Control bacteria for molecular bacterial load assay

Abstract

The disclosure provides extraction control methods for use with molecular bacterial load assays (the 'MBLA'). The MBLA may be used to quickly (e.g. in about four hours), detect and enumerate the number of vaiable bacteria in, for example, a sample. The disclosed extraction control methods provide improved MBLAs and may be applied to a broad range of different MBLAs may find application as a means to accurately adjust for bacterial loss during a target bacterial nucleic acid extraction procedure.

Description

[0001]ASSAY FIELD The present disclosure relates to methods of detecting and quantifying live microorganisms. BACKGROUNDAt present, microbiological diagnosis is based on two main paradigms: culture and moleculartesting. Culture lacks sensitivity and is compromised by competing micro-organisms from thediagnostic specimen (contamination) and is readily rendered false negative due to thepresence of antibiotics that are at sufficiently high concentration to prevent growth but not curethe infection (Cruciani et al., 2004). Further, culture based assays can only generate a resultin a minimum of two days and may not deliver results for up to six weeks (Tyrrell et al., 2012).An alternative method based on molecular testing typically involves the detection of nucleicacids of target pathogens, such as detection of bacterial DNA or mRNA from sputum samples(Desjardin et al., 1999). However, molecular testing methods, such as those based onbacterial DNA detection, often do not distinguish between live and dead bacteria (Banada etal., 2010). In addition, mRNA-based testing methods rely on detection of bacterial mRNA thatoccur in low copy numbers and require special handling as mRNA is highly sensitive todegradation (Mtafya et al., 2019). These limitations highlight a need in the art for novelmicrobiological diagnostic tools with enhanced specificity and sensitivity that can rapidly detect and quantify target pathogens.Previous studies have shown that a molecular bacterial load assay (MBLA) comprisingdetection of M. tuberculosis 16S ribosomal RNA may be used to monitor tuberculosis treatment response (Honeyborne et al., 2011). This method is advantageous over other RNAbased assays as it detects viable bacteria with high specificity in a quantitative manner.Importantly, these methods provide means of monitoring changing bacterial number over timeas part of the study of the natural history of the infection or in response to antibioticchemotherapy (Honeyborne et al., 2014). The internal control used in Honeyborne et al’sexperiments was labile and unstable in high ambient temperature settings. As such, there is a need for a more reliable and stable internal control. SUMMARYThe present disclosure relates to a molecular bacterial load assay (the ‘MBLA’) for quickly(e.g. in about four hours), detecting and enumerating the number of vaiable bacteria in, forexample, a sample. The disclosure is further based on the finding that molecular bacterialload assays (MBLAs) can be improved with the use of an extraction control. The disclosedextraction control techniques may be applied to a broad range of different MBLAs and mayfind application as a means to accurately adjust for bacterial loss during a target bacterialnucleic acid extraction procedure. Molecular bacterial load assays (MBLA) typically comprise a reverse transcription real-timequantitative polymerase chain reaction (RT-qPCR) to detect the 16S rRNA of a targetbacterium in a sample. This allows the user to quantify the viable (target) bacterial load. MBLAdata can be used as an indicator of infection and / or to assess a response to, for example, anantibiotic-based treatment. Importantly, an MBLA method is capable of accurately andsensitively detecting a reduction in a bacterial load and therefore may be used to monitor orstage a disease and / or a response to treatment.MBLA typically involves the extraction of nucleic acid from a sample – with an emphasis onthe extraction of the total nucleic acid content (within which resides the 16S rRNA, including16S rRNA from the target bacteria). The extracted nucleic acid is then treated to remove (orsubstantially remove) the DNA content – using, for example enzymes such as DNase). Theextracted RNA is then subject to an amplification protocol, for example RT-qPCR, designedto selectively amplify or to detect and quantify certain target (16S rRNA) sequences. One ofskill will appreciate that the cycle threshold can be transformed into a measure of the bacterialload. For example, when monitoring the progress of a particular treatment, a sample may bemonitored for changes in the bacterial load. For example, a fall in the bacterial load(manifesting as no change or a reduction in the detection of certain 16S rRNA sequences),may signify a positive treatment response (e.g., an antibiotic drug is successfully killing (or hasbegun to kill) the bacteria). No change or a rise in bacterial load (manifesting as no change ora rise in the detection of certain 16S rRNA sequences) may imply a negative response totreatment. In view of the above, a MBLA for the detection and enumeration of target bacteriain a sample may comprise: extracting RNA from the sample; andamplifying 16s rRNA from the sample.In one teaching, the extracting step comprises extracting the total nucleic acid (NA) content of a sample. In one teaching, the step of amplifying may involve subjecting the extracted RNA toamplification of the 16s rRNA component using RT-qPCR. Additionally, or alternatively, thestep of amplifying may involve subjecting the extracted RNA to amplify the 16s rRNAcomponent using digital PCR. The 16s rRNA component of the extracted RNA may otherwisebe referred to as the “target 16s rRNA”. The term “target 16s rRNA” means the specific 16srRNA of the bacterial species to be identified. As stated, the purpose of the MBLA may be to quantify the number of viable target bacteria ina sample. In this regard, a standard curve is used to translate the cycle threshold to bacterialload. As explained later in this disclosure, the standard curve is drawn using rRNA extracted from a known amount of colony forming units per ml of bacteria.A MBLA method may further comprise a step in which the step of extracting (total) RNA froma sample, comprises subjecting the sample to a general nucleic acid purification procedureto extract nucleic acid contained therein (including DNA and / or RNA comprised therein). Theresulting nucleic acid preparation may then be subject to a process which removes (for example some, all, or substantially all) of the DNA. This generates an RNA extract from thesample which may then be subject to any of the above-mentioned amplification procedures,including for example RT-qPCR or digital PCR, to selectively amplify the target 16s rRNAcomponent. Without wishing to be bound by theory, due to cellular abundance of 16S rRNA and shorter half-life of 16S rRNA compared to DNA, a decline in 16S rRNA is often interpreted or defined as a surrogate marker of microbial viability and may be used as a means to determine a response to treatment. However, high accuracy and reproducibility of the nucleic acid extraction step is critical for this method to be suitable for use in the clinic.Any change in the amount of 16S rRNA detected in a sample may be assessed relative to acontrol or standard amount. The control may be a positive control containing a known amount of a target molecule / sequence. Thus, the MBLA represents a sensitive, specific and rapid approach to detecting andenumerating one or more target bacteria in a sample. The disclosed MBLA techniques openup a wide range of research and clinical diagnostic opportunities.In one teaching, a MBLA for use in the detection and / or diagnosis may be used to determinethe numbers of any one or more of the target bacteria disclosed herein. The target bacteria may be any bacteria that a user wishes to detect and enumerate using a MBLA (a list of target bacteria is provided later in this disclosure). The term “target bacteria” refers to any bacterial species of interest. In one embodiment, the target bacteria may comprise a single bacterial species or multiple (for example two or more) bacterial species. The target bacteria may comprise one or more pathogenic bacterial species. The target bacteria may be associated with a disease or condition. The target bacteria may be associated with a chronic disease or chronic condition. The target bacteria may be an indicator of a disease state.The target bacteria may not be a primary pathogen – rather it may be a secondary pathogenassociated with a (chronic) disease or (chronic) condition.The target bacteria may be an opportunistic pathogen associated with a (chronic) disease or(chronic) condition. The target bacteria may comprise respiratory pathogen. In one teaching, the target bacteria may comprise one or more pathological non-tuberculosismycobacteria species.The target bacteria for detection using a molecular bacterial load assay comprises one or more pathological Streptococcal species.The target bacteria may comprise one or more species selected from (the group consisting of)H. influenzae, P. aeruginosa, M. tuberculosis, M. abscessus, M. catarrhalis, S. pneumoniae,S. oralis and / or S. auereus.Where the target bacteria are associated with and / or causative of Chronic bronchial sepsis (CBS), the assay may be referred to as a CBS-MBLA. A CBS-MBLA of this disclosure may be used or for use in the detection of the key bacterial causes of COPD / CBS exacerbations. TheMBLAs described herein have the potential to provide a more sensitive and rapid detectiontool than standard culture methods for patient diagnosis and monitoring response to antibiotic treatment. Moreover, there is currently no reliable way to determine the natural history of chronic bronchial sepsis between relapses and to monitor the disease to predict and potentially prevent relapses. The MBLA described herein can address these issues and may be exploited as a chronic disease monitoring tool. Furthermore, by quantifying all of the relevant (and different) pathogenic species accurately, it may be possible to distinguish chance contamination from relapse thereby enhancing the accuracy of diagnosis and improving disease management. Culture based diagnosis is frequently rendered falsely negative by the presence of antibiotics that are at sufficiently high concentration to prevent growth but not cure the infection. As such, chronic pulmonary infections represent an innovative target for the clinical application of a MBLA (as described herein) not least because these patients are treated for an extended period of time and understanding the response to treatment is important for proper patient management, optimising treatment and reducing inappropriate antibiotic use.In view of the above, the disclosure provides a CBS-MBLA for detecting and counting(enumerating) the number of (viable) target bacteria in a sample, wherein the target bacteria is one or more selected from the group consisting of: H. influenza; P. aeruginosa; M. tuberculosis; M. abscessus; M. catarrhalis; S. pneumonia; S. mitis; S. pyogenes; S. oralis; and S. aureus.A CBS-MBLA may be performed as a series of separate assays, each probing a sample forthe numbers of one or more (for example two, three or four) different target bacteria. By way of example, a CBS-MBLA may be performed as a plurality (for example three) (RT)-qPCR multiplex assays. The first assay may be a quadraplex assay running dual labelled probes forHaemophilus influenzae, Pseudomonas aeruginosa, Moraxella catarrhalis and the extractioncontrol. The second assay may be a triplex running dual labelled probes for the Streptococcusmitis species complex, Staphylococcus aureus and the extraction control. The third assay maybe a triplex running dual labelled probes for Streptococcus pyogenes, Streptococcuspneumoniae and the extraction control. All assays involve a multi- (for example three) stepPCR. A first step may comprise reverse transcription by reverse transcriptase (e.g. 30 min reverse transcription by reverse transcriptase at 50 °C), a second denaturation step (e.g.15 min denaturation at 95 °C), and a third amplification step (e.g.40 cycles of amplification at 94 °C for 15 s). One of skill will appreciate that the annealing temperature may vary depending on a number of factors and parameters. Thus, acquisition of fluorescence from the probes occurs at the respective annealing / elongation temperature (i.e., the fragment elongation stage). The sample may comprise any sample comprising (or likely to comprise) the target bacteria. The sample may comprise a biological sample. The sample may comprise a tissue or biological fluid. The sample may comprise blood (whole blood or a fraction thereof e.g. serum or plasma), mucus, sputum, saliva, CSF, faeces (stool), urine, fluid from a lavage or wash procedure, a secretion, a tissue scraping or a cell. The sample may comprise saliva. The sample may comprise sputum. The sample may comprise two or more samples from different sources and / or of different types. A sample may comprise a single sample or may comprise a plurality of samples (such as 2, 3, 4, 5, 6, 8, 10 or more samples), which are pooled together. One of skill will appreciate that the method of this disclosure can be applied to any suitable sample and the sample will depend on the selected target bacteria. For example, where the target bacteria are known to cause or contribute to a disease or condition, the sample may bederived from a suitable tissue / secretion – for example a tissue from an organ affected by thedisease / condition or a secretion likely to contain the bacteria associated with (or causative of) the disease or condition. Where the disease or condition is a diseased of the lung or respiratory system, the sample may be derived from the lung, the mucosal membranes or mucus lining the same; for example, the sample may comprise a sputum sample. By way of example in a CBS-MBLA, the sample may comprise sputum. As stated, the sample (e.g. sputum or any of the sample types described herein) may be subject to an established MBLA protocol. Moreover, the sample may be subjected to a processwhich extracts nucleic acid from any bacteria, including any target bacteria (e.g. one or moreof those target species listed above), contained within the sample. The extracted nucleic acid may comprise DNA and / or RNA, including DNA and / or RNA derived from any target bacteria. The RNA component of any extracted nucleic acid may comprise, for example mRNA, rRNA, RNAi and the like. In particular, the extracted nucleic acid may comprise 16S ribosomal RNA (16S rRNA), including 16S rRNA from any target bacteria. In order to extract nucleic acid from a sample, the sample may be subject to a cell lysis or breakage protocol (e.g., to yield a cell lysate and / or cell extract) and / or a sample fractionation procedure. The extracted nucleic acid may be subject to a process which purges the sample of any DNA. This prevents DNA from contaminating later stages of the MBLA method (DNA may invalidate the MBLA result). The skilled person would be aware of the various techniques available to remove DNA. Indeed, there are commercially available kits for the removal of DNA. DNAremoval methods may use DNase enzymes. By purging a nucleic acid preparation of DNA,the user may be left with a RNA preparation which may contain any 16S rRNA present withinthe original sample. This would include 16S rRNA from the target bacteria. To ensure DNAremoval, a DNA control may be included. This control will determine whether or not the sample of nucleic acid extract (which ought to have been purged of DNA) contains any DNA. For example, the DNA control may comprise performing of a PCR reaction without reverse transcriptase. As explained in more detail below, the nucleic acid sample (optionally purged of DNA to yield an RNA preparation) may then be subject to RT-qPCR to amplify specific (target) 16S rRNA sequences.As stated, any of the disclosed MBLAs may be improved by the inclusion of an extractioncontrol. An extraction control may be used to accurately control and / or adjust for bacterial lossduring the nucleic acid (RNA) extraction procedure of MBLA. Moreover, the disclosedextraction control may be used as an internal control to monitor the efficiency of the nucleicacid (RNA) extraction process.Accordingly, the disclosure provides an extraction control for a molecular bacterial load assay(MBLA), wherein the MBLA is used to enumerate the number of viable target bacteria in asample and said extraction control comprises detecting and / or quantifying the presence of anucleic acid of one or more control bacteria in the sample, wherein the control bacteria isphysiologically similar to one or more of the target bacteria but taxonomically unrelated. Thedisclosure also provides a MBLA for enumerating the number of viable target bacteria in asample, wherein said MBLA comprises an extraction control, which extraction comprisesdetecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample, wherein the control bacteria is physiologically similar to one or more of the targetbacteria but taxonomically unrelated. The disclosure also provides use of a bacteria that isphysiologically similar to one or more of a target bacteria but taxonomically unrelated, as anextraction control for an MBLA for enumerating the number of viable target bacteria in a sample. It should be noted that with reference to the control bacteria, the phrase physiologically similarbut taxonomically unrelated “to one or more” of the target bacteria may embrace a scenariowhere, if there are multiple target bacteria in a sample, the control bacteria is physiologicallysimilar but taxonomically unrelated to either one of those target bacteria or to multiple differenttarget bacterial types, species and / or strains present in the sample - for example 2, 3, 4, 5 ormore species, types or strains target bacteria in a sample – the exact number depending onthe microbial composition of the sample.In one teaching, the disclosure provides an extraction control for a CBS-MBLA as describedabove. In a further teaching the disclosure provides a CBS-MBLA comprising an extractioncontrol. The extraction control may comprise spiking the sample with one or more control bacteria priorto any nucleic acid extraction procedure. In this way, the nucleic acid extraction proceduremay extract nucleic acid not only from any target bacteria in the sample (e.g. one or more ofthose target species listed above), but also nucleic acid from any control bacteria added to, orspiked into, the sample. DNA may be removed from the nucleic acid preparation to yield a RNA preparation.The RNA preparation may comprise 16S rRNA from the target bacteria (i.e. the “target 16srRNA) and / or any control bacteria in the sample. Where the MBLA includes an extractioncontrol as described herein, the RNA component of any extracted nucleic acid may comprise, for example, mRNA, rRNA, RNAi and 16S ribosomal RNA (16S rRNA), including 16S rRNA from any target bacteria and / or any control bacteria in the sample.The RNA preparation may be subject to an amplification protocol, for example RT-qPCR, toamplify the 16S ribosomal RNA content. The extraction control of this disclosure may be used to check for extraction losses (forexample losses that might occur as nucleic acid is extracted from the sample – e.g. duringcentrifugation and the like) and PCR inhibition. This is possible because the user will know inwhat range of CT the extraction control should be amplified. The extraction control allows the MBLA user to: (i) accurately control and adjust for the loss of a target bacteria from a sample duringa nucleic acid extraction procedure; and / or(ii) monitor the efficiency of a (target bacterial) nucleic acid extraction process from asample. In another aspect, the disclosure provides an assay for: (i) accurately controlling and adjusting for the loss of a target bacteria from a sampleduring a bacterial nucleic acid extraction procedure; and / or(ii) monitoring the efficiency of a target bacterial nucleic acid extraction process from asample; said assay comprising: spiking the sample with a control bacteria;extracting RNA from the sample,subjecting the extracted RNA to RT-qPCR to quantify 16S rRNA; andfrom the RT-qPCR data, from the RT-qPCR determining whether any target bacteriamay have been lost during the bacterial nucleic acid extraction procedure or determining theefficiency of a target bacterial nucleic acid extraction process from a sample; wherein the control bacteria is physiologically similar, but taxonomically unrelated to,the target bacteria. By way of example, a control bacteria which is physiologically similar, buttaxonomically unrelated to the target bacteria may possesses a cell wall structure that is physiologically similar to the target bacteria, One of skill will appreciate that as the number of bacteria making up the control (or from whichthe control is derived) is known, the amount of rRNA can be calculated and from that, any lossthat has occurred in processing) e.g. nucleic acid / RNA extraction) can also be calculated. Inother words, any loss in the known quantum of the internal control is used to calculate any processing loss attributable to the target bacteria. Without wishing to be bound by theory, if the internal control yields a loss during processing, then so to must the target bacteria. Accordingly any control bacteria processing loss (which can be determined accuratelybecause the amount of control bacteria added or the amount of control bacteria RNA addedis known) may be proportional to the amount of target bacteria loss. As such, the output of the MBLA can be adjusted (according to the result of the internal control) to ensure that the result is an accurate and fair reflection of the number of target bacteria in a sample.The disclosed extraction control may be part of any of the disclosed MBLAs, including thedisclosed CBS-MBLAs. As such, the extraction control procedures described herein may be applied to any MBLA fordetecting and counting (enumerating) the number of (viable) target bacteria in a sample,wherein the target bacteria is one or more selected from the group consisting of: H. influenza; P. aeruginosa; M. tuberculosis; M. abscessus; M. catarrhalis; S. pneumonia; S. mitis; S. pyogenes; S. oralis; and S. aureus.The present disclosure provides a novel internal control method that can be applied to, or usedwith, a range of MBLAs. The novel internal control improves detection and quantitation thetarget bacteria. The disclosed novel internal control provides an efficient quality control stepand ensures that the results obtained are accurate readouts of the target bacteria in thesample. Moreover, the disclosed internal control is not labile and is stable in high ambienttemperature settings. Additionally, the internal control of this disclosure provide MBLAsoffering improved and more accurate quantification by providing a control that allows theconcentration of the target to be adjusted to take account of the efficiency of extraction.As stated, the extraction control may exploit control bacteria. The control bacteria maycomprise a bacterial species that is physiologically similar but taxonomically unrelated to, any(or all) of the target bacteria. A control bacteria which is physiologically similar, buttaxonomically unrelated to the target bacteria may possesses a cell wall structure that isphysiologically similar to any or all of the target bacteria, Additionally or alternatively, theextraction control may further comprise a bacterial species that is ‘pathologically distinct’ from any (or all) of the target bacteria. The term ‘pathologically distinct’ may embrace bacterial species which is never (or very unlikely) to be present in the relevant sample (e.g. a sample being subject to MBLA). It should be noted that the term “extraction control” embraces not only live and / or whole cell bacteria (which may be added directly to an MBLA for use as an internal control), but also to RNA which has been extracted from the control bacteria and then subsequently added (orspiked) into the MBLA. For example, the extraction control may involve the addition of wholecontrol bacterial cells at a known concentration and the subsequent detection of RNA fromthese bacteria (wherein the amount of RNA extracted from the known concentration of controlbacteria used in the MBLA is used to accurately quantify a target bacteria in a sample).Additionally, or alternatively, an RNA extract from a selected control bacteria may be addedas the extraction control to an MBLA. Again, the RNA extract may be prepared from a know quantity of control bacteria, such that the RNA extract is also a known quantity. Any loss in the amount of control RNA extracted and amplified from the MBLA may then be used to accurately quantify the target bacteria in a sample. In one teaching, the extraction control (forexample RNA derived from a control bacteria) may be added to the MBLA after a lysis step inthe nucleic acid / RNA extraction process. Where the extraction control comprises whole bacterial cells, these may be added before any nucleic acid / RNA extraction lysis step. This is advantageous as it ensures that the extraction control serves as a proper and full control of the whole nucleic acid (RNA) extraction process.Again, a purpose of the extraction control is to monitor the efficiency of the nucleic extractionprocess (a part of the MBLA). To this end, the extraction control (comprising, for example, acontrol bacteria) may be added to a sample to be subject to MBLA. For example, a samplemay be spiked with the extraction control (comprising, for example, a control bacteria) prior toany nucleic acid extraction procedure. A predetermined amount of the extraction control maybe added or spiked to the sample. The extraction control may be added or spiked to the sampleat any suitable or optimised concentration. In one teaching, the extraction control may beadded into a lysis buffer.It should be noted that the term “physiologically similar” refers to, for example, features of thechemical composition and structure of the control bacterial cell wall for use as the extractioncontrol.In one teaching, a physiologically similar bacteria for use as an extraction control may (relativeto one or more of the target species) exhibit at least some structural similarity. As such, aphysiologically similar bacteria (for use as an extraction control) may be structurally similar toa target bacterial species. For example, the morphology of a typical bacterial cell may fall intoa specific category and any given bacteria may be classified as having, for example, a coccus,a bacillus, a coccobacillus, a spiral or a filamentous morphology. As such, where the targetspecies has a specific morphology, the extraction control bacteria may be (but not necessarily be) selected to have the same or similar morphology.In an alternative teaching, a physiologically similar bacteria for use as an extraction controlmay comprise a bacteria having, relative to a target species, similar or identical extracellularand / or intracellular structural feature(s). In one teaching, a physiologically or structurally similar bacteria (for use as an extraction control) may comprise (relative to a target species) abacteria having, for example, a similar cell wall structure (Gram +ve / Gram –ve),presence / absence of fimbriae / pili, presence / absence of S-layers, presence / absence of glycocalyx and / or presence / absence of flagella. In one embodiment, a structurally or physiologically similar bacteria may refer to bacteria with similar intracellular components and / or properties, such as intracellular membranes, cytoskeletal structures, nutrient storage structures, microcompartments, carboxysomes and / or magnetosomes.A bacteria that is taxonomically unrelated to (or distinct from) another, refers to a species ofbacteria that, relative to another is evolutionarily removed therefrom. For example, the targetspecies (to be subjected to MBLA) may be evolutionarily removed from the selected extraction control. Moreover, an extraction control which is selected as evolutionarily removed from a target species is one that is unlikely to be present in the sample of interest. The physiologically similar but taxonomically unrelated control bacteria of the extraction control may confirm to one, more or all of the following criteria: 1. The bacterial cell wall of the control bacteria may be similar to that of the targetbacteria so that it accurately matches the behaviour of the target. 2. It should be extremely unlikely that the physiologically similar but taxonomicallyunrelated bacteria selected for use as the control bacteria, be present in the sample that is to be subject to MBLA. 3. primers are designed to take account of the diversity of bacterial species andthe possibility of chance matches in primers. As such a careful analysis of the controlbacteria sequence and testing in silico, in vitro and ex vivo is performed.4. Morphological similarity is not required.In view of the above, a bacteria for use as an extraction control may comprise a plant pathogenhaving, relative to the target species, similar or identical physiological features and / or featureswhich correspond to one, more or all of criteria 1-4 listed above. A bacteria for use as an extraction control may comprise a marine organism having, relative to the target species, similar or identical physiological features and / or features which correspond to one, more or all of criteria 1-4 listed above. An extraction control may comprise Mycobacterium smegmatis. In other words the control bacteria, for use in an extraction control of this disclosure, may comprise Mycobacteriumsmegmatis and / or nucleic acid / RNA extracted from Mycobacterium smegmatis. Performanceof the Mycobacterium smegmatis extraction control is illustrated in Figure 4. Although of thesame genus, M. smegmatis is taxonically distant from Mycobacterium tuberculosis and is notlikely to be found in human respiratory or systemic samples. A human sample to be subjected to MBLA (for example a human sputum sample) is not likelyto contain a plant pathogen. As such, where a sample for MBLA is derived or obtained from ahuman and is to be subject to MBLA, a plant pathogen may represent a good choice for the extraction control. As such, an MBLA assay for enumerating or detecting a target bacterial species within a sample, may comprise the step of adding to the sample or spiking the samplewith, a plant pathogen – for example a plant bacterial pathogen, which plant pathogen isphysiologically similar to, but taxonomically district from, the target species. The extraction control (e.g. a plant (bacterial) pathogen) may comprise a (bacterial) speciesthat does not belong to the same Kingdom, Phylum, Class, Order and / or Family as the targetspecies.In one teaching, a taxonomically distinct extraction control (for example a plant (bacterial)pathogen) may comprise a species that does not belong to the same Order as the targetspecies.In another teaching, a taxonomically (plant pathogen) distinct species (for use as an extractioncontrol) may comprise a species that does not belong to the same Family as the targetspecies. In one embodiment, the bacterium used for the extraction control may comprise, consist of orconsist essentially of Agrobacterium tumefaciens.Also disclosed are primers for the detection of bacterial nucleic acid in a sample.Disclosed are primers for the detection of Agrobacterium tumefaciens nucleic acid, inparticular A. tumefaciens 16S rRNA:, those primers may comprise the following sequences:Forward primer 5’ – AGCAACGCGCAGAACCTTACC – 3’Reverse primer 5’ – TCTGGGGCCAGCCTAACTGAAG – 3’.The primers may be used in the RT-qPCR for the detection of A. tumefaciens 16S rRNA.In another aspect, the disclosure provides a kit for use with an MBLA, said kit comprising theabove disclosed primers, which primers are for the detection of Agrobacterium tumefaciens16S rRNA. As stated, the kit may provide the user (of the MBLA) with a means to conduct anextraction control. A kit of this disclosure may comprise or further comprise Agrobacterium tumefaciens, for use as an extraction control. For example, a sample (for example a human sputum) sample, maybe spiked with Agrobacterium tumefaciens provided by a kit of this disclosure for use as anextraction control. The kit may further provide tools, receptacles, buffers and the like for the collection, storage and processing of samples. The kit may further comprise instructions for use. A kit may comprise buffers, enzymes and components for use in an amplification method, for example RT-qPCR. DETAILED DESCRIPTION The present disclosure will now be described in further detail with reference to the following Figures and examples.Figure 1: Real-time qPCR (A–C) show assay 1 real-time PCR standard curves andamplification curves for H.influenzae (green), P.aeruginosa (orange), and M.catarrhalis (red).Figure 2: Real-time qPCR (A–B) show assay 2 real-time PCR standard curves and amplification curves for S.Pyogenes (green), and S.pneumonia (orange). Figure 3: Real-time qPCR (A–B) show assay 3 real-time PCR standard curves and amplification curves for S.aureus (green), and S.mitis complex (orange). Figure 4: Real-time PCR amplification and standard curve efficiency of M. smegmatis extraction control in the tuberculosis Molecular Bacterial Load Assay (TB-MBLA) (A-B). C) the performance of the M. smegmatis extraction control in sputum TB RNA extractions at NIMR-Mbeya Medical Research Centre Tanzania. The RNA extractions were performed by the University of St Andrews sponsored PhD student. Figure 5: Case series of COPD patients diagnosed for bacteria underlying exacerbation using COPD-MBLA in comparison to culture (yellow bars). A) The patient was positive for Streptococcus pneumoniae up to day 30 but antibiotic therapy was stopped at day 14. Culture test was negative all through in this case. B) Antibioc tazocin was effective at eliminating Pseudomonus aeruginosa but innefective against other pathogens Heamophilus influenza and S. pneumoniae. In this case, culture was only positive for P. aeruginosa at day 2 and 3, and negative all through for H. influenza and S. peumoniae. C) Demonstrates a patient relapsing with P. aeruginosa infection after they stopped antibiotics at day 14. In this case culture was negative at day 5 and 7, which most likely gave the doctor false confidence to stop antibiotics at day 14. D) Demonstrates a patient given a series of antibiotics with nogain in terms of eliminating the bacteria. Culture was negative most of the time but thepatient’s clinical situation was not improving. Example 1 An exemplary MBLA is outlined below PROTOCOL: A MBLA according to this disclosure may comprise the following steps: 1. Obtain and prepare a sample (comprising, potentially comprising or thought tocomprise a target bacteria); 2. Extract nucleic acid from the sample;3. Optionally purge or remove DNA from the extracted nucleic acid; and4. conduct RT-qPCR to amplify selected 16S rRNA sequences.Step 1 may further comprise spiking the sample with the extraction control (i.e. a selectedcontrol bacteria as described herein). In this way, step 2 will extract nucleic acid from thecontrol bacteria added to the sample and step 4 will amplify 16S rRNA not only from thetarget bacteria but also the extraction control bacteria. Any RT-qPCR method may use primers designed to specifically amplify the target (e.g.16S rRNA) sequences. Further detail is provided below.A Chronic Bronchial Sepsis (CBS) Molecular Bacterial Load Assay (CBS-MBLA)Chronic obstructive pulmonary disease and Chronic Bronchial Sepsis (COPD / CBS) is a group of lung conditions that cause breathing difficulties. They are characterized by damage of air sacs in the lungs (emphysema) and long-term inflammation of airways (chronic bronchitis). Patients often have episodes of severe symptoms (exacerbation) of which 40- 60% are linked to bacterial infection. Similarly, the bronchial tract can become chronically infected with a range of organisms that cause periodic exacerbation. This poses a diagnostic challenges as it is difficult to distinguish viral from bacterial infection or to predict the species of the infecting organisms. Diagnosis has traditionally depended on the slow and less sensitive microbial culture, making it difficult to monitor the efficacy of antibiotic treatment. This disclosure provides a culture-free chronic obstructive pulmonary disease molecular bacterial load assay (CBS-MBLA) test for rapid detection and quantification of keybacterial species underlying CBS exacerbation. CBS-MBLA uses reverse transcriptasequantitative polymerase chain reaction (RT-qPCR) of species-specific genes to quantify bacterial load of Haemophilus influenzae (Hi), Pseudomonas aeruginosa (Pa), Moraxella catarrhalis (Mc), Streptococcus mitis species complex (Sm), Staphylococcus aureus (Sa), Streptococcus pyogenes (Spy) and Streptococcus pneumonia (Spn). Described is the procedure of conducting the test which involves RNA extraction and amplification via PCR to detect and quantify the species bacterial load. Three PCR panels have been optimized:panel 1 – Hi, Pa, Mc & internal control (IC); panel 2 – Sm, Sa & IC and panel 3 – Spy, Spn &IC. The results are generated in the form of quantification cycles (Cq) and translated into bacterial load (estimated colony forming, eCFU / ml) using a standard curve. There is an inverse relationship between Cq and the bacterial load of a samples. The species with high bacterial load signify multiplication and most likely driver of exacerbation of COPD / CBS symptoms. Once a patient begins antibiotic treatment, the decline in bacterial load is an indicator of efficacy of the antibiotic(s).Example sample preparation procedure(i) Culture 1. harvest (e.g.1 mL) aliquots of exponential phase bacterial culture into (e.g.1.5mL) plastic microtubes.(ii) Patient sputum specimen2. Open the specimen cup, pipette (e.g. 1 mL) aliquots into (e.g. 15 mL) plastic centrifuge tubes. 2. Nucleic acid (RNA) extractionNOTE: RNA extraction may exploit any suitable RNA kit.(i) Extraction control (EC) addition 1. Transfer (e.g.1 mL) aliquots of the samples to (e.g. 1.5 mL) tubes. Spike (e.g.100 µL) of the EC into each sample.(ii) Cell sedimentation 1. Centrifuge the tubes (e.g. at 20,000 x g for 10 min at room temperature).2. Suspend the sediment in (e.g.950 µL) lysis buffer.3. For cell lysis, transfer the tubes to a homogenizer. Homogenize the samples(e.g. for 40 s at 6,000 rpm). 2. Nucleic acid purification1. Centrifuge the lysate (e.g. at 12,000 x g for 5 min at room temperature).2. Prepare fresh (e.g. 1 mL) tubes and add (e.g. 300 µL) of chloroform into eachtube. 3. carefully pipette off the supernatant without touching the lysing matrix.4. Transfer the supernatant to the chloroform containing tubes and vortex (e.g. for5 s). Leave the tube to settle (e.g. for 5 min or longer) until three phases (upper,middle, and bottom) are clearly visible. 5. Centrifuge (e.g. at 12,000 x g for 5 min at room temperature). Carefully pipettethe upper phase and transfer into fresh (e.g.1.5 mL) tubes.6. Add (e.g. 500 µL) of ice-cold 100% ethanol, close the tubes, and mix gently(e.g. inverting upside down 3x). Incubate the tubes (e.g. at -80 °C for 15 min or -20 °C for 30 min) and continue the extraction, or leave (e.g. at -20 °C)overnight to complete the extraction the following day. 7. Chill the microcentrifuge (e.g. set to 4 °C and leave to chill to at least 12 °C)before commencing centrifugation. Load the tubes into the microcentrifuge andcentrifuge (e.g. for 20 min at 13,000 x g). Discard the supernatant, replace with70% ice-cold ethanol, and centrifuge (e.g. for another 10 min at 13,000 x g).NOTE: The 70% ethanol should be made with molecular grade nuclease freewater.8. Discard all the supernatant and transfer the tubes to an incubator (e.g. set at50 °C). Incubate (e.g. for 20 min) to dry the RNA / DNA pellet. Keep the tubes partially open to enable evaporation of all ethanol.9. Add (e.g.100 µL) of nuclease free water to the dry pellet and incubate (e.g.for 5 min at room temperature). Vortex (e.g. for 3s) to mix the contents.NOTE: At this stage the extract may be stored 2−3 days in the fridge orlonger at -80 °C. removal1. Prepare a mix of the enzyme DNase I 10x buffer and DNase I enzyme for thenumber of samples (10 µL of buffer and 2 µL of DNase per sample) plus 10% extra to cover any loss from pipetting. Mix by vortexing and then pipette (e.g. 12 µL) into each tube containing the RNA extract.2. Mix by vortexing (e.g. 3 s) and then spin briefly (e.g. 10 s at 13,000 x g) toremove any droplets on the walls. Incubate (e.g. at 37 °C for 30 min) in the hotblock or incubator. Add an additional amount (e.g. 2 μL of DNase I enzyme)directly into each tube, mix well by vortexing, and incubate (e.g. for a further 30 min at 37 °C).3. Thaw the DNase inactivation reagent (e.g.10 min) prior to the end of the DNaseincubation. Vortex (e.g. 20 s) to ensure a homogenous, milky suspension andthen add (e.g.10 μL) of DNase inactivation reagent into each RNA extract.4. Incubate the mixture at room temperature (e.g. for 5 min). Vortex (e.g. 3x)during the (e.g.5 min) incubation step.5. Centrifuge the mixture (e.g. at 13,000 x g for 2 min). Carefully transfer thesupernatant to (e.g. 1.5 mL) RNase free tubes without touching any of the inactivation matrix. 6. Store the RNA extract in the fridge if running the RT-qPCR on the same day orat -80 °C for long-term storage. everse Transcriptase qPCR1. For unknown samples, dilute all RNA extracts to be used in a 1:10 ratio in RNase freewater. Mix well by vortexing (e.g. for 5 s) and briefly spin down to remove any dropletsor air bubbles.2. For standard samples for a standard curve, take each bacterial species and EC RNAstandards from the -80 °C freezer and thaw at room temperature. Make (e.g. seven and six 10-fold) dilutions of each bacterial species and EC standard samplesrespectively. Change the tips before transferring the mixture from one tube to another. NOTE: Standard samples are supplied with the COPD-MBLA kit.3. Master mix preparationNOTE: Master mix (MM) is a solution of PCR reagents sufficient to amplify allsamples, standards, and water for a no template control (NTC). The water used as NTC should be the same water used in the extraction and for preparing the MM. Ensure that the standards, each RNA sample, and its decimal dilution are amplified 2x for the reverse transcriptase positive (RT+) reaction and 1x for the reverse transcriptase negative (RT-) reaction. The RT- reaction is a control to determine theefficiency of DNA removal (Table 1). 1. Transfer a volume (e.g. 16 µL) of MM into each PCR reaction tube.2. Add a volume (e.g. 4 µL) of RNA extract into each RT+ and RT- reaction tubeand water into the NTC reaction tubes. 3. Load the reaction tubes into a real time PCR machine and set the PCRconditions. In one teaching, the PCR conditions may be: 50 °C for 30 min, 95 °C for 15 min, 40x cycles at 94 °C for 45 s, and either 59 °C, 63 °C, or 62 °C (for assays 1-3 respectively, dependent on the assay being performed) for 1 min with acquisition with fluorophores that absorb in green, yellow, orange and crimson channels.NOTE: For assay 1, the green channel is the H.influenzae detection fluorophore, the orangechannel is the P.aeruginosa detection fluorophore, and the crimson channel is theM.catarrhalis detection fluorophore.For assay 2, the green channel is the S.aureus detection fluorophore, and the orangechannel is the S.mitis complex detection fluorophore.For assay 3, the green channel is the S.Pyogenes detection fluorophore, and the orangechannel is the S.pneumonia detection fluorophore. The yellow channel is the extractioncontrol detection fluorophore in all assays. 4. Result interpretationNOTE: Ensure that the duplicate reactions of the same sample do not differ by morethan 1 standard deviation. Bacterial and EC Cq values higher than 30 are considered negative. See further interpretation details in Table 2.1. To interpret the treatment response, convert the Cq values into bacterial load(eCFU / mL) using the standard curve. Read the treatment response as the change in bacterial load over the treatment follow-up period. NOTE: The fall in bacterial load following treatment signifies a positiveresponse (i.e., antibiotic drugs killing the bacteria) while no change or rise in bacterial load implies a negative response, which may mean resistance of bacteria to antibiotic drugs or the patient not appropriately adhering to their treatment dose. Supplementary RT qPCR information (example only) The RT qPCR process may involve 3 stages: 1. Reverse transcription of RNA to complementary DNA (cDNA) - 30min at 50°C.2. Denaturation of cDNA to open up the double strand - 15min at 95°C3. Cycling (amplification) involving primer annealing at 94°C for 45sec and elongation of the DNA strand at 60°C for 60sec during which the growing strand reacts with the fluorescent probe emitting fluorescence that captured by camera. The cycle is repeated 40 times. Unique probes are used for the extraction control and target bacteria. Fluorescence increases with amplification cycles until a threshold is reached at which the cycle threshold or quantification cycle is distinguishable from any background (non-specific fluorescence). The higher the concentration of the template (RNA) in a sample, the earlier the threshold is reached. For MBLA, the threshold line is set in the middle of the exponential phase of the amplification curve. Quantification cycles (Cqs) are then translated into bacterial load (estimated colony forming units per mL) using a standard curve. The bacterial load of the extraction control analysed within a fluorescent channel different from that of the target bacteria. Bacterial load measured by CBS-MBLA is inversely correlated to bacterial concentration The change in bacterial load measured by CBS-MBLA corresponds to the differences in cell concentration of cultures (CFU / mL), showing an inverse relationship of Cq value to bacterial load.Figures 1-3 demonstrate the inverse correlation found between bacterial load andlog10 eCFU / mL per culture. The data for slope, intersection of the line, coefficient of determination, and efficiency of the reaction are shown in Figures 1-3. Assay linearity and limit of detection were conducted using serial dilutions of the respective bacterial RNA extract. Dependent on the species, assay limit of detection was 104-101CFUs / mL. All r2 values were >0.991 and all amplification efficiencies were >92%, except for assay 3 which showed amplification efficiency of 89-91%.Figure 4: demonstrates the amplification efficiency, assay linearity and assay performanceof the internal (extraction) control used in the TB-MBLA Assay to control for the efficiency ofthe extraction procedure. 4A) Demonstrate the standard curve efficiency of 100.6% for theM. smegmatis extraction control. This optimized internal control demonstrates high assaylinearity and assay efficiency. The results demonstrate the high efficiency of all primer / probe sets for the three multiplex assays. 4B) demonstrates the high efficient amplification of the different concetraions of the extraction control with a perfect amplication difference of 3.3 quantification cycles from one concentration to another. By importing a previously runstandard curve, quantitative bacterial load can be calculated from unknown samples toprovide a value in CFU / mL.4C) Demonstrates effiency and consistency in recovering the extraction control from different batches of specimens. Black bars signify 1stbatch ofextraction control covering 9 extractions and the grey bars signify 2nd batch of extractioncontrol covering 10 extractions. Error bars are standard deviation of the mean.Establishment of the quantitative PCR methodDual labelled primers and probes targeting a specific unique region in each bacterial species were observed to be specific to the intended target gene. RT-qPCR was used to confirm the specificity of primer / probe sets with the results indicating the high specificity of primer sets. As Figure 3 demonstrates, no cross reactivity was observed, and each primer set can detect the intended bacterial target. Thus, all assays showed 100% specificity without cross- reactivity or detection of any other pathologically relevant species found in the normal respiratory flora and / or respiratory diseases.Table 1. Summary of primers and probes for use in the CBS-MBLA Assay 1 to specificallydetect H. influenzae, P. aeruginosa, M. catarrhalis. Primers and probes were tested in RT-qPCR for assay performance, specificity and sensitivity. A taxonomically unrelated species(A. tumefaciens) is used as an internal extraction control with primers and probe specificallydesigned for the 16S rRNA gene of this bacterial species. Target Oligo Sequences 5’-3’ GeneNCBI Fluore target Accession scent (number) probe H. Forward CTTGCTTTCTTGCTGAC 16SL42023.1 FAMinfluenzae Reverse CATCTTCCGATAATACGC rRNA Probe FAM-CCAGATTCCCAAGCATTACTCACC-BHQ1 P. Forward TTAAGTTGGGAGGAAGG 16S NR_026078.1 ROX aeruginosa Reverse TTTCACATCCAACTTGCTGAAC rRNA Probe ROX-AGCGTTAATCGGAATTACTGGGCGT-BHQ2 M. Forward GACATAGTGAGAATCTTGC 16S U10876.1 ATTO7 catarrhalis Reverse GTCACTGGCAGTATCC rRNA 00 Probe ATTO700-TTCCTTAGTTACCAGCGACTC-BHQ2 Extraction Forward AGCAACGCGCAGAACCTTACC 16SNC_003063 VICControl Reverse TCTGGGGCCAGCCTAACTGAAG rRNA Probe VIC-AGCTCTTGACATTCGGGGTTTGGGCAGT-BHQ1Table 2. Summary of primers and probes for use in Assay 2 to specifically detect pathologicalStreptococcus species relevant to respiratory diseases. Species specific lytA-encodedautolysin for detection of Streptococcus pneumoniae. Primers and probes were tested in RT-qPCR for assay performance, specificity and sensitivity. A taxonomically unrelated species(A. tumefaciens) was used as an internal extraction control with primers and probe specificallydesigned for the 16S rRNA gene of this bacterial species. TargetOligo Sequences 5’-3’ GeneNCBI Fluores (Source) target Accession cent (number) probeS. pyogenes ForwardGGGATAACTATTGGAAACG 16SAM295007.1 FAMReverse CAGGTCGGCTATGTATC rRNA ProbeFAM- AATACCGCATAAGAGAGACTAACG-BHQ1S. Forward ACGCAATCTAGCAGATGAAGCALytA NZ_UYIP01ROX pneumoniae Reverse TCGTGCGTTTTAATTCCAGCT 000002.1 (Gadsby et Probe ROX-TGCCGAAAACGCTTGATACAGGGAG-BHQ2 al., 2015) Internal Forward AGCAACGCGCAGAACCTTACC 16SNC_003063 VICControl Reverse TCTGGGGCCAGCCTAACTGAAG rRNA Probe VIC-AGCTCTTGACATTCGGGGTTTGGGCAGT-BHQ1Table 3. Summary of primers and probes for use in Assay 3 to specifically detect oralcommensal bacterial group of Streptococcus viridans and Staphylococcus aureus relevant torespiratory diseases. Species specific nuc gene used for detection of Staphylococcus aureus. Primers and probes were tested in RT-qPCR for assay performance, specificity and sensitivity.A taxonomically unrelated species (A. tumefaciens) was used as an internal extraction controlwith primers and probe specifically designed for the 16S rRNA gene of this bacterial species. TargetOligo Sequences 5’-3’ GeneNCBI Fluore (Source) target Accession scent (number) probe Streptococcus Forward CTGTGGCTTAACCATAGTAG 16S NZ_LS4833 ROX Viridan group Reverse CTCAGCGTCAGTTACAAG rRNA 90.1 Probe ROX-TCCATGTGTAGCGGTGAAATGCGTA-BHQ2 Staphylococcu Forward CATCCTAAAAAAGGTGTAGAGANUC NR_118997.FAM s aureus Reverse TTCAATTTTCTTTGCATTTTCTACCA 2 (Pichon et al., Probe FAM-TTTTCGTAAATGCACTTGCTTCAGGACCA-BHQ1 2012) Internal Forward AGCAACGCGCAGAACCTTACC 16SNC_003063 VICControl Reverse TCTGGGGCCAGCCTAACTGAAG rRNA Probe VIC-AGCTCTTGACATTCGGGGTTTGGGCAGT-BHQ1Table 4: Master mix preparation guide for the CBS-MBLA qPCR. (A-C) For assays 1-3.Assay 1 for detection of H. influenzae (H.i), P. aeruginosa (P.a), and M. catarrhalis (M.c).Assay 2 for detection of S. mitis complex (S.m), and S.aureus (S.a). Assay 3 for detection ofS. pyogenes (S.py), and S. pneumoniae (S.pn).RT positive reaction RT negative reactionVolume per reaction x no. of Volume per reaction x no. of Master mix assay 2 reactions + 5 reactions + 5 Quantitect mix 10.0 μL 10.0 μLS.a nuc primer mix (F + R) 0.4 μL 0.4 μLS.a nuc probe 0.1 μL 0.1 μL S.m 16S primer mix (F + R) 0.6 μL 0.6 μLS.m 16S probe 0.3 μL 0.3 μLEC primer mix (F + R) 0.2 μL 0.2 μLEC probe 0.1 μL 0.1 μLRT enzyme 0.2 μL -------RNase free water 4.1 μL 4.3 μLTotal volume 16 µL 16 μLTable 5. RT-qPCR tests for primer specificity validation against various microbial DNA templates. Positive PCR signal indicated with (+) and negative PCR signal (>30 Cq) indicated with (-). Isolate RT-qPCR detection of target speciesIntern H. P. M. S. S. S. al influenz aerugino catarrha pyogen pneumoni aure contro S. ae sa lis es ae us l mitis H. influenzae + - - - - - - -P.aeruginosa - + - - - - - -M.catarrhalis - - + - - - - -Internal control - - - - - - + -Escherichia coli - - - - - - - -Staphylococc us aureus - - - - - + - -Streptococcus pneumonia - - - - - - - +Klebsiella pneumonia - - - - - - - -Streptococcus mitis - - - - - - - +Streptococcus oralis - - - - - - - + Streptococcus pneumoniae - - - - + - - -Streptococcus pyogenes - - - + - - - -Acinetobacter baumannii - - - - - - - -Mycobacteriu mavium - - - - - - - -Mycobacteriu mabscessus - - - - - - - -Mycobacteriu mchelonae - - - - - - - -Mycobacteriu mfortuitum - - - - - - - -Mycobacteriu mkansasii - - - - - - - -Mycobacteriu mmarinum - - - - - - - -Mycobacteriu mXenopi - - - - - - - -Bacille Calmette Guerin - - - - - - - -METHODS Assay design and optimization The assay was first optimized by targeting single pathogens with primers and dual labelled probes specific to the 16S rRNA of the pathogen in single-plex RT-qPCR. Single-plex qPCR results were evaluated prior to potential optimization procedures to determine the most appropriate primer and probe concentration and annealing temperature. Primers and probes were re-designed as necessary due to specificity or efficiency issues. The assay efficiency was estimated by testing a minimum of seven ten-fold serial dilutions of three biological and three technical repeats for each bacterial species. Efficiency acceptance values based on diagnostic use were values between 0.95 and 1.05 (95-105%). Progression to the optimization of the quadruplex and triplex assays were performed following optimization of the singleplex and duplex assays. Determine the most appropriate primer and probe concentration and annealing temperature was continually performed along all optimization steps. Further re- design of primers and Taqman dual labelled probes was performed if oligo sets produced insufficient efficiency, formed secondary structures, or exhibited poor specificity to the target of interest in the multiplex quantification results. Universal dual labelled dyes were chosen with a specific fluorophore and quencher for each target in the four-plex assay to ensure no cross reactivity or cross channel breeding. Extraction controlThe soil bacterium of Agrobacterium tumefaciens was chosen for use in the assay as aninternal extraction control due to its physiological similarity to H. influenzae, P. aeruginosa,and M. catarrhalis. As A. tumefaciens is taxonomically unrelated to the target bacterial speciesin the assay, performance of this microorganism was evaluated as a potential species to accurately control and adjust for bacterial loss during the RNA extraction procedure. Use ofA. tumefaciens as an extraction control was recently applied to a duplex qPCR assay in aprevious study (Falconer, 2016, unpublished data). The extraction control is used as aninternal control to monitor efficiency of the extraction process. Addition of 100 ul of theextraction control at an optimized concentration (10^6 CFU / ml) is spike into all samples prior to the RNA extraction procedure. Extraction control cross reactivity Evaluation of the oligonucleotide set for the extraction control was performed to observepotential cross reactivity of the internal control A. tumefaciens with the target pathogens.Testing was performed to assess the potential impact on all target bacterial species quantification or impact in efficiency because of the acquisition channels in use. Potentialfluorophore spectra overlap was evaluated to observe cross-reactivity between the A.tumefaciens oligo set to each target bacterial pathogen species.CONCLUSIONS It has been shown that it is possible to adapt the molecular bacterial load assay (MBLA) test to detect key bacterial species associated with exacerbations of COPD and CBS. The findings confirm the effectiveness of the method in detecting and quantifying several keybacterial species underlying patient aggravations COPD and CBS. Direct quantification ofbacterial load from patient sputum without the requirement of culture increases sensitivity and shortens time to result. The method allows faster identification of bacteria in samples and increases the potential for rapid clinical decision-making regarding patient progress. Patient sputum samples can be processed in a category 2 laboratory with two main protocol steps to achieve CBS-MBLA results: RNA extraction and RT-qPCR. The CBS-MBLA consists of three (RT)-qPCR multiplex assays. The first is a quadraplex running dual labelled probes for Haemophilus influenzae, Pseudomonas aeruginosa,Moraxella catarrhalis and the extraction control. The second is a triplex running dual labelledprobes for the Streptococcus mitis species complex, Staphylococcus aureus and theextraction control. The third assay is a triplex running dual labelled probes for Streptococcuspyogenes, Streptococcus pneumonia and the extraction control. All assays involve threestep PCR: 30 min reverse transcription by reverse transcriptase at 50 °C, 15 min denaturation at 95 °C, and 40 cycles of amplification at 94 °C for 15 s. Assay one is run atthe annealing temperature of 59 °C, assay two at 63 °C, and assay three at 62 °C. Thus,acquisition of fluorescence from the probes occurs at either 59 °C, 63 °C, or 62 °C, respectively for each assay (i.e., the fragment elongation stage). The advantage of the procedure is that the CBS-MBLA results are available within 6 hours and time-to-result is independent of the level of bacterial load. This is in contrast with 2–3 days for culture tests using bacterial culture techniques. Contamination and unspecific growth of microbial flora in culture further compromises the results from culture-based tests. A culture-free, multiplex PCR strategy saves time, labour, reagents lost in repeating cultures due to no growth (false negative) and / or contamination (false positive growth). The highly sensitive and specific multiplex real-time assays can be implemented in diagnostic laboratories for rapid identification and quantification of bacterial load using a single-tube approach, to maximize user time and reagent use. A critical step in the RNA extraction procedure is the effective removal of DNA for downstream processes. The removal efficiency of the DNA is controlled for by running asingle reaction per sample in the absence of RT. A positive result from the RT- reaction willindicate insufficient removal of DNA. In high burden samples or higher concentration bacterial standards, high amounts of DNA can be present and require additional amounts of the DNase enzyme to completely remove contaminating DNA. Although, note that in samples of high bacillary load, the presence of small amounts of DNA is less likely to affect the result from the RNA. Ribosomal RNA is one of the main CBS-MBLA gene targets andnaturally occurs in twice the amount of DNA (Yamada et al, 2015).To control for cross contamination during the PCR, a no template control (NTC) which is the water used to dissolve the PCR reagents, is run with every test. A positive signal in the NTC is due to cross contamination with exogenous DNA or RNA and tests must be repeated if contamination is observed. The results are considered invalid for that PCR run if a positive signal in the NCT is observed. Analysis of the PCR results is a key step in the method and involves the conversion of PCR Cqs into bacterial load (i.e., the estimated colony forming units per mL) using a standardcurve for each target. A standard curve may be set up and optimised for this step. Therecommended efficiency for the standard curves is 0.95–1. The standard curves for eachbacterial species and extraction control may be set up and optimised before patient or othertest samples are used. The disclosure further embraces the following numbered clause statements: Clause 1. An extraction control for a molecular bacterial load assay (MBLA), wherein the MBLA is used to enumerate a target bacteria in a sample and said extraction control comprises one or more control bacteria for addition to the sample, wherein the control bacteria is physiologically similar to one or more of the target bacteria but taxonomically unrelated.Clause 2. The extraction control of Clause 1, wherein said extraction control furtehrcomprises detecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample.Clause 3. The extraction control of Clause 1 or 2, wherein the extraction control permitsthe MBLA user to: (i) accurately control and adjust for the loss of a target bacteria from a sample during a nucleic acid extraction procedure; and / or (ii) monitor the efficiency of a (target bacterial) nucleic acid extraction process from a sample.Clause 4. The extraction control of any preceding Clause, wherein the sample is spikedwith the control bacteria, control bacteria as whole cells and / or nucleic acid / RNA obtained or derived from the control bacteria.Clause 5. The extraction control of any preceding Clause, wherein RNA is extractedfrom the sample / spiked sample.Clause 6. The extraction control of Clause 5, wherein: (a) where the extraction controlcomprises nucleic acid / RNA obtained or derived from the control bacteria, the nucleic acid / RNA is added after any lysis step associated with RNA extraction process; or (b) where the extraction control is whole bacterial cells, the whole bacterial cells are added directly to the sample and prior to the RNA extraction process including any lysis step associated therewith.Clause 7. The extraction control of Clause 5 or 6, wherein the extracted RNA issubjected to RT-qPCR to quantify 16s rRNA;Clause 8. The extraction control of any preceding Clause, wherein the physiologicallysimilar, but taxonomically unrelated control bacteria is not already present in the sample. Clause 9. The extraction control of any preceding Clause, wherein the physiologically similar, but taxonomically unrelated control bacteria is a marine organism.Clause 10. The extraction control of any one of clauses 1-8, wherein the physiologicallysimilar, but taxonomically unrelated control bacteria is Mycobacterium smegmatis.Clause 11. The extraction control of any one of clauses 1-8, wherein the physiologicallysimilar, but taxonomically unrelated control bacteria is a plant pathogen.Clause 12. The extraction control of any one of clauses 1-8, wherein the physiologicallysimilar, but taxonomically unrelated control bacteria is Agrobacterium tumefaciens.Clause 13. The extraction control of any preceding clause, wherein the samplecomprises or is likely to comprise the target bacteria.Clause 14. The extraction control of any preceding clause, wherein the target bacteria isany bacterial species of interest.Clause 15. The extraction control of any preceding clause, wherein the target bacteriacomprises a single bacterial species or multiple bacterial species.Clause 16. The extraction control of any preceding clause, wherein the target bacteriacomprises one or more pathogenic bacterial species.Clause 17. The extraction control of any preceding clause, wherein the target bacteria isassociated with a disease or condition.Clause 18. The extraction control of any preceding clause, wherein the target bacteria isassociated with a chronic disease or chronic condition.Clause 19. The extraction control of any preceding clause, wherein the target bacteriacauses or contributes to a pathological condition.Clause 20. The extraction control of any preceding clause, wherein the target bacteria isan indicator of a disease state.Clause 21. The extraction control of any preceding clause, wherein the target bacteria isnot a primary pathogen.Clause 22. The extraction control of any preceding clause, wherein the target bacteriacomprises is a secondary pathogen associated with a (chronic) disease or (chronic) condition.Clause 23. The extraction control of any preceding clause, wherein the target bacteriacomprises is an opportunistic pathogen associated with a (chronic) disease or (chronic) condition.Clause 24. The extraction control of any preceding clause, wherein the target bacteriacomprises is a respiratory pathogen.Clause 25. The extraction control of any preceding clause, wherein the target bacteriacomprises one or more pathological non-tuberculosis mycobacteria species.Clause 26. The extraction control of any one of clauses 1-23, wherein the target bacteriacomprises one or more pathological Streptococcal species.Clause 27. The extraction control of any one of clauses 1-23, wherein the target bacteriacomprises one or more species selected from the group consisting of: (i) H. influenza;(ii) P. aeruginosa;(iii) M. tuberculosis;(iv) M. abscessus;(v) M. catarrhalis;(vi) S. pneumonia;(vii) S. mitis; (viii) S. pyogenes; (ix) S. oralis; and(x) S. aureus.Clause 29. The extraction control of any preceding clause, wherein the samplecomprises a biological sample.Clause 30. The extraction control of any preceding clause, wherein the samplecomprises a tissue or biological fluid.Clause 31. The extraction control of any preceding clause, wherein the samplecomprises blood, whole blood or a fraction thereof, serum, plasma, mucus, sputum, saliva, CSF, faeces (stool), urine, fluid from a lavage or wash procedure, a secretion, a tissue scraping and / or a cell.Clause 32. The extraction control of any preceding clause, wherein the samplecomprises saliva.Clause 33. The extraction control of any preceding clause, wherein the samplecomprises sputum.Clause 34. The extraction control of any preceding clause, wherein the samplecomprises two or more samples from different sources and / or of different types.Clause 35. The extraction control of any preceding clause, wherein the sample is subjectto a nucleic acid extraction procedure to yield a nucleic acid preparation.Clause 36. The extraction control of clause 35, wherein DNA is removed from the nucleicacid preparation to yield an RNA preparation.Clause 37. The extraction control of clause 36, wherein the 16s rRNA component of theRNA preparation is quantified using RT-qPCR.Clause 38. An assay for:(i) accurately controlling and adjusting for the loss of a target bacteria from a sample during a bacterial nucleic acid extraction procedure; and / or (ii) monitoring the efficiency of a target bacterial nucleic acid extraction process from a sample; said assay comprising: (a) spiking the sample with Agrobacterium tumefaciens and / or Agrobacteriumtumefaciens RNA; (b) extracting 16s ribosomal RNA from the sample,(c) subjecting the extracted 16s rRNA to RT-qPCR to quantify the 16s rRNA;and (d) from the RT-qPCR determining whether any target bacteria may have been lost during the bacterial nucleic acid extraction procedure or determining the efficiency of a target bacterial nucleic acid extraction process from a sample.Clause 39. The assay of clause 38, wherein the RT-qPCR uses the following primers:Forward primer 5’ – AGCAACGCGCAGAACCTTACC – 3’Reverse primer 5’ – TCTGGGGCCAGCCTAACTGAAG – 3’.Clause 40. An extraction control for a MBLA, wherein the MBLA is used to enumerate thenumber of target bacteria in a sample and said extraction control comprises detecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample, wherein the control bacteria is Agrobacterium tumefaciens and the nucleic acid is A. tumefaciens 16s rRNA.Clause 41. The assay of clause 38, wherein the target bacteria is selected from the groupconsisting of:(i) one or more pathogenic bacterial species;(ii) one or more bacteria associated with a disease or condition;(iii) one or more bacteria associated with a chronic disease or chronic condition;(iv) one or more bacteria causing or contributing to a pathological condition;(v) one or more bacteria which are indicator(s) of a disease state;(vi) a respiratory pathogen;(vii) one or more pathological non-tuberculosis mycobacteria species;(viii) one or more pathological Streptococcal species; and(ix) one or more species selected from the group consisting of:(a) H. influenza;(b) P. aeruginosa;(c) M. tuberculosis;(d) M. abscessus;(e) M. catarrhalis;(f) S. pneumonia;(g) S. mitis; (h) S. pyogenes;(i) S. oralis; and(j) S. aureus.Clause 42. An assay for:(i) accurately controlling and adjusting for the loss of a target bacteria from a sample during a bacterial nucleic acid extraction procedure; and / or (ii) monitoring the efficiency of a target bacterial nucleic acid extraction process from a sample; said assay comprising : (a) spiking the sample with Mycobacterium smegmatus and / or Mycobacteriumsmegmatus RNA; (b) extracting 16s ribosomal RNA from the sample,(c) subjecting the extracted 16s rRNA to RT-qPCR to quantify the 16s rRNA;and (d) from the RT-qPCR determining whether any target bacteria may have been lost during the bacterial nucleic acid extraction procedure or determining the efficiency of a target bacterial nucleic acid extraction process from a sample.Clause 43. An extraction control for a MBLA, wherein the MBLA is used to enumerate thenumber of target bacteria in a sample and said extraction control comprises detecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample, wherein the control bacteria is Mycobacterium smegmatus and the nucleic acid is Mycobacterium smegmatus 16s rRNA.Clause 44. The MBLA of clause 43, wherein the target bacteria is selected from thegroup consisting of:(i) one or more pathogenic bacterial species;(ii) one or more bacteria associated with a disease or condition;(iii) one or more bacteria associated with a chronic disease or chronic condition;(iv) one or more bacteria causing or contributing to a pathological condition;(v) one or more bacteria which are indicator(s) of a disease state;(vi) a respiratory pathogen;(vii) one or more pathological non-tuberculosis mycobacteria species;(viii) one or more pathological Streptococcal species; and(ix) one or more species selected from the group consisting of:(a) H. influenza;(b) P. aeruginosa;(c) M. tuberculosis;(d) M. abscessus;(e) M. catarrhalis;(f) S. pneumonia;(g) S. mitis; (h) S. pyogenes; (i) S. oralis; and(j) S. aureus.REFERENCES Banada, P.P., Sivasubramani, S.K., Blakemore, R., Boehme, C., Perkins, M.D., Fennelly, K. and Alland, D., 2010. Containment of bioaerosol infection risk by the Xpert MTB / RIF assay and its applicability topoint-of-care settings. Journal of clinical microbiology, 48(10), pp.3551-3557.Cruciani, M., Scarparo, C., Malena, M., Bosco, O., Serpelloni, G. and Mengoli, C., 2004. Meta-analysis of BACTEC MGIT 960 and BACTEC 460 TB, with or without solid media, for detection ofmycobacteria. Journal of clinical microbiology, 42(5), pp.2321-2325.Desjardin, L.E., Perkins, M.D., Wolski, K., Haun, S., Teixeira, L., Chen, Y., Johnson, J.L., Ellner, J.J., Dietze, R., Bates, J. and Donald Cave, M., 1999. Measurement of sputum Mycobacterium tuberculosismessenger RNA as a surrogate for response to chemotherapy. American journal of respiratory andcritical care medicine, 160(1), pp.203-210.Honeyborne, I., McHugh, T.D., Phillips, P.P., Bannoo, S., Bateson, A., Carroll, N., Perrin, F.M., Ronacher, K., Wright, L., Van Helden, P.D. and Walzl, G., 2011. Molecular bacterial load assay, a culture-free biomarker for rapid and accurate quantification of sputum Mycobacterium tuberculosisbacillary load during treatment. Journal of clinical microbiology, 49(11), pp.3905-3911.Honeyborne, I., McHugh, T.D., Phillips, P.P., Bannoo, S., Bateson, A., Carroll, N., Perrin, F.M., Ronacher, K., Wright, L., Van Helden, P.D. and Walzl, G., 2011. Molecular bacterial load assay, a culture-free biomarker for rapid and accurate quantification of sputum Mycobacterium tuberculosisbacillary load during treatment. Journal of clinical microbiology, 49(11), pp.3905-3911.Mtafya, B., Sabiiti, W., Sabi, I., John, J., Sichone, E., Ntinginya, N.E. and Gillespie, S.H., 2019. Molecular bacterial load assay concurs with culture on NaOH-induced loss of Mycobacteriumtuberculosis viability. Journal of Clinical Microbiology, 57(7), pp.e01992-18. Tyrrell, F.C., Budnick, G.E., Elliott, T., Gillim-Ross, L., Hildred, M.V., Mahlmeister, P., Parrish, N., Pentella, M., Vanneste, J., Wang, Y.F. and Starks, A.M., 2012. Probability of negative Mycobacterium tuberculosis complex cultures based on time to detection of positive cultures: a multicenter evaluationof commercial-broth-based culture systems. Journal of clinical microbiology, 50(10), pp.3275-3282.Calverley, P. et al. (2007). Salmeterol and fluticasone propionate and survival in chronic obstructive pulmonary disease. New England Journal of Medicine 356(8), 775789. Chalmers, J. et al. (2016). Neutrophil Elastase Activity is Associated with Exacerbations and Lung Function Decline in Bronchiectasis. American Journal of Respiratory and Critical Care Medicine 195(10), rccm.201605-1027OC. Chalmers, J., Chotirmall, S. (2018). Bronchiectasis: new therapies and new perspectives. The Lancet. Respiratory medicine 6(9), 715726. Cox, M.et al. (2017). Longitudinal assessment of sputum microbiome by sequencing of the 16S rRNA gene in non-cystic fibrosis bronchiectasis patients. PLoS ONE 12(2), e0170622. Dransfield, M. et al. (2013). Once-daily inhaled fluticasone furoate and vilanterol versus vilanterol only for prevention of exacerbations of COPD: two replicate double-blind, parallel- group, randomised controlled trials. The Lancet. Respiratory medicine 1(3), 210-23. Flume, P., Chalmers, J., Olivier, K. (2018). Advances in bronchiectasis: endotyping, genetics, microbiome, and disease heterogeneity The Lancet 392(10150), 880-890. Gadsby, N. et al. (2015). Development of two real-time multiplex PCR assays for the detection and quantification of eight key bacterial pathogens in lower respiratory tract infections. Clinical microbiology and infection: the official publication of the European Society of Clinical Microbiology and Infectious Diseases 21(8), 788.e1-788.e13. Gadsby, N. et al. (2016). Comprehensive Molecular Testing for Respiratory Pathogens in Community-Acquired Pneumonia Clinical Infectious Diseases 62(7), 817-823. Gillespie, S., Sabiiti, W., Oravcova, K. (2017). Mycobacterial Load Assay. Methods in molecular biology (Clifton, N.J.) 1616(8), 89105. Hurst, J., Elborn, J., Soyza, A., Consortium, B. (2015). COPD-bronchiectasis overlap syndrome. The European respiratory journal 45(2), 310-3. Keir, H. et al (2019). Personalised anti-inflammatory therapy for bronchiectasis and cystic fibrosis: selecting patients for controlled trials of neutrophil elastase inhibition. ERJ open research 5(1), 00252-2018. Lozano, R., Naghavi, M., Foreman, et al. (2012). Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. The Lancet 380(9859), 2095-2128. Sabiiti, W. et al. (2019). Improving diagnosis and monitoring of treatment response in pulmonary tuberculosis using the molecular bacterial load assay (MBLA) bioRxiv Singanayagam, A. et al. (2019). Inhaled corticosteroid suppression of cathelicidin drives dysbiosis and bacterial infection in chronic obstructive pulmonary disease Science Translational Medicine 11(507), eaav3879. Suissa, S., Patenaude, V., Lapi, F., Ernst, P. (2013). Inhaled corticosteroids in COPD and the risk of serious pneumonia. Thorax 68(11), 10291036. Walia, G., Vellakkal, R., Gupta, V. (2015). Chronic Obstructive Pulmonary Disease and its Non-Smoking Risk Factors in India COPD: Journal of Chronic Obstructive Pulmonary Disease 13(2), 251-261. Unger, S., Bogaert, D. (2017). The respiratory microbiome and respiratory infections. The Journal of infection 74 Suppl 1(Lancet38599662015), S84-S88. Yamada, H., Yamaguchi, M., Chikamatsu, K., Aono, A., Mitarai, S. Structome analysis of virulent Mycobacterium tuberculosis, which survives with only 700 ribosomes per 0.1 fl of cytoplasm. PLoS One.10, 1-14 (2015).

Claims

1. Claims 1. Use of an extraction control for a molecular bacterial load assay (MBLA), wherein the MBLA is used to enumerate a target bacteria in a sample and wherein said extraction control comprises one or more control bacteria physiologically similar to one or more of the target bacteria but taxonomically unrelated.

2. A molecular bacterial load assay (MBLA) for enumerating a target bacteria in a sample,said MBLA comprising an extraction control, which extraction control comprises one or more control bacteria physiologically similar to one or more of the target bacteria but taxonomically unrelated.

3. The use of claim 1 or MBLA of claim 2, wherein said extraction control further comprisesdetecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample.

4. The use or MBLA of claims 1 or 2, wherein the extraction control permits the MBLAuser to: (i) accurately control and adjust for the loss of a target bacteria from a sample during a nucleic acid extraction procedure; and / or (ii) monitor the efficiency of a (target bacterial) nucleic acid extraction process from a sample.

5. The use or MBLA of any preceding claim, wherein the sample is spiked with thecontrol bacteria, control bacteria as whole cells and / or nucleic acid / RNA obtained or derived from the control bacteria.

6. The use or MBLA of any preceding claim, wherein RNA is extracted from thesample / spiked sample.

7. The use or MBLA of claim 5, wherein: (a) where the extraction control comprisesnucleic acid / RNA obtained or derived from the control bacteria, the nucleic acid / RNA isadded after any lysis step associated with the RNA extraction process; or (b) where theextraction control is whole bacterial cells, the whole bacterial cells are added directly to thesample and prior to the RNA extraction process including any lysis step associatedtherewith.

8. The use or MBLA of claim 5 or 6, wherein the extracted RNA is subjected to RT-qPCR to quantify 16s rRNA;9. The use or MBLA of any preceding claim, wherein the physiologically similar, buttaxonomically unrelated control bacteria is not already present in the sample.

10. The use or MBLA of any preceding claim, wherein the physiologically similar, buttaxonomically unrelated control bacteria is a marine organism.

11. The use or MBLA of any one of claims 1-8, wherein the physiologically similar, buttaxonomically unrelated control bacteria is Mycobacterium smegmatis.

12. The use or MBLA of any one of claims 1-8, wherein the physiologically similar, buttaxonomically unrelated control bacteria is a plant pathogen.

13. The use or MBLA of any one of claims 1-8, wherein the physiologically similar, buttaxonomically unrelated control bacteria is Agrobacterium tumefaciens.

14. The use or MBLA of any preceding claim, wherein the sample comprises or is likely tocomprise the target bacteria.

15. The use or MBLA of any preceding claim, wherein the target bacteria is selected fromthe group consisting of: (a) any bacterial species of interest; (b) a single bacterial species or multiple bacterial species; (c) one or more pathogenic bacterial species; (d) a bacteria which is associated with a disease or condition; (e) a bacteria associated with a chronic disease or chronic condition;(f) a bacteria which causes or contributes to a pathological condition;(g) a bacteria which is an indicator of a disease state;(h) a bacteria which is not a primary pathogen;(i) a secondary pathogen associated with a (chronic) disease or (chronic) condition;(j) an opportunistic pathogen associated with a (chronic) disease or (chronic) condition;(k) a respiratory pathogen; (l) one or more pathological non-tuberculosis mycobacteria species; and(m) one or more species selected from the group consisting of:(i) H. influenza;(ii) P. aeruginosa;(iii) M. tuberculosis;(iv) M. abscessus;(v) M. catarrhalis;(vi) S. pneumonia;(vii) S. mitis; (viii) S. pyogenes; (ix) S. oralis; and(x) S. aureus.

16. The use or MBLA of any preceding claim, wherein the sample comprises a biologicalsample, a tissue, biological fluid, blood, whole blood or a fraction thereof, serum, plasma, mucus, sputum, saliva, CSF, faeces (stool), urine, fluid from a lavage or wash procedure, a secretion, a tissue scraping and / or a cell.

17. The use or MBLA of any preceding claim, wherein the sample is subject to a nucleicacid extraction procedure to yield a nucleic acid preparation.

18. The use or MBLA of claim 16, wherein DNA is removed from the nucleic acidpreparation to yield an RNA preparation.

19. The use or MBLA of claim 17, wherein the 16s rRNA component of the RNApreparation is quantified using RT-qPCR.

20. An assay for:(i) accurately controlling and adjusting for the loss of a target bacteria from a sample during a bacterial nucleic acid extraction procedure; and / or (ii) monitoring the efficiency of a target bacterial nucleic acid extraction process from a sample; said assay comprising: (a) spiking the sample with Agrobacterium tumefaciens and / or Agrobacteriumtumefaciens RNA;(b) extracting 16s ribosomal RNA from the sample,(c) subjecting the extracted 16s rRNA to RT-qPCR to quantify the 16s rRNA;and (d) from the RT-qPCR determining whether any target bacteria may have been lostduring the bacterial nucleic acid extraction procedure or determining the efficiency of a targetbacterial nucleic acid extraction process from a sample.

21. The assay of claim 20, wherein the RT-qPCR uses the following primers:Forward primer 5’ – AGCAACGCGCAGAACCTTACC – 3’Reverse primer 5’ – TCTGGGGCCAGCCTAACTGAAG – 3’.

22. An MBLA used to enumerate the number of target bacteria in a sample, said MBLAcomprising an extraction control, which extraction control comprises detecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample, wherein the control bacteria is Agrobacterium tumefaciens and the nucleic acid is A.tumefaciens 16s rRNA.

23. The assay of claims 20 or 21 or MBLA of claim 22, wherein the target bacteria isselected from the group consisting of:(i) one or more pathogenic bacterial species;(ii) one or more bacteria associated with a disease or condition;(iii) one or more bacteria associated with a chronic disease or chronic condition;(iv) one or more bacteria causing or contributing to a pathological condition;(v) one or more bacteria which are indicator(s) of a disease state;(vi) a respiratory pathogen;(vii) one or more pathological non-tuberculosis mycobacteria species;(viii) one or more pathological Streptococcal species; and(ix) one or more species selected from the group consisting of:(a) H. influenza;(b) P. aeruginosa;(c) M. tuberculosis;(d) M. abscessus;(e) M. catarrhalis;(f) S. pneumonia;(g) S. mitis; (h) S. pyogenes; (i) S. oralis; and(j) S. aureus.

24. An assay for:(i) accurately controlling and adjusting for the loss of a target bacteria from a sample during a bacterial nucleic acid extraction procedure; and / or (ii) monitoring the efficiency of a target bacterial nucleic acid extraction process from a sample; said assay comprising : (a) spiking the sample with Mycobacterium smegmatus and / or Mycobacteriumsmegmatus RNA;(b) extracting 16s ribosomal RNA from the sample,(c) subjecting the extracted 16s rRNA to RT-qPCR to quantify the 16s rRNA;and (d) from the RT-qPCR determining whether any target bacteria may have been lost during the bacterial nucleic acid extraction procedure or determining the efficiency of a target bacterial nucleic acid extraction process from a sample.

25. An MBLA used to enumerate the number of target bacteria in a sample, said MBLAcomprising an extraction control, which extraction control comprises detecting and / or quantifying the presence of a nucleic acid of one or more control bacteria in the sample,wherein the control bacteria is Mycobacterium smegmatus and the nucleic acid isMycobacterium smegmatus 16s rRNA.

26. The assay of claim 24 or MBLA of claim 25, wherein the target bacteria is selectedfrom the group consisting of: (i) one or more pathogenic bacterial species;(ii) one or more bacteria associated with a disease or condition;(iii) one or more bacteria associated with a chronic disease or chronic condition;(iv) one or more bacteria causing or contributing to a pathological condition;(v) one or more bacteria which are indicator(s) of a disease state;(vi) a respiratory pathogen;(vii) one or more pathological non-tuberculosis mycobacteria species;(viii) one or more pathological Streptococcal species; and(ix) one or more species selected from the group consisting of:(a) H. influenza;(b) P. aeruginosa;(c) M. tuberculosis;(d) M. abscessus;(e) M. catarrhalis;(f) S. pneumonia;(g) S. mitis; (h) S. pyogenes; (i) S. oralis; and(j) S. aureus.

27. Use of a bacteria that physiologically similar to one or more of a target bacteria buttaxonomically unrelated as an extraction control in an MBLA for enumerating the target bacteria in a sample.

28. The use of claim 27, wherein the physiologically similar, but taxonomically unrelatedcontrol bacteria is not already present in the sample.

29. The use of any one of claims 27-28, wherein the physiologically similar, buttaxonomically unrelated control bacteria is Mycobacterium smegmatis and / or Agrobacteriumtumefaciens.

Images