] In an embodiment, the guide molecule target sequence is in the 5' arm, the 3' arm, or portions of the guide molecule target sequence are in both the 5' and the 3' arm.

[0015] In an embodiment, the guide molecule target sequence is in the linker.

[0016] In an embodiment, the linker is 5-30 nucleotides.

[0017] In an embodiment, the linker is a poly-A linker or a scrambled linker.

[0018] In an embodiment, reaction components (a)-(f) are configured to operate without pre-incub ati on of the Cast 2 polypeptide with the guide molecule.

[0019] In an embodiment, the ligase is selected from the group consisting of SplintR ligase, Taq DNA ligase, T3 DNA ligase, and 9°N DNA ligase.

[0020] In an embodiment, the padlock probe is configured to detect a target nucleic acid is from a DNA virus, a RNA virus, a fungal pathogen, or a bacterial pathogen.

[0021] In an embodiment, the DNA virus is a herpesvirus.

[0022] In an embodiment, the herpesvirus is an alpha-herpesvirus, a beta-herpesvirus, a gamma-herpesvirus.

[0023] In an embodiment, the alpha-herpesvirus is herpes simplex virus type 1 (HSV-1, HHV-1), herpes simplex virus type 2 (HSV-2, HHV-2), or Varicella-Zoster virus (VZV, HHV-3).

[0024] In an embodiment, the beta-herpesvirus is cytomegalovirus (CMV, HHV-5), human herpesvirus 5 (HHV-6), or human herpesvirus-7 (HHV-7).

[0025] In some aspects, the techniques described herein relate to a system, wherein the beta-herpesvirus is CMV.

[0026] In some aspects, the techniques described herein relate to a system, wherein the padlock probe is configured to detect a UL123 target sequence.

[0027] In some aspects, the techniques described herein relate to the system, wherein the padlock probe is selected from the group consisting of SEQ ID NO: 1-13, 33-35, Table 1, and Table 2.

[0028] In an embodiment, the gamma-herpesvirus is Epstein-Barr virus (EBV, HHV- 4), or Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8).

[0029] In some aspects, the techniques described herein relate to a method for detecting a target pathogen in a sample, the method including: (a) combining in a single reaction vessel: (i) a sample containing or suspected of containing a target pathogen nucleic acid; (ii) one or more padlock probes, each padlock probe including a 5' hybrid arm with a sequence complementary to a first region of the target pathogen nucleic acid and a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the target pathogen nucleic acid, wherein the padlock probe includes a linker region between the 5' hybrid arm and the 3' hybrid arm; (iii) a Cast 2 polypeptide; (iv) a guide molecule specific for an amplified product of the padlock probe; (v) a ligase; (vi) a polymerase; and (vii) a reporter molecule; (b) incubating the reaction vessel at a temperature suitable for circularization of the padlock probe, amplification of the circularized probe, and activation of the Cast 2 polypeptide; and (c) detecting a signal generated when the target pathogen nucleic acid is present in the sample.

[0030] In an embodiment, the method does not require pre-incubation of the Cast 2 polypeptide with the guide molecule.

[0031] In an embodiment, the method does not require prior nucleic acid isolation from the sample.

[0032] In an embodiment, the method includes a brief heating step to denature doublestranded nucleic acids prior to padlock probe hybridization.

[0033] In an embodiment, the heating step includes heating the sample to 60-95°C for 1-5 minutes.

[0034] In an embodiment, the one or more padlock probes are configured to detect one or more target nucleic acids from a DNA virus, an RNA virus, a fungal pathogen, or a bacterial pathogen.

[0035] In an embodiment, the DNA virus is a herpesvirus.

[0036] In an embodiment, the herpesvirus is an alpha-herpesvirus, a beta-herpesvirus, a gamma-herpesvirus.

[0037] In an embodiment, the alpha-herpesvirus is herpes simplex virus type 1 (HSV-1, HHV-1), herpes simplex virus type 2 (HSV-2, HHV-2), or Varicella-Zoster virus (VZV, HHV-3).

[0038] In an embodiment, the beta-herpesvirus is cytomegalovirus (CMV, HHV-5), human herpesvirus 5 (HHV-6), or human herpesvirus-7 (HHV-7).

[0039] In an embodiment, the beta-herpesivirus is CMV and at least one padlock probe is configured to detect a UL123 target sequence. 33.

[0040] In an embodiment, the gamma-herpesvirus is Epstein-Barr virus (EBV, HHV- 4), or Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8).

[0041] In an embodiment, the RNA virus is selected from the group consisting of influenza virus, respiratory syncytial virus, SARS-CoV-2, human immunodeficiency virus, hepatitis C virus, dengue virus, and Zika virus.

[0042] In an embodiment, the bacterial pathogen is selected from the group consisting of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Mycobacterium tuberculosis, and Clostridioides difficile.

[0043] In an embodiment, the fungal pathogen is selected from Candida, Aspergillus, Cryptococcus, Histoplasma capsulatum, Pneumocystis jirovecii, and Mucormycetes.

[0044] In an embodiment, the one or more padlock probes are configured to detect antimicrobial resistance or a strain-specific target sequence.

[0045] In an embodiment, (a) does not require polyethylene glycol (PEG).

[0046] In an embodiment, the sample is selected from the group consisting of blood, serum, plasma, saliva, urine, cerebrospinal fluid, tissue, and fecal matter.

[0047] In an embodiment, the method further includes the step of subjecting the clinical sample to a heating step to denature double-stranded nucleic acids without prior nucleic acid isolation.

[0048] In some aspects, the techniques described herein relate to a kit for detecting a target pathogen in a sample, the kit including: (a) a pathogen-specific padlock probe including a 5' hybrid arm with a sequence complementary to a first region of a target pathogen nucleic acid and a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the target pathogen nucleic acid, wherein the padlock probeincludes a poly A linker region between the 5' hybrid arm and the 3' hybrid arm; (b) a Casl2 polypeptide; (c) a guide molecule specific for an amplified product of the padlock probe; (d) a ligase; (e) a polymerase; and (f) a reporter molecule capable of generating a detectable signal when cleaved by the Cast 2 polypeptide.

[0049] In an embodiment, components (a)-(f) are configured to operate in a single reaction vessel without pre-incubation of the Cast 2 polypeptide with the guide molecule.

[0050] In an embodiment, the kit is configured to detect the target pathogen without prior nucleic acid isolation from the sample.

[0051] In an embodiment, the Cast 2 polypeptide is provided at a concentration that will result in 0.1 mM to 10 nM final concentration in a reaction.

[0052] In an embodiment, the ligase is selected from the group consisting of SplintR ligase, Taq DNA ligase, T3 DNA ligase, and 9°N DNA ligase.

[0053] In an embodiment, the kit does not include polyethylene glycol (PEG).

[0054] In an embodiment, (a)-(f) are lyophilized.

[0055] In some aspects, the techniques described herein relate to a padlock probe specifically designed for use in a CRISPR-Casl2 based detection system, the padlock probe including: (a) a 5' hybrid arm with a sequence complementary to a first region of a target nucleic acid; (b) a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the target nucleic acid; (c) a linker region including 5-15 adenine nucleotides between the 5' hybrid arm and the 3' hybrid arm; and (d) a detection zone that lacks a PAM sequence.

[0056] In an embodiment, the target nucleic acid is from a pathogen selected from the group consisting of, bacterial pathogens, fungal pathogens, and double-stranded DNA viruses.

[0057] In some aspects, the techniques described herein relate to a nucleic acid detection device for detecting a target nucleic acid in a sample, including: (a) a padlock probe including a poly A linker region; (b) a Casl2 polypeptide at a concentration of 0.1 mM to 10 nM; (c) a guide molecule; (d) a ligase; (e) a polymerase; (f) a reporter molecule; (g) one or more single reaction vessel configured to contain (a)-(f) in a single pot suitable for digital detection; and (h) a heating element configured to maintain the reaction vessel at temperatures required for the reaction.

[0058] In an embodiment, the system does not require pre-incubation of the Cast 2 polypeptide with the guide molecule.

[0059] In an embodiment, wherein the device does not require prior nucleic acid isolation from samples.

[0060] In an embodiment, wherein the system does not require polyethylene glycol (PEG) in its reaction mixture.

[0061] These and other aspects, objects, features, and advantages of the example embodiments will become apparent to those having ordinary skill in the art upon consideration of the following detailed description of example embodiments.BRIEF DESCRIPTION OF THE DRAWINGS

[0062] An understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention may be utilized, and the accompanying drawings of which:

[0063] FIG. 1A-1D - One-pot Casl2a-Phi29-based Padlock Probe Assay for Nucleic Acid Detection (1 A) Reagent composition for the OnePotOOl reaction mix is shown for 20 pL and 40 pL reaction volumes. Components include Cast 2a enzyme, guide RNA (gRNA), padlock probes, SplintR ligase, Phi29 DNA polymerase, and a fluorescent probe. (IB) Protocol outline for the assay: Stepwise combination of reagents including Casl2a- gRNA complex pre-incubation, padlock probe hybridization and ligation, followed by rolling circle amplification (RCA) and fluorescence detection. (1C) (SEQ ID NO: 1) Schematic of the padlock probe design (Version 11), indicating key regions including hybridization arms, gRNA target sequence, and linker. (ID) Fluorescence results comparing a 1 : 10 DNA dilution (target) to a no-template control (NTC), measured at 525 nm after 30 minutes at 37 °C. The 1 : 10 sample showed increased fluorescence intensity, indicating successful target amplification and detection.

[0064] FIG. 2A-2E - Comparison of SPENT -R and T4 Ligase Conditions in a One-Pot Casl2a-Phi29 Padlock Probe Assay. (2A) Reagent composition for OnePot002 reactions with 20 pL and 40 pL volumes, featuring reduced concentrations of Cast 2a, gRNA, buffer, and fluorescent probe, and the addition of T4 ligase in parallel to SPENT -R. (2B) Updated protocol including T4 or SPENT -R ligation buffer, padlock probe hybridization at 80 °C,followed by Phi29-mediated rolling circle amplification and fluorescence detection at 525 nm after 30 minutes. (2C) (SEQ ID NO: 1) Padlock Probe VI 1 schematic showing probe structure with hybridization arms, linker, and gRNA target. (2D) Fluorescence intensities of 1 : 100 diluted DNA samples (T4 and SPLNT-R conditions) at 0 and 20 minutes. T4-treated samples showed increased signal, suggesting improved ligation and amplification efficiency. (2E) Gel electrophoresis image of saved reactions shows amplification products across conditions (NTC, DNA NEAT, 1 : 10, 1 : 100, 1 : 1000). DNA is visible in both T4 and SPLNT-R lanes, with T4 producing more intense bands, particularly at lower DNA concentrations.

[0065] FIG. 3A-3D - Optimization of Casl2a-Phi29-Based Padlock Assay with Reduced Enzyme and Probe Concentrations. (3 A) Reagent composition for the OnePot004 30 pL reaction includes further reduced concentrations of Casl2a (0.1 pL), gRNA (0.1 pL), probe (1 pL), and buffer components, compared to prior versions. SplintR and T4 ligases are tested in parallel. (3B) Updated protocol describing a 3-stage workflow: (1) preincubation of Cast 2a with gRNA, (2) padlock hybridization at 80 °C followed by ligation, and (3) rolling circle amplification with Phi29 polymerase. Reactions were read at 525 nm after 30 minutes incubation at 37 °C. (3C) (SEQ ID NO: 1) Schematic of padlock probe VI 1 with 15 bp hybridization arms and 20 bp gRNA target sequence. (3D) Fluorescence intensity results of NTC and DNA-containing samples using either SplintR or T4 ligase. Signals across all conditions were comparable, with no significant enhancement from the T4 condition at this enzyme concentration.

[0066] FIG. 4 - (SEQ ID NO: 1-13) Performance of UL123 padlock probe designs engineered for compatibility with CRISPR-Casl2a-based detection. Each design includes a 5' phosphate, hybridization arms flanking a central target region, an optional PAM site, and a linker of varying length and sequence. Variations among probes include arm length (12- 15 bp), linker length (5-36 bp), and presence or repositioning of the PAM and gRNA target site. Probes that failed to support detection are marked with "X" symbols, V12, containing poly-A hybrid arms, serves as a negative control for probe specificity and circularization fidelity. VI 6 includes longer 20 bp hybrid arms with a gRNA target region no linker region.

[0067] FIG. 5 - Collection and preparation of various clinical sample types — including serum or dried blood spot (DBS), saliva, cell culture supernatant, and urine — for downstream DNA analysis. Samples are first heat-inactivated at 95 °C for 5 minutes toensure biosafety and facilitate lysis. Serum samples, which may solidify at higher temperatures, are alternatively treated at 70 °C for 30 minutes. DNA is then isolated using the Zymo Quick-DNA / RNA Viral Column Kit (Cat# D7020) or alternative validated chemical or thermal methods. Elution is performed in 50 pL of nuclease-free water, and samples are stored at -20 °C. A dilution factor of 1.2 is applied to adjust for recovery efficiency during downstream limit of detection (LoD) calculations.

[0068] FIG. 6 - Each reaction 1 pl of 1 pM Cast 2a, 1 pl of 1 pM gRNA, 1 pl of lOx NEB 2.1 Buffer are mixed and set at room temperature until next step to form a combined Casl2a-gRNA ribonucleoprotein.

[0069] FIG. 7 - (SEQ ID NO: 1, 14-15) Precircularization and Hybridization: Amixture of 4 pl of Padlock Probe, 4 pl of Sample, and 4 pl of 10X T4 Ligase Buffer is incubated at 80°C for 5 minutes to allow the DNA to unwind and pre-circularize the padlock probe's hybridization arms.

[0070] FIG. 8 - (SEQ ID NO: 1, 14-15) CRISPR-Casl2a Room-Temperature One-Pot Assay overview. Casl2a-gRNA ribonucleoprotein and the ULI 23 padlock probe precircularization are combined with a ligase (T4), isothermal polymerase (phi29), dNTPs, BSA, phi29 buffer, oligonucleotide reporter. This combines to create a 20 pl reaction of which 30 pl is plated and read for up to 80 minutes at 525nm while incubated at 25°C. Once cleaved, the target nucleic acid can re-enter the cycle to be amplified and detected for another round by CRISPR-Casl2a.

[0071] FIG. 9A-9D - Screening of Padlock Probe Variants and Comparison of RCA Efficiency With and Without Padlock Probes (9A) Padlock Probe Screening Protocol Casl2a-gRNA pre-incubation was followed by DNA denaturation with T4 ligase and hybridization of various padlock probe designs. Rolling Circle Amplification (RCA) with Phi29 polymerase was performed in the presence of fluorescent probe, and fluorescence intensity was read at 525 nm after 40 minutes at 37 °C. (9B) Padlock Probe Variant Screening Results. Fluorescence intensities across padlock probes Pl through Pl 5. Padlocks P7, P4, and Pl 1 demonstrated higher signal compared to NTC and other variants, indicating better ligation and RCA efficiency. (9C) Linear RCA Without Padlock Probe Protocol: Modified reaction excluding padlock probe. DNA was pre-incubated with ligation buffer and denatured, followed by overnight RCA at 30 °C using a defined master mix. (9D) RCA Results With and Without Padlock Probes: Padlock-containing reactions generatedsignificantly higher fluorescent signals, confirming the importance of the circularization step in enhancing RCA signal. Negative control and linear RCA (without padlock) showed limited amplification.

[0072] FIG. 10A-10C - Time-Course Analysis of CMV Detection Using One-Pot Padlock Assay. (10A) Protocol Summary: Modified from OnePot002, this experiment tested fluorescence output over time from CMV (Towne) 107lU / mL versus no-template control (NTC). Key changes (in bold / underlined) include higher concentrations of Cast 2a and gRNA (1 pL each), and extended fluorescence acquisition time to 40 minutes. (10B) Kinetic Analysis: A time-course plot of fluorescence intensity from 0-40 minutes. Statistical Comparison of Slopes and Linear regression parameters are provided (10C) Time Intervals: Bar graphs show replicate measurements at 5-minute intervals (5-40 min) of Towne 107lU / mL CMV spiked samples.

[0073] FIG. 11A-11C - Limit of Detection (LoD) Analysis for VI 1 UL123 Using OnePot Padlock Probe (11 A) Protocol Summary: Padlock probe hybridization was followed by rolling circle amplification, and fluorescence was read at 525 nm after 20 minutes at 37 °C. (1 IB) Fluorescence intensities measured at 20 minutes (11C) Time-course data from 0-20 minutes indicate that fluorescence.

[0074] FIG. 12 - (SEQ ID NO: 16-17)Shows an embodiment for the evaluation of EBV padlock probe designs for DNA detection.

[0075] FIG. 13A-13D - Linear RCA Protocol-Based Screening of Padlock Probe Variants with T4 and SPLNTR Ligases. (13A) Linear RCA + Padlock Protocol: Template DNA was pre-incubated with padlock probes and ligation buffer, denatured at 95 °C, and ligated with T4 DNA ligase. RCA was carried out at 36 °C for 18 hours, followed by CRISPR-Casl2a detection. Final fluorescence was measured at 525 nm after 20 minutes at 37 °C. (13B) Padlock Probe Variant Screen: Fluorescent readouts show that Padlocks 9, 10, and 11 produced the highest signals. Padlocks 3, 4, and 1 also showed moderate performance, while others exhibited minimal or no signal. The cocktail condition (mix of high-performing padlocks) and positive controls confirmed assay sensitivity. (13C) Comparison of T4 Ligase Performance: Under T4 ligase conditions, varying probe designs (VI 1, V12), additives (PEG), and enzyme inputs showed differential signal intensities. VI 1 with full probe and V12 with 4 pL ligase performed best. (13D) Comparison with SPLNTR Ligase: Equivalent reactions using SPLNTR ligase demonstrated significantlyless variation across conditions. All samples yielded comparable moderate signals, indicating reduced probe-specific differentiation with SPLNTR.

[0076] FIG. 14 - CRISPR-Casl2a Padlock Probe RCA Isothermal One-Pot assay. Fluorescence readout was evaluated from a one-pot CRISPR-Casl2a reaction using Padlock Probe VI 1 designed for the UL123 gene of CMV. Towne strain CMV DNA (107lU / mL) was tested alongside a no-template control (NTC). Fluorescence was measured over time (a.u. = arbitrary units), and linear regression was applied to each curve. Slopes from CMV- positive samples were compared to the NTC (Y = ), and statistical significance was assessed based on differences in slope. The probe structure is shown below, highlighting the 5' phosphate, hybridization arms (15 bp), linker (10 bp), and gRNA target (20 bp). lU / mL denotes infectious units per milliliter.

[0077] FIG. 15 - CRISPR-Casl2a RCA Isothermal One-Pot assay with combined cocktail of Padlock probes. One-Pot Reactions were tested with CMV strain Towne (107lU / mL) and a no-template control (NTC), and fluorescence was monitored for 40 minutes at 37°C. Response when VI 1 was combined with V3 in a single-tube combined cocktail. Fluorescence is measured in arbitrary units (a.u.), and viral input is denoted in infectious units per milliliter (lU / mL).

[0078] FIG. 16 - One-pot CRISPR-Casl2a assay using Padlock Probe VI 6 designed for the ULI 23 region of CMV. Fluorescence was monitored over time in samples containing Towne strain CMV (105lU / mL) and a no-template control (NTC). Arbitrary units (a.u.) denote fluorescence intensity, and infectious units per milliliter (lU / mL) represent viral concentration. A standard linear regression was applied to each time course, and slopes were compared between CMV-positive samples and the NTC.

[0079] FIG. 17A-17B - (17A) Real-time fluorescence output of a one-pot CRISPR- Casl2a assay targeting EBV at 106copies / mL. The reaction was carried out for 20 minutes using the described one-pot workflow. Fluorescence intensity is presented in arbitrary units (a.u.) and reflects the activation of Casl2a collateral cleavage following successful target recognition. (17B) EBV One-pot using Clinical Plasma Samples. CRISPR-Casl2a one-pot LMP2B detection assay using EBV plasma-based samples to assess background fluorescence and potential cross-reactivity. Fluorescent readouts from CMV-positive plasma and matched negative plasma (no template control, NTC) were measured were measured across three replicates. N.s.=No significance. Statistical significance wasdetermined using a one-way ANOVA with a Dunnett’s multiple comparison test single pooled variance. NTC = no template control. A.u. = arbitrary unit.

[0080] FIG. 18 - One-Pot CRISPR-Casl2a Detection of CMV in Plasma Samples. Fluorescence output measures one-pot detection assay performed on plasma-based samples to assess both target detection and potential background interference. The assay was conducted using a CMV-positive plasma sample, positive DBS sample (2.17 X 102copies) and a no-template control nuclease free water (NTC). Fluorescence was measured after the complete one-pot reaction at 25°C for 40 minutes.

[0081] FIG. 19 - (SEQ ID NO: 18-21) UL97 Codon 460 Point Mutation and Codon 590-593 Deletion: Primer and gRNA Design. CRISPR-Casl2a assay designs targeting clinically relevant resistance mutations in the UL97 gene of CMV. The top panel shows the design for detecting the Codon 460-point mutation, where a single nucleotide change (ATG^GTG) results in an amino acid substitution from methionine to valine, flanked by forward and reverse primers and a gRNA with a nearby PAM site. The bottom panel depicts the design for detecting a Codon 590-593 deletion, with gRNA and primers positioned to differentiate the wild-type and deletion alleles. Both designs integrate gRNAs with adjacent TTTV PAM motifs (where V = A, C, or G) and primer pairs optimized for Casl2a-mediated detection.

[0082] FIG. 20 - Provides an example for lysis condition optimization by the example of the IE1 gene, or Immediate Early 1, of human cytomegalovirus (HCMV).

[0083] FIG. 21 - (SEQ ID NO: 22-32) Detection of UL123 gRNA Point Mutations Using CRISPR-Casl2a Fluorescent Assay. To assess the effect of single nucleotide changes within the guide RNA (gRNA) sequence, ULI 23 -targeting gRNAs were systematically mutated at specific positions within and beyond the seed region. Mutations were introduced as transition substitutions and tested using a CRISPR-Casl2a fluorescence-based assay over a 20-minute period. Fluorescent intensities for each gRNA mutant are shown alongside the wild-type positive control and a scrambled gRNA negative control.

[0084] FIG. 22 - CRISPR-Casl2a-Based Detection of CMV UL97 460 Point Mutation Associated with Antiviral Resistance. Fluorescence intensity measurements were used to evaluate detection of the cytomegalovirus (CMV) UL97 codon 460-point mutation using a CRISPR-Casl2a-based assay. Samples were tested in triplicate (N = 3) across variant and wild-type sequences. Synthetic duplexed DNA and single stranded (ssDNA)oligonucleotides were designed to mimic the 460-point mutation and tested against control gRNA versus a gRNA designed to match the 460 mutant. Statistical analysis was performed using one-way ANOVA with Dunnett’s multiple comparison test against a single pooled variance. Significance was denoted as *P < 0.05, **P < 0.01, ****P<0.001. A.u. = arbitrary units; IU = infectious units.

[0085] FIG. 23 - CRISPR-Casl2a-Based Detection of CMV UL97 590-593 Deletion Associated with Antiviral Resistance. Detection of Cytomegalovirus (CMV) UL97 antiviral resistance deletion mutation (codons 590-593) was evaluated using the described standard CRISPR-Casl2a fluorescent assay. Synthetic duplexed DNA and single stranded (ssDNA) oligonucleotides were designed to mimic the 590-593 deletion and tested against control gRNA versus a gRNA designed to match the mutant. Samples were tested in triplicate (N = 3) and fluorescence intensity was recorded. Significance testing was performed via one-way ANOVA followed by Dunnett’s multiple comparison test with single pooled variance. Asterisks denote significance levels (*P < 0.05, **P < 0.01, ***p < 0.005, ****p < 0.001). A.u. = arbitrary units; IU = infectious units.

[0086] The figures herein are for illustrative purposes only and are not necessarily drawn to scale.

[0087] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application were specifically and individually indicated as being incorporated by reference.DETAILED DESCRIPTION

[0088] Embodiments disclosed herein provide pathogen detection through an isothermal, one-pot nucleic acid detection system that combines optimized padlock probe technology with CRISPR-Cas detection. Unlike conventional PCR-based diagnostic methods that require expensive thermal cycling equipment, complex sample preparation, and lengthy turnaround times, the present invention enables rapid, sensitive, and specific pathogen detection directly from clinical samples at a single, constant temperature. These embodiments address limitations in current diagnostic workflows, particularly for timesensitive applications, such as monitoring human herpesvirus in transplant patients and point-of-care pathogen identification.

[0089] Existing detection systems have not addressed the unique challenges associated with detecting double-stranded DNA pathogens, particularly the complexities of direct clinical sample processing and the optimization requirements for isothermal amplification of circularized padlock probes from complex biological matrices. Embodiments disclosed herein overcome these limitations through several innovations that enable robust detection of double-stranded DNA viruses, RNA viruses, bacterial pathogens, and fungal pathogens directly from clinical specimens.

[0090] A fundamental advantage of the present system lies in its elimination of nucleic acid isolation steps that are typically required in conventional diagnostic workflows. Traditional methods necessitate complex sample preparation procedures to extract and purify nucleic acids from clinical specimens, adding time, cost, and potential sources of error to the diagnostic process. Embodiments disclosed herein circumvent these limitations by incorporating a simplified sample processing approach that requires only a brief heating step to denature double-stranded nucleic acids, followed by direct addition of the sample to the isothermal reaction mixture. This streamlined approach significantly reduces the time from sample collection to result reporting while maintaining high sensitivity and specificity.

[0091] In an embodiment, the padlock probe is designed to minimize the formation of stable secondary structures, particularly hairpin loops and self-dimers that can inhibit target hybridization and ligation efficiency. This embodiment avoids long homopolymer stretches (e.g., >8 consecutive identical nucleotides) and incorporates sequence modifications in the remaining regions to prevent stable intramolecular base pairing.

[0092] Embodiments further utilize a padlock probe that incorporates specifically designed padlock probes featuring a linker region between the 5' and 3' hybrid arms. This design element enhances stability and efficiency in the detection of double-stranded DNA targets. The linker region facilitates optimal circularization of the padlock probe while minimizing secondary structure formation that could interfere with the detection process. Furthermore, the hybrid arm design addresses the unique challenges of double-stranded DNA detection by incorporating reverse complement sequences that are specifically optimized for DNA targets, as opposed to the direct complement sequences suitable for single-stranded RNA targets.

[0093] The CRISPR-Casl2 component of the system has been optimized to operate at significantly lower concentrations than those typically employed in standard protocols. Thisoptimization offers several key advantages, including reduced reagent costs, minimized non-specific cleavage activity, and enhanced signal -to-noise ratios. The lower concentration requirement also eliminates the need for pre-incubation of the Casl2 polypeptide with guide molecule, further simplifying the workflow and reducing the overall assay time.

[0094] The isothermal nature of the system provides substantial practical advantages for point-of-care applications and resource-limited settings. By operating at a constant temperature, typically between 24-40°C, the system eliminates the need for sophisticated thermal cycling equipment while maintaining compatibility with simple heating devices or even ambient conditions in certain applications. This temperature range is particularly advantageous for clinical settings as it closely approximates normal hospital ambient temperatures and can be easily maintained using simple heating elements or water baths.

[0095] The reaction chemistry has been further optimized to eliminate components that are typically required in conventional systems but may interfere with the isothermal detection process. Notably, the present system operates efficiently without polyethylene glycol (PEG), which is commonly used in other CRISPR-based detection systems but can complicate the reaction dynamics in one-pot isothermal applications. The elimination of PEG, combined with optimized buffer conditions and enzyme concentrations, provides a more robust and reproducible detection platform that is less susceptible to inhibition by clinical sample components.

[0096] The platform's versatility extends beyond viral detection to encompass bacterial and fungal pathogens, as well as antimicrobial resistance markers, providing a comprehensive diagnostic solution for clinical microbiology applications. The system can be configured with multiple pathogen-specific padlock probes to enable multiplex detection, while maintaining the simplicity of the one-pot isothermal format. This flexibility addresses the growing need for rapid, broad-spectrum pathogen identification in clinical settings where time-to-result directly impacts patient care and treatment decisions.NUCLEIC ACID DETECTION SYSTEM

[0097] The present invention encompasses a nucleic acid detection system that integrates multiple enzymatic and detection components within a unified platform, enabling rapid, isothermal identification of target nucleic acids. The system comprises one or more padlock probes, each serving as a target-specific recognition element designed to circularize upon hybridization with target nucleic acid sequences. Each padlock probe comprises a 5'hybrid arm with a sequence complementary to a first region of a target nucleic acid and a 3' hybrid arm complementary to a second, adjacent region of the target nucleic acid. In an embodiment where the target nucleic acid is double-stranded DNA, one hybrid arm binds to one strand of the target DNA, and the second arm to an adjacent sequence on the opposite strand of the target DNA. The padlock probe incorporates a linker region positioned between the 5' and 3' hybrid arms, along with a guide molecule target sequence that serves as the recognition element for subsequent CRISPR-Casl2 detection.

[0098] The detection system operates through a cascade of molecular recognition and amplification events that culminate in the generation of a detectable signal proportional to the presence of the target nucleic acid. The system leverages the specificity of padlock probe hybridization, the amplification power of rolling circle amplification, and the signal generation capabilities of CRISPR-Casl2 trans-cleavage activity to achieve sensitive and specific detection of target sequences. Each component of the system has been optimized to function synergistically under isothermal conditions, enabling operation at constant temperatures without the need for thermal cycling equipment. The system demonstrates remarkable versatility in target nucleic acid detection, being capable of identifying sequences from DNA viruses, RNA viruses, fungal pathogens, and bacterial pathogens, thereby providing a unified platform for comprehensive pathogen detection across diverse clinical applications. For DNA virus detection, the system demonstrates particular efficacy against herpesviruses, including alpha-herpesviruses such as herpes simplex virus type 1 (HSV-1, HHV-1), herpes simplex virus type 2 (HSV-2, HHV-2), and Varicella-Zoster virus (VZV, HHV-3), beta-herpesviruses such as cytomegalovirus (CMV, HHV-5), human herpesvirus 6 (HHV-6), and human herpesvirus-7 (HHV-7), and gamma-herpesviruses such as Epstein-Barr virus (EBV, HHV-4) and Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8). In an embodiment, this system is configured for CMV detection, with padlock probes specifically designed to detect target sequences, such as the ULI 23 gene that encodes the immediate-early protein 1 (IE1), which is expressed at high levels early in infection and is essential for CMV viral gene expression.Padlock Probe Component

[0099] The padlock probe represents a critical component of the detection system, comprising a linear oligonucleotide designed to circularize upon hybridization with a target nucleic acid sequence. In an embodiment, a “padlock probe” is a single-strandedoligonucleotide that contains two terminal regions, designated as the 5' hybrid arm and the 3' hybrid arm, which are complementary to adjacent regions of a target nucleic acid sequence. The padlock probe is specifically designed such that when both hybrid arms simultaneously hybridize to their respective complementary regions on the target sequence, the 5' phosphate and 3' hydroxyl termini of the probe are brought into close proximity, enabling enzymatic ligation to form a closed circular molecule. The padlock probe is designed for use with CRISPR-Cas 12-based detection systems, incorporating design features that enhance compatibility with the isothermal amplification and detection processes.

[0100] A defining feature of the padlock probe architecture is the incorporation of a guide molecule target sequence that serves as the recognition element for subsequent CRISPR-Cas 12 detection. The guide molecule target sequence can be strategically positioned in different regions of the padlock probe to optimize detection performance and accommodate various design constraints. In an embodiment, the guide molecule target sequence is positioned within the 5' hybrid arm, enabling guide molecule recognition of sequences that correspond directly to the target nucleic acid. In alternative embodiments, the guide molecule target sequence may be located within the 3' hybrid arm, providing another option for direct target sequence recognition. In another embodiment, portions of the guide molecule target sequence may be distributed across both the 5' and 3' hybrid arms, creating a segmented recognition strategy that can accommodate longer guide molecule target sequences or provide enhanced specificity through multi-region targeting.

[0101] In an embodiment, the padlock probe comprises design features that optimize performance in the one-pot EXTRA-CRISPR system while avoiding structural elements that interfere with the coupled enzymatic reactions. The present disclosure provides multiple embodiments of padlock probe designs that incorporate various combinations of these optimized features.

[0102] In an embodiment, the guide molecule target sequence is positioned within the linker region between the 5' and 3' hybrid arms, allowing guide molecule recognition to occur within the central portion of the amplified probe sequence following circularization and rolling circle amplification. This positioning strategy ensures that guide molecule- mediated Casl2 activation is dependent upon successful completion of the padlock probecircularization and amplification steps, providing an additional layer of specificity to the detection process.

[0103] The versatility of the padlock probe design enables detection of diverse pathogen types, including DNA viruses, RNA viruses, fungal pathogens, and bacterial pathogens. For the detection of DNA viruses, the system demonstrates particular efficacy against herpesviruses, including alpha-herpesviruses, beta-herpesviruses, and gammaherpesviruses. These viral targets represent clinically significant pathogens that require rapid and accurate detection for patient management, particularly in immunocompromised populations. For RNA virus detection, the padlock probe design accommodates targets from viruses such as influenza, respiratory syncytial virus, SARS-CoV-2, human immunodeficiency virus, hepatitis C virus, dengue virus, and Zika virus, typically following reverse transcription to generate complementary DNA targets. Bacterial pathogen detection may encompass organisms such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Mycobacterium tuberculosis, and Clostridioides difficile, among others. Fungal pathogen detection may encompass organismis such as Candida albicans, C. glabrata, C. tropicalis, C. parapsilosis, C. krusei, Aspergillus fiumigatus, A. flavus, A. niger, A. terreus, Cryptococcus neoformans, C. gattii, Histoplasma capsulatum, Coccidiodes immitis, C. posadasii, Blastomyces dermatitidis, Pneumocystis jirovecii, Mucorales species, and Fusarium species. The padlock probe design accommodates the specific sequence characteristics of each pathogen type while maintaining consistent performance parameters across different target organisms.

[0104] The target nucleic acid sequences recognized by the padlock probes can encode various types of functionally important genes, depending on the diagnostic application. For pathogen identification, target sequences may encode structural proteins that are essential components of the pathogen architecture, such as capsid proteins in viruses or cell wall proteins in bacteria. Virulence factor genes represent important targets as they encode proteins directly involved in pathogenesis and host interaction, including toxins, adhesins, invasion factors, and immune evasion proteins. Replication factor genes encode proteins essential for pathogen reproduction and can serve as highly conserved targets across related pathogen species. For detecting antimicrobial resistance, the padlock probes can target genes encoding resistance markers, such as beta-lactamases, efflux pumps, ribosomal modifications, or other proteins that confer resistance to specific antimicrobial agents. Thistargeting flexibility enables the detection system to serve multiple diagnostic purposes including pathogen identification, virulence assessment, and resistance profiling.

[0105] In an embodiment, the 5' hybrid arm comprises a sequence that is complementary to a first region of the target nucleic acid, while the 3' hybrid arm comprises a sequence that is reverse complement to a second, adjacent region of the target nucleic acid. This design ensures that the padlock probe can specifically recognize and bind to double-stranded DNA targets, with each arm targeting opposite strands of the double helix. The term “reverse complement” refers to the nucleotide sequence that would hybridize to the complement of a given sequence when read in the opposite direction, accounting for the antiparallel nature of DNA double helix structure. This reverse complement design is particularly important for double-stranded DNA targets, as it ensures proper spatial orientation of the hybrid arms for efficient circularization. For RNA virus targets that have been converted to complementary DNA through reverse transcription, the hybrid arm design may be adapted to recognize the resulting double-stranded cDNA or single-stranded cDNA templates.

[0106] In an embodiment, the padlock probe comprises balanced hybridization arms flanking the target recognition sequence, wherein each arm is independently 12-25 nucleotides in length, preferably 15-20 nucleotides. This embodiment ensures sufficient binding affinity and specificity while maintaining appropriate spacing for enzymatic access. The hybridization arms in this embodiment are designed to provide stable target binding under reaction conditions while allowing for specific discrimination against non-target sequences.

[0107] The linker region positioned between the 5' and 3' hybrid arms may serve multiple functional purposes within the padlock probe architecture designed for use with CRISPR-Casl2 detection systems. This linker region provides the necessary spacing and flexibility to accommodate the circularization process while incorporating sequence elements that can serve as templates for subsequent amplification and detection steps. The linker region can comprise various sequence compositions and architectural arrangements optimized for different performance characteristics and detection requirements.

[0108] In an embodiment, the padlock probe incorporates linker regions of defined length and composition to provide structural flexibility while avoiding interference with enzymatic functions. The linker regions in this embodiment comprise 3-15 nucleotides, preferably 5-10 nucleotides, of simple sequence composition (e.g., alternating purines andpyrimidines or short homopolymer stretches of <6 nucleotides). These linker regions provide sufficient spacing between functional modules while avoiding the formation of stable secondary structures that could impede probe circularization upon target binding. In an embodiment, the linker region is comprised entirely of the guide molecule target region and includes additional linker sequences.

[0109] The linker region length typically ranges from 5-30 nucleotides, 6-28 nucleotides, 7-25 nucleotides, 8-24 nucleotides, 9-22 nucleotides, 10-20 nucleotides, 11-18 nucleotides, 12-16 nucleotides, 5-15 nucleotides, 6-14 nucleotides, 7-13 nucleotides, 8-12 nucleotides, 9-11 nucleotides, 5-10 nucleotides, 6-9 nucleotides, 7-8 nucleotides, 15-30 nucleotides, 16-28 nucleotides, 17-25 nucleotides, 18-24 nucleotides, 19-22 nucleotides, 20- 30 nucleotides, 21-28 nucleotides, 22-26 nucleotides, 23-25 nucleotides, exactly 5 nucleotides, exactly 10 nucleotides, exactly 15 nucleotides, exactly 20 nucleotides, exactly 25 nucleotides, or exactly 30 nucleotides, providing the necessary spacing for efficient probe circularization while accommodating various functional elements.

[0110] In an embodiment, the linker region comprises a poly-A sequence that provides enhanced stability and reduces the formation of secondary structures that could interfere with probe circularization or subsequent enzymatic processes. The poly-A linker region can comprise continuous adenine nucleotides or can be interspersed with other nucleotides while maintaining predominantly adenine composition. Alternatively, the linker region may comprise a scrambled sequence that is non-complementary to target sequences but designed with specific nucleotide compositions to optimize probe performance. Scrambled linkers are typically designed with reduced guanine and cytosine content to minimize hairpin formation and secondary structure complications. These scrambled sequences can incorporate random or semi-random arrangements of adenine, thymine, guanine, and cytosine nucleotides while avoiding sequences that might interfere with probe function or cross-react with non-target sequences.

[0111] Alternatively, the linker region may comprise a poly-T sequence with similar length ranges, providing different base-pairing characteristics that may be advantageous for specific target sequences or reaction conditions. Poly-T linkers offer distinct melting temperatures and secondary structure profiles compared to poly-A linkers, enabling optimization for particular applications or target sequences. The selection between poly-A and poly-T linkers depends on several key factors including target sequence composition,reaction temperature requirements, enzyme compatibility, and secondary structure considerations.

[0112] Poly-A linkers may provide enhanced compatibility with specific polymerase enzymes that demonstrate improved processivity on adenine-rich templates during rolling circle amplification. The adenine-rich composition can also provide favorable stacking interactions that enhance the overall stability of the circularized padlock probe structure. Poly-A linkers are particularly advantageous when the target pathogen sequences are adenine-rich, guanine-rich, or cytosine-rich, as this composition difference minimizes the potential for unintended cross-hybridization between the linker region and target sequences within the sample, since poly-A linkers would not readily hybridize to these non-thymine- rich target regions.

[0113] Poly-T linkers offer complementary advantages, particularly in applications where the target sequences contain thymine-rich regions that might otherwise interact with poly-A linkers through A-T base pairing and interfere with specific target recognition. The thymine-rich composition provides distinct melting characteristics that can be beneficial for isothermal reactions operating at lower temperature. This property can enhance the accessibility of the linker region for enzymatic processing while maintaining the structural integrity necessary for efficient probe circularization. Poly-T linkers also demonstrate reduced propensity for forming certain types of secondary structures, such as adenine- mediated stacking interactions, which can improve the uniformity and predictability of probe performance across different reaction conditions. Poly-T linkers are particularly suitable when target sequences are thymine-rich, guanine-rich, or cytosine-rich, avoiding potential cross-hybridization with adenine-rich target regions.

[0114] The choice between poly-A and poly-T linkers can also be influenced by the specific enzymatic components employed in the detection system. Certain polymerases may demonstrate different amplification kinetics depending on the template composition, with some polymerases showing enhanced processivity on adenine-rich templates while others perform optimally on thymine-rich sequences.

[0115] For multiplexed detection applications where multiple padlock probes are employed simultaneously, the strategic use of both poly A and poly T linkers across different probes can help minimize potential cross-interactions between probes while maintaining optimal performance for each individual target. This approach enables the creation oforthogonal probe sets where each probe maintains its specific target recognition while avoiding interference with other detection components in the multiplexed system.

[0116] In additional embodiments, the linker region may comprise mixed nucleotide sequences that combine poly-A and poly-T regions within the same linker. These mixed- sequence linkers can provide intermediate properties between pure poly-A and poly-T compositions while offering additional design flexibility. For example, the linker may comprise alternating poly-A and poly-T segments, or may incorporate specific transition sequences between different homopolymer regions.

[0117] In an embodiment, the linker region can incorporate functional sequence elements including guide molecule target sequences that become accessible following probe circularization and amplification. When the guide molecule target sequence is positioned within the linker region, it typically comprises 15-25 nucleotides. In an embodiment, the guide molecule target sequence is 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length. The guide molecule target sequence can be flanked by poly A sequences, poly T sequences, or other linker compositions that provide the necessary spacing and structural support for efficient probe circularization and subsequent amplification.

[0118] The linker region architecture can also accommodate protospacer adjacent motif (PAM) sequences when included in the padlock probe design. PAM sequences within the linker region are typically positioned adj acent to or near the guide molecule target sequences to facilitate Casl2 binding and activation. The PAM sequences can comprise natural PAM motifs such as 5'-TTTV-3' sequences (where V represents A, C, or G) or other PAM variants depending on the specific Casl2 enzyme employed in the detection system.

[0119] In an embodiment, linker architectures may incorporate multiple functional elements within a single linker region, such as guide molecule target sequences flanked by different linker compositions on each side. For example, a linker region may comprise a 5' poly A segment, a central guide molecule target sequence, and a 3' poly T segment, providing asymmetric linker composition that can optimize probe performance for specific applications. Similarly, the linker region may incorporate guide molecule target sequences flanked by scrambled sequences of different compositions or lengths.

[0120] The choice of linker composition, length, and architecture can be tailored to specific applications including pathogen detection, antimicrobial resistance identification, strain typing, and other diagnostic purposes. The linker configurations serve to standardize the spacing between hybrid arms across different probe designs while facilitating consistent performance across various target sequences and providing options for sequence-specific optimization.

[0121] A key design feature of the padlock probe that enhances its versatility for CRISPR-Casl2 applications is the strategic incorporation or exclusion of protospacer adjacent motif (PAM) sequences within the guide molecule target sequence. In certain embodiments, the padlock probe is designed such that the guide molecule target sequence specifically lacks PAM sequences. This PAM-free design approach within the guide molecule target sequence avoids potential interference with Cast 2 activity that could occur if PAM-dependent binding competed with guide molecule-mediated recognition. By specifically designing the guide molecule target sequence to lack PAM sequences, the padlock probe can ensure that nuclease activation occurs specifically through the intended guide molecule-mediated recognition pathway rather than through unintended PAM- dependent binding events.

[0122] The absence of PAM sequences in the guide molecule target sequence may enhance the specificity and reliability of the detection system while simplifying the probe design process by removing PAM sequence constraints that might otherwise limit target selection or probe optimization. This PAM-free design is particularly advantageous when targeting conserved sequences that may not contain suitable PAM sites or when designing multiplexed detection systems where PAM availability might create design conflicts.

[0123] In an embodiment, the padlock probe is specifically designed to lack protospacer-adjacent motif (PAM) sequences, particularly avoiding TTTT, AAAA, or other consensus PAM sequences (TTTV, where V=A, G, C) within the detection zone or adjacent regions. This PAM-free design prevents premature activation of Casl2a cis-cleavage activity that would otherwise interfere with the exponential amplification process. In this embodiment, the detection zone comprises the sequence complementary to the crRNA without requiring PAM-mediated double-strand recognition, thereby enabling optimal trans-cleavage activity while preserving the integrity of the amplification substrates.

[0124] In alternative embodiments, the padlock probe may be designed to include PAM sequences within the guide molecule target sequence or other regions of the probe architecture. When PAM sequences are incorporated, they are typically positioned adjacent to or near the guide molecule target sequences to facilitate optimal Cast 2 binding and activation. The inclusion of PAM sequences can provide additional recognition elements that may enhance Cast 2 binding affinity or provide alternative activation pathways under specific reaction conditions.Casl2 Polypeptide Component

[0125] The Cast 2 polypeptide serves as the core nuclease component responsible for both target-specific recognition and signal generation within the detection system. “Casl2” refers to a diverse family of Class 2 CRISPR-associated endonucleases that exhibit both cis- cleavage activity (specific cleavage of target sequences) and trans-cleavage activity (nonspecific cleavage of single-stranded nucleic acids following target recognition). The term “Cast 2 polypeptide” encompasses naturally occurring Cast 2 family members as well as synthetic, engineered, or computationally designed polypeptides that retain equivalent functional characteristics. Synthetic Cas polypeptides can be engineered to exhibit improved or modified properties while maintaining the essential cis-cleavage and trans-cleavage activities required for the detection system.

[0126] The Casl2 family encompasses multiple distinct subtypes, each with unique characteristics that can be leveraged for specific diagnostic applications. Naturally occurring variants include well-characterized family members, while synthetic variants may incorporate optimized features such as enhanced thermostability, altered PAM specificity, improved trans-cleavage kinetics, or reduced immunogenicity for therapeutic applications. Engineered Casl2 polypeptides may also incorporate modifications to enhance compatibility with specific reaction conditions, reduce non-specific activity, or improve storage stability.

[0127] Casl2a, also known as Cpfl demonstrates robust trans-cleavage activity against single-stranded DNA substrates and exhibits a relatively relaxed protospacer adjacent motif (PAM) requirement, typically recognizing 5'-TTTV-3' sequences where V represents A, C, or G. The enzyme functions optimally at temperatures between 25-42°C, making it particularly suitable for isothermal diagnostic applications. Casl2a generates staggered cuts with 4-5 nucleotide 5' overhangs, and its trans-cleavage activity is highly processive,enabling robust signal amplification from minimal target recognition events. Synthetic variants of Casl2a may incorporate amino acid substitutions that enhance these properties or adapt the enzyme for specialized applications.

[0128] Casl2b, formerly designated C2cl, exhibits strong preference for AT-rich PAM sequences and demonstrates enhanced thermostability compared to Cast 2a, with optimal activity at elevated temperatures that can improve specificity in complex sample matrices. Casl2b also shows distinct substrate preferences for trans-cleavage activity, which can be exploited for specialized reporter molecule designs. Engineered variants of Cast 2b may further enhance these characteristics through rational design or directed evolution approaches.

[0129] Cast 2d offers enhanced specificity through stringent PAM recognition, providing improved discrimination against off-target sequences. This characteristic makes Cast 2d particularly valuable for applications requiring high specificity or when working with closely related target sequences that might challenge less discriminating nucleases.

[0130] Casl2e and Casl2f provide alternative options for applications requiring specific kinetic properties or compatibility with particular buffer conditions. These enzymes offer distinct temperature optima, substrate preferences, and reaction kinetics that can be matched to specific diagnostic requirements or operational constraints.

[0131] Additional Cast 2 family members continue to be discovered and characterized, each potentially offering unique properties that can be exploited for diagnostic applications. Synthetic analogs of these enzymes may be designed to combine favorable characteristics from multiple family members or to incorporate entirely novel functional properties developed through computational design approaches.

[0132] The selection of appropriate Cast 2 variants depends on multiple factors including target sequence characteristics, desired reaction temperature, available PAM sites, and compatibility with other system components. For the present isothermal detection system, Cast 2a typically provides optimal performance due to its robust trans-cleavage activity, favorable temperature profile, and extensive characterization in diagnostic applications. However, the system design accommodates various Casl2 family members as well as synthetic variants that demonstrate equivalent functional properties, allowing optimization for specific pathogen targets or clinical requirements.

[0133] Synthetic Casl2 polypeptides may be designed using computational approaches including machine learning algorithms, protein folding prediction software, and rational design methodologies. These approaches can generate variants with enhanced properties such as improved stability under storage conditions, reduced sensitivity to inhibitors present in clinical samples, or optimized kinetic parameters for specific detection applications. AI- assisted design platforms can also generate Casl2 variants with novel PAM specificities, enabling detection of target sequences that may not be accessible to naturally occurring enzymes.

[0134] The Cast 2 polypeptide employed in the present system exhibits trans-cleavage activity that is activated upon formation of a ternary complex with guide molecule and a complementary target sequence, leading to indiscriminate cleavage of single-stranded DNA or RNA molecules in the reaction mixture. This trans-cleavage activity is fundamentally distinct from the cis-cleavage activity that occurs at the target site, as it involves non-specific nuclease activity that can process reporter molecules throughout the reaction volume. The trans-cleavage mechanism provides further signal amplification, as a single target recognition event can result in cleavage of numerous reporter molecules. Both naturally occurring and synthetic Cast 2 polypeptides must retain these essential functional characteristics to be compatible with the detection system.

[0135] The Cast 2 polypeptide concentration within the detection system has been optimized to provide maximal signal generation while minimizing non-specific background activity. The system achieves optimal performance at concentrations ranging from 10 nM to 0.1 pM (100 nM), 15 nM to 90 nM, 20 nM to 80 nM, 25 nM to 75 nM, 30 nM to 70 nM, 35 nM to 65 nM, 40 nM to 60 nM, 45 nM to 55 nM, 10 nM to 50 nM, 15 nM to 45 nM, 20 nM to 40 nM, 25 nM to 35 nM, 50 nM to 0.1 pM, 60 nM to 90 nM, 70 nM to 80 nM, exactly 10 nM, exactly 15 nM, exactly 20 nM, exactly 25 nM, exactly 30 nM, exactly 40 nM, exactly 50 nM, exactly 75 nM, or exactly 0.1 pM. This concentration may provide several advantages including optimal signal generation, controlled enzymatic activity, and improved signal -to-noise ratios.

[0136] An operational advantage of the present system is that the reaction components are configured to operate without requiring pre-incubation of the Cast 2 polypeptide with the guide molecule. Traditional CRISPR-based detection protocols typically require a separate incubation step to allow formation of the ribonucleoprotein complex prior to targetaddition. The present system eliminates this requirement through optimized component concentrations and reaction conditions that promote efficient complex formation during the isothermal detection process itself. This simplification reduces the overall assay time and complexity while maintaining robust detection performance. The elimination of preincubation steps also reduces the potential for ribonucleoprotein complex degradation or aggregation that can occur during extended incubation periods.Guide Molecule Component

[0137] The guide molecule functions as a specificity-determining element that directs the Cast 2 polypeptide to recognize and bind to specific target sequences generated during the amplification process. A “guide molecule” as used herein refers to a synthetic or naturally derived nucleic acid molecule that forms a ribonucleoprotein complex with the Casl2 polypeptide and provides sequence-specific targeting through Watson-Crick base pairing with complementary DNA sequences. The guide molecule is specifically designed to be complementary to sequences present within the amplified products generated from circularized padlock probes, ensuring that Cast 2 activation occurs only in the presence of the intended target nucleic acid.

[0138] The guide molecule design incorporates several features that may optimize its performance within the one-pot detection system. The guide molecule sequence is selected to be complementary to regions within the padlock probe sequence that become accessible following circularization and amplification, typically targeting sequences within the linker region or junction sequences created during the circularization process. This design strategy ensures that guide molecule-mediated Casl2 activation is dependent upon successful completion of the padlock probe circularization and amplification steps, providing an additional layer of specificity to the detection process.

[0139] The length and composition of the guide molecule are optimized to provide robust Cast 2 binding while maintaining specificity for the intended target sequences. Typically, guide molecules range from 15 to 25 nucleotides in length. In an embodiment, the guide molecule target sequence is 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length. In an embodiment, the guide molecule sequence is also designed to minimize potential secondary structure formation and to avoid sequences that might exhibit cross-reactivity with non-target nucleic acids present in clinical samples.

[0140] Guide molecule stability and performance can be further enhanced through various chemical modifications that improve resistance to nuclease degradation, enhance binding affinity, or optimize delivery characteristics. Common modifications include 2'-O- methyl modifications at the ribose sugar, which provide enhanced stability against ribonuclease activity while maintaining Watson-Crick base pairing capability. Phosphorothioate linkages can be incorporated at the 5' and 3' termini or at internal positions to further improve nuclease resistance. Locked nucleic acid (LNA) or bridged nucleic acid (BNA) modifications may be introduced at specific positions to increase binding affinity and improve target discrimination. Additional modifications such as pseudouridine substitutions can enhance guide molecule stability and reduce immunogenicity in certain applications. The 5' and 3' termini may be modified with protective groups, fluorescent labels, or other functional moieties to improve performance or enable detection. These modifications can be strategically placed to optimize guide molecule function while maintaining compatibility with Cast 2 binding and activation, thereby enhancing the overall robustness and reliability of the detection system.Ligase Component

[0141] The ligase component serves the essential function of circularizing padlock probes that have successfully hybridized to target nucleic acid sequences. “Ligase” refers to an enzyme capable of catalyzing the formation of phosphodiester bonds between adjacent 5' phosphate and 3' hydroxyl groups of nucleic acid molecules. In the context of the present detection system, the ligase specifically catalyzes the joining of the 5' and 3' termini of padlock probes that have hybridized to their target sequences, converting the linear probe into a closed circular molecule that serves as a template for subsequent amplification steps.

[0142] In an embodiment, ligases include thermostable enzymes that maintain activity at the reaction temperature while exhibiting minimal activity on non-specifically bound or partially hybridized padlock probes. Suitable ligases include SplintR ligase, Taq DNA ligase, T3 DNA ligase, T4 DNA ligase, and 9°N DNA ligase, each of which exhibits distinct temperature optima and substrate specificity characteristics that can be selected based on the specific requirements of the detection assay. SplintR ligase demonstrates particular utility for applications requiring high specificity and low background ligation, while Taq DNA ligase provides robust performance across a wide temperature range. T3 DNA ligase and 9°N DNA ligase offer additional options for specialized applications where specifickinetic or thermostability characteristics are desired. T4 DNA ligase represents a widely utilized option that provides excellent substrate specificity and robust activity at moderate temperatures, typically functioning optimally at 16-37°C, making it well-suited for the isothermal reaction conditions employed in the detection system. T4 DNA ligase exhibits strong discrimination between correctly base-paired substrates and mismatched or gapped substrates, thereby providing enhanced specificity for properly hybridized padlock probes while minimizing non-specific ligation events that could generate false-positive signals. The enzyme requires ATP as a cofactor and exhibits reliable performance across diverse buffer conditions and sample matrices, offering enhanced compatibility with clinical specimens and complex biological samples that may contain potential reaction inhibitors.

[0143] In an embodiment, the ligase volume is 0.1 pL, 0.2 pL, 0.3 pL, 0.4 pL, 0.5 pL, 0.6 pL, 0.7 pL, 0.8 pL, 0.9 pL, 1 pL, 2 pL, 3 pL, 4 pL, 5 pL, 6 pL, 7 pL, 8 pL, 9 pL, or 10 pL. In an embodiment, the ligase volume is 0.1-1 pL, 2-4 pL, 2.5-3.5 pL, 3-5 pL, and 5-10 pL. In an embodiment, the ligase volume is 0.01-0.1 pL, 0.1-1 pL, 0.5-5 pL, 1-10 pL, 5-20 pL, and 10-50 pL. In an embodiment, the ligase volume is scaled according to the desired product.Polymerase Component

[0144] The polymerase component is responsible for amplifying circularized padlock probes through an isothermal amplification process, typically rolling circle amplification (RCA), which generates long single-stranded DNA products containing multiple copies of the padlock probe sequence. “Polymerase” refers to DNA polymerase enzymes capable of synthesizing complementary DNA strands using single-stranded DNA templates. In the context of the present system, the polymerase initiates synthesis from the 3' hydroxyl terminus of hybridized primers and proceeds around the circular padlock probe template, generating long concatemeric products that contain multiple copies of the probe sequence.

[0145] The polymerase employed in the system is selected for compatibility with isothermal reaction conditions and the ability to perform efficient strand displacement synthesis required for rolling circle amplification. The polymerase facilitates isothermal amplification between 24-40°C, providing substantial operational advantages including reduced energy consumption, simplified instrumentation requirements, and enhanced compatibility with point-of-care applications. The polymerase may exhibit several critical characteristics including high processivity (ability to add numerous nucleotides beforedissociating), robust strand displacement activity (capability to displace downstream DNA strands during synthesis), 3' to 5' exonuclease activity for proofreading, and stability under the isothermal reaction conditions employed in the detection system. The polymerases must maintain optimal activity across the temperature range of 24-40°C, with particular emphasis on robust performance at lower temperatures to enable efficient isothermal amplification. In an embodiment, the temperature is 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, or 40°C. In an embodiment the temperature range is between 26°C and 38°C, from 30°C to 35°C, and within the range of 33°C-40°C

[0146] In an embodiment, the polymer is a Phi29 DNA due to its exceptional processivity, with the ability to incorporate thousands of nucleotides without template dissociation. This enzyme exhibits strong 3' to 5' exonuclease activity that provides proofreading capability, ensuring high fidelity during amplification. Phi29 polymerase also demonstrates robust strand displacement activity and functions efficiently at isothermal temperatures throughout the 24-40°C range, making it ideally suited for the present detection system.

[0147] Alternative polymerases that can be employed in the system include Bst DNA polymerase, which offers excellent strand displacement activity and isothermal performance within the required temperature range, though it lacks 3' to 5' exonuclease activity. Deep Vent DNA polymerase provides thermostability and proofreading capability through its 3' to 5' exonuclease activity, while maintaining compatibility with isothermal conditions. Bsu DNA polymerase large fragment demonstrates strong strand displacement activity and high processivity suitable for rolling circle amplification. Klenow fragment (3' to 5' exonuclease minus) offers strand displacement capabilities, though with more limited processivity compared to phi29 polymerase. Large Klenow fragment provides enhanced processivity compared to the standard Klenow fragment while maintaining strand displacement activity. Bea DNA polymerase combines thermostability with strand displacement activity, making it suitable for applications requiring operation across the full temperature range. T7 DNA polymerase exhibits high processivity and can be employed in modified reaction conditions optimized for isothermal amplification.

[0148] In an embodiment, the polymerase is a T4 polymerase. T4 DNA polymerase exhibits strong 3' to 5' exonuclease activity, providing excellent proofreading capability and ensuring high fidelity during amplification processes. The enzyme exhibits goodprocessivity and is capable of performing strand displacement synthesis. T4 DNA polymerase functions effectively across a range of temperatures, including the isothermal conditions employed in the detection system, with optimal activity typically observed at 37°C, making it well-suited for the standard reaction temperatures used in the kit. The T4 DNA polymerase option offers distinct advantages in applications where high fidelity is crucial, such as the detection of point mutations, antimicrobial resistance markers, or strainspecific variants, where sequence accuracy is essential for accurate identification. The strong proofreading activity of T4 DNA polymerase can reduce amplification errors that might otherwise compromise detection specificity or lead to false-positive results in sensitive detection applications. T4 DNA polymerase also offers enhanced compatibility with certain buffer systems and reaction conditions that may be advantageous for specific sample types or when processing clinical specimens that contain potential PCR inhibitors. The enzyme's robust performance characteristics and tolerance for suboptimal reaction conditions can provide improved reliability in challenging sample matrices or when operating under less-than-ideal laboratory conditions.

[0149] Additional polymerase options include various engineered or modified versions of naturally occurring enzymes that have been optimized for specific reaction conditions or enhanced performance characteristics. These may include polymerases with improved thermostability, enhanced processivity, reduced exonuclease activity where desired, or optimized cofactor requirements. The selection of the appropriate polymerase depends on factors such as desired reaction temperature within the 24-40°C range, required amplification efficiency, tolerance for reaction inhibitors, and compatibility with other system components.

[0150] The polymerase component works synergistically with the other system components to ensure that amplification occurs only from properly circularized padlock probes. The isothermal nature of the amplification process eliminates the need for thermal cycling while maintaining robust amplification efficiency. The amplification products generated by the polymerase serve as targets for guide molecule recognition and subsequent Cast 2 activation, linking the amplification and detection processes within the integrated detection system. The high processivity of the preferred polymerases enables the generation of amplification products containing hundreds to thousands of copies of the padlock probesequence, providing substantial signal amplification that enhances the detection system's sensitivity.

[0151] In an embodiment, the polymerase volume is 0.1 pL, 0.2 pL, 0.3 pL, 0.4 pL, 0.5 pL, 0.6 pL, 0.7 pL, 0.8 pL, 0.9 pL, 1 pL, 2 pL, 3 pL, 4 pL, 5 pL, 6 pL, 7 pL, 8 pL, 9 pL, or 10 pL. In an embodiment, the polymerase volume is 0.1-1 pL, 2-4 pL, 2.5-3.5 pL, 3- 5 pL, and 5-10 pL. In an embodiment, the polymerase volume is 0.01-0.1 pL, 0.1-1 pL, 0.5-5 pL, 1-10 pM, 5-20 pL, and 10-50 pL. In an embodiment, the polymerase volume is scaled according to the desired product.Reporter Molecule Component

[0152] The reporter molecule serves as the signal-generating component, producing a detectable output upon cleavage by the activated Cast 2 polypeptide. A reporter molecule refers to a substrate molecule that undergoes a detectable change in physical or chemical properties when cleaved by the trans-cleavage activity of the Cast 2 polypeptide. The reporter molecule is designed to remain in a quenched or inactive state until cleaved by Cast 2, at which point it generates a measurable signal that indicates the presence of the target nucleic acid.

[0153] A critical design requirement for reporter molecules in Cas 12-based detection systems is the incorporation of a single-stranded DNA (ssDNA) region that serves as the cleavage substrate for the activated Casl2 nuclease. The Casl2 polypeptide exhibits robust trans-cleavage activity specifically against single-stranded nucleic acids, including both DNA and RNA substrates, but demonstrates minimal activity against double-stranded nucleic acids. Therefore, the reporter molecule single-stranded nucleic acid sequences that can be efficiently processed by the activated Cas 12 enzyme. In an embodiment the single stranded nucleic acid is DNA (ssDNA). The single stranded nucleic acid region typically comprises 8-20 nucleotides. In an embodiment, the single stranded nucleic acid regions comprises 10-15 nucleotides. The sequence composition of the single stranded region can be optimized for specific Cas 12 variants, though most Cas 12 family members demonstrate broad substrate specificity for single-stranded DNA cleavage.

[0154] The reporter molecule architecture typically incorporates the single stranded region cleavage substrate as a linker region between signaling elements, such as fluorophore and quencher pairs in fluorescent reporter systems. In the intact state, the proximity of the quencher molecule suppresses fluorescent emission from the fluorophore throughfluorescence resonance energy transfer (FRET) or other quenching mechanisms. Upon cleavage of the single stranded nucleic acid linker by activated Cast 2, the fluorophore and quencher are separated, resulting in increased fluorescent signal that can be detected using standard fluorometry equipment or even simple visual inspection under appropriate lighting conditions. The single stranded nucleic acid linker may be designed to maintain the appropriate spatial relationship between signaling elements while providing efficient access for Cast 2 cleavage.

[0155] Alternative reporter molecule formats accommodate different detection modalities while maintaining the cleavage substrate requirement. Colorimetric substrates incorporate single stranded linkers between enzyme substrate and inhibitor components, producing visible color changes upon cleavage and subsequent enzymatic activity. Lateral flow substrates utilize single stranded linkers to connect capture and detection elements, generating visible bands on test strips when cleaved by activated Casl2. Electrochemical substrates employ single stranded linkers between electroactive species and electrode surfaces, producing measurable electrical signals upon cleavage-induced changes in electron transfer efficiency.

[0156] The reporter molecule must demonstrate stability under the isothermal reaction conditions employed in the detection system, maintaining both structural integrity and signaling capability throughout the detection process. The ssDNA region must resist degradation by non-specific nucleases that may be present in clinical samples while remaining accessible to the specific trans-cleavage activity of activated Casl2. Chemical modifications such as phosphorothioate linkages or 2'-O-methyl modifications can be incorporated to enhance stability without compromising Casl2 cleavage efficiency.

[0157] The reporter molecule concentration should be sufficient to ensure that activated Casl2 enzymes encounter adequate substrate for signal generation, while avoiding concentrations that might inhibit other reaction components or create high background signals. The selection of appropriate reporter molecules depends on the intended application and available detection equipment, with the system designed to accommodate various reporter formats without requiring modifications to the core detection components.

[0158] In an embodiment, the reporter molecule volume is 0.1 pL, 0.2 pL, 0.3 pL, 0.4 pL, 0.5 pL, 0.6 pL, 0.7 pL, 0.8 pL, 0.9 pL, 1 pL, 2 pL, 3 pL, 4 pL, 5 pL, 6 pL, 7 pL, 8 pL, 9 pL, or 10 pL. In an embodiment, the reporter molecule volume is 0.1-1 pL, 2-4 pL, 2.5-3.5 pL, 3-5 pL, and 5-10 pL. In an embodiment, the reporter molecule volume is 0.01- 0.1 pL, 0.1-1 pL, 0.5-5 pL, 1-10 pL, 5-20 pL, and 10-50 pL. In an embodiment, the ligase volume is scaled according to the desired product.DETECTION METHODS AND PROTOCOLS

[0159] The present invention encompasses comprehensive methods for detecting target pathogens in clinical and research samples using the nucleic acid detection system described herein. These methods utilize the integrated padlock probe-CRISPR-Casl2 detection platform to provide rapid, sensitive, and specific pathogen identification directly from various sample types without requiring complex laboratory infrastructure or extensive sample preparation procedures. The detection methods are designed to accommodate diverse pathogen types including DNA viruses, RNA viruses, bacterial pathogens, and fungal organisms while maintaining consistent performance characteristics and simplified workflows suitable for point-of-care applications.

[0160] In an embodiment, the detection method comprises combining all reaction components of the nucleic acid detection system described herein in a single reaction vessel to create an integrated detection system. The method begins with combining a sample containing or suspected of containing target pathogen nucleic acid with the complete set of detection reagents. The pathogen-specific padlock probe is designed with hybrid arms complementary to the target pathogen nucleic acid and incorporates a linker region positioned between the hybrid arms to optimize circularization and amplification processes. The padlock probe further comprise a guide molecule target sequence.

[0161] Following component assembly, the reaction vessel is incubated at a temperature suitable for simultaneous circularization of the padlock probe, amplification of the circularized probe comprising the guide molecule target sequence, and activation of the Casl2 polypeptide. This isothermal incubation approach eliminates the need for thermal cycling equipment while maintaining robust detection performance across diverse pathogen targets. In an embodiment, the incubation temperature can be maintained at 24-40°C, 25- 38°C, 26-36°C, 27-35°C, 28-34°C, 29-33°C, 30-32°C, 24-30°C, 25-32°C, 26-35°C, 28- 40°C, 30-40°C, 32-38°C, exactly 24°C, exactly 25°C, exactly 26°C, exactly 27°C, exactly 28°C, exactly 30°C, exactly 32°C, exactly 35°C, exactly 37°C, or exactly 40°C, representing an advancement over conventional detection systems that typically require higher operating temperatures. In an embodiment, the incubation temperature is 25°C. The ability to operateat 25°C provides substantial practical advantages including reduced energy consumption, enhanced compatibility with ambient laboratory conditions, improved enzyme stability, and simplified instrumentation requirements for point-of-care applications.

[0162] The isothermal amplification step represents a critical component of the detection system, utilizing rolling circle amplification (RCA) to generate multiple copies of the circularized padlock probe sequence comprising the guide molecule target sequence. During this amplification process, the polymerase initiates synthesis from primer binding sites on the circular padlock probe template and proceeds continuously around the circular template multiple times, generating long single-stranded DNA products containing hundreds to thousands of copies of the original probe sequence.

[0163] The temperature optimization provides several technical advantages beyond simple operational convenience. The system achieves a balance between enzymatic activity and reaction specificity, with reduced formation of secondary structures that could interfere with probe hybridization or amplification processes. In an embodiment, the lower temperature also minimizes evaporation from reaction vessels, reducing the need for mineral oil overlays or specialized sealed reaction systems that are often required for higher temperature protocols. Additionally, the 25°C operating temperature is readily achievable using simple heating blocks, water baths, or even ambient temperature control in temperature-controlled environments, eliminating the need for thermal control instrumentation.

[0164] The detection process culminates with monitoring for signal generation that indicates the presence of the target pathogen nucleic acid in the sample. Signal detection can be accomplished through various modalities including fluorescence monitoring, colorimetric changes, lateral flow detection, or electrochemical measurements, depending on the reporter molecule employed and the available detection equipment. The signal generation is directly proportional to the amount of target nucleic acid present in the sample, enabling both qualitative detection and semi-quantitative assessment of pathogen load.

[0165] A critical advantage of the present detection methods is the elimination of preincubation requirements that are typically necessary in conventional CRISPR-based detection protocols. The methods utilize the optimized component concentrations and reaction conditions of the nucleic acid detection system described herein to promote efficient complex formation during the isothermal detection process itself. Thissimplification reduces the overall assay time, minimizes hands-on manipulation, and decreases the potential for procedural errors while maintaining robust detection performance.

[0166] The methods also eliminate the requirement for prior nucleic acid isolation from samples, representing a substantial advancement over conventional diagnostic approaches. Traditional pathogen detection protocols typically require complex sample preparation procedures including cell lysis, nucleic acid extraction, purification, and concentration steps that add significant time, cost, and complexity to the diagnostic workflow. The present methods operate directly on clinical samples with minimal processing, requiring only a brief heating step to denature double-stranded nucleic acids prior to padlock probe hybridization. This heating step comprises heating the sample to 60-95°C for 1-5 minutes, which is sufficient to disrupt double-stranded nucleic acid structures while preserving the integrity of target sequences for subsequent detection. In an embodiment, the temperature is 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93°C, 94°C, or 95°C. In an embodiment, the temperate is 60-65°C, 66-72°C, 70-80°C, 75-85°C, 80-90°C, or 85-95°C.

[0167] In an embodiment, the detection methods eliminate pre-incubation requirements that are typically necessary in conventional CRISPR-based detection protocols. The methods utilize the component concentrations and reaction conditions of the nucleic acid detection system described herein to promote efficient complex formation during the isothermal detection process itself. This simplification reduces the overall assay time, minimizes hands-on manipulation, and decreases the potential for procedural errors while maintaining robust detection performance.

[0168] The methods also eliminate the requirement for prior nucleic acid isolation from samples, representing a substantial advancement over conventional diagnostic approaches. Traditional pathogen detection protocols typically require complex sample preparation procedures including cell lysis, nucleic acid extraction, purification, and concentration steps that add significant time, cost, and complexity to the diagnostic workflow. The present methods operate directly on clinical samples with minimal processing. In an embodiment, the method comprises a brief heating step to denature double-stranded nucleic acids prior to padlock probe hybridization. This heating step comprises heating the sample to 60-95°C for1-5 minutes, which is sufficient to disrupt double-stranded nucleic acid structures while preserving the integrity of target sequences for subsequent detection. In an embodiment, the method comprises a brief heating step of the sample and all reaction components in the reaction vessel at 60-95°C for 1-5 minutes.

[0169] Samples may comprise any sample type suspected of comprising the target pathogen(s). In an embodiment, sample types include blood, serum, plasma, saliva, urine, cerebrospinal fluid, tissue samples, and fecal matter, providing flexibility for different clinical scenarios and patient populations.Detection of Double-Stranded Viruses

[0170] In an embodiment, the method is used to detect double-stranded DNA viruses, which represent a clinically significant group of pathogens causing diverse disease manifestations across immunocompetent and immunocompromised patient populations. Clinically relevant dsDNA viruses include herpesviruses (the most extensively studied and clinically important group), adenoviruses, polyomaviruses (including BK virus and JC virus), human papillomaviruses, poxviruses, and hepadnaviruses (hepatitis B virus). Among these, herpesviruses represent significant clinical targets due to their ubiquity, propensity for latency and reactivation, and substantial morbidity and mortality in vulnerable populations.

[0171] For double-stranded DNA virus detection, the padlock probe design may utilize the antiparallel nature of the DNA double helix to achieve specific target recognition and efficient circularization. The 5' hybrid arm comprises a sequence that is complementary to a first region of the target nucleic acid on one strand of the double helix, while the 3' hybrid arm comprises a sequence that is reverse complement to a second, adjacent region of the target nucleic acid on the opposite strand of the double helix. This design ensures that when the padlock probe encounters its target double-stranded DNA sequence, both hybrid arms simultaneously hybridize to their respective complementary regions on opposite strands, bringing the 5' phosphate and 3' hydroxyl termini of the probe into close proximity for efficient enzymatic ligation and circularization.

[0172] Specialized detection methods have been developed for direct detection of herpesviruses in clinical samples, addressing the critical need for rapid diagnosis of these clinically significant pathogens. Human herpesviruses comprise a family of eight distinct viruses classified into three subfamilies based on biological and genetic characteristics. Thealpha-herpesviruses are characterized by rapid replication, broad host range, and establishment of latency in sensory ganglia. This subfamily includes herpes simplex virus type 1 (HSV-1, HHV-1), herpes simplex virus type 2 (HSV-2, HHV-2), and varicella-zoster virus (VZV, HHV-3). The beta-herpesviruses exhibit slower replication kinetics, restricted host range, and establish latency in multiple cell types including monocytes, lymphocytes, and epithelial cells. This subfamily encompasses cytomegalovirus (CMV, HHV-5), human herpesvirus 6 A (HHV-6A), human herpesvirus 6B (HHV-6B), and human herpesvirus 7 (HHV-7). The gamma-herpesviruses demonstrate tropism for lymphoid cells, establish latency primarily in B lymphocytes, and are associated with lymphoproliferative disorders. This subfamily includes Epstein-Barr virus (EBV, HHV-4) and Kaposi's sarcoma-associated herpesvirus (KSHV, HHV-8).

[0173] The herpesvirus detection method comprises subjecting the clinical sample to a heating step to denature double-stranded nucleic acids without prior nucleic acid isolation, followed by creation of a reaction mixture by combining the heated sample with herpesvirus-specific detection reagents. The herpesvirus-specific padlock probes are designed to target conserved or strain-specific sequences within essential viral genes that are present during both lytic and latent phases of infection, ensuring robust detection across different stages of viral replication. The complement and reverse complement design of the hybrid arms ensures specific recognition of the target double-stranded viral DNA sequences while maintaining the spatial orientation necessary for efficient probe circularization. In an embodiment, the padlock probes may be configured to detect one or more genes from Table A and / or Table B.Table A - Human Herpesvirus Target Genes for Padlock Probe Design

[0174] The target gene selection for padlock probe design considers multiple factors including gene conservation across viral strains, expression levels during different phases of infection, sequence accessibility, and clinical relevance. DNA polymerase genes (UL30 for HSV, ORF29 for VZV, UL54 for CMV, U67 for HHV-6, U65 for HHV-7) represent highly conserved targets that are essential for viral replication and present in high copy numbers during active infection. The complement and reverse complement hybrid arm design ensures that these conserved double-stranded DNA targets can be efficiently recognized and processed by the detection system. Immediate-early genes such as UL123 (CMV IE1) and ORF62 (VZV IE62) are expressed early in the replication cycle and provide sensitive detection targets. Structural genes including major capsid proteins and glycoproteins offer stable targets that are present throughout the viral replication cycle.

[0175] The herpesvirus detection method accommodates various clinical sample types including blood, serum, plasma, saliva, urine, cerebrospinal fluid, tissue samples, and fecal matter, providing flexibility for different clinical scenarios and patient populations. The method is particularly valuable for monitoring CMV reactivation in transplant recipients through detection of ULI 23 and UL83 targets, detecting EBV-associated malignancies via EBNA1 and LMP1 detection, identifying HHV-6 reactivation in immunocompromised patients through U67 targeting, and diagnosing HSV infections across various clinical contexts using UL30 and UL27 targets. All steps of the herpesvirus detection process can be performed in a single reaction vessel without pre-incubation of the Cast 2 polypeptide with guide RNA, maintaining the simplified workflow advantages while providing pathogen-specific detection capabilities.Detection of RNA Viruses

[0176] In an embodiment, the method is used to detect single-stranded RNA viruses, which represent a diverse and clinically significant group of pathogens responsible for acute and chronic infections across all patient populations. Clinically relevant RNA viruses include respiratory viruses (influenza viruses, respiratory syncytial virus, human parainfluenza viruses, human metapneumovirus, rhinoviruses, coronaviruses including SARS-CoV-2), hepatitis viruses (hepatitis A, C, D, and E), hemorrhagic fever viruses (Ebola, Marburg, Lassa, dengue, yellow fever, Zika), neurotropic viruses (West Nile virus, Japanese encephalitis virus, tick-borne encephalitis virus), and chronic infection viruses (human immunodeficiency virus, human T-lymphotropic viruses). These viruses cause significant morbidity and mortality globally and require rapid, accurate detection for appropriate clinical management and public health response.

[0177] RNA virus detection requires specialized protocols that accommodate the singlestranded nature of RNA viral genomes while maintaining the advantages of the padlock probe detection system. In an embodiment, the method may further comprise an initial reverse transcription step to convert the single-stranded RNA genome into complementary DNA (cDNA). The RNA virus detection method comprises contacting the clinical sample with reverse transcriptase to generate complementary DNA (cDNA) without prior RNA isolation, followed by combining the sample containing cDNA with the detection reagent mixture. During reverse transcription, the single-stranded RNA genome serves as a template for synthesis of a complementary DNA strand, creating RNA-cDNA heteroduplexes. Theseheteroduplexes can be converted to double-stranded cDNA through second-strand synthesis, or the RNA template can be degraded to leave single-stranded cDNA products, depending on the specific protocol requirements.

[0178] For RNA virus detection, the padlock probe design must accommodate the nature of the target. When targeting double-stranded cDNA products, the virus-specific padlock probe utilizes the same complement and reverse complement hybrid arm design employed for double-stranded DNA viruses, with the 5' hybrid arm complementary to one strand and the 3' hybrid arm reverse complementary to the adjacent region on the opposite strand. When targeting single-stranded RNA or DNA products, both hybrid arms comprise sequences that are complementary to adjacent regions of the same cDNA strand, reflecting the single-stranded nature of the target following reverse transcription.Table B - Clinically Relevant RNA Viruses and Target Genes for Padlock Probe Design,, PrimaryGenome ... „ „ ClinicalVirus Family Virus Target Gene FunctionType Significance GenesHemagglutinin,SeasonalInfluenza neuraminidase,Orthomyxoviri dae ssRNA(-)epidemics,A NP, Ml nucleoprotein, pandemics matrixHemagglutinin,Influenza HA, NA, neuraminidase,Orthomyxoviri dae ssRNA(-) Seasonal epidemicsB NP, Ml nucleoprotein, matrixNucleocapsid,fusion, PediatricPneumoviridae RSV ssRNA(-) TJ— / attachment, respiratory disease polymerase Spike,DVA / S, N, E, nucleocapsid, COVID-19CoronaviridaessRNA(+>RdRp envelope, RNA pandemic polymerase Envelope, non-E, NS1,Dengue structural protein, Dengue fever,Flaviviridae ssRNA(+) NS3, virus protease, hemorrhagic feverNS5 polymerase Envelope, non-E, NS1,Zika structural protein, Congenital ZikaFlaviviridae ssRNA(+) NS3, virus protease, syndromeNS5 polymerase„ Primary Genome > ; „ .. ClinicalVirus Family Virus .. Target Gene Function ypeSignificance Genes5'UTR, RegulatoryHepatitisT. , , . Core, region, capsid, Chronic hepatitis,FlaviviridaeCSSRNA +) NS3, protease, cirrhosisNS5B polymeraseStructural,AIDS,Retroviridae HIV-1 ssRNAMga8’P01’enzymes’ env, LTR envelope, immunodeficiency regulatoryStructural,AIDS,Retroviridae HIV-2 ssRNAt+iga8’P01’enzymes’ env, LTR envelope, immunodeficiency regulatoryVP1,HepatitisT. , , . VP2, Capsid proteins,Picornaviridae A ssRNA(+) Acute hepatitis regulatory region5'UTRNucleoprotein,polymeraseFiloviridae EbolaSSRN (-) VP35, cofactor, Hemorrhagic fever virus „„Tglycoprotein, polymerase Nucleocapsid,Measlesn NI A, . N, H, F, hemagglutinin, Measles,Paramyxoviridae ssRNA(-) ’ virus J— / fusion, complications polymerase

[0179] The target gene selection for RNA virus padlock probe design requires consideration of genome organization, gene expression patterns, sequence conservation, and clinical diagnostic requirements. For negative-sense RNA viruses (influenza, RSV, Ebola), nucleocapsid genes (N, NP) provide highly conserved targets that are abundantly expressed during infection. Surface glycoprotein genes (HA / NA for influenza, F / G for RSV, GP for Ebola) enable subtyping and strain identification. For positive-sense RNA viruses (SARS- CoV-2, dengue, Zika, HCV), structural genes such as spike (S) and nucleocapsid (N) for coronaviruses, envelope (E) genes for flaviviruses, and non- structural genes including RNA-dependent RNA polymerase provide robust detection targets.

[0180] The 5' untranslated region (5'UTR) represents a particularly valuable target for several RNA viruses due to its high degree of conservation within viral species and essentialrole in viral replication. HCV 5'UTR detection enables pan-genotypic detection across all major HCV genotypes, while maintaining sufficient conservation for reliable detection despite sequence variability in other genomic regions.

[0181] For retroviruses such as HIV, the integrated proviral DNA can serve as an alternative target, eliminating the need for reverse transcription and enabling detection of latent infection. However, RNA-based detection remains important for viral load monitoring and assessment of active replication.

[0182] The RNA virus detection method accommodates diverse viral targets including influenza virus, respiratory syncytial virus, SARS-CoV-2, human immunodeficiency virus, hepatitis C virus, dengue virus, and Zika virus, providing broad applicability for viral diagnostics. The method maintains the isothermal detection approach and single-vessel workflow while incorporating the reverse transcription step necessary for RNA target processing. The detection system can be configured for real-time monitoring during the reverse transcription and detection process or for endpoint detection following completion of all enzymatic steps.

[0183] The flexibility of the padlock probe design framework enables adaptation to diverse RNA virus targets while maintaining the operational advantages of the nucleic acid detection system described herein. This capability provides critical support for pandemic preparedness, seasonal respiratory virus surveillance, and chronic infection monitoring across diverse clinical and public health applications.Detection of Bacterial Pathogens

[0184] In an embodiment the method is used ot detect bacterial pathogens, which represent a diverse group of microorganisms responsible for a broad spectrum of infectious diseases ranging from localized infections to life-threatening systemic conditions. Clinically relevant bacterial pathogens encompass gram-positive cocci (Staphylococcus species, Streptococcus species, Enterococcus species), gram-negative rods (Enterob acteriaceae family including Escherichia coli and Klebsiella pneumoniae, non-fermenting gramnegative rods including Pseudomonas aeruginosa and Acinetobacter baumannii), grampositive rods (Bacillus species, Listeria monocytogenes, Corynebacterium species), mycobacteria (Mycobacterium tuberculosis complex, non-tuberculous mycobacteria), anaerobic bacteria (Clostridioides difficile, Bacteroides species, Peptostreptococcus species), and fastidious organisms (Haemophilus species, Neisseria species, Legionellapneumophila). These pathogens cause significant morbidity and mortality globally and are increasingly associated with antimicrobial resistance, necessitating rapid and accurate detection for optimal patient management.

[0185] The detection methods extend to bacterial pathogens through specialized protocols that accommodate the unique characteristics of bacterial nucleic acids and clinical presentation. Bacterial genomic DNA exists as double-stranded circular chromosomes, often accompanied by plasmids that may carry virulence factors and antimicrobial resistance genes. In an embodiment, the padlock probe design for bacterial detection utilizes the same complement and reverse complement hybrid arm architecture employed for double-stranded DNA viruses, with the 5' hybrid arm complementary to one strand of the target bacterial DNA sequence and the 3' hybrid arm reverse complementary to the adjacent region on the opposite strand.

[0186] The bacterial pathogen detection method follows a similar workflow to viral detection but incorporates bacteria-specific padlock probes designed to recognize conserved or species-specific sequences from target bacterial organisms. The method accommodates the generally larger genome size of bacteria compared to viruses, providing multiple target options for probe design including housekeeping genes, virulence factors, species-specific sequences, and antimicrobial resistance markers.Table C - Clinically Relevant Bacterial Pathogens and Target Genes for Padlock Probe Design

[0187] The target gene selection for bacterial pathogen detection encompasses multiple categories of genetic markers. The 16S ribosomal RNA gene serves as a universal bacterial target due to its presence in all bacteria and species-specific sequence variations that enable taxonomic identification. Housekeeping genes such as gyrB (DNA gyrase subunit B), rpoB (RNA polymerase P subunit), and tuf (elongation factor Tu) provide highly conserved targets for broad bacterial detection while containing sufficient sequence diversity for species differentiation.

[0188] Species-specific genes offer enhanced specificity for pathogen identification. Examples include nuc (thermonuclease) for S. aureus, uidA (P-glucuronidase) for E. coh, oprl and oprL (outer membrane proteins) for P. aeruginosa, and IS6110 (insertion sequence) for AT. tuberculosis. These targets enable definitive species identification and differentiation from closely related organisms.

[0189] Virulence factor genes provide clinically relevant targets that correlate with pathogenic potential and disease severity. Toxin genes such as tcdA and tcdB in C. difficile, hemolysin genes (hlyA) in various pathogens, and adhesion factors enable detection of virulent strains and assessment of pathogenic potential.

[0190] A particularly valuable application of the bacterial detection method is the identification of antimicrobial resistance markers through bacteria-specific padlock probes that target genes encoding resistance determinants. These probes can recognize sequences encoding P-lactamases (blaTEM, blaSHV, blaCTX-M, blaKPC, blaNDM), aminoglycosidemodifying enzymes (aac, ant, aph genes), efflux pumps (mexAB-oprM, acrAB-tolC), ribosomal modifications (ermA, ermB, ermC), and other proteins that confer resistance to specific antimicrobial agents. This capability enables rapid resistance profiling that can inform treatment decisions and antimicrobial stewardship efforts, addressing the critical clinical need for rapid resistance detection in bacterial infections.

[0191] The bacterial pathogen detection method accommodates various clinical sample types including blood, urine, respiratory specimens, wound samples, cerebrospinal fluid,and tissue samples. The method is particularly valuable for rapid identification of sepsiscausing organisms, urinary tract infection pathogens, respiratory pathogens in pneumonia, and wound infection organisms. The complement and reverse complement hybrid arm design ensures efficient recognition of bacterial double-stranded DNA targets while maintaining the operational advantages of the isothermal detection system described herein. Detection of Fungal Pathogens

[0192] In an embodiment, the method is used for detecting fungal pathogens, which represent a diverse group of eukaryotic microorganisms responsible for superficial, invasive, and systemic mycoses with increasing clinical importance, particularly in immunocompromised patient populations. Clinically relevant fungal pathogens encompass yeasts (Candida species, Cryptococcus species, Malassezia species), molds (Aspergillus species, Mucormycetes, Fusarium species, Scedosporium species), dimorphic fungi (Histoplasma capsulatum, Blastomyces dermatitidis, Coccidioides species, Paracoccidioides species), dermatophytes (Trichophyton species, Microsporum species, Epidermophyton floccosum . and atypical fungi (Pneumocystis jirovecii). These pathogens cause a spectrum of diseases ranging from superficial skin infections to life-threatening invasive mycoses, with mortality rates exceeding 50% for certain invasive infections in high-risk patients.

[0193] Fungal genomic DNA exists as double-stranded linear chromosomes within membrane-bound nuclei, often accompanied by mitochondrial DNA and episomal elements. The padlock probe design for fungal detection utilizes the complement and reverse complement hybrid arm architecture, with the 5' hybrid arm complementary to one strand of the target fungal DNA sequence and the 3' hybrid arm reverse complementary to the adjacent region on the opposite strand.

[0194] The fungal pathogen detection method accommodates the unique characteristics of fungal nucleic acids, including the presence of introns in many genes, alternative splicing patterns, and the complex genomic organization typical of eukaryotic organisms. The method targets both ribosomal RNA genes, which are highly conserved within species but exhibit sufficient variability for taxonomic identification, and protein-coding genes that provide species-specific identification and functional information.Table D - Clinically Relevant Fungal Pathogens and Target Genes for Padlock Probe Design

[0195] The target gene selection for fungal pathogen detection requires consideration of the unique characteristics of fungal genomes and the diagnostic challenges associated with mycological identification. The 18S ribosomal RNA gene serves as a universal fungal targetdue to its presence in all fungi and species-specific sequence variations that enable taxonomic classification. The internal transcribed spacer regions (ITS1 and ITS2) flanking the 5.8 S rRNA gene represent the primary fungal DNA barcode regions, providing specieslevel identification capability and serving as the standard for molecular fungal identification.

[0196] Protein-coding genes offer enhanced specificity and functional information for fungal detection. P-tubulin genes provide excellent targets for species differentiation among morphologically similar fungi, particularly within the Aspergillus and Fusarium complexes. Elongation factor genes (EF-la, EF3) offer highly conserved housekeeping functions with sufficient sequence variability for species identification. RNA polymerase subunit genes (RPB1, RPB2) provide robust phylogenetic markers for challenging taxonomic groups.

[0197] Species-specific virulence factors enable detection of pathogenic potential and clinical correlation. Examples include CAP59 (capsule biosynthesis) in Cryptococcus species, which correlates with virulence and immune evasion capability, H-antigen in Histoplasma capsulatum for species confirmation, and YPS3 (yeast phase-specific protein) for identification of the pathogenic yeast form of dimorphic fungi.

[0198] Antifungal resistance genes represent increasingly important targets for clinical management. ERG11 (lanosterol 14a-demethylase) mutations confer azole resistance in Candida and Aspergillus species, FKS1 and FKS2 mutations provide echinocandin resistance in Candida species, and CYP51A mutations mediate azole resistance in Aspergillus fumigatus. DHPS (dihydropteroate synthase) mutations in Pneumocystis jirovecii confer resistance to sulfamethoxazole-trimethoprim.

[0199] The fungal pathogen detection method accommodates various clinical sample types including blood, respiratory specimens (sputum, bronchoalveolar lavage), cerebrospinal fluid, tissue samples, skin and nail specimens, and sterile body fluids. The method is particularly valuable for rapid identification of invasive fungal infections in immunocompromised patients, where early diagnosis and treatment initiation are critical for patient survival. The complement and reverse complement hybrid arm design ensures efficient recognition of fungal double-stranded DNA targets while accommodating the complex genomic organization typical of eukaryotic pathogens.

[0200] The detection method addresses critical diagnostic gaps in medical mycology, where traditional culture-based methods require extended incubation periods and specialized expertise, and where morphological identification can be challenging orimpossible for certain species. The isothermal detection approach provides rapid results that can guide antifungal therapy selection and infection control measures, particularly important given the limited therapeutic options available for certain invasive mycoses and the emergence of antifungal resistance across multiple fungal species.Detection of Strain-Specific Variants

[0201] The detection platform encompasses sophisticated methods for identifying strain-specific pathogen variants through multiplexed detection approaches that can differentiate between closely related strains or variants across viral, bacterial, and fungal pathogens within a single assay. The strain-specific pathogen variant identification method comprises contacting the sample with a plurality of strain-specific padlock probes, each designed to recognize unique sequence signatures that distinguish specific pathogen strains or variants from closely related organisms. Each strain-specific padlock probe comprises a 5' hybrid arm with a sequence complementary to a first region of a strain-specific target sequence and a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the strain-specific target sequence, with each probe incorporating a linker region between the hybrid arms.

[0202] The multiplexed approach enables simultaneous detection of multiple pathogen strains or variants within a single reaction, providing comprehensive strain identification capabilities that are particularly valuable for epidemiological investigations, outbreak characterization, antimicrobial and antifungal resistance monitoring, and clinical diagnosis where strain identity affects treatment decisions or public health response. The strainspecific target sequences may be located within variable regions of pathogen genomes that exhibit sufficient sequence divergence to enable specific recognition while maintaining conservation within individual strains or variants.Viral Strain-Specific Detection

[0203] For viral pathogens, strain-specific detection focuses on rapidly evolving genomic regions that accumulate mutations leading to antigenic drift, drug resistance, or altered pathogenicity. SARS-CoV-2 variant identification targets the spike protein gene, focusing on key mutations such as D614G, N501Y, E484K, K417N / T, L452R, and T478K that define variants of concern including Alpha, Beta, Gamma, Delta, and Omicron lineages. Influenza strain typing utilizes hemagglutinin (HA) and neuraminidase (NA) gene sequences to differentiate between H1N1, H3N2, and other subtypes, enabling seasonalvaccine strain selection and pandemic preparedness. HIV drug resistance monitoring targets the pol gene region, identifying specific mutations such as Ml 84 V (lamivudine / emtricitabine resistance), K103N (efavirenz / rilpivirine resistance), and major protease inhibitor resistance mutations including D30N, M46I, G48V, I50V, V82A, I84V, and L90M.

[0204] Human herpesviruses exhibit strain-level variation that impacts clinical outcomes, antiviral resistance patterns, geographic distribution, and epidemiological tracking. Herpesvirus strain-specific detection addresses multiple variant types including antiviral resistance mutations, geographic lineages, virulence variants, and recombinant strains.

[0205] CMV demonstrates extensive strain diversity with clinical implications for transplant outcomes and antiviral therapy. Glycoprotein gene variants in UL144, UL146, and UL147 define distinct CMV genotypes that correlate with immune evasion capabilities and clinical severity. UL144 genotypes (A, B, C) exhibit different abilities to downregulate NKG2D ligands, affecting natural killer cell recognition.

[0206] EBV exists as two major types (Type 1 and Type 2) distinguished by EBNA-2 and EBNA-3 gene sequences, with Type 1 showing greater transforming ability and global distribution. LMP1 (latent membrane protein 1) variants include the Chinal variant associated with nasopharyngeal carcinoma, the Mediterranean variant linked to Hodgkin lymphoma, and the North Carolina variant found in Western populations. BZLF1 variants affecting the immediate-early transactivator ZEBRA influence viral reactivation patterns and therapeutic responses.

[0207] VZV strains are classified into five major clades (A, B, C, D, E) with distinct geographic distributions. Clade A predominates in Europe and North America, Clade B in Asia, and Clades C, D, E show more restricted geographic ranges. The Oka vaccine strain (derived from Clade A) can be distinguished from wild-type strains through specific single nucleotide polymorphisms in ORF62, ORFO, and ORF21. Antiviral resistance variants include thymidine kinase mutations (R216H, T60A) and DNA polymerase mutations conferring acyclovir resistance.

[0208] HSV strains exhibit variation in neurovirulence, latency characteristics, and antiviral sensitivity. HSV-1 strains include the KOS strain (laboratory reference), F strain (prototype), McIntyre strain and clinical isolates with varying neurotropism. Antiviralresistance mutations primarily occur in thymidine kinase (TK) genes, including frameshift mutations, nonsense mutations, and amino acid substitutions (R176Q, R222C) that confer acyclovir resistance. HSV-2 resistance variants include similar TK mutations and occasional DNA polymerase mutations in severely immunocompromised patients.

[0209] While originally considered variants of the same virus, HHV-6A and HHV-6B are now recognized as distinct species with different clinical implications. HHV-6B causes roseola infantum and febrile seizures in children, while HHV-6A has unclear pathogenic significance. Strain differentiation targets include the U12, U39, and U100 genes that show substantial sequence divergence between the two species.

[0210] KSHV exhibits distinct subtypes (A, B, C, D, E) with geographic clustering. Subtype A predominates in Mediterranean regions and among men who have sex with men, Subtype B is found in sub-Saharan Africa, and Subtype C occurs in Pacific regions. The KI gene shows the highest variability and serves as the primary target for subtype classification, while ORF-K 15 variants also contribute to strain differentiation and potentially to oncogenic potential.

[0211] HHV-7 shows less characterized strain variation, but variants have been identified in the U12 and U21 genes that may correlate with different clinical presentations and reactivation patterns in immunocompromised patients.

[0212] The herpesvirus strain-specific detection method utilizes these variant sequences to provide clinically relevant information including antiviral resistance profiling, epidemiological tracking, vaccine strain identification, and risk stratification for transplant recipients. The padlock probe design targets the specific variant sequences while maintaining compatibility with the isothermal detection system described herein, enabling rapid strain characterization that informs clinical management and infection control decisions.Bacterial Strain-Specific Detection

[0213] Bacterial strain-specific detection encompasses multiple typing methodologies that provide epidemiological and clinical insights essential for outbreak investigation and antimicrobial stewardship. Multi-locus sequence typing (MLST) targets utilize housekeeping genes such as aroE, gdh, gki, recP, spi, xpt, and ddl to define sequence types that correlate with clonal complexes and epidemic lineages. For Staphylococcus aureus, strain-specific detection targets include spa (staphylococcal protein A) gene polymorphismsfor spa typing, SCCmec (staphylococcal cassette chromosome mec) elements for methicillin-resistant S. aureus (MRS A) typing, and agr (accessory gene regulator) alleles that influence virulence expression.

[0214] Enterobacteriaceae strain typing focuses on extended-spectrum P-lactamase (ESBL) and carbapenemase gene variants, with specific targeting of blaCTX-M subtypes (blaCTX-M-1, blaCTX-M-9, blaCTX-M-14, blaCTX-M-15), blaKPC variants (blaKPC-2, blaKPC-3), and blaNDM subtypes (blaNDM- 1, blaNDM-5) that exhibit distinct epidemiological patterns and resistance profiles. Clostridioides difficile strain identification targets binary toxin genes (cdtA, cdtB), tcdA and tcdB toxin gene variants, and ribotype- specific regions that correlate with hypervirulent strains such as NAP 1 / B 1 / 027.

[0215] Mycobacterium tuberculosis strain-specific detection utilizes spoligotyping patterns, IS6110 insertion sequence polymorphisms, and variable number tandem repeat (VNTR) loci to identify outbreak clusters and transmission chains. Beijing lineage identification targets specific genetic markers including the RD 105 deletion and pksl 5 / 1 gene polymorphisms that correlate with enhanced virulence and drug resistance.Fungal Strain-Specific Detection

[0216] Fungal strain-specific detection addresses the complex taxonomy and emerging resistance patterns observed across medically important fungi. Candida auris clade identification targets ITS and D1 / D2 sequence polymorphisms that distinguish between the four major geographic clades (South Asian, East Asian, African, and South American), each exhibiting distinct antifungal resistance profiles and epidemiological characteristics. Aspergillus fumigatus azole resistance detection focuses on CYP51A gene mutations, particularly the TR34 / L98H and TR46 / Y121F / T289A tandem repeat and point mutation combinations that confer pan-azole resistance.

[0217] Cryptococcus species strain typing utilizes multilocus sequence typing (MLST) targeting CAP59, GPD1, LAC1, PLB1, SOD1, URA5, and IGS1 loci to distinguish between molecular types that correlate with geographic distribution, antifungal susceptibility, and clinical outcomes. Mucormycetes species identification within the complex requires targeting of multiple genes including ACT1, RPB1, RPB2, and TEF-la due to the morphological similarity and varied susceptibility patterns across different species within the order.

[0218] Following contact with the sample, the strain-specific padlock probes undergo selective hybridization and circularization based on the presence of their corresponding target sequences. Only probes that encounter their specific target strains will successfully circularize, providing the selectivity mechanism that enables strain differentiation across viral, bacterial, and fungal pathogens. The method then performs isothermal amplification on the circularized padlock probes, generating amplified products that correspond to the specific pathogen strains or variants present in the sample. This isothermal amplification operates within a temperature range of 24-40°C, with optimal performance achieved at temperatures as low as 25°C, providing exceptional operational flexibility and compatibility with diverse laboratory environments.

[0219] The detection of strain-specific amplified products is accomplished using a CRISPR-Casl2 detection system that operates without pre-incubation of the CRISPR- Casl2 components with guide RNA, maintaining the simplified workflow advantages while accommodating the multiplexed detection format. The detection system can be configured with multiple guide RNAs that correspond to the different strain-specific targets, enabling simultaneous identification of multiple strains or variants within a single assay. Alternatively, the system can employ universal guide RNAs that recognize common sequences present in all strain-specific amplified products, followed by strain identification through amplicon characterization or sequencing.

[0220] The strain-specific pathogen identification method provides critical support for infection control programs through rapid identification of outbreak strains, healthcare- associated infection surveillance through detection of high-risk clones, and antimicrobial stewardship through resistance gene variant identification. The method's ability to differentiate between epidemic and endemic strains enables targeted infection control interventions and contact tracing efforts. For fungal pathogens, strain-specific identification supports antifungal stewardship by identifying resistant strains that require alternative therapeutic approaches and infection control measures to prevent healthcare-associated transmission.Detection of Anti-microbial Resistance

[0221] In an embodiment, the method is used to detect antimicrobial resistance variants across bacterial, viral, and fungal pathogens, addressing the critical clinical need for rapid resistance profiling to guide therapeutic decisions and infection control measures.Antimicrobial resistance variants encompass diverse genetic mechanisms including enzymatic inactivation, target modification, efflux pump expression, and metabolic bypass pathways that confer resistance to specific antimicrobial agents.Antibacterial Resistance Variants

[0222] Beta-Lactamase Variants: Beta-lactamase enzymes represent the most clinically significant bacterial resistance mechanism, with over 3,000 characterized variants. Extended-spectrum beta-lactamases (ESBLs) include blaCTX-M variants (CTX-M-1, CTX- M-3, CTX-M-14, CTX-M-15, CTX-M-27) that exhibit distinct substrate profiles and geographic distributions. CTX-M-15 predominates globally and confers resistance to ceftriaxone and ceftazidime, while CTX-M-14 is prevalent in Asia and shows enhanced activity against cefotaxime. blaTEM variants include TEM-1 (narrow-spectrum), TEM-3, TEM-4, TEM-5 (ESBL variants), and inhibitor-resistant TEM variants (IRT) such as TEM- 30 and TEM-33. blaSHV variants encompass SHV-1 (narrow-spectrum), SHV-2, SHV-5, SHV-12 (ESBL variants), and SHV-10 (inhibitor-resistant variant).

[0223] Carbapenemase variants include blaKPC subtypes (KPC-2, KPC-3, KPC-4) with KPC-2 and KPC-3 being most prevalent in Klebsiella pneumoniae carbapenemase- producing Enterob acteriaceae (KPC-CRE). Metallo-beta-lactamases include blaNDM variants (NDM-l, NDM-4, NDM-5, NDM-7, NDM-9) withNDM-l being the index enzyme and NDM-5 showing enhanced carbapenemase activity. blaVIM variants (VIM-1, VIM-2, VIM-4) and blaIMP variants (IMP-1, IMP-4, IMP-6) demonstrate geographic clustering and distinct substrate profiles. blaOXA-48-like variants include OXA-48, OXA-162, OXA-181, OXA-232, and OXA-244, each exhibiting different hydrolysis profiles and carbapenem resistance levels.

[0224] Quinolone Resistance Variants: Chromosomal quinolone resistance results from mutations in DNA gyrase (gyrA, gyrB) and topoisomerase IV (parC, parE) genes. Common gyrA mutations include Ser83Phe, Ser83Tyr, Asp87Asn, Asp87Gly, and Asp87Tyr in E. coli, with double mutations conferring high-level fluoroquinolone resistance. Plasmid- mediated quinolone resistance (PMQR) variants include qnrA (qnrAl, qnrA6), qnrB (qnrBl, qnrB2, qnrB4, qnrB6), qnrC, qnrD, and qnrS (qnrSl, qnrS2) that provide low-level resistance but facilitate selection of high-level resistance mutations.

[0225] Aminoglycoside Resistance Variants: Aminoglycoside-modifying enzymes include acetyltransferases (AAC), nucleotidyltransferases (ANT), and phosphotransferases(APH). Common variants include aac(3)-IIa, aac(6')-Ib, ant(2")-Ia, ant(3")-Ia, aph(3')-Ia, and aph(3')-VIa. The bifunctional enzyme AAC(6')-Ib-cr variant confers resistance to both aminoglycosides and fluoroquinolones. 16S rRNA methylases including armA, rmtA, rmtB, rmtC, rmtD, and npmA confer high-level pan-aminoglycoside resistance.

[0226] Macrolide Resistance Variants: Erythromycin ribosomal methylases include ermA, ermB, ermC, and ermF variants that confer cross-resistance to macrolides, lincosamides, and streptogramin B (MLSB phenotype). Efflux-mediated resistance includes msrA, msrB (macrolide-streptogramin resistance), and mphA variants. Lincosamide nucleotidyltransferases include InuA, InuB, and InuC variants.

[0227] Methicillin Resistance Variants: Staphylococcal cassette chromosome mec (SCCmec) elements contain mecA or mecC genes encoding altered penicillin-binding proteins. SCCmec types I-V exhibit different sizes and genetic compositions, with type IV being most common in community-associated MRSA and types I-III in hospital-associated MRSA. The mecC variant (formerly mecALGA251) occurs in specific S. aureus lineages and exhibits unique PCR detection characteristics.Antiviral Resistance Variants

[0228] HIV drug resistance mutations affect multiple drug classes. Nucleoside reverse transcriptase inhibitor (NRTI) resistance includes M184V / I (lamivudine / emtricitabine), K65R (tenofovir), thymidine analog mutations (TAMs) including M41L, D67N, K70R, L210W, T215Y / F, K219QZE that confer zidovudine / stavudine resistance, and Q151M complex mutations. Non-nucleoside reverse transcriptase inhibitor (NNRTI) resistance mutations include K103N, Y181C, G190A / S (efavirenz / rilpivirine resistance), K101E, and V106A / M.

[0229] Protease inhibitor resistance includes major mutations D30N, M46I / L, G48V, I50L / V, V82A / F / L / T / S, I84V, and L90M, along with minor mutations that accumulate to confer high-level resistance. Integrase strand transfer inhibitor (INSTI) resistance includes Q148H / K / R, N155H, and Y143C / H / R mutations that affect dolutegravir and raltegravir susceptibility.

[0230] Neuraminidase inhibitor resistance mutations include H275Y in N1 neuraminidase (oseltamivir resistance), El 19V, D151V, R152K, and I222R / K that affect oseltamivir and zanamivir susceptibility. Adamantane resistance results from M2 ionchannel mutations including L26F, V27A, A30T, S3 IN, and G34E that confer resistance to amantadine and rimantadine.

[0231] Herpesvirus Antiviral Resistance Variants: HSV and VZV thymidine kinase mutations include frameshift mutations, nonsense mutations, and missense mutations (R176Q, R222C, A168T) that confer acyclovir resistance. DNA polymerase mutations in UL30 (HSV) and ORF28 (VZV) genes include A719T, S724N, and D368A that confer resistance to acyclovir, valacyclovir, and famciclovir.

[0232] CMV resistance mutations include UL97 kinase mutations (M460V, H520Q, A594V, L595S, C603W) conferring ganciclovir resistance and UL54 DNA polymerase mutations (A809V, N408K, F412C, A834P) providing cross-resistance to ganciclovir, cidofovir, and foscarnet.Antifungal Resistance Variants

[0233] Candida azole resistance mechanisms include ERG11 mutations encoding altered lanosterol 14a-demethylase with hotspot mutations Y132F, K143R, F145L, S405F, G464S, and R467K. Efflux pump overexpression involves CDR1, CDR2 (ABC transporters), and MDR1 (MFS transporter) upregulation through gain-of-function mutations in transcriptional regulators TAC1 and MRR1.

[0234] Aspergillus fumigatus azole resistance includes CYP51 A mutations, particularly TR34 / L98H and TR46 / Y121F / T289A tandem repeat and point mutation combinations that confer pan-azole resistance. Additional mutations include G54E, M220I, G432S, and G448S that affect itraconazole and voriconazole susceptibility.

[0235] Candida echinocandin resistance results from FKS1 and FKS2 mutations in glucan synthase hotspot regions. FKS1 hotspot 1 mutations include S645P, S645F, S645Y, and R1361G / H, while hotspot 2 mutations include R1361G / H / K. C. glabrata shows particularly high rates of FKS resistance mutations including F625S, S629P, and W715X.

[0236] Amphotericin B resistance involves ERG genes affecting ergosterol biosynthesis, including ERG2, ERG3, ERG6, and ERG11 mutations that alter membrane sterol composition and reduce amphotericin B binding affinity.

[0237] The antimicrobial resistance variant identification method utilizes these specific genetic markers to provide rapid resistance profiling that directly impacts clinical decisionmaking. The padlock probe design targets conserved regions flanking resistance mutations while maintaining compatibility with the isothermal detection system described herein,enabling simultaneous pathogen identification and resistance characterization within a single assay. This capability supports antimicrobial stewardship programs through rapid identification of resistant organisms, infection control programs through detection of transmissible resistance elements, and clinical management through optimization of antimicrobial therapy selection based on genotypic resistance profiles.Multiplex Detection

[0238] In an embodiment, the method comprises integrated point-of-care detection systems that utilize the nucleic acid detection system described herein for simultaneous identification of multiple pathogens directly from clinical samples without requiring complex laboratory infrastructure or extensive sample preparation procedures. These systems represent a significant advancement in diagnostic technology by combining the molecular recognition capabilities of the integrated detection platform in a streamlined, user-friendly system suitable for deployment in clinical settings, emergency departments, physician offices, and other point-of-care environments.

[0239] The method incorporates a plurality of pathogen-specific padlock probes, each designed to recognize and bind to specific target pathogen nucleic acids through the complementary hybridization mechanisms described herein. The padlock probes may also include probes configured to detect specific stains of a pathogen or anti-microbial resistance.

[0240] The multiplexed detection capability enables simultaneous identification of diverse pathogen types including DNA viruses such as herpesviruses (alpha-herpesvirus, beta-herpesvirus, gamma-herpesvirus), bacterial pathogens such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Mycobacterium tuberculosis, and Clostridioides difficile, and RNA viruses such as influenza virus, respiratory syncytial virus, SARS-CoV- 2, human immunodeficiency virus, hepatitis C virus, dengue virus, and Zika virus. The system can be configured with pathogen panels tailored to specific clinical scenarios, geographic regions, or diagnostic requirements.

[0241] The system incorporates a plurality of guide RNAs, each specifically designed to recognize amplified products corresponding to specific target pathogens. This multiplexed guide RNA approach enables the single Cast 2 polypeptide component to provide specific recognition for multiple different pathogen targets within the same reaction system. Each guide RNA is designed to be complementary to sequences within the amplified products generated from specific pathogen-associated padlock probes, ensuring that signalgeneration occurs only when the corresponding target pathogen is present in the clinical sample.

[0242] The guide RNA design strategy accommodates the multiplexed detection format by incorporating pathogen-specific sequences that enable discrimination between different target organisms while maintaining compatibility with the shared Casl2 polypeptide component. The guide RNAs typically range from 15-25 nucleotides in length, with 18-22 nucleotides being preferred for optimal binding affinity and specificity. In an embodiment, the guide RNAs target sequence is 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or 25 nucleotides in length. The guide RNA sequences can be selected from conserved regions that are specific to individual pathogens or from variable regions that enable strain-level discrimination, depending on the diagnostic requirements of the particular application.Multiplex Detection Reporter Molecule Design Considerations

[0243] Multiplex detection applications utilizing the nucleic acid detection system described herein require specialized reporter molecule design strategies to enable simultaneous identification of multiple pathogen targets within a single assay format. The complexity of multiplex detection introduces unique challenges not encountered in singletarget assays, necessitating careful consideration of spectral properties, spatial organization, signal discrimination, crosstalk prevention, and detection system compatibility.Spatial Separation Multiplexing

[0244] Spatial separation represents a highly effective multiplexing strategy that utilizes identical reporter molecules across multiple discrete reaction volumes, with each volume containing padlock probes specific for different pathogen targets. This approach eliminates the spectral complexity associated with multi -fluor ophore systems while enabling comprehensive multi-target detection through physical compartmentalization of reactions.

[0245] The spatial separation method employs standard reporter molecule designs optimized for single-target detection, avoiding the need for multiple fhiorophore-quencher pairs and associated spectral considerations. Each reaction volume contains the complete nucleic acid detection system described herein, including identical Cast 2 polypeptides, ligases, polymerases, and reporter molecules, with the only variable being the pathogenspecific padlock probes and corresponding guide RNAs.

[0246] Microwell plate formats provide the most common implementation of spatial separation multiplexing, utilizing 96-well, 384-well, or higher density plates where each well contains reagents for detecting a specific pathogen target. This format enables simultaneous processing of multiple samples across multiple targets, providing comprehensive pathogen screening capabilities. The identical reporter molecule chemistry across all wells ensures consistent detection sensitivity and eliminates the need for signal normalization between different targets.

[0247] Microfluidic devices offer advanced spatial separation capabilities through integrated channel networks that enable parallel processing of multiple targets within a single device. Each channel or chamber contains target-specific padlock probes while sharing common fluidic connections for sample introduction and waste removal. The microfluidic format reduces reagent consumption, minimizes cross-contamination risks, and enables automated processing workflows.

[0248] Array -based spatial separation utilizes spotted or printed padlock probes on solid surfaces, with different locations corresponding to different pathogen targets. The sample and detection reagents flow across the array surface, enabling simultaneous interaction with all targets while maintaining spatial separation of detection signals. Signal localization correlates directly with target identity, eliminating the need for spectral discrimination.

[0249] The spatial separation approach provides several advantages including simplified assay development, reduced optimization requirements, and enhanced assay robustness. The use of identical reporter molecules across all targets eliminates batch-to- batch variation in fluorophore properties and ensures consistent performance across different pathogen targets. Quality control and validation procedures are simplified since the same detection chemistry is employed across all spatial locations.Spectral Separation and Fluorophore Selection

[0250] The fundamental requirement for multiplex fluorescent detection within a single reaction volume is adequate spectral separation between different reporter molecules to prevent signal overlap and enable accurate target discrimination. Fluorophore selection must consider excitation and emission wavelength ranges, spectral bandwidth, and instrument filter compatibility. Common multiplex fluorophore combinations include FAM (fluorescein, 495 / 520 nm), ROX (rhodamine, 580 / 623 nm), Cy5 (cyanine, 650 / 670 nm), and Cy5.5 (695 / 718 nm) that provide sufficient spectral separation for four-plex detection.

[0251] Advanced multiplex designs may incorporate additional fluorophores including ATTO dyes, Alexa Fluor variants, and quantum dots that offer enhanced brightness, photostability, and spectral characteristics. The selection of fluorophore combinations must account for instrument-specific filter sets, excitation source capabilities, and detector sensitivity across different wavelength ranges. Spectral overlap calculations should ensure less than 5% crosstalk between channels to maintain quantitative accuracy.

[0252] Each fluorophore must be paired with an appropriate quencher molecule that provides efficient quenching in the intact reporter molecule while allowing signal recovery upon Casl2-mediated cleavage. Universal quenchers such as BHQ (Black Hole Quenchers) provide broad-spectrum quenching capabilities that can accommodate multiple fluorophores within a single multiplex design, while specific quencher-fluorophore pairs may offer enhanced quenching efficiency for particular applications.Hybrid Spatial-Spectral Multiplexing

[0253] Combined spatial and spectral separation strategies enable highly multiplexed detection capabilities that exceed the limitations of either approach alone. This hybrid methodology utilizes multiple reaction volumes (spatial separation) with multiple fluorophores per volume (spectral separation), enabling detection of dozens to hundreds of targets within a single assay format.

[0254] Each spatial location contains multiple padlock probes targeting different pathogens, with each probe associated with a spectrally distinct reporter molecule. This approach enables comprehensive pathogen panels such as respiratory virus panels, gastrointestinal pathogen panels, or bloodstream infection panels that require simultaneous detection of 10-50 different targets.

[0255] The hybrid approach requires careful optimization of both spatial and spectral components to ensure optimal performance. Padlock probe concentrations must be balanced across different targets within each spatial location, while fluorophore selection must provide adequate spectral separation across all detection channels. The increased complexity necessitates sophisticated data analysis algorithms and quality control procedures to ensure accurate target identification.Signal Intensity Normalization

[0256] Multiplex detection requires careful normalization of signal intensities across different reporter molecules to ensure comparable detection sensitivity for all targets.Fluorophore quantum yields, extinction coefficients, and detector sensitivity vary significantly across different wavelengths, necessitating compensation through reporter molecule concentration adjustments, amplification gain settings, or post-acquisition data normalization procedures.

[0257] The single-stranded DNA cleavage substrate must be optimized for each reporter molecule to ensure equivalent Casl2 cleavage efficiency across all targets. Substrate sequence composition, length, and secondary structure can influence cleavage kinetics and must be standardized across multiplex components. The linker design should maintain consistent spatial relationships between fluorophore and quencher while accommodating the sequence requirements of the ssDNA cleavage substrate.Alternative Detection Modalities for Multiplexing

[0258] Beyond fluorescent detection, multiplex applications can utilize alternative reporter molecule designs that enable simultaneous multi-target detection through different modalities. Colorimetric multiplex detection can employ multiple enzyme-substrate combinations that produce distinct colored products, enabling visual differentiation between targets. Lateral flow multiplex designs can utilize spatially separated capture zones with different reporter molecules, providing target-specific signal localization.

[0259] Electrochemical multiplex detection can employ reporter molecules with distinct electroactive properties, enabling simultaneous detection through different voltage potentials or current responses. Size-based separation approaches can utilize reporter molecules with different molecular weights or electrophoretic mobilities, enabling postreaction separation and identification of target-specific products.Quality Control and Validation Considerations

[0260] Multiplex reporter molecule systems can be validated to ensure accurate target identification and quantification across all detection channels. Internal controls should be incorporated to monitor reaction efficiency, detect inhibition, and validate negative results for each target simultaneously. Positive controls using synthetic targets or characterized clinical specimens should verify performance across all multiplex components.

[0261] Cross-contamination prevention becomes particularly critical in multiplex systems where multiple targets are processed simultaneously. Spatial separation approaches inherently minimize cross-contamination risks through physical isolation of differenttargets, while spectral separation approaches require attention to probe purification and handling procedures.

[0262] The multiplex reporter molecule design framework enables comprehensive pathogen identification capabilities while maintaining the operational advantages of the isothermal detection system described herein. This capability provides critical support for syndromic diagnosis, outbreak investigations, and comprehensive pathogen surveillance that require simultaneous identification of multiple targets within a single assay format. The flexibility to choose between spatial, spectral, or hybrid multiplexing approaches enables optimization for specific clinical applications, available instrumentation, and throughput requirements.DETECTION DEVICES

[0263] The nucleic acid detection device encompasses platform configurations that integrate the complete detection system components described herein within optimized physical formats designed for diverse analytical applications and deployment scenarios. The device architecture accommodates the padlock probe, Cast 2 polypeptide, guide molecule, ligase, polymerase, and reporter molecule components within single reaction vessels that are specifically configured for detection, multiplexed analysis, and / or pathogen identification. The integrated heating element provides precise temperature control necessary to maintain optimal isothermal reaction conditions across all device formats while ensuring consistent enzymatic activities and reaction kinetics.

[0264] The device platforms are designed to accommodate various detection methodologies including digital quantification approaches that provide absolute target enumeration, multiplexed detection systems that enable simultaneous identification of multiple pathogens, and point-of-care formats that deliver rapid results in clinical settings without requiring sophisticated laboratory infrastructure. Each device configuration incorporates optimized detection means that enable signal quantification and result interpretation, ranging from high-sensitivity fluorescence detection systems to simple visual readouts suitable for resource-limited environments. The modular device architecture enables customization for specific applications while maintaining consistent performance characteristics and operational advantages across different platform implementations.Multi-Well Format Configurations

[0265] The nucleic acid detection device can be configured in multi-well formats that enable high-throughput pathogen detection and digital quantification applications. Multiwell formats comprise arrays of individual reaction wells, each serving as an independent reaction vessel capable of containing the complete detection system components including the padlock probe, Cast 2 polypeptide, guide molecule, ligase, polymerase, and reporter molecule. The multi-well configuration enables parallel processing of multiple samples, replicate testing for enhanced statistical confidence, and digital detection methodologies that provide absolute quantification of target nucleic acids.

[0266] Standard multi-well formats include 96-well, 384-well, and 1536-well microplates that provide scalable detection capabilities ranging from moderate throughput applications to high-density screening requirements. Each well functions as an individual reaction vessel with typical volumes ranging from 1-100 pL, 2-50 pL, 5-25 pL, 10-20 pL, 1-10 pL, 2-5 pL, exactly 1 pL, exactly 2 pL, exactly 5 pL, exactly 10 pL, exactly 20 pL, exactly 50 pL, or exactly 100 pL, depending on the specific application requirements and detection sensitivity needs.

[0267] For digital detection applications, the multi -well format enables partitioning of samples across hundreds to thousands of individual wells, with each well containing either zero or a small number of target molecules. This digital approach provides absolute quantification based on Poisson statistics and the fraction of positive wells observed across the entire plate. The multi-well digital detection format is particularly advantageous for applications requiring precise quantification of viral loads, copy number variations, or rare mutation detection where absolute quantification is preferred over relative measurements.

[0268] The multi-well format incorporates optimized well geometries that promote uniform heat distribution, consistent reaction kinetics, and reliable signal detection across all wells in the array. Well designs include flat-bottom configurations for optimal optical detection, U-bottom shapes for enhanced mixing and reaction efficiency, and specialized geometries that accommodate specific detection modalities or sample processing requirements. The well surfaces can be treated with various coatings or modifications to reduce non-specific binding, enhance wetting characteristics, or improve compatibility with specific detection reagents.

[0269] Advanced multi-well formats may incorporate integrated heating elements within the plate structure, enabling precise temperature control across all wells simultaneously. These integrated heating systems can maintain the isothermal reaction conditions required for the detection system while providing uniform temperature distribution that ensures consistent performance across the entire well array. Temperature control accuracy is typically maintained within ±0.5°C across all wells to ensure reproducible enzymatic activities and reaction kinetics.Microfluidic Format Configurations

[0270] The nucleic acid detection device can be implemented in microfluidic formats that provide enhanced control over reaction conditions, reduced reagent consumption, and improved integration of sample processing and detection functions. Microfluidic devices, also referred to as “lab-on-chip” systems, incorporate microscale channels, chambers, and functional elements that enable precise manipulation of small fluid volumes while maintaining optimal conditions for the padlock probe-CRISPR detection system.

[0271] Microfluidic formats typically operate with reaction volumes in the nanoliter to microliter range, including 1 nL to 1 pL, 5 nL to 500 nL, 10 nL to 100 nL, 1-10 nL, 10-100 nL, 100 nL to 1 pL, exactly 1 nL, exactly 5 nL, exactly 10 nL, exactly 50 nL, exactly 100 nL, exactly 500 nL, or exactly 1 pL. These reduced volumes provide significant advantages including decreased reagent costs, enhanced reaction efficiency due to improved surface-to- volume ratios, faster thermal equilibration, and reduced sample requirements that are particularly beneficial for precious or limited clinical specimens.

[0272] Droplet microfluidic formats represent a particularly advantageous implementation where individual reactions are encapsulated within discrete aqueous droplets suspended in an immiscible oil phase. Each droplet functions as an independent reaction vessel containing the detection system components, enabling digital detection approaches with thousands to millions of individual reactions within a single device. Droplet generation is achieved through various microfluidic geometries including T-junctions, flowfocusing devices, and step emulsification structures that produce monodisperse droplets with precise volume control.

[0273] The droplet format provides several unique advantages including elimination of cross-contamination between reactions, enhanced mixing through internal circulation patterns, protection from surface effects that can inhibit reactions in conventionalmicrofluidic channels, and compatibility with various downstream processing steps including sorting, incubation, and analysis. Droplet diameters typically range from 10-200 pm, with corresponding volumes of approximately 0.5 pL to 4 nL, enabling extremely high- density digital detection with minimal reagent consumption.

[0274] Microfluidic devices can incorporate integrated functions including sample preparation, reagent mixing, reaction incubation, and signal detection within a single chip platform. These integrated capabilities enable complete sample-to-result workflows that minimize manual handling, reduce contamination risks, and improve overall assay reliability. Sample preparation functions may include cell lysis, nucleic acid concentration, and buffer exchange, while detection functions can incorporate various optical, electrical, or magnetic detection modalities.

[0275] Advanced microfluidic formats may incorporate valve systems for precise fluid control, mixing elements for efficient reagent homogenization, temperature control zones for optimized reaction conditions, and integrated detection optics for real-time monitoring of reaction progress. The microfluidic architecture can be optimized for specific applications including single-cell analysis, rare cell detection, environmental monitoring, or point-of- care diagnostics.Lateral Flow Format Configurations

[0276] The nucleic acid detection device can be configured in lateral flow formats that provide rapid, visual detection results without requiring sophisticated instrumentation or technical expertise. Lateral flow devices, commonly known as rapid test strips, incorporate the detection system components within a paper-based or membrane-based format that enables sample application, reagent mixing, reaction incubation, and result visualization through a simple, user-friendly workflow.

[0277] The lateral flow format integrates the padlock probe-CRISPR detection system with established lateral flow architectures that include sample application pads, conjugate release pads, reaction zones, detection zones, and absorbent wicking pads. The detection system components can be pre-loaded onto various elements of the lateral flow strip in dried or lyophilized form, enabling activation upon sample application and subsequent fluid flow through the device.

[0278] One lateral flow implementation incorporates the detection reagents within the conjugate pad, where they are released upon sample application and flow through the devicewith the sample fluid. The padlock probe recognition and CRISPR activation occur during transit through the reaction zone, with signal generation occurring at the detection zone where immobilized capture molecules or detection antibodies enable visual signal development.

[0279] Alternative lateral flow configurations may incorporate the detection components within discrete reaction chambers integrated into the flow path, enabling controlled incubation conditions and optimized reaction kinetics. These chamber-based formats can include integrated heating elements that maintain optimal reaction temperatures while preserving the simplicity and portability advantages of lateral flow devices.

[0280] The lateral flow format accommodates various signal detection modalities including colorimetric detection through gold nanoparticle conjugates, enzymatic substrates that produce colored products, or fluorescent particles that enable enhanced sensitivity detection. Colorimetric detection provides visual results that can be interpreted without instrumentation, while fluorescent detection offers improved sensitivity and quantitative capabilities when combined with simple optical readers.

[0281] Recent advances in lateral flow technology enable integration of more complex molecular detection systems including isothermal amplification and CRISPR-based detection. These molecular lateral flow devices can incorporate temperature control elements, timing mechanisms for sequential reagent release, and enhanced detection systems that maintain the operational simplicity while providing the sensitivity and specificity advantages of molecular detection methods.Detection Means and Instrumentation

[0282] The nucleic acid detection device incorporates various detection means and instrumentation systems that enable reliable quantification and interpretation of signals generated by the reporter molecules upon cleavage by activated Cast 2 polypeptides. The detection instrumentation is designed to accommodate the specific characteristics of the reporter molecules employed while providing the sensitivity, dynamic range, and reliability required for accurate pathogen detection and quantification.Fluorescence Detection Systems

[0283] Fluorescence detection represents the most commonly employed detection modality due to its excellent sensitivity, broad dynamic range, and compatibility with various device formats. Fluorescence detection systems comprise excitation light sources,emission detection systems, optical filters, and signal processing electronics that enable precise measurement of fluorescent signals generated by cleaved reporter molecules.

[0284] LED-based excitation systems provide cost-effective, reliable light sources that can be optimized for specific fluorophore excitation wavelengths. Common LED wavelengths include 365 nm for UV-excitable fluorophores, 470 nm for blue-excitable dyes, 525 nm for green-excitable fluorophores, and 630 nm for red-excitable compounds. LED arrays can provide multiple excitation wavelengths for multiplexed detection applications, while maintaining compact form factors suitable for portable or point-of-care implementations.

[0285] Photodiode detection systems provide robust, sensitive detection of fluorescent emission with excellent signal-to-noise characteristics and broad spectral response. Silicon photodiodes offer optimal sensitivity in the visible and near-infrared regions, while specialized photodiodes provide enhanced UV or infrared response for specific fluorophore applications. Avalanche photodiodes (APDs) provide enhanced sensitivity for applications requiring detection of low-level fluorescent signals, while photomultiplier tubes (PMTs) offer maximum sensitivity for the most demanding detection applications.

[0286] Optical filter systems enable wavelength selection for both excitation and emission, providing the spectral discrimination necessary for specific fluorophore detection and background rejection. Interference filters provide narrow-band wavelength selection with high transmission efficiency, while dichroic mirrors enable efficient separation of excitation and emission light paths. Filter wheel systems enable rapid wavelength switching for multiplexed detection applications.

[0287] Advanced fluorescence detection systems may incorporate confocal optics for improved spatial resolution and background rejection, time-resolved fluorescence detection for enhanced sensitivity and specificity, and spectral unmixing capabilities for complex multiplexed assays. These advanced detection methods provide enhanced performance characteristics while maintaining compatibility with the core detection system components. Smartphone-Compatible Detection Systems

[0288] Recent advances in smartphone technology have enabled the development of smartphone-compatible detection systems that leverage the sophisticated cameras, processing power, and display capabilities of modem mobile devices. Smartphone-based detection systems provide unprecedented accessibility, portability, and cost-effectivenessfor molecular diagnostics while maintaining performance characteristics suitable for clinical applications.

[0289] Smartphone cameras provide high-resolution optical detection capabilities with advanced image sensors that offer excellent sensitivity, low noise characteristics, and sophisticated image processing algorithms. The cameras can be coupled with simple optical accessories including LED excitation sources, optical filters, and focusing lenses to create complete fluorescence detection systems. Smartphone apps can provide real-time image analysis, result interpretation, data storage, and wireless connectivity for result transmission and reporting.

[0290] Smartphone-compatible systems offer particular advantages for point-of-care applications including ease of use, familiar user interfaces, built-in connectivity for result transmission, GPS capabilities for location tracking, and integration with electronic health records and laboratory information systems. The smartphone platform also enables continuous software updates, remote technical support, and integration with cloud-based data analysis and reporting systems.Colorimetric Detection Systems

[0291] Colorimetric detection systems provide visual detection capabilities that can be interpreted without sophisticated instrumentation while offering compatibility with simple optical readers for quantitative applications. Colorimetric detection typically employs reporter molecules that produce colored products upon cleavage, with signal intensity proportional to the amount of target nucleic acid present in the sample.

[0292] Visual colorimetric detection enables result interpretation through direct observation, providing immediate results without requiring any detection equipment. Color intensity can be compared to reference standards or color charts to provide semi-quantitative results, while digital photography using smartphones or cameras can enable more precise color analysis and quantitative measurements.

[0293] Optical colorimetric detection systems employ visible light sources and photodetectors optimized for specific absorption wavelengths characteristic of the colored products. These systems can provide quantitative measurements of color intensity while maintaining simplicity and cost-effectiveness advantages. Reflectance measurements can be employed for solid-phase detection formats, while transmission measurements are suitable for solution-phase applications.Electrochemical Detection Systems

[0294] Electrochemical detection systems provide highly sensitive, quantitative detection capabilities through measurement of electrical signals generated by electroactive reporter molecules or enzymatic products. Electrochemical detection offers several advantages including excellent sensitivity, broad dynamic range, compatibility with complex sample matrices, and minimal optical requirements that simplify device design and reduce costs.

[0295] Amperometric detection measures current generated by oxidation or reduction of electroactive species at controlled electrode potentials. This approach provides excellent sensitivity and can be implemented using simple, low-cost electronics that are compatible with portable device formats. Chronoamperometry, differential pulse voltammetry, and square wave voltammetry represent common amperometric techniques that can be optimized for specific reporter molecule characteristics.

[0296] Potentiometric detection measures voltage changes associated with ion concentration changes or electrochemical reactions, providing label-free detection capabilities that can simplify assay design and reduce costs. Ion-selective electrodes, reference electrodes, and field-effect transistor-based sensors provide various potentiometric detection options that can be optimized for specific application requirements.

[0297] Advanced electrochemical detection systems may incorporate multiplexed electrode arrays for simultaneous detection of multiple targets, integrated sample processing capabilities, and wireless connectivity for data transmission and remote monitoring. Electrochemical detection is particularly well-suited for point-of-care applications due to its minimal power requirements, robust performance characteristics, and compatibility with simple, portable instrumentation.Integrated Detection and Data Management Systems

[0298] Modem detection systems incorporate sophisticated data management capabilities that enable automated result analysis, quality control monitoring, and integration with laboratory information systems and electronic health records. These integrated systems provide enhanced workflow efficiency, improved result reliability, and comprehensive data tracking capabilities that support clinical decision -making and regulatory compliance requirements.

[0299] In an embodiment, the padlock probe comprises: (i) a ligation zone with balanced hybridization arms of 15-20 nucleotides each, designed to provide stable hybridization above 37°C and lacking PAM sequences; (ii) a detection zone comprising the crRNA- complementary sequence positioned to avoid steric hindrance with the ligation machinery, specifically lacking PAM sequences and designed with minimal predicted secondary structure formation; (iii) linker regions of 5-10 nucleotides providing structural flexibility without forming stable secondary structures; and (iv) overall probe length of 50-80 nucleotides optimized for efficient circularization kinetics. In this embodiment, the entire probe sequence is computationally validated to have minimal self-complementarity (longest complementary stretch <6 nucleotides) and predicted folding energy >-10 kcal / mol, ensuring optimal linear conformation for target hybridization and subsequent enzymatic processing. This integrated design approach provides padlock probes with enhanced performance characteristics, including improved target binding specificity, increased ligation efficiency, optimal RCA kinetics, and minimized background signal generation in the one-pot reaction format.

[0300] Automated result analysis algorithms can provide real-time interpretation of detection signals, including positive / negative determination, quantitative measurements, quality control assessment, and result validation. Machine learning algorithms can enhance result interpretation accuracy while accommodating variations in sample types, operator technique, and environmental conditions.

[0301] Data management systems incorporate secure data storage, encrypted data transmission, user authentication, and audit trail capabilities that ensure data integrity and patient privacy protection. Integration with hospital information systems, laboratory information systems, and public health reporting systems enables seamless workflow integration and automated result reporting.

[0302] Further embodiments may incorporate artificial intelligence algorithms for predictive analytics, outbreak detection, antimicrobial resistance monitoring, and treatment optimization recommendations. These Al-enhanced capabilities provide value-added functionality that extends beyond simple pathogen detection to support comprehensive patient care and public health monitoring objectives.DIAGNOSTIC KIT FOR PATHOGEN DETECTION

[0303] The diagnostic kit for detecting target pathogens represents a complete, integrated solution that incorporates all essential components necessary for rapid, sensitive, and specific pathogen identification using the advanced padlock probe-CRISPR-Casl2 detection platform described herein. The kit architecture is designed to provide laboratories, clinical facilities, and point-of-care settings with a standardized, optimized detection system that eliminates the complexity of component sourcing, concentration optimization, and compatibility testing while ensuring consistent performance characteristics across diverse pathogen targets and sample types.

[0304] The kit design addresses critical needs in clinical diagnostics by providing a unified platform capable of detecting various pathogen types including DNA viruses, RNA viruses, bacterial pathogens, and fungal organisms through a consistent workflow and reagent system. The comprehensive kit approach ensures optimal component ratios, concentrations, and compatibilities that have been extensively validated for maximum detection sensitivity, specificity, and reliability while minimizing potential sources of assay failure or variability.

[0305] Each kit component works synergistically with all other components, creating an integrated detection system that provides superior performance compared to individual components sourced separately or assembled from different suppliers. The kit formulation incorporates extensive compatibility testing, stability optimization, and performance validation across diverse sample types and pathogen targets to ensure reliable results in clinical applications.

[0306] The pathogen-specific design enables kit customization for various clinically relevant pathogens including herpesviruses such as cytomegalovirus (CMV), Epstein-Barr virus (EBV), human herpesvirus-6B (HHV-6B), and herpes simplex virus-1 (HSV-1), bacterial pathogens such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Mycobacterium tuberculosis, and Clostridioides difficile, and RNA viruses such as influenza virus, respiratory syncytial virus, SARS-CoV-2, and hepatitis C virus. Each pathogen-specific probe is validated for performance characteristics including limit of detection, specificity against related organisms, and stability under kit storage conditions.

[0307] Embodiments may incorporate multiple recognition sites within the same pathogen genome, enabling enhanced specificity through multi-site recognition or strain-specific detection capabilities. Probe cocktails can be formulated to detect multiple related pathogens or different strains of the same pathogen within a single assay, providing comprehensive detection capabilities while maintaining the simplified workflow advantages of the kit format.

[0308] The kit formulation includes Cast 2 polypeptide at concentrations optimized for the specific detection system and kit format, typically provided in concentrations that will result in final reaction concentrations of 0.1-10 nM when reconstituted according to kit instructions. These optimized concentrations ensure maximum signal generation while minimizing background activity and non-specific cleavage that could compromise assay specificity or generate false positive results.

[0309] The Casl2 polypeptide is provided in stabilized formulations that maintain activity during storage while enabling rapid reconstitution and activation upon kit use. Stabilization approaches may include lyophilization with appropriate excipients, glycerolbased storage buffers, or other formulation strategies that preserve enzymatic activity while providing enhanced shelf stability and shipping tolerance.

[0310] Guide molecule stability and performance may be enhanced through various chemical modifications that improve resistance to nuclease degradation while maintaining Watson-Crick base pairing capability. Common modifications include 2'-O-methyl modifications at ribose sugar positions that provide enhanced stability against ribonuclease activity, phosphorothioate linkages at terminal positions for additional nuclease resistance, and specialized base modifications that can enhance binding affinity or improve target discrimination.

[0311] Multiple guide molecules can be included in specialized kit configurations designed for multiplexed detection applications, strain differentiation, or enhanced specificity through multi-target recognition. These multiplexed guide molecule systems enable simultaneous detection of multiple pathogens or enhanced confidence through redundant target recognition while maintaining the simplified workflow advantages of the integrated kit format.

[0312] The ligase selection includes thermostable enzymes that maintain robust activity at the reaction temperatures employed in the detection system while exhibiting minimal activity on non-specifically bound probes that could generate false positive signals. Preferred ligases include SplintR ligase, which demonstrates exceptional specificity forperfectly matched substrates and minimal activity on mismatched or partially hybridized probes, Taq DNA ligase, which provides robust performance across wide temperature ranges with excellent thermostability, T3 DNA ligase, which offers high activity and good specificity characteristics, and 9°N DNA ligase, which provides specialized performance characteristics for specific applications.

[0313] The ligase concentration and formulation are selected to ensure efficient circularization of target-bound padlock probes while maintaining reaction kinetics that are compatible with the isothermal detection workflow. Buffer systems and cofactor concentrations are specifically formulated to support optimal ligase activity while maintaining compatibility with the other enzymatic components in the detection system.

[0314] The polymerase concentration and buffer formulation are optimized to provide efficient amplification while maintaining compatibility with the isothermal reaction conditions and other system components. Cofactor concentrations including magnesium ions, nucleotide triphosphates, and stabilizing agents are specifically formulated to support optimal polymerase activity while maintaining reaction stability throughout the detection process.

[0315] The reporter molecule component provides the signal generation mechanism that produces detectable output upon cleavage by activated Cast 2 polypeptide, enabling quantification and interpretation of detection results. The kit incorporates optimized reporter molecules that provide robust signal generation with excellent signal-to-noise characteristics while maintaining stability during kit storage and compatibility with various detection instrumentation.

[0316] Fluorescent reporter molecules represent the most common format, comprising fluorophore-quencher pairs separated by cleavable linker sequences that are substrates for Casl2 trans-cleavage activity. In the intact state, the proximity of the quencher molecule suppresses fluorescent emission through fluorescence resonance energy transfer (FRET) or other quenching mechanisms. Upon cleavage by activated Casl2, the fluorophore and quencher are separated, resulting in increased fluorescent signal proportional to the amount of target pathogen present in the sample.

[0317] Common fluorophore-quencher combinations include FAM-BHQ1 pairs for green fluorescence detection, ROX-BHQ2 pairs for red fluorescence applications, and Cy5- BHQ3 pairs for far-red detection. Multiple reporter molecules with different spectralcharacteristics can be included in multiplexed kit configurations that enable simultaneous detection of multiple targets using different fluorescence channels.

[0318] Alternative reporter molecule formats include colorimetric substrates that produce visible color changes upon cleavage, enabling visual result interpretation without requiring sophisticated detection equipment. These reporter molecules typically comprise chromogenic substrates that produce colored products with signal intensity proportional to target concentration, enabling both qualitative and semi-quantitative result interpretation.

[0319] Electrochemical reporter molecules provide alternative detection modalities particularly suitable for portable or point-of-care applications where optical detection may not be practical. These reporters generate electroactive products upon cleavage that can be detected using simple electrochemical instrumentation with excellent sensitivity and quantitative capabilities.

[0320] The diagnostic kit is available in various configurations optimized for different applications, throughput requirements, and detection modalities. Standard kit configurations include single-pathogen kits designed for specific target organisms, multiplexed kits that enable simultaneous detection of multiple related pathogens, and customizable kits that can be adapted for emerging pathogens or specialized applications.

[0321] Kit sizing options accommodate different laboratory throughput requirements, including small-scale kits suitable for research applications or low-volume testing, mediumscale kits appropriate for clinical laboratories with moderate testing volumes, and high- throughput kits designed for reference laboratories or screening applications. Each kit configuration includes appropriate controls, standards, and quality assurance materials necessary for reliable result interpretation and quality monitoring.

[0322] The kit formulation incorporates extensive optimization of component ratios, concentrations, and buffer systems to ensure optimal performance across diverse sample types and pathogen targets. Buffer pH, ionic strength, and stabilizing agent concentrations are specifically formulated to support optimal enzymatic activities while maintaining component stability during storage and shipping.

[0323] Quality control materials included with each kit comprise positive control samples containing known amounts of target pathogen nucleic acid, negative control samples verified to be free of target sequences, and internal control elements that monitorfor reaction inhibition or procedural errors. These control materials enable users to verify proper kit function and validate result interpretation for each testing run.

[0324] The diagnostic kit components are formulated for enhanced stability and extended shelf life while maintaining consistent performance characteristics throughout the storage period. Lyophilization represents the preferred stabilization approach for most kit components, providing enhanced stability at ambient temperatures while preserving biological activity and enabling simplified storage and shipping requirements.

[0325] Lyophilized components are formulated with appropriate stabilizing excipients including trehalose, mannitol, or other cryoprotectants that preserve protein structure and enzymatic activity during the freeze-drying process and subsequent storage. Buffer components and pH stabilizers are incorporated to maintain optimal conditions upon reconstitution while providing consistent performance across different storage conditions and timeframes.

[0326] Stability testing protocols include accelerated aging studies at elevated temperatures to predict shelf life under normal storage conditions, real-time stability monitoring at recommended storage temperatures to verify maintained performance, and stress testing under adverse conditions to establish storage and shipping tolerances. These stability studies encompass all kit components individually and in combination to ensure optimal performance throughout the shelf life period.

[0327] The kit design accommodates various storage temperatures including ambient temperature storage for enhanced deployment flexibility, refrigerated storage for extended shelf life applications, and frozen storage for maximum stability in long-term storage scenarios. Storage condition recommendations are based on extensive stability data and are designed to ensure consistent performance while maximizing storage flexibility for diverse deployment requirements.

[0328] Each diagnostic kit includes comprehensive user instructions that provide step- by-step protocols for sample processing, reagent preparation, assay execution, and result interpretation. The instructions are designed for users with various levels of technical expertise, including detailed protocols for experienced laboratory personnel and simplified procedures suitable for point-of-care applications or users with limited molecular biology experience.

[0329] Troubleshooting guides address common procedural issues, result interpretation challenges, and quality control concerns that may arise during kit use. These guides include decision trees for systematic problem resolution, contact information for technical support, and reference materials for additional guidance on specialized applications or unusual sample types.

[0330] Quality assurance documentation includes certificates of analysis for each kit lot, performance specifications for all components, validation data supporting claimed performance characteristics, and regulatory compliance information relevant to the intended applications. This documentation supports laboratory accreditation requirements, regulatory submissions, and quality management system compliance.

[0331] Technical support services provide ongoing assistance for kit users including consultation on protocol optimization, guidance on specialized applications, assistance with result interpretation, and troubleshooting support for procedural issues. Support services are available through multiple channels including telephone consultation, email correspondence, and web-based resources that provide additional technical information and application notes.GENERAL DEFINITIONS

[0332] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2ndedition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4thedition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F.M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M.J. MacPherson, B.D. Hames, and G.R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2ndedition 2013 (E.A. Greenfield ed.); Animal Cell Culture (1987) (R.I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nded., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2ndedition (2011).

[0333] As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.

[0334] The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0335] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

[0336] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, + / -5% or less, + / -1% or less, and + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.

[0337] As used herein, a “biological sample” may contain whole cells and / or live cells and / or cell debris. The biological sample may contain (or be derived from) a “bodily fluid”. The present invention encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.

[0338] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets.Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

[0339] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.

[0340] Further embodiments are illustrated in the following Examples which are given for illustrative purposes only and are not intended to limit the scope of the invention.EXAMPLESExample Padlock Architectures

[0341] Table 1. IE1 Padlock Probes (all designs have a 5’ phosphorylated end):

[0342] US28 Padlock Probes: gRNA: GCGTCGGGGCTCGCCGAGTC (SEQ ID NO: 36)VI.ACCCGTACAATGCGAAAAAAAAAAAGCGTCGGGGCTCGCCGAGTCACGACCGCTATAAGT (SEQ ID NO: 37)V2. (No linker region 20 bp hybrid arms AT ligation region)ACCCGTACAATGCGACCTTTGCGTCGGGGCTCGCCGAGTCCAAGCACGACCGCTATAAGT (SEQ ID NO: 38)

[0343] EBV Padlock Probes: gRNA: GTCCTCTGGCTCTCTTCGCC (SEQ ID NO: 39)VI.CCTGCTGCCAATGTTAAAAAAAAAAGGCGAAGAGAGCCAGAGGACCACACGTGTGGCTTA (SEQ ID NO: 40)V2.ATGGAAACCACAGTTAAAAAAAAAAGGCGAAGAGAGCCAGAGGACAGTAGCAGCAGCGTC (SEQ ID NO: 41)V3. (A to T junction change)ACCTGCTGCCAATGTTAAAAAAAAAAGGCGAAGAGAGCCAGAGGACCACACGTGTGGCTT (SEQ ID NO: 42)HSV-1

[0344] Table 2. Padlock Prob Design: SEQ ID NO: 43-258Ctttcgaagtagcttacccttc (SEQ ID NO: 259)Example Protocols:

[0345] No Steps Eliminated at 37°C.

[0346] Combined at beginning and incubated at 37°C for 30 mins.One-Pot Total UnitsCast 2a 67 picomolar gRNA 50 pMNEB 2.0 1 Ox Buffer 1 pL

[0347] Incubated the following at 85°C for 5 minutes and allow to cool to room temperature.Padlock Probe 3 nMSample 4 pLT4 1 Ox Buffer 4 pL

[0348] These previous reactions are then combined with the following in a 96 well plate and read at 37°C for 40-80 minutes at 525nm on a fluorescent plate reader.One-Pot Total UnitsT4 ligase 62.5 UnitsPhi29 Polymerase 31.25 UnitsPhi29 Buffer 2 pLBSA 30 mg / mL dNTPs 4 nM each

[0349] End Total Concentrations of One-pot Components:One-Pot Total UnitsT4 ligase 62.5 UnitsPhi29 Polymerase 31.25 UnitsPhi29 Buffer 2 pLBSA 30 mg / mL dNTPs 4 nM eachCast 2a 67 picomolar gRNA 50 pMNEB 2.0 Buffer 1 pLPadlock Probe 3 nMSample 4 pLT4 Buffer 4 pLRoom Temper ature / Isolation Free / One-pot Protocol

[0350] Incubated the following at 85°C for 5 minutes and allow to cool to room temperature.Padlock Probe 3 nMSample 4 pLT4 1 Ox Buffer 4 pL

[0351] The previous reaction is then combined with the following in a 96 well plate and read at 25°C for 40-80 minutes at 525nm on a fluorescent plate reader.One-Pot Total UnitsT4 ligase 62.5 UnitsPhi29 Polymerase 31.25 UnitsPhi29 Buffer 2 pLBSA 30 mg / mL dNTPs 4 nM eachCast 2a 67 picomolar gRNA 50 pMNEB 2.0 Buffer 1 pL

[0352] Example Protocol conditions: T4 condition is added in addition to SplintR ligase. A 40ul reaction was created and 30ul are plated. Lower concentration of probe. Lower concentration of Casl2a, NEB buffer, and gRNA. Difference is made up by water. PEG is not added but there is likely PEG in the T4 buffer. Lower background that previous experiments. The T4+ Towne 105condition increased slightly over the 20 minutes with the NTC conditions and the SplintR conditions decreased. The condition shown in 1 : 100 condition as the others were too oversaturated for the plates reader to read. The samples were saved and run on a gel to compare band size - it is expected to have some DNA appear in the NTC because of the Padlock probe. However, the T4 condition appears to be more efficient at lower reaction dilutions. For example, see Figure 2.

[0353] Sample types can range from cell culture, serum, urine, or saliva. Once collected, approximately 50-100 pL of the sample is heat-inactivated at 95°C for 5 minutes (can be scaled down or up to multiple milliliters). Serum samples become gelatinous at higher temperatures and are instead heat-inactivated at 70°C for 30 minutes (addition of Proteinase K may improve DNA isolation). Heat inactivation is not necessary but appears to improve DNA isolation. DNA isolation is completed using the Zymo Quick-DNA / RNA Viral column-based kit (Cat# D7020). However, Applicants have also tested other heat- and chemical-based methods. The isolated samples are eluted in 50 pL of nuclease-free FEO andstored at -20°C until use. The downstream dilution factor is 1.2 so any calculations for limit of detection (LoD) was multiplied by the dilution factor. For example, see Figure 5.

[0354] For each reaction 1.5ul of luM Casl2a, luM gRNA, lul of NEB2.1 buffer, and 4ul of nuclease-free water are mixed and pre-incubated at 37°C for 30mins. For example, see Figure 6.

[0355] A mixture of 4ul of padlock probe, 4 pl of isolated DNA, and 4 l of lOx T4 ligase buffer is incubated at 80°C for 5mins to allow the DNA to unwind and pre-circularize the padlock probe’s hybridization arms. (4ul SplintR ligase buffer was also used in some experiments). For example, see Figure 7

[0356] The Casl2a-gRNA ribonucleoprotein and the DNA-padlock probe precircularized are the combined with 2 pL T4 ligase (or SplintR ligase), 4 pL Phi29, 1.6 pL of dNTPs, 0.4 pL of BSA, 2 pL Phi29 buffer, and 2 pL oligonucleotide reporter. This combines to create a 40 pL reaction of which 30 pL is plated for detection components and read for 80 mins at 525nm while incubated at 37°C. For example, see Figure 8.References for Background SectionYue, H., et al. (2023). “CMV reactivation during pregnancy and adverse outcomes: an overview.” Journal of Infectious Diseases. PMC 10280810.Chandler H. Monk et al. (2024). “Advances in CRISPR-based diagnostics for infectious diseases.” Nature Reviews Microbiology, 22, 123-135.Griffiths, P., et al. (2015). Herpesviruses. In: Fields Virology, 6th Ed., pp. 2407-2457.Cannon, M. J., et al. (2010). “Cytomegalovirus (CMV) Infection and Disease in Neonates.” Seminars in Perinatology, 34(6), 396-402.Li, S. Y., et al. (2018). “CRISPR-Cas 12-based detection of nucleic acids.” Advanced Science, 5(4), 1700561.Notomi, T., et al. (2000). “Loop-mediated isothermal amplification of DNA.” Nucleic Acids Research, 28(12), e63.***

[0357] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.

Claims

CLAIMSWhat is claimed is:

1. A nucleic acid detection system comprising:(a) one or more padlock probes, each padlock probe comprising a 5' hybrid arm with a sequence complementary to a first region of a target nucleic acid and a 3' hybrid arm with a sequence complementary to a second, adjacent region of the target nucleic acid, wherein the padlock probe comprises a linker region between the 5' hybrid arm and the 3' hybrid arm, and guide molecule target sequence;(b) a Cast 2 polypeptide;(c) a guide molecule specific to the guide molecule target sequence;(d) a ligase for circularizing the padlock probe;(e) a polymerase for amplifying the circularized padlock probe; and(f) a reporter molecule capable of generating a detectable signal when cleaved by the Casl2 polypeptide.

2. The system of claim 1, wherein the Casl2 polypeptide is at a concentration between 0.1 pM to 10 nM.

3. The system of claim 2, wherein the Casl2 polypeptide concentration is between 0.1 pM to 1 pM.

4. The system of claim 1, wherein the system does not comprise polyethylene glycol (PEG).

5. The system of claim 1, wherein the polymerase facilitates isothermal amplification between 24-40 °C.

6. The system of claim 1, wherein the padlock probe does not comprise a PAM sequence in guide molecule target sequence.

7. The system of claim 1, wherein the guide molecule target sequence is in the 5’ arm, the 3’ arm, or portions of the guide molecule target sequence are in both the 5’ and the 3’ arm.

8. The system of claim 1, wherein the guide molecule target sequence is in the linker.

9. The system of claim 1, wherein the linker is 5-30 nucleotides.

10. The system of claim 1, wherein the linker is a poly-A linker or a scrambled linker.

11. The system of claim 1, wherein reaction components (a)-(f) are configured to operate without pre-incubation of the Cast 2 polypeptide with the guide molecule.

12. The system of claim 1, wherein the ligase is selected from the group consisting of SplintR ligase, Taq DNA ligase, T3 DNA ligase, and 9°N DNA ligase.

13. The system of claim 1, wherein the padlock probe is configured to detect a target nucleic acid is from a DNA virus, a RNA virus, a fungal pathogen, or a bacterial pathogen.

14. The system of claim 13, wherein the DNA virus is a herpesvirus.

15. The system of claim 14, wherein the herpesvirus is an alpha-herpesvirus, a beta-herpesvirus, a gamma-herpesvirus.

16. The system of claim 15, wherein the alpha-herpesvirus is herpes simplex virus type 1 (HSV-1, HHV-1), herpes simplex virus type 2 (HSV-2, HHV-2), or Varicella- Zoster virus (VZV, HHV-3).

17. The system of claim 15, wherein the beta-herpesvirus is cytomegalovirus(CMV, HHV-5), human herpesvirus 5 (HHV-6), or human herpesvirus-7 (HHV-7).

18. The system of claim 17, wherein the beta-herpesvirus is CMV.

19. The system of claim 18, wherein the padlock probe is configured to detect a ULI 23 target sequence.

20. The system of claim 1, wherein the padlock probe is selected from the group consisting of SEQ ID NO: 1-13, 33-35, Table 1, and Table 2.

21. The system of claim 15, wherein the gamma-herpesvirus is Epstein-Barr virus (EBV, HHV-4), or Kaposi’s sarcoma-associated herpesvirus (KSHV, HHV-8).

22. A method for detecting a target pathogen in a sample, the method comprising:(a) combining in a single reaction vessel:(i) a sample containing or suspected of containing a target pathogen nucleic acid;(ii) one or more padlock probes, each padlock probe comprising a 5' hybrid arm with a sequence complementary to a first region of the target pathogen nucleic acid and a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the target pathogen nucleic acid, wherein the padlock probe comprises a linker region between the 5' hybrid arm and the 3' hybrid arm;(iii) a Cast 2 polypeptide;(iv) a guide molecule specific for an amplified product of the padlock probe;(v) a ligase;(vi) a polymerase; and(vii) a reporter molecule;(b) incubating the reaction vessel at a temperature suitable for circularization of the padlock probe, amplification of the circularized probe, and activation of the Cast 2 polypeptide; and(c) detecting a signal generated when the target pathogen nucleic acid is present in the sample.

23. The method of claim 22, wherein the method does not require pre-incubation of the Casl2 polypeptide with the guide molecule.

24. The method of claim 22, wherein the method does not require prior nucleic acid isolation from the sample.

25. The method of claim 22, wherein the method includes a brief heating step to denature double-stranded nucleic acids prior to padlock probe hybridization.

26. The method of claim 25, wherein the heating step comprises heating the sample to 60-95°C for 1-5 minutes.

27. The method of claim 22, wherein the one or more padlock probes are configured to detect one or more target nucleic acids from a DNA virus, a RNA virus, a fungal pathogen, or a bacterial pathogen.

28. The method of claim 27, wherein the DNA virus is a herpesvirus.

29. The method of claim 28, wherein the herpesvirus is an alpha-herpesvirus, a beta-herpesvirus, a gamma-herpesvirus.

30. The method of claim 29, wherein the alpha-herpesvirus is herpes simplex virus type 1 (HSV-1, HHV-1), herpes simplex virus type 2 (HSV-2, HHV-2), or Varicella- Zoster virus (VZV, HHV-3).

31. The method of claim 29, wherein the beta-herpesvirus is cytomegalovirus (CMV, HHV-5), human herpesvirus 5 (HHV-6), or human herpesvirus-7 (HHV-7).

32. The method of claim 31, wherein the beta-herpesvirus is CMV and at least one padlock probe is configured to detect a UL123 target sequence.

33. The method of claim 29, wherein the gamma-herpesvirus is Epstein-Barr virus (EBV, HHV-4), or Kaposi’s sarcoma-associated herpesvirus (KSHV, HHV-8).

34. The method of claim 27, wherein the RNA virus is selected from the group consisting of influenza virus, respiratory syncytial virus, SARS-CoV-2, human immunodeficiency virus, hepatitis C virus, dengue virus, and Zika virus.

35. The method of claim 27, wherein the bacterial pathogen is selected from the group consisting of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Mycobacterium tuberculosis, and Clostridioides difficile.

36. The method of claim 27, wherein the fungal pathogen is selected from Candida, Aspergillus, Cryptococcus, Histoplasma capsulatum, Pneumocystis jirovecii, and Mucormycetes.

37. The method of claim 27, wherein the one or more padlock probes are configured to detect anti-microbial resistance or a strain-specific target sequence.

38. The method of claim 22, wherein (a) does not require polyethylene glycol (PEG).

39. The method of claim 22, wherein the sample is selected from the group consisting of blood, serum, plasma, saliva, urine, cerebrospinal fluid, tissue, and fecal matter.

40. The method of claim 22, further comprising the step of subj ecting the clinical sample to a heating step to denature double-stranded nucleic acids without prior nucleic acid isolation.

41. A kit for detecting a target pathogen in a sample, the kit comprising:(a) a pathogen-specific padlock probe comprising a 5' hybrid arm with a sequence complementary to a first region of a target pathogen nucleic acid and a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the target pathogen nucleic acid, wherein the padlock probe comprises a poly A linker region between the 5' hybrid arm and the 3' hybrid arm;(b) a Cast 2 polypeptide;(c) a guide molecule specific for an amplified product of the padlock probe;(d) a ligase; (e) a polymerase; and(f) a reporter molecule capable of generating a detectable signal when cleaved by the Cast 2 polypeptide.

42. The kit of claim 41, wherein components (a)-(f) are configured to operate in a single reaction vessel without pre-incub ati on of the Cast 2 polypeptide with the guide molecule.

43. The kit of claim 41 , wherein the kit is configured to detect the target pathogen without prior nucleic acid isolation from the sample.

44. The kit of claim 41, wherein the Casl2 polypeptide is provided at a concentration that will result in 0.1 pM to 10 nM final concentration in a reaction.

45. The kit of claim 41, wherein the ligase is selected from the group consisting of SplintR ligase, Taq DNA ligase, T3 DNA ligase, and 9°N DNA ligase.

46. The kit of claim 41, wherein the kit does not include polyethylene glycol (PEG).

47. The kit of claim 41, wherein (a)-(f) are lyophilized.

48. A padlock probe specifically designed for use in a CRISPR-Casl2 based detection system, the padlock probe comprising: (a) a 5' hybrid arm with a sequencecomplementary to a first region of a target nucleic acid; (b) a 3' hybrid arm with a sequence that is reverse complement to a second, adjacent region of the target nucleic acid; (c) a linker region comprising 5-15 adenine nucleotides between the 5' hybrid arm and the 3' hybrid arm; and (d) a detection zone that lacks a PAM sequence.

49. The padlock probe of claim 48, wherein the target nucleic acid is from a pathogen selected from the group consisting of, bacterial pathogens, fugnal pathogens, and double-stranded DNA viruses.

50. A nucleic acid detection device for detecting a target nucleic acid in a sample, comprising:(a) a padlock probe comprising a poly A linker region;(b) a Casl2 polypeptide at a concentration of 0.1 pM to 10 nM;(c) a guide molecule;(d) a ligase;(e) a polymerase;(f) a reporter molecule;(g) one or more single reaction vessel configured to contain (a)-(f) in a single pot suitable for digital detection; and(h) a heating element configured to maintain the reaction vessel at temperatures required for the reaction.

51. The device of claim 50, wherein the system does not require pre-incubation of the Casl2 polypeptide with the guide molecule.

52. The device of claim 50, wherein the device does not require prior nucleic acid isolation from samples.

53. The device of claim 50, wherein the system does not require polyethylene glycol (PEG) in its reaction mixture.