Oligonucleotide amplification at reduced temperatures

Reduced temperature amplification of oligonucleotides with repeat regions forms monoclonal clusters, addressing sequencing errors and improving resolution in repeat regions and downstream areas.

WO2026006675A1PCT designated stage Publication Date: 2026-01-02ILLUMINA INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035613
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-28
Filing Date
2025-06-27
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Repeat regions in oligonucleotides, such as homopolymers, lead to systematic sequencing errors (SSEs) and reduced sequencing resolution, affecting the ability to identify important mutations and genome-based clinical decisions.

Method used

Amplification of oligonucleotides with repeat regions is performed at reduced temperatures (20-50°C) to form monoclonal clusters, using enzymes like chain extending enzymes, recombinase, exchange factors, and strand-displacing polymerases, without recombinase or single-stranded binding proteins, to enhance sequencing accuracy.

Benefits of technology

Improved sequencing resolution within and downstream of repeat regions, reducing errors and enhancing the ability to accurately sequence clinically relevant regions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000045_0001
    Figure IMGF000045_0001
  • Figure IMGF000086_0001
    Figure IMGF000086_0001
  • Figure IMGF000087_0001
    Figure IMGF000087_0001
Patent Text Reader

Abstract

Methods for preparing a surface for sequence a target oligonucleotide having a repeat region. Methods include amplifying a template oligonucleotide comprising the target oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface. The temperature used during amplification can vary.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] OLIGONUCLEOTIDE AMPLIFICATION AT REDUCED TEMPERATURES CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 665,614, filed June 28, 2024, which is incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] This application contains a Sequence Listing electronically submitted via Patent Center to the United States Patent and Trademark Office as an XML file entitled “0531_002769WO01_ST26.xml” having a size of 22.7 kilobytes and created on June 26, 2025. The information contained in the Sequence Listing is incorporated by reference herein. FIELD

[0003] The present disclosure is concerned with increasing sequencing resolution through and downstream of regions having a repeating pattern of nucleotides. In particular, the present disclosure includes methods for using a reduced temperature during the production of clusters, during first strand resynthesis, or both. INTRODUCTION

[0004] Repeat regions, such as homopolymer tracts, pose challenges to oligonucleotide sequencing. T homopolymers, A homopolymers, G homopolymers, and C homopolymers can lead to systematic, or sequence specific errors (SSEs), in sequencing-by-synthesis (SBS) methodologies. Poor sequencing resolution of homopolymer regions can also result in reduced sequencing resolution downstream of the homopolymer region. Regions downstream of homopolymers may be clinically relevant. As such, low sequencing resolution of homopolymer regions and regions downstream thereof, can affect the ability of clinicians to identify important mutations and make genome-based decisions affecting the health of patients. SUMMARY

[0005] Repeat regions and regions downstream of repeat regions can be difficult to accurately sequence. Such sequencing challenges are thought to be due at least in part to the introduction of nucleotides errors during amplification of oligonucleotides having one or more repeat regions prior to sequencing. During amplification, nucleotides can be added, removed, or both, from oligonucleotides having one or more repeat regions leading to a cluster of oligonucleotides having sequences of varying lengths. Subsequent sequencing of the cluster can result in low sequence resolution and / or errors within the one or more repeat regions and / or downstream of the one or more repeat regions.

[0006] Provided herein are methods for preparing a surface for sequencing oligonucleotides having a repeat region. The methods include amplification of an oligonucleotide having a repeat region. In some embodiments, the methods include kinetic exclusion amplification.

[0007] In one embodiment, the present disclosure provides a first method for preparing a surface for sequencing a target oligonucleotide having a repeat region. The method includes amplifying a template oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface. The template oligonucleotide includes the target oligonucleotide. The monoclonal cluster includes a first population of oligonucleotides and a second population of oligonucleotides. The first population of oligonucleotides includes the sequence of the target oligonucleotide, the sequence of the target oligonucleotide including the repeat region. The second population of oligonucleotides includes the sequence of the target oligonucleotide, the sequence complementary to the target oligonucleotide including a complementary repeat region. In some embodiments, amplifying the template oligonucleotide comprises incubating a chain extending enzyme with the amplification site at temperature of 20 °C to 35 °C, such as 25 °C to 35 °C, 20 °C to 33 °C, 30 °C to 35 °C, 30 °C to 33 °C, or 20 °C to 30 °C. In some embodiments, amplifying the template oligonucleotide comprises incubating a chain extending enzyme with the amplification site at temperature of 20 °C to 35 °C, such as 25 °C to 35 °C, 20 °C to 33 °C, 30 °C to 35 °C, 30 °C to 33 °C, or 20 °C to 30 °C for 5 minutes or longer, 10 minutes or longer, or 15 minutes or longer. In some embodiments, the method includes the use of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, an energy recycling factor, or any combination thereof.

[0008] In one embodiment, the present disclosure provides a second method for preparing a surface for sequencing a target oligonucleotide having a repeat region. The method includes amplifying a template oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface. The template oligonucleotide includes the target oligonucleotide. The monoclonal cluster includes a first population of oligonucleotides and a second population of oligonucleotides. The first population of oligonucleotides includes the sequence of the target oligonucleotide, the sequence of the target oligonucleotide including the repeat region. The second population of oligonucleotides includes the sequence of the target oligonucleotide, the sequence complementary to the target oligonucleotide including a complementary repeat region. In some embodiments, amplifying the template oligonucleotide comprises incubating a chain extending enzyme with the amplification site at temperature of 35 °C to 50 °C such as 35 °C to 45 °C. In some embodiments, amplifying the template oligonucleotide comprises incubating a chain extending enzyme with the amplification site at temperature of 35 °C to 50 °C such as 35 °C to 45 °C for 5 minutes or longer, 10 minutes or longer, or 15 minutes or longer. In some embodiments, the method does not include the use of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, an energy recycling factor, or any combination thereof.

[0009] The details of one or more embodiments are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will be apparent from the description and drawings, and from the claims.

[0010] It is to be understood that both the foregoing general description and the following detailed description present embodiments of the subject matter of the present disclosure and are intended to provide an overview or framework for understanding the nature and character of the subject matter as it is claimed. The accompanying drawings are included to provide a further understanding of the subject matter and are incorporated into and constitute a part of this specification. The drawings illustrate various embodiments of the subject matter and together with the description serve to explain the principles and operations of the subject matter of the present disclosure. Additionally, the drawings and descriptions are meant to be merely illustrative and are not intended to limit the scope of the claims in any manner.

[0011] The above summary is not intended to describe each disclosed embodiment or every implementation of the present disclosure. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the disclosure, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive or exhaustive list. BRIEF DESCRIPTION OF DRAWINGS

[0012] The following detailed description of the present disclosure may be understood when read in conjunction with the following drawings.

[0013] FIG.1 is a schematic drawing illustrating amplification of a template oligonucleotide that includes a homopolymer region of a target oligonucleotide.

[0014] FIG.2 is a flow diagram of a general illustrative sequencing workflow.

[0015] FIGS.3A, 3B, 3C, and 3D are flow diagrams illustrating a general overview of a first surface preparation or sequencing method (FIG.3A) and optional workflow steps (FIG.3B and FIG.3C).

[0016] FIGS.4A, 4B, 4C, and 4D are flow diagrams illustrating a general overview of a second surface preparation or sequencing method (FIG.4A) and optional workflow steps (FIG. 4B and FIG.4C).

[0017] FIG.5 is a schematic drawing illustrating a general surface preparation method .

[0018] FIGS.6A, 6B, and 6C are schematic drawings illustrating a first surface preparation or sequencing method.

[0019] FIGS.7A and 7B are schematic drawings illustrating a second surface preparation method.

[0020] FIG.8 is a plot of resolution value verses length of homopolymer repeat length. Each template oligonucleotide species was clustered on the surface followed by sequencing (Clustered) or sequenced without clustering (Primer hyb).

[0021] FIGS.9A and 9B are plots of error rate versus sequencing cycle for a first read (FIG. 9A) and a second read (FIG.9B) following conventional clustering or cold clustering.

[0022] FIG.10 is a plot of sequence specific error metrics for poly(A) and poly(T) homopolymer regions of template oligonucleotides clustered using a conventional amplification temperature (Control) or reduced temperatures (Cold Cluster).

[0023] FIG.11 is a plot of poly(A) and poly(T) autosome callability for template oligonucleotides clustered using a conventional amplification temperature (Control) or reduced temperatures (Cold Cluster).

[0024] FIG.12 is a plot of normalized GC coverage per percent GC content for template oligonucleotide having a homopolymer region and clustered using a conventional amplification temperature (Control) or reduced temperatures (Cold Cluster).

[0025] FIGS.13A, 13B, and 13C are integrative genomics viewer images for sequenced oligonucleotides having a short homopolymer region (10-15 bases; FIG.13A), medium length homopolymer region (15-25 bases; FIG.13B (SEQ ID NO: 1)), and a longer homopolymer region (25 or greater bases; FIG.13C (SEQ ID NO: 2)).

[0026] FIG.14 is a plot of resolution value verses type of repeat region. Each template oligonucleotide species was clustered using a conventional amplification temperature (Control) or reduced temperatures (Cold Cluster).

[0027] FIG.15 is a plot of percent soft clipped bases in a homopolymer region of a template oligonucleotide amplified using various amplification temperatures.

[0028] FIG.16 is a plot of the percent of soft clipped bases within a homopolymer region versus the mean precent passing filter (%PF) for various clustering temperatures and times.

[0029] FIG.17 is a plot showing the percent soft clipping, percent passing filter (% PF), percent error PhiX, and percent Q30 for various oligonucleotide libraries and clustering conditions.

[0030] FIG.18 is a plot showing the percent soft clipping, percent passing filter (% PF), and percent Q30 for a BACPack oligonucleotide library prepared using various clustering temperatures and times.

[0031] FIGS.19A to 19D are plots showing predicted and actual results for total false positives and false negatives (FP + FN) in homopolymer regions (FIG.19A), percent passing filter (%PF) (FIG.19B), percent PhiX error in read 2 (FIG.19C), and percent greater than Q30 in Read 2 for a human DNA library prepared using various clustering conditions.

[0032] FIG.20 is a plot showing the total false positives and false negatives (FP + FN HP) in the homopolymer region, percent error percent, and percent passing filter (%PF) predicted (DOE predicted) and observed (DOE Actual) when a human DNA library was amplified at 26.2 °C for 4.5 hours followed by 33.3 °C for 30 minutes. A cold clustering method (4 hours at 25 °C) and a control clustering method (37 °C) were also included.

[0033] FIG.21 is a plot the percent strand invasion activity of a recombinase included in the EXC amplification reagent mixture (Rec in ECX) and a recombinase include in the TXC amplification reagent mixture (Rec in TCX)

[0034] FIG.22 is plot of the percent intensity of amplified clusters generated from using kinetic exclusion amplification with either the EXC amplification reagent mixture or the TXC amplification reagent mixture at varying temperatures. All data is normalized to the intensity of the recombinase included in the TCX amplification reagent mixture at the standard 37 °C temperature (Intensity =1).

[0035] FIG.23A to 23B are plots of the total false positive plus false negatives (FP+FN) count in homopolymer regions (FIG.23A) or AT dinucleotide repeat regions (FIG.23B) and areas that flank homopolymer regions or AT dinucleotide repeat regions (+ / -50bp) after clustering using the ECX amplification reagent mixture or the TCX amplification reagent mixture at varying temperatures and times.

[0036] FIG.24 are plots showing two static clustering protocols and two temperature ramping clustering protocols.

[0037] FIG.25 shows various primary sequencing metrics achieved after clustering according to a TCX 38 °C static protocol, TCX 32 °C, a TCX 30 °C - 40 °C temperature ramping protocol, and a TCX 28 °C - 42 °C temperature ramping protocol.

[0038] FIG.26 is a plot showing the total number of false calls (false positives + false negatives (FP+FN)) at regions of high confidence, homopolymers, AT repeats, and STR dinucleotides achieved after clustering according to a TCX 38 °C static protocol, TCX 32 °C, a TCX 30 °C - 40 °C temperature ramping protocol, and a TCX 28 °C - 42 °C temperature ramping protocol.

[0039] The schematic drawings are not necessarily to scale. Like numbers used in the figures refer to like components, steps, and the like. However, it will be understood that the use of a number to refer to a component in a given figure is not intended to limit the component in another figure labeled with the same number. In addition, the use of different numbers to refer to components is not intended to indicate that the different numbered components cannot be the same or similar to other numbered components. Definitions

[0040] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.

[0041] As used herein, the term “amplification site” refers to a region or site on a surface where one or more amplicons can be generated. An amplification site can be further configured to contain, hold or attach at least one amplicon that is generated at the site. An amplification site can be a region or site on a surface in which a template oligonucleotide can be amplified to form a monoclonal cluster. The generated monoclonal cluster can be held or attached at the amplification site.

[0042] As used herein, the term “amplicon,” when used in reference to an oligonucleotide, means the product of copying the oligonucleotide, where the product has a nucleotide sequence that is the same as or complementary to at least a portion of the nucleotide sequence of the oligonucleotide. An amplicon can be produced by any of a variety of amplification methods that use the oligonucleotide (e.g., a target oligonucleotide, a template oligonucleotide, or an amplicon thereof) as a template including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), ligation extension, or ligation chain reaction. An amplicon can be an oligonucleotide having a single copy of a particular nucleotide sequence (e.g., a polymerase extension product) or multiple copies of the nucleotide sequence (e.g., a concatemeric product of RCA). A first amplicon of an oligonucleotide is typically a complementary copy. Subsequent amplicons are copies that are created, after generation of the first amplicon, from the original oligonucleotide or from the first amplicon. A subsequent amplicon can have a sequence that is substantially complementary to the original oligonucleotide or substantially identical to the original oligonucleotide.

[0043] As used herein, the terms “amplifying” and “amplified” refer to production of one or more amplicons.

[0044] As used herein, the term “array” refers to a population of sites that can be differentiated from each other according to relative location. Different molecules that are at different sites of an array can be differentiated from each other according to the locations of the sites in the array. An individual site of an array can include one or more molecules of a particular type. For example, a site can include a single target oligonucleotide having a particular sequence or a site can include several oligonucleotides having the same sequence (and / or complementary sequence, thereof). The sites of an array can be different features located on the same substrate. Exemplary features include without limitation, wells in a substrate, beads (or other particles) in or on a substrate, projections from a substrate, ridges on a substrate or channels in a substrate. The sites of an array can be separate substrates each bearing a different molecule. Different molecules attached to separate substrates can be identified according to the locations of the substrates on a surface to which the substrates are associated or according to the locations of the substrates in a liquid or gel. Exemplary arrays in which separate substrates are located on a surface include, without limitation, those having beads in wells.

[0045] As used herein, the term “providing” in the context of a compound, complex, composition, or article means making the compound, composition, complex, or article; purchasing the compound, complex, composition or article; or otherwise obtaining the compound, composition or article.

[0046] As used herein, the term “chain extending enzyme” refers to an enzyme that produces a copy replicate of an oligonucleotide using the oligonucleotide as a template strand. For example, a chain extending enzyme may be an enzyme having polymerase activity. Typically, DNA polymerases bind to the template strand and then move down the template strand sequentially adding nucleotides to the free hydroxyl group at the 3′ end of a growing strand of an oligonucleotide. DNA polymerases typically synthesize complementary DNA molecules from DNA templates and RNA polymerases typically synthesize RNA molecules from DNA templates (transcription). Polymerases may use a short RNA or DNA strand, often called a primer, to begin strand growth. Some polymerases may displace the strand upstream of the site where they are adding bases to a chain. Such polymerases are said to be strand displacing, meaning they have an activity that removes a complementary strand from a template strand being read by the polymerase. Exemplary polymerases having strand displacing activity include, without limitation, the large fragment of Bst (Bacillus stearothermophilus) polymerase, exo- Klenow polymerase or sequencing grade T7 exo-polymerase. Some polymerases degrade the strand in front of them, effectively replacing it with the growing chain behind (5′ exonuclease activity). Some polymerases have an activity that degrades the strand behind them (3′ exonuclease activity). Some useful polymerases have been modified, either by mutation or otherwise, to reduce or eliminate 3′ and / or 5′ exonuclease activity. Any suitable polymerase may be used with the methods of the present disclosure. In some embodiments, the polymerase is a polymerase described in US Provisional Patent Application Number 63 / 412,241 (US2024 / 0141427A1), US Patent Application Number US16 / 703569 (US11001816B2), PCT Application Number PCT / US2013 / 03169 (WO2014142921A1) all of which are hereby incorporated by reference in its entirety.

[0047] As used herein, the terms “polynucleotide,” “oligonucleotide,” “oligonucleotide strand,” “strand,” “nucleic acid,” and “nucleic acid strand” are used interchangeably to refer to a polymeric form of nucleotides of any length, and may comprise ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. These terms refer only to the primary structure of the molecule. Thus, these terms includes triple-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”).

[0048] Suitable nucleotides for use in the provided methods include, but are not limited to, deoxynucleotide triphosphates, deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxycytidine triphosphate (dCTP), and deoxyguanosine triphosphate (dGTP). Optionally, the nucleotides used in the provided methods, whether labeled or unlabeled, can include a blocking moiety such as a reversible terminator moiety that inhibits chain extension. Suitable labels for use on the labeled nucleotides include, but are not limited to, haptens, radionucleotides, enzymes, fluorescent labels, chemiluminescent labels, and chromogenic agents.

[0049] An oligonucleotide will generally contain phosphodiester bonds, although in some cases nucleic acid analogs can have alternate backbones, comprising, for example, phosphoramidite (Beaucage et al., Tetrahedron 49(10): 1925 (1993) and references therein; Letsinger, J. Org. Chem.35:3800 (1970); Sprinzl et al., Eur. J. Biochem.81:579 (1977); Letsinger et al., Nucl. Acids Res.14:3487 (1986); Sawai et al, Chem. Lett.805 (1984), Letsinger et al., J. Am. Chem. Soc.110:4470 (1988); and Pauwels et al., Chemica Scripta 26:14191986)), phosphorothioate (Mag et al., Nucleic Acids Res.19:1437 (1991); and U.S. Patent No. 5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc.111:2321 (1989), O- methylphophoroamidite linkages (Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (Egholm, J. Am. Chem. Soc.114:1895 (1992); Meier et al., Chem. Int. Ed). Other nucleic acid analogs include those with positively charged backbones (Denpcy et al., Proc. Natl. Acad. Sci. USA 92:6097 (1995)); non-ionic backbones (U.S. Patent Nos.5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English 30:423 (1991); Letsinger et al., J. Am. Chem. Soc.110:4470 (1988); Letsinger et al., Nucleoside & Nucleotide 13:1597 (1994); Chapters 2 and 3, ASC Symposium Series 580, “Carbohydrate Modifications in Antisense Research”, Ed. Y.S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal Chem. Lett.4:395 (1994); Jeffs et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett.37:743 (1996)), and non-ribose backbones (U.S. Patent Nos.5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y.S. Sanghui and P. Dan Cook). Polynucleotides containing one or more carbocyclic sugars are also included within the definition of polynucleotides (Jenkins et al., Chem. Soc. Rev. (1995) pg.169-176). Several oligonucleotide analogs are described in Rawls, C & E News June 2, 1997 page 35. All these references are hereby expressly incorporated by reference. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of labels and / or to increase the stability and half-life of such molecules in physiological environments.

[0050] An oligonucleotide will generally contain a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T). Uracil (U) can also be present, for example, as a natural replacement for thymine when the nucleic acid is RNA. Uracil can also be used in DNA (dU). An oligonucleotide may also include native or non-native bases. In this regard, a native deoxyribonucleic acid polynucleotide may have one or more bases selected from the group consisting of adenine, thymine, cytosine, or guanine and a ribonucleic acid may have one or more bases selected from the group consisting of uracil, adenine, cytosine, or guanine. It will be understood that a deoxyribonucleic acid oligonucleotide used in the methods or compositions set forth herein may include, for example, uracil bases and a ribonucleic acid can include, for example, a thymine base. Exemplary non-native bases that may be included in a nucleic acid, whether having a native backbone or analog structure, include, without limitation, inosine, xathanine, hypoxathanine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5- hydroxymethyl cytosine, 2-aminoadenine, 6-methyl adenine, 6-methyl guanine, 2-propyl guanine, 2-propyl adenine, 2-thioLiracil, 2-thiothymine, 2-thiocytosine, 15–halouracil, 15- halocytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil, 4-thiouracil, 8-halo adenine or guanine, 8-amino adenine or guanine, 8-thiol adenine or guanine, 8-thioalkyl adenine or guanine, 8-hydroxyl adenine or guanine, 5-halo substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7- deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine or the like. Optionally, isocytosine and isoguanine may be included in a nucleic acid to, for example, reduce non- specific hybridization, as generally described in U.S. Patent No.5,681,702, which is incorporated by reference herein in its entirety.

[0051] A non-native base used in an oligonucleotide may have universal base pairing activity such that it is capable of base pairing with any other naturally occurring base. Exemplary bases having universal base pairing activity include 3-nitropyrrole and 5-nitroindole. Other bases that can be used include those that have base pairing activity with a subset of the naturally occurring bases such as inosine, which base pairs with cytosine, adenine or uracil.

[0052] Incorporation of a nucleotide into an oligonucleotide strand refers to joining of the nucleotide to a free 3′ hydroxyl group of the oligonucleotide strand via formation of a phosphodiester linkage with the 5′ phosphate group of the nucleotide. The oligonucleotide template to be sequenced can be DNA or RNA, or even a hybrid molecule that includes both deoxynucleotides and ribonucleotides. The oligonucleotide can include naturally occurring and / or non-naturally occurring nucleotides and natural or non-natural backbone linkages.

[0053] As used herein, the terms “target oligonucleotide” and “target nucleic acid” refer to an oligonucleotide where identification of at least a portion of its nucleotide sequence is desired. A target oligonucleotide has a target nucleotide sequence. A target nucleotide sequence is the sequence within the target oligonucleotide for which the sequence information is desired. A target sequence may be a portion or the entire sequence of the target oligonucleotide. A target oligonucleotide may be essentially any nucleic acid of known or unknown sequence.

[0054] As used herein, the term “repeat region” refers to sequence of a single repeating nucleotide or a pattern of two or more repeating nucleotides. A repeat region includes five or more nucleotides. Examples of repeat regions include, for example, homopolymers, dinucleotide repeats, trinucleotide repeats, and tetranucleotide repeats.

[0055] As used herein, the term “sample” and its derivatives are used in their broadest sense and includes any specimen, culture and the like that is suspected of including a target nucleic acid. In some embodiments, a sample comprises DNA, RNA, PNA, LNA, chimeric, or hybrid forms of nucleic acids. A sample can include any biological, clinical, surgical, agricultural, atmospheric-based specimen, or aquatic-based specimen containing one or more nucleic acids. The term also includes any isolated nucleic acid sample such as genomic DNA, fresh-frozen, or formalin-fixed paraffin-embedded nucleic acid specimen. It is also envisioned that a sample can be from a single individual; a collection of nucleic acid samples from genetically related members; nucleic acid samples from genetically unrelated members; nucleic acid samples (matched) from a single individual such as a tumor sample and normal tissue sample; or a sample from a single source that contains two distinct forms of genetic material such as maternal and fetal DNA obtained from a maternal subject, or the presence of contaminating bacterial DNA in a sample that contains plant or animal DNA. In some embodiments, the source of nucleic acid material can include nucleic acids obtained from a newborn, for example as typically used for newborn screening.

[0056] As used herein, he terms “template polynucleotide” and “template oligonucleotide” refer to an oligonucleotide that includes at least a portion of a target oligonucleotide and an adaptor, or a portion of an adaptor, on one or both ends. An adaptor can be ligated to, for example, an initial target oligonucleotide. An initial template oligonucleotide can be amplified such that an amplicon derived from the initial template oligonucleotide includes an adaptor, or a portion of an adaptor, on one or both ends. As such, the terms “template oligonucleotide” and “template polynucleotide” are not limited to oligonucleotides prior to amplification unless explicitly stated.

[0057] As used herein, the term “adapter” and its derivatives, e.g., universal adapter, refers generally to any oligonucleotide which can be ligated to a target nucleic acid. In some embodiments, an adapter is substantially non-complementary to the 3′ end or the 5′ end of any target oligonucleotide present in a sample. In some embodiments, suitable adapter lengths are in the range of about 10 to100 nucleotides, about 12 to 60 nucleotides and about 15 to50 nucleotides in length. Generally, an adapter can include any combination of nucleotides. In some embodiments, the adapter can include one or more cleavable groups at one or more locations. In some embodiments, anadapter can include a sequence that is substantially identical, or substantially complementary, to at least a portion of a primer. In some embodiments, an adapter can include a sequence that is substantially identical, or substantially complementary, to at least a portion of a surface oligonucleotide. In some embodiments, an adapter can include a universal molecular identifier and / or barcode, also referred to as an index or tag to assist with downstream error correction, identification, or sequencing. The terms “adaptor” and “adapter” are used interchangeably.

[0058] As used herein, the term “universal sequence” refers to a region of sequence that is common to two or more template oligonucleotides, where the molecules also have regions of sequence that differ from each other. A universal sequence that is present in different members of a collection of molecules can allow capture of multiple different template oligonucleotides using a population of capture agent oligonucleotide that are complementary to a portion of the universal sequence, e.g., a universal capture binding sequence. Non-limiting examples of universal capture binding sequences include sequences that are identical to or complementary to P5 and P7 primers. Similarly, a universal sequence present in different members of a collection of molecules can allow the replication or amplification of multiple different nucleic acids using a population of universal primers that are complementary to a portion of the universal sequence, e.g., a universal primer binding site. Target oligonucleotides may be modified to attach universal adapters (also referred to herein as adapters), for example, at one or both ends of the different target sequences, as described herein.

[0059] As used herein, the terms “primer oligonucleotide” and “primer” are used interchangeably and refer to oligonucleotide sequences that are capable of annealing specifically to one or more template oligonucleotides to be amplified or sequenced. Generally, primer oligonucleotides are single-stranded or partially single-stranded. Primers may also contain a mixture of non-natural bases, non-nucleotide chemical modifications, or non-natural backbone linkages so long as the non-natural entities do not interfere with the function of the primer. Typically, a primer functions as a substrate onto which nucleotides may be polymerized by a polymerase; in some embodiments, however, the primer may become incorporated into the synthesized oligonucleotide strand and provide a site to which another primer may hybridize to prime synthesis of a new strand that is complementary to the synthesized nucleic acid molecule. A primer may include any combination of nucleotides or analogs thereof. In some embodiments, a primer is a single-stranded oligonucleotide.

[0060] As used herein, the term “double-stranded,” when used in reference to an oligonucleotide, means that substantially all of the nucleotides in the oligonucleotide are hydrogen bonded to a complementary nucleotide. A double-stranded oligonucleotide can be hybridized to itself or to one or more additional oligonucleotides. A partially double-stranded oligonucleotide can have at least 10%, at least 25%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% of its nucleotides hydrogen bonded to a complementary nucleotide.

[0061] As used herein, the “double-stranded oligonucleotide complex” and “double-stranded complex” refer to a complex comprising, consisting of, or consisting essentially of a double- stranded oligonucleotide or a partially double-stranded oligonucleotide. A double-stranded oligonucleotide complex can include a single oligonucleotide or two or more oligonucleotides. For example, a double-stranded oligonucleotide complex can include a first oligonucleotide that is at least partially hybridized to at least a portion of a second oligonucleotide. In embodiments, at least at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% of the nucleotides of a double-stranded oligonucleotide complex are hydrogen bonded to a complementary nucleotide.

[0062] As used herein, the term “surface oligonucleotide” refers to a surface-bound oligonucleotide. In some embodiments, a surface oligonucleotide is attached to the surface at the 5′ end and has a free 3′ end. The terms “P5”, “P7”, “P15”, and “P17” may be used when referring to a surface oligonucleotide. P5, P7, P15, and P17 are described in US Patent Pub. No. US 2019 / 0352327. The terms “P5′” (P5 prime),“P7′” (P7 prime), “P15′” (P15 prime), and “P17′” (P17 prime) refer to the complement of P5, P7, P15, and P17 respectively. It will be understood that any suitable surface oligonucleotide can be used in the methods presented herein, and that the use of P5, P7, P15, and P17 are exemplary embodiments only. Uses of surface oligonucleotide such as P5, P7, P15, and P17 on flow cells is known in the art, as exemplified by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957. In view of the general knowledge available and the teachings of the present disclosure, one of skill in the art will understand how to design and use sequences that are suitable for surface oligonucleotides. A surface oligonucleotide can be used as a primer. For example, any suitable surface oligonucleotide can act as a forward amplification primer and can be useful in the methods presented herein for hybridization to a sequence (e.g., an adaptor sequence) and / or amplification of a sequence. Similarly, any suitable surface oligonucleotide can act as a reverse amplification primer, and can be useful in the methods presented herein for hybridization to a sequence (e.g., an adaptor sequence) and amplification of a sequence. In view of the general knowledge available and the teachings of the present disclosure, one of skill in the art will understand how to design and use sequences that are suitable for hybridization to and amplification of template oligonucleotides as presented herein.

[0063] As used herein, the term “different,” when used in reference to oligonucleotides, means that the oligonucleotides have nucleotide sequences that are not the same as each other. Two or more oligonucleotides can have nucleotide sequences that are different along their entire length. Alternatively, two or more oligonucleotides can have nucleotide sequences that are different along a substantial portion of their length. For example, two or more oligonucleotides can have target nucleotide sequence portions that are different from each other while also having a universal sequence region that are the same as each other.

[0064] Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.

[0065] As used in this specification and the appended claims, the term "or" is generally employed in its sense including "and / or" unless the content clearly dictates otherwise. The term "and / or" means one or all of the listed elements or a combination of any two or more of the listed elements. The use of "and / or" in some instances does not imply that the use of "or" in other instances may not mean "and / or."

[0066] The words "preferred" and "preferably" refer to embodiments of the disclosure that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the disclosure.

[0067] As used herein, "have," "has," "having," "include," "includes," "including," "comprise," "comprises," "comprising" or the like are used in their open ended inclusive sense, and generally mean "include, but not limited to," "includes, but not limited to," or "including, but not limited to."

[0068] It is understood that wherever embodiments are described herein with the language "have," "has," "having," "include," "includes," "including," "comprise," "comprises," "comprising" and the like, otherwise analogous embodiments described in terms of "consisting of" and / or "consisting essentially of" are also provided. The term "consisting of" means including, and limited to, whatever follows the phrase "consisting of." That is, "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present. The term "consisting essentially of" indicates that any elements listed after the phrase are included, and that other elements than those listed may be included provided that those elements do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements.

[0069] Conditions that are "suitable" for an event to occur, or "suitable" conditions are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and / or are conducive to the event.

[0070] Reference throughout this specification to "one embodiment," "an embodiment," "certain embodiments," "one or more embodiments," or "some embodiments," etc., means that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily referring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

[0071] Throughout this disclosure, various aspects of the disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0072] In the description herein particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiments can include a combination of compatible features described herein in connection with one or more embodiments.

[0073] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously. DETAILED DESCRIPTION

[0074] Reference will now be made in greater detail to various embodiments of the subject matter of the present disclosure, some embodiments of which are illustrated in the accompanying drawings.

[0075] The present disclosure is concerned with increasing sequencing resolution. In some embodiments, sequencing resolution is increased within a repeat region and / or downstream of repeat region of an oligonucleotide. A repeat region is a portion of an oligonucleotide, such as a target oligonucleotide or template oligonucleotide, that has a sequence of a single repeating nucleotide or a pattern of two or more repeating nucleotides. Examples of repeat regions include, homopolymers, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, and the like.

[0076] Repeat regions and regions downstream of repeat regions can be difficult to accurately sequence. For example, a plurality of oligonucleotides (e.g., a cluster) amplified from a template oligonucleotide having a repeat region may include a variety of repeat region lengths. For example, a polymerase synthesizing a new strand using a template oligonucleotide as a template, may insert and / or delete one or more nucleotides when synthesizing the complement to the repeat region (see, for example, FIG.1 where the repeat region is an adenine homopolymer). During multiple rounds of amplification, these errors can propagate, and new similar errors may be introduced as each new strand can be used as template during the amplification process. As a result, the plurality of amplified oligonucleotides may have different sequences and sequence lengths (FIG.1). When sequenced, the difference in sequence identity and length may result in noise and / or a higher error rate for the nucleotides within and / or downstream of the repeat region.

[0077] The reason for the addition or deletion of nucleotides during synthesis of a repeat complement region is not fully understood. Without wishing to be bound by theory, it is thought that the nascent strand being synthesized and the template oligonucleotide may unhybridize and rehybridize one or more times when the polymerase is synthesizing the complement of the repeat region of the template strand. The hybridization-rehybridization may cause the polymerase to lose synchronization with the template strand resulting in the incorporation of too few or too many nucleotides. The melting temperature of repeat regions may be lower than that of non- repeat regions resulting in an increase in hybridization-rehybridization.

[0078] The methods of the present disclosure may reduce the sequencing error rate and / or increase sequence resolution within and / or downstream of a repeat region by increasing the monoclonality of a plurality of template oligonucleotides present at an amplification site. As such, the methods of the present disclosure may be useful during any step of sequencing or sequencing preparation that includes the synthesis of an oligonucleotide using an oligonucleotide having a repeat region as a synthesis template. For example, the methods of the present disclosure may be useful during amplification site generation (e.g., clustering), strand resynthesis, or both.

[0079] A general sequencing workflow 1000 can include four steps (FIG.2) including sequencing library preparation (step 600), amplification site generation (step 700), sequencing (step 800), and data analysis (step 900). Amplification site generation (step 700) can include amplification site seeding, first strand synthesis, and amplification. Sequencing (step 800) can include a first sequence read, resynthesis, and a second sequencing read. The present disclosure provides methods related to amplification site generation (step 700) and resynthesis between the first read and second read of sequencing (step 800). The methods of the present disclosure can be employed during one or more of amplification site seeding, first strand synthesis, amplification, and resynthesis.

[0080] The methods described herein include the use of reduced temperatures during the synthesis of oligonucleotides from a template having a repeat region. The use of reduced temperature during synthesis may reduce the number of oligonucleotides having a different sequence at an amplification site when such oligonucleotides were amplified from a template having a repeat region. The data obtained from subsequent sequencing may include increased representation of repeat regions, reduced sequence specific errors, decreased error rate, increased output from repeat regions and regions downstream of repeat regions, increased quality from repeat regions and regions downstream of repeat regions, or any combination thereof.

[0081] In some embodiments, the methods of the present disclosure are particularly useful for next generation sequencing, also called massively parallel sequencing. Next generation sequencing allows many target oligonucleotides to be sequenced simultaneously.

[0082] The methods of the present disclosure include amplifying a template oligonucleotide. A template oligonucleotide includes the sequence of a target oligonucleotide and an adapter, or at least a portion of an adaptor, on one or both ends of the target oligonucleotide.

[0083] A template oligonucleotide may be prepared from a target oligonucleotide. A template oligonucleotide may be prepared in any suitable manner. In some embodiments, preparing a template oligonucleotide includes obtaining a target oligonucleotide and using ligation or tagmentation to add one or more adapters to the target oligonucleotide to create a template oligonucleotide.

[0084] A target oligonucleotide is an oligonucleotide where identification of at least a portion of its nucleotide sequence is desired. A target oligonucleotide may be essentially any oligonucleotide of known or unknown sequence. The sequence of two or more target oligonucleotides in the population of target oligonucleotides may be the same or different.

[0085] Sequencing may result in the determination of the sequence of a part of a target oligonucleotide or the entire target oligonucleotide. A target oligonucleotide or a population of target oligonucleotides can be derived from one or more primary oligonucleotide samples. A primary oligonucleotide sample may originate in double-stranded DNA (dsDNA) form (e.g., genomic DNA fragments, cell free DNA, PCR and amplification products, and the like) or may originate in single-stranded form, as DNA or RNA that may been converted to dsDNA.

[0086] A primary target oligonucleotide may be obtained from any biological sample using known, routine methods. Suitable biological samples include, but are not limited to, a blood sample, biopsy specimen, tissue explant, organ culture, biological fluid, or any other tissue or cell preparation, or fraction thereof, or derivative thereof, or isolated therefrom. In some embodiments, a primary target oligonucleotide may be obtained as a sample from a human, an animal, a bacterium, a fungus, or a virus.

[0087] A target oligonucleotide or a population of target oligonucleotides can be derived from a primary oligonucleotide sample that has been sequence specifically fragmented or randomly fragmented. For example, a fragment of genomic DNA or cDNA may be used as a target oligonucleotide or a population of target oligonucleotides. Random fragmentation refers to the fragmentation of a nucleic acid from a primary oligonucleotide sample in a non-ordered fashion by enzymatic, chemical, or mechanical methods. Such fragmentation methods are known in the art and use standard methods (e.g., see Sambrook and Russell, Molecular Cloning, A Laboratory Manual, third edition).

[0088] A target oligonucleotide, one or more target oligonucleotides in a population of oligonucleotides, or a population of target oligonucleotides can include a repeat region. A repeat region is a sequence of a single repeating nucleotide or a pattern of two or more repeating nucleotides. A pattern of two or more repeating nucleotides can be referred to as an X-nucleotide repeat where X is the prefix for the total number of nucleotides in each repeat. For example, a dinucleotide repeat is a repeating pattern of two nucleotides.

[0089] Repeat regions are ubiquitous in prokaryotic and eukaryotic genomic DNA. For example, approximately 50% of the human genome is made up of repeat regions. The repeat regions exist in both the noncoding and coding portion of the human genome. In the noncoding portion of the genome, repeat regions can play a role in gene expression regulation and variation induction. In the coding portion of the human genome, repeat regions can be translated into polypeptides. Expansion of repeat regions is associated with some diseases and disorders. For example, an expanded CAG trinucleotide repeat is associated with Huntington´s disease and an expanded CTG trinucleotide repeat is associated with myotonic dystrophy type 1.

[0090] Repeat regions can be located at any position in a target oligonucleotide. Examples of repeat regions include homopolymers, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, pentanucleotide repeats, hexanucleotide repeats, and repeats that have a repeating sequence larger than six nucleotides. Nucleotide homopolymers are 5 or more consecutive nucleotides that have the same nucleobase. Examples of nucleotide homopolymers include poly(thymine) (poly(T)), poly(adenine) (poly(A)), poly(guanine) (poly(G)), poly(cytosine) (poly(C)), and poly(uridine) (poly(U)). A dinucleotide repeat is a sequence of two nucleotides having different nucleobases that are consecutively repeated three or more times. Examples of dinucleotide repeats include, for example, (TA)n, (TG)n, (TC)n, (AG)n, (AC)n, (AU)n, (GC)n, (GU)n, and (CU)n where n is the number of times the dinucleotide sequence is repeated. A trinucleotide repeat is a sequence of three nucleotides having different nucleobases that are consecutively repeated three or more times. Examples of dinucleotide repeats include, for example, (CAG)n, (CGG)n, (CTG)n, (GAA)n, (GCC)n, and (GCG)n where n is the number of times the dinucleotide sequence is repeated. A tetranucleotide repeat is a sequence of four nucleotides having different nucleobases that are consecutively repeated three or more times. An example of a tetranucleotide repeat is (CCTG)n where n is the number of times the tetranucleotide sequence is repeated.

[0091] A repeat region in a target oligonucleotide can have a total of 5 or more nucleotides, for example 5 to 500 nucleotides. In some embodiments, a repeat region has a total of 5 or more, 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, 95 or more, 100 or more, 200 or more, 300 or more, or 400 or more nucleotides. In some embodiments, a repeat region has a total of 500 or fewer, 400 or fewer, 300 or fewer, 200 or fewer, 100 or fewer, 95 or fewer, 90 or fewer, 85 or fewer, 80 or fewer, 75 or fewer, 70 or fewer, 65 or fewer, 60 or fewer, 55 or fewer, 50 or fewer, 45 or fewer, 40 or fewer, 35 or fewer, 30 or fewer, 25 or fewer, 20 or fewer, 15 or fewer, or 10 or fewer nucleotides.

[0092] A target oligonucleotide can have any total number of nucleotides. For example, a target oligonucleotide can have from 15 to 1500 nucleotides. In some embodiments, a target oligonucleotide can have 15 or more, 25 or more, 50 or more, 75 or more, 100 or more, 150 or more, 200 or more, 250 or more, 300 or more, 350 or more, 400 or more, 450 or more, 500 or more, 550 or more, 600 or more, 650 or more, 700 or more, 750 or more, 800 or more, 850 or more, 900 or more, or 950 or more nucleotides. In some embodiments, a target oligonucleotide can have 1000 or less, 950 or less, 900 or less, 850 or less, 800 or less, 750 or less, 700 or less, 650 or less, 600 or less, 550 or less, 500 or less, 450 or less, 400 or less, 350 or less, 300 or less, 250 or less, 200 or less, 150 or less, 100 or less, 75 or less, 50 or less, or 25 or less nucleotides.

[0093] Once a target oligonucleotide or population of target oligonucleotides are obtained, a library of template oligonucleotides for use in the provided methods may be prepared using a variety of standard techniques available and known in the art. The term “library” refers to the collection of template oligonucleotides containing known common sequences at their 3′ and / or 5′ ends, for example, by attachment of adapters. Each template oligonucleotide of the library includes one or more target oligonucleotides. Exemplary methods of template oligonucleotide preparation include, but are not limited to, those described in Bentley et al., Nature 456:49-51 (2008); U.S. Patent No.7,115,400; and U.S. Patent Application Publication Nos.2007 / 0128624; 2009 / 0226975; 2005 / 0100900; 2005 / 0059048; 2007 / 0110638; and 2007 / 0128624, each of which is herein incorporated by reference in its entirety.

[0094] For the methods of the present disclosure, a template oligonucleotide includes adapters that are ligated to the 5′ and / or 3′ ends of a target oligonucleotide. Methods for attaching adapters to one or both ends of a target oligonucleotide are known to the person skill in the art. The attachment can be through standard library preparation techniques using, for example, ligation (U.S. Pat. Pub. No.2018 / 0305753), or tagmentation using transposase complexes (Gunderson et al., WO 2016 / 130704).

[0095] Adapters include one or more known sequences. When a template oligonucleotide includes adapters with known sequences on the 5′ and / or 3′ ends, the known sequences may be the same or different. In some embodiments, known adapter sequences located on the 5′ and / or 3′ ends of a template oligonucleotide are capable of hybridizing to one or more surface oligonucleotides that are immobilized on a surface. For instance, for use with a surface that includes P5 and P7 surface oligonucleotides, the adapters may include P5′ or a P7′ sequence or derivative thereof. A P5 surface oligonucleotide may hybridize with a P5′ adapter sequence and a P7 surface oligonucleotide may hybridize with a P7′ adapter sequence. In one or more embodiments, a template oligonucleotide may include one or more detectable labels. The one or more detectable labels may be attached to a template oligonucleotide at the 5′ end, at the 3′ end, and / or at any nucleotide position within the template oligonucleotide, for example, within the adapter sequence.

[0096] An adapter may further include one or more universal sequences. A universal sequence is a region of nucleotide sequence that is common to, e.g., shared by, two or more template oligonucleotides, where the two or more template oligonucleotides also have regions of sequence differences (e.g., the target oligonucleotide sequence). A universal sequence may be present in different members of a library of template oligonucleotides may allow the replication or amplification of multiple different sequences using a single universal primer that is complementary to the universal sequence. Similarly, at least one, two (e.g., a pair), or more universal sequences may be present in different members of a library of template oligonucleotides may allow the replication or amplification of multiple different sequences using at least one, two (e.g., a pair), or more single universal primers that are at least partially complementary to the universal sequences. Thus, a universal primer includes a sequence that may hybridize specifically to such a universal sequence.

[0097] An adapter may also include one or more indexes. An index can be used as a marker characteristic of the source of particular target oligonucleotide (U.S. Pat. No.8,053,192). Generally, an index is a synthetic sequence of nucleotides that is part of an adapter which is added to a target oligonucleotide as part of the library preparation step. Accordingly, an index is an oligonucleotide sequence which is attached to each of the target oligonucleotides of a particular sample, the presence of which is indicative of, or is used to identify, the sample or source from which the target oligonucleotides were isolated. In some embodiments, a multiple index system may be used. In a multiple index system, the adapter attached to target oligonucleotides includes two or more different index sequences, for example as described in U.S. Pat. No.10,975,430; U.S. Pat. No.10,995,369; U.S. Pat. No.10,934,584; and U.S. Pat. Pub. No.2018 / 0305753.

[0098] In some embodiments, an adapters includes a cleavage site. An adapter may include any suitable cleavage site. Examples of suitable cleavage sites include abasic cleavage sites, chemical cleavage sites, ribonucleotide cleavage sites, photochemical cleavage sites, hemimethylated DNA cleavage sites, nicking endonuclease cleavage sites, and restriction enzyme cleavage sites.

[0099] A template oligonucleotide may also be modified to include any oligonucleotide sequence desirable using standard, known methods. The modifications may be incorporated as a part of an adapter or separately, for example, prior to adapter addition. Such additional sequences may include, but are not limited to, restriction enzyme sites, non-natural nucleotides, modified nucleotides, and combinations thereof. Examples of unnatural or modified nucleotides, but are not limited to, deoxyuridine (U), 8-oxo-guanine (8-oxo-G), hemimethylated sequences, ally- dNTPs (e.g., ally-T, ally-C, ally-G, and ally-A), and deoxyinosine.

[0100] In some embodiments, a template oligonucleotide may include one or more modified nucleotides that enhance base pair binding, relative to a natural nucleotide, to a nucleotide of the template oligonucleotide. The modifications may be incorporated as a part of the adapter or separately, for example, prior to adapter ligation. Modified nucleotides are known and include, for example, locked nucleotides (LNAs) and bridged nucleotides (BNAs). LNAs and BNAs, as well as oligonucleotides containing LNAs and BNAs, are commercially available. The following publications provide additional information regarding BNAs: (1) Obika, S., et al., (1997), "Synthesis of 2′-O,4′-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering," Tetrahedron Letters.38 (50): 8735; (2) Obika, S., et al., (2001), "3′-amino-2′,4′-BNA: Novel bridged nucleic acids having an N3′-->P5′ phosphoramidate linkage," Chemical communications (Cambridge, England) (19): 1992–1993; (3) Obika, S., et al., (2001), "A 2′,4′-Bridged Nucleic Acid Containing 2-Pyridone as a Nucleobase: Efficient Recognition of a C⋅G Interruption by Triplex Formation with a Pyrimidine Motif," Angewandte Chemie International Edition.40 (11): 2079; (4) Morita, K., et al., (2001), "2′-O,4′-C-ethylene- bridged nucleic acids (ENA) with nuclease-resistance and high affinity for RNA," Nucleic Acids Research. Supplement.1 (1): 241–242; (5) Hari, Y., et al., (2003), "Selective recognition of CG interruption by 2′,4′-BNA having 1-isoquinolone as a nucleobase in a pyrimidine motif triplex formation," Tetrahedron.59 (27): 5123; (6) Rahman, S. M. A., et al., (2007), "Highly Stable Pyrimidine-Motif Triplex Formation at Physiological pH Values by a Bridged Nucleic Acid Analogue," Angewandte Chemie International Edition.46 (23): 4306–4309. LNAs monomers include an additional bridge that connects the 2′ oxygen and the 4′ carbon of a ribose moiety to "lock" the ribose in the 3′-endo conformation. Preferably, the modified nucleotides form standard Watson-Crick base pairs. For example, LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the base pairing (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)).

[0101] In some embodiments, a template oligonucleotides may include non-natural backbone linkages such as a diol or disulfide; photo-cleavable spacer group; or any combination thereof. The modifications may be incorporated as a part of the adapter, or separately prior to adapter ligation.

[0102] In some embodiments, prior to or after adapter addition, a target oligonucleotide, a template oligonucleotide, or a plurality thereof are amplified. Amplification may be accomplished through any known amplification process known in the art, for example, solid- phase amplification, polony amplification, colony amplification, polymerase chain reaction (PCR) such as emulsion PCR, bead rolling circle amplification (RCA), surface RCA, or surface exponential strand displacement (SDA). Amplification can be thermal or isothermal.

[0103] The methods of the present disclosure may be useful for preparing a surface for sequencing a target oligonucleotide having a repeat region or a template oligonucleotide amplified therefrom. The methods of the present disclosure may be useful for sequencing a target oligonucleotide having a repeat region on a surface or template oligonucleotide amplified therefrom.

[0104] As used herein the term “surface” refers to a substrate for attaching oligonucleotides. A surface is made of material that has a rigid or semi-rigid structure to which an oligonucleotide can be attached or upon which oligonucleotides can be synthesized and / or modified. Surfaces can include any resin, gel, bead, well, column, chip, flow cell, membrane, matrix, plate, filter, glass, controlled pore glass (CPG), polymer support, membrane, paper, plastic, plastic tube or tablet, plastic bead, glass bead, slide, ceramic, silicon chip, multi-well plate, nylon membrane, fiber optic, poly(vinylidene fluoride) (PVDF) membrane, or any combination thereof. In some embodiments, the surface is within or a part of a flow cell.

[0105] A surface includes one or more amplification sites. An amplification site can be a region on a surface in which a template oligonucleotide can be amplified to form a monoclonal cluster. The terms "monoclonal cluster" and "monoclonal population" are used interchangeably and refer to a population of oligonucleotides that is homogeneous with respect to a particular nucleotide sequence. A monoclonal cluster can be derived from a single target oligonucleotide or template oligonucleotide derived from a single target oligonucleotide. Typically, all oligonucleotides in a monoclonal cluster will have a single nucleotide sequence or the complement of the single nucleotide sequence. It will be understood that a small number of mutations (e.g., due to amplification artifacts) can occur in a monoclonal cluster without departing from monoclonality. It will also be understood that a small number of different target oligonucleotides or template oligonucleotides derived therefrom (e.g., due to a target oligonucleotide or a template oligonucleotide derived therefrom that was not amplified or amplified to a limited degree) can occur in a monoclonal population without departing from monoclonality.

[0106] A surface, or an amplification site on the surface, includes a population of surface- bound oligonucleotides, also called surface oligonucleotides. A surface oligonucleotides may be covalently attached to the surface. A surface oligonucleotide is generally configured to capture a template oligonucleotide. For example, a surface oligonucleotide can bind or hybridize to a portion of a template oligonucleotide, particularly to a portion of an adapter of the template oligonucleotide. In some embodiments, surface oligonucleotides are attached to a surface at their 5′ end and have a free 3′ end.

[0107] An amplification site on a surface may include a population of surface oligonucleotides. A population of surface oligonucleotides at an amplification site may include a population of first surface oligonucleotides and a population of a second surface oligonucleotides where the population of first surface oligonucleotides and the population of second surface oligonucleotides have different sequences. In some embodiments, the population of first surface oligonucleotides include the sequence of P7. In some embodiments, the population of second surface oligonucleotides include the sequence of P5. In some embodiments, the population of second surface oligonucleotides include the sequence of P15. P7, P5, and P15 surface oligonucleotides are configured to hybridize with the P7′, P5′, and P15′ sequences of adapters that can be attached to a template oligonucleotide. Uses of surface oligonucleotides such as P5 and P7 on flow cells is known in the art, as exemplified by the disclosures of WO 2007 / 010251, WO 2006 / 064199, WO 2005 / 065814, WO 2015 / 106941, WO 1998 / 044151, and WO 2000 / 018957. P7, P5, and P15 surface oligonucleotides are also described in, for example, US 2019 / 0352327, which is hereby incorporated by reference in its entirety. In some embodiments, additional populations of surface oligonucleotides having sequences different from the population of first surface oligonucleotides and the population of second surface oligonucleotides may be present. In some embodiments, the surface oligonucleotides may include one or more unnatural or modified nucleotides, unnatural backbone linkages, restriction enzyme sequences, or any combination thereof, such as those described elsewhere herein.

[0108] Attachment of surface oligonucleotides to the surface can be accomplished through any method known in the art, for example, such as those described in U.S. Pat. No.8,895,249, WO 2008 / 093098, and US. Pat. Pub. No.2011 / 0059865 A1, amongst others. The attachment can be via an intermediate structure such as a bead, particle, or gel. An example of attachment of surface oligonucleotides to an array via a gel is described in U.S. Pat. No.8,895,249 and further exemplified by flow-cells available commercially from Illumina Inc. (San Diego, Calif.) or described in WO 2008 / 093098. Exemplary gels that can be used in the methods and apparatus set forth herein include, but are not limited to, those having a colloidal structure, such as agarose; polymer mesh structure, such as gelatin; or cross-linked polymer structure, such as polyacrylamide, SFA (see, for example, US Pat. App. Pub. No.2011 / 0059865 A1) or PAZAM (see, for example, U.S. Prov. Pat. App. Ser. No.61 / 753,833 and U.S. Pat. No.9,012,022). Attachment via a bead can be achieved as exemplified in the description and cited references set forth previously herein.

[0109] A surface oligonucleotide can be immobilized by a single point covalent attachment to a surface at or near the 5´ end of the surface oligonucleotide, leaving the template-specific portion of the surface oligonucleotide free to anneal to its cognate universal capture binding sequence and the 3´ hydroxyl group free for extension. Any suitable covalent attachment means known in the art may be used for this purpose. The chosen attachment chemistry can depend on the nature of the solid support, and any derivatization or functionalization applied to it. A surface oligonucleotide itself may include a moiety, which may be a non-nucleotide chemical modification, to facilitate attachment. In a particular embodiment, a surface oligonucleotide may include a sulfur-containing nucleophile, such as phosphorothioate or thiophosphate, at the 5´ end.

[0110] A template oligonucleotide may be immobilized on the surface through hybridization of an adapter portion that is configured to bind to a surface oligonucleotide. For example, if the population of first surface oligonucleotides includes the P5 sequence, a template oligonucleotide that include the P5′ sequence in the adapter region may hybridize to the first surface oligonucleotide. If the population of first surface oligonucleotides includes the P7 sequence, a template oligonucleotide that include the P7′ sequence in the adapter region may hybridize to the first surface oligonucleotide. If the population of first surface oligonucleotides includes the P15 sequence, a template oligonucleotide that include the P15′ sequence in the adapter region may hybridize to the first surface oligonucleotide.

[0111] A surface oligonucleotide may be used as primers for chain extension during amplification site formation and / or resynthesis.

[0112] Some embodiments of the methods described herein can be used to generate an array of amplification sites. An array of amplification sites can be present as one or more substrates. Exemplary types of substrate materials that can be used for an array include glass, modified glass, functionalized glass, inorganic glasses, microspheres (e.g., inert and / or magnetic particles), plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, an optical fiber or optical fiber bundles, polymers, multiwell (e.g., microtiter) plates, or any combination thereof. Exemplary plastics include acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes and TEFLON. Exemplary silica-based materials include silicon and various forms of modified silicon.

[0113] In particular embodiments, a substrate can be within or part of a vessel such as a well, tube, channel, cuvette, Petri plate, bottle or the like. A particularly useful vessel is a flow-cell, for example, as described in US Pat. No.8,241,573 or Bentley et al., Nature 456:53-59 (2008). Exemplary flow-cells are those that are commercially available from Illumina, Inc. (San Diego, Calif.). Another particularly useful vessel is a well in a multiwell plate or microtiter plate.

[0114] In some embodiments, sites of an array can be configured as features on a surface. Features can be present in any of a variety of desired formats. For example, the sites can be wells, pits, channels, ridges, raised regions, pegs, posts or the like. As set forth herein, the sites can contain beads. However, in particular embodiments, the sites need not contain a bead or particle. Exemplary sites include wells that are present in substrates used for commercial sequencing platforms sold by 454 LifeSciences (a subsidiary of Roche, Basel Switzerland) or Ion Torrent (a subsidiary of Life Technologies, Carlsbad Calif.). Other substrates having wells include, for example, etched fiber optics and other substrates described in U.S. Pat. No. 6,266,459; U.S. Pat. No.6,355,431; U.S. Pat. No.6,770,441; U.S. Pat. No.6,859,570; U.S. Pat. No.6,210,891; U.S. Pat. No.6,258,568; U.S. Pat. No.6,274,320; U.S. Pat No.8,262,900; U.S. Pat. No.7,948,015; U.S. Pat. Pub. No.2010 / 0137143; U.S. Pat. No.8,349,167, or PCT Publication No. WO 00 / 63437. In several cases, the substrates are exemplified in these references for applications that use beads in the wells. Well-containing substrates can be used with or without beads in the methods or compositions of the present disclosure. In some embodiments, wells of a substrate can include gel material (with or without beads) as set forth in U.S. Pat. No.9,512,422.

[0115] The sites of an array can be metal features on a non-metallic surface such as glass, plastic or other materials exemplified herein. A metal layer can be deposited on a surface using methods known in the art such as wet plasma etching, dry plasma etching, atomic layer deposition, ion beam etching, chemical vapor deposition, vacuum sputtering, or the like. Any of a variety of commercial instruments can be used as appropriate including, for example, the FLEXAL, OPAL, IONFAB 300 PLUS, or OPTOFAB 30 (Oxford Instruments, UK). A metal layer can also be deposited by e-beam evaporation or sputtering as set forth in Thornton, Ann. Rev. Mater. Sci.7:239-60 (1977). Metal layer deposition techniques, such as those exemplified herein, can be combined with photolithography techniques to create metal regions or patches on a surface. Exemplary methods for combining metal layer deposition techniques and photolithography techniques are provided in U.S. Pat. No.8,778,848 and U.S. Pat. No. 8,895,249.

[0116] In some embodiments, an array can include a collection of beads or other particles. Particles can be suspended in a solution or they can be located on the surface of a substrate. Examples of bead arrays in solution are those commercialized by Luminex (Austin, Tex.). Examples of arrays having beads located on a surface include those where beads are located in wells such as a BeadChip array (Illumina Inc., San Diego Calif.) or substrates used in sequencing platforms from 454 LifeSciences (a subsidiary of Roche, Basel Switzerland) or Ion Torrent (a subsidiary of Life Technologies, Carlsbad Calif.). Other arrays having beads located on a surface are described in U.S. Pat. No.6,266,459; U.S. Pat. No.6,355,431; U.S. Pat. No.6,770,441; U.S. Pat. No.6,859,570; U.S. Pat. No.6,210,891; U.S. Pat. No.6,258,568; U.S. Pat. No.6,274,320; US 2009 / 0026082 A1; US 2009 / 0127589 A1; US 2010 / 0137143 A1; US 2010 / 0282617 A1, or PCT Publication No. WO 00 / 63437. Several of the above references describe methods for attaching a template oligonucleotide to beads prior to loading the beads in or on an array substrate. It will, however, be understood that the beads can be made to include surface oligonucleotides and the beads can then be used to load an array, thereby forming amplification sites for use in a method set forth herein. As set forth previously herein, the substrates can be used without beads. For example, surface oligonucleotides can be attached directly to the wells or to gel material in wells. Thus, the references are illustrative of materials, compositions or apparatus that can be modified for use in the methods and compositions set forth herein.

[0117] In some embodiments, features on a surface of an array substrate are non-contiguous, being separated by interstitial regions of the surface. Interstitial regions that have a substantially lower quantity or concentration of capture agents, compared to the features of the array, are advantageous. Interstitial regions that lack surface oligonucleotides are particularly advantageous. For example, a relatively small amount or absence of surface oligonucleotides at the interstitial regions favors localization of template oligonucleotides, and subsequently generated clusters, to desired features. In particular embodiments, the features can be concave features in a surface (e.g., wells) and the features can contain a gel material. The gel-containing features can be separated from each other by interstitial regions on the surface where the gel is substantially absent or, if present the gel is substantially incapable of supporting localization of oligonucleotides. Methods and compositions for making and using substrates having gel containing features, such as wells, are set forth in U.S. Pat. No.9,512,422. The size of the features and / or spacing between the regions can vary such that arrays can be high density, medium density or lower density. High density arrays are characterized as having regionsseparated by less than about 15 micrometers ( m). Medium density arrays have regionsseparated by about 15 to 30 m, while low density arrays have regions separated by greater than 30 m. An array useful in the disclosure can have regions that are separated by less than 100 m, 50 m, 10 m, 5 m, 1 m or 0.5 m.

[0118] In some embodiments, a substrate or surfaceincludes a patterned surface. A "patterned surface" refers to an arrangement of different regions in or on an exposed layer of a surface of substrate. For example, one or more of the regions can be features where one or more surface oligonucleotides are present. In some embodiments, a pattern can be an x-y format of features that are in rows and columns. In some embodiments, a pattern can be a repeating arrangement of features and / or interstitial regions. In some embodiments, a pattern can be a random arrangement of features and / or interstitial regions. In some embodiments, a pattern can appear as a grid of spots or patches. The features can be located in a repeating pattern or in an irregular non-repeating pattern. Particularly useful patterns are hexagonal patterns, rectilinear patterns, grid patterns, patterns having reflective symmetry, patterns having rotational symmetry, or the like. Asymmetric patterns can also be useful. The pitch can be the same between different pairs of nearest neighbor features or the pitch can vary between different pairs of nearest neighbor features. In particular embodiments, features of an array can each have an area that is larger than about 100 nm2, 250 nm2, 500 nm2, 1 m2, 2.5 m2, 5 m2, 10 m2, 100 m2, or 500 m2. Alternatively, or additionally, features of an array can each have an area that is smaller than about 1 mm2, 500 m2, 100 m2, 25 m2, 10 m2, 5 m2, 1 m2, 500 nm2, or 100 nm2. Indeed, a region can have a size that is in a range between an upper and lower limit selected from those exemplified above. Exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Pat. Nos.8,778,848, 8,778,849 and 9,079,148, and U.S. Pat. Appl. Pub. No.2014 / 0243224.

[0119] Features in a patterned surface or substrate can be wells in an array of wells (e.g., microwells or nanowells) on glass, silicon, plastic or other suitable solid supports with patterned, covalently-linked gel such as poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide) (PAZAM, see, for example, US Pub. No.2013 / 184796, WO 2016 / 066586, and WO 2015 / 002813). The process can create gel pads used for sequencing that can be stable over sequencing runs with a large number of cycles. The covalent linking of the polymer to the wells is helpful for maintaining the gel in the structured features throughout the lifetime of the structured substrate during a variety of uses. However, in many embodiments the gel need not be covalently linked to the wells. For example, in some conditions, silane free acrylamide (SFA, see, for example, US Pat. No.8,563,477) which is not covalently attached to any part of the structured substrate, can be used as the gel material.

[0120] In some embodiments, a structured substrate can be made by patterning a solid support material with wells (e.g., microwells or nanowells), coating the patterned support with a gel material (e.g., PAZAM, SFA, or chemically modified variants thereof, such as the azidolyzed version of SFA (azido-SFA)) and polishing the gel coated support, for example via chemical or mechanical polishing, thereby retaining gel in the wells but removing or inactivating substantially all of the gel from the interstitial regions on the surface of the structured substrate between the wells. Surface oligonucleotides can be attached to gel material. A solution of template oligonucleotides can then be contacted with the polished substrate such that individual template oligonucleotide acids will seed individual wells via interactions with surface oligonucleotides attached to the gel material; however, a template oligonucleotide will not occupy the interstitial regions due to absence or inactivity of the gel material. Amplification of a template oligonucleotide will be confined to the wells since absence or inactivity of gel in the interstitial regions prevents outward migration of the growing cluster. The process can be conveniently manufactured, being scalable and utilizing conventional micro- or nanofabrication methods.

[0121] FIGS.3A, 3B, 3C, 3D, 4A, 4B, 4C, 4D, 5, 6A, 6B, 7A, and 7B, are referenced to illustrate embodiments consistent with the present disclosure. For clarity, the description of each element and step in the figures may be described in the singular. However, it should be understood that the methods described herein may be applied to arrays or cluster of template oligonucleotides in order to accomplish massively parallel sequencing.

[0122] FIGS.3A and 4A are flow charts illustrating methods 700A (FIG.3A) and 700B (FIG.4A) for preparing a surface for sequencing a target oligonucleotide having a repeat region. The methods include amplifying a template oligonucleotide derived from and including a target oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface (step 710A / 710B). Amplifying a template oligonucleotide includes incubating a chain extending enzyme (e.g., a polymerase) with the amplification site at a reduced temperature, for example, 20 °C to 30 °C (method 700A) or 35 °C to 45 °C (method 700B).

[0123] In some embodiments where amplifying is done at 35 °C to 45 °C (method 700B), the method does not include the use of one or more of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, and an energy recycling factor. In some embodiments, where amplifying is done at 35 °C to 45 °C (method 700B), the method does not include the use of a recombinase. In some embodiments, where amplifying is done at 35 °C to 45 °C (method 700B), the method does not include the use of an exchange factor. In some embodiments, where amplifying is done at 35 °C to 45 °C (method 700B), the method does not include the use of a single stranded binding protein. In some embodiments, where amplifying is done at 35 °C to 45 °C (method 700B), the method does not include the use of an energy recycling factor.

[0124] In some embodiments where amplifying is done at 20 °C to 30 °C (method 700A), the method does include the use of one or more of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, and an energy recycling factor. In some embodiments, where amplifying is done at 20 °C to 30 °C (method 700A), the method does include the use of a recombinase. In some embodiments, where amplifying is done at 20 °C to 30 °C (method 700A), the method does include the use of an exchange factor. In some embodiments, where amplifying is done at 20 °C to 30 °C (method 700A), the method does include the use of a single stranded binding protein. In some embodiments, where amplifying is done at 35 °C to 45 °C (method 700B), the method does include the use of an energy recycling factor.

[0125] The monoclonal clusters of methods 700A and 700B include a first population of oligonucleotides and a second population of oligonucleotides. The first population of oligonucleotides has the sequence of the target oligonucleotide where the sequence of the target oligonucleotide includes the repeat region. The second population of oligonucleotides has a sequence complementary to the target oligonucleotide where the sequence complementary to the target oligonucleotide includes a complementary repeat region. The oligonucleotides of the first population and the second population can be template oligonucleotides.

[0126] In some embodiments, the methods 700A and 700B further include removing the first population of oligonucleotides or the second population of oligonucleotides from the surface (step 880A / 880B). In some embodiments, the methods 700A and 700B further include sequencing the first population of oligonucleotides or the second population of oligonucleotides that remain bound to the surface (step 890A / 890B). Steps 880A / 880B and 890A / 890B can be a part of sequencing steps (see, for example, step 800 of FIG.2).

[0127] In some embodiments, the methods 700A and 700B further include synthesizing a new population of oligonucleotides that is complementary to a population of oligonucleotides previously sequenced. Synthesizing a new population of oligonucleotides may be accomplished by using a population of oligonucleotides previously sequenced as synthesis templates. Following synthesis of a new population, an amplification site will have a population of oligonucleotides that was previously sequenced and a new population of oligonucleotides. In some embodiments, the methods 700A and 700B further includes removing from the surface the population of oligonucleotides that was previously sequenced. In some embodiments, methods 700A and 700B further include sequencing the new population of oligonucleotides.

[0128] FIG.5 provides a schematic overview for preparing a surface for sequencing a target oligonucleotide having a repeat region consistent with some embodiments of the present disclosure, for example, methods 700A and 700B of FIG.3A and 4A. The workflow in FIG.5 includes providing an amplification site AS on a surface S. The amplification site AS includes a template oligonucleotide AA. The template oligonucleotide AA includes a target oligonucleotide having a repeat region RR and one or more adapters appended to the 5´ end, the 3´ end, or both of the target oligonucleotide. The amplification site AS may include a lawn (a plurality) of surface oligonucleotides (not shown). The lawn of surface oligonucleotides can include two populations of surface oligonucleotides, each population having at least a portion of their sequence configured to hybridize with at least a portion of the adapter sequence appended to the template oligonucleotide AA. The surface oligonucleotides can serve as primers during the amplification of the template oligonucleotide AA. The template oligonucleotide AA can be hybridized to a surface oligonucleotide (not shown in FIG.5). For example, the amplification site AS may have been seeded by hybridizing the template oligonucleotide AA to a surface oligonucleotide (see step 700 of FIG.2). The 5´end of the template oligonucleotide AA can be covalently attached to the surface.

[0129] The workflow includes amplifying the template oligonucleotide (step 710A in method 700A of FIG.3A and step 710B in method 700B of FIG.4A). Amplification can include, for example, first strand synthesis (see step 700 in FIG.2) During first strand synthesis, a surface oligonucleotide to which an initial template oligonucleotide is hybridized is extended using a chain extending enzyme (e.g., a polymerase) to form a second oligonucleotide using the initial template oligonucleotide as a template. The second oligonucleotide includes the surface oligonucleotide primer to which it is now covalently bound. The second oligonucleotide has a sequence that is complementary to the initial template oligonucleotide.

[0130] The template oligonucleotide is amplified to form a monoclonal cluster MC of oligonucleotides at the amplification site AS. The monoclonal cluster MC includes a first population of oligonucleotides BB and a second population of oligonucleotides BB´. The first population of oligonucleotides BB includes oligonucleotides having the sequence of the target oligonucleotide including the repeat region RR. The second population of oligonucleotides BB´ includes oligonucleotides having the complementary sequence of the target oligonucleotide including a complementary repeat region (RR´). The monoclonal cluster MC may include the initial template oligonucleotide AA.

[0131] Each oligonucleotide of the first population of oligonucleotides and second population of oligonucleotide is a template oligonucleotide since they include at least a portion of the target oligonucleotide sequence or the complement thereto and at least a portion of the adapter sequence or the complement thereto. Oligonucleotides of the first and second oligonucleotide populations can serve as a template for the synthesis of a complementary strand. In some embodiments, synthesis of oligonucleotides of the first and second population includes extending a surface oligonucleotide using a template oligonucleotide as a template. As a result, the newly synthesized oligonucleotide includes the surface oligonucleotide and is bound to the surface at its 5´ end.

[0132] A variety of amplification techniques may be used to amplify a template oligonucleotide to form a monoclonal cluster. Different amplification techniques may make use of different amplification conditions, such as temperature, amplification reagents, or both. Amplification techniques include, for example, isothermal amplification, oligonucleotide extension and ligation, rolling circle amplification (see, for example, Lizardi et al., Nat. Genet. 19:225-232 (1998)), polymerase chain reaction, strand displacement amplification, transcription mediated amplification, nucleic acid sequence-based amplification (described, for example, in U.S. Pat. No.8,003,354), and oligonucleotide ligation assay (see, for example, U.S. Pat. Nos. 7,582,420, 5,185,243, 5,679,524 and 5,573,907; EP 0320308 B1; EP 0336731 B1; EP 0439 182 B1; WO 90 / 01069; WO 89 / 12696; and WO 89 / 09835). Amplification conditions include, for example, the temperature during amplification or during specific steps of amplification. Amplification reagents include the molecules (e.g., biomolecules and small molecules) used during amplification. Amplification reagents may facilitate the synthesis of new oligonucleotides.

[0133] In some embodiments, amplification is isothermal amplification. Isothermal amplification is amplification of oligonucleotides without the cycling of temperatures to affect chain extension and denaturation. In some embodiments during isothermal amplification, the same temperature, or narrow temperature range (e.g., a range of + / - 0.01 °C to 5 °C) is maintained. In other embodiments of isothermal amplification, one or more temperatures can be applied for various times. For example, a first temperature can be applied for a period,a second temperature can be applied for a period of time, and so on. The first temperature , the second temperature, or any additional temperature, are not configured to denature a double-stranded oligonucleotide complex.

[0134] During isothermal amplification, cycles of extension and denaturing are performed using changes of reagents instead of changes in temperature. Examples of isothermal amplification techniques include bridge amplification (see, for example, U.S. Pat. No.7790418), exclusion amplification (ExAmp, also referred to as kinetic exclusion amplification (KEA); see for example, U.S. Pat. No.8895249), multiple displacement amplification (MDA; see, for example Dean et al., Proc. Natl. Acad. Sci. USA 99:5261-66 (2002)), isothermal strand displacement nucleic acid amplification (see, for example U.S. Pat. No.6,214,587), strand displacement amplification (SDA; see, for example, Walker et al., Molecular Methods for Virus Detection, Academic Press, Inc., 1995; U.S. Pat. Nos.5,455,166, and 5,130,238, and Walker et al., Nucl. Acids Res.20:1691-96 (1992)), recombinase polymerase amplification, and hyper- branched strand displacement amplification (see, for Example Lage et al., Genome Res.13:294- 307 (2003)). Isothermal amplification methods are described in patent application numbers WO 02 / 46456, U.S. Pub. No.2008 / 0009420, U.S. Pat. No.8,895,249, U.S. Pub No.2013 / 0338042, and U.S. Pat. No.9,169,513.

[0135] DNA nanoballs can also be used in combination with methods described herein. Methods for creating and using DNA nanoballs for genomic sequencing can be found at, for example, US patents and publications U.S. Pat. No.7,910,354, 2009 / 0264299, 2009 / 0011943, 2009 / 0005252, 2009 / 0155781, 2009 / 0118488 and as described in, for example, Drmanac et al. (2010, Science 327(5961): 78-81). Briefly, following production of template oligonucleotides, the template oligonucleotides are circularized and amplified by rolling circle amplification (Lizardi et al., 1998. Nat. Genet.19:225-232; US 2007 / 0099208 A1). The extended concatemeric structure of the amplicons promotes coiling creating compact DNA nanoballs. The DNA nanoballs can be captured on substrates, preferably to create an ordered or patterned array such that distance between each nanoball is maintained thereby allowing sequencing of the separate DNA nanoballs. In some embodiments such as those used by Complete Genomics (Mountain View, Calif.), consecutive rounds of adapter addition, amplification, and digestion are carried out prior to circularization to produce head to tail constructs having several target oligonucleotides separated by adapter sequences.

[0136] It will be appreciated that any of the amplification methodologies described herein or generally known in the art may be used with universal or target-specific primers to amplify surface-bound template oligonucleotides.

[0137] It will be appreciated that any of the amplification methodologies may be designed to amplify an immobilized template oligonucleotide. An immobilized template may be immobilized, for example, through covalent attachment to a surface or through hybridization to a surface oligonucleotide. In some embodiments, the amplification method includes ligation probe amplification or oligonucleotide ligation assay reactions that contain primers directed specifically to a template oligonucleotide. In some embodiments, the amplification method includes a primer extension-ligation reaction that contains primers directed specifically to the template oligonucleotide. As a non-limiting example of primer extension and ligation primers that may be specifically designed to amplify template oligonucleotide, the amplification may include primers used for the GoldenGate assay (Illumina, Inc., San Diego, CA) as exemplified by U.S. Pat. No.7,582,420 and 7,611,869.

[0138] Most amplification techniques include the use of a chain extending enzyme, for example, a DNA polymerase, as an amplification reagent. The chain extending enzyme synthesizes a nascent oligonucleotide strand by extending a primer and using an oligonucleotide (e.g., a template oligonucleotide) as a template. The specific type of chain extending enzyme may depend at least in part on the type of amplification. Kinetic exclusion amplification and recombinase polymerase amplification generally include the use of a strand-displacing polymerase (see, for example FIG.6B for an example of kinetic exclusion amplification). Isothermal amplification by bridge amplification may or may not include the use of a strand- displacing polymerase (see, for example FIG.7B for an example of bridge amplification). Strand displacing polymerases have an activity that removes a complementary strand from a template strand being read by the polymerase. Examples of strand-displacing polymerases include Bsu (Bacillus subtilis) DNA polymerase or large fragment of Bsu, the larger fragment of the Bst (Bacillus stearothermophilus) DNA polymerase, Phi29 DNA polymerase from the bacteriophage Phi29 of Bacillus subtilis, DNA polymerase I from Geobacillus stearothermophilus (BF) or the large fragment thereof, and polymerases derived therefrom. Other examples of DNA polymerases include those described in Igor Oscorbin and Maxim Filipenko, Bst polymerase — a humble relative of Taq polymerase, Computational and Structural Biotechnology Journal 21 (2023) 4519–4535, doi.org / 10.1016 / j.csbj.2023.09.008. Examples of non-strand displacing polymerases or polymerases having low strand displacing activity include T4 DNA polymerase, T7 DNA polymerase, Klenow polymerase, and Taq DNA polymerase. Other polymerases that may be used for amplification for some embodiments of the present disclosure include those described in US Application No.18 / 373,620 filed Sep.27, 2023, US Patent No.11,001,816, (filed Dec.4, 2019, issued May 11, 2021), and US Patent No.11,634,697 (filed Apr.9, 2021, issued Apr.25, 2023). Optionally, the polymerase is deficient in 5´ exonuclease activity, 3´ exonuclease activity, or both activities.

[0139] In some embodiments, a polymerase may be a bacterial polymerase, a phage polymerase, an archaea polymerase, or a eukaryotic polymers. In some embodiments, a polymerase may be a bacterial polymerase. In some embodiments, a polymerase may be a phage polymerase. In some embodiments, a polymerase may be an archaea polymerase. In some embodiments, a polymerase may be a bacterial polymerase a eukaryotic polymerase.

[0140] In some embodiments, a polymerase is a psychrophilic DNA polymerase. Psychrophilic DNA polymerase are polymerase from psychrophiles. Psychrophiles are organisms capable of growth and reproduction at cold temperatures (e.g., -20 °C to 20 °C). Examples of psychrophilic DNA polymerases include those disclosed in Xue Y, Braslavsky I, Quake SR. Temperature effect on polymerase fidelity. J Biol Chem.2021 Nov;297(5):101270. doi: 10.1016 / j.jbc.2021.101270. Epub 2021 Oct 23. PMID: 34695416; PMCID: PMC8592868.

[0141] In some embodiments, amplification includes the use of one or more amplification reagents in addition to a chain extending enzyme and the deoxynucleotides used by the chain extending enzyme to synthesize a nascent strand. Different amplification techniques may make use of different amplification aids. For example, bridge amplification, kinetic exclusion amplification, and recombinase polymerase amplification may make use of one or more different amplification reagents. An amplification reagent can facilitate amplicon formation, and in some cases increase the rate of amplicon formation. In addition to the deoxynucleotides and the chain extending enzyme, examples of amplification reagents include, but are not limited to, adenosine triphosphate (ATP), creatine phosphate, a magnesium source, recombinases, single-stranded binding proteins (SSB), helicases, origin binding proteins, exchange factors, energy recycling factors, and molecular crowding agents.

[0142] In some embodiments, amplification includes incubating the amplification site with one or more of adenosine triphosphate (ATP), creatine phosphate, a magnesium source, a recombinase, a single-stranded binding protein (SSB), a helicase, an origin binding protein, an exchange factor, an energy recycling factor, and a molecular crowding agent. In other embodiments, amplification does not include incubating the amplification site with one or more of adenosine triphosphate (ATP), creatine phosphate, a magnesium source, a recombinase, a single-stranded binding protein (SSB), a helicase, an origin binding protein, an exchange factor, an energy recycling factor, and a molecular crowding agent.

[0143] In some embodiments, amplification includes incubating the amplification site with a recombinase. Recombinases can be included in isothermal amplification techniques including , for example, kinetic exclusion amplification and recombinase amplification. In vivo, recombinases play a role in homologous recombination. During amplification, recombinases can pair a primer, such as a surface-bound primer (e.g., a surface oligonucleotide acting as a primer), with a homologous sequence within a double-stranded DNA complex. Example recombinases include UvsX from T4-like bacteriophages, RecA family recombinases, and Rad51 family recombinases. Additional recombinase examples include those disclosed in WO2016054088A1. A recombinase can be from, for example, acinetobacter phage 133, cyanophage P-SSM2, cyanophage PSSM4, cyanophage S-PM2, enterobacteria phage Rb32, enterobacteria phage Rb16, enterobacteria phage Rb69, enterobacteria phage Rb43, enterobacteria phage 49Aeh1, aeromonas phase 655, or derived therefrom. In some embodiments, the recombinase is Rb32 UsvX which is described, for example, in US 8,071,308, US 8,637,253, US 10,093,908, and US 11,339,382. In some embodiments, the recombinase is a mutant of Rb49 UsvX which is described, for example, in US 9,982,244 and US 10,344,269.

[0144] In some embodiments, amplification does not include incubating the amplification site with a recombinase. For example, in some embodiments, amplification is accomplished by bridge amplification without the use of a recombinase.

[0145] In some embodiments, amplification includes incubating the amplification site with a sing-stranded binding protein (SSB). SSBs can be included in isothermal amplification techniques, including for example, kinetic exclusion amplification and recombinase amplification. In some embodiments, amplification includes incubating the amplification site with both a recombinase and an SSB. A mixture of a recombinase and SSB protein is particularly useful as SSB can further facilitate amplification. An example of a SSB is the T4 single-stranded DNA (ssDNA) binding protein gene 32 protein (gp32). Another example of a SSB is Enterobacteria phage Rb69 UvsY. In some embodiments, two or more SSB proteins may be used together. Exemplary formulations for recombinase-facilitated amplification include those sold commercially as TwistAmp kits by TwistDx (Cambridge, UK). Useful amplification reagents and reaction conditions for recombinase-facilitated amplification are set forth in US 5,223,414 and US 7,399,590.

[0146] In some embodiments, amplification does not include incubating the amplification site with an SSB. For example, in some embodiments, amplification is accomplished using bridge amplification without the use of an SSB.

[0147] In some embodiments, amplification includes incubating the amplification site with a helicase. Helicases can facilitate amplicon formation and, in some cases, increase the rate of amplicon formation. Helicases can be included in isothermal amplification techniques including, for example, kinetic exclusion amplification and recombinase amplification. Exemplary formulations for helicase-facilitated amplification include those sold commercially as IsoAmp kits from Biohelix (Beverly, MA). Further, examples of useful formulations that include a helicase protein are described in US 7,399,590 and US 7,829,284.

[0148] In some embodiments, amplification does not include incubating the amplification site with a helicase. For example, in some embodiments, amplification is accomplished by bridge amplification without the use of helicase.

[0149] In some embodiments, amplification includes incubating the amplification site with an energy recycling factor. Energy recycling factors can be included in isothermal amplification techniques including, for example, kinetic exclusion amplification and recombinase amplification. An energy recycling factor is a molecule, such as an enzyme, capable of reversibly donating a high energy phosphoryl bond from ADP to ATP. Various enzyme amplification reagents may use ATP or ADP for initiation and / or for catalyzing transformations. For example, when some recombinases bind to primers, they hydrolyze ATP to form ADP. Inclusion of an energy recycling factor can convert the ADP back into ATP which can be then used by the recombinase. Examples of energy recycling factors include creatine kinases, hexokinase, acetate kinase, arginine kinase, and ATP synthases.

[0150] In some embodiments, amplification does not include incubating the amplification site with an energy recycling factor. For example, in some embodiments, amplification is accomplished by bridge amplification without the use of an energy recycling factor.

[0151] In some embodiments, amplification includes incubating the amplification site with an exchange factor. Exchange factors can be included in isothermal amplification techniques including, for example, kinetic exclusion amplification and recombinase amplification. Exchange factors are recombination mediator proteins that facilitate binding of a recombinase to an oligonucleotide already bound to single stranded binding proteins. As such, recombinases, single stranded binding proteins, and strand-displacing polymerases are often used in conjunction in order to accomplish some types of amplification including, recombinase amplification and kinetic exclusion amplification. Examples of exchange factors include, UvsY(bacteriophage), Orf (bacteriophage), RAD52 (Saccharomyces cerevisiae), BRCA2 (humans), RecF (bacteria), RecO (bacteria), and RecR (bacteria).

[0152] In some embodiments, amplification does not include incubating the amplification site with an exchange factor. For example, in some embodiments, amplification is accomplished by bridge amplification without the use of an exchange factor.

[0153] In some embodiments, amplification includes incubating the amplification site with a molecular crowding agent. Crowding agents can be included in isothermal amplification techniques including, for example, kinetic exclusion amplification and recombinase amplification. The presence of a molecular crowding agent during amplification can be used to aid, for example, isothermal amplification. In some embodiments, the presence of a molecular crowding agent during amplification can be used to aid kinetic exclusion and recombinase polymer amplification. Examples of useful molecular crowding reagents include, but are not limited to, polyethylene glycol (PEG), FICOLL, dextran, and polyvinyl alcohol. Exemplary molecular crowding reagents and formulations are set forth in U.S. Pat. No.7,399,590.

[0154] In some embodiments, amplification does not include incubating the amplification site with a molecular crowding agent. For example, in some embodiments, amplification is accomplished by bridge amplification without the use of a molecular crowding agent.

[0155] One or more amplification reagents may be present in an amplification mixture. An amplification mixture includes one or more amplification reagents and a carrier. As such, in some embodiments, amplifying an oligonucleotide template includes incubating an amplification mixture with the amplification site.

[0156] The rate at which an amplification reaction occurs can be increased by increasing the concentration or amount of one or more of the amplification reagents. For example, the amount or concentration of polymerase, nucleotide triphosphates, primers, recombinase, helicase, SSB, origin binding protein, molecular crowding agent, or any combination thereof can be increased to increase the amplification rate. In some cases, the one or more amplification reagents of an amplification mixture that are increased in amount or concentration (or otherwise manipulated in a method set forth herein) are non-nucleic acid components of the amplification reaction.

[0157] The rate at which an amplification reaction occurs can be increased by increasing the activity of one or more amplification reagents. For example, a cofactor that increases the extension rate of a polymerase can be added to a reaction where the polymerase is in use. In some embodiments, metal cofactors such as magnesium, zinc, or manganese can be added to a polymerase reaction or betaine can be added. In another example, some energy recycling factors often make use of a cofactor or reaction substrate. For example, the energy recycling factor creatine kinase uses creatine as a reaction substrate and ADP or ATP. As such, in some embodiments where creatine kinase is included in an amplification mixture, the amplification mixture also includes a source of creatine, such as, for example, creatine phosphate.

[0158] The temperature of amplification can be varied to increase the monoclonality of the monoclonal cluster. Each polymerase has an active temperature range. When above the active temperature range, the polymerase may become denatured. Below the active temperature range, the polymerase may lose enzymatic activity. Within the active temperature range of a polymerase, the higher temperatures are associated with increased reaction rate and / or increased reaction errors. In contrast, within the active temperature range of a polymerase, lower temperatures are associated with decreased reaction rate and / or decreased reaction errors. As such, polymerases are typically employed at a temperature where the balance between polymerase reaction efficiency and polymerase fidelity is considered optimal. Enzyme manufactures, suppliers, and vendors that include enzymes in kits generally instruct users to employ the enzyme at a temperature predetermined to be the optimal balanced temperature for the specific polymerase. Table 1 shows example polymerases and the optimal amplification temperature provided by New England Biolabs (NEB). Closely related derivatives of a specific polymerase tend to have similar optimal balanced temperatures. For example, as shown in Table 1, homologues of the large fragment of Bst, Bst 2.0 and Bst 3.0 have the same optimal working temperature as the large fragment of Bst. Table 1 Vendor Strand- Vendor Polymerase Reaction displacing (Catalog T i i N ) ) ) )))))))

[0159] When amplifying a template oligonucleotide that includes a repeat region at the optimal amplification temperature of a polymerase, a decrease of monoclonality can be observed. For example, during amplification at optimal amplification temperatures, a polymerase mayadd or remove nucleotides when replicating the repeat region. This error and / or other similar errors can be propagated leading to clusters having a population of template oligonucleotides of similar sequences but of different lengths, particularly in the repeat region. It is thought that repeat regions are prone to inaccurate replication due to increased DNA breathing. DNA breathing is thought to be local conformational changes within the nascent strand-template strand double- stranded oligonucleotide complex resulting in polymerase desynchronization with the template (e.g., see FIG.1).

[0160] The methods of the present disclosure accomplish amplification at a temperature that is below the conventional amplification temperature for the polymerase employed during amplification. A conventional amplification temperature is the predetermined optimal amplification temperature instructed by a vendor of the polymerase in question. In cases where multiple vendors supply the same polymerase and each vendor instructs a different optimal temperature, the conventional temperature is the average of the optimal temperatures. The use of a temperature below the conventional amplification temperature is thought to decrease the prevalence of DNA breathing during amplification resulting in monoclonal clusters.

[0161] In one or more embodiments, amplification includes incubating an amplification site with a polymerase (e.g., a commercially available polymerase) or of a polymerase having a sequence having 85% or greater, 90% or greater, 95% or greater, or 99% or greater sequence identity to a commercially available polymerase, at a temperature that is lower than the conventional amplification temperature of a polymer by 1 °C or more, 2 °C or more, 3 °C or more, 4 °C or more, 5 °C or more, 6 °C or more, 7 °C or more, 8 °C or more, 10 °C or more, 15 °C or more, or 20 °C or more In one or more embodiments, amplification includes incubating an amplification site with a polymerase (e.g., a commercially available polymerase) at a temperature that is 1 °C to 25 °C, 1 °C to 5 °C, 5 °C to 25 °C, 5 °C to 15 °C, or 5 °C to 10 °C lower than the conventional amplification temperature (e.g., the temperature provided by a vendor) of the polymerase or of a polymerase having 85% or greater, 90% or greater, 95% or greater, or 99% or greater sequence identity to a commercially available polymerase.

[0162] In one or more embodiments, amplification includes incubating an amplification site with a polymerase at a temperature of 15 °C to 70 °C. In some embodiments, amplification includes incubating an amplification site with a polymerase at a temperature of 15 °C or greater, 20 °C or greater, 25 °C or greater, 26 °C or greater, 27 °C or greater, 28 °C or greater, 29 °C or greater, 30 °C or greater, 31 °C or greater, 32 °C or greater, 33 °C or greater, 34 °C or greater, 35 °C or greater, 36 °C or greater, 37 °C or greater, 38 °C or greater, 39 °C or greater, 40 °C or greater, 41 °C or greater, 42 °C or greater, 43 °C or greater, 44 °C or greater, 45 °C or greater, 46 °C or greater, 47 °C or greater, 48 °C or greater, 49 °C or greater, 50 °C or greater, 55 °C or greater, 60 °C or greater, or 65 °C or greater up to 70 °C. In some embodiments, amplification includes incubating an amplification site with a polymerase at a temperature of 70 °C or less, 65 °C or less, 60 °C or less, 55 °C or less, 50 °C or less, 49 °C or less, 48 °C or less, 47 °C or less, 46 °C or less, 45 °C or less, 44 °C or less, 43 °C or less, 42 °C or less, 41 °C or less, 40 °C or less, 39 °C or less, 38 °C or less, 37 °C or less, 36 °C or less, 35 °C or less, 34 °C or less, 33 °C or less, 32 °C or less, 31°C or less, 30 °C or less, 29 °C or less, 28 °C or less, 27 °C or less, 26 °C or less, 25 °C or less, 24 °C or less, 23 °C or less, 22 °C or less, or 21 °C or less down to 20 °C.

[0163] In some embodiments, amplification includes incubating a polymerase with the amplification site at a temperature of 15 °C to 40 °C, 15 °C to 35 °C, 20 °C to 25 °C, 15 °C to 20 °C, 20 °C to 29 °C, 20 °C to 28 °C, 20 °C to 27 °C, 20 °C to 26 °C, 20 °C to 25 °C, 25 °C to 30 °C, 26 °C to 30 °C, 27 °C to 30°C, 28 °C to 30 °C, or 29 °C to 30 °C, 30 °C to 40 °C, 31 °C to 40°C, or 35 °C to 40°C.

[0164] In some embodiments, amplification includes incubating a strand displacing polymerase with the amplification site at a temperature of 15 °C to 40 °C, 15 °C to 35 °C, 20 °C to 25 °C, 15 °C to 20 °C, 20 °C to 29 °C, 20 °C to 28 °C, 20 °C to 27 °C, 20 °C to 26 °C, 20 °C to 25 °C, 25 °C to 30 °C, 26 °C to 30 °C, 27 °C to 30°C, 28 °C to 30 °C, 29 °C to 30 °C, 30 °C to 40 °C, 31 °C to 40°C, 35 °C to 40°C, 20 °C to 35°C, 25 °C to 35°C, or 30 °C to 35 °C. In one or more embodiments, amplification includes incubating a strand displacing polymerase with the amplification site at a temperature of 20 °C to 35°C. In one or more embodiments, amplification includes incubating a strand displacing polymerase with the amplification site at a temperature of 25 °C to 35°C. In one or more embodiments, amplification includes incubating a strand displacing polymerase with the amplification site at a temperature of 25 °C to 35°C. In one or more embodiments, amplification includes incubating a strand displacing polymerase with the amplification site at a temperature of 30 °C to 35°C. In one or more embodiments, amplification includes incubating a strand displacing polymerase with the amplification site at a temperature of 20 °C to 30°C. In some embodiments, amplification includes incubating a chain extending enzyme (e.g., a strand displacing polymerase) with the amplification site at a temperature of 20 °C to 35°C, 25 °C to 35°C, 30 °C to 35°C, 20 °C to 30°C, or 20 °C to 33°C for 5 minutes or longer, 10 minutes or longer, or 15 minutes or longer. In some such embodiments, amplification is recombinase polymerase amplification and / or kinetic exclusion amplification (see, for example FIG.6B for an example of kinetic exclusion amplification). In some embodiments, the strand displacing polymerase comprises the large fragment of the Bsu polymerase, the large fragment of the Bst polymerase, the full length Bst polymerase, the Phi29 polymerase, or a polymerase comprising a sequence having 85% or greater, 90% or greater, 95% or greater, or 99% or greater sequence identity thereto.

[0165] Aspect A1(b1) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 20 °C to 30 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C for 15 minutes or longer.

[0166] Aspect A1(c) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 25 °C to 35 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 25 °C to 35 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 25 °C to 35 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 25 °C to 35 °C for 11 minutes or longer.

[0167] Aspect A1(d) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 30 °C to 35 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 35 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 35 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 35 °C for 15 minutes or longer.

[0168] Aspect A1(e) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 20 °C to 33 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 15 minutes or longer.

[0169] Aspect A1(f) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 30 °C to 33 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 33 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 33 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 33 °C for 15 minutes or longer.

[0170] In some embodiments, amplification includes incubating a polymerase with the amplification site at a temperature of 30 °C to 50 °C, 35 °C to 45 °C, 36 °C to 45 °C, 37 °C to 45 °C, 38 °C to 45 °C, 39 °C to 45 °C, 40 °C to 45 °C, 41 °C to 45 °C, 42 °C to 45 °C, 43 °C to 45 °C, 44 to 45 °C, 35 °C to 44 °C, 35 °C to 43 °C, 35 °C to 42 °C, 35 °C to 41 °C, 35 °C to 40 °C, 35 °C to 39 °C, 35 °C to 38 °C, 35 °C to 37 °C, or 35 °C to 36 °C.

[0171] In some embodiments, amplification includes incubating a non-strand displacing polymerase with the amplification site at a temperature of 30 °C to 50 °C, 35 °C to 45 °C, 36 °C to 45 °C, 37 °C to 45 °C, 38 °C to 45 °C, 39 °C to 45 °C, 40 °C to 45 °C, 41 °C to 45 °C, 42 °C to 45 °C, 43 °C to 45 °C, 44 to 45 °C, 35 °C to 44 °C, 35 °C to 43 °C, 35 °C to 42 °C, 35 °C to 41 °C, 35 °C to 40 °C, 35 °C to 39 °C, 35 °C to 38 °C, 35 °C to 37 °C, or 35 °C to 36 °C. In some such embodiment, amplification is bridge amplification. In some embodiments, amplification includes incubating a non-strand displacing polymerase with the amplification site at a temperature of 35 °C to 50 °C. In some embodiments, amplification includes incubating a non-strand displacing polymerase with the amplification site at a temperature of 35 °C to 45 °C. In some embodiments, amplification includes incubating a non-strand displacing polymerase with the amplification site at a temperature of 35 °C to 50 °C or 35 °C to 45 °C for 5 minutes or longer, 10 minutes or longer, or 15 minutes or longer. In some embodiments, amplification does not include the use of one or more of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, and an energy recycling factor In some embodiments, the non-strand displacing polymers comprises T4 DNA polymerase, T7 DNA polymerase, Klenow polymerase, Taq polymerase, or a polymerase comprising a sequence having 85% or greater, 90% or greater, 95% or greater, or 99% or greater sequence identity thereto.

[0172] In some embodiments, amplification includes incubating a polymerase with an amplification site at a first temperature for a first incubation time and a second incubation temperature for a second incubation time. In some such embodiment, amplification is isothermal in that the first temperature and the second temperature are not configured to promote dehybridization of an at least partially double-stranded oligonucleotide complex. Additional incubation temperatures and incubation times may also be included in amplification.

[0173] The first and second amplification temperature may each independently be any amplification temperature or range of amplification temperatures disclosed herein. The first and second amplification times may each independently be 0.25 hours or greater, 0.5 hours or greater, 0.75 hours or greater, 1 hour or greater, 1.5 hours or greater, 2 hours or greater, 2.5 hours or greater, 3 hours or greater, 3.5 hours or greater, 4 hours or greater, 4.5 hours or greater, 5 hours or greater, 6 hours or greater, 7 hours or greater, 8 hours or greater, 9 hours or greater, 10 hours or greater, 11 hours or greater, or 12 hours or greater. The first and second amplification times may each independently be 24 hours or less, 12 hours or less, 10 hours or less, 9 hours or less, 8 hours or less, 7 hours or less, 6 hours or less, 5 hours or less, 4.5 hours or less, 4.0 hours or less, 3.5 hours or less, 3.0 hours or less, 2.5 hours or less, 2 hours or less, 1.5 hours or less, 1 hour or less, 0.75 hours or less, or 0.5 hours or less.

[0174] In some embodiments, the first amplification temperature is lower than the second amplification temperature. For example, in some embodiments, the first amplification temperature is 20 °C to 30 °C, such as 20 °C to 28 °C or 22 °C to 26 °C, and the second amplification temperature is 31 °C to 40 °C, such as 15 °C to 40 °C, 35 °C to 40°C. In some embodiments, the first amplification temperature is 25 °C to 35 °C, such as 30 °C to 35 °C, and the second amplification temperature is 35 °C to 40 °C.

[0175] In some embodiments, the first amplification temperature is 20 °C to 30°C such as 24 °C to 28 °C and the second amplification temperature is 30°C to 35 °C such as 31°C to 34 °C. In some such embodiments, the first amplification time is 2 hour to 7 hours such as 3 hours to 5 hours and the second amplification time is 0.25 hours to 2 hour such as 0.25 hours to 1 hour or 0.25 hours to 0.75 hours.

[0176] In some embodiments, the first amplification time is longer than the second amplification time. For example, in some embodiments, the first amplification time is 1 hour to 5 hours, such as 1 hour to 4 hours, or 2 hours to 3 hour and the second amplification time is less than 1 hour.

[0177] In some embodiments, the first amplification temperature is lower than the second amplification temperature and the first amplification time is longer than the second amplification time.

[0178] In some embodiments, amplification includes incubating a polymerase with an amplification site at a first temperature for a first incubation time and a final incubation temperature for a final incubation time. In some such embodiment, amplification is isothermal in that the first temperature and the final temperature are not configured to promote dehybridization of an at least partially double-stranded oligonucleotide complex.

[0179] The first and final amplification temperatures may each independently be any amplification temperature or range of amplification temperatures disclosed herein. In some embodiments, the first and final amplification times may each independently be 5 minutes to120 minutes. For example, in some embodiments, the first and final amplification times may each independently be 5 minutes or greater, 10 minutes or greater, 15 minutes or greater, 20 minutes or greater, 25 minutes or greater, 30 minutes or greater, 35 minutes or greater, 40 minutes or greater, 45 minutes or greater, 50 minutes or greater, 55 minutes or greater, 60 minutes or greater, 70 minutes or greater, 80 minutes or greater, 90 minutes or greater, 100 minutes or greater, or 110 minutes or greater. In some embodiments, the first and final amplification times may each independently be 120 minutes or less, 110 minutes or less, 100 minutes or less, 90 minutes or less, 80 minutes or less, 70 minutes or less, 60 minutes or less, 55 minutes or less, 50 minutes or less, 45 minutes or less, 40 minutes or less, 35 minutes or less, 30 minutes or less, 25 minutes or less, 20 minutes or less, 15 minutes or less, or 10 minutes or less. In some embodiments, the first and final amplification times may each independently 5 minutes to 60 minutes, 10 minutes to 60 minutes, 20 minutes to 60 minutes, 20 minutes to 50 minutes, or 20 minutes to 40 minutes. In some embodiments, the first and final amplification times may each independently 10 minutes to 60 minutes. In some embodiments, the first and final amplification times may each independently 15 minutes to 50 minutes. In some embodiments, the first and final amplification times may each independently 15 minutes to 45 minutes.

[0180] In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 30 °C to 55 °C. In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 35 °C to 55 °C. In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 35 °C to 45 °C. In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 40 °C to 50 °C. In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 42 °C to 50 °C. In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 38 °C to 45 °C. In one or more embodiments where the first amplification temperature is 20 °C to 35 °C, the final amplification temperature can be 38 °C to 42 °C. In one or more such embodiments, amplification is accomplished by kinetic exclusion amplification.

[0181] In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 30 °C to 55 °C. In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 35 °C to 55 °C. In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 35 °C to 45 °C. In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 40 °C to 50 °C. In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 42 °C to 50 °C. In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 38 °C to 45 °C. In one or more embodiments where the first amplification temperature is 25 °C to 35 °C, the final amplification temperature can be 38 °C to 42 °C. In one or more such embodiments, amplification is accomplished by kinetic exclusion amplification.

[0182] In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 30 °C to 55 °C. In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 35 °C to 55 °C. In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 35 °C to 45 °C. In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 40 °C to 50 °C. In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 42 °C to 50 °C. In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 38 °C to 45 °C. In one or more embodiments where the first amplification temperature is 20 °C to 30 °C, the final amplification temperature can be 38 °C to 42 °C. In one or more such embodiments, amplification is accomplished by kinetic exclusion amplification.

[0183] In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 30 °C to 55 °C. In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 35 °C to 55 °C. In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 35 °C to 45 °C. In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 40 °C to 50 °C. In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 42 °C to 50 °C. In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 38 °C to 45 °C. In one or more embodiments where the first amplification temperature is 30 °C to 35 °C, the final amplification temperature can be 38 °C to 42 °C. In one or more such embodiments, amplification is accomplished by kinetic exclusion amplification.

[0184] In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 35 °C to 55 °C. In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 40 °C to 52 °C. In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 42 °C to 52 °C. In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 45 °C to 52 °C. In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 45 °C to 50 °C. In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 48 °C to 52 °C. In one or more embodiments where the first amplification temperature is 35 °C to 45 °C, the final amplification temperature can be 48 °C to 50 °C.

[0185] In one or more embodiments, amplifying can further include sequentially incubating the chain extending enzyme at one or more additional amplification temperatures in addition to the first amplification temperature and the final amplification temperature. Each additional amplification temperature can be higher (hotter) than any previous amplification temperature and lower (colder) than the final amplification temperature. For example, amplifying can include incubating a chain extending enzyme at a first amplification temperature (e.g., 20 °C to 35 °C or 35 °C to 45 °C), followed by incubating the chain extending enzyme at increasingly elevated amplification temperatures, and finally incubating the chain extending enzyme at a final amplification temperature. The final amplification temperature can be the highest of any of the amplification temperatures.

[0186] The number of additional amplification temperatures can vary. In some embodiments, amplifying can include sequentially incubating the chain extending enzyme 1 to 20 additional amplification temperatures. For example, in some embodiments, amplifying can include sequentially incubating the chain extending enzyme at 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, or 19 or more additional amplification temperatures. In some embodiments, amplifying can include sequentially incubating the chain extending enzyme at 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, or 2 or fewer additional amplification temperatures. In some embodiments, amplifying can include sequentially incubating the chain extending enzyme at 1 to 15 additional amplification temperatures. In some embodiments, amplifying can include sequentially incubating the chain extending enzyme at 4 to 12 additional amplification temperatures. In some embodiments, amplifying can include sequentially incubating the chain extending enzyme at 5 to 10 additional amplification temperatures. In some embodiments, amplifying can include sequentially incubating the chain extending enzyme at 7 to 9 additional amplification temperatures.

[0187] In some embodiments, amplification includes incubating a polymerase with an amplification site at three or more different amplification temperatures. In some embodiments, amplification includes incubating a polymerase with an amplification site at 3 to 20 different temperatures. In some embodiments, amplification includes incubating a polymerase with an amplification site at 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, or 19 or more different temperatures. In some embodiments, amplification includes incubating a polymerase with an amplification site at 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, or 4 or less different temperatures.

[0188] The difference in temperature between each of the additional amplification temperatures can vary. Each additional amplification temperature can be, independently, higher than the previous amplification temperature by 1 °C to 10 °C. For example, a chain extending enzyme can be incubated at first additional amplification temperature followed by incubation at a second additional amplification temperature that is 1 °C to 10 °C higher than the first additional amplification temperature. The difference between any two additional amplification temperatures sequentially applied and any other two additional amplification temperatures applied can vary. For example, a chain extending enzyme can be first incubated at first additional amplification temperature, the incubated at a second additional amplification temperature that is 1 °C to 10 °C higher than the first additional amplification temperature, and then incubated at a third additional amplification temperature that is 1 °C to 10 °C higher than the second additional amplification temperature.

[0189] In some embodiments, each additional amplification temperature can be, independently, higher than the previous amplification temperature by 1 °C or more, 2 °C or more, 3 °C or more, 4 °C or more, 5 °C or more, 6 °C or more, 7 °C or more, 8 °C or more, or 9 °C or more. In some embodiments, each additional amplification temperature can be, independently, higher than the previous amplification temperature by 10 °C or less, 9 °C or less, 8 °C or less, 7 °C or less, 6 °C or less, 5 °C or less, 4 °C or less, 3 °C or less, or 2 °C or less. In some embodiments, each additional amplification temperature can be, independently, higher than the previous amplification temperature by 1 °C to 5 °C. In some embodiments, each additional amplification temperature can be, independently, higher than the previous amplification temperature by 1 °C to 4 °C. In some embodiments, each additional amplification temperature can be, independently, higher than the previous amplification temperature by 2 °C to 4 °C.

[0190] In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is, independently, 5 minutes to120 minutes. The amplification times for the additional amplification temperatures may be the same or vary. In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is, independently, 5 minutes or greater, 10 minutes or greater, 15 minutes or greater, 20 minutes or greater, 25 minutes or greater, 30 minutes or greater, 35 minutes or greater, 40 minutes or greater, 45 minutes or greater, 50 minutes or greater, 55 minutes or greater, 60 minutes or greater, 70 minutes or greater, 80 minutes or greater, 90 minutes or greater, 100 minutes or greater, or 110 minutes or greater In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is, independently, 120 minutes or less, 110 minutes or less, 100 minutes or less, 90 minutes or less, 80 minutes or less, 70 minutes or less, 60 minutes or less, 55 minutes or less, 50 minutes or less, 45 minutes or less, 40 minutes or less, 35 minutes or less, 30 minutes or less, 25 minutes or less, 20 minutes or less, 15 minutes or less, or 10 minutes or less. In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is, independently, 5 minutes to 60 minutes, 10 minutes to 60 minutes, 20 minutes to 60 minutes, 20 minutes to 50 minutes, or 20 minutes to 40 minutes. In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is independently 10 minutes to 60 minutes. In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is independently 10 minutes to 50 minutes. In some embodiments, the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is independently 15 minutes to 45 minutes.

[0191] The total amplification time, that is, the time to complete the amplifying step of FIGS.3A-3C or 4A-4D can be, for example, 0.2 hours to 6 hours. The total amplifying time can be the sum of the first amplification time of the first amplification temperature, the final amplification time of the final amplification temperature, and the amplification times of any additional amplification temperatures. In some embodiments, the total amplifying time is 0.2 or greater, 0.4 hours or greater, 0.6 hours or greater, 0.8 hours or greater, 0.9 hours or greater, 1 hour or greater, 1.2 hours or greater, 1.4 hours or greater, 1.6 hours or greater, 1.8 hours or greater, 2.0 hours or greater, 2.2 hours or greater, 2.4 hours or greater, 2.6 hours or greater, 2.8 hours or greater, 3.0 hours or greater, 3.2 hours or greater, 3.4 hours or greater, 3.6 hours or greater, 3.8 hours or greater, 4.0 hours or greater, 4.2 hours or greater, 4.4 hours or greater, 4.6 hours or greater, 4.8 hours or greater, 5.0 hours or greater, 5.2 hours or greater, 5.4 hours or greater, 5.6 hours or greater, or 5.8 hours or greater. In some embodiments, the total amplifying time is 6.0 hours or less, 5.8 hours or less, 5.6 hours or less, 5.4 hours or less, 5.2 hours or less, 5.0 hours or less, 4.8 hours or less, 4.6 hours or less, 4.4 hours of less, 4.2 hours or less, 4.0 hours or less, 3.8 hours or less, 3.6 hours or less, 3.4 hours or less, 3.2 hours or less, 3.0 hours or less, 2.8 hours or less, 2.6 hours or less, 2.4 hours or less, 2.2 hours or less, 2.0 hours or less, 1.8 hours or less, 1.6 hours or less, 1.4 hours or less, 1.2 hours or less, 1.0 hours or less, 0.8 hours or less, 0.6 hours or less, or 0.4 hours or less. In some embodiments, the total amplifying time is 2 hours to 6 hours. In some embodiments, the total amplifying time is 3 hours to 6 hours. In some embodiments, the total amplifying time is 2 hours to 5 hours. In some embodiments, the total amplifying time is 3 hours to 5 hours. In some embodiments, the total amplifying time is 3 hours to 4 hours. In some embodiments, the total amplifying time is 1 hours to 5 hours.

[0192] In one or more embodiments, the additional amplification temperatures are a temperature gradient over a gradient time. In one or more embodiments, the gradient time is the total amplifying time. In one or more embodiments, the gradient time is 0.2 hours to 6 hours. In one or more embodiments, the gradient time is 1 hour to 6 hours. In one or more embodiments, the gradient time is 0.2 hours to 6 hours. In one or more embodiments, the gradient time is 1 hour to 5 hours. In one or more embodiments, the gradient time is 0.2 hours to 6 hours. In one or more embodiments, the gradient time is 1 hour to 4 hours. In one or more embodiments, the gradient time is 0.2 hours to 3 hours. In one or more embodiments, the gradient time is 1 hour to 2 hours. In one or more embodiments, the gradient time is 2 hours to 3 hours. In one or more embodiments, temperature gradient can span 5 °C to 20 °C over the gradient time. In one or more embodiments, temperature gradient can span 5 °C to 15 °C over the gradient time. In one or more embodiments, temperature gradient can span 5 °C to 10 °C over the gradient time.

[0193] In some embodiments, the monoclonal cluster can be, but need not be, entirely clonal. Rather, for some applications, an individual amplification site can be predominantly populated with amplicons from an template oligonucleotide and can also have a low level of contaminating amplicons from a second template oligonucleotide or from an error in amplification of the first template oligonucleotide. An amplification site can have a low level of contaminating amplicons so long as the level of contamination does not have an unacceptable impact on a subsequent use of the amplification site. For example, when an amplification site is to be used in a detection application, an acceptable level of contamination would be a level that does not impact signal to noise or resolution of the detection technique in an unacceptable way. Accordingly, apparent clonality will generally be relevant to a particular use or application of an amplification site made by the methods set forth herein. Exemplary levels of contamination that can be acceptable at an individual amplification site for particular applications include, but are not limited to, at most 0.1%, 0.5%, 1%, 5%, 10% or 25% contaminating amplicons.

[0194] Additional description of amplification reactions, conditions and components are set forth in detail in the disclosure of U.S. Patent No.7,670,810.

[0195] In some embodiments, monoclonal cluster generation can be accomplished using commercially available machines such as the cBot (Illumina, San Diego, CA) and certain sequencing instruments such as iSeq 100, MiniSeq, NextSeq 550 Series, NextSeq 1000 & 2000, NovaSeq 6000 Series, and NovaSeq X Series (Illumina, San Diego, CA).

[0196] Returning to FIGS.3A, 4A, and 5, methods 700A and 700B may further include removing from the surface the first population of oligonucleotides or the second population of oligonucleotides (step 880A and 880B). For example, the first population of oligonucleotides BB can be removed from the surface S. After removal of the first population of oligonucleotides BB, the amplification site AS includes the second population of oligonucleotides BB´. Removal of the first population of oligonucleotide or the second population of oligonucleotides may be done in preparation for sequencing or as a part of the sequencing workflow (e.g., see step 800 of FIG. 2).

[0197] The process of removing all or a portion of a population of oligonucleotides (e.g., the first population of oligonucleotides or the second population of oligonucleotides) from the surface can be referred to as "linearization." There are various linearization techniques, including, but not limited, to enzymatic cleavage (e.g., uracil DNA glycosylase (UDG) and endonuclease VII, oxoguanine glycosylase), chemical cleavage (e.g., palladium reagents and Pd linearization, nickel reagents and Ni Pd linearization), and photo-chemical cleavage. Non- limiting examples of linearization methods are disclosed in US Serial No.18 / 473,971, filed Sep. 25, 2023; PCT Publication No. WO 2019 / 222264; US Published Patent Application No. 2019 / 0352327; WO 2007 / 010251; US Patent Application Publication No.2009 / 0088327; and in US. Patent Publication No.2009 / 0118128, which are incorporated by reference in their entireties.

[0198] Post-linearization, the remaining population of oligonucleotide on the surface (e.g., the first population of oligonucleotides BB in FIG.5) may be sequenced. As such, in some embodiments, methods 700A (FIG.3A) and 700B (FIG.3B) further include sequencing the first population of oligonucleotides or the second population of oligonucleotides that remain bound to the surface (steps 890A and 890B).

[0199] Sequencing can be accomplished by a variety of techniques. In some embodiments, sequencing includes sequencing by synthesis (SBS). SBS techniques include, but are not limited to, ISEQ sequencing systems, the MINISEQ sequencing systems, the MISEQ sequencing systems, and the NEXTSEQ sequencing systems (Illumina Inc., San Diego, CA), and the True Single Molecule Sequencing (tSMS)™ systems (Helicos BioSciences Corporation, Cambridge, MA). In the SBS technique, a number of sequencing by synthesis reactions are used to elucidate the identity of a plurality of bases at target positions within a template oligonucleotide. In some embodiments that include SBS, the reactions rely on the use of a template oligonucleotide sequence having at least two domains; a first domain to which a sequencing primer will hybridize; and an adjacent second domain, for which sequence information is desired. The two domains may be separated by a intermediate sequence or contiguous with each other.

[0200] Generally, in SBS an initial sequencing complex is formed where a primer is hybridized to a portion of a template oligonucleotide. After formation of an initial sequencing complex, a chain extension enzyme (e.g., polymerase) may be used to add deoxynucleotide triphosphates (dNTPs) to the sequencing primer, and each addition of dNTPs may be read to determine the identity of the added dNTP. This may proceed for many cycles. The sequence for which the nucleotide identity is determined is generally termed a “read.” Read lengths may be greater than 5, greater than 10, greater than 20, greater than 50, greater than 100, greater than 200, greater than 300, or greater than 400 nucleotides in length.

[0201] In some SBS embodiments, an oligonucleotide strand hybridizes with a sequencing primer and is incubated in the presence of a polymerase and one or more labeled nucleotides that includes a 3′ blocking group. Examples of labeled nucleotides that include a blocking group can are known and can be found, for example, in WO 2004 / 018497, US Patent No.11,293,061 and U.S. Published Patent Application No.2022 / 0396832. The sequencing primer is extended such that the labeled nucleotide is incorporated. The presence of the blocking group permits only one round of incorporation, that is, the incorporation of a single nucleotide. The presence of the label permits identification of the incorporated nucleotide. In some embodiments, the label is a fluorescent label. A plurality of homogenous single nucleotide bases can be added during each cycle, such as used in the True Single Molecule Sequencing (tSMS)™ systems (Helicos BioSciences Corporation, Cambridge, MA). Alternatively, all four nucleotide bases can be added during each cycle simultaneously, such as used in the ISEQ sequencing systems, the MINISEQ sequencing systems, the MISEQ sequencing systems, and the NEXTSEQ sequencing systems (Illumina Inc., San Diego, CA), particularly when each base is associated with a distinguishable label. After identifying the incorporated nucleotide by its corresponding label, both the label and the blocking group can be removed, thereby allowing a subsequent round of incorporation and identification. Determining the identity of the added nucleotide base includes, in some embodiments, repeated exposure of the newly added labeled bases to a light source that can induce a detectable emission due to the addition of a specific nucleotide. In some embodiments, the label is a fluorescent label.

[0202] In some embodiments, the nucleotides used in SBS do not include a label, for example when pyrosequencing is used. Pyrosequencing detects the release of inorganic pyrophosphate (PPi) as particular nucleotides are incorporated into a nascent nucleic acid strand (Ronaghi, et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res.11(1), 3- 11 (2001); Ronaghi et al. Science 281(5375), 363 (1998); U.S. Pat. No.6,210,891; U.S. Pat. No. 6,258,568 and U.S. Pat. No.6,274,320). In pyrosequencing, released PPi can be detected by being immediately converted to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP generated can be detected via luciferase-produced photons. Thus, the sequencing reaction can be monitored via a luminescence detection system. Excitation radiation sources used for fluorescence-based detection systems are not necessary for pyrosequencing procedures. Because the incorporation of any dNTP into a growing chain releases pyrophosphate, the four dNTP bases must be added to the system in separate steps. Useful fluidic systems, detectors, and procedures that can be used for application of pyrosequencing to arrays of the present disclosure are described, for example, in WO2012058096A1; US Pat. Pub. No.2005 / 0191698 A1; U.S. Pat. No.7,595,883; and U.S. Pat. No.7,244,559.

[0203] Sequencing-by-ligation SBS reactions such as those described, for example, in Shendure et al. Science 309:1728-1732 (2005); U.S. Pat. No.5,599,675; and U.S. Pat. No. 5,750,341, may also be used. Some embodiments can include sequencing-by-hybridization procedures as described, for example, in Bains et al., Journal of Theoretical Biology 135(3), 303- 7 (1988); Drmanac et al., Nature Biotechnology 16, 54-58 (1998); Fodor et al., Science 251(4995), 767-773 (1995); and WO 1989 / 10977. In both sequencing-by-ligation and sequencing-by-hybridization procedures, oligonucleotides that are present at sites of an array are subjected to repeated cycles of oligonucleotide delivery and detection. Fluidic systems for SBS methods can be readily adapted for delivery of reagents for sequencing-by-ligation or sequencing-by-hybridization procedures. Typically, the oligonucleotides are fluorescently labeled and can be detected using fluorescence detectors similar to those described with regard to SBS procedures herein or in references cited herein.

[0204] Some embodiments can use methods involving the real-time monitoring of DNA polymerase activity. For example, nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and gamma-phosphate-labeled nucleotides, or with zeromode waveguides (ZMWs). Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al. Science 299, 682-686 (2003); Lundquist et al. Opt. Lett.33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008).

[0205] Some SBS embodiments include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are commercially available from Ion Torrent (Guilford, Conn., a Life Technologies subsidiary) or sequencing methods and systems described in US Pat. No.8,262,900; US Pat. No.7,948,015; US Pat. Pub.2010 / 0137143 A1; or US Pat. No.8,349,167.

[0206] The sequencing methods disclosed herein are particularly useful when used in conjunction with SBS. In addition, the sequencing methods described herein may be particularly useful for sequencing from an array of clusters of oligonucleotides, where multiple sequences can be read simultaneously from multiple clusters on the array since each nucleotide at each position can be identified based on its identifiable label. Exemplary methods are described in US Pat. No.7,754,429; US Pat. No.7,785,796; and US Pat. No.7,771,973, each of which is incorporated herein by reference.

[0207] In some embodiments, where a template oligonucleotide includes one or more index sequences, the index sequences may be sequenced using SBS.

[0208] In some embodiments, SBS involves several rounds of incorporation of nucleotides for which the identity of the incorporated nucleotides are not determined. Such rounds of incorporation may be referred to as “dark cycles.” Dark cycling involves the sequential incorporation of nucleotides containing a 5′ blocking group and subsequent blocking group removal. Dark cycles may be used to skip the reading of index sequences, universal sequences, and / or any other sequence where the identity is not desired to be determined. Each cycle of a dark cycle includes the incorporation of a nucleotide. Any suitable number of dark cycles of incorporation may be performed to effectively reach the portion of the oligonucleotide template where determining the nucleotide sequence is desired. For example, 2 to 150 dark incorporation cycles may be performed, such as 3 to 100, 5 to 50, or 6 to 25 dark cycles. The sequence of a template oligonucleotide to which the extended sequencing primer is complementary during the dark cycles is preferably known. Once the appropriate number of dark cycles of incorporation are performed, SBS (determining the identity of the nucleotides incorporated in subsequent cycles) may be performed.

[0209] In some embodiments, sequencing includes "paired-end" or "pairwise" sequencing (U.S. Pat. No.7,754,429 and U.S. Pat. No.8,017,335). Paired-end sequencing is a multi-step process that allows the determination of two "reads" of a target oligonucleotide sequence by sequencing a template oligonucleotide containing the target oligonucleotide sequence and sequencing a template oligonucleotide having the complementary sequence of the target oligonucleotide. The advantage of the paired-end approach is that there is significantly more information to be gained from sequencing bases from two complementary strands than from sequencing the same number of bases from each of two independent strands in a random fashion. With the use of appropriate software tools for the assembly of sequence information, it is possible to use the knowledge that the "paired-end" sequences are not completely random, but are known to occur on a single population of oligonucleotides in a monoclonal cluster, and are therefore linked or paired in the genome. This information greatly aids the assembly of whole genome sequences into a consensus sequence.

[0210] Paired-end sequencing of a monoclonal cluster having a first and a second population of oligonucleotides that are complementary to each other generally includes: (i) removing the first population or the second population of oligonucleotides from the surface (step 880A of FIG.3A and 880B of FIG.4A); (ii) sequencing the population of oligonucleotides remaining on the surface (step 890A and 890B); (iii) resynthesizing at least a portion of the population of oligonucleotides removed from the surface using the oligonucleotides of the sequenced population as templates to form a third population of oligonucleotides complementary to the sequenced population; (iv) removing the sequenced population from the surface; (v) and sequencing the third population of oligonucleotides. As such, in some embodiments, methods 700A and 700B further include synthesizing a third population of oligonucleotides using the oligonucleotides of the sequenced population as templates, removing the sequenced population of oligonucleotides from the surface, and sequencing the third population of oligonucleotides.

[0211] Synthesizing the third population of oligonucleotides includes amplifying one or more of the oligonucleotides of the sequenced population on the surface. Amplification may be accomplished via any technique described herein. For example, the amplification may be accomplished by isothermal amplification. In some embodiments, amplification may be accomplished by bridge amplification or exclusion amplification. In some embodiments, the amplification may be accomplished by step 710A or step 710B of methods 700A and 700B, respectively.

[0212] Returning to FIG.5, an example schematic for the workflow of paired end sequencing is shown. Following the sequencing of the population of oligonucleotides on the surface (the first population of oligonucleotides BB in FIG.5), a second amplification may occur. In the second amplification, a third population of oligonucleotides B´´ is generated. The third population of oligonucleotides B´´ includes oligonucleotides having a sequence complementary to the second population of oligonucleotides B´ including a complementary repeat region sequence (RR´´). The third population of oligonucleotides B´´ includes oligonucleotides having at least a portion of the sequence of the first population of oligonucleotides BB that was previously removed from the surface S. The production of the third population of the oligonucleotides is called resynthesis or resynthesis amplification, for example, resynthesis of the first population of oligonucleotides previously removed from the surface.

[0213] The resynthesis amplification may be accomplished via any amplification method disclosed herein. For example, resynthesis amplification may be accomplished by isothermal amplification. In some embodiments, resynthesis amplification may be accomplished by bridge amplification or exclusion amplification. In some embodiments, resynthesis amplification may be accomplished by step 710A or step 710B of methods 700A and 700B, respectively.

[0214] FIGS.3B, 3C, and 3D, are flow charts illustrating embodiments consistent with method 700A of the present disclosure. The steps of FIGS.3B, 3C, and 3D illustrate optional steps consistent with embodiments of step 710A of method 700A.

[0215] Beginning with FIG.3B, in some embodiments of method 700A, step 710A further includes providing a surface-bound oligonucleotide complex (step 720A). The surface-bound oligonucleotide complex includes a first surface-bound primer having a 5´ end bound to the surface and a free 3´ end. The surface-bound oligonucleotide complex includes the template oligonucleotide having a free 3´ end. The initial template oligonucleotide can be referred to as the first template oligonucleotide. The template oligonucleotide is hybridized to the surface- bound primer proximate to the free 3´ end of the template oligonucleotide. The method further includes extending the first surface-bound primer from its free 3´ end using the template oligonucleotide as a template to produce a second oligonucleotide (step 730A). The second oligonucleotide can be referred to as a second template oligonucleotide. The second population of oligonucleotides includes the second oligonucleotide (second template oligonucleotide). Synthesis of a second oligonucleotide via the steps of FIG.3B can be referred to as first strand synthesis.

[0216] The method steps of FIG.3B can be understood in conjunction with the schematic of FIG.6A. The surface-bound oligonucleotide complex 400 includes a first surface-bound primer 22. The first surface-bound primer 22 is a surface oligonucleotide having a 5´ end bound to the surface 15 and a free 3´ end. The surface-bound oligonucleotide complex 400 includes a the template oligonucleotide 40* (first template oligonucleotide). The template oligonucleotide 40* has free 3´ and 5´ ends. The template oligonucleotide 40* also includes the repeat region 42*. In some embodiments, the template oligonucleotide 40* is the initial template oligonucleotide to be amplified. Proximate to and including the 3´ end, the template oligonucleotide 40* is hybridized to at least a portion of the first surface-bound primer 22.

[0217] In step A of FIG.6A the surface-bound oligonucleotide complex 400 is converted into a surface-bound double-stranded oligonucleotide complex 410. In this step, the surface- bound oligonucleotide complex 400 is incubated with a chain extending enzyme and, optionally, one or more additional amplification reagents. The chain extending enzyme extends the first surface-bound primer 22 from its free 3´ to synthesize a second oligonucleotide 40 (a template oligonucleotide) using the template oligonucleotide 40* as a template. As such, the second oligonucleotide 40 has a sequence that is at least partially complementary to the template oligonucleotide 40* including a complementary repeat region 42. The second oligonucleotide 40 includes the surface-bound primer 22 as they are covalently attached. The template oligonucleotide 40* and the second oligonucleotide 40 are at least partially hybridized. In some embodiments, step A further includes removing the template oligonucleotide 40* from the amplification site, for example, by washing. In other embodiments, the template oligonucleotide 40* and the second oligonucleotide 40 remain bound surface-bound double-stranded oligonucleotide complex..

[0218] Following or simultaneously during first strand synthesis (see FIG.3B), in some embodiments of method 700A, step 710A further includes synthesizing a third oligonucleotide according to the steps of FIG.3C. For example, in one or more embodiments of method 700A, step 710A further includes providing a surface-bound double-stranded oligonucleotide complex (step 740A). The surface-bound double-stranded oligonucleotide complex includes the template oligonucleotide (first template oligonucleotide) and the second oligonucleotide (second template oligonucleotide), the second oligonucleotide bound to the surface on its 3´ end. The surface- bound double-stranded oligonucleotide complex also includes a second surface-bound primer (a surface oligonucleotide) having a 5´ end bound to the surface and a free 3´ end. The template oligonucleotide and the second oligonucleotide are at least partially hybridized. The second oligonucleotide is hybridized to the second surface-bound primer proximate the 3´ end of the second oligonucleotide. The method further includes extending the second surface-bound primer from its free 3´ end using the second oligonucleotide as a template to produce a third oligonucleotide. The third oligonucleotide can be referred to as the third template oligonucleotide. The first population of oligonucleotides includes the third oligonucleotide (step 750A).

[0219] The method steps of FIG.3C can be understood in conjunction with the schematic of FIG.6B. In some embodiments, the surface-bound double-stranded oligonucleotide complex 500 includes the surface-bound double-stranded oligonucleotide complex 410 formed from first strand synthesis (FIG.6A). As such, the surface-bound double-stranded oligonucleotide complex 500 includes the template oligonucleotide 40* (first template oligonucleotide) and the second oligonucleotide 40 (second template oligonucleotide). The template oligonucleotide 40* and the second oligonucleotide 40 are partially hybridized. The template oligonucleotide 40* has free 3´ and 5´ ends. The second oligonucleotide 40 has a free 3´ end and a 5´ end that is bound to the surface. In contrast to the surface-bound double-stranded oligonucleotide complex 410 of resynthesis, the surface-bound double-stranded oligonucleotide complex 500 is immobilized on the surface on both ends forming a bridged structure. The surface-bound double-stranded oligonucleotide complex 500 includes a second surface-bound primer 24. The second surface- bound primer 24 is hybridized to the second oligonucleotide 40 proximate to and at the 3´ end of the second oligonucleotide 40 to form the bridged structure. The second surface-bound primer 24 can displace a portion of the hybridized template oligonucleotide 40* or can be intercalated between a portion of the hybridized template oligonucleotide 40* and the second oligonucleotide 40. To facilitate displacement or intercalation of the second surface-bound primer 24, the method may include the use of single-stranded binding proteins, a recombinase, or both.

[0220] In step B of FIG.6B the surface-bound double-stranded oligonucleotide complex 500 proceeds through an intermediate structure 550 and is converted into a second double-stranded surface-bound oligonucleotide complex 575. The second double-stranded surface-bound oligonucleotide complex 575 includes the second oligonucleotide 40 (second template oligonucleotide) and a third oligonucleotide 40´ (third template oligonucleotide). The second oligonucleotide 40 and the third oligonucleotide 40´ are complementary and are at least partially hybridized in a bridged structure. The third oligonucleotide 40´ includes the second surface- bound primer 24. The second double-stranded surface-bound oligonucleotide complex 575 has both ends immobilized on the surface. The 5´ ends of both the second oligonucleotide 40 and the third oligonucleotide 40´ are bound to the surface.

[0221] During step B of FIG.6B, intermediate structure 550 is formed. Intermediate structure 550 schematically shows the process of extending the second surface-bound primer 24 from its free 3´ end using the second oligonucleotide 40 (second template oligonucleotide) as a template to produce the third oligonucleotide 40´ (step 750A of FIG.3C). During synthesis of the third oligonucleotide 40´, a strand displacing polymerase Pol extends the second surface- bound primer 24 while displacing the impeding template oligonucleotide 40*. The growing nascent third oligonucleotide 40´ remains hybridized to the second oligonucleotide 40. The template oligonucleotide 40* is eventually completely dehybridized from the second oligonucleotide 40. Since the template oligonucleotide 40* is not attached to the surface 15, it can be washed away.

[0222] Following or simultaneously during the synthesis of the second surface-bound double-stranded oligonucleotide complex (see FIG.3C), in some embodiments of method 700A, step 710A further includes synthesizing a plurality of new oligonucleotides where each new oligonucleotide is a part of the first population or the second population (FIG.3D). The new oligonucleotides are template oligonucleotides and can be termed new template oligonucleotides. For example, in one or more embodiments of method 700A, step 710A further includes providing a new surface-bound double-stranded oligonucleotide complex (step 760A). The new surface-bound double-stranded oligonucleotide complex includes an oligonucleotide (a template oligonucleotide) from the first population of oligonucleotides bound to the surface on its 5´ end; an oligonucleotide (a template oligonucleotide) from the second population of oligonucleotides bound to the surface on its 5´ end; and an unincorporated surface-bound primer having a 5´ end bound to the surface and a free 3´ end. An unincorporated surface-bound primer is a surface- bound primer that is not a part of a template oligonucleotide, for example as the 3´ end region or 5´ end region of a template oligonucleotide. Generally, incorporated surface-bound primers have been extended to form a template oligonucleotide. The oligonucleotide from the first population of oligonucleotides and the oligonucleotide from the second population of oligonucleotides are at least partially hybridized. The oligonucleotide from the first population of oligonucleotides or the oligonucleotide from the second population of oligonucleotides is hybridized to the unincorporated surface-bound primer proximate the 3´ end of the oligonucleotide hybridized to the surface-bound primer. The method further includes extending the unincorporated surface- bound primer from its free 3´ end using the oligonucleotide hybridized to the unincorporated surface-bound primer as a template to produce a new oligonucleotide, the first population of oligonucleotides or the second population of oligonucleotides including the new oligonucleotide (step 770A). The method can further include repeating steps 760A and 770A to synthesize at least a portion of the first population and the second population.

[0223] The method steps of FIG.3D can be understood in conjunction with the schematic of FIG.6C. In some embodiments, the new surface-bound double-stranded oligonucleotide complex 600 includes or is the second surface-bound double-stranded oligonucleotide complex (575 from FIG.6B). The new surface-bound double-stranded oligonucleotide complex 600 includes an oligonucleotide (template oligonucleotide) of the first population 40a and an oligonucleotide (template oligonucleotide) of the second population 40a´. The oligonucleotide of the first population 40a and the oligonucleotide of the second population 40a´ are complementary and are at least partially hybridized in a bridged structure. The new surface- bound double-stranded oligonucleotide complex 600 has both ends immobilized on the surface. The 5´ ends of both the oligonucleotide of the first population 40a and the oligonucleotide of the second population 40a´ are bound to the surface. For example, the oligonucleotide of the first population 40a and the oligonucleotide of the second population 40a´ may have previously been synthesized by extending a surface-bound primer. The new surface-bound double-stranded oligonucleotide complex 600 includes an unincorporated surface-bound primer 28. The unincorporated surface-bound primer 28 is hybridized to the oligonucleotide from the first population 40a or the oligonucleotide from the second population 40a´ proximate to and at the 3´ end of the hybridized oligonucleotide to form the bridged structure. In FIG.6C, the unincorporated surface-bound primer 28 is hybridized to the oligonucleotide from the second population 40a´. The unincorporated surface-bound primer 28 is intercalated between a portion of the hybridized oligonucleotides from the first and second populations. To facilitate intercalation of the unincorporated surface-bound primer 28, the method may include the use of single-stranded binding proteins, a recombinase, or both.

[0224] In step C of FIG.6C the unincorporated surface-bound primer 28 is extended from its from its 3´ end using the oligonucleotide hybridized thereto (the oligonucleotide from the second population of oligonucleotides 40a´) as a template to form a new oligonucleotide 40a´´. During synthesis of the new oligonucleotide 40a´´, a strand displacing polymerase Pol extends the unincorporated surface-bound primer 28 while displacing the impeding oligonucleotide strand not hybridized 40a to the unincorporated surface-bound primer 28. The growing nascent new oligonucleotide 40a´´ remains hybridized to the oligonucleotide used as a template. The oligonucleotide that was not hybridized to the unincorporated surface-bound primer 28 (the oligonucleotide from the first population of oligonucleotides 40a) is eventually completely dehybridized from the oligonucleotide that was hybridized to the unincorporated surface-bound primer 28. Completion of step C results in the formation of a surface-bound double-stranded oligonucleotide complex between the new oligonucleotide and the oligonucleotide used as a template during synthesis. Additionally, since the dehybridized oligonucleotide 40a is attached to the surface, completion of step C results in the formation of a surface-bound single strand (e.g., 40a in FIG.6C). The surface-bound double-stranded oligonucleotide complex formed during step C can be used as a new surface-bound double-stranded oligonucleotide complex for the completion of step 775A.

[0225] In some embodiments of method 700B (FIG.4A), step 710B further includes one or more of the method steps of FIG.4B, 4C, and 4D. Starting with FIG.4B, in some embodiments of method 700B, step 710 further includes providing a surface-bound oligonucleotide complex (step 720B). The surface-bound oligonucleotide complex includes a surface-bound primer having a 5´ end bound to the surface and a free 3´ end. The surface-bound oligonucleotide complex also includes the template oligonucleotide having a free 3´ end. The template oligonucleotide is hybridized to the surface-bound primer proximate the free 3´ end of the template oligonucleotide. The method further includes extending the surface-bound primer from its free 3´ end using the template oligonucleotide as a template to produce a second oligonucleotide. The second oligonucleotide is a template oligonucleotide and can be referred toas the second template oligonucleotide. The second oligonucleotide is a part of the second population of oligonucleotides. Synthesis of a second oligonucleotide via the steps of FIG.4B can be called first strand synthesis.

[0226] The method steps of FIG.4B can be understood in conjunction with the schematic of FIG.7A. The surface-bound oligonucleotide complex 100 includes a surface-bound primer 22. The surface-bound primer 22 has a 5´ end bound to the surface 15 and a free 3´ end. The surface- bound oligonucleotide complex 100 includes the template oligonucleotide 30*. The template oligonucleotide 30* has free 3´ and 5´ ends. The template oligonucleotide 30* also includes repeat region 32*. In some embodiments, the template oligonucleotide 30* is the initial template oligonucleotide to be amplified. Proximate to and including the 3´ end, the template oligonucleotide 30* is hybridized to at least apportion of the surface-bound primer 22.

[0227] In step A of FIG.7A the surface-bound oligonucleotide complex 100 is converted into a double-stranded surface-bound oligonucleotide complex 150. In this step, the surface- bound oligonucleotide complex 100 is incubated with a chain extending enzyme and, optionally, one or more additional amplification reagents. The chain extending enzyme extends the surface- bound primer 22 from its free 3´ end to synthesize a second oligonucleotide 30 (second template oligonucleotide) using the template oligonucleotide 30* as a template. As such, the second oligonucleotide 30 has a sequence that is at least partially complementary to the template oligonucleotide 30* including a complementary repeat region 32. The second oligonucleotide includes the surface-bound primer 22 as they are covalently attached. The template oligonucleotide 30* and the second oligonucleotide 30 are at least partially hybridized. In some embodiments, step A further includes removing the template oligonucleotide 30* from the amplification site, for example, by washing. In other embodiments, the template oligonucleotide 30* and the second oligonucleotide 30 remain bound in a double-stranded structure.

[0228] Following or simultaneously during first strand synthesis (see FIG.4B), in some embodiments of method 700B, step 710B further includes synthesizing a third oligonucleotide according to the steps of FIG.4C. The third oligonucleotide is a template oligonucleotide and can be referred to as the third template oligonucleotide. For example, in one or more embodiments of method 700B, step 710B further includes providing a bridged surface-bound oligonucleotide complex (step 740B). The bridged surface-bound oligonucleotide complex includes the second oligonucleotide bound to the surface on its 5´ end and having a free 3´ end. The bridged surface-bound oligonucleotide complex also includes a second surface-bound primer having a 5´ end bound to the surface and a free 3´ end. The second oligonucleotide is hybridized to the second surface-bound primer proximate to the 3´ end of the second oligonucleotide. The method includes extending the second surface-bound primer from the free 3´ ends using the oligonucleotide hybridized to the surface-bound primer as a template to produce at least a portion of the first population of oligonucleotides or the second population of oligonucleotides (step 750B).

[0229] The method steps of FIG.4C can be understood in conjunction with the schematic of FIG.7B. The bridged surface-bound oligonucleotide complex 200 includes the second oligonucleotide 30 synthesized during the steps of FIG.4B. The second oligonucleotide 30 is bound to the surface 15 on its 5´ end and has a free 3´ end. The bridged surface-bound oligonucleotide complex 200 includes a second surface-bound primer 24. The second surface- bound primer 24 has a free 3´ end and a 5´ end that is bound to the surface 15. The second surface-bound primer 24 is hybridized to the second oligonucleotide 30 proximate to and at the 3´ end of the second oligonucleotide 30 to form the bridged structure.

[0230] In step A of FIG.7B, the bridged surface-bound oligonucleotide complex 200 is converted into a surface-bound double-stranded bridged oligonucleotide complex 275. In this step, the bridged surface-bound oligonucleotide complex 200 is incubated with a chain extending enzyme and, optionally, one or more additional amplification reagents. The chain extending enzyme extends the second surface-bound primer 24 from its free 3´ end to synthesize a third oligonucleotide 30´ (third template oligonucleotide) using the second oligonucleotide 30 (second template oligonucleotide) as a template. As such, the third oligonucleotide 30´ has a sequence that is at least partially complementary to the second oligonucleotide 30 including a complementary repeat region 32´. The third oligonucleotide includes the second surface-bound primer 24 as they are covalently attached. The second oligonucleotide 30 and the third oligonucleotide 30´ are at least partially hybridized.

[0231] Following or simultaneously during the synthesis of the surface-bound double- stranded bridged oligonucleotide complex (see 275 of FIG.7B), in some embodiments of method 700B, step 710B further includes synthesizing a plurality of new oligonucleotides where each new oligonucleotide is a part of the first population or the second population (FIG.4D). Each new oligonucleotide is a template oligonucleotide and as such, can be referred to as a new template oligonucleotide. For example, in one or more embodiments of method 700B, step 710B further includes providing a new bridged surface-bound oligonucleotide complex (step 760B). The new bridged surface-bound oligonucleotide complex includes an oligonucleotide from the first population of oligonucleotides bound to the surface on its 5´ end or an oligonucleotide from the second population of oligonucleotides bound to the surface on its 5´ end; and an unincorporated surface-bound primer having a 5´ end bound to the surface and a free 3´ end. The oligonucleotide from the first population of oligonucleotides or the oligonucleotide from the second population of oligonucleotides is hybridized to the unincorporated surface-bound primer proximate the 3´ end of the oligonucleotide hybridized to the surface-bound primer. The method further includes extending the unincorporated surface-bound primer from its free 3´ end using the oligonucleotide hybridized to the unincorporated surface-bound primer as a template to produce a new oligonucleotide, the first population of oligonucleotides or the second population of oligonucleotides including the new oligonucleotide (step 770B). The method can further include repeating steps 760B and 770B to synthesize at least a portion of the first population and the second population (step 775B).

[0232] The method steps of FIG.4D can be understood in conjunction with the schematic of FIG.7B. For example, a new bridged surface-bound oligonucleotide complex can be oligonucleotide complex 200 where 30 is an oligonucleotide from the first population or an oligonucleotide from the second population and the unincorporated surface-bound primer is surface-bound primer 24. Following extension of the unincorporated surface-bound primer 24, a new oligonucleotide 30´ is formed. The new oligonucleotide 30´ is complementary to the oligonucleotide of the first population or second population used as a template during new oligonucleotide synthesis. The new oligonucleotide 30´and the oligonucleotide hybridized to the unincorporated surface-bound primer prior to new oligonucleotide synthesis are hybridized in a double-stranded bridged structure 275. The oligonucleotide of the double-stranded bridged structure 275 can dehybridize. Following dehybridization the oligonucleotides are free to form different new bridged surface-bound oligonucleotide complexes with other unincorporated surface-bound primers and serve as templates for the synthesis of more new oligonucleotides (step 775B of method 700B).

[0233] In some embodiments, the methods of the present disclosure (e.g., methods 700A and 700B of FIG.3A and FIG.3B) may improve repeat region resolution and / or resolution downstream of a repeat region of one or more template oligonucleotides. Specifically, the methods of the present disclosure that include performing amplification within a temperature range may have improved repeat region resolution and / or resolution downstream of the repeat region compared to the same method using a single amplification temperature that is higher, for instance, 4 °C, 5 °C or 10 °C higher, than the lowest amplification temperature of the present disclosure method.

[0234] Repeat region resolution is the ability to sequence through one or more repeat regions. Resolution downstream of a repeat region is the ability to sequence through a region downstream of the repeat region. Repeat resolution and / or downstream resolution (downstream of a repeat region) can be quantified using a resolution value. A repeat region resolution value and a downstream resolution value are generally determined using a plurality of template oligonucleotides of the same known sequence, known repeat regions, and / or known downstream regions. A resolution value is the percent of nucleotides correctly identified in one or more regions of interest of a template oligonucleotide normalized to 100% when a plurality of template oligonucleotides of the same, known sequence is sequenced.

[0235] In some embodiments, the methods of the present disclosure that include performing at least a portion of amplification within a specified temperature range may have an improved repeat region resolution value and / or downstream resolution value compared to performing the same method using a single amplification temperature is higher, for instance, 4 °C, 5 °C or 10 °C higher, than the specified temperature range.

[0236] In some embodiments, the repeat resolution value and / or the downstream resolution value of a method that includes performing at least a portion of amplification within a specified temperature range is 1% or greater, 5% or greater, 7% or greater, 10% or greater, 15% or greater, 20% or greater, 25% or greater, 30% or greater, 35% or greater, 40% or greater, 45% or greater, or 50% or greater than the repeat resolution value and / or downstream resolution value of the same method using a single amplification temperature that is 4 °C, 5 °C, or 10 °C greater than the lowest amplification temperature of the present disclosure method. For example, performing at least a portion of amplification at a temperature below the conventional amplification temperature of a polymerase may result in an improved repeat resolution value and / or downstream resolution value compared to performing amplification at the conventional amplification temperature of the polymerase.

[0237] In some embodiments, the methods of the present disclosure (e.g., methods 700A and 700B of FIG.3A and FIG.3B) may improve the error rate within and / or downstream of a repeat region. Specifically, the methods of the present disclosure that include performing at least a portion of amplification within a specified temperature range may have improved error rate within and / or downstream of a repeat region compared to the same method using a single amplification temperature that is 4 °C, 5 °C, or 10 °C greater than the lowest amplification temperature of the present disclosure method. For example, performing at least a portion of amplification at a temperature below the conventional amplification temperature of a polymerase may result in an improved error rate compared to performing amplification at the conventional amplification temperature of the polymerase.

[0238] Error rate is the percent of nucleotides incorrectly identified when sequencing a plurality of template oligonucleotide of the same, known sequence. For example, an error rate of 5% indicates that 5% of nucleotides are identified incorrectly. The error rate may vary depending on the number of sequencing cycles. For example, the error rate may be 3% at cycle 10 and 5% at cycle 50. Generally, the error rate increases as the number of cycles increases.

[0239] The methods of the present disclosure that include performing at least a portion of amplification within a specified temperature range may have a lower error rate compared to the same method using a single amplification temperature that is 4 °C, 5 °C, or 10 °C greater than the specified temperature range. The methods of the present disclosure that that include performing at least a portion amplification within a specified temperature range may have a lower error rate after 50 cycles or more, 100 cycles or more, or 150 cycles or more as compared to the same method using a single amplification temperature that is 4 °C, 5 °C, or 10 °C greater than thespecified temperature. In some embodiments, the methods of the present disclosure that include performing at least a portio n of amplification within a specified temperature range may have an error rate that is lower by 0.5% or greater, 1% or greater, 2% or greater, 3% or greater, 4% or greater, 5% or greater, 6% or greater, 7% or greater, 8% or greater, 9% or greater, 10% or greater, or 20% or greater compared to the same method using a single amplification temperature that is 4 °C, 5 °C, or 10 °C greater than the specified temperature range. Exemplary Aspects

[0240] The invention is defined in the claims. However, below there is provided a non- exhaustive listing of non-limiting exemplary aspects. Any one or more of the features of these aspects may be combined with any one or more features of another example, embodiment, or aspect described herein.

[0241] Aspect A1(a) is a method for preparing a surface for sequencing a target oligonucleotide having a repeat region, the method including: (a) amplifying a template oligonucleotide including the target oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface, where the monoclonal cluster of oligonucleotides includes: (i) a first population of oligonucleotides including the sequence of the target oligonucleotide, the sequence of the target oligonucleotide including the repeat region; and (ii) a second population of oligonucleotides including the sequence complementary to the target oligonucleotide, the sequence complementary to the target oligonucleotide including a complementary repeat region; and where amplifying includes incubating a chain extending enzyme with the amplification site at a temperature (amplification temperature) of 20 °C to 35 °C.

[0242] Aspect A1(b1) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 20 °C to 35 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C for 15 minutes or longer.

[0243] Aspect A1(c) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 25 °C to 35 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 25 °C to 35 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 25 °C to 35 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 25 °C to 35 °C for 11 minutes or longer.

[0244] Aspect A1(d) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 30 °C to 35 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 35 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 35 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 35 °C for 15 minutes or longer.

[0245] Aspect A1(e) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 20 °C to 33 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 15 minutes or longer.

[0246] Aspect A1(f) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 30 °C to 33 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 33 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 33 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 30 °C to 33 °C for 15 minutes or longer.

[0247] Aspect A1(g) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 20 °C to 33 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 33 °C for 15 minutes or longer.

[0248] Aspect A1(h) is the method of Aspect A1(a) or any “A” aspect, wherein the amplification site at temperature (amplification temperature) of 20 °C to 30 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 30 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 30 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 30 °C for 15 minutes or longer.

[0249] Aspect A2 is the method of Aspect A1, where amplifying the template oligonucleotide includes: (a) providing a surface-bound oligonucleotide complex including: (i) a first surface-bound primer having a 5´end bound to the surface and a free 3´ end, the surface-bound primer being complementary to at least a portion of the template oligonucleotide; and (ii) the template oligonucleotide having a free 3´ end, the template oligonucleotide hybridized to the surface-bound primer proximate to the free 3´ end of the template oligonucleotide; and (b) extending the first surface-bound primer from its free 3´ end using the template oligonucleotide as a template to produce a second oligonucleotide, the second population of oligonucleotides including the second oligonucleotide.

[0250] Aspect A3 is the method of aspect A1 or A2, where amplifying the template oligonucleotide further includes: (a) providing a surface-bound double-stranded oligonucleotide complex including: (i) the template oligonucleotide; (ii) the second oligonucleotide bound to the surface on its 5´ end; and (iii) a second surface-bound primer having a 5´ end bound to the surface and a free 3´ end; where the template oligonucleotide and the second oligonucleotide are at least partially hybridized; and where the second oligonucleotide is hybridized to the second surface-bound primer proximate the 3´ end of the second oligonucleotide; and (b) extending the second surface primer from its free 3´ end using the second oligonucleotide as a template to produce a third oligonucleotide, the first population of oligonucleotides including the third oligonucleotide.

[0251] Aspect A4 is the method of any preceding Aspect, where amplifying the template oligonucleotide further includes: (a) providing a new surface-bound double-stranded complex includes: (i) an oligonucleotide from the first population of oligonucleotides bound to the surface on its 5´ end; (ii) an oligonucleotide from the second population of oligonucleotides bound to the surface on its 5´ end; (iii) an unincorporated surface-bound primer having a 5´ end bound to the surface and a free 3´ end; where the oligonucleotide from the first population of oligonucleotides and the oligonucleotide from the second population of oligonucleotides are at least partially hybridized, and where the oligonucleotide from the first population of oligonucleotides or the oligonucleotide from the second population of oligonucleotides is hybridized to the unincorporated surface-bound primer proximate the 3´ end of the oligonucleotide hybridized to the surface-bound primer; and (b) extending the unincorporated surface-bound primer from its free 3´ end using the oligonucleotide hybridized to the unincorporated surface-bound primer as a template to produce a produce a new oligonucleotide, the first population of oligonucleotides or the second population of oligonucleotides includes the new oligonucleotide.

[0252] Aspect A5 is the method of any preceding Aspect, where amplifying the template oligonucleotide further includes repeating the providing a new surface-bound double-stranded complex and the extending the unincorporated surface-bound primer to form at least a portion of the first population of oligonucleotides and at least a portion of the second population of oligonucleotides.

[0253] Aspect A6 is the method of any preceding Aspect, further including removing from the surface the first population of oligonucleotides or the second population of oligonucleotides.

[0254] Aspect A7 is the method of any preceding Aspect, further includes sequencing the first population of oligonucleotides or the second population of oligonucleotides that remain bound to the surface.

[0255] Aspect A8 is the method of any “A” Aspect, where a sequencing resolution downstream of the repeat region, downstream of the complementary repeat region, or both, is improved compared to completing the method where the chain extending enzyme is incubated with the amplification site at a single temperature that is 4 °C, 5 °C, or 104 °C greater than the amplification temperature.

[0256] Aspect A9 is method of any “A” Aspect, where a number of sequencing errors downstream of the repeat region, downstream of the complementary repeat region, or both, is decreased compared to completing the method where chain extending enzyme is incubated with the amplification site at a temperature greater than 33 °C.

[0257] Aspect A10 is the method of any “A” Aspect, where the repeat region includes a sequence prone to produce sequence specific errors.

[0258] Aspect A11 is the method of any “A” Aspect, where the repeat region includes 10 or more nucleotides.

[0259] Aspect A12 is the method of any “A” Aspect, where the repeat region includes a homopolymer.

[0260] Aspect A13 is the method of any “A” Aspect, where the homopolymer includes poly(thymine) or poly(adenine).

[0261] Aspect A14 is method of any “A” Aspect, where the repeat region includes a dinucleotide repeat, trinucleotide repeat, a trinucleotide repeat, or a tetranucleotide repeat.

[0262] Aspect A15 is the method of “A” Aspect , where amplifying includes incubating the chain extending enzyme at a first amplification temperature of 20 °C to 35 °C for a first amplification time and incubating the chain extending enzyme at a final amplification temperature greater than the first amplification temperature for a final amplification time. In some embodiments, the first amplification time is 5 minutes or more. In some embodiments, the first amplification time is 10 minutes or more. In some embodiments, the first amplification time is 15 minutes or more.

[0263] Aspect A16 is the method of Aspect A15, where the first amplification temperature is 24 °C to 36 °C and the second amplification temperature is greater than 30 °C.

[0264] Aspect A17 is the method of any of Aspects A15 or A16, where the first amplification time is longer than the second amplification time.

[0265] Aspect A18 is the method of any of Aspects A15 to A17, where the first amplification time is 2 hours to 6 hours.

[0266] Aspect A19 is the method of any of Aspects A15 to A18, where the second amplification temperature is 0.25 hours to 1 hour.

[0267] Aspect A20 is the method of any of Aspects A15 to A19, where the final amplification temperature is 35 °C to 45 °C.

[0268] Aspect A21 is the method of any of Aspects A15 to A20, where amplifying further includes sequentially incubating the chain extending enzyme at one or more additional amplification temperatures, where each additional amplification temperature is higher than any previous amplification temperature and lower than the final amplification temperature.

[0269] Aspect A22 is the method of Aspect A21, where sequentially incubating includes incubating the chain extending enzyme at 2 or more additional amplification temperatures.

[0270] Aspect A23(a) is the method of Aspect A21 or Aspect 22, where each additional amplification temperatures is higher than the previous amplification by 1 °C to 5 °C.

[0271] Aspect A23(b) is the method of Aspect A21 or Aspect 22, where the additional amplification temperatures are a temperature gradient over a gradient time. In some embodiments, the temperature gradient spans 5 °C to 20 °C over the gradient time. In some embodiments, the temperature gradient spans 5 °C to 15 °C over the gradient time. In some embodiments, the temperature gradient spans 5 °C to 10 °C over the gradient time. In some embodiments, the gradient time is the total amplification time (e.g., 0.2 hours to 6 hours).

[0272] Aspect A24 is the method of any of Aspects A21 to A23, where the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is 5 minutes to 50 minutes.

[0273] Aspect A24 is the method of any of Aspects A21 to A24, wherein first amplification time and the final amplification time are 5 minutes to 50 minutes.

[0274] Aspect B1(a) is a method for preparing a solid surface for sequencing a target oligonucleotide having a repeat region, the method includes: (a) amplifying a template oligonucleotide includes the target oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface , where the monoclonal cluster of oligonucleotides incudes: (i) a first population of oligonucleotides includes a sequence of the target oligonucleotide, the sequence of the target oligonucleotide includes the repeat region; and (ii) a second population of oligonucleotides includes a sequence complementary to the target oligonucleotide, the sequence complementary to the target oligonucleotide includes a complementary repeat region; where amplifying includes incubating a chain extending enzyme with the amplification site at temperature of 35 °C to 50 °C; and where the method does not include use of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, an energy recycling factor, or any combination thereof.

[0275] Aspect B1(b) is the method of Aspect B1(a) or any “B” aspect, wherein the amplification site at temperature (amplification temperature) of 35 °C to 45 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 35 °C to 45 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 35 °C to 45 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 35 °C to 45 °C for 15 minutes or longer.

[0276] Aspect B1(c) is the method of Aspect B1(a) or any “B” aspect, wherein the amplification site at temperature (amplification temperature) of 35 °C to 45 °C. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 35 °C to 45 °C for 5 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 35 °C to 45 °C for 10 minutes or longer. In some embodiments, amplifying includes incubating a chain extending enzyme with the amplification site at a temperature of 35 °C to 45 °C for 15 minutes or longer.

[0277] Aspect B2 is the method of Aspect B1, where amplifying the template oligonucleotide includes: (a) providing a surface-bound oligonucleotide complex includes: (i) a surface-bound primer having a 5´ end bound to the surface and a free 3´ end; and (ii) the template oligonucleotide having a free 3´ end, the template oligonucleotide hybridized to the surface-bound primer proximate the free 3´ end of the template oligonucleotide; and (b) extending the surface-bound primer from its free 3´ end using the template oligonucleotide as a template to produce a second oligonucleotide , the second population of oligonucleotides includes the second oligonucleotide.

[0278] Aspect B3 is the method of Aspect B1 or B2, where amplifying the template oligonucleotide further includes: (a) providing a bridged surface-bound oligonucleotide complex includes: (i) the second oligonucleotide bound to the surface on its 5´ end and having a free 3´ end; and (ii) a second surface-bound primer having a 5´ end bound to the surface and a free 3´ end, where the second oligonucleotide is hybridized to the second surface-bound primer proximate to the 3´ end of the second oligonucleotide; and (b) extending the second surface-bound primer from its free 3´ ends using the second oligonucleotide as a template to produce a third oligonucleotide , the second population of oligonucleotides includes the third oligonucleotide.

[0279] Aspect B4 is the method of any one of Aspects B1 to B3, where amplifying the template oligonucleotide further includes: (a) providing a new bridge surface-bound complex includes: (i) an oligonucleotide from the first population of oligonucleotides bound to the surface on its 5´ end or an oligonucleotide from the second population of oligonucleotides bound to the surface on its 5´ end; and (ii) an unincorporated surface-bound primer bound primer having a 5´ end bound to the surface and a free 3´ end; where the oligonucleotide from the first population of oligonucleotides or the second population of oligonucleotide is hybridized to the surface-bound primer proximate its 3´ end; and (b) extending the unincorporated surface-bound primer from its free 3´ end using the oligonucleotide hybridized to the unincorporated surface primer as a template to produce a new oligonucleotide, the first population of oligonucleotides or the second population of oligonucleotides includes the new oligonucleotide.

[0280] Aspect B5 is the method of any one of Aspects B1 to B4, where amplifying the template oligonucleotide further includes repeating the providing a new bridge surface-bound complex and the extending the unincorporated surface-bound primer to form at least a portion of the first population of oligonucleotides and at least a portion of the second population of oligonucleotides.

[0281] Aspect B6 is the method of any one of the “B” Aspects, where the method further includes removing from the surface the first population of oligonucleotides or the second population of oligonucleotides.

[0282] Aspect B7 is the method any one of the “B” Aspects, where the method further includes sequencing the first population of oligonucleotides or the second population of oligonucleotides that remain bound to the solid surface.

[0283] Aspect B8 is the method any one of the “B” Aspects, where the sequencing resolution downstream of the repeat region, downstream of the complementary repeat region, or both, is improved compared to completing the method where the chain extending enzyme is incubated with the amplification site at a temperature greater than 30 °C.

[0284] Aspect B9 is the method any one of the “B”, where the number of sequencing errors downstream of the repeat region, downstream of the complementary repeat region, or both, is decreased compared to completing the method where chain extending enzyme is incubated with the amplification site at a temperature greater than 30 °C.

[0285] Aspect B10 is the method of any one of the “B”, where the repeat region includes a sequence prone to produce sequence specific errors.

[0286] Aspect B11 is the method of any one of the “B” ,where the repeat regions includes a homopolymer.

[0287] Aspect B12 is the method any one of the “B” Aspects, where the homopolymer includes poly(thymine) or poly(adenine).

[0288] Aspect B13 is the method of any one of the “B” Aspects, where the repeat region includes a dinucleotide, a trinucleotide repeat, or a tetranucleotide repeat.

[0289] Aspect B14 is the method of any one of the “B” Aspects, where amplifying includes incubating the chain extending enzyme at a first amplification temperature of 35 °C to 45 °C for a first amplification time and incubating the chain extending enzyme at a final amplification temperature greater than the first amplification temperature for a final amplification time.

[0290] Aspect B15 is the method of Aspect B14, where the final amplification temperature is 37 °C to 50°C.

[0291] Aspect B16 is the method of Aspect B14 or B15, where amplifying further includes sequentially incubating the chain extending enzyme at one or more additional amplification temperatures wherein each additional amplification temperature is higher than any previous amplification temperature and lower than the final amplification temperature.

[0292] Aspect B17 is the method of Aspect B16, where sequentially incubating comprises incubating the chain extending enzyme at 2 to 10 additional amplification temperatures.

[0293] Aspect B18 is the method of Aspect B16 or B17, where each additional amplification temperature is higher than the previous amplification temperature by 1 °C to 5 °C.

[0294] Aspect B19 is the method of any of Aspects B16 to B18, where the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is 5 minutes to 50 minutes.

[0295] Aspect B20 is the method of any of Aspects B14 to B19, where first amplification time and the final amplification time are 5 minutes to 50 minutes. EXAMPLES

[0296] The present disclosure is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the disclosure as set forth herein. Example 1: Exploration of the cause of reduced sequencing quality in homopolymer regions

[0297] It is thought that the reduced sequencing quality for oligonucleotides having homopolymer regions can be due to errors in clustering, errors in sequencing by synthesis, or both. To explore the impact of clustering and sequencing by synthesis on sequencing quality, a series of oligonucleotides having varying homopolymer regions (10 bp, 20 bp, and 30bp) were assessed using two different approaches. The oligonucleotides included sequences that hybridized to the flow cell surface primers, to allow them to be clustered, a flanking region containing a generic DNA sequence, and a portion complementary to one of the DNA primers in Illumina Read 1 primer mix. An Illumina cBot equipped with camera to measure fluorescence intensity was used. The oligo sequences used are shown in Table 2. In the first approach, a single template oligonucleotide was clustered on the flow cell. After clustering, Illumina Read 1 primer mix was hybridized to the clustered template DNA and the oligonucleotides were sequenced by synthesis. In the second approach, a plurality of identical template oligonucleotides was hybridized to surface oligonucleotides followed by sequencing. In contrast to the first approach, the second approach did not include clustering. The resolution value was determined for each homopolymer containing oligonucleotide and a control oligonucleotide (no homopolymer region, see Table 3) using each approach. The resolution value is the portion of the DNA bases after the homopolymer region that were sequenced correctly, relative to the control oligonucleotide. Table 2 Name Sequence (5' to 3') A C CAAGCAGAAGACGGCATACGAGATTGGAGAAAAAAAAAAAAAAAAAAA 20 bp AGAGGTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTGTAGATCTCG T T TAT ATTAAA C T A G t.

[0298] FIG.8 shows that clustering followed by sequencing (approach 1, termed clustering on the plot of FIG.8) results in a lower resolution value than sequencing without clustering (second approach, termed primer hyb on the plot of FIG.8) for all of the homopolymer template lengths tested. This suggests that reduced sequencing quality of homopolymer regions is due mostly to clustering and not sequencing. Example 2: Exploration of clustering at a reduced temperature

[0299] Experiments were conducted to explore how lowering the temperature of clustering impacts primary and secondary sequencing metrics.

[0300] The experiments of Example 2 used NextSeq2k (Illumina) with X-Leap sequencing by synthesis chemistry. A human DNA library was used, prepared using Illumina TruSeq DNA Nano 450. Clustering was accomplished using kinetic exclusion amplification. For the control runs, clustering was run for 2 hours at 38 °C using the large fragment of the Bsu polymerase (38 °C is the near the conventional temperature for the large fragment of Bsu, see Table 1). For the reduced temperature clustering runs (cold clustering), kinetic exclusion amplification was accomplished by first incubating the large fragment of Bsu for 1 hour at 20 °C followed by 1.5 hours at 25 °C deg. Reagent volumes, pump speeds and mixing ratios were the same for both the control and the reduced temperature runs.

[0301] FIGS.9A and 9B demonstrate that although the cold clustering appears to cause a slight impact to the primary metric quality (as depicted by a slightly elevated % error rate across both reads), it still allows for two full read runs (FIG.9A is read 1 and FIG.9B is read 2) with sufficient quality to allow for in-depth secondary metrics analysis.

[0302] FIGS.10 and 11 show sequence specific errors (SSEs; FIG.10) and base callability (FIG.11) for cold clustering and control runs. Compared to control clustering, the cold clustering protocol results in improved callability and lower SSEs for both poly T and Poly A regions.

[0303] FIG.12 shows a normalized GC coverage metrics per percent GC content as calculated using Dragen Gremlin GC (Illumina). Cold clustering was hypothesized to possibly result in worse sequencing metrics in GC regions. For example, decreasing the amplification temperature may potentially increase the severity / stability of secondary structures prone to GC rich regions. However, as can be seen in FIG.12, decreasing the temperature of clustering did not result in any biasing of the GC coverage.

[0304] FIGS.13A, 13B, and 13C are Integrative Genomics View (IGV) plots showing sequence resolution for oligonucleotides having short homopolymer regions (10-15 bases; FIG. 13A), medium length homopolymer regions (15-25 bases; FIG.13B), and longer homopolymer regions (25 or greater bases; FIG.13C). Increased resolution may be linked to the size of the homopolymer stretch. Visual examination of a selection of the known homopolymer regions appears to demonstrate that the smaller homopolymer regions are almost completely resolved (FIG.13A), the medium length are largely resolved (FIG.13A), and larger length regions are partially resolved (FIG.13C). Example 3: Exploration of cold clustering to improve sequence metrics of oligonucleotides having dinucleotide repeat regions and homopolymer regions

[0305] Experiments were conducted to explore how lowering the temperature of clustering impacts the sequencing metrics for oligonucleotides having a GT, GA, or AT dinucleotide repeat region (see Table 3) or a poly(A) homopolymer repeat region of 10 bp, 20 bp, or 30 bp (see Table 2). The experiments of Example 3 used Illumina cBot equipped with a camera to measure fluorescence intensity. Clustering was accomplished using kinetic exclusion amplification. For the control runs, clustering was run for 2 hours at 38 °C using the large fragment of the Bsu polymerase (38 °C is the near the conventional temperature for the large fragment of Bsu, see Table 1). For the reduced temperature clustering runs (cold clustering), kinetic exclusion amplification was accomplished by first incubating the large fragment of Bsu for 1 hour at 20 °C followed by 1.5 hours at 25 °C. Reagent volumes, pump speeds and mixing ratios were the same for both the control and the reduced temperature runs. Table 3 Name Sequence (5' to 3') AT CAAGCAGAAGACGGCATACGAGATTGGACATATATATATATATATAT A ) G G O: A G D A A ) e

[0306] FIG.14 shows the resolution value for the various oligonucleotides having a dinucleotide repeat region or homopolymer region. Cold clustering improves AT and GA dinucleotide and homopolymer errors as evident by the increased resolution values compared to control clustering (clustered on the plot of FIG.14). Example 4: Exploration of cold clustering temperature on sequencing metrics

[0307] A variety of cold clustering temperature conditions were tested to determine how changing the amplification temperature impacts sequencing metrics. The experiments of Example 3 used NextSeq2k (Illumina) with X-Leap sequencing by synthesis chemistry . A library containing a portion of the human genome was used for these experiments. Clustering was accomplished using kinetic exclusion amplification. Table 4 shows the clustering temperature conditions for each run. For the cold clustering runs, the temperature was adjusted such that during amplification, one, two, or three amplification temperatures were used. The control runs and the cold clustering runs used the large fragment of the Bsu polymerase. Table 4 First First Second S Third Am econd Third Run ID plification Amplification Amplification Amplification Amplification Amplification s)

[0308] FIG.15 shows percentage soft clipped bases in known homopolymer regions in the human genome. Percentage soft clipping is a measure of the proportion of DNA bases that are removed from the beginning or end of reads by the Dragen aligner due to low quality. Only a small improvement in homopolymer performance was observed with 15 °C + 38 °C or 20 °C + 38 °C clustering, likely because these temperatures were too low for significant clustering activity, meaning the majority of clustering occurred during the 38 °C incubation. The lowest % soft clipping in homopolymer regions was observed when clustering occurred at 20 °C + 25 °C or 25 °C + 38 °C, indicating that the temperature of cold clustering needs to be sufficiently high for a significant portion of clustering to occur before any increase in temperature.

[0309] FIG.16 shows the relationship between % soft clipping in homopolymer regions and % Passing Filter (%PF). Filtering was performed by the Real Time Analysis software during the first cycles of sequencing to remove poor performance DNA clusters from analysis. In the conditions used, reduction in % soft clipping in homopolymer regions corresponded with a drop in % Passing Filter. This led to the conclusion that longer clustering times could give improved homopolymer resolution without a drop in other metrics.

[0310] FIG.17 shows that improved % soft clipping in homopolymer regions can be achieved without a significant decrease in % Q30 (% of bases that have a predicted error rate below 1 / 1000), % Error of the 2% PhiX spike-in in the library or % Passing Filter. With a BAC library containing a portion of the human genome, all metrics were the same or better with cold clustering (1 hour at 20 °C, 4 hours at 25 °C) vs control (1 hour at 38 °C), while library % Error and %PF were slightly worse with cold clustering.

[0311] FIG.18 demonstrates that improved homopolymer performance is not due to extended clustering time alone, indicated by an increase in % soft clipping in homopolymer regions clustered for 5 hours at 38 °C, whereas reduced % soft clipping in homopolymer regions was observed when clustering was done at reduced temperatures. Example 5: Further exploration of cold clustering temperature on sequencing metrics

[0312] Design of Experiments (DOE) was used to explore the cold clustering temperature and time to improve homopolymer performance while retaining other sequencing metrics. Sequencing runs were performed on NextSeq2k (Illumina) with X-Leap sequencing by synthesis chemistry and a human DNA library.

[0313] Three factors were used in the DOE: (1) the temperature of the cold portion of the clustering (between 25 °C and 30 °C); (2) total clustering time (from 3 to 5 hours); and (3) the temperature during the last 30 minutes of clustering (from the same temperature used during the ‘cold’ portion of clustering to 38 °C). The values used for each sequencing run are shown in Table 5. Table 5 Run IDCold temperatureTotal time Temperature of last 30 ° h i ° 10 30 3 30 11 25 5 25

[0314] Homopolymer performance was measured by the total false positives and false negatives (FP + FN) in homopolymer regions compared with the National Institute of Standards and Technology (NIST) T2TQ100 draft truthset. FIGS.19A-19D show the prediction parameters and actual results for FP + FN in homopolymer regions (FIG.19A), % Passing filter (%PF) (FIG.19B), % Error of the 2% PhiX spike-in Read 2 (FIG.19C), and % greater than Q30 in Read 2 (FIG.19D). Actual vs predicted plots are also shown. Using the parameters from the DOE, clustering conditions were selected to balance homopolymer performance without negatively impacting primary sequencing metrics. The clustering conditions selected were 26.2 °C for 4.5 hours followed by 33.3 °C for 30 minutes.

[0315] Two sequencing runs were carried out using the selected conditions from the DOE. FIG.20 shows % Passing filter, % Error and FP + FN in homopolymer regions for control runs using standard recipe (37 °C), the original cold clustering recipe (4 hours at 25 °C; Cold cluster on the plot), the predicted values from the DOE model (DOE predicted on the plot), and the actual values of the test runs (DOE actual on the plot). There was good agreement between the predicted values and the actual values. Example 6: Exploration of recombinase activity

[0316] The activity of two recombinases at different temperatures was explored. For kinetic exclusion amplification (also called ExAmp), a recombinase is included as an amplification reagent that enables homologous recombination of DNA strands at isothermal temperatures. The activity of a recombinase may be impacted by the temperature of the reaction. Example 6 tests the activity of Rb32 UvsX (see US 8,071,308; US 8,637,253; US 10,093,908; and US 11,339,382 for the sequence of Rb32 UvsX) and a Rb49 UvsX mutant (denoted simply as Rb49UvsX; see US 9,982,244 and US 10,344,269 for the sequence of the Rb49 UvsX mutant) at 25 °C, 28 °C, 30 °C, 32 °C, and 37 °C (see WO2016054088A1 for recombinase sequences). Rb32 UsvX is included in the ECX ExAmp reagent mixture. The Rb49 UsvX mutant is included in TCX ExAmp reagent mixture. Other differences between ECX and TCX include the use of a second single stranded binding protein in TCX but not in ECX and the inclusion of 6K PEG in ECX but not in TCX.

[0317] First, a plate-based fluorescent assay was used to determine recombinase activity at varying temperatures. The plate-based fluorescent assay included a double stranded oligo with a fluorophore on one strand and a quencher on the other plus a single stranded non-labeled oligo that is complement to the strand with the fluorophore. Recombinase activity was measured by the amount of fluorescence detected when the single stranded non-labeled oligos invades the double stranded duplex, displaces the quencher, and allowed the fluorophore to emit fluorescence. FIG.21 shows the results.

[0318] In a second experiment, ExAmp clustering using ECX or TCX was done on a HiseqX flow cell at various temperatures. FIG.22 shows the percent intensity of amplified clusters. Cluster detection was done on a fluorescent imager by the incorporation of a single base ffN after clustering. FIG.22 indicates the resulting intensity from clustering correlates with recombinase activity. ECX’s recombinase cluster intensity begins to plateau at 30 °C with 25 °C showing a 20% to 25% reduction in intensity. At ~32 °C the recombinase in TCX shows this comparable 20% to 25% reduction in intensity. Example 7: Exploration of clustering time and temperature The temperature, time, and number of ExAmp TCX reagent pushes for accomplishing kinetic exclusion amplification (ExAmp) were varied. The Truseq PCR free 450 base pair library (NIST ID NO: HG002 NA24385) was clustered using TCX amplification reagent mixture according to the conditions shown in Table 6. Following clustering, sequencing by synthesis was used to determine the sequence. Cluster generation using ECX amplification reagent mixture (run D) and using standard conditions Novaseq conditions (run A) were also included. See Example 6 for an explanation of the components of TCX and ECX. Table 6 Run ExAmp Conditions (recombinase) Clustering Clustering Time A TCX (Rb49 UvsX mutant) 37 3 × 40 min B TCX (Rb49 UvsX mutant) 32 4 × 60 min in

[0319] FIGS.23A-23B are plots showing the total false positive plus false negatives (FP+FN) count in homopolymer regions (FIG.23A) and in AT dinucleotide repeat regions (FIG.23B) as well as 50 bases upstream or downstream of the homopolymer or AT repeat region. The total FP+FN count in homopolymer regions and flanking regions was reduced when a clustering temperature of 32 °C was used comparable levels within error to ECX clustering at 25 °C (FIG.23A). The total FP+FN count in AT repeat regions and subsequent flanking regions are reduced when the temperature was decrease from 37 °C to 32 °C. Example 8: Exploration of cold cluster temperature ramping

[0320] In Example 8, two clustering temperature ramping protocols were tested and compared to static clustering. Sequencing runs were performed on NovaSeqX (Illumina) with X- Leap sequencing by synthesis chemistry and an TruSeq PCR-free library with genome NA24385. The temperature, time, and number of ExAmp TCX reagent pushes for accomplishing kinetic exclusion amplification (ExAmp) were varied.

[0321] Two different temperature ramping clustering protocols (TCX 30 °C-40 °C and TCX 28 °C-42 °C) were tested. Additionally, two static clustering temperatures were tested (TCX 38 °C and TCX 32 °C) FIG.24 shows a schematic of the ramping and static clustering protocols. All protocols being with an initial push of ExAmp reagents onto a flow cell at 25 °C. The TCX 38 °C (Dory 38C) protocol included 6 pushes of ExAmp reagents with the following incubation times: push 1 = 22.5 min, push 2 = 30 min, push 3 = 26.7 min, push 4 = 26.7 min, push 5 = 26.7 min, push 6 = 26.7 min. The TCX 32 °C (Dory 32C) protocol included 6 pushes of ExAmp reagents with the following incubation times: push 1 = 22.5 min, push 2 = 30 min, push 3 = 26.7 min, push 4 = 26.7 min, push 5 = 26.7 min, push 6 = 26.7 min. The TCX 30 °C-40 °C protocol included 6 pushes of ExAmp reagents with the following incubation times: push 1 = 22.5 min, push 2 = 30 min, push 3 = 25.3 min, push 4 = 25.3 min, push 5 = 25.3 min, push 6 = 25.3 min, push 7 = 25.3 min, push 8 = 25.3 min. The TCX 30 °C-40 °C protocol included 6 pushes of ExAmp reagents with the following incubation times: push 1 = 22.5 min, push 2 = 30 min, push 3 = 25.3 min, push 4 = 25.3 min, push 5 = 25.3 min, push 6 = 25.3 min, push 7 = 25.3 min, push 8 = 25.3 min.

[0322] FIG.25 shows various sequencing primary metrics achieved after clustering according to TCX 30 °C-40 °C, TCX 28 °C-42 °C, TCX 38 °C , or TCX 32 °C. The temperature ramp workflows allowed for good variant calling performance without compromising primary metrics. The description of the metrics shown in FIG.25 are shown in Table 7. Table 7 Metric name Description %PF Percent of nanowells which contain a passing filter cluster. s. d l,e e

[0323] Variant calling performance for each clustering protocol was assessed by the total counts of false calls (false positives plus false negatives (FP+FN) at regions of high confidence, homopolymers, AT repeats, and short tandem repeat (STR) dinucleotides (STR) dinucleotides. STR dinucleotides are repeating sequences of 2-6 base pairs of DNA found in non-coding regions of the genome, where the repeating unit consists of 2 nucleotides, e.g. (CA)n or (AT)n, where “n” represents the number of times it is repeated. A lower FP+FN count indicates better variant calling performance. The results are shown in FIG.26. The isothermal clustering at 32 °C (condition 2) shows an overall improvement in variant calling as compared to traditional 38 °C clustering (condition 1). The temperature ramp clustering in condition 4 shows a similar degree of overall improvement in variant calling as condition 2 does.

[0324] A number of embodiments have been described. Nevertheless, it will be understood that various modifications may be made. Accordingly, other embodiments are within the scope of the following claims.

[0325] The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and / or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The disclosure is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the disclosure defined by the claims.

[0326] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present disclosure. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0327] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0328] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Claims

CLAIMS What is claimed is:

1. A method for preparing a surface for sequencing a target oligonucleotide having a repeat region, the method comprising: amplifying a template oligonucleotide comprising the target oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface, wherein the monoclonal cluster of oligonucleotides comprises: a first population of oligonucleotides comprising the sequence of the target oligonucleotide, the sequence of the target oligonucleotide comprising the repeat region; and a second population of oligonucleotides comprising the sequence complementary to the target oligonucleotide, the sequence complementary to the target oligonucleotide comprising a complementary repeat region; and wherein amplifying comprises incubating a chain extending enzyme with the amplification site at a temperature of 20 °C to 35 °C.

2. The method of claim 1, wherein amplifying the template oligonucleotide comprises: providing a surface-bound oligonucleotide complex comprising: a first surface-bound primer having a 5´ end bound to the surface and a free 3´ end, the surface-bound primer being complementary to at least a portion of the template oligonucleotide; and the template oligonucleotide having a free 3´ end, the template oligonucleotide hybridized to the surface-bound primer proximate to the free 3´ end of the template oligonucleotide; and extending the first surface-bound primer from its free 3´ end using the template oligonucleotide as a template to produce a second oligonucleotide, the second population of oligonucleotides comprising the second oligonucleotide.

3. The method of claim 2, wherein amplifying the template oligonucleotide further comprises: providing a surface-bound double-stranded oligonucleotide complex comprising:the template oligonucleotide; the second oligonucleotide bound to the surface on its 5´ end; and a second surface-bound primer having a 5´ end bound to the surface and a free 3´ end; wherein the template oligonucleotide and the second oligonucleotide are at least partially hybridized; and wherein the second oligonucleotide is hybridized to the second surface-bound primer proximate the 3´ end of the second oligonucleotide; and extending the second surface primer from its free 3´ end using the second oligonucleotide as a template to produce a third oligonucleotide, the first population of oligonucleotides comprising the third oligonucleotide.

4. The method of claim 3, wherein amplifying the template oligonucleotide further comprises: providing a new surface-bound double-stranded oligonucleotide complex comprising: an oligonucleotide from the first population of oligonucleotides bound to the surface on its 5´ end; an oligonucleotide from the second population of oligonucleotides bound to the surface on its 5´ end; an unincorporated surface-bound primer having a 5´ end bound to the surface and a free 3´ end; wherein the oligonucleotide from the first population of oligonucleotides and the oligonucleotide from the second population of oligonucleotides are at least partially hybridized, and wherein the oligonucleotide from the first population of oligonucleotides or the oligonucleotide from the second population of oligonucleotides is hybridized to an unincorporated surface-bound primer proximate the 3´ end of the oligonucleotide hybridized to the surface-bound primer; and extending the unincorporated surface-bound primer from its free 3´ end using the oligonucleotide hybridized to the unincorporated surface-bound primer as a template to produce a produce a new oligonucleotide, the first population of oligonucleotides or the second population of oligonucleotides comprising the new oligonucleotide; andrepeating the providing a new surface-bound double-stranded complex and the extending the unincorporated surface-bound primer to form at least a portion of the first population of oligonucleotides and at least a portion of the second population of oligonucleotides.

5. The method of any one of claims 1 to 4, wherein amplifying comprises incubating the chain extending enzyme at a first amplification temperature of 20 °C to 35 °C for a first amplification time and incubating the chain extending enzyme at a final amplification temperature greater than the first amplification temperature for a final amplification time, wherein the final amplification temperature is 35 °C to 45 °C.

6. A method for preparing a surface for sequencing a target oligonucleotide having a repeat region, the method comprising: amplifying a template oligonucleotide comprising the target oligonucleotide to form a monoclonal cluster of oligonucleotides at an amplification site on the surface , wherein the monoclonal cluster of oligonucleotides comprises: a first population of oligonucleotides comprising a sequence of the target oligonucleotide, the sequence of the target oligonucleotide comprising the repeat region ; and a second population of oligonucleotides comprising a sequence complementary to the target oligonucleotide, the sequence complementary to the target oligonucleotide comprising a complementary repeat region; wherein amplifying comprises incubating a chain extending enzyme with the amplification site at temperature of 35 °C to 45 °C; and wherein the method does not comprise use of a recombinase, an exchange factor, a single stranded binding protein, a strand-displacing polymerase, an energy recycling factor, or any combination thereof.

7. The method of claim 6, wherein amplifying the template oligonucleotide comprises: providing a surface-bound oligonucleotide complex comprising: a surface-bound primer having a 5´ end bound to the surface and a free 3´ end; andthe template oligonucleotide having a free 3´ end, the template oligonucleotide hybridized to the surface-bound primer proximate the free 3´ end of the template oligonucleotide; and extending the surface-bound primer from its free 3´ end using the template oligonucleotide as a template to produce a second oligonucleotide, the second population of oligonucleotides comprising the second oligonucleotide.

8. The method of claim 7, wherein amplifying the template oligonucleotide further comprises: providing a bridged surface-bound oligonucleotide complex comprising: the second oligonucleotide bound to the surface on its 5´ end and having a free 3´ end; and a second surface-bound primer having a 5´ end bound to the surface and a free 3´ end, wherein the second oligonucleotide is hybridized to the second surface-bound primer proximate to the 3´ end of the second oligonucleotide; and extending the second surface-bound primer from its free 3´ ends using the second oligonucleotide as a template to produce a third oligonucleotide , the second population of oligonucleotides comprising the third oligonucleotide.

9. The method of claim 8, wherein amplifying the template oligonucleotide further comprises: providing a new bridge surface-bound complex comprising: an oligonucleotide from the first population of oligonucleotides bound to the surface on its 5´ end or an oligonucleotide from the second population of oligonucleotides bound to the surface on its 5´ end; and an unincorporated surface-bound primer bound primer having a 5´ end bound to the surface and a free 3´ end;wherein the oligonucleotide from the first population of oligonucleotides or the second population of oligonucleotide is hybridized to the surface-bound primer proximate its 3´ end; extending the unincorporated surface-bound primer from its free 3´ end using the oligonucleotide hybridized to the unincorporated surface primer as a template to produce a new oligonucleotide, the first population of oligonucleotides; and repeating the providing a new bridge surface-bound complex and the extending the unincorporated surface-bound primer to form at least a portion of the first population of oligonucleotides and at least a portion of the second population of oligonucleotides.

10. The method of any one of claims 6 to 9, wherein amplifying comprises incubating the chain extending enzyme at a first amplification temperature of 35 °C to 45 °C for a first amplification time and incubating the chain extending enzyme at a final amplification temperature greater than the first amplification temperature for a final amplification time, wherein the final amplification temperature is 37 °C to 50 °C.

11. The method of claim 5 or 10, wherein amplifying further comprises sequentially incubating the chain extending enzyme at one or more additional amplification temperatures wherein each additional amplification temperature is higher than any previous amplification temperature and lower than the final amplification temperature.

12. The method of claim 11, wherein sequentially incubating comprises incubating the chain extending enzyme at 2 to 10 additional amplification temperatures.

13. The method of claim 11 or 12, wherein each additional amplification temperatures is higher than the previous amplification temperature by 1 °C to 5 °C.

14. The method of any one of claims 11 to 13, wherein the chain extending enzyme is incubated at each additional amplification temperature for an amplification time and each amplification time is 5 minutes to 50 minutes.

15. The method of any one of claims 11 to 14, wherein the first incubation time and the final incubation time are 5 minutes to 50 minutes.

16. The method of any one of claims 1 to 15, wherein the method further comprises removing from the surface the first population of oligonucleotides or the second population of oligonucleotides and comprising sequencing the first population of oligonucleotides or the second population of oligonucleotides that remain bound to the surface.

17. The method of any one of claims 1 to 16, wherein the repeat region comprises a sequence prone to produce sequence specific errors.

18. The method of any one of claims 1 to 17, wherein the repeat regions comprises a homopolymer.

19. The method of claim 18, wherein the homopolymer comprises poly(thymine) or poly(adenine).

20. The method of any one of claims 1 to 17, wherein the repeat region comprises a dinucleotide, a trinucleotide repeat, or a tetranucleotide repeat.

Citation Information

Patent Citations

  • Methods and systems for aligning repetitive DNA elements

    US20160110498A1