Methods and compositions for LPA gene editing and therapy using crispr system

Abstract

Compositions and methods for inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene are provided. Compositions and methods for treating diseases associated with LPA are provided.

Description

METHODS AND COMPOSITIONS FOR LPA GENE EDITING AND THERAPY USING CRISPR SYSTEM

[0001] This application claims the priority to the following patent application: PCT / CN2024 / 103872, filed on 05 July 2024; PCT / CN2024 / 134843, filed on 27 November 2024; PCT / CN2024 / 106309, filed on 19 July 2024; and PCT / CN2024 / 134847, filed on 27 November 2024. The entire contents of the aforementioned application (s) are hereby incorporated by reference.Technical Field

[0002] The present disclosure relates to methods, compositions and components for the control of LPA gene expression, or gene-editing, by introducing double-stranded breaks, and for treating subjects having any diseases associated with LPA.Background

[0003] Lp (a) is a unique atherogenic and thrombogenic lipoprotein. Lp (a) was discovered in 1963 by the geneticist Kara Berg. Lp (a) is a low-density lipoprotein particle, like LDL cholesterol. The levels of Lp (a) in plasma are genetically determined. Lp (a) is composed of two distinct parts: apolipoprotein-B (apoB) and apolipoprotein-A (apoA) , a plasminogen-like glycoprotein. ApoB is structurally and physicochemically similar to LDL-C, and apoA consists of carbohydrate-rich proteins. Both molecules are covalently linked by a disulfide bond to form a single macromolecule.

[0004] Lp (a) is a well-recognized, independent risk factor for atherosclerotic cardiovascular disease (ASCVD) . Evidence from experimental, observational, and genetic studies has demonstrated that increased Lp (a) is associated with increased risk for coronary heart disease (CHD) , ischemic stroke, peripheral artery disease, heart failure, calcific aortic valve stenosis (CAVS) , mitral valve stenosis, and possibly retinopathy in diabetic patients. On the contrary, elevated Lp (a) concentrations do not appear to be a risk factor for venous thromboembolism, as previously considered, whereas very low Lp (a) levels have been linked to an increased risk of incident type 2 diabetes mellitus (T2DM) .

[0005] The concentration of Lp (a) is almost exclusively genetically determined with an autosomal codominant inheritance pattern and strongly determined by a single gene, the LPA gene. Serum Lp (a) levels are inherited in an autosomal codominant manner. Greater than 90%of the variability in Lp (a) levels is determined by a single gene, i.e., the LPA gene. By the age of two, the LPA gene is fully expressed. Adult Lp (a) levels are usually reached by approximately the age of five but may further increase until adulthood. Elevations in Lp (a) levels, though, may be observed in pregnancy and menopause. Ethnicity also affects Lp (a) concentrations, with median Lp (a) increasing sequentially in Chinese, White, South Asian, and Black individuals. Furthermore, sex influences Lp (a) concentrations; specifically, women have ～5–10%higher levels compared with men in both Blacks and Whites. Overall, Lp (a) levels are stable over time and are not generally affected by diet, physical activity, or other environmental factors.

[0006] However, there remains a critical need for safe and effective delivery systems and highly efficient RNA components to enable precise genetic interventions, such as gene therapy for diseases associated with LPA.Summary

[0007] The present disclosure solves the above-mentioned technical problems through the following technical solutions:

[0008] In one aspect, this disclosure provides a LPA gene-targeting guide RNA (gRNA) comprising a guide sequence: (i) selected from a nucleotide sequence set forth in any one of SEQ ID NOs: 1-209; (ii) with at least 17, 18, 19, or 20 contiguous nucleotides of any sequence set forth in SEQ ID NOs:  1-209; or (iii) selected from a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%,  92%, 91%, or 90%identity to any sequence set forth in SEQ ID NOs: 1-209.

[0009] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence selected from any one of SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, and 488.

[0010] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 213; wherein the scaffold sequence comprises a modification pattern of nucleotides 21-100 of SEQ ID NO: 212 (GUUUUAGAGmCmUmAmGmAmAmAmUmAmGmCmAAGUUAAAAUAAGGCUAGUCCGU UAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGm UmGmCmU*mU*mU*mU*mU) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0011] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 213; wherein the scaffold sequence comprises a modification pattern of nucleotides 21-100 of SEQ ID NO: 212 (GUUUUAGAGmCmUmAmGmAmAmAmUmAmGmCmAAGUUAAAAUAAGGCUAGUCCGU UAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGm UmGmCmU*mU*mU*mU*mU) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0012] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 424, wherein the sequence of SEQ ID NO: 424 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 423 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0013] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 431, wherein the sequence of SEQ ID NO: 431 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 430 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGAGUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0014] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 434, wherein the sequence of SEQ ID NO: 434 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 433 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0015] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 437, wherein the sequence of SEQ ID NO: 437 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 436 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGfGfCfAfCfCfGAGUCGG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified, and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0016] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) a guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 440, wherein the sequence of SEQ ID NO: 440 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 439 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGfGfCfAfCfCfGfAfGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0017] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 443, wherein the sequence of SEQ ID NO: 443 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 442 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0018] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 446, wherein the sequence of SEQ ID NO: 446 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 445 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAACGGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0019] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a sequence of SEQ ID NO: 449, wherein the sequence of SEQ ID NO: 449 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 448 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAAGGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0020] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 452, wherein the sequence of SEQ ID NO: 452 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 451 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAGGAAACGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0021] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 455, wherein the sequence of SEQ ID NO: 455 comprises a modification pattern of nucleotides 21-89 of SEQ ID NO: 454 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAGAAACGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0022] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 458, wherein the sequence of SEQ ID NO: 458 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 457 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAACGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0023] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 462, wherein the sequence of SEQ ID NO: 462 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 461 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAACGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0024] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 466, wherein the sequence of SEQ ID NO: 466 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 465 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAAGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0025] In some embodiments, the LPA gene-targeting gRNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as described herein; and (ii) a scaffold sequence of SEQ ID NO: 470, wherein the sequence of SEQ ID NO: 470 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 469 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAAGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified .

[0026] In some embodiments, the sgRNA further comprises a modification at the guide sequence. In some embodiments, wherein the sgRNA further comprises a modification at the first 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end of the guide sequence. In some embodiments, the modification includes a 2’-O-methyl (2’-O-Me) modified nucleotide or 2’-fluoro (2’-F) modified nucleotide. In some embodiments, the modification includes a phosphorothioate (PS) bonds between the nucleotides; preferably, the modification includes PS bonds between the first four nucleotides. In some embodiments, the sgRNA further comprises (a) PS bonds between the first four nucleotides; or (b) 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end. In some embodiments, the sgRNA further comprises a) PS bonds between the first four nucleotides; and (b) 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end.

[0027] In another aspect, this disclosure provides an optimized guide RNA (gRNA) comprising a conserved portion having at least 90%sequence identity to SEQ ID NO: 488 or 492, except in a modified hairpin 1 (H1) region, wherein said modified H1 region: comprises a deletion of 4 to 10 nucleotides relative to positions H1-1 to H1-12 of SEQ ID NO: 488 or 492. In some embodiments, H1 region comprises a deletion of 4, 5, 6, 7, 8, 9, or 10 nucleotides relative to positions H1-1 to H1-12 of SEQ ID NO: 488 or 492.

[0028] In some embodiments, the modified hairpin 1 region comprises deletion of at least one base pair selected from the group consisting of: (a) nucleotides corresponding to positions H1-1 and H1-12 of SEQ ID NO: 488 or 492; (b) nucleotides corresponding to positions H1-2 and H1-11 of SEQ ID NO: 488 or 492; (c) nucleotides corresponding to positions H1-3 and H1-10 of SEQ ID NO: 488 or 492; and (d) nucleotides corresponding to positions H1-4 and H1-9 of SEQ ID NO: 488 or 492.

[0029] In some embodiments, the modified hairpin 1 region further comprises one or more substitutions of nucleotides corresponding to positions selected from H1-1 to H1-12 of SEQ ID NO: 488 or 492.

[0030] In some embodiments, the substitution occurs at H1-2, H1-9 or H1-12.

[0031] In some embodiments, the gRNA is a single guide RNA (sgRNA) .

[0032] In some embodiments, position H1-1 is deleted. In some embodiments, position H1-2 is deleted. In some embodiments, position H1-3 is deleted. In some embodiments, position H1-4 is deleted. In some embodiments, position H1-5 is deleted. In some embodiments, position H1-6 is deleted. In some embodiments, position H1-7 is deleted. In some embodiments, position H1-8 is deleted. In some embodiments, position H1-9 is deleted. In some embodiments, position H1-10 is deleted. In some embodiments, position H1-11 is deleted. In some embodiments, position H1-12 is deleted.

[0033] In some embodiments, position H1-9 is substituted with a C. In some embodiments, position H1-2 is substituted with a G and / or H1-11 is substituted with a C.

[0034] In some embodiments, the hairpin 1 region comprises an insertion of one or more of nucleotides within its loop. In some embodiments, the hairpin 1 region comprises an insertion of one nucleotide within its loop. In some embodiments, the nucleotide is inserted immediately after the last nucleotide at the 3'end of the original loop. In some embodiments, the nucleotide is inserted immediately before the first nucleotide at the 5'end of the original loop. In some embodiments, the insertion results in conversion of a four-nucleotide original loop to a five-nucleotide loop. In some embodiments, the insertion results in conversion of a four-nucleotide original loop to a three-nucleotide loop. In some embodiments, the insertion results in a Watson-Crick base pair forming between: (a) a nucleotide at the 3'or 5'terminal position of the original loop; and (b) the inserted nucleotide; wherein said base pair is selected from the group consisting of: A-U, U-A, C-G, G-C, A-T, and T-A.

[0035] As used in this disclosure, the term “nucleotide” when used in reference to a sequence shall mean a covalently linked monomeric unit within a polynucleotide chain.

[0036] As used in this disclosure, “immediately before” a specified nucleotide refers to insertion of one or more nucleotides directly adjacent to the 5’ end of that nucleotide, such that the inserted nucleotide (s) become (s) directly covalently linked to the specified nucleotide (e.g., 5’ phosphate group of the specified nucleotide) , with no intervening nucleotides between them. Conversely, “immediately after” a specified nucleotide refers to insertion directly adjacent to its 3’ end, wherein the inserted nucleotide (s) form (s) a direct covalent linkage with the specified nucleotide (e.g., the 3’ hydroxyl group of the specified nucleotide) , leaving no nucleotides between them.

[0037] As used in this disclosure, the term “original loop” refers to the unmodified loop structure of a guide RNA (gRNA) , as found in its native or engineered form prior to any deliberate nucleotide insertion, deletion, or substitution within said loop region. This loop is characterized by its position within the gRNA secondary structure, typically flanked by base-paired stem regions, and comprises a specific nucleotide sequence of defined length and composition in its pre-altered state.

[0038] In some embodiments, the conserved portion comprises: (a) a nucleotide sequence having at least 99%, at least 98%, at least 97%, at least 96%, at least  95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identity to the sequence selected from any one of: SEQ ID NO: 488 or 492; and (b) a sequence motif of N1GAAAAN2 or N1GAAACN2; wherein N1 and N2 form a Watson-Crick  base pair selected from G-C, C-G, A-U, or U-A.

[0039] In some embodiments, the optimized gRNA comprises: (i) a guide sequence selected from SEQ ID NOs: 1-209; (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence selected from SEQ ID NOs: 1-209; or (iii) a guide sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90%identity to a sequence selected from SEQ ID NOs: 1-209.

[0040] In some embodiments, (a) the conserved portion comprises: (i) a nucleotide sequence having at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identity to SEQ ID NO: 488 or 492; and (ii) a sequence motif of N1CGAAAGN2; wherein N1 and N2form a Watson-Crick base pair selected from G-C, C-G, A-U, or U-A; and (b) the optimized gRNA further comprises: (i) a guide sequence selected from SEQ ID NOs: 1-209; (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence selected from SEQ ID NOs: 1-209; or (iii) a guide sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90%identity to a sequence selected from SEQ ID NOs: 1-209.

[0041] In some embodiments, the optimized gRNA comprises a nucleotide sequence: (a) selected from: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462,  466, 470, and 488; (b) that is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least  93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identical to any one of the nucleotide sequences selected from: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, and 488.

[0042] In some embodiments, the optimized gRNA comprises a 5’ end modification. In some embodiments, the optimized gRNA comprises a 3’ end modification. In some embodiments, the optimized gRNA comprises a 5’ end modification and 3’ end modification. In some embodiments, the optimized gRNA comprises a 3’ tail. In some embodiments, the optimized gRNA does not comprise a 3’ tail. In some embodiments, the 3’ and 5’ end modification comprises a protective end modification, optionally a modified nucleotide selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-O- (2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, or a combination thereof.

[0043] In some embodiments, the optimized gRNA comprises an upper stem (US) region, and the upper stem region comprises at least one modification. In some embodiments, the upper stem modification comprises any one or more of: (a) a modification of any one or more of US1-US12 in the upper stem region; and (b) a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the upper stem region. In some embodiments, the upper stem modification comprises one or more of: (a) a 2’-OMe modified nucleotide; (b) a 2’-O-moe modified nucleotide; (c) a 2’-F modified nucleotide; or (d) combinations of one or more of (a) - (c) .

[0044] In some embodiments, the optimized gRNA comprises a hairpin 2 (H2) region, and the hairpin 2 region comprises at least one modification. In some embodiments, the hairpin 2 region modification comprises any one or more of: (a) a modification of any one or more of H2-1 to H2-15 in the hairpin 2 region; and (b) a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or all 15 nucleotides in the hairpin 2 region.

[0045] In some embodiments, the hairpin 2 region modification comprises one or more of: (a) a 2’-OMe modified nucleotide; (b) a 2’-O-moe modified nucleotide; (c) a 2’-F modified nucleotide; or (d) combinations of one or more of (a) - (c) .

[0046] In some embodiments, the optimized gRNA comprises a nucleotide sequence having at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identity to the nucleotide sequence of any one of SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472.

[0047] In some embodiments, disclosure provides an optimized gRNA comprising any of SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472.

[0048] In another aspect, this disclosure provides a polynucleotide encoding the optimized gRNA as described in this disclosure. In some embodiments, the polynucleotide is presented in a vector.

[0049] In another aspect, this disclosure provides a polynucleotide encoding an optimized gRNA comprising: (a) a sequence selected from any one of SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, 530-547; or (b) a sequence that is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, or at least 90%identical to a sequence selected from any one of SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, 530-547. In some embodiments, the polynucleotide is presented in a vector.

[0050] In another aspect, this disclosure provides an ionizable lipid of Formula (I) or its N-oxide, a pharmaceutically acceptable salt, isomer or prodrug thereof, wherein R1 is hydrogen; phenyl; 3-to 7-membered cycloaliphatic; 3-to 7-membered heterocyclyl comprising  1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; 5-to 6-membered monocyclic heteroaryl comprising 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; 8-to 10-membered bicyclic heteroaryl comprising 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; -OR’ ; or wherein the phenyl, cycloaliphatic, 3-to 7-membered heterocyclyl, 5-to 6-membered monocyclic heteroaryl, 8-to 10-membered bicyclic heteroaryl are optionally substituted with one or more substituents independently selected from the group consisting of halide, hydroxy, or thiol; R’ is selected from hydrogen, C1-C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, wherein the C1-C8 alkyl,  the C2-C8 alkenyl and the C2-C8 alkynyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C6 alkyl, cycloalkyl, aryl, halide, hydroxy, or thiol; R2, R3, R4, and R5 are each independently selected from hydrogen, C1-C18 alkyl, C2-C18 alkenyl,  C2-C18 alkynyl, -S-C3-13 alkyl, and -CH2-S-C3-13 alkyl; wherein the C1-C18 alkyl, the C2-C18 alkenyl, the C2-C18 alkynyl, or the C3-13 alkyl motif are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C6 alkyl, cycloalkyl, aryl, halide, hydroxy, or thiol; R9, R10 and R11 are each independently selected from hydrogen, C1-C5 alkyl, C2-C5 alkenyl, C2-C5  alkynyl, or -C (=O) R8; wherein the C1-C5 alkyl, C2-C5 alkenyl, C2-C5 alkynyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C6 alkyl, cycloalkyl, aryl, halide, hydroxy, or thiol; X1 is selected from a bond, -S-, -O-; X2 and X3 are each independently selected from -C (=O) O-, -OC (=O) -, -OC (=S) O-, -SC (=O) O-,  -OC (=O) S-, -OC (=O) O-, -C (=O) S-, -SC (=O) -; L0 and L1 are each independently selected from a bond, C1-C8 alkylene, C2-C8 alkenylene or C2-C8  alkynylene; wherein C1-C8 alkylene, C2-C8 alkenylene and C2-C8 alkynylene are each optionally substituted with one or more substituents independently selected from the group consisting of halide, hydroxy, or thiol; L2 and L3 are each independently selected from a bond, C1-C18 alkylene, C2-C18 alkenylene,  C2-C18 alkynylene, wherein the C1-C18 alkylene, the C2-C18 alkenylene and the C2-C18 alkynylene are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C6 alkyl, cycloalkyl, aryl, halide, hydroxy, or thiol.

[0051] In some embodiments, R1 is -OR’ , and R’ is selected from hydrogen or C1-C8 alkyl. In some embodiments, the R1 is -OR’ , wherein R’ is hydrogen. In some embodiments, R1 is  R9, R10 and R11 are each independently selected from hydrogen or C1-C5 alkyl. In some embodiments, R1 is R9, R10 and R11 are independently selected from hydrogen or linear C1-C3 alkyl. In some embodiments, R1 is selected from R9, R10 and R11 are independently selected from hydrogen or linear C1 alkyl.

[0052] In some embodiments, L0 is selected from a bond or C1-C8 alkylene. In some embodiments, L0 is a linear C1-C5 alkylene. In some embodiments, the L0 is selected from a linear C4 alkylene, a linear C3 alkylene or a linear C2 alkylene. In some embodiments, L0 is a bond.

[0053] In some embodiments, L1 is selected from a bond or C1-C8 alkylene. In some embodiments, L1 is a linear C1-C5 alkylene. In some embodiments, L1 is selected from a linear C4 alkylene, a linear C3 alkylene or a linear C2 alkylene. In some embodiments, L1 is a bond.

[0054] In some embodiments, L2, L3 are independently selected from a bond or C3-C18 alkylene. In some embodiments, L2, L3 are independently a bond. In some embodiments, L2, L3 are independently C3-C10 alkylene. In some embodiments, L2, L3 are independently C5-C8 alkylene. In some embodiments, L2, L3 are independently C8 alkylene. In some embodiments, L2, L3 are independently C7 alkylene. In some embodiments, L2, L3 are independently C6 alkylene. In some embodiments, L2, L3 are independently C5 alkylene. In some embodiments, L2, L3 are independently C4 alkylene. In some embodiments, L2, L3 are independently C3 alkylene.

[0055] In some embodiments, L4, L5 are independently selected from a bond or C1-C5 alkylene. In some embodiments, L4, L5 are independently a bond. In some embodiments, L4, L5 are independently C1 alkylene, C2 alkylene or C3 alkylene.

[0056] In some embodiments, the X1 is a bond or -O-.

[0057] In some embodiments, X2 and X3 are independently selected from -OC (=O) S-, -SC (=O) O-, -C (=O) O-, -OC (=O) -, or -OC (=O) O-. In some embodiments, X2 and X3 are independently selected from -OC (=O) S-, -SC (=O) O-, -C (=O) O-, -OC (=O) -, or -OC (=O) O-; and at least one of X2 and X3 is selected from -OC (=O) S-or -SC (=O) O-. In some embodiments, X2 and X3 are independently selected from -OC (=O) S-or -SC (=O) O-. In some embodiments, X2 and X3 are independently selected from -OC (=O) S-, -SC (=O) O-, -C (=O) O-, -OC (=O) -, or -OC (=O) O-X3 is selected from -OC (=O) S-or -SC (=O) O-; and X2 is selected from -OC (=O) -or -C (=O) O-. In some embodiments, X2 and X3 are independently selected from -OC (=O) -or -C (=O) O-.

[0058] In some embodiments, R2, R3, R4 and R5 are independently selected from a hydrogen, C5-C12 alkyl, -S-C3-13 alkyl, or -CH2-S-C3-13 alkyl. In some embodiments, R2 and R3 are independently C10 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, or C4 alkyl. In some embodiments, R2 and R3 are independently -S- (CH2) 5CH3. In some embodiments, R2 and R3 are independently -CH2-S-C4-12 alkyl. In some embodiments, R2 and R3 are independently -CH2-S-C5-10 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C6-9 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C4 alkyl. In some embodiments, R2 and R3 are independently -CH2-S-C5 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C6 alkyl; R2 and R3 are independently -CH2-S-C5 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C7 alkyl; R2 and R3 are independently -CH2-S-C8 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C9 alkyl. In some embodiments, the alkyl is a linear alkyl

[0059] In some embodiments, R3 and R5 are independently -CH2-S-C3-13 alkyl. In some embodiments, R3 and R5 are independently –CH2S- (CH2) 8CH3, –CH2S- (CH2) 7CH3, –CH2S- (CH2) 6CH3, –CH2S- (CH2) 5CH3, –CH2S- (CH2) 4CH3, or –CH2S- (CH2) 3CH3; and R2 and R4 are independently -S-C3-13 alkyl; optionally, R2 and R4 are independently -S- (CH2) 8CH3, -S- (CH2) 7CH3, -S- (CH2) 6CH3, -S- (CH2) 5CH3, -S- (CH2) 4CH3, or -S- (CH2) 3CH3.

[0060] This disclosure also provides an ionizable lipid of Formula (III) or its N-oxide, a pharmaceutically acceptable salt, isomer or prodrug thereof, wherein R2, R3, R4 and R5 are each independently selected from hydrogen, C1-C12 alkyl, C2-C12 alkenyl,  C2-C12 alkynyl, -S-C3-13 alkyl, or -CH2-S-C3-13 alkyl; X1 is selected from a bond, -S-, and -O-; preferably, X1 is a bond. X2 and X3 are each independently selected from -C (=O) O-, -OC (=O) -, -OC (=S) O-, -SC (=O) O-,  -OC (=O) S-, -OC (=O) O-, -C (=O) S-, -SC (=O) -; and at least one of X2 and X3 is selected from -OC (=O) S-or -SC (=O) O-; L1 or L0 are independently selected from a bond or C1-C8 alkylene; L2 and L3 are independently C3-C10 alkylene; L4 and L5 are independently selected from a bond, or C1-3 alkylene.

[0061] In some embodiments, L0 is a bond. In some embodiments, L0 is a linear C2 alkylene. In some embodiments, L0 is a linear C4 alkylene. In some embodiments, L0 is a linear C3 alkylene.

[0062] In some embodiments, L1 is a bond. In some embodiments, L1 is a linear C2 alkylene. In some embodiments, L1 is a linear C4 alkylene. In some embodiments, L1 is a linear C3 alkylene.

[0063] In some embodiments, L2, L3 are independently C5-C8 alkylene. In some embodiments, L2, L3 are independently C5 linear alkylene. In some embodiments, L2, L3 are independently C6 linear alkylene. In some embodiments, L2, L3 are independently C7 linear alkylene.

[0064] In some embodiments, L4 and L5 are independently a bond. In some embodiments, L4 and L5 are independently C1 alkylene. In some embodiments, L4 and L5 are independently C2 alkylene.

[0065] In some embodiments, R2, R3, R4 and R5 are independently selected from a hydrogen, C5-C12 alkyl, -S-C3-13 alkyl, or -CH2-S-C3-13 alkyl. In some embodiments, R2 and R3 are independently C10 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, or C4 alkyl. In some embodiments, R2 and R3 are independently -S- (CH2) 5CH3. In some embodiments, R2 and R3 are independently -CH2-S-C4-12 alkyl. In some embodiments, R2 and R3 are independently -CH2-S-C5-10 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C6-9 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C4 alkyl. In some embodiments, R2 and R3 are independently -CH2-S-C5 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C6 alkyl; R2 and R3 are independently -CH2-S-C5 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C7 alkyl; R2 and R3 are independently -CH2-S-C8 alkyl; In some embodiments, R2 and R3 are independently -CH2-S-C9 alkyl. In some embodiments, the alkyl is a linear alkyl. In some embodiments, R3 and R5 are independently -CH2-S-C3-13 alkyl. In some embodiments, R3 and R5 are independently –CH2S- (CH2) 8CH3, –CH2S- (CH2) 7CH3, –CH2S- (CH2) 6CH3, –CH2S- (CH2) 5CH3, –CH2S- (CH2) 4CH3, or –CH2S- (CH2) 3CH3; and R2 and R4 are independently -S-C3-13 alkyl; optionally, R2 and R4 are independently -S- (CH2) 8CH3, -S- (CH2) 7CH3, -S- (CH2) 6CH3, -S- (CH2) 5CH3, -S- (CH2) 4CH3, or -S- (CH2) 3CH3.

[0066] This disclosure also provides an ionizable lipid of Formula (VII) : L0 and L1 are each independently a bond or C1-C5 alkylene, wherein the C1-C5 alkylene is  optionally substituted with one or more substituents independently selected from the group consisting of halide, hydroxy, or thiol; X1 is selected from a bond, -S-or -O-; X2, X3 are independently selected from -C (=O) O-, -OC (=O) -, -OC (=O) O-, -OC (=O) S-, or  -SC (=O) O-; L2 and L3 are each independently selected from a bond, C3-C9 alkylene, wherein the C3-C9 alkylene  is optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol; L4 and L5 are each independently selected from a bond, C1-C5 alkylene, wherein the C1-C5 alkylene  is optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol; R4 is selected from C1-C18 alkyl, C2-C18 alkenyl; wherein the C1-C18 alkyl and  the C2-C18 alkenyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol; wherein L6, L7, L10 and L11 are each independently a bond or C6-C9 alkenylene; preferably, wherein  L6, L7, L10 and L11 are each independently a bond. R2, R3, R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl; wherein the  C1-C18 alkyl and the C2-C18 alkenyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol.

[0067] This disclosure also provides an ionizable lipid of Formula (VIII) : or its N-oxide, a pharmaceutically acceptable salt, isomer or prodrug thereof, wherein L0 and L1 are each independently a bond or C1-C5 alkylene; X1 is a bond, -S-or -O-; X2, X3 are independently selected from -C (=O) O-, -OC (=O) -, -OC (=O) O-, -OC (=O) S-, or  -SC (=O) O-; L2 and L3 are each independently C3-C9 alkylene; L4 and L5 are each independently C1-C5 alkylene; R4 is selected from C1-C18 alkyl, or C2-C18 alkenyl; L6, L7, L10 and L11 are each independently a bond; R2, R3, R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.

[0068] In some embodiments, L0 is a bond and L1 is C1-C5 alkylene, preferably, L1 is C2, C3 or C4 alkylene.

[0069] In some embodiments, X1 is a bond. In some embodiment, X1 is -O-.

[0070] In some embodiments, X2, X3 are independently selected from -C (=O) O-, -OC (=O) -or -OC (=O) O-.

[0071] In some embodiments, L2 and L3 are each independently C3-C9 alkylene. In some embodiments, L2 and L3 are each independently C3 alkylene. In some embodiments, L2 and L3 are each independently C4 alkylene. In some embodiments, L2 and L3 are each independently C5 alkylene. In some embodiments, L2 and L3 are each independently C6 alkylene. In some embodiments, L2 and L3 are each independently C7 alkylene. In some embodiments, L2 and L3 are each independently C8 alkylene. In some embodiments, L2 and L3 are each independently C9 alkylene.

[0072] In some embodiments, L4 and L5 are each independently C1-C3 alkylene. In some embodiments, L4 and L5 are each independently C1 alkylene. In some embodiments, L4 and L5 are each independently C2 alkylene. In some embodiments, L4 and L5 are each independently C3 alkylene.

[0073] In some embodiments, R4 is selected from L10 and L11 are each independently a bond; R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.

[0074] In some embodiments, R2, R3, R5 and R6 are each independently selected from C4-C18 alkyl or C4-C18 alkenyl. In some embodiments, R2, R3, R5 and R6 are each independently selected from C4-C12 alkyl. In some embodiments, R2, R3, R5 and R6 are each C4 alkyl. In some embodiments, R2, R3, R5 and R6 are each C5 alkyl. In some embodiments, R2, R3, R5 and R6 are each C6 alkyl. In some embodiments, R2, R3, R5 and R6 are each C7 alkyl. In some embodiments, R2, R3, R5 and R6 are each C8 alkyl. In some embodiments, R2, R3, R5 and R6 are each C9 alkyl. In some embodiments, R2, R3, R5 and R6 are each C10 alkyl. In some embodiments, R2, R3, R5 and R6 are each C11 alkyl. In some embodiments, R2, R3, R5 and R6 are each C12 alkyl. Preferably, the alkyl is a linear alkyl.

[0075] This disclosure also provides a compound of Formula (XI) : or its N-oxide, a pharmaceutically acceptable salt, isomer or prodrug thereof, wherein L0 and L1 are each independently a bond or C1-C5 alkylene; X1 is a bond, -S-or -O-; X2, X3 are independently selected from -C (=O) O-, -OC (=O) -, -OC (=O) O-, -OC (=O) S-, or  -SC (=O) O-; L2 and L3 are each independently C3-C9 alkylene; L4 and L5 are each independently C1-C5 alkylene; L6, L7, L10 and L11 are each independently a bond; R2, R3, R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.

[0076] In some embodiments, L0 is a bond and L1 is C1-C5 alkylene, preferably, L1 is C2, C3 or C4 alkylene. In some embodiments, L0, L1 are each independently a C2, C3 or C4 alkylene.

[0077] In some embodiments, X1 is a bond.

[0078] In some embodiments, X2, X3 are independently selected from -C (=O) O-, -OC (=O) -or -OC (=O) O-.

[0079] In some embodiments, L2 and L3 are each independently C3-C9 alkylene. In some embodiments, L2 and L3 are each independently C4-C8 alkylene. In some embodiments, L2 and L3 are each independently C3 alkylene. In some embodiments, L2 and L3 are each independently C4 alkylene. In some embodiments, L2 and L3 are each independently C5 alkylene. In some embodiments, L2 and L3 are each independently C6 alkylene. In some embodiments, L2 and L3 are each independently C7 alkylene. In some embodiments, L2 and L3 are each independently C8 alkylene. In some embodiments, L2 and L3 are each independently C9 alkylene.

[0080] In some embodiments, L4 and L5 are each independently C1-C3 alkylene. In some embodiments, L4 and L5 are each independently C1 alkylene. In some embodiments, L4 and L5 are each independently C2 alkylene. In some embodiments, L4 and L5 are each independently C3 alkylene.

[0081] In some embodiments, L10 and L11 are each independently a bond; R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.

[0082] In some embodiments, R2, R3, R5 and R6 are each independently selected from C4-C18 alkyl or C4-C18 alkenyl. In some embodiments, R2, R3, R5 and R6 are each independently selected from C4-C12 alkyl. In some embodiments, R2, R3, R5 and R6 are each C4 alkyl. In some embodiments, R2, R3, R5 and R6 are each C5 alkyl. In some embodiments, R2, R3, R5 and R6 are each C6 alkyl. In some embodiments, R2, R3, R5 and R6 are each C7 alkyl. In some embodiments, R2, R3, R5 and R6 are each C8 alkyl. In some embodiments, R2, R3, R5 and R6 are each C9 alkyl. In some embodiments, R2, R3, R5 and R6 are each C10 alkyl. In some embodiments, R2, R3, R5 and R6 are each C11 alkyl. In some embodiments, R2, R3, R5 and R6 are each C12 alkyl. Preferably, the alkyl is a linear alkyl.

[0083] This disclosure also provides an ionizable lipid compound selected from any one of the compounds as set forth in Table 1.

[0084] Table 1: The exemplary ionizable lipid

[0085] In another aspect, this disclosure provides a lipid nanoparticle (LNP) composition comprising an ionizable lipid as described in this disclosure.

[0086] In some embodiments, the LNP further comprises: (i) a neutral lipid; (ii) a steroid; and (ii) a stealth lipid.

[0087] In some embodiments, the ionizable lipid is present in a concentration ranging from 40 mol %to 50 mol %of the total lipid component; optionally, the ionizable lipid is present in a concentration ranging from 45 mol %to 49.5 mol %of the total lipid component. Preferably, the ionizable lipid is present in a concentration ranging from 46.3 mol %to 49.5 mol %of the total lipid component. In some embodiments, the ionizable lipid is present in a concentration of 40 mol %, 40.1 mol %, 40.2 mol %, 40.3 mol %, 40.4 mol %, 40.5 mol %, 40.6 mol %, 40.7 mol %, 40.8 mol %, 40.9 mol %, 41 mol %, 41.1 mol %, 41.2 mol %, 41.3 mol %, 41.4 mol %, 41.5 mol %, 41.6 mol %, 41.7 mol %, 41.8 mol %, 41.9 mol %, 42 mol %, 42.1 mol %, 42.2 mol %, 42.3 mol %, 42.4 mol %, 42.5 mol %, 42.6 mol %, 42.7 mol %, 42.8 mol %, 42.9 mol %, 43 mol %, 43.1 mol %, 43.2 mol %, 43.3 mol %, 43.4 mol %, 43.5 mol %, 43.6 mol %, 43.7 mol %, 43.8 mol %, 43.9 mol %, 44 mol %, 44.1 mol %, 44.2 mol %, 44.3 mol %, 44.4 mol %, 44.5 mol %, 44.6 mol %, 44.7 mol %, 44.8 mol %, 44.9 mol %, 45 mol %, 45.1 mol %, 45.2 mol %, 45.3 mol %, 45.4 mol %, 45.5 mol %, 45.6 mol %, 45.7 mol %, 45.8 mol %, 45.9 mol %, 46 mol %, 46.1 mol %, 46.2 mol %, 46.3 mol %, 46.4 mol %, 46.5 mol %, 46.6 mol %, 46.7 mol %, 46.8 mol %, 46.9 mol %, 47 mol %, 47.1 mol %, 47.2 mol %, 47.3 mol %, 47.4 mol %, 47.5 mol %, 47.6 mol %, 47.7 mol %, 47.8 mol %, 47.9 mol %, 48 mol %, 48.1 mol %, 48.2 mol %, 48.3 mol %, 48.4 mol %, 48.5 mol %, 48.6 mol %, 48.7 mol %, 48.8 mol %, 48.9 mol %, 49 mol %, 49.1 mol %, 49.2 mol %, 49.3 mol %, 49.4 mol %, 49.5 mol %, 49.6 mol %, 49.7 mol %, 49.8 mol %, 49.9 mol %or 50 mol %of the total lipid component.

[0088] In some embodiments, the neutral lipid is selected from the group consist of: distearoylphosphatidylcholine (DSPC) , dioleoylphosphatidylcholine (DOPC) , dipalmitoylphosphatidylcholine (DPPC) , dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) , dioleoyl-phosphatidylethanolamine (DOPE) , palmitoyloleoylphosphatidylcholine (POPC) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1 carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) and 1, 2-dielaidoyl-sn-glycero-3-phosphoethanolamine (transDOPE) ; preferably the neutral lipid is DSPC.

[0089] In some embodiments, the neutral lipid is present in a concentration ranging from 5 mol %to 15 mol %of the total lipid component; preferably, the neutral lipid is present in a concentration ranging from 8.5 mol %to 10.5 mol %of the total lipid component. In some embodiments, the neutral lipid is present in a concentration of 5.0 mol %, 5.1 mol %, 5.2 mol %, 5.3 mol %, 5.4 mol %, 5.5 mol %, 5.6 mol %, 5.7 mol %, 5.8 mol %, 5.9 mol %, 6.0 mol %, 6.1 mol %, 6.2 mol %, 6.3 mol %, 6.4 mol %, 6.5 mol %, 6.6 mol %, 6.7 mol %, 6.8 mol %, 6.9 mol %, 7.0 mol %, 7.1 mol %, 7.2 mol %, 7.3 mol %, 7.4 mol %, 7.5 mol %, 7.6 mol %, 7.7 mol %, 7.8 mol %, 7.9 mol %, 8.0 mol %, 8.1 mol %, 8.2 mol %, 8.3 mol %, 8.4 mol %, 8.5 mol %, 8.6 mol %, 8.7 mol %, 8.8 mol %, 8.9 mol %, 9.0 mol %, 9.1 mol %, 9.2 mol %, 9.3 mol %, 9.4 mol %, 9.5 mol %, 9.6 mol %, 9.7 mol %, 9.8 mol %, 9.9 mol %, 10.0 mol %, 10.1 mol %, 10.2 mol %, 10.3 mol %, 10.4 mol %, 10.5 mol %, 10.6 mol %, 10.7 mol %, 10.8 mol %, 10.9 mol %, 11.0 mol %, 11.1 mol %, 11.2 mol %, 11.3 mol %, 11.4 mol %, 11.5 mol %, 11.6 mol %, 11.7 mol %, 11.8 mol %, 11.9 mol %, 12.0 mol %, 12.1 mol %, 12.2 mol %, 12.3 mol %, 12.4 mol %, 12.5 mol %, 12.6 mol %, 12.7 mol %, 12.8 mol %, 12.9 mol %, 13.0 mol %, 13.1 mol %, 13.2 mol %, 13.3 mol %, 13.4 mol %, 13.5 mol %, 13.6 mol %, 13.7 mol %, 13.8 mol %, 13.9 mol %, 14.0 mol %, 14.1 mol %, 14.2 mol %, 14.3 mol %, 14.4 mol %, 14.5 mol %, 14.6 mol %, 14.7 mol %, 14.8 mol %, 14.9 mol %, 15.0 mol %.

[0090] In some embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0. In some embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0; about 4.2: 1.0; about 4.3: 1.0; about 4.4: 1.0; about 4.5: 1.0; about 4.6: 1.0; about 4.7: 1.0; about 4.8: 1.0; or about 4.9: 1.0.

[0091] In some embodiments, the steroid is cholesterol. In some embodiments, the steroid is present in a concentration ranging from 35 mol %to 55 mol %of the total lipid component; preferably, the steroid is present in a concentration ranging from 40 mol %to 50 mol %of the total lipid component.

[0092] In some embodiments, the steroid is present in a concentration of 40.0 mol %, 40.1 mol %, 40.2 mol %, 40.3 mol %, 40.4 mol %, 40.5 mol %, 40.6 mol %, 40.7 mol %, 40.8 mol %, 40.9 mol %, 41.0 mol %, 41.1 mol %, 41.2 mol %, 41.3 mol %, 41.4 mol %, 41.5 mol %, 41.6 mol %, 41.7 mol %, 41.8 mol %, 41.9 mol %, 42.0 mol %, 42.1 mol %, 42.2 mol %, 42.3 mol %, 42.4 mol %, 42.5 mol %, 42.6 mol %, 42.7 mol %, 42.8 mol %, 42.9 mol %, 43.0 mol %, 43.1 mol %, 43.2 mol %, 43.3 mol %, 43.4 mol %, 43.5 mol %, 43.6 mol %, 43.7 mol %, 43.8 mol %, 43.9 mol %, 44.0 mol %, 44.1 mol %, 44.2 mol %, 44.3 mol %, 44.4 mol %, 44.5 mol %, 44.6 mol %, 44.7 mol %, 44.8 mol %, 44.9 mol %, 45.0 mol %, 45.1 mol %, 45.2 mol %, 45.3 mol %, 45.4 mol %, 45.5 mol %, 45.6 mol %, 45.7 mol %, 45.8 mol %, 45.9 mol %, 46.0 mol %, 46.1 mol %, 46.2 mol %, 46.3 mol %, 46.4 mol %, 46.5 mol %, 46.6 mol %, 46.7 mol %, 46.8 mol %, 46.9 mol %, 47.0 mol %, 47.1 mol %, 47.2 mol %, 47.3 mol %, 47.4 mol %, 47.5 mol %, 47.6 mol %, 47.7 mol %, 47.8 mol %, 47.9 mol %, 48.0 mol %, 48.1 mol %, 48.2 mol %, 48.3 mol %, 48.4 mol %, 48.5 mol %, 48.6 mol %, 48.7 mol %, 48.8 mol %, 48.9 mol %, 49.0 mol %, 49.1 mol %, 49.2 mol %, 49.3 mol %, 49.4 mol %, 49.5 mol %, 49.6 mol %, 49.7 mol %, 49.8 mol %, 49.9 mol %, or 50.0 mol %.

[0093] In some embodiments, the molar ratio of ionizable lipid to steroid ranges from about 1.0: 0.9 to about 1.0: 1.2.

[0094] In some embodiments, the stealth lipid is a pegylated lipid. In some embodiments, the pegylated lipid is selected from the group consist of: pegylated diacylglycerol (PEG-DAG) , 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2′, 3′-di (tetradecanoyloxy) propyl-1-O- (ω-methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ω-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecanoxy) propyl) carbamate or 2, 3-di (tetradecanoxy) propyl-N- (ω-methoxy (polyethoxy) ethyl) carbamate; preferably, the pegylated lipid is DMG-PEG2000.

[0095] In some embodiments, the stealth lipid is present in a concentration ranging from 1.0 mol %to 3.0 mol %of the total lipid component; preferably, pegylated lipid is present in a concentration ranging from 2.0 mol %to 2.5 mol %of the total lipid component. In some embodiments, the stealth lipid is present in a concentration of 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5 mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol %, 2.0 mol %, 2.2 mol %, 2.2 mol %, 2.3 mol %, 2.4 mol %, 2.5 mol %, 2.6 mol %, 2.7 mol %, 2.8 mol %, 2.9 mol %, or 3.0 mol %of the total lipid component.

[0096] In some embodiments, the molar ratio of ionizable lipid to the stealth lipid ranges from about 100: 1 to about 20: 1.

[0097] In some embodiments, lipid nanoparticle comprises an ionizable lipid of GY1480, DSPC, Cholesterol and DMG-PEG2000.

[0098] In some embodiments, the lipid nanoparticle comprises an ionizable lipid with a concentration ranging from 40 mol %to 50 mol %of the total lipid component; a neutral lipid with a concentration ranging from 5 mol %to 15 mol %of the total lipid component; a steroid with a concentration ranging from 35 mol %to 55 mol %of the total lipid component; and a stealth lipid with a concentration ranging from 1.0 mol %to 3.0 mol %of the total lipid component.

[0099] In some embodiments, the lipid nanoparticle comprises an ionizable lipid with a concentration ranging from 43 mol %to 47 mol %of the total lipid component; a neutral lipid with a concentration ranging from 8 mol %to 12 mol %of the total lipid component; a steroid with a concentration ranging from 40 mol %to 50 mol %of the total lipid component; and a stealth lipid with a concentration ranging from 1.5 mol %to 2.5 mol %of the total lipid component.

[0100] In some embodiments, the lipid nanoparticle comprises an ionizable lipid with a concentration having 46.3 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a steroid with a concentration having 42.3 mol %of the total lipid component; and a stealth lipid with a concentration having 2 mol %of the total lipid component.

[0101] In some embodiments, the lipid nanoparticle comprises an ionizable lipid with a concentration having 40 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a steroid with a concentration having 48.6 mol %of the total lipid component; and a stealth lipid with a concentration having 2 mol %of the total lipid component.

[0102] In some embodiments, the lipid nanoparticle comprises an ionizable lipid with a concentration having 49.5 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a steroid with a concentration having 39.1 mol %of the total lipid component; and a stealth lipid with a concentration having 2 mol %of the total lipid component.

[0103] In some embodiments, the lipid nanoparticle comprises an ionizable lipid with a concentration having 49.5 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a steroid with a concentration having 38.6 mol %of the total lipid component; and a stealth lipid with a concentration having 2.5 mol %of the total lipid component.

[0104] In some embodiments, the LNP composition further comprising a biologically active agent encapsulated within or associated with the lipid nanoparticle. In some embodiments, the biologically active agent comprises a polypeptide or a pharmaceutically acceptable salt thereof. In some embodiments, the biologically active agent comprises a nucleic acid or a pharmaceutically acceptable salt thereof. In some embodiments, the nucleic acid component comprises RNA. In some embodiments, the RNA component comprises a modified RNA.

[0105] In some embodiments, the nucleic acid component comprises RNA, wherein the RNA component comprises an mRNA. In some embodiments, the RNA component comprises a sequence encoding RNA-guided DNA-binding agent, such as a Cas nuclease mRNA. In some embodiments, the RNA component comprises a Class 2 Cas nuclease mRNA. In some embodiments, the RNA component comprises a mRNA encoding Cas9, Cpf1, c2c2, cas12i, cas12f, cas12b, cas12c, cas12d, cas12e, cas12g, cas12j, or cas12k nuclease. In some embodiments, the RNA component comprises a gRNA or a sequence encoding such gRNA. In some embodiments, the RNA component comprises: (i) a Cas nuclease mRNA or a sequence encoding such mRNA; and (ii) a gRNA or a sequence encoding such gRNA. In some embodiments, the nucleic acid is or encodes a dual-guide RNA (dgRNA) . In some embodiments, the nucleic acid is or encodes a single-guide RNA (sgRNA) . In some embodiments, the gRNA is a modified gRNA. In some embodiments, the nucleic acid component further comprises at least one donor nucleic acid.

[0106] In some embodiments, the LNP composition further comprising a biologically active agent comprises a guide RNA as described in this disclosure.

[0107] In some embodiments, the LNP composition has an N / P ratio of about 3-10. In some embodiments, the composition has an N / P ratio of about 5-8. In some embodiments, the composition has an N / P ratio of about 4-8; In some embodiments, the composition has an N / P ratio of about 4, 4.5, 5, 5.5, 6, or 6.5; In some embodiments, the composition has an N / P ratio of about 6.

[0108] In some embodiments, the LNP composition further comprises a buffer.

[0109] In another aspect, this disclosure also provided a method of delivering a biologically active agent to a cell, comprising contacting the cell with the LNP composition described herein. In some embodiments, the cell is a liver cell, such as a hepatocyte.

[0110] In another aspect, this disclosure also provides a pharmaceutical composition comprising: (i) the ionizable lipid as described in this disclosure or the LNP composition as described in this disclosure; and (ii) one or more pharmaceutically acceptable carriers, diluents or excipients.

[0111] In another aspect, this disclosure also provides a method of delivering a biologically active agent to a cell, comprising contacting the cell with the pharmaceutical composition as described herein or the LNP composition as described herein to a subject.

[0112] In another aspect, this disclosure also provides a method for administering a therapeutic agent to a subject in need thereof comprising administering the pharmaceutical composition herein or the LNP composition herein to a subject.

[0113] In another aspect, this disclosure also provides a method for treating a disease in a subject in need thereof, the method comprising administering the the LNP composition or the pharmaceutical composition containing said LNP composition to a subject.

[0114] In another aspect, this disclosure also provided a method of gene editing, comprising contacting a cell with the LNP composition as described herein. In some embodiments, the method herein comprises administering the LNP composition to a human. In some embodiments, the method herein comprises administering the composition to a cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the method comprises administering the mRNA formulated in a first LNP composition and a second LNP composition; and the second LNP composition may comprises one or more of an mRNA, a gRNA, a nucleic acid encoding the gRNA, and a template nucleic acid (i.e. a donor nucleic acid) . In some embodiments, the method comprises administering the mRNA and the gRNA formulated in a single LNP composition. In some embodiments, the method comprises administering the mRNA and the gRNA formulated in two LNP compositions.

[0115] In another aspect, this disclosure also provided a method of cleaving a DNA, comprising contacting a cell with the LNP composition as described herein. In some embodiments, the method herein comprises administering the LNP composition to a human. In some embodiments, the method herein comprises administering the composition to a cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the method comprises administering the mRNA formulated in a first LNP composition and a second LNP composition; and the second LNP composition may comprises one or more of an mRNA, a gRNA, a nucleic acid encoding the gRNA, and a template nucleic acid (i.e. a donor nucleic acid) . In some embodiments, the method comprises administering the mRNA and the gRNA formulated in a single LNP composition. In some embodiments, the method comprises administering the mRNA and the gRNA formulated in two LNP compositions.

[0116] In yet another aspect, the present disclosure provides a gRNA formulation comprising the guide RNA as described in this disclosure or a polynucleotide encoding said guide RNA.

[0117] In some embodiments, the polynucleotide is a DNA. In some embodiments, the polynucleotide is presented in a vector.

[0118] In some embodiments, the gRNA formulation further comprises an RNA-guided DNA binding agent or a polynucleotide that encodes said RNA-guided DNA binding agent; preferably, the RNA-guided DNA binding agent is Cas9. In some embodiment, the polynucleotide is a DNA or RNA; preferably, the polynucleotide is an mRNA; optionally, the mRNA is a modified RNA. In some embodiments, the polynucleotide comprises a sequence with at least 90%, 95%, 96%, 97%, 98%, 99%, 100%identity to SEQ ID NO: 500 or 501. In some embodiments, the mRNA encoding the RNA-guided DNA binding agent comprises an open reading frame (ORF) comprising a sequence that is at least 90%identical to SEQ ID NO: 502. Preferably, the uridine of the mRNA is substituted with a modified uridine. More preferably, the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine the N1-methyl-pseudouridine. Optionally, at least 10%of the uridine of the mRNA is substituted with a modified uridine, wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine; preferably, 100%of the uridine is substituted with a modified uridine, wherein the modified uridine is N1-methyl-pseudouridine.

[0119] In some embodiments, the gRNA formulation further comprises: (i) an ionizable lipid; (ii) a neutral lipid; (iii) a helper lipid; (iv) a stealth lipid; or (v) a combination of any two or more of (i) - (iv) . In some embodiments, the gRNA formulation comprises: an ionizable lipid, a neutral lipid, a helper lipid, and a stealth lipid.

[0120] In some embodiments, the ionizable lipid is selected from any compound as described in this disclosure. Preferably, the ionizable lipid is GY1453 or GY1480.

[0121] In some embodiments, the ionizable lipid is present in a concentration ranging from 40 mol %to 50 mol %of the total lipid component. Optionally, the ionizable lipid is present in a concentration ranging from 45 mol %to 49.5 mol %of the total lipid component. Preferably, the ionizable lipid is present in a concentration ranging from 46.3 mol %to 49.5 mol %of the total lipid component. In some embodiments, the ionizable lipid is present in a concentration of 40 mol %, 40.1 mol %, 40.2 mol %, 40.3 mol %, 40.4 mol %, 40.5 mol %, 40.6 mol %, 40.7 mol %, 40.8 mol %, 40.9 mol %, 41 mol %, 41.1 mol %, 41.2 mol %, 41.3 mol %, 41.4 mol %, 41.5 mol %, 41.6 mol %, 41.7 mol %, 41.8 mol %, 41.9 mol %, 42 mol %, 42.1 mol %, 42.2 mol %, 42.3 mol %, 42.4 mol %, 42.5 mol %, 42.6 mol %, 42.7 mol %, 42.8 mol %, 42.9 mol %, 43 mol %, 43.1 mol %, 43.2 mol %, 43.3 mol %, 43.4 mol %, 43.5 mol %, 43.6 mol %, 43.7 mol %, 43.8 mol %, 43.9 mol %, 44 mol %, 44.1 mol %, 44.2 mol %, 44.3 mol %, 44.4 mol %, 44.5 mol %, 44.6 mol %, 44.7 mol %, 44.8 mol %, 44.9 mol %, 45 mol %, 45.1 mol %, 45.2 mol %, 45.3 mol %, 45.4 mol %, 45.5 mol %, 45.6 mol %, 45.7 mol %, 45.8 mol %, 45.9 mol %, 46 mol %, 46.1 mol %, 46.2 mol %, 46.3 mol %, 46.4 mol %, 46.5 mol %, 46.6 mol %, 46.7 mol %, 46.8 mol %, 46.9 mol %, 47 mol %, 47.1 mol %, 47.2 mol %, 47.3 mol %, 47.4 mol %, 47.5 mol %, 47.6 mol %, 47.7 mol %, 47.8 mol %, 47.9 mol %, 48 mol %, 48.1 mol %, 48.2 mol %, 48.3 mol %, 48.4 mol %, 48.5 mol %, 48.6 mol %, 48.7 mol %, 48.8 mol %, 48.9 mol %, 49 mol %, 49.1 mol %, 49.2 mol %, 49.3 mol %, 49.4 mol %, 49.5 mol %, 49.6 mol %, 49.7 mol %, 49.8 mol %, 49.9 mol %or 50 mol %of the total lipid component.

[0122] In some embodiments, the neutral lipid is selected from the group consist of: distearoylphosphatidylcholine (DSPC) , dioleoylphosphatidylcholine (DOPC) , dipalmitoylphosphatidylcholine (DPPC) , dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) , dioleoyl-phosphatidylethanolamine (DOPE) , palmitoyloleoylphosphatidylcholine (POPC) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1 carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) and 1, 2-dielaidoyl-sn-glycero-3-phosphoethanolamine (transDOPE) ; preferably the neutral lipid is DSPC.

[0123] In some embodiments, the neutral lipid is present in a concentration ranging from 5 mol %to 15 mol %of the total lipid component; preferably, the neutral lipid is present in a concentration ranging from 8.5 mol %to 10.5 mol %of the total lipid component. In some embodiments, the neutral lipid is present in a concentration of 5.0 mol %, 5.1 mol %, 5.2 mol %, 5.3 mol %, 5.4 mol %, 5.5 mol %, 5.6 mol %, 5.7 mol %, 5.8 mol %, 5.9 mol %, 6.0 mol %, 6.1 mol %, 6.2 mol %, 6.3 mol %, 6.4 mol %, 6.5 mol %, 6.6 mol %, 6.7 mol %, 6.8 mol %, 6.9 mol %, 7.0 mol %, 7.1 mol %, 7.2 mol %, 7.3 mol %, 7.4 mol %, 7.5 mol %, 7.6 mol %, 7.7 mol %, 7.8 mol %, 7.9 mol %, 8.0 mol %, 8.1 mol %, 8.2 mol %, 8.3 mol %, 8.4 mol %, 8.5 mol %, 8.6 mol %, 8.7 mol %, 8.8 mol %, 8.9 mol %, 9.0 mol %, 9.1 mol %, 9.2 mol %, 9.3 mol %, 9.4 mol %, 9.5 mol %, 9.6 mol %, 9.7 mol %, 9.8 mol %, 9.9 mol %, 10.0 mol %, 10.1 mol %, 10.2 mol %, 10.3 mol %, 10.4 mol %, 10.5 mol %, 10.6 mol %, 10.7 mol %, 10.8 mol %, 10.9 mol %, 11.0 mol %, 11.1 mol %, 11.2 mol %, 11.3 mol %, 11.4 mol %, 11.5 mol %, 11.6 mol %, 11.7 mol %, 11.8 mol %, 11.9 mol %, 12.0 mol %, 12.1 mol %, 12.2 mol %, 12.3 mol %, 12.4 mol %, 12.5 mol %, 12.6 mol %, 12.7 mol %, 12.8 mol %, 12.9 mol %, 13.0 mol %, 13.1 mol %, 13.2 mol %, 13.3 mol %, 13.4 mol %, 13.5 mol %, 13.6 mol %, 13.7 mol %, 13.8 mol %, 13.9 mol %, 14.0 mol %, 14.1 mol %, 14.2 mol %, 14.3 mol %, 14.4 mol %, 14.5 mol %, 14.6 mol %, 14.7 mol %, 14.8 mol %, 14.9 mol %, 15.0 mol %.

[0124] In some embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0. In some embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0; about 4.2: 1.0; about 4.3: 1.0; about 4.4: 1.0; about 4.5: 1.0; about 4.6: 1.0; about 4.7: 1.0; about 4.8: 1.0; or about 4.9: 1.0.

[0125] In some embodiments, the helper lipid is steroid, preferably, the steroid is cholesterol. In some embodiments, the helper lipid is present in a concentration ranging from 35 mol %to 55 mol %of the total lipid component; preferably, the helper lipid is present in a concentration ranging from 40 mol %to 50 mol %of the total lipid component.

[0126] In some embodiments, the helper lipid is present in a concentration of 40.0 mol %, 40.1 mol %, 40.2 mol %, 40.3 mol %, 40.4 mol %, 40.5 mol %, 40.6 mol %, 40.7 mol %, 40.8 mol %, 40.9 mol %, 41.0 mol %, 41.1 mol %, 41.2 mol %, 41.3 mol %, 41.4 mol %, 41.5 mol %, 41.6 mol %, 41.7 mol %, 41.8 mol %, 41.9 mol %, 42.0 mol %, 42.1 mol %, 42.2 mol %, 42.3 mol %, 42.4 mol %, 42.5 mol %, 42.6 mol %, 42.7 mol %, 42.8 mol %, 42.9 mol %, 43.0 mol %, 43.1 mol %, 43.2 mol %, 43.3 mol %, 43.4 mol %, 43.5 mol %, 43.6 mol %, 43.7 mol %, 43.8 mol %, 43.9 mol %, 44.0 mol %, 44.1 mol %, 44.2 mol %, 44.3 mol %, 44.4 mol %, 44.5 mol %, 44.6 mol %, 44.7 mol %, 44.8 mol %, 44.9 mol %, 45.0 mol %, 45.1 mol %, 45.2 mol %, 45.3 mol %, 45.4 mol %, 45.5 mol %, 45.6 mol %, 45.7 mol %, 45.8 mol %, 45.9 mol %, 46.0 mol %, 46.1 mol %, 46.2 mol %, 46.3 mol %, 46.4 mol %, 46.5 mol %, 46.6 mol %, 46.7 mol %, 46.8 mol %, 46.9 mol %, 47.0 mol %, 47.1 mol %, 47.2 mol %, 47.3 mol %, 47.4 mol %, 47.5 mol %, 47.6 mol %, 47.7 mol %, 47.8 mol %, 47.9 mol %, 48.0 mol %, 48.1 mol %, 48.2 mol %, 48.3 mol %, 48.4 mol %, 48.5 mol %, 48.6 mol %, 48.7 mol %, 48.8 mol %, 48.9 mol %, 49.0 mol %, 49.1 mol %, 49.2 mol %, 49.3 mol %, 49.4 mol %, 49.5 mol %, 49.6 mol %, 49.7 mol %, 49.8 mol %, 49.9 mol %, or 50.0 mol %.

[0127] In some embodiments, the molar ratio of ionizable lipid to helper lipid ranges from about 1.0: 0.9 to about 1.0: 1.2.

[0128] In some embodiments, the stealth lipid is a pegylated lipid. In some embodiments, the pegylated lipid is selected from the group consist of: pegylated diacylglycerol (PEG-DAG) , 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2′, 3′-di (tetradecanoyloxy) propyl-1-O- (ω-methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ω-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecanoxy) propyl) carbamate or 2, 3-di (tetradecanoxy) propyl-N- (ω-methoxy (polyethoxy) ethyl) carbamate; preferably, the pegylated lipid is DMG-PEG2000.

[0129] In some embodiments, the stealth lipid is present in a concentration ranging from 1.0 mol %to 3.0 mol %of the total lipid component; preferably, pegylated lipid is present in a concentration ranging from 2.0 mol %to 2.5 mol %of the total lipid component. In some embodiments, the stealth lipid is present in a concentration of 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5 mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol %, 2.0 mol %, 2.2 mol %, 2.2 mol %, 2.3 mol %, 2.4 mol %, 2.5 mol %, 2.6 mol %, 2.7 mol %, 2.8 mol %, 2.9 mol %, or 3.0 mol %of the total lipid component.

[0130] In some embodiments, the molar ratio of ionizable lipid to the stealth lipid ranges from about 100: 1 to about 20: 1.

[0131] In some embodiments, the gRNA formulation comprises an ionizable lipid of GY1480, DSPC, Cholesterol and DMG-PEG2000.

[0132] In some embodiments, the gRNA formulation comprises an ionizable lipid with a concentration ranging from 40 mol %to 50 mol %of the total lipid component; a neutral lipid with a concentration ranging from 5 mol %to 15 mol %of the total lipid component; a helper lipid with a concentration ranging from 35 mol %to 55 mol %of the total lipid component; and a stealth lipid with a concentration ranging from 1.0 mol %to 3.0 mol %of the total lipid component.

[0133] In some embodiments, the gRNA formulation comprises an ionizable lipid with a concentration ranging from 43 mol %to 47 mol %of the total lipid component; a neutral lipid with a concentration ranging from 8 mol %to 12 mol %of the total lipid component; a helper lipid with a concentration ranging from 40 mol %to 50 mol %of the total lipid component; and a stealth lipid with a concentration ranging from 1.5 mol %to 2.5 mol %of the total lipid component.

[0134] In some embodiments, the gRNA formulation comprises an ionizable lipid with a concentration having 46.3 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a helper lipid with a concentration having 42.3 mol %of the total lipid component; and a stealth lipid with a concentration having 2 mol %of the total lipid component.

[0135] In some embodiments, the gRNA formulation comprises an ionizable lipid with a concentration having 40 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a helper lipid with a concentration having 48.6 mol %of the total lipid component; and a stealth lipid with a concentration having 2 mol %of the total lipid component.

[0136] In some embodiments, the gRNA formulation comprises an ionizable lipid with a concentration having 49.5 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a helper lipid with a concentration having 39.1 mol %of the total lipid component; and a stealth with a concentration having 2 mol %of the total lipid component.

[0137] In some embodiments, the gRNA formulation comprises an ionizable lipid with a concentration having 49.5 mol %of the total lipid component; a neutral lipid with a concentration having 9.4 mol %of the total lipid component; a helper lipid with a concentration having 38.6 mol %of the total lipid component; and a stealth lipid with a concentration having 2.5 mol %of the total lipid component.

[0138] In some embodiments, wherein the gRNA formulation has an N / P ratio of about 3-10. In some embodiments, wherein the gRNA formulation has an N / P ratio of about 4-8. In some embodiments, wherein the gRNA formulation has an N / P ratio of about 4, 4.5, 5, 5.5, 6, or 6.5.

[0139] In some embodiments, the gRNA formulation is a lipid nanoparticle (LNP) composition as described in the present disclosure.

[0140] In yet another aspect, the present disclosure provides a gene editing composition comprising: (i) a nucleic acid comprising a sequence with at least 90%, 95%, 96%, 97%, 98%, 99%, 100% identity to SEQ ID NO: 500 or 501; and / or (ii) a guide RNA or a polynucleotide encoding said guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-209. In some embodiments, the polynucleotide encoding said guide RNA is presented in a vector.

[0141] In still yet another aspect, the present disclosure provides a gene editing composition comprising: (i) a nucleic acid comprising a sequence with at least at least 95%, 96%, 97%, 98%, 99%, 100%identity to SEQ ID NO: 500 or 501; and / or (ii) a sgRNA or a vector encoding a sgRNA thereof, wherein the sgRNA comprises a sgRNA sequence selected from SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472.

[0142] In another aspect, this disclosure provides a method of inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene, comprising delivering to a cell: (a) the LPA gene-targeting gRNA as described in this disclosure; (b) the optimized gRNA as described in this disclosure; (c) the LNP composition as described in this disclosure; (d) the gRNA formulation as described in this disclosure; or (e) the gene editing composition as described in this disclosure.

[0143] In another aspect, the present disclosure provides a method of treating, preventing or diagnosing diseases associated with LPA, comprising administering a composition to a subject in need: (a) the LPA gene-targeting gRNA as described in this disclosure; (b) the optimized gRNA as described in this disclosure; (c) the LNP composition as described in this disclosure; (d) the gRNA formulation as described in this disclosure; or (e) the gene editing composition as described in this disclosure. In some embodiments, the present disclosure provides use of (a) the LPA gene-targeting gRNA as described in this disclosure; (b) the optimized gRNA as described in this disclosure; (c) the LNP composition as described in this disclosure; (d) the gRNA formulation as described in this disclosure; or (e) the gene editing composition as described in this disclosure, in the manufacture of a medicament for inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene in a cell or subject. In some embodiments, the present disclosure provides (a) the LPA gene-targeting gRNA as described in this disclosure; (b) the optimized gRNA as described in this disclosure; (c) the LNP composition as described in this disclosure; (d) the gRNA formulation as described in this disclosure; or (e) the gene editing composition as described in this disclosure, for use in inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene in a cell or subject.

[0144] In some embodiments, the optimized gRNA, LNP composition, or the gRNA formulation comprises: (a) a guide RNA comprising a guide sequence selected from SEQ ID NOs: 1-209; (b) a guide RNA comprising at least 17, 18, 19 or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-209; or (d) a guide RNA comprising a guide sequence that with at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, or at least 90%identity to a sequence selected from SEQ ID NOs: 1-209.

[0145] In yet another aspect, the present disclosure provides a method of inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene, comprising delivering to a cell: (a) the LPA gene-targeting gRNA as described in this disclosure; (b) the optimized gRNA as described in this disclosure; (c) the LNP composition as described in this disclosure; (d) the gRNA formulation as described in this disclosure; or (e) the gene editing composition as described in this disclosure.

[0146] In some embodiments, the LNP composition, or the gRNA formulation comprises: (a) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent and (b) a guide RNA comprising: (i) comprising a guide sequence selected from SEQ ID NOs: 1-209; (ii) a guide RNA comprising at least 17, 18, 19 or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-209; or (iii) a guide RNA comprising a guide sequence with at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, or at least 90%identity to a sequence selected from SEQ ID NOs: 1-209.

[0147] The exemplary spacers were designed toward human LPA as listed in Table 2; and the exemplary spacers toward cynomolgus LPA are listed in Table 3. The exemplary guide RNA sequences are listed in Table 4. The exemplary mRNA sequence and the nucleic acid encoding the mRNA are listed in Table 5.

[0148] Table 2: The exemplary spacers were designed toward human LPA

[0149] Table 3: The exemplary spacer toward cynomolgus LPA

[0150] Table 4: The exemplary guide RNA sequences

[0151] Table 5: The exemplary mRNA sequence and the nucleic acid encoding the mRNA

[0152] Beneficial effects:

[0153] The ionizable lipids of the present invention, when incorporated into LNP delivery systems, demonstrate high delivery efficiency coupled with a favorable safety profile (e.g., reduced hepatotoxicity) . Optimized LNP formulations providing enhanced performance in cargo delivery and safty.

[0154] Through advanced gRNA design-including precision spacer selection and scaffold engineering-the platform achieves highly efficient editing with minimal off-target activity. Further optimization of gRNA structure (e.g., the conserved portion) enhances editing efficacy.

[0155] The methods, compositions, and components described herein enable high-efficiency gene editing of LPA through targeted double-stranded break induction, with enhanced safety profiles (e.g., reduced hepatotoxicity) , for treating LPA-associated diseases.Brief description of the drawings

[0156] FIG. 1-FIG. 3 show the indel of dual guide RNAs targeting human LPA gene in primary human hepatocytes.

[0157] FIG. 4-FIG. 7 show the indel of dual guide RNAs targeting cynomolgus monkey LPA gene in primary cynomolgus monkey hepatocytes.

[0158] FIG. 8-FIG. 10 show dose response assays of modified sgRNAs targeting human LPA gene in primary human hepatocytes (PHH) from different donors.

[0159] FIG. 11-FIG. 13 show dose response assays of modified sgRNAs targeting human LPA gene in primary human hepatocytes (PHH) from different donors.

[0160] FIG. 14-FIG. 15 show dose response assays of modified sgRNAs targeting cynomolgus LPA gene in primary cynomolgus hepatocytes (PCH) .

[0161] FIG. 16-FIG. 17 show dose response assays of original and optimized sgRNAs targeting human LPA gene in primary human hepatocytes (PHH) .

[0162] FIG. 18 shows dose response assay of optimized sgRNAs targeting human LPA gene in primary human hepatocytes (PHH) .

[0163] FIG. 19 shows dose response assay of LNPs formulated with original and optimized sgRNAs in primary human hepatocytes (PHH) .

[0164] FIG. 20 shows editing efficiency of LNPs formulated with different optimized sgRNAs in primary human hepatocytes (PHH) at two doses.

[0165] FIG. 21 shows dose response assay of LNPs formulated with spCas9 mRNA Cas001F and sgRNAs targeting cynomolgus LPA gene in primary cynomolgus hepatocytes (PCH) .

[0166] FIG. 22 shows dose response assay of LNPs formulated with original and optimized sgRNAs in primary cynomolgus hepatocytes (PCH) .

[0167] FIG. 23 and FIG. 24 show editing efficiency in the liver (FIG. 23) and reduction of serum Apo (a) protein from baseline (FIG. 24) 6 days after administration in a mouse model carrying human LPA gene.

[0168] FIG. 25 and FIG. 26 show editing efficiency in the liver (FIG. 25) and reduction of serum Apo (a) from baseline (FIG. 26) 6 days after administration of the LNPs formulated with original and optimized sgRNAs in a mouse model carrying human LPA gene.

[0169] FIG. 27 shows serum Apo (a) reduction 6 days after administration of original and optimized sgRNAs in humanized LPA mouse model at 0.2mpk.

[0170] FIG. 28 and FIG. 29 show editing efficiency in the liver (FIG. 28) and reduction of serum Apo (a) from baseline (FIG. 29) 6 days after administration of the LNPs formulated with optimized sgRNAs in a mouse model carrying human LPA gene.

[0171] FIG. 30 and FIG. 31 show editing efficiency in the liver (FIG. 30) and serum Lp (a) reduction (FIG. 31) after administration of LNP formulated with SpCas9 mRNA Cas001F and LPT12 in non-human primates.

[0172] FIG. 32 and FIG. 33 show editing efficiency in the liver (FIG. 32) and serum Lp (a) reduction percent from baseline (FIG. 33) after administration of LNP-GY453 formulated with SpCas9 mRNA Cas001F and CLPA88 sgRNA in non-human primates.

[0173] FIG. 34 and FIG. 35 show editing efficiency in the liver (FIG. 34) and serum Lp (a) reduction (FIG. 35) after administration of the LNP-480 formulated with original and optimized sgRNAs in non-human primates at different doses.

[0174] FIG. 36 shows an exemplary sgRNA (SEQ ID NO: 488) in a possible secondary structure with labels designating individual nucleotides of the conserved region of the sgRNA, including the lower stem, bulge, upper stem, nexus (the nucleotides of which can be referred to as N1 through N18, respectively, in the 5’ to 3’ direction) , and the hairpin region which includes hairpin 1 and hairpin 2 regions. A nucleotide between hairpin 1 and hairpin 2 regions, A nucleotide between hairpin 1 and hairpin 2 is labeled n. A guide region may be present on an sgRNA and in indicated in this figure as “ (N) x” preceding the conserved region of the sgRNA.

[0175] FIG. 37 shows the editing efficiency of targeting LPA in NHP after administration of various LNP formulations.

[0176] FIG. 38A shows the editing efficiency of targeting LPA in NHP after administration of LNP.

[0177] FIG. 38B shows the protein level of LP (a) in NHP after administration of LNP.

[0178] FIG. 38C shows the circulating ALT level in NHP after administration of LNP.

[0179] FIG. 38D shows the circulating AST level in NHP after administration of LNP.

[0180] FIG. 38E shows the circulating total bilirubin level in NHP after administration of LNP.

[0181] FIGs. 38F-38I shows immune response and cytokine activation (TNF-α, IFN-γ, IL-6 and MCP-1) in NHP at 4h and 24 h after LNP administration.

[0182] FIGs. 39A-39C shows the editing efficiency of targeting TTR in PCH of various LNPs.

[0183] FIGs. 40A-40C shows the editing efficiency of targeting TTR in mice after administration of various LNPs.

[0184] FIGs. 41A-41C shows the editing efficiency of targeting TTR in NHP after administration of various LNPs.

[0185] FIG. 42A shows the circulating ALT level in rats after administration of various LNPs. FIG. 42B shows the circulating AST level in rats after administration of various LNPs.

[0186] FIG. 43A shows the circulating ALT level in rats after administration of various LNPs. FIG. 43B shows the circulating AST level in rats after administration of various LNPs.

[0187] FIG. 44A shows the circulating ALT level in rats after administration of various LNPs. FIG. 44B shows the circulating AST level in rats after administration of various LNPs. FIG. 44C-44F shows immune response and cytokine activation (TNF-α, IFN-γ, IL-6 and MCP-1) in rats at 4h and 24 h after LNP administration.

[0188] FIG. 44G shows the pathological hematoxylin and eosin staining analysis of liver sections from LNP treated rats. Detailed description of the present disclosure

[0189] Reference will now be made in detail to certain embodiments of the disclosure, examples of which are illustrated in the accompanying drawings. While the disclosure will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the disclosure to those embodiments. On the contrary, the disclosure is intended to cover all alternatives, modifications, and equivalents, which may be included within the disclosure as defined by the appended claims.

[0190] It should be noted that as used in this disclosure (as well as in the appended claims) , the singular forms or the terms “a” , “an” , “the” and similar terms used in the context of the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In some embodiments, the above terms can be reasonably comprehended as “one” or “one or more” . Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0191] Unless otherwise indicated, all singular and plural terms used herein are intended to encompass their respective singular and plural forms. Additionally, terms used in the present tense are intended to encompass their past and future tense forms, and vice versa, as appropriate depending on the context of the description. This interpretation applies to all terms used in the specification, claims, and drawings, unless explicitly stated otherwise. For example, the term “cell” may refer to a single cell or multiple cells.

[0192] Numeric ranges are inclusive of the numbers defining the range. Measured and measurable values are understood to be approximate, taking into account significant digits and the error associated with the measurement. Also, the use of “comprise” , “comprises” , “comprising” , “contain” , “contains” , “containing” , “include” , “includes” , and “including” are not intended to be limiting. It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the teachings.

[0193] Unless specifically noted in the above specification, embodiments in the specification that recite “comprising” various components are also contemplated as “consisting of’ or “consisting essentially of” the recited components; embodiments in the specification that recite “consisting of” various components are also contemplated as “comprising” or “consisting essentially of” the recited components; and embodiments in the specification that recite “consisting essentially of” various components are also contemplated as “consisting of” or “comprising” the recited components (this interchangeability does not apply to the use of these terms in the claims) . The term “or” is used in an inclusive sense, i.e., equivalent to “and / or, ” unless the context clearly indicates otherwise.

[0194] The section headings used herein are for organizational purposes only and are not to be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined in this specification or any other express content of this specification, this specification controls. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.

[0195] Unless stated otherwise, the following terms and phrases as used herein are intended to have the following meanings:

[0196] The use of “or” or “ / ” is inclusive and means “and / or” unless stated otherwise; or it could be interpreted differently based on the context.

[0197] When “t” or “T” appears in a sequence in this disclosure as a nucleotide of an RNA sequence, it should be understood as “u” or “U” .

[0198] As used in this disclosure, the term “exemplary” is used herein to mean serving as an example, instance, or illustration. Any aspect or design described herein as “exemplary” is not necessarily to be construed as preferred or advantageous over other aspects, embodiments, or designs.

[0199] As used in this disclosure, the term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0200] As used in this disclosure, “as defined in” is a term of art that imports the complete technical and legal boundaries of a referenced portion of the disclosure (e.g., claim, embodiment, or defined term) , requiring strict conformity to: (i) the literal text, (ii) inherent technical properties, and (iii) express scope limitations of the referenced material, without modification or extrapolation.

[0201] As used in this disclosure, the “guide RNA” or “gRNA” are used herein interchangeably to refer to either a crRNA (also known as CRISPR RNA) , or the combination of a crRNA and a trRNA (also known as tracrRNA) . The crRNA and tracrRNA may be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA) . “Guide RNA” or “gRNA” refers to each type. The trRNA may be a naturally-occurring sequence, or a trRNA sequence with modifications or variations compared to naturally-occurring sequences.

[0202] Guide RNAs can include modified RNAs as described herein. In some embodiments, the gRNA comprises scaffold.

[0203] In some embodiments, the gRNA comprises one or more hairpin region, one or more upper stem (US) region, one or more lower stem (LS) region, one or more nexus, one or more bulge, 3’ tail, or combinations thereof. Example of sequence of scaffold in linear view as shown in FIG. 36. In some embodiments, the gRNA comprises LS region that when viewed linearly, is separated by a bulge and US region. As shown in FIG. 36, “USn” means the position of the nucleotides in the US region (e.g. US1 through US12 means the first nucleotide through the twelfth nucleotide of US region) . “LSn” means the position of the nucleotides in the LS region (e.g. LS1 through LS12 means the first nucleotide through the twelfth nucleotide of LS region) . “Bn” means the position of the nucleotides in the bulge (e.g. B1 through B6 means the first nucleotide through the six nucleotide of bulge) . In some embodiments, the gRNA comprises one or more hairpin regions. In some embodiments, the hairpin region is downstream of (e.g., 3’ to) the Nexus region. In some embodiments, the region of nucleotides immediately downstream of Nexus region is termed “hairpin 1” or “H1” . As shown in FIG. 36, “H1-n” means the position of the nucleotides in the hairpin 1 region (e.g. H1-1 through H1-12 means the first nucleotide through the twelfth nucleotides of the hairpin 1 region) . In some embodiments, the region of nucleotides 3’ to hairpin 1 is termed “hairpin 2” or “H2” . As shown in FIG. 36, “H2-n” means the position of the nucleotides in the hairpin 2 region (e.g. H2-1 through H2-15 means the first nucleotide through the fifteenth nucleotide of the hairpin 2 region) . In some embodiments, one or more nucleotides is present between the hairpin 1 and the hairpin 2. In some embodiments, the hairpin region comprises both hairpin 1 and hairpin 2. In some embodiments, the gRNA comprises hairpin 1 or hairpin 2. In some embodiments, the gRNA comprises one or more nucleotides deletion in hairpin 1. A homologous tracrRNA should possess the same secondary structure (not shown) within the scope of its sequence as exemplified in this instance.

[0204] In some embodiments, the gRNA comprises replacement of hairpin 1 with one or more nucleotides. In some embodiments, the hairpin 1 region of an gRNA is replaced by 2 nucleotides. In some embodiments, the gRNA comprises 3’ tail, which comprises nucleotides after the hairpin region (s) in 3’ end. In some embodiments, the 3’ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides, e.g. that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ tail region comprises 5 nucleotides that are not associated with the secondary structure of a hairpin.

[0205] As used in this disclosure, the term “nucleotide” when used in reference to a sequence shall mean a covalently linked monomeric unit within a polynucleotide chain.

[0206] As used in this disclosure, “immediately before” a specified nucleotide refers to insertion of one or more nucleotides directly adjacent to the 5’ end of that nucleotide, such that the inserted nucleotide (s) become (s) directly covalently linked to the specified nucleotide (e.g., 5’ phosphate group of the specified nucleotide) , with no intervening nucleotides between them. Conversely, “immediately after” a specified nucleotide refers to insertion directly adjacent to its 3’ end, wherein the inserted nucleotide (s) form (s) a direct covalent linkage with the specified nucleotide (e.g., the 3’ hydroxyl group of the specified nucleotide) , leaving no nucleotides between them.

[0207] As used in this disclosure, the term “original loop” refers to the unmodified loop structure of a guide RNA (gRNA) , as found in its native or engineered form prior to any deliberate nucleotide insertion, deletion, or substitution within said loop region. This loop is characterized by its position within the gRNA secondary structure, typically flanked by base-paired stem regions, and comprises a specific nucleotide sequence of defined length and composition in its pre-altered state.

[0208] As used in this disclosure, the “RNA-guided DNA binding agent” means a polypeptide or complex of polypeptides having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA binding activity is sequence-specific and depends on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavases / nickases and inactivated forms thereof ( “dCas DNA binding agents” ) . “Cas nuclease” , as used herein, encompasses Cas cleavases, Cas nickases, and dCas DNA binding agents. Cas cleavases / nickases and dCas DNA binding agents include a Csm or Cmr complex of a type III CRISPR system, the CaslO, Csml, or Cmr2 subunit thereof, a Cascade complex of a type I CRISPR system, the Cas3 subunit thereof, and Class 2 Cas nucleases. As used herein, a “Class 2 Cas nuclease” is a single-chain polypeptide with RNA-guided DNA binding activity, such as a Cas9 nuclease or a Cpfl nuclease. Class 2 Cas nucleases include Class 2 Cas cleavases and Class 2 Cas nickases (e.g., H840A, D10A, or N863A variants) , which further have RNA-guided DNA cleavases or nickase activity, and Class 2 dCas DNA binding agents, in which cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants) , HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants) , eSPCas9 (1.0) (e.g, K810A, K1003A, R1060A variants) , and eSPCas9 (l. l) (e.g., K848A, K1003A, R1060A variants) proteins and modifications thereof. Cpfl protein, Zetsche et al, Cell, 163: 1-13 (2015) , is homologous to Cas9, and contains a RuvC-like nuclease domain. Cpfl sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Zetsche, Tables SI and S3. “Cas9” encompasses Spy Cas9, and the functional the variants of Cas9, and equivalents thereof.

[0209] In some embodiments, the heterologous functional domain may facilitate transport of the RNA-guided DNA-binding agent into the nucleus of a cell. For example, the heterologous functional domain may be a nuclear localization signal (NLS) . In some embodiments, the RNA-guided DNA-binding agent may be fused with more than one NLS. In some embodiments, the NLS may be a monopartite sequence, such as, e.g., the SV40 NLS. In a specific embodiment, a SV40 NLS may be linked at the C-terminus of the RNA-guided DNA-binding agent. One or more linkers are optionally included at the fusion site.

[0210] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a purification tag and / or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST) , chitin binding protein (CBP) , maltose binding protein (MBP) , thioredoxin (TRX) , poly (NANP) , tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP) , poly-His, and calmodulin. In a specific embodiment, the marker domain is a FLAG.

[0211] As used in this disclosure, “mRNA” refers to a polynucleotide that is RNA or modified RNA and comprises an open reading frame (ORF) that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and amino-acylated tRNAs) . In some embodiments, mRNA can comprise a phosphate-sugar backbone including ribose residues or analogs thereof, e.g., 2’-methoxy ribose residues. In some embodiments, the sugars of a nucleic acid phosphate-sugar backbone consist essentially of ribose residues, 2’-methoxy ribose residues, or a combination thereof.

[0212] In some embodiments, the mRNA may comprise a modified uridine, such as pseudouridine, N1-methyl pseudouridine, or 5 -methoxy uridine substitution at one, a plurality of, or all uridine positions. In some embodiments, the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine the N1-methyl-pseudouridine.

[0213] In some embodiments, the mRNA comprises at least one UTR from an expressed mammalian mRNA, such as a constitutively expressed mRNA. An mRNA is considered constitutively expressed in a mammal if it is continually transcribed in at least one tissue of a healthy adult mammal. In some embodiments, the mRNA comprises a 5’ UTR; 3’ UTR; or 5’ and 3’ UTRs from an expressed mammalian RNA, such as a constitutively expressed mammalian mRNA. In some embodiments, the mRNA comprises a Kozak sequence. The Kozak sequence can affect translation initiation and the overall yield of a polypeptide translated from an mRNA. A Kozak sequence includes a methionine codon that can function as the start codon. A minimal Kozak sequence is NNNRUGN wherein at least one of the following is true: the first N is A or G and the second N is G. In the context of a nucleotide sequence, R means a purine (Aor G) . In some embodiments, an mRNA disclosed herein comprises a 5’ cap, such as a Cap-0, Cap-1, or Cap22. A 5’ cap is generally a 7-methylguanine ribonucleotide (which may be further modified) linked through a 5’-triphosphate to the 5’ position of the first nucleotide of the 5’-to-3’ chain of the mRNA, i.e., the first cap-proximal nucleotide. In some embodiments, the mRNA further comprises a poly-adenylated (poly-A) tail. In some embodiments, the poly-Atail comprises at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, optionally up to 300 adenines. In some embodiments, the poly-Atail is “interrupted” with one or more non-adenine nucleotide “anchors” at one or more locations within the poly-Atail.

[0214] As used in this disclosure, a first sequence is considered to comprise a sequence with (at least) “X%identity to” (the homology or similar description) a second sequence if an alignment of the first sequence to the second sequence shows that X%or more of the positions of the second sequence in its entirety are matched by the first sequence. For example, the sequence AAGA comprises a sequence with 100%identity to the sequence AAG because an alignment would give 100%identity in that there are matches to all three positions of the second sequence. The differences between RNA and DNA (generally the exchange of uridine for thymidine or vice versa) and the presence of nucleoside analogs such as modified uridines do not contribute to differences in identity or complementarity among polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement) . Thus, for example, the sequence 5’-AXG where X is any modified uridine, such as pseudouridine, Nl-methyl pseudouridine, or 5-methoxy uridine, is considered 100%identical to AUG in that both are perfectly complementary to the same sequence (5’ -CAU) .

[0215] As used in this disclosure, the term “modification” , “modifications” and “modified” , which can be used interchangeably, in the context of an oligonucleotide or polynucleotide or guide RNA (s) includes but is not limited to (a) end modifications, e.g., 5’ end modifications or 3’ end modifications, (b) non-terminal modifications, (c) nucleobase (or “base” ) modifications, including replacement or removal of bases, (d) sugar modifications, including modifications at the 2’ , 3’ , and / or 4’ positions, and (e) backbone modifications, including modification or replacement of the phosphodiester linkages. The term “modified nucleotide” generally refers to a nucleotide having a modification to the chemical structure of one or more of the bases, the sugar, and the phosphodiester linkage or backbone portions, including nucleotide phosphates.

[0216] Exemplary types of modifications used in this disclosure include:

[0217] (a) 2’-O-methyl modifications

[0218] Modified sugars are believed to control the puckering of nucleotide sugar rings, a physical property that influences oligonucleotide binding affinity for complementary strands, duplex formation, and interaction with nucleases. Substitutions on sugar rings can therefore alter the confirmation and puckering of these sugars. For example, 2’-O-methyl (2’-O-Me) modifications can increase binding affinity and nuclease stability of oligonucleotides, though as shown in the Examples, the effect of any modification at a given position in an oligonucleotide needs to be empirically determined.

[0219] The terms "mA, " "mC, " "mU, " or "mG" may be used to denote a nucleotide that has been modified with 2'-O-Me.

[0220] Modification of a ribonucleotide as 2'-O-methyl ribonucleotide can be depicted as follows:

[0221] (b) 2’-fluoro modifications

[0222] Another chemical modification that has been shown to influence nucleotide sugar rings is halogen substitution. For example, 2’-fluoro (2’-F) substitution on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.

[0223] In this application, the terms “fA, ” “fC, ” “fU, ” or “fG” may be used to denote a nucleotide that has been substituted with 2’-F.

[0224] A ribonucleotide without and with a 2’-F substitution can be depicted as follows:

[0225] (c) Phosphorothioate modifications

[0226] Phosphorothioate (PS) linkage or bond refers to a bond where a sulfur is substituted for one nonbridging phosphate oxygen in a phosphodiester linkage, for example in the bonds between nucleotides bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0227] A “*” may be used to depict a PS modification. In this disclosure, the terms A*, C*, U*, or G*may be used to denote a nucleotide that is linked to the next (e.g., 3’ ) nucleotide with a PS bond.

[0228] In this application, the terms “mA*, ” “mC*, ” “mU*, ” or “mG*” may be used to denote a nucleotide that has been substituted with 2’-O-Me and that is linked to the next (e.g., 3') nucleotide with a PS bond. Similarly, the terms “fA*, ” “fC*, ” “fU*, ” or “fG*” may be used to denote a nucleotide that has been substituted with 2'-F and that is linked to the next (e.g., 3') nucleotide with a PS bond. Equivalents of a PS linkage or bond are encompassed by embodiments described herein.

[0229] The diagram below shows the substitution of S-into a nonbridging phosphate oxygen, generating a PS bond in lieu of a phosphodiester bond:

[0230] As used in this disclosure, the “polynucleotide” or “nucleic acid” refers to a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. A nucleic acid “backbone” can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds, phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. Sugar moieties of a nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2’ methoxy or 2’ halide substitutions. Nitrogenous bases can be conventional bases (A, G, C, T, U) , analogs thereof (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine, or others) ; inosine; derivatives of purines or pyrimidines (e.g., N4-methyl deoxyguanosine, deaza-or aza-purines, deaza-or aza-pyrimidines, pyrimidine bases with substituent groups at the 5 or 6 position (e.g., 5-methylcytosine) , purine bases with a substituent at the 2, 6, or 8 positions, 2-amino-6-methylaminopurine, 4-thio-pyrimidines, 4-amino-pyrimidines, and 4-dimethylhydrazine-pyrimidines) . Nucleic acids can include one or more “abasic” residues where the backbone includes no nitrogenous base for position (s) of the polymer. A nucleic acid can comprise only conventional RNA or DNA sugars, bases and linkages, or can include both conventional components and substitutions (e.g., conventional bases with 2’ methoxy linkages, or polymers containing both conventional bases and one or more base analogs) . Nucleic acid includes “locked nucleic acid” (LNA) , an analogue containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhance hybridization affinity toward complementary RNA and DNA sequences. RNA and DNA have different sugar moieties and can differ by the presence of uracil or analogs thereof in RNA and thymine or analogs thereof in DNA.

[0231] As used in this disclosure, the term “alkyl” as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, 5-butyl, t-butyl, s-pentyl, isopentyl, 5-pentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. The alkyl group can be cyclic or acyclic. The alkyl group can be branched or unbranched (i.e., linear) . The alkyl group can also be substituted or unsubstituted. For example, the alkyl group can be substituted with one or more groups including, but not limited to, alkyl, aryl, heteroaryl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfoxo, sulfonate, carboxylate, or thiol. In some embodiments, C1-C18 alkyl described herein may comprise C1 alkyl, C2 alkyl, C3 alkyl, C4 alkyl, C5 alkyl, C6 alkyl, C7 alkyl, C8 alkyl, C9 alkyl, C10 alkyl, C11 alkyl, C12 alkyl, C13 alkyl, C14 alkyl, C15 alkyl, C16 alkyl, C17 alkyl, or C18 alkyl. In some embodiments, the alkyl is branched alkyl or unbranched alkyl.

[0232] As used in this disclosure, the term “alkenyl” , as used herein, refers to an aliphatic group containing at least one carbon-carbon double bond and is intended to include both “unsubstituted alkenyls” and “substituted alkenyls” , the latter of which refers to alkenyl moieties having substituents replacing a hydrogen on one or more carbons of the alkenyl group. Such substituents may occur on one or more carbons that are included or not included in one or more double bonds. Moreover, such substituents include all those contemplated for alkyl groups, as discussed below, except where stability is prohibitive. For example, an alkenyl group may be substituted by one or more alkyl, carbocyclyl, aryl, heterocyclyl, or heteroaryl groups is contemplated. Exemplary alkenyl groups include, but are not limited to, vinyl (-CH=CH2-) , allyl (-CH2CH=CH2) , cyclopentenyl (-C5H7) , and 5-hexenyl (-CH2CH2CH2CH2CH=CH2) . The alkenyl group can be branched or unbranched (i.e., linear) . In some embodiments, C2-C18 alkenyl described herein may comprise C3 alkenyl, C4 alkenyl, C5 alkenyl, C6 alkenyl, C7 alkenyl, C8 alkenyl, C9 alkenyl, C10 alkenyl, C11 alkenyl, C12 alkenyl, C13 alkenyl, C14 alkenyl, C15 alkenyl, C16 alkenyl, C17 alkenyl, or C18 alkenyl. In some embodiments, the alkenyl is branched alkenyl or unbranched alkenyl. In some embodiments, C2-C18 alkynyl described herein may comprise C3 alkynyl, C4 alkynyl, C5 alkynyl, C6 alkynyl, C7 alkynyl, C8 alkynyl, C9 alkynyl, C10 alkynyl, C11 alkynyl, C12 alkynyl, C13 alkynyl, C14 alkynyl, C15 alkynyl, C16 alkynyl, C17 alkynyl, or C18 alkynyl. In some embodiments, the alkynyl is branched alkynyl or unbranched alkynyl.

[0233] As presented in this disclosure, an “alkylene” group refers to a divalent alkyl radical, which may be branched or unbranched (i.e., linear) . Any of the above mentioned monovalent alkyl groups may be converted to an alkylene by abstraction of a second hydrogen atom from the alkyl. Representative alkylenes include C2-4 alkylene and C2-3 alkylene. Typical alkylene groups include, but are not limited to -CH2-, -CH (CH3) -, -C (CH3) 2-, -CH2CH2-, -CH2CH (CH3) -, -CH2C (CH3) 2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, and the like. The alkylene group can also be substituted or unsubstituted. For example, the alkylene group can be substituted with one or more groups including, but not limited to, alkyl, aryl, heteroaryl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfoxo, sulfonate, carboxylate, or thiol, as described herein. In some embodiments, C1-C18 alkylene described herein may comprise C3 alkylene, C4 alkylene, C5 alkylene, C6 alkylene, C7 alkylene, C8 alkylene, C9 alkylene, C10 alkylene, C11 alkylene, C12 alkylene, C13 alkylene, C14 alkylene, C15 alkylene, C16 alkylene, C17 alkylene, or C18 alkylene.

[0234] As used in this disclosure, the term “alkenylene” includes divalent, straight or branched, unsaturated, acyclic hydrocarbyl groups having at least one carbon-carbon double bond and, in one embodiment, no carbon-carbon triple bonds. Any of the above-mentioned monovalent alkenyl groups may be converted to an alkenylene by abstraction of a second hydrogen atom from the alkenyl. Representative alkenylenes include C2-6 alkenylenes. In some embodiments, C2-C18 alkynylene described herein may comprise C3 alkynylene, C4 alkynylene, C5 alkynylene, C6 alkynylene, C7 alkynylene, C8 alkynylene, C9 alkynylene, C10 alkynylene, C11 alkynylene, C12 alkynylene, C13 alkynylene, C14 alkynylene, C15 alkynylene, C16 alkynylene, C17 alkynylene, or C18 alkynylene.

[0235] As presented in this disclosure, the term “Cx-y” , “Cx-Cy” or “Cx” (x or y independently represent integers, such as 1, 2, 3, 4, 5, 67, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18…) , when used in conjunction with a chemical moiety, such as alkyl or alkylene, is meant to include groups that contain from x to y carbons, or x carbons in the chain. And in some embodiments, it may comprise any integer number of carbon atoms between x and y (in some embodiments, for example, C1-8 alkyl may comprise C1 alkyl, C2 alkyl, C3 alkyl, C4 alkyl, C5 alkyl, C6 alkyl, C7 alkyl, or C8 alkyl) . In some embodiments, for example, the term “Cx-y alkyl” (e.g. C1-8 alkyl or C1-18 alkyl) or “Cx-Cy alkyl” (e.g. C1-C8 alkyl or C1-C18 alkyl) herein comprises substituted or unsubstituted saturated hydrocarbon groups, including straight-chain and branched-chain alkyl that contain from x to y carbons in the chain. And for example, C8 alkyl refers to substituted or unsubstituted saturated hydrocarbon groups, including straight-chain and branched-chain alkyl that contain 8 carbons in the chain.

[0236] In some embodiments, -CH2-S-C3-13 alkyl described herein may comprise -CH2-S-C3 alkyl, -CH2-S-C4 alkyl, -CH2-S-C5 alkyl, -CH2-S-C6 alkyl, -CH2-S-C7 alkyl, -CH2-S-C8 alkyl, -CH2-S-C9 alkyl, -CH2-S-C10 alkyl, -CH2-S-C11 alkyl, -CH2-S-C12 alkyl, or -CH2-S-C13 alkyl. In some embodiments, the alkyl is branched alkyl or unbranched alkyl.

[0237] As presented in this disclosure, the term “alkoxy” refers to refers to any alkyl moiety attached through an oxygen bridge (i.e. a -O-C1-3 alkyl group wherein C1-3 alkyl is as defined herein) . Examples of such groups include, but are not limited to, methoxy, ethoxy, and propoxy.

[0238] As used in this disclosure, the term “cycloalkyl” refers to a saturated monocyclic, bicyclic or tricyclic hydrocarbon ring having the specified number of carbon atoms. For example, C3.7 cycloalkyl refers to a cycloalkyl ring having from 3 to 7 carbon atoms. Cycloalkyl groups may be optionally substituted with one or more substituents. Representative examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, bicyclo [2.1.1] hexyl, bicyclo [2.2.1] heptyl, adamantyl and the like. In some embodiments, the atom that forming the cycloalkyl can be substituted with an atom other than carbon, e.g., oxygen, nitrogen (e.g. -NH-, -N (alkyl) -, or -N (aryl) -) , sulfur (e.g. -S-, -S (=O) -, or -S (=O) 2-) .

[0239] As used in this disclosure, the “ionizable lipid (s) ” refer to synthetic amphiphiles incorporating tertiary amine moieties with designed pKa values between 3.0–8.5, 3.0-7.5 or 3.0-6.5, enabling reversible protonation under acidic conditions to form cationic species, while maintaining neutrality at physiological pH. This pH-dependent charge-flip transition drives electrostatic binding to anionic endosomal membranes, inducing non-bilayer phase reorganization that disrupts membrane integrity and mediates cytosolic release of nucleic acid payloads, thereby critically enabling endosomal escape and biological efficacy.

[0240] As used in this disclosure, the “neutral lipid (s) ” suitable for use in a lipid composition of the disclosure include, for example, a variety of neutral, uncharged or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include, but are not limited to, distearoylphosphatidylcholine (DSPC) , dioleoylphosphatidylcholine (DOPC) , dipalmitoylphosphatidylcholine (DPPC) , dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) , dioleoyl-phosphatidylethanolamine (DOPE) , palmitoyloleoylphosphatidylcholine (POPC) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1 carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) and 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (trans DOPE) and combinations thereof. In some embodiments, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC) .

[0241] As used in this disclosure, the “helper lipid (s) ” include steroids, sterols, and alkyl resorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In some embodiments, the helper lipid may be cholesterol.

[0242] As used in this disclosure, the “stealth lipid (s) ” are lipids that alter the length of time the nanoparticles can exist in vivo (e.g., in the blood) . Stealth lipids may assist in the formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipids used herein may modulate pharmacokinetic properties of the LNP. A typical stealth lipid is a polymer conjugated lipid. Stealth lipids suitable for use in a lipid composition of the disclosure include, but are not limited to, stealth lipids having a hydrophilic head group linked to a lipid moiety, such as pegylated diacylglycerol (PEG-DAG) , 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2′, 3′-di (tetradecanoyloxy) propyl-1-O- (ω-methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ω-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecanoxy) propyl) carbamate or 2, 3-di (tetradecanoxy) propyl-N- (ω-methoxy (polyethoxy) ethyl) carbamate and combinations thereof. In some embodiments, the stealth lipids may be DMG-PEG2000.

[0243] As used in this disclosure, the “N / P ratio” is used to refer to the molar ratio of protonatable nitrogen atoms (N) in ionizable lipid components to phosphate groups (P) in the nucleic acid payload within a lipid nanoparticle (LNP) , calculated as total moles of ionizable nitrogen atoms derived from ionizable lipids, helper lipids, or other ionizable constituents divided by total moles of phosphate groups in the encapsulated nucleic acid, wherein this ratio determines net charge and critically influences encapsulation efficiency, particle stability, cellular uptake, and endosomal release efficacy.

[0244] It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment (s) . Reference throughout this specification to “in some embodiment (s) ” or similar expressions means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Furthermore, a particular feature, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the disclosure. For example, in the appended claims, any one of the claimed embodiments can be used in any combination.

[0245] The following examples further illustrate the present disclosure, but the present disclosure is not limited thereto.

[0246] Further Numbered Embodiments

[0247] 1. An ionizable lipid compound of Formula (VII) : L0 and L1 are each independently a bond or C1-C5 alkylene, wherein the C1-C5 alkylene is  optionally substituted with one or more substituents independently selected from the group consisting of halide, hydroxy, or thiol; X1 is selected from a bond, -S-or -O-; X2, X3 are independently selected from -C (=O) O-, -OC (=O) -, -OC (=O) O-, -OC (=O) S-, or  -SC (=O) O-; L2 and L3 are each independently selected from a bond, C3-C9 alkylene, wherein the C3-C9 alkylene  is optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol; L4 and L5 are each independently selected from a bond, C1-C5 alkylene, wherein the C1-C5 alkylene  is optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol; R4 is selected from C1-C18 alkyl, C2-C18 alkenyl; wherein the C1-C18 alkyl and  the C2-C18 alkenyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol; wherein L6, L7, L10 and L11 are each independently a bond or C6-C9 alkenylene; preferably, wherein  L6, L7, L10 and L11 are each independently a bond; R2, R3, R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl; wherein the  C1-C18 alkyl and the C2-C18 alkenyl are each optionally substituted with one or more substituents independently selected from the group consisting of C1-C3 alkyl, halide, hydroxy, or thiol.

[0248] 2. The ionizable lipid compound of embodiment 1, wherein L0 is a bond and L1 is C1-C5 alkylene; preferably, L1 is C2, C3 or C4 alkylene.

[0249] 3. The ionizable lipid compound of any one of embodiments 1-2, wherein X1 is a bond.

[0250] 4. The ionizable lipid compound of any one of embodiments 1-3, wherein X2, X3 are independently selected from -C (=O) O-, -OC (=O) -or -OC (=O) O-.

[0251] 5. The ionizable lipid compound of any one of embodiments 1-4, wherein L2 and L3 are each independently C3-C9 alkylene; preferably, L2 and L3 are each independently C4 alkylene, C5 alkylene, C6 alkylene or C7 alkylene.

[0252] 6. The ionizable lipid compound of any one of embodiments 1-5, wherein L4 and L5 are each independently C1-C3 alkylene.

[0253] 7. The ionizable lipid compound of any one of embodiments 1-6, wherein L4 and L5 are each independently C1-C3 linear alkylene.

[0254] 8. The ionizable lipid compound of any one of embodiments 1-7, wherein R4 is selected from and wherein L10 and L11 are each independently a bond; R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.

[0255] 9. The ionizable lipid compound of any one of embodiments 1-8, wherein R2, R3, R5 and R6 are each independently selected from C4-C12 alkyl.

[0256] 10. The ionizable lipid compound of any one of embodiments 1-9, wherein R2, R3, R5 and R6 are each independently selected from C4-C18 alkyl or C4-C18 alkenyl; preferably, R2, R3, R5 and R6 are each independently selected from C6-C10 linear alkyl; more preferably, R2, R3, R5 and R6 are each independently selected from C7 linear alkyl.

[0257] 11. An ionizable lipid compound of Formula (XI) : or its N-oxide, a pharmaceutically acceptable salt, isomer or prodrug thereof, wherein L0 and L1 are each independently a bond or C1-C5 alkylene; X1 is a bond, -S-or -O-; X2, X3 are independently selected from -C (=O) O-, -OC (=O) -, -OC (=O) O-, -OC (=O) S-, or  -SC (=O) O-; L2 and L3 are each independently C3-C9 alkylene; L4 and L5 are each independently C1-C5 alkylene; L6, L7, L10 and L11 are each independently a bond; R2, R3, R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.

[0258] 12. The ionizable lipid compound of embodiment 11, wherein L0 is a bond and L1 is C1-C5 alkylene; preferably, L1 is C2, C3 or C4 alkylene.

[0259] 13. The ionizable lipid compound of any one of embodiments 11-12, wherein X1 is a bond or -O-.

[0260] 14. The ionizable lipid compound of any one of embodiments 11-13, wherein X2, X3 are independently selected from -C (=O) O-, -OC (=O) -or -OC (=O) O-.

[0261] 15. The ionizable lipid compound of any one of embodiments 11-14, wherein L2 and L3 are each independently C3-C9 alkylene.

[0262] 16. The ionizable lipid compound of any one of embodiments 11-15, wherein L4 and L5 are each independently C1-C3 alkylene.

[0263] 17. The ionizable lipid compound of any one of embodiments 11-16, wherein L10 and L11 are each independently a bond.

[0264] 18. The ionizable lipid compound of any one of embodiments 11-17, wherein R2, R3, R5 and R6 are each independently selected from C4-C18 alkyl or C4-C18 alkenyl; preferably, R2, R3, R5 and R6 are each independently selected from C6-C10 linear alkyl; more preferably, R2, R3, R5 and R6 are each independently selected from C7 linear alkyl.

[0265] 19. The ionizable lipid compound of any one of embodiments 11-18, wherein the compound is not GY1701, GY1702, GY1703, GY1704 or GY1705.

[0266] 20. An ionizable lipid selected from the compound set forth in Table 1.

[0267] 21. A lipid nanoparticle (LNP) composition comprising an ionizable lipid compound of any one of the embodiments 1-20.

[0268] 22. The LNP composition of embodiments 21, wherein the LNP composition further comprises a group consisting of: (i) a neutral lipid; (ii) a steroid; and (ii) a stealth lipid.

[0269] 23. The LNP composition of embodiments 22, wherein the ionizable lipid is present in a concentration ranging from 40 mol %to 50 mol %of the total lipid component. Optionally, the ionizable lipid is present in a concentration ranging from 45 mol %to 49.5 mol %of the total lipid component. Preferably, the ionizable lipid is present in a concentration ranging from 46.3 mol %to 49.5 mol %of the total lipid component.

[0270] 24. The LNP composition of any one of embodiments 22-23, wherein neutral lipid is selected from the group consist of: distearoylphosphatidylcholine (DSPC) , dioleoylphosphatidylcholine (DOPC) , dipalmitoylphosphatidylcholine (DPPC) , dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) , dioleoyl-phosphatidylethanolamine (DOPE) , palmitoyloleoylphosphatidylcholine (POPC) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1 carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) and 1, 2-dielaidoyl-sn-glycero-3-phosphoethanolamine (transDOPE) ; preferably the neutral lipid is DSPC.

[0271] 25. The LNP composition of any one of embodiments 22-24, wherein the neutral lipid is present in a concentration ranging from 5 mol %to 15 mol %of the total lipid component; preferably, the neutral lipid is present in a concentration ranging from 8.5 mol %to 10.5 mol %of the total lipid component.

[0272] 26. The LNP composition of any one of embodiments 22-25, wherein the steroid is cholesterol.

[0273] 27. The LNP composition of any one of embodiments 22-26, wherein the steroid is present in a concentration ranging from 35 mol %to 55 mol %of the total lipid component; preferably, the steroid is present in a concentration ranging from 40 mol %to 50 mol %of the total lipid component.

[0274] 28. The composition of embodiments any one of embodiments 22-27, wherein stealth lipid is a pegylated lipid selected from the group consist of: pegylated diacylglycerol (PEG-DAG) , 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2′, 3′-di (tetradecanoyloxy) propyl-1-O- (ω-methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ω-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecanoxy) propyl) carbamate or 2, 3-di (tetradecanoxy) propyl-N- (ω-methoxy (polyethoxy) ethyl) carbamate; preferably, the pegylated lipid is DMG-PEG2000.

[0275] 29. The LNP composition of any one of embodiments 22-28, wherein the stealth lipid is present in a concentration ranging from 1.0 mol %to 3.0 mol %of the total lipid component; preferably, pegylated lipid is present in a concentration ranging from 2.0 mol %to 2.5 mol %of the total lipid component.

[0276] 30. The LNP composition of any one of embodiments 22-29, wherein the molar ratio of ionizable lipid to neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0. In some embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0; about 4.2: 1.0; about 4.3: 1.0; about 4.4: 1.0; about 4.5: 1.0; about 4.6: 1.0; about 4.7: 1.0; about 4.8: 1.0; or about 4.9: 1.0.

[0277] 31. The LNP composition of any one of embodiments 22-30, wherein the molar ratio of ionizable lipid to steroid ranges from about 1.0: 0.9 to about 1.0: 1.2.

[0278] 32. The LNP composition of any one of embodiments 22-31, wherein the molar ratio of ionizable lipid to the stealth lipid ranges from about 100: 1 to about 20: 1

[0279] 33. The LNP composition of any one of embodiments 22-32, wherein LNP composition comprises: (a) an ionizable lipid of GY1480; (b) DSPC; (c) Cholesterol; and (d) DMG-PEG2000.

[0280] 34. The LNP composition of any one of embodiments 22-33, wherein LNP composition comprises a biologically active agent encapsulated within or associated with the lipid nanoparticle.

[0281] 35. The LNP composition of any one of embodiments 22-34, wherein the biologically active agent comprises a polypeptide or a nucleic acid; preferably, nucleic acid component comprises RNA.

[0282] 36. The LNP composition of any one of embodiments 22-35, wherein the RNA is an mRNA or a gRNA.

[0283] 37. An LPA gene-targeting guide RNA comprising a guide sequence: (i) selected from a nucleotide sequence set forth in any one of SEQ ID NOs: 1-209; (ii) with at least 17, 18, 19, or 20 contiguous nucleotides of any sequence set forth in SEQ ID NOs:  1-209; or (iii) selected from a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%,  92%, 91%, or 90%identity to any sequence set forth in SEQ ID NOs: 1-209.

[0284] 38. An LPA gene-targeting guide RNA comprising: (a) a guide sequence as defined in embodiment 37; and a scaffold sequence selected from any one of: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, and 488.

[0285] 39. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 213; wherein the scaffold sequence comprises a  modification pattern of nucleotides 21-100 of SEQ ID NO: 212 (GUUUUAGAGmCmUmAmGmAmAmAmUmAmGmCmAAGUUAAAAUAAGGCUAGUCCGU UAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGm UmGmCmU*mU*mU*mU*mU) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0286] 40. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 213; wherein the scaffold sequence comprises a  modification pattern of nucleotides 21-100 of SEQ ID NO: 212 (GUUUUAGAGmCmUmAmGmAmAmAmUmAmGmCmAAGUUAAAAUAAGGCUAGUCCGU UAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGm UmGmCmU*mU*mU*mU*mU) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0287] 41. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 424, wherein the sequence of SEQ ID NO: 424 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 423 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0288] 42. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 431, wherein the sequence of SEQ ID NO: 431 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 430 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGAGUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0289] 43. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 434, wherein the sequence of SEQ ID NO: 434 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 433 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0290] 44. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 437, wherein the sequence of SEQ ID NO: 437 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 436 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGfGfCfAfCfCfGAGUCGG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified, and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0291] 45. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) a guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 440, wherein the sequence of SEQ ID NO: 440 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 439 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGfGfCfAfCfCfGfAfGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0292] 46. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 443, wherein the sequence of SEQ ID NO: 443 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 442 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0293] 47. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 446, wherein the sequence of SEQ ID NO: 446 comprises  a modification pattern of nucleotides 21-91 of SEQ ID NO: 445 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAACGGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0294] 48. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a sequence of SEQ ID NO: 449, wherein the sequence of SEQ ID NO: 449 comprises a  modification pattern of nucleotides 21-91 of SEQ ID NO: 448 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAAGGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0295] 49. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 452, wherein the sequence of SEQ ID NO: 452 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 451 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAGGAAACGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0296] 50. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 455, wherein the sequence of SEQ ID NO: 455 comprises  a modification pattern of nucleotides 21-89 of SEQ ID NO: 454 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAGAAACGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0297] 51. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 458, wherein the sequence of SEQ ID NO: 458 comprises  a modification pattern of nucleotides 21-91 of SEQ ID NO: 457 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAACGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0298] 52. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 462, wherein the sequence of SEQ ID NO: 462 comprises  a modification pattern of nucleotides 21-91 of SEQ ID NO: 461 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAACGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.

[0299] 53. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 466, wherein the sequence of SEQ ID NO: 466 comprises  a modification pattern of nucleotides 21-91 of SEQ ID NO: 465 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAAGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.

[0300] 54. The LPA gene-targeting guide RNA of embodiment 37, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction: (i) the guide sequence as defined in embodiment 37; and (ii) a scaffold sequence of SEQ ID NO: 470, wherein the sequence of SEQ ID NO: 470 comprises  a modification pattern of nucleotides 21-90 of SEQ ID NO: 469 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCACGAAAAGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified .

[0301] 55. The LPA gene-targeting guide RNA of any one of embodiments 37-54, wherein the sgRNA further comprises a modification at the guide sequence.

[0302] 56. The LPA gene-targeting guide RNA of any one of embodiments 37-55, wherein the sgRNA further comprises a modification at the first 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end of the guide sequence.

[0303] 57. The LPA gene-targeting guide RNA of any one of embodiments 37-56, wherein the modification includes a 2’-O-methyl (2’-O-Me) modified nucleotide or 2’-fluoro (2’-F) modified nucleotide.

[0304] 58. The LPA gene-targeting guide RNA of any one of embodiments 37-57, wherein the modification includes a phosphorothioate (PS) bonds between the nucleotides; preferably, the modification includes PS bonds between the first four nucleotides.

[0305] 59. The LPA gene-targeting guide RNA of any one of embodiments 37-58, wherein the sgRNA further comprises (a) PS bonds between the first four nucleotides; or (b) 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end.

[0306] 60. The LPA gene-targeting guide RNA of any one of embodiments 37-59, wherein the sgRNA further comprises a) PS bonds between the first four nucleotides; and (b) 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end.

[0307] 61. A polynucleotide encoding the LPA gene-targeting of any one of embodiments 37 or 38.

[0308] The following is a detailed description of the preferred embodiments of the present disclosure based on the accompanying drawings to illustrate the technical solutions of the present disclosure.

[0309] Example 1: in vitro editing of dual-guides in PHH and PCH using lipofection

[0310] Primary human liver hepatocytes (PHH) cells were thawed and resuspended in hepatocyte thawing medium with supplements (Lonza, Cat. MCHT50) followed by centrifugation at 100 g for 10 minutes. The supernatant was discarded and the pelleted cells resuspended in hepatocyte plating medium (Lonza, Cat. MP100) plus 10%fetal bovine serum. Cells were counted and plated on Ultra Low Adsorption Cell Culture 96-well plates (Liver Biotech, Cat. LV-ULA002-96W) at a density of 40,000 cells / well. Plated cells were allowed to settle and adhere for 24 hours in a tissue culture incubator at 37℃ and 5%CO2 atmosphere. After incubation cells were checked for monolayer formation and media was replaced with hepatocyte culture medium (Lonza, Cat. CC-3198) plus 10%fetal bovine serum.

[0311] Primary cynomolgus monkey hepatocytes (PCH) cells were thawed and resuspended in hepatocyte thawing medium with supplements (Liver Biotech, Cat. LV-Rec001) followed by centrifugation at 50 g for 5 minutes. The supernatant was discarded and the pelleted cells resuspended in hepatocyte plating medium (Liver Biotech, Cat. LV-WEP007) plus 10%fetal bovine serum. Cells were counted and plated on Ultra Low Adsorption Cell Culture 96-well plates (Liver Biotech, Cat. LV-ULA002-96W) at a density of 40,000 cells / well. Plated cells were allowed to settle and adhere for 24 hours in a tissue culture incubator at 37℃ and 5%CO2 atmosphere. After incubation cells were checked for monolayer formation and media was replaced with hepatocyte culture medium (Liver Biotech, Cat. WEM007) .

[0312] Individual crRNA and tracrRNA were renatured before use. Cells were transfected with Lipofectamine RNAiMAX (ThermoFisher, Cat. 13778150) per the manufacturer's protocol. Cells were transfected with a lipoplex containing renatured crRNA (25 / 1.56 nM) , tracrRNA (25 / 1.56 nM) , and SpCas9 mRNA (100 / 6.25 ng) with Lipofectamine RNAiMAX (0.3 μL / well) and OptiMem. Triplicate samples were included in the assay.

[0313] Transfected cells were harvested post-transfection at 72 hours. The genomic DNA was extracted from each well of a 48-well plate using DNA Extraction solution (Denogen (Beijing) Bio Sci &Tech Co. Ltd, Cat. DNS033-48) per manufacturer's protocol. Extracted DNA was quantified by NanoDrop One or Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) , and were stored at -20℃ until use.

[0314] For NGS analysis, primers around the target area within the LPA genes were designed. Additional PCR was performed per the manufacturer's protocols (Illumina) to add adaptor for sequencing. PCR samples were purified by AMPure XP beads. Final amplicons library QC was conducted using the Agilent Bioanalyzer 2100. Illumina deep sequencing was conducted on Illumina iSeq 100 or NestSeq 1000 instrument. The reads were aligned to a reference genome after eliminating those having low quality scores. The resulting files containing the reads were mapped to the reference genome (BAM files) , where reads that overlapped the target region of interest were selected and the number of wild types reads versus the number of reads which contain an insertion, substitution, or deletion was calculated. The editing efficiency (e.g., the “editing percentage” or “percent editing” or “indel frequency” ) is defined as the total number of sequences reads with insertions / deletions ( “indels” ) or substitutions over the total number of sequences reads, including wild type.

[0315] In one set of experiment, PHH cell was transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NOs: 12, 32, 38, 39, 46, 47, 52, 56, 57, 58, 59, 73 or 86) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501 ) . The indel data for the tested LPA dual guide RNAs are shown graphically in FIG. 1. dg-LPT78 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence of SEQ ID NO: 73) shows the highest indel among 13 tested guide RNA.

[0316] Table 6-12 shows the detailed sequence information used.

[0317] Table 6: Detailed sequence information for FIG. 1

[0318] In another set of experiment, PHH cell was transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NOs: 12, 15, 16, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 31, 35, 36, 37, 41, 42, 43, 44, 48, 49, 50, 51, 53, 60, 61, 63, 67 or 70) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501) . The indel data for the tested LPA dual guide RNAs are shown graphically in FIG. 2. LPT25 / 34 / 39 / 44 / 46 / 47 / 52 / 66 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NO: 22 / 31 / 36 / 41 / 43 / 44 / 49 / 63) show indel greater than 70%at a dose of 25 nM while LPT25 / 39 / 46 / 47 / 66 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NOs: 22 / 36 / 43 / 44 / 63) show indel greater than 30%at a dose of 1.56 nM.

[0319] Table 7: detailed sequence information for FIG. 2

[0320] In a similar in vitro study, PHH cell was transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NOs: 12, 39, 43, 63, 71, 76, 81, 82, 83, 85, 87, 88, 91, 92, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 or 114) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501) . The indel data for the tested LPA dual guide RNAs are shown graphically in FIG. 3. LPT42 / 46 / 66 / 107 / 114 / 122 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NOs: 39 / 43 / 63 / 94 / 101 / 109) shows indel greater than 80%at a dose of 25 nM while LPT42 / 46 / 66 shows indel greater than 40%at a dose of 1.56 nM.

[0321] Table 8: Detailed sequence information for FIG. 3

[0322] In a fourth in vitro study, PCH cell were transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NO: 118, 119, 120, 121, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139 or 140) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501) . The indel data for the tested LPA dual guide RNA are shown graphically in FIG. 4. cLPA3 / 4 / 11 / 12 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NO: 120 / 121 / 128 / 129) shows indel greater than 10%at a dose of 25 nM.

[0323] Table 9: Detailed sequence information for FIG. 4

[0324] In another in vitro study, PCH cell were transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NO: 12, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162 or 163) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501) . The indel data for the tested LPA dual guide RNA are shown graphically in FIG. 5. cLPA28 / 29 / 37 / 39 / 43 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NO: 145 / 146 / 154 / 156 / 160) shows indel greater than 30%at a dose of 25 nM.

[0325] Table 10: Detailed sequence information for FIG. 5

[0326] In another in vitro study, PCH cell were transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NOs: 12, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185 or 186) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501) . The indel data for the tested LPA dual guide RNAs are shown graphically in FIG. 6. cLPA53 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NO: 170) shows indel greater than 35%at a dose of 25 nM.

[0327] Table 11: Detailed sequence information for FIG. 6

[0328] In another in vitro study, PCH cell were transfected with lipoplex containing renatured crRNA (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the spacer of the crRNA comprises the sequence selected from SED ID NO: 12, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208 or 209) , tracrRNA (SED ID NO: 210) , and SpCas9 mRNA Cas001F (SED ID NO: 501) . The indel data for the tested LPA dual guide RNA are shown graphically in FIG. 7. cLPA85 / 88 / 91 (the crRNA comprises a modification pattern of SEQ ID NO: 211, and the corresponding spacer of the crRNA comprises the sequence of SED ID NO: 202 / 205 / 208) shows indel greater than 30%at a dose of 25 nM.

[0329] Table 12: Detailed sequence information for FIG. 7

[0330] Example 2: Dose response assays for sgRNA comparison using lipofection

[0331] Single guide RNA with modifications and SpCas9 mRNA Cas001F (SED ID NO: 501) were lipofected into PHH or PCH for sgRNA efficiency comparison. PHH and PCH cell were prepared, treated and analyzed as described above unless otherwise noted. Guides were assayed in an 8-point dose response curve from 30nM to 0.01nM. Triplicate samples were included in the assay. EC50 and EC90 values and top editing results are shown in Tables 14-17. Dose response curves are plotted in FIGs. 8-15

[0332] Table 13 shows the detailed sequence information used.

[0333] Table 13: Detailed sequence information for FIGs. 8-15 and Tables 14-17

[0334] Table 14: Editing efficiency in PHH using lipofection

[0335] Table 15: editing efficiency in PHH using lipofection

[0336] Table 16: editing efficiency in PCH using lipofection

[0337] Table 17: editing efficiency in PCH using lipofection

[0338] Example 3: sgRNA optimization

[0339] sgRNAs with optimized sequences and modifications and SpCas9 mRNA Cas001F (SED ID NO: 501) were tested for efficiency in PHH using lipofection as described above. Original (the original sgRNA comprises a modification pattern of SEQ ID NO: 212) and optimized sgRNAs were assayed at 3 or 4 doses to evaluate dose response. Triplicate samples were included in the assay. FIGs. 16-18 show the editing efficiency results in PHH cell. FIG. 16-FIG. 17 show dose response assays of original and optimized sgRNAs targeting human LPA gene in primary human hepatocytes (PHH) . FIG. 18 shows dose response assay of optimized sgRNAs targeting human LPA gene in primary human hepatocytes (PHH) .

[0340] Table 18 shows the detailed sequence information used.

[0341] Table 18: Detailed sequence information for FIGs. 16-18

[0342] Example 4: Synthesis of the ionizable lipids

[0343] The compounds of the present disclosure may be prepared using methods analogous to those described in PCT / CN2024 / 106309 or conventional synthetic techniques known in the art. A person skilled in the art will readily appreciate that appropriate starting materials and reaction conditions may be selected based on the structural characteristics of the target compounds disclosed herein, guided by general knowledge in the field.

[0344] Representative synthetic routes for compound GY1480 is provided below as illustrative, non-limiting examples.

[0345] Ionizable lipid compound GY1480

[0346] GY1480 can be synthesized through the following steps:

[0347]

[0348] Synthesis of GY1480-1:

[0349]

[0350] To a solution of starting material (5 g, 89 mmol, 1.0 eq. ) in DMF (200 mL) was added DMPA (59 g, 446 mmol, 5 eq. ) under N2. Stir the mixture under UV lamp for 0.5 h. The mixture was concentrated in vacuum to give the residue GY1480-1 (7 g, yield 42%) as yellow oil., which was used in the next step without further purification. LCMS: m / z =377.2 [M+H] +.

[0351] Synthesis of GY1480-2

[0352]

[0353] A solution of intermediate GY1480-1 (7 g, 18.6 mmol, 1.0 eq. ) in THF : H2O=1: 1 (200 mL) was added LiOH (6 g, 149 mmol, 8 eq) at room temperature. The mixture was stirred rt for 16 hours. The reaction mixture was added EA (30ml) and H2O. Then extract with EA (30ml*3) . Dried concentrated to crude product which was further purified by com-flash (EA in PE=0-10%) to afford product GY1480-2 (5 g, yield: 72 %) as yellow oil. LCMS: m / z =363.3 [M+H] +.

[0354] Synthesis of GY1480-3:

[0355]

[0356] A solution of GY1480-2 (5 g, 13.8 mmol, 1.0 eq. ) in DCM (50 mL) was added DMAP (2 g, 16.5 mmol, 1.2 eq. ) , DCC (3.4 g, 16.5 mmol, 1.2 eq) at room temperature. The mixture was stirred rt for 16 hours. The mixture was concentrated in vacuum to give the residue, which was purified by silica column chromatography (PE: EA =0-10%) to give the title compound GY1480-3 (2.6 g, yield: 43 %) as yellow oil. LCMS: m / z =463.3 [M+H] +.

[0357] Synthesis of GY1480-4:

[0358]

[0359] A solution of GY1480-3 (2.6 g, 5.6 mmol, 1.0 eq. ) in DCM (40 mL) was added the methanesulfonic anhydride (1.46 g, 8.4 mmol, 1.5 eq. ) , Et3N (1.7 g, 16.8 mmol, 3 eq. ) at room temperature. The mixture was stirred rt for 16 hours. The mixture was concentrated in vacuum to give the residue, which was purified by silica column chromatography (PE: EA =0-10%) to give the title compound GY1480-4 (2.4 g, yield: 79 %) as yellow oil. LCMS: m / z =541.7 [M+H] +.

[0360] Synthesis of GY1480:

[0361] A solution of GY1480-4 (1.5 g, 2.8 mmol, 2.2 eq. ) in ACN (50 mL) was added 3-aminopropan-1-ol (0.1 g, 1.26 mmol, 1 eq) , K2CO3 (0.5 g, 3.78 mmol, 3 eq) , KI (0.25 g, 1.5 mmol, 1.2 eq) at room temperature. The mixture was stirred 80 ℃ for 16 hours. The mixture was concentrated in vacuum to give the residue, which was purified by silica column chromatography (DCM: MeOH=10: 1) to give the title compound GY1480 (477 mg, yield: 18%) as yellow oil.

[0362]

[0363] 1H NMR (400 MHz, Chloroform-d) δ 4.18 –4.11 (m, 4H) , 3.57 (td, J = 7.1, 5.5 Hz, 2H) , 2.92 –2.82 (m, 4H) , 2.76 –2.59 (m, 4H) , 2.52 –2.32 (m, 14H) , 2.26 (dt, J = 16.8, 6.9 Hz, 4H) , 1.82 –1.58 (m, 18H) , 1.49 (dp, J = 14.4, 7.1 Hz, 8H) , 1.37 –1.22 (m, 37H) , 0.94 –0.84 (m, 12H) . LCMS: m / z =964.7 [M+H] +.

[0364] Example 5: LNP preparation and characterization

[0365] Materials and Methods:

[0366] 1. Nanoparticle Formulation

[0367] LNPs were formulated by mixing an aqueous phase containing nucleic acid with an ethanol phase containing lipids and excipients using a microfluidic chip device as previously described (Chen D, et al. (2012) Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation. J Am Chem Soc 134 (16) : 6948–6951) . Specifically, the ethanol phase contained a mixture of an ionizable lipid, 1, 2-Dioctadecanoyl-sn-glycero-3-phophocholine (DSPC) , cholesterol, and 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2000) . The molar ratio of ionizable lipid / DSPC / Chol / DMG-PEG2000 was 50 / 10 / 38.5 / 1.5 (Except for specially marked LNPs) . The ethanol phase was prepared by solubilizing a mixture. The aqueous phase was prepared in 25 mM citrate buffer with RNA (e.g., mRNA: sgRNA was about 2: 1) . The resulting LNPs were dialyzed against buffer contained 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) in a 30,000 MWCO cassette at room temperature for 2 hours and then extruded through a 0.22 μm sterile filter. The final LNP was stored at -80 ℃ until further use.

[0368] 2. LNP characterization

[0369] LNP particle diameter and polydispersity were measured using dynamic light scattering (DLS) . Dynamic Light Scattering ( “DLS” ) is used to determine the average particle size and polydispersity index ( “PDI” ) of LNP samples. Average particle size and polydispersity are measured by dynamic light scattering (DLS) using a Malvern Zetasizer DLS instrument. Dilute LNP samples in 1x PBS at volumetric ratios of 1: 99 prior to testing. Measure the mean hydrodynamic diameter of each sample by reporting average particle size along with PDI. Zeta potential of the LNP is also measured by Malvern Zetasizer. Samples are diluted at volumetric ratios of 1: 19 in 10 mM NaCl prior to measurement.

[0370] A fluorescence-based assay ( ThermoFisher Scientific) is used to determine the encapsulation efficiency (EE (%) ) , which is calculated as (Total RNA -Free RNA)  / Total RNA. LNP samples are diluted with 1x TE buffer containing 1%Triton-X 100 to a proper concentration to determine total RNA or 1x TE buffer to determine free RNA. Standard curves are prepared by utilizing the starting RNA solution used to make the formulations according to the manufacturer's instructions) .  stain is then added to each of the standards and samples and allowed stain to incubate for approximately 5 minutes at room temperature, in the absence of light. A Tecan INFINITE 200 PRO is used to read the samples with excitation and emission wavelength at 480 nm, 520 nm respectively. Total RNA and free RNA are calculated from the appropriate standard curves after subtracting the fluorescence value of the reagent blank from that of each of the samples.

[0371] Typically, when preparing LNPs, encapsulation was >80%, particle size was <150 nm, and PDI was < 0.2.

[0372] The values for average particle size, polydispersity, and %EE are reported in Table 19-21, for various LNPs.

[0373] Optional LNP composition is listed in Table 22.

[0374] Table 19: Summary of LNP Formulation Data for mice

[0375] Table 20: Summary of LNP Formulation Data for PCH and NHP

[0376] Table 21: Summary of LNP Formulation Data for rats

[0377] Table 22: Summary of LNP compositions

[0378] Table 23: The exemplary sgRNA used herein

[0379] Table 24: The Cas9-encoding DNA sequences and the corresponding RNA

[0380] The mRNA used in the examples is N1-methyl-pseudouridine modified of the uracil.

[0381] Table 25 listed the exemplary sgRNA without modification used herein.

[0382] Table 25: The exemplary sgRNA without modification

[0383] 3. In vitro LNP delivery

[0384] The primary cynomolgus liver hepatocytes (PCH) (TPCS, CCH-100CYS-PQ) were cultured under the manufacturer’s protocol. Cells were seeded in 96-well plates at a density of 30,000 cells per well. After 24 hours, cells were treated with LNPs with 6.25 nM. After 72 hours transfection, cells were washed with PBS and genomic DNA was extracting using QuickExtract DNA Extraction Solution (Epicentre, QE09050) following the manufacturer's recommended protocol.

[0385] LNPs were formulated with in vitro transcribed Cas9 mRNA (SEQ ID NO: 504, Table 24) and chemically modified sgRNA (targeting NHP TTR) (SEQ ID NO: 489, Table 23) as described above. Details for these formulations are provided in Table 20, including average particle size, polydispersity, and encapsulation efficiency. As shown in FIGs. 39A-39C, in vitro editing was observed for each formulation. LNP formulations comprising Lipid GY1410 (LNP018) , GY1411 (LNP019) , GY1412 (LNP020) , GY1413 (LNP021) , GY1414 (LNP022) , GY1415 (LNP023) , GY1416 (LNP024) , GY1417 (LNP025) , GY1424 (LNP026) , GY1425 (LNP027) , GY1426 (LNP028) , GY1427 (LNP029) , GY1430 (LNP030) , GY1431 (LNP031) , GY1432 (LNP032) , GY1433 (LNP033) , GY1439 (LNP034) , GY1449 (LNP035) , GY1450 (LNP036) , GY1452 (LNP037) , GY1453 (LNP038) , GY1455 (LNP039) , GY1456 (LNP040) , GY1457 (LNP041) , GY1457 (LNP041) , GY1458 (LNP042) , GY1459 (LNP043) , GY1460 (LNP044) , GY1418 (LNP107) , GY1419 (LNP108) , GY1422 (LNP109) , GY1423 (LNP110) , GY1428 (LNP111) , GY1429 (LNP112) , GY1474 (LNP201) , GY1475 (LNP202) , GY1476 (LNP203) , GY1479 (LNP204) , GY1480 (LNP205) , GY1497 (LNP206) , GY1498 (LNP207) , GY1499 (LNP208) , GY1500 (LNP209) , GY1489 (LNP210) , GY1490 (LNP211) and GY1501 (LNP212) successfully delivered Cas9 mRNA and edited TTR.

[0386] These results demonstrated delivery of CRISPR / Cas9 cargo to a cynomolgus liver hepatocytes using LNPs with new lipids is promising in vitro (FIGs. 39A-39C) .

[0387] 4. Animal experiments

[0388] All mice were purchased from Charles River Labs. For in vivo nanoparticle screens, 6-week-old female BALB / C mice were injected intravenously via the tail vein with LNPs at a dose of 0.3 mg / kg. At 168 hours post-dose, all animals were euthanized for necropsy. Assessment of clinical signs, body weight, organ weights and histopathology were performed. Liver was cut into small slices, and genomic DNA was extracting using TIANamp Genomic DNA kit following the manufacturer's recommended protocol.

[0389] LNPs were formulated with in vitro transcribed Cas9 mRNA (SEQ ID NO: 504) and chemically modified sgRNA (targeting mouse TTR) (SEQ ID NO: 490) as describedabove. Details for these formulations are provided in Table 19, including average particle size, polydispersity, and encapsulation efficiency. The animals were euthanized 7 days following the dose in each group. As shown in FIGs. 40A-40C, in vivo editing was observed in the livers of animals that received LNPs targeting TTR for each formulation. LNP formulations comprising Lipid GY1410 (LNP001) , GY1411 (LNP002) , GY1412 (LNP003) , GY1413 (LNP004) , GY1414 (LNP005) , GY1415 (LNP006) , GY1416 (LNP007) , GY1417 (LNP008) , GY1424 (LNP009) , GY1425 (LNP010) , GY1426 (LNP011) , GY1427 (LNP012) , GY1430 (LNP013) , GY1431 (LNP014) , GY1432 (LNP015) , GY1433 (LNP016) , GY1418 (LNP101) , GY1419 (LNP102) , GY1422 (LNP103) , GY1423 (LNP104) , GY1428 (LNP105) , GY1429 (LNP106) , GY1479 (LNP214) and GY1480 (LNP215) successfully delivered Cas9 mRNA to liver and edited TTR.

[0390] These results indicate that these LNPs using new lipids have great delivery efficiency of CRISPR / Cas9 cargo in vivo, even saturated editing effect at very low doses.

[0391] LNPs were formulated with in vitro transcribed Cas9 mRNA (SEQ ID NO: 504) and chemically modified sgRNA (targeting NHP TTR) (SEQ ID NO: 489) as described in above. Details for these formulations are provided in Table 20, including average particle size, polydispersity, and encapsulation efficiency. Likewise, LNPs targeted NHP TTR demonstrated robust and sustainable reduction of cynomolgus monkey serum TTR protein from in vivo non-human primary (NHP) studies (data not shown) . For in vivo screens, cynomolgus monkeys were injected intravenously via the vein with LNPs at a dose of 2 mg / kg. For in vivo editing, liver tissue was collected at 14 days and 28 days post-dose through biopsy with the guidance of ultrasound. Liver was cut into small slices, and genomic DNA was extracting using TIANamp Genomic DNA kit following the manufacturer's recommended protocol. And Blood was collected and the serum was isolated as indicated every 7 days post-dose. As shown in FIGs. 41A-41C, in vivo editing was observed in the livers of animals that received LNPs targeting TTR for each formulation. LNP formulations comprising lipid GY1410 (LNP018) , GY1411 (LNP019) , GY1412 (LNP020) , GY1413 (LNP021) , GY1414 (LNP022) , GY1415 (LNP023) , GY1416 (LNP024) , GY1417 (LNP025) , GY1424 (LNP026) , GY1425 (LNP027) , GY1426 (LNP028) , GY1427 (LNP029) , GY1430 (LNP030) , GY1431 (LNP031) , GY1432 (LNP032) , GY1433 (LNP033) , GY1439 (LNP034) , GY1449 (LNP035) , GY1450 (LNP036) , GY1452 (LNP037) , GY1453 (LNP038) , GY1455 (LNP039) , GY1456 (LNP040) , GY1457 (LNP041) , GY1457 (LNP041) , GY1458 (LNP042) , GY1459 (LNP043) , GY1460 (LNP044) , GY1418 (LNP107) , GY1419 (LNP108) , GY1423 (LNP109) , GY1428 (LNP111) , GY1429 (LNP112) , GY1479 (LNP217) and GY1480 (LNP218) successfully delivered Cas9 mRNA to liver and edited TTR. Even the delivery efficiency of individual samples is promising, more than 40%. These results indicate that these LNPs using new lipids have great delivery efficiency of CRISPR / Cas9 cargo in NHP.

[0392] LNPs were formulated with in vitro transcribed Cas9 mRNA (SEQ ID NO: 504) and chemically modified sgRNA (targeting rat TTR) (SEQ ID NO: 491) as described above. Details for these formulations are provided in Table 22, including average particle size, polydispersity, and encapsulation efficiency. All rats were purchased from Charles River Labs. Female Sprague-Dawley rats ranging from 6–8 weeks of age were used. LNP was dosed at 2.5 mg / kg in a dose volume of 7 mL / kg body weight injected intravenously via the tail vein. At 18 hours and 168 hours post-dose, aspartate aminotransferase (AST) , alanine aminotransferase (ALT) and other blood biochemical items were assessed in blood plasma using the Cobas c701 analyser (Roche GmbH, Mannheim, Germany) . At 168 hours post-dose, all animals were euthanized for necropsy. Assessment of clinical signs, body weight, organ weights and histopathology were performed. As shown in FIGs. 42A and 42B, FIGs. 43A and 43B, FIGs. 44A and 44B, ALT and AST were detected in the serum of animals that received LNPs targeting TTR for each formulation. AST and ALT activity was significantly increased in LNP-treated mice, when compared to negative control animals (TSS) . But at 18 hours post-dose, ALT and AST were lower in LNP046, LNP047, LNP048, LNP049, LNP050 and LNP051 treated animals when compared to LNP045-treated rats, which LNP045 was the positive control using the commercial lipid ALC-0315. And LNP113 also had lower ALT and AST than LNP114 at 18 hours post-dose. And LNP402 also had lower ALT and AST than LNP403 at 18 hours post-dose at 2.5 mg / kg. ALT and AST returned to normal 7 days later. This data show that the lipid GY1412, GY1425, GY1427, GY1449, GY1452 and GY1453 and GY1428 had lower liver acute toxicity than ALC-0315, and the acute liver damage was manageable and could be repaired 7 days later. Cytokine TNF-α, IFN-γ, IL-6 and MCP-1 (FIGs. 44C-44F) were analyzed at different time points from blood collected from rats that received an intravenous infusion of 2.5 mg / kg total RNA dose of LNPs. Although we noted moderate rises in aspartate aminotransferase (AST) and alanine aminotransferase (ALT) that were largely resolved by the end of the first week at 3.5 mg / kg of LNP402, no hepatocyte necrosis was observed in pathological section (FIG. 44G) , while LNP403 resulted in significant hepatocyte necrosis at 3 mg / kg. Meanwhile, no hepatocyte necrosis was observed in pathological section at 2.5 mg / kg both in LNP402 and LNP403 (FIG. 44G) . These results indicate that LNPs using new lipid showed better safety compared to previous lipid. Especially, GY1480 caused less cytokine activation, as compared to ALC-0366. And GY1480 not only had lower liver acute toxicity, but also had hypoimmunity than ALC-0366.

[0393] 5. PCR Amplification

[0394] All samples were amplified and prepared for sequencing using a two-step, nested PCR. More specifically, 1 μL of primers (5 uM for Final Reverse / Forward) were added to 5 μL of Kapa HiFi 2X master mix (Roche) , and 4 μL template DNA / water. This first PCR reaction was run for 20 cycles. The second PCR, to add Nextera XT chemistry, indices, and i5 / i7 adapter regions was ran for 5–10 cycles and used the product from ‘PCR 1’ as template. Dual-indexed samples were run on a 2%agarose gel to ensure that PCR reaction occurred before being pooled and gel purified.

[0395] 6. Transthyretin (TTR) ELISA analysis used in animal studies

[0396] Blood was collected and the serum was isolated as indicated. The total NHP TTR serum levels were determined using a human Prealbumin (Transthyretin) ELISA Kit (Abcam, Cat. ab231920) according to manufacture protocol. Briefly, sera were serial diluted with kit sample diluent to a final dilution of 300,000-fold. 100 μL of the prepared standard curve or diluted serum samples were added to the ELISA plate, incubated for 30 minutes at room temperature then washed 3 times with provided wash buffer. 100 μL of detection antibody was then added to each well and incubated for 20 minutes at room temperature followed by 3 washes. 100 μL of substrate is added then incubated for 10 minutes at room temperature before the addition of 100 μL stop solution. The absorbance of the contents was measured on the INFINITE 200 PRO plate reader with analysis using SoftmaxPro version 7.0 software. Serum TTR levels were quantitated off the standard curve using 4 parameters logistic fit and expressed as μg / mL of serum.

[0397] 7. Deep Sequencing

[0398] PCR samples were purified by AMPure XP beads. Final library QC was conducted using the Agilent Bioanalyzer 2100. Illumina deep sequencing was conducted on an Illumina MiniSeqTM. Primers were designed based on Nextera XT adapter sequences.

[0399] 8. Data Analysis

[0400] Sequencing results were processed using a custom python-based tool to extract raw barcode counts for each tissue. These raw counts were then normalized with an R script prior to further analysis. Correlation analyses were run assuming a Gaussian distribution in order to obtain Pearson correlation coefficients. R2 values (0-1) were computed by squaring Pearson correlation coefficients.

[0401] Example 6: Dose response assays using lipid nanoparticle

[0402] Guide RNAs were tested for efficacy in PHH and PCH using lipid nanoparticle to deliver single guide RNA and SpCas9 mRNA 001F (SED ID NO: 501) .

[0403] Lipid nanoparticle LNP-GY1453 contained GY1453, Cholesterol, DSPC, and DMG-PEG2000 in the molar ratios recited in Table 26. LNP-GY1453 were prepared using the Precision MPF-L2TM AITESEN. In general, the lipid nanoparticle components were dissolved in 100%ethanol with the lipid component (GY1453, DSPC, cholesterol, and DMG-PEG2000 in molar ratio of 50: 9: 38: 3) . The RNA cargos were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL. The LNPs were formulated with a lipid amine to RNA phosphate (N: P) molar ratio of about 6, with the ratio of mRNA to gRNA at 2: 1 by weight. RNA in aqueous buffer condition mixed with ethanolic lipid mix, respectively in the volume ratio of 3 parts of RNA and 1 part of lipid mix. After mixing, the LNPs were collected, and then remaining buffer was exchanged into pH 7.5 TSS (contain 5%w / v sucrose, 45 mM NaCl, 50 mM Tris , 100-fold excess of sample volume) , overnight at 4℃ under gentle stirring using a 10 kDa dialysis bag. The resulting mixture was then filtered using a 0.2 um sterile filter. The resulting filtrate was stored at 2-8 ℃.

[0404] Table 26 Prescription of LNP-GY1453

[0405] Lipid nanoparticle LNP-GY1480 contained GY1480, Cholesterol, DSPC, and DMG-PEG2000 in the molar ratios recited in Table 27. LNP-GY1480 were prepared using the Precision MPF-L2TM AITESEN. In general, the lipid nanoparticle components were dissolved in 100%ethanol with the lipid component (GY1480, DSPC, cholesterol, and DMG-PEG2000 in molar ratio of 46.3: 9.4: 42.3: 2) . The RNA cargos were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL. The LNPs were formulated with a lipid amine to RNA phosphate (N: P) molar ratio of about 6, with the ratio of mRNA to gRNA at 2: 1 by weight. RNA in aqueous buffer condition mixed with ethanolic lipid mix, respectively in the volume ratio of 3 parts of RNA and 1 part of lipid mix. After mixing, the LNPs were collected, and then remaining buffer was exchanged into pH 7.5 TSS (contain 5%w / v sucrose, 45 mM NaCl, 50 mM Tris , 100-fold excess of sample volume) , overnight at 4℃ under gentle stirring using a 10 kDa dialysis bag. The resulting mixture was then filtered using a 0.2 um sterile filter. The resulting filtrate was stored at 2-8 ℃.

[0406] Table 27: Prescription of LNP-GY1480

[0407] Dynamic Light Scattering ( “DLS” ) is used to determine the average particle size and polydispersity index ( “PDI” ) and of LNP samples. Average particle size and polydispersity are measured by dynamic light scattering (DLS) using a Malvern Zetasizer DLS instrument. Dilute LNP samples in 1x PBS at volumetric ratios of 1: 99 prior to testing. Measure the mean hydrodynamic diameter of each sample by reporting average particle size along with PDI. Zeta potential of the LNP is also measured by Malvern Zetasizer. Samples are diluted at volumetric ratios of 1: 19 in 10mM NaCl prior to measurement.

[0408] A fluorescence-based assay ( ThermoFisher Scientific) is used to determine the encapsulation efficiency, which is calculated as (Total RNA -Free RNA)  / Total RNA. LNP samples are diluted with1x TE buffer containing 1%Triton-X 100 to a proper concentration to determine total RNA or 1x TE buffer to determine free RNA. Standard curves are prepared by utilizing the starting RNA solution used to make the formulations according to the manufacturer's instructions) .  stain is then added to each of the standards and samples and allowed stain to incubate for approximately 5 minutes at room temperature, in the absence of light. A Tecan INFINITE 200 PRO is used to read the samples with excitation and emission wavelength at 480nm, 520nm respectively. Total RNA and free RNA are calculated from the appropriate standard curves after subtracting the fluorescence value of the reagent blank from that of each of the samples. Typically, when preparing LNPs, encapsulation was >80%, particle size was <120 nm, and pdi was < 0.2

[0409] PHH and PCH cell were prepared as described above. In addition, cells were incubated at 37 ℃ 5%CO2 for 24 hours prior to treatment with LNPs. LNPs were incubated in culture medium (Lonza, Cat. CC-3198) plus 10%fetal cynomolgus serum for PHH or culture medium (Liver Biotech, Cat. WEM007) for PCH at 37 ℃ for 10 minutes. Post-incubation the LNPs were added onto PHH or PCH in 7-point 3-fold dose response curve starting at 30nM to 0.04nM of the sgRNA concentration. In some experiments, the editing efficiency of LNPs were assayed at 30nM and 3.3nM two doses. The cells were lysed 72 hours post-treatment for NGS analysis as described above. Triplicate samples were included in the assay. EC50 and EC90 values and top editing efficiency are shown in Table 30, and the dose response results in PHH are shown in FIGs. 19-20. The dose response results in PCH are shown in FIGs. 21-22.

[0410] Tables 28-29 listed the sequence information used herein.

[0411] Table 28: Detailed sequence information for FIGs. 19-20

[0412] Table 29: Detailed sequence information for FIGs. 21-22

[0413] Table 30: Editing efficiency in PHH using LNP

[0414] Example 7: In vivo testing of LPA gene editing in humanized LPA mouse model

[0415] Guide RNAs were tested for efficacy in humanized LPA mouse model using lipid nanoparticle to deliver single guide RNA and SpCas9 mRNA 001F (SED ID NO: 501) .

[0416] Lipid nanoparticle LNP-ACL0315 contained ACL0315, Cholesterol, DSPC, and ACL0519 in the molar ratios recited in Table 31. LNP-ACL-0315 were prepared using the Precision MPF-L2TM AITESEN. In general, the lipid nanoparticle components were dissolved in 100%ethanol with the lipid component (ALC-0315, DSPC, cholesterol and ALC-0159 in molar ratio of 46.3: 42.7: 389.4: 1.6) . The RNA cargos were dissolved in 25 mM citrate, 100 mM NaCl, pH 5.0, resulting in a concentration of RNA cargo of approximately 0.45 mg / mL. The LNPs were formulated with a lipid amine to RNA phosphate (N: P) molar ratio of about 6, with the ratio of mRNA to gRNA at 2: 1 by weight. RNA in aqueous buffer conditions is mixed with ethanolic lipid mix, respectively in the volume ratio of 3 parts of RNA and 1 part of lipid mix. After mixing, the LNPs were collected, and then remaining buffer was exchanged into PH7.5 TSS (contain 5%w / v sucrose, 45 mM NaCl, 50 mM Tris, 100-fold excess of sample volume) , overnight at 4℃ under gentle stirring using a 30 kDa dialysis bag. The resulting mixture was then filtered using a 0.2 um sterile filter. The resulting filtrate was temporarily stored at 2–8 ℃ and will be stored at -80 ℃ for long-term preservation.

[0417] Table 31: Prescription of LNP-0315

[0418] Selected guides were tested for editing efficiency in vivo. humanized LPA mice, ranging 6-10 weeks of age were used in each study involving mice. Animals were weighed pre-dose for dosing calculations. LNPs were dosed via the lateral tail vein in a volume of 0.2 mL per animal (0.3, 1 or 2 mpk) . The animals were observed at approximately 6 hours post dose for adverse effects. Body weight was measured at twenty-four hours post-administration and animals were euthanized 6 days post-administration by exsanguination under isoflurane anesthesia. Blood was collected via cardiac puncture into serum separator tubes or into tubes containing buffered sodium citrate for plasma as described herein. For studies involving in vivo editing, liver tissue was collected from the left median lobe from each animal for DNA extraction and analysis. For the in vivo studies, genomic DNA was extracted from 10 mg of tissue using a bead-based extraction kit ( (DenoGen, Cat. #DNS033-48) ) according to the manufacturer's protocol which includes homogenizing the tissue in lysis buffer. All DNA samples were normalized to 100 ng / μL concentration for PCR and subsequent NGS analysis, as described in Example 1.

[0419] For the ELISA analysis, the total Lp (A) serum levels were determined using a human Lipoprotein A ELISA kit (abcam, Cat. #ab212165) . Kit reagents and standards were prepared according to the manufacturer's protocol. Mouse serum was diluted with lx assay diluent. Both standard curve dilutions (50 μL each) and diluted serum samples were added to each well of the ELISA plate pre-coated with capture antibody. The plate was incubated at room temperature for 30 minutes before washing. Enzyme-antibody conjugate (50 μL per well) was added for a 1-hour incubation. Unbound antibody conjugate was removed and the plate was washed 3 times before the addition of 100 μL TMB development solution. The plate was incubated for 10 minutes before adding 100 μL of the stop solution. the plate was read on an INFINITE M PLEX plate reader at an absorbance of 450 nm. Serum Lp (A) levels were calculated by GraphPad Prism 9 software using a four-parameter logistic curve fit off the standard curve. Final serum values were adjusted for the assay dilution. Percent knockdown (%KD) values were determined relative to controls, which generally were animals sham-treated with vehicle (transport and storage solution or TSS) unless otherwise indicated.

[0420] In one in vivo study, humanized LPA mice were applied with LNP-0315 containing LPT9 or LPT12 sgRNA with SpCas9 mRNA Cas001F at dose of 0.3, 1 or 2 mpk. FIG. 23 shows the indel for the LNPs containing the sgRNA indicated. FIG. 24 shows the reduction of serum Apo (a) protein from baseline 6 days after LNP treatment.

[0421] In another in vivo study, humanized LPA mice were applied with LNP-GY1480 containing LPT39 / 46 / 47 original and optimized sgRNAs and SpCas9 mRNA Cas001F at a dose of 0.2 or 0.5mpk. FIG. 25 shows the indel for the LNPs containing the sgRNA indicated. FIG. 26 shows the reduction of serum Apo (a) protein from baseline 6 days after administration. FIG. 27 shows the reduction of serum Apo (a) from baseline after treatment at a dose of 0.2mpk.

[0422] In another in vivo study, humanized LPA mice were applied with LNP-GY1480 containing optimized sgRNA LPT46-HP, LPT46-HP1M5 and LPT46-HP2M5 and spCas9 mRNA Cas001F at a dose of 0.2mpk. FIG. 28 shows the indel efficiency in the liver after administration of the LNPs. FIG. 29 shows the reduction of serum Apo (a) protein from baseline post-dosing.

[0423] The detailed sequence information used herein are listed in Table 32.

[0424] Table 32: Detailed sequence information for FIGs. 23-29

[0425] Example 8: In vivo testing of LPA gene editing in non-human primates (NHPs)

[0426] Male or female cynomolgus monkeys ranging 3 to 6 years and weighing from 3.0 to 6.0 kg were used in each in vivo study. Pre-treatment was completed 0.5-1 hour before the administration of the test substance. The animals were injected with diphenhydramine hydrochloride (intravenous injection, 5 mg / kg) , dexamethasone sodium phosphate (intravenous injection, 1 mg / kg) , and ranitidine hydrochloride (intravenous injection, 0.5 mg / kg) in sequence.

[0427] In one in vivo study, the test animals NHP6611 and NHP6621 were administered via intravenous injection, with the LPT12 (SEQ ID NO: 225) at a dosage of 3mg / kg (NHP6611) or CLPA88 (SEQ ID NO: 418) at a dosage of 2mg / kg (NHP6621) . LNPs used in NHP6611 and NHP6621 in vivo study was LNP-GY1453 which contained SpCas9 mRNA Cas001F (SEQ ID NO: 501) and modified sgRNA with a ratio of 2: 1 by weight. Serum was collected on the 3rd, 2nd days before administration and 8th, 15th, 22nd, and 28th days after administration for the detection of Lp (a) level. Liver biopsies were performed on the 8th, 15th, 22nd, and 28th days after administration, with one sample taken from the left lobe (site 1) and another from the right lobe (site 2) of each liver. The extracted liver tissue was used to extract genomic DNA for NGS analysis of editing efficiency.

[0428] FIG. 30 and FIG. 31 show in vivo %editing in the liver and serum Lp (a) reduction result for LPT12 guide on the 28th day after administration, respectively. LPT12 produced around 50%editing of LPA gene and up to 88%Lp (a) level reduction in serum after a 3.0 mpk dose treatment. The reduction of Lp (a) levels maintained for 140 days until when the experiment ended. FIG. 32 and FIG. 33 show editing efficiency in the liver and serum Lp (a) reduction for CLPA88 guide on the 28th day after administration, respectively. CLPA88 produced nearly 55%editing of LPA gene and 77%Lp (a) reduction in serum after 2.0 mpk dose administration.

[0429] In another NHP study, the in vivo efficacy of LNP-GY1480 containing SpCas9 mRNA Cas001F and CLPA53 (SEQ ID NO: 383) or CLPA53HP (SEQ ID NO: 429) sgRNAs at 1.0 mpk, 2.0 mpk and 2.5mpk was evaluated. The experiment design was summarized in Table 33. Serum was collected on the 3rd and 2nd days before administration as well as on the 7th, 14th, 21st and 28th days after administration for Lp (a) level detection. Liver biopsies were performed on the 7th, 14th, 21st and 28th days after administration. The extracted liver tissues were used to extract genomic DNA for NGS analysis. FIG. 34 and FIG. 35 show editing efficiency in the liver (FIG. 34) on the 28th day after administration and the reduction of serum Lp (a) levels from baseline (FIG. 35) after administration.

[0430] Table 33: The experimental design protocol.

[0431] Example 9: Optimization of the formulation

[0432] The values for average particle size, polydispersity, and %EE are reported in Table 34, for various LNPs. And the LNP composition is listed in Table 35.

[0433] Table 34: Summary of LNP Formulation Data for PCH and NHP

[0434] Table 35: Summary of LNP compositions

[0435] LNPs were formulated with in vitro transcribed Cas9 mRNA and chemically modified sgRNA (targeting NHP LPA CLPA53) . Details for these formulations are provided in Table 34, including average particle size, polydispersity, and encapsulation efficiency. And the LNP composition is listed in Table 35. The recipe for LNP304 and LNP305 are the same, but the N / P ratio of LNP304 is 4.5 and the N / P ratio of LNP305 is 6. Cynomolgus monkey was injected intravenously via the vein with LNPs at a dose of 1 mg / kg. Liver tissue was collected at 28 days post-dose through biopsy with the guidance of ultrasound for analysis. As shown in FIG. 37, the adjustment of the proportion of each component has a significant effect on the delivery efficiency. These results indicated that the F1-F4 all exhibit a good performance for GY1480. The N / P ratio of 4.5 demonstrated better performance than that of 6.

[0436] We conducted a novel study to evaluate the drug tolerability and the pharmacodynamic effects of the LP (a) reductions that result from LPA editing. LNPs were formulated with in vitro transcribed Cas9 mRNA and chemically modified sgRNA (targeting NHP LPA CLPA53 HP) with the F1 formulation. Cynomolgus monkey was injected intravenously via the vein with LNPs at a dose of 1 mg / kg. Liver tissue was collected at 28 days post-dose through biopsy with the guidance of ultrasound. The liver biopsy samples showed a mean 45%indel frequency (FIG. 38A) . Levels of LP (a) in the blood reached a trough by 2 weeks and have remained stable thereafter, and have settled at a reduction of around 80% (FIG. 38B) . We also performed liver function tests and noted light rises in aspartate aminotransferase (AST) and alanine aminotransferase (ALT) that were largely resolved by the end of the first week, and which had entirely resolved by two weeks after LNP infusion (FIGs. 38C and 38D) with no changes in any other liver function tests (FIG. 38E) and with no adverse health events observed. Cytokine TNF-α, IFN-γ, IL-6 and MCP-1 (FIGs. 38F-38I) were analyzed at different time points from blood collected from NHP that received an intravenous infusion of l. 0 mg / kg total RNA dose of LNP. This caused minimal cytokine activation. These results indicated that GY1480 have good delivery efficacy and drug tolerability in NHP.

Claims

1.A gRNA formulation comprising a guide RNA (gRNA) comprising a guide sequence:(i) selected from a nucleotide sequence set forth in any one of SEQ ID NOs: 1-209;(ii) with at least 17, 18, 19, or 20 contiguous nucleotides of any sequence set forth in SEQ ID NOs: 1-209; or(iii) a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90%identity to any sequence set forth in SEQ ID NOs: 1-209.2.The gRNA formulation of claim 1, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence selected any one of: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, and 488.3.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 213; wherein the scaffold sequence comprises a modification pattern of nucleotides 21-100 of SEQ ID NO: 212 (GUUUUAGAGmCmUmAmGmAmAmAmUmAmGmCmAAGUUAAAAUAAGGCUAGUCC GUUAUCAAmCmUmUmGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCm GmGmUmGmCmU*mU*mU*mU*mU) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.4.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 424, wherein the sequence of SEQ ID NO: 424 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 423 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.5.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 431, wherein the sequence of SEQ ID NO: 431 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 430 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGGCACCGAGUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.6.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 434, wherein the sequence of SEQ ID NO: 434 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 433 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.7.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 437, wherein the sequence of SEQ ID NO: 437 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 436 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGfGfCfAfCfCfGAGUCGG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified, and a lower case “f” indicates that the nucleotide is 2’-F modified.8.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) a guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 440, wherein the sequence of SEQ ID NO: 440 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 439 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGfGfCfAfCfCfGfAfGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.9.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 443, wherein the sequence of SEQ ID NO: 443 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 442 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a “*” indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.10.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 446, wherein the sequence of SEQ ID NO: 446 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 445 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAACGGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.11.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a sequence of SEQ ID NO: 449, wherein the sequence of SEQ ID NO: 449 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 448 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAAGGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.12.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 452, wherein the sequence of SEQ ID NO: 452 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 451 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCAGGAAACGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.13.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 455, wherein the sequence of SEQ ID NO: 455 comprises a modification pattern of nucleotides 21-89 of SEQ ID NO: 454 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCAGAAACGGCACCGAGUCGG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.14.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 458, wherein the sequence of SEQ ID NO: 458 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 457 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAACGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.15.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 462, wherein the sequence of SEQ ID NO: 462 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 461 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAACGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.16.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 466, wherein the sequence of SEQ ID NO: 466 comprises a modification pattern of nucleotides 21-91 of SEQ ID NO: 465 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAAGGGCACCGmAmGmUmCmGmG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage and a lower case “m” indicates that the nucleotide is 2’-O-Me modified.17.The gRNA formulation of claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising in 5’ to 3’ direction:(i) the guide sequence as defined in claim 1; and(ii) a scaffold sequence of SEQ ID NO: 470, wherein the sequence of SEQ ID NO: 470 comprises a modification pattern of nucleotides 21-90 of SEQ ID NO: 469 (GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCC GUUAUCACGAAAAGGGCACCGAGfUfCfGfG*mU*mG*mC) , wherein a *indicates a phosphorothioate (PS) linkage, a lower case “m” indicates that the nucleotide is 2’-O-Me modified and a lower case “f” indicates that the nucleotide is 2’-F modified.18.The gRNA formulation of any one of claims 1-17, wherein the sgRNA further comprises a modification at the guide sequence.19.The gRNA formulation of any one of claims 1-18, wherein the sgRNA further comprises a modification at the first 1, 2, 3, 4, 5, 6, or 7 nucleotides at the 5’ end of the guide sequence.20.The gRNA formulation of any one of claims 1-19, wherein the modification includes a 2’-O-methyl (2’-O-Me) modified nucleotide or 2’-fluoro (2’-F) modified nucleotide.21.The gRNA formulation of any one of claims 1-20, wherein the modification includes a phosphorothioate (PS) bonds between the nucleotides; preferably, the modification includes PS bonds between the first four nucleotides.22.The gRNA formulation of any one of claims 1-21, wherein the sgRNA further comprises (a) PS bonds between the first four nucleotides; or (b) 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end.23.The gRNA formulation of any one of claims 1-21, wherein the sgRNA further comprises (a) PS bonds between the first four nucleotides; and (b) 2’-O-Me modified nucleotides at the first three nucleotides at the 5’ end.24.The gRNA formulation of claims 1 or 2, wherein the guide sequence has the modification pattern of sequence selected from: SEQ ID NO: 212, SEQ ID NO: 423, SEQ ID NO: 430, SEQ ID NO: 433, SEQ ID NO: 436, SEQ ID NO: 439, SEQ ID NO: 442, SEQ ID NO: 445, SEQ ID NO: 448, SEQ ID NO: 451, SEQ ID NO: 454, SEQ ID NO: 457, SEQ ID NO: 461, SEQ ID NO: 465, or SEQ ID NO: 469.25.The gRNA formulation of any one of claims 2, wherein the single guide RNA (sgRNA) comprises:(a) a sequence selected from SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472;(b) a sequence with at least 90%identity to a sequence selected from SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472; or(c) a sequence with at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, or at least 90%identity to a sequence selected from SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472.26.The gRNA formulation of any one of the preceding claims 1-25, wherein the gRNA formulation further comprises:(i) the ionizable lipid;(ii) the neutral lipid;(iii) the helper lipid;(iv) the stealth lipid; or(v) a combination of any two or more of (i) - (iv) .27.The gRNA formulation of claim 26, wherein the ionizable lipid comprise a compound of Formula (XI) : or its N-oxide, a pharmaceutically acceptable salt, isomer or prodrug thereof,whereinL0 and L1 are each independently a bond or C1-C5 alkylene;X1 is a bond, -S-or -O-;X2, X3 are independently selected from -C (=O) O-, -OC (=O) -, -OC (=O) O-, -OC (=O) S-, or-SC (=O) O-;L2 and L3 are each independently C3-C9 alkylene;L4 and L5 are each independently C1-C5 alkylene;L6, L7, L10 and L11 are each independently a bond;R2, R3, R5 and R6 are each independently selected from C1-C18 alkyl or C2-C18 alkenyl.28.The gRNA formulation of claim 27, wherein L0 is a bond and L1 is C1-C5 alkylene, preferably, L1 is a C2, C3 or C4 alkylene.29.The gRNA formulation of claim 27 or 28, wherein L0, L1 are each independently a C2, C3 or C4 alkylene.30.The gRNA formulation of any one of claims 27-29, wherein X1 is a bond.31.The gRNA formulation of any one of claims 27-30, wherein X2, X3 are each independently selected from -C (=O) O-, -OC (=O) -or -OC (=O) O-.32.The gRNA formulation of any one of claims 27-31, wherein L2 and L3 are each independently C4-C8 alkylene.33.The gRNA formulation of any one of claims 27-32, wherein L4 and L5 are each independently C1-C3 alkylene.34.The gRNA formulation of any one of claims 27-33, wherein R2, R3, R5 and R6 are each independently C5-C9 alkyl.35.The gRNA formulation of any one of claims 27-34, wherein the ionizable lipid is 36.The gRNA formulation of any one of claims 26-35, wherein the neutral lipid is selected from the group consist of: distearoylphosphatidylcholine (DSPC) , dioleoylphosphatidylcholine (DOPC) , dipalmitoylphosphatidylcholine (DPPC) , dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) , dioleoyl-phosphatidylethanolamine (DOPE) , palmitoyloleoylphosphatidylcholine (POPC) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1 carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) and 1, 2-dielaidoyl-sn-glycero-3-phosphoethanolamine (trans DOPE) ; preferably the neutral lipid is DSPC.37.The gRNA formulation of any one of claims 26-36, wherein the helper lipid is steroid, preferably, the steroid is cholesterol.38.The gRNA formulation of any one of claims 26-37, wherein the stealth lipid is a pegylated lipid; optionally, the pegylated lipid is selected from the group consist of: pegylated diacylglycerol (PEG-DAG) , 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2′, 3′-di (tetradecanoyloxy) propyl-1-O- (ω-methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ω-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecanoxy) propyl) carbamate or 2, 3-di (tetradecanoxy) propyl-N- (ω-methoxy (polyethoxy) ethyl) carbamate; preferably, the pegylated lipid is DMG-PEG2000.39.The gRNA formulation of any one of claims 26-38, wherein the gRNA formulation comprises: (i) the ionizable lipid selected from the group consisting of: (ii) the neutral lipid DSPC; (iii) the helper lipid Cholesterol; and (iv) the stealth lipid DMG-PEG2000.40.The gRNA formulation of any one of claims 26-39, wherein the gRNA formulation comprises (i) the ionizable lipid with a concentration ranging from 40 mol %to 50 mol %of the total lipid component; (ii) the neutral lipid with a concentration ranging from 5 mol %to 15 mol %of the total lipid component; (iii) the helper lipid with a concentration ranging from 35 mol %to 55 mol %of the total lipid component; and (iv) the stealth lipid with a concentration ranging from 1.0 mol %to 3.0 mol %of the total lipid component.41.The gRNA formulation of any one of claims 26-40, wherein the gRNA formulation comprises (i) the ionizable lipid with a concentration having 46.3 mol %of the total lipid component; (ii) the neutral lipid with a concentration having 9.4 mol %of the total lipid component; (iii) the helper lipid with a concentration having 42.3 mol %of the total lipid component; and (iv) the stealth lipid with a concentration having 2 mol %of the total lipid component.42.The gRNA formulation of any one of claims 1-41, wherein the gRNA formulation further comprises an RNA-guided DNA binding agent or a nucleic acid that encodes an RNA-guided DNA binding agent; preferably, the RNA-guided DNA binding agent is Cas9; optionally, the nucleic acid is mRNA.43.The gRNA formulation of any one of claims 1-42, wherein the nucleic acid comprises a sequence with at least 90%, 95%, 96%, 97%, 98%, 99%, 100%identity to SEQ ID NO: 500 or 501.44.The gRNA formulation of claim 43, wherein the mRNA encoding the RNA-guided DNA binding agent comprises an open reading frame (ORF) comprising a sequence that is at least 90%identical to SEQ ID NO: 502.45.The gRNA formulation of claim 44, wherein at least 10%of the uridine of the mRNA is substituted with a modified uridine, wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine; preferably, 100%of the uridine is substituted with a modified uridine, wherein the modified uridine is N1-methyl-pseudouridine.46.The gRNA formulation of any one of the preceding claims 1-45, wherein the gRNA formulation is a lipid nanoparticle (LNP) composition.47.A method of inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene, comprising delivering to a cell the gRNA formulation of any one of the claims 1-46.48.Use of the gRNA formulation of any one of the preceding claims 1-46, in the manufacture of a medicament for inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene in a cell or subject.49.The gRNA formulation of any one of the preceding claims 1-46, for use in inducing a double-stranded break (DSB) within the LPA gene, and / or modifying the LPA gene in a cell or subject.50.An optimized guide RNA (gRNA) comprising a conserved portion having at least 90%sequence identity to SEQ ID NO: 488 or 492, except in a modified hairpin 1 (H1) region, wherein said modified H1 region: comprises a deletion of 4 to 10 nucleotides relative to positions H1-1 to H1-12 of SEQ ID NO: 488 or 492.51.The optimized gRNA of claim 50, wherein the modified hairpin 1 region comprises deletion of at least one base pair selected from the group consisting of:(a) nucleotides corresponding to positions H1-1 and H1-12 of SEQ ID NO: 488 or 492;(b) nucleotides corresponding to positions H1-2 and H1-11 of SEQ ID NO: 488 or 492;(c) nucleotides corresponding to positions H1-3 and H1-10 of SEQ ID NO: 488 or 492; and(d) nucleotides corresponding to positions H1-4 and H1-9 of SEQ ID NO: 488 or 492.52.The optimized gRNA of claim 50 or 51, wherein the modified hairpin 1 region further comprises one or more substitutions of nucleotides corresponding to positions selected from H1-1 to H1-12 of SEQ ID NO: 488 or 492.53.The optimized gRNA of claim 52, wherein the substitution occurs at H1-2, H1-9 or H1-12.54.The optimized guide RNA (gRNA) of any one of claims 50-53, wherein the gRNA is a single guide RNA (sgRNA) .55.The optimized gRNA of any one of claims 50-54, wherein position H1-1 is deleted.56.The optimized gRNA of any one of claims 50-55, wherein position H1-2 is deleted.57.The optimized gRNA of any one of claims 50-56, wherein position H1-3 is deleted.58.The optimized gRNA of any one of claims 50-57, wherein position H1-4 is deleted.59.The optimized gRNA of any one of claims 50-58, wherein position H1-5 is deleted.60.The optimized gRNA of any one of claims 50-59, wherein position H1-6 is deleted.61.The optimized gRNA of any one of claims 50-60, wherein position H1-7 is deleted.62.The optimized gRNA of any one of claims 50-61, wherein position H1-8 is deleted.63.The optimized gRNA of any one of claims 50-62, wherein position H1-9 is deleted.64.The optimized gRNA of any one of claims 50-63, wherein position H1-10 is deleted.65.The optimized gRNA of any one of claims 50-64, wherein position H1-11 is deleted.66.The optimized gRNA of any one of claims 50-65, wherein position H1-12 is deleted.67.The optimized gRNA of any one of claims 50-66, wherein position H1-9 is substituted with a C.68.The optimized gRNA of any one of claims 50-67, wherein position H1-2 is substituted with a G and / or H1-11 is substituted with a C.69.The optimized gRNA of any one of claims 50-58, wherein the hairpin 1 region comprises an insertion of one or more of nucleotides within its loop.70.The optimized gRNA of claim 69, wherein the hairpin 1 region comprises an insertion of one nucleotide within its loop.71.The optimized gRNA of any one of claims 69-70, wherein a nucleotide is inserted immediately after the last nucleotide at the 3' end of the original loop.72.The optimized gRNA of any one of claims 69-71, wherein a nucleotide is inserted immediately before the first nucleotide at the 5' end of the original loop.73.The optimized gRNA of any one of claims 69-72, wherein the insertion results in conversion of a four-nucleotide original loop to a five-nucleotide loop.74.The optimized gRNA of any one of claims 69-73, wherein the insertion results in conversion of a four-nucleotide original loop to a three-nucleotide loop.75.The optimized gRNA of any one of claims 69-74, wherein the insertion results in a Watson-Crick base pair forming between:(a) a nucleotide at the 3' or 5' terminal position of the original loop; and(b) the inserted nucleotide;wherein said base pair is selected from the group consisting of: A-U, U-A, C-G, G-C, A-T, and T-A.76.The optimized guide RNA (gRNA) of any one of claims 69-75, wherein the conserved portion comprises:(a) a nucleotide sequence having at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identity to the sequence selected from any one of: SEQ ID NOs: 488 or 492; and(b) a sequence motif of N1GAAAAN2 or N1GAAACN2; wherein N1 and N2 form a Watson-Crick base pair selected from G-C, C-G, A-U, or U-A.77.The optimized guide RNA (gRNA) of any one of claims 69-76, wherein the optimized gRNA comprises: (i) a guide sequence selected from SEQ ID NOs: 1-209; (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence selected from SEQ ID NOs: 1-209; or (iii) a guide sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90%identity to a sequence selected from SEQ ID NOs: 1-209.78.The optimized guide RNA (gRNA) of any one of claims 69-77, wherein(a) the conserved portion comprises: (i) a nucleotide sequence having at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identity to SEQ ID NO: 488 or SEQ ID NO: 492; and (ii) a sequence motif of N1CGAAAGN2; wherein N1 and N2 form a Watson-Crick base pair selected from G-C, C-G, A-U, or U-A; and(b) the guide RNA further comprises: (i) a guide sequence selected from SEQ ID NOs: 1-209; (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a guide sequence selected from SEQ ID NOs: 1-209; or (iii) a guide sequence with at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90%identity to a sequence selected from SEQ ID NOs: 1-209.79.The optimized guide RNA (gRNA) of any one of claims 69-78, wherein the gRNA comprises a nucleotide sequence:(a) selected from any one of: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, and 488;(b) that is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identical to the nucleotide sequences selected from any one of: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, and 488.80.The optimized gRNA of any one of claims 69-79, wherein the gRNA comprises a 5’ end modification.81.The optimized gRNA of any one of claims 69-80, wherein the gRNA comprises a 3’ end modification.82.The optimized gRNA of any one of claims 69-81, wherein the gRNA comprises a 5’ end modification and 3’ end modification.83.The optimized gRNA of any one of claims 69-82, wherein the gRNA comprises a 3’ tail.84.The optimized gRNA of any one of claims 69-82, wherein the gRNA does not comprise a 3’ tail.85.The optimized gRNA of any one of claims 69-84, wherein the 3’ and 5’ end modification comprises a protective end modification, optionally a modified nucleotide selected from a 2’-O-methyl (2’-OMe) modified nucleotide, a 2’-O- (2-methoxyethyl) (2’-O-moe) modified nucleotide, a 2’-fluoro (2’-F) modified nucleotide, a phosphorothioate (PS) linkage between nucleotides, or a combination thereof.86.The optimized gRNA of any one of claims 69-85, wherein the optimized gRNA comprises an upper stem (US) region, and wherein the upper stem region comprises at least one modification.87.The optimized gRNA of claim 86, wherein the upper stem modification comprises any one or more of:(a) a modification of any one or more of US1-US12 in the upper stem region; and(b) a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the upper stem region.88.The optimized gRNA of claim 86 or 87, wherein the upper stem modification comprises one or more of:(a) a 2’-OMe modified nucleotide;(b) a 2’-O-moe modified nucleotide;(c) a 2’-F modified nucleotide; or(d) combinations of one or more of (a) - (c) .89.The optimized gRNA of any one of claims 69-88, wherein the optimized gRNA comprises a hairpin 2 (H2) region, and wherein the hairpin 2 region comprises at least one modification.90.The optimized gRNA of claim 89, wherein the hairpin 2 region modification comprises any one or more of:(a) a modification of any one or more of H2-1 to H2-15 in the hairpin 2 region; and(b) a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or all 15 nucleotides in the hairpin 2 region.91.The optimized gRNA of claim 89 or 90, wherein the hairpin 2 region modification comprises one or more of:(a) a 2’-OMe modified nucleotide;(b) a 2’-O-moe modified nucleotide;(c) a 2’-F modified nucleotide; or(d) combinations of one or more of (a) - (c) .92.The optimized gRNA of any one of claims 50-91, comprising a nucleotide sequence: (a) having at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%or at least 70%identity to the nucleotide sequence of any one of SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, and 471-472; or (b) selected from any one of: SEQ ID NOs: 214-422, 425-429, 432, 435-436, 438, 441, 444, 447, 450, 453, 456, 459-460, 463-464, 467-468, or 471-472.93.A polynucleotide comprising a sequence encoding the gRNA as defined in any one of claims 1-2; or the optimized gRNA of any one of claims 50-79.94.A polynucleotide comprising a sequence encoding a gRNA, wherein the gRNA comprises:(a) a sequence selected from any one of: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, 530-547, or(b) a sequence that is at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 91%, or at least 90%identical to a sequence selected from any one of: SEQ ID NOs: 213, 424, 431, 434, 437, 440, 443, 446, 449, 452, 455, 458, 462, 466, 470, 530-547.

Images