Capped polynucleotide

The capped polynucleotide structure with multiple translation units and a 5' cap structure linked to a stem loop in the RNA chain addresses inefficiencies in mRNA vaccines, enhancing translation efficiency of multiple proteins or peptides.

WO2026009964A1PCT designated stage Publication Date: 2026-01-08NAT UNIV CORP TOKAI NAT HIGHER EDUCATION & RES SYST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/024061
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-10
Filing Date
2025-07-03
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Existing mRNA vaccines face challenges in efficiently translating multiple proteins or peptides from a single RNA molecule due to varying transfection efficiencies and low translation rates from downstream coding sequences.

Method used

A capped polynucleotide structure with multiple translation units, each containing a 5' cap structure and a protein or peptide coding sequence, linked to a base within a stem loop, allows for efficient translation by introducing a cap structure into the RNA chain using tRNA-guanine transglycosylase.

Benefits of technology

Enhances translation efficiency of multiple proteins or peptides from a single RNA molecule by stabilizing the cap structure and promoting translation across the entire sequence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure JPOXMLDOC01-APPB-C000001
    Figure JPOXMLDOC01-APPB-C000001
  • Figure JPOXMLDOC01-APPB-C000002
    Figure JPOXMLDOC01-APPB-C000002
  • Figure JPOXMLDOC01-APPB-C000003
    Figure JPOXMLDOC01-APPB-C000003
Patent Text Reader

Abstract

Provided is a technique for efficiently translating a protein or peptide from a polynucleotide containing two or more proteins or peptide coding sequences. A capped polynucleotide comprises two or more translation units containing a 5' cap structure and a protein or peptide coding sequence disposed downstream thereof.
Need to check novelty before this filing date? Find Prior Art

Description

Capped Polynucleotides

[0001] The present invention relates to capped polynucleotides and the like.

[0002] In recent years, the use of mRNA vaccines has become widespread. The structure of an mRNA vaccine can be divided into a cap structure, a 5' untranslated region, a protein coding region, a 3' untranslated region, and a poly(A) tail region from the 5' end. The presence of a cap structure allows protein translation from the mRNA vaccine. Patent Document 1 describes capped RNAs with various unprecedented structures and high translation activity, as well as methods for producing the same. Specifically, it discloses a structure with a cap structure at a branch on the RNA.

[0003] International Publication No. 2023 / 167276 International Publication No. 2023 / 282245

[0004] By expressing multiple proteins or peptides from a single RNA molecule, it is possible to avoid the problem of different transfection efficiencies between cells that can occur when multiple proteins or peptides are expressed from separate RNA molecules. However, in this case, the translation rate from the downstream coding sequence is relatively low.

[0005] An objective of the present invention is to provide a technique for efficiently translating a protein or peptide from a polynucleotide containing two or more protein- or peptide-encoding sequences.

[0006] The present inventors have conducted extensive research in light of the above-mentioned problems and have found that the above-mentioned problems can be solved by a capped polynucleotide containing two or more translation units each containing a 5' cap structure and a protein or peptide coding sequence located downstream of the 5' cap structure. Based on this finding, the present inventors have conducted further research and have completed the present invention. The present invention encompasses the following aspects.

[0007] Item 1. A capped polynucleotide comprising two or more translation units comprising a 5' cap structure and a protein or peptide coding sequence located downstream thereof.

[0008] Item 2. The capped polynucleotide of Item 1, wherein at least one of the 5' cap structures is linked to a base within a stem loop in the polynucleotide.

[0009] Item 3. The capped polynucleotide of Item 2, wherein the base is PreQ1.

[0010] Item 4. The capped polynucleotide of any one of Items 1 to 3, which is circular.

[0011] Item 5. The capped polynucleotide of any one of Items 1 to 3, which is non-circular.

[0012] Item 6. A capped polynucleotide comprising one translation unit comprising a 5' cap structure and a protein or peptide coding sequence located downstream thereof, wherein the 5' cap structure is linked to a base within a stem loop in the polynucleotide.

[0013] Item 7. The capped polynucleotide of Item 6, which is circular.

[0014] Item 8. A compound in which a 5' cap structure is linked to PreQ1 directly or via a linker.

[0015] Item 9. The compound according to Item 8, wherein a 5' cap structure is linked to the amino group on the aminomethyl group of PreQ1 via a linker.

[0016] Item 10. A method for producing the capped polynucleotide according to any one of Items 1 to 7, comprising reacting a polynucleotide comprising a stem-loop containing guanine in the loop portion with the compound according to Item 8 in the presence of tRNA-guanine transglycosylase.

[0017] Item 11. A pharmaceutical or reagent comprising at least one member selected from the group consisting of the capped polynucleotide according to any one of Items 1 to 7, a polynucleotide comprising a stem-loop containing guanine in the loop portion, and the compound according to Item 8.

[0018] Item 12. The pharmaceutical or reagent according to Item 11, comprising at least one selected from the group consisting of a polynucleotide comprising a stem-loop containing guanine in the loop portion and the compound according to Item 8, and for use in such a way that the polynucleotide and the compound come into contact in vivo or in vitro.

[0019] Item 13. The pharmaceutical according to Item 11, wherein the capped polynucleotide according to any one of Items 1 to 7 and a polynucleotide comprising a stem-loop containing guanine in the loop portion are used in combination (e.g., used concomitantly).

[0020] Item 14. The reagent according to item 11, comprising at least one member selected from the group consisting of the capped polynucleotide according to any one of items 1 to 7 and a polynucleotide comprising a stem-loop containing guanine in the loop portion.

[0021] Item 15. General formula (4):

[0022]

[0023] wherein X independently in each occurrence represents an oxygen atom, a sulfur atom, or a selenium atom; L represents a linker; R a and R b are the same or different and represent a protecting group for a hydroxy group. c represents a hydrogen atom or a protecting group for an amino group.

[0024] Section 16. General formula (5):

[0025]

[0026] [In the formula: R d represents a protecting group for a hydroxy group. e represents a protecting group for the amino group. f represents a protecting group for an amino group.]

[0027] The present invention provides a technique for efficiently translating a protein or peptide from a polynucleotide containing two or more protein- or peptide-encoding sequences. Specifically, it provides a capped polynucleotide containing two or more protein- or peptide-encoding sequences. The present invention also provides a technique for introducing a 5'-cap structure into any position in a polynucleotide, and capped polynucleotides obtained by the technique.

[0028] Furthermore, to efficiently translate circular RNA, it is useful to introduce a cap structure into the RNA chain, but the synthesis of such a structure has been difficult. In the present invention, it is possible to introduce a cap structure into the middle of the RNA chain by an enzymatic reaction of circular RNA.

[0029] The following shows an outline of the cap introduction reaction by transglycosylation in Test Example 1. In Test Example 1, m 7 The results of the analysis of the reaction using denatured acrylamide gel when Gppp-PreQ1 was used are shown. + / - indicates the presence / absence of TGT enzyme in the reaction system. 7 The analytical results of the reaction by LC-MS in the case of Figure 2 when Gppp-PreQ1 was used are shown. 2’-O m 7 The results of the analysis of the reaction by denatured acrylamide gel when Gppp-PreQ1 was used are shown. The + / - of TGT indicates the presence / absence of TGT enzyme in the reaction system. The - of ΔC indicates the case where a normal model RNA (RNA having a guanosine in the loop structure that is replaced by the TGT enzyme) was used, and the + indicates the case where RNA in which the guanosine was replaced with cystidine was used. In Test Example 1, Nb 2’-O m 7LC-MS analysis results for the reaction using Gppp-PreQ1 are shown. Analysis results for the cap structure introduction reaction of Test Example 2 are shown. (a) shows the results when linear mRNA containing TGT-17 as the stem loop is used. (b) shows the results when linear mRNA containing TGT-25 as the stem loop is used. (c) shows the results when linear mRNA containing N1-methylpseudouridine-modified TGT-17 as the stem loop is used. (d) shows the results when linear mRNA containing N1-methylpseudouridine-modified TGT-25 as the stem loop is used. (e) shows the results when circular mRNA containing TGT-17 as the stem loop is used. (f) shows the results when circular mRNA containing TGT-25 as the stem loop is used. (g) shows the results when circular mRNA containing TGT-17 or TGT-25 as the stem loop is used. Measurement results of the amount of translation product in Test Example 2 are shown. (a) shows the results when linear mRNA containing TGT-17 or TGT-25 as the stem loop was used. (b) shows the results when linear mRNA containing N1-methylpseudouridine-modified TGT-17 or TGT-25 as the stem loop was used. (c) shows the results when circular mRNA containing TGT-17 or TGT-25 as the stem loop was used. On the horizontal axis of the graph, + / - indicates the presence / absence of cap introduction by TGT, and "purified" indicates the use of mRNA purified using the hydrophobic tag in the cap structure. (a) shows the three types of 121-base-long RNA used in Test Example 3. (b) shows the results of denaturing polyacrylamide electrophoresis analysis of the synthetic target RNA in Test Example 3. (c) shows the results of measurement of the amount of translation product in Test Example 3. The vertical axis indicates whether RNA was used and the type of RNA used. The results of measurement of the amount of translation product in Test Example 4 are shown. The vertical axis indicates whether RNA was used and the type of RNA used. The results of measurement of the amount of translation product in Test Example 5 are shown. The vertical axis indicates whether RNA was used and the type of RNA used. a) Shows the capped RNA used in Test Example 6. b) Shows the results of PAGE analysis of the mRNA used to evaluate translation activity in Test Example 6. c) Shows the results of evaluating mCherry expression in HeLa cells in Test Example 6.+ / - indicates the presence / absence of TGT enzyme in the reaction system. Time indicates reaction time. Results of translation activity evaluation of circular RNA in Test Example 7 are shown. (A) Schematic diagram of cap structure introduction into NLuc circular RNA. (B) Branched structure and sequence. (C) Schematic diagram of translation activity evaluation. (D) Results of translation activity evaluation. a) Scheme for intracellular capping of circular RNA in Test Example 8 is shown. b) Results of confirmation of TGT expression are shown. c) Results of evaluation of intracellular translation activity are shown.

[0030] In this specification, the expressions "contain" and "comprise" include the concepts of "contain," "comprise," "consist essentially of," and "consist only of."

[0031] In the present specification, when a range consisting of an upper limit and a lower limit is indicated, a range consisting of only the upper limit, a range consisting of only the lower limit, a range formed by combining any upper limit and any lower limit, etc. are also unambiguously disclosed in the present specification.

[0032] As used herein, polynucleotides are not particularly limited and may be DNA, RNA, or other known chemically modified, as exemplified below. To prevent degradation by hydrolases such as nucleases, the phosphate residues of each nucleotide may be substituted with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. The hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may also be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, such as by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, etc., but are not limited to these.

[0033] In this specification, the nucleic acid bases constituting a polynucleotide include not only typical bases in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases such as hypoxanthine (I) and modified bases. Modified bases include, for example, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, etc. Examples of amino acids that can be used include uracil, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, xanthine, and cyanuric acid.

[0034] As used herein, a polynucleotide may be linked to another molecule. Examples of other molecules include fluorescent labels. Examples of fluorescent labels include fluorescein, rhodamine, Texas Red, tetramethylrhodamine, carboxyrhodamine, phycoerythrin, 6-FAM™, Cy®3, Cy®5, and the Alexa Fluor® series.

[0035] In one aspect, the present invention relates to a capped polynucleotide (sometimes referred to herein as a "capped polynucleotide of the present invention") comprising two or more translation units each comprising a 5' cap structure and a protein or peptide coding sequence located downstream thereof.

[0036] The 5'-cap structure is not particularly limited, and examples thereof include cap-0, cap-1, and cap-2. The 5'-cap structure is located at the 5'-end of a protein / peptide coding sequence, and is not particularly limited thereto. It may be located not only at the 5'-end of a linear polynucleotide, but also at the center of a linear polynucleotide or in the main chain of a cyclic polynucleotide. The 5'-cap structure may also be modified as long as it has a translation-promoting effect. For example, the use of a 5'-cap structure substituted with a hydrophobic protecting group can facilitate the purification of capped polynucleotides (Patent Document 2). Furthermore, the hydrophobic protecting group can be removed by employing a photolabile hydrophobic protecting group, such as that used in Patent Document 2. Specific examples of 5'-cap structures include those represented by the general formula (1):

[0037]

[0038] More specifically, the structure includes a structure represented by the general formula (2):

[0039]

[0040] Examples of the structure include a structure represented by the following formula:

[0041] R 1 and R 2 are the same or different and represent a hydrophobic protecting group or a hydrogen atom.

[0042] The hydrophobic protecting group is preferably an optionally substituted aryl group (preferably having 5 to 20 carbon atoms, more preferably having 6 to 12 carbon atoms, and even more preferably having 6 to 8 carbon atoms) or arylalkyl group (e.g., an arylalkyl group in which a hydrogen atom (e.g., 1 to 3, preferably 1 hydrogen atom) of a linear or branched alkyl group having 1 to 6 carbon atoms (preferably 1 to 3) is substituted with the aryl group). The substituent is not particularly limited as long as it does not impair hydrophobicity, and examples include an alkyl group (preferably having 1 to 8 carbon atoms) optionally substituted with a halogen atom, an aryl group (similar to the aryl group described above) optionally substituted with a halogen atom, an amino group substituted with an alkyl group and / or an aryl group, and a halogen atom. The molecular weight of the hydrophobic protecting group is preferably 50 to 300, from the viewpoint of minimizing the effect on translation activity while enabling more efficient purification utilizing hydrophobicity. Photodegradable hydrophobic protecting groups are known (e.g., Patent Document 2), and include, for example, a nitrobenzyl group, a benzophenone-derived group, a bromocoumarin-derived group, or a group having any of these as its skeleton. The photodegradable hydrophobic protecting group can be a hydrophobic protecting group that is deprotected by light irradiation (for example, irradiation with light having a wavelength of 300 to 400 nm for 30 minutes).

[0043] X independently represents an oxygen atom, a sulfur atom, or a selenium atom in each occurrence. Any X is preferably an oxygen atom. In a particularly preferred embodiment, all Xs are oxygen atoms.

[0044] A protein or peptide coding sequence is a coding sequence for a protein or peptide to be expressed from a capped polynucleotide, such as a microbial antigen, a cancer antigen, or a therapeutic protein (e.g., for protein replacement therapy).

[0045] Examples of microbial antigens include viral antigens, fungal antigens, etc. Examples of viruses from which viral antigens are derived include, but are not limited to, enveloped viruses (viruses with an envelope) such as influenza viruses (e.g., types A and B), rubella viruses, Ebola viruses, coronaviruses, measles viruses, varicella-zoster viruses, herpes simplex viruses, mumps viruses, arboviruses, respiratory syncytial viruses, SARS viruses, hepatitis viruses (e.g., hepatitis B viruses, hepatitis C viruses), yellow fever viruses, AIDS viruses, rabies viruses, hantaviruses, dengue viruses, Nipah viruses, and lyssaviruses; and non-enveloped viruses (viruses without an envelope) such as adenoviruses, noroviruses, rotaviruses, human papillomaviruses, polioviruses, enteroviruses, coxsackieviruses, human parvoviruses, encephalomyocarditis viruses, and rhinoviruses. The bacteria from which bacterial antigens are derived are not particularly limited, but examples include Bordetella pertussis, Clostridium tetani, Corynebacterium diphtheriae, Salmonella enterica, Helicobacter pylori, Clostridium perfringens, Clostridium botulinum, Campylobacter, Escherichia coli, Staphylococcus aureus, Streptococcus staphylococcus, Bacillus cereus, Vibrio parahaemolyticus, Propionibacterium acnes, Clostridium faecalis, Clostridium difficile, Streptococcus pneumoniae, Haemophilus influenzae, Moraxella pneumoniae, Klebsiella pneumoniae, Koinebacterium, Streptococcus hemolyticus, Pseudomonas aeruginosa, Staphylococcus aureus, Mycoplasma, Candida, and Aspergillus.

[0046] Cancer antigens include, but are not limited to, T cell receptor / CD3-zeta chain, CD20, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A10, MAGE-A11, MAGE-A12, MAGE-Xp2 (MAGE-B2), MAGE-Xp3 (MAGE-B3), MAGE-Xp4 (MAGE-B4), MAGE-C1, and MAGE-C2. 2, MAGE-C3, MAGE-C4, MAGE-C5, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8 and GAGE-9, BAGE, RAGE, LAGE-1, NAG, GnT-V, MUM-1, CDK4, tyrosinase, p53, MUC family, HER2 / neu, p21ras, RCAS1, α-fetoprotein, E-cadherin, α-catenin, β-catenin, γ- Catenin, p120ctn, gp100Pmel117, PRAME, NY-ESO-1, cdc27, adenomatous polyposis coli protein (APC), fodrin, connexin 37, Ig idiotype, p15, gp75, GM2 ganglioside, GD2 ganglioside, human papillomavirus protein, Smad family of tumor antigens, lmp-1, P1A, EBV-encoded nuclear antigen (EBNA)-1, brain glycogen phosphorylase, SSX-1, SSX -2 (HOM-MEL-40), SSX-1, SSX-4, SSX-5, SCP-1, CT-7, CD20, c-erbB-2, ERK1, ERK2, MART-1 / Melan-A, gp100, adenosine deaminase-binding protein (ADAbp), FAP, cyclophilin b, colorectal-associated antigen (CRC)-C017-1A / GA733, carcinoembryonic antigen (CEA), CAP-1, CAP-2, etv6, AML1, prostate-specific antigen (PSA), PSA-1, PSA-2, PSA-3, prostate-specific membrane antigen (PSMA), and partial peptides thereof.

[0047] Therapeutic proteins include, for example, enzymes such as oxidoreductases, transferases, hydrolases, lyases, isomerases, ligases, imiglucerase, α-galactosidase A (α-galA), agalsidase beta, acid α-glucosidase (GAA), alglucosidase alpha, LUMIZYME, MYOZYME, arylsulfatase B, laronidase, ALDURAZYME, idursulfase, ELAPRASE, arylsulfatase B, and NAGLAZYME; cytokines such as lymphokines, interleukins, chemokines, type 1 cytokines, and type 2 cytokines; Examples of blood coagulation factors include factor I, factor II, tissue factor, factor V, factor VII, factor VIII, factor IX, factor X, factor Xa, factor XII, factor XIII, von Willebrand factor, prekallikrein, high molecular weight kininogen, fibronectin, antithrombin III, heparin cofactor II, protein C, protein S, protein Z, protein Z-related protease inhibitor (ZPI), plasminogen, alpha 2-antiplasmin, tissue plasminogen activator (tPA), urokinase, plasminogen activator inhibitor-1 (PAI1), plasminogen activator inhibitor-2 (PAI2), cancer procoagulant, and epoetin alpha.

[0048] The protein or peptide coding sequence preferably begins with an initiation codon (ATG / AUG).

[0049] A translation unit is a unit that translates a protein or peptide, and in the capped polynucleotide of the present invention, it comprises a 5' cap structure and a protein or peptide coding sequence located downstream thereof.

[0050] The number of 5' cap structures placed in each translation unit is 1. Meanwhile, the number of protein or peptide coding sequences is 1 or more (e.g., 2 to 10, 2 to 5, 2 to 3, or 2). Preferably, the number of 5' cap structures and protein or peptide coding sequences placed in each translation unit is both 1.

[0051] In each translation unit, the protein or peptide coding sequence is located downstream of the 5' cap structure, which is the side toward which the ribosome moves during translation, or the 3' side in the case of RNA.

[0052] In each translation unit, the length of bases between the first base downstream of the 5'-cap structure and the most upstream base of the protein or peptide coding sequence (usually the A of the most upstream initiation codon) is not particularly limited as long as the protein or peptide can be translated, and is, for example, 0 to 1500, preferably 5 to 500, and more preferably 9 to 300.

[0053] In one embodiment, the capped polynucleotide of the present invention comprises two or more translation units. That is, the capped polynucleotide of the present invention comprises two or more 5' cap structures and two or more protein or peptide coding sequences. More specifically, the capped polynucleotide of the present invention comprises a partial structure arranged in the following order from the upstream side: one 5' cap structure, one or more protein or peptide coding sequences, one 5' cap structure, one or more protein or peptide coding sequences. The number of translation units contained in the capped polynucleotide of the present invention is not particularly limited and may be, for example, 2 to 20, 2 to 10, 2 to 8, 2 to 6, 2 to 4, 2 to 3, or 2.

[0054] The capped polynucleotides of the present invention can contain any sequence, such as an internal ribosome entry site (IRES), a sequence encoding a 2A peptide (e.g., P2A, T2A, E2A, F2A, etc.), etc. These sequences can be contained within or outside the translation unit.

[0055] The manner of linking the 5'-cap structure in the capped polynucleotide of the present invention is not particularly limited, and the linking can be performed, for example, according to or in accordance with known methods (e.g., Patent Documents 1 and 2, WO 2025 / 053250, etc.).

[0056] For example, a capped polynucleotide having a 5' cap structure linked to the upstream end can be obtained according to or in accordance with known methods, for example, by performing a transcription reaction in a reaction system containing a promoter and a double-stranded polynucleotide template comprising a protein or peptide coding sequence, and a 5' cap analog.

[0057] Capped polynucleotides in which a 5'-cap structure is linked to any position (e.g., a non-terminal portion) of a polynucleotide can also be obtained according to or in accordance with known methods, such as the method described in Patent Document 1. In one embodiment, at least one 5'-cap structure in a capped polynucleotide obtained by this method is linked to at least one branched end of a three- or more-branched linker in the polynucleotide. As shown in Patent Document 1 and Figure 7(a), the linker is a non-polynucleotide linker containing a moiety branched in three or more directions, specifically an alkyl chain or heteroalkyl chain, optionally containing a reactive group bond (e.g., a peptide bond, an ester bond, an ether bond, etc.). The linker can have a structure derived from a single amidite monomer having a three- or more-branched structure. Such amidite monomers are well known, and various commercially available products can be used.

[0058] In one embodiment of the present invention, at least one 5'-cap structure is preferably linked to a base within a stem-loop in a polynucleotide constituting the capped polynucleotide of the present invention. This linking mode is obtainable by a technique discovered by the present invention that allows for the introduction of a 5'-cap structure at any position in a polynucleotide. Therefore, in one embodiment, the present invention also relates to a capped polynucleotide containing a 5'-cap structure introduced by this technique, specifically, a capped polynucleotide that includes one translation unit containing a 5'-cap structure and a protein or peptide coding sequence located downstream thereof, and in which the 5'-cap structure is linked to a base within the stem-loop in the polynucleotide. Such capped polynucleotides are also encompassed within the "capped polynucleotides of the present invention."

[0059] The stem loop may be contained anywhere in the capped polynucleotide of the present invention.

[0060] A stem loop linked to a 5' cap structure can be obtained by a method comprising reacting a polynucleotide containing a stem loop containing guanine in the loop portion with a compound in which a 5' cap structure is linked to PreQ1 directly or via a linker (the compound of the present invention) in the presence of tRNA-guanine transglycosylase.

[0061] The stem-loop containing guanine in the loop portion is not particularly limited, as long as it is recognized by tRNA-guanine transglycosylase and the substitution reaction of guanine with PreQ1 (the structure of which is shown below) is catalyzed by the enzyme.

[0062]

[0063] It is known that in stem-loops containing anticodons in certain tRNAs (e.g., tRNAs containing asparagine, aspartic acid, histidine, tyrosine, etc.) within living cells, the first guanine of the anticodon is replaced with PreQ1 by tRNA-guanine transglycosylase. Various stem-loop variations that can be recognized and catalyzed by tRNA-guanine transglycosylase have also been reported (e.g., The Journal of Biological Chemistry, Vol. 269, No. 51, Issue of December 23, pp. 32221-32225, 1994; The Journal of Biological Chemistry, Vol. 270, No. 29, Issue of July 21, pp. 17264-17267, 1995).

[0064] The base length of the stem-loop containing guanine in the loop portion is, for example, 12 to 50, preferably 14 to 35, more preferably 15 to 30, and particularly preferably 17 to 25. The base length of the loop portion that is not base-paired is, for example, 5 to 10, preferably 6 to 8, more preferably 6 to 7, and particularly preferably 7.

[0065] The compound of the present invention used for introducing a 5' cap structure into a stem loop is more preferably a compound in which the 5' cap structure is linked to the amino group on the aminomethyl group of PreQ1 via a linker.

[0066] The linker is not particularly limited, and examples thereof include alkyl linkers (e.g., the number of atoms constituting the main chain is, for example, 1 to 30, preferably 2 to 20, more preferably 3 to 12, even more preferably 4 to 10, and particularly preferably 5 to 8, and the carbon atoms constituting the main chain may be substituted with heteroatoms (e.g., oxygen atoms, nitrogen atoms, sulfur atoms, etc.) or -NH-, -C(=O)-, -O-, -NH-C(=O)-, -C(=O)-O-, etc.), polynucleotide linkers (base lengths are, for example, 1 to 20, 2 to 10, 3 to 10, or 3 to 8), and peptide linkers. Among these, alkyl linkers and polynucleotide linkers are preferred, and alkyl linkers are particularly preferred. In one embodiment of the present invention, the linker preferably comprises a polynucleotide linker. The number of nucleotides constituting the polynucleotide linker is preferably 1 to 8, more preferably 1 to 6, even more preferably 1 to 4, even more preferably 1 to 3, and particularly preferably 1 to 2. The linker may consist of only one type, or may be a combination of two or more types.

[0067] The compound of the present invention is particularly preferably a compound represented by the general formula (3):

[0068]

[0069] Examples of the compound include compounds represented by the following formula:

[0070] R 1 , R 2and X are as defined above. L represents a linker. The linker is as defined above.

[0071] The compound of the present invention also includes salt forms. The salts are not particularly limited, and examples thereof include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine, and ammonium salts. The salts may be acid addition salts, and specific examples of such salts include acid addition salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid.

[0072] The compounds of the present invention also include solvates. The solvates are not particularly limited, and examples thereof include solvates with solvents such as water, ethanol, glycerol, and acetic acid.

[0073] The compounds of the present invention can be produced according to or in accordance with various methods, for example, according to or in accordance with the method for producing cap analogs described in Patent Document 2.

[0074] In one embodiment, the compound of the present invention has the general formula (4):

[0075] For example, according to the method via a compound represented by the following Scheme 1:

[0076]

[0077] This allows for a higher yield of synthesis. 1 and R 2 When at least one of the protecting groups is a hydrophobic protecting group, the compound can be synthesized in high yield.

[0078] X and L are as described above.

[0079] R a and R b are the same or different and represent a protecting group for a hydroxy group. The protecting group is, for example, an alkyl group, an aryl group, or a group consisting of a combination thereof. More specific examples of the protecting group include a tert-butyl group, a methyl group, a benzyl group, a trityl group, and a p-methoxybenzyl group. Preferred are groups that can be deprotected under strong acidic conditions using trifluoroacetic acid or the like, and particularly preferred is a tert-butyl group.

[0080] R c represents a protecting group for a hydrogen atom or an amino group. The protecting group is not particularly limited, but is particularly preferably a trityl group.

[0081] The reaction from Compound I to Compound II can be carried out by reacting Compound I under conditions that allow the hydrocarbon group to be deprotected. More specifically, this reaction can be carried out by reacting Compound I in a solvent containing an acid (particularly preferably a strong acid) such as trifluoroacetic acid. This reaction generates an ion (A - ) to give compound II.

[0082] The reaction from Compound II to Compound III can be carried out by reacting Compound II with a compound containing a 5'-cap structure under conditions that form a phosphodiester bond. The reaction can be carried out according to or in accordance with a known method.

[0083] In one embodiment, the compound of the present invention has the general formula (5):

[0084] The compound can be synthesized by the phosphoramidite method using a support modified with a group represented by the following formula:

[0085] R d represents a protecting group for a hydroxy group. A wide variety of known protecting groups used in amidite monomers can be used as the protecting group. Preferred examples of the protecting group include alkoxytrityl groups such as dimethoxytrityl groups.

[0086] R e represents a protecting group for the amino group. f R represents a protecting group for an amino group. A preferred example of such a protecting group is an acyl group. e Particularly preferred examples of the acyl group of R include halogenated acyl groups such as trifluoroacetyl. f Particularly preferred examples of the acyl group include long-chain (for example, C4-20, C5-15, C6-12, C6-10) acyl groups such as an octanoyl group.

[0087] L 1 , L 2 , and L 3 Each represents a linker. The linker is as described above. 1 The number of atoms constituting the main chain of the linker is preferably 4 to 20, more preferably 5 to 15, and even more preferably 6 to 10. 2 The number of atoms constituting the main chain of the linker is preferably 1 to 6, more preferably 1 to 4, and even more preferably 1 to 2. 3 The number of atoms constituting the main chain of the linker is preferably 4 to 25, more preferably 6 to 20, and even more preferably 8 to 15.

[0088] The support is not particularly limited as long as it is a solid support that can be used in polynucleotide synthesis by the phosphoramidite method. Typical support materials include glass, resin, etc.

[0089] The phosphoramidite method can be carried out according to a known method, for example, using a commercially available automated nucleic acid synthesizer. d (B) a step of condensing the amidite monomer, (C) a step of capping the hydroxyl group at the 5'-position (or a position corresponding thereto) of the unreacted compound, (D) a step of converting the phosphite group to a phosphate group or a thiophosphate group, (E) a step of cleaving the resulting compound from the solid support and deprotecting the phosphate moiety and the nucleic acid base, and (F) a step of deprotecting the hydroxyl group at the 5'-position (or a position corresponding thereto). By repeating steps (A) to (D), the compound of the present invention containing a polynucleotide linker of the desired chain length can be produced.

[0090] The tRNA-guanine transglycosylase is not particularly limited as long as it has the activity of substituting PreQ1 for guanine in the stem-loop portion of a polynucleotide, and those derived from various organisms (e.g., bacteria) can be used. Commercially available enzymes can be used, or those produced using recombinant production techniques can also be used.

[0091] The reaction is usually carried out in a solvent containing water. The concentration of the compound of the present invention in the reaction solution can be, for example, 30 to 500 μM, preferably 70 to 200 μM. The molar concentrations of the polynucleotide and tRNA-guanine transglycosylase in the reaction solution can be, for example, 0.03 to 0.5, preferably 0.07 to 0.2, relative to the molar concentration of the compound of the present invention (1). The reaction solution can contain other substances necessary for or that can promote the enzymatic reaction (e.g., buffers, reducing agents, divalent metal ions, etc.). The pH of the reaction solution is, for example, 7.0 to 7.8. The reaction temperature and reaction time are not particularly limited as long as the enzymatic reaction is possible, and can be, for example, 30 to 50°C for 30 minutes to 5 hours.

[0092] The base length of the capped polynucleotide of the present invention is not particularly limited as long as it allows translation of a protein or peptide, and may be, for example, 25 to 10,000, 25 to 5,000, 25 to 3,000, 25 to 2,000, 25 to 1,000, 25 to 500, 25 to 300, or 25 to 200.

[0093] The capped polynucleotides of the present invention are typically single-stranded, but can contain partially double-stranded regions so long as the protein or peptide can be translated.

[0094] The capped polynucleotides of the present invention can be circular or non-circular (chained, linear).

[0095] The capped polynucleotide of the present invention is preferably RNA, and may contain artificial nucleic acids such as LNA. The number of RNA building blocks (ribonucleotides / ribonucleosides) relative to the number of building blocks (nucleotides / nucleosides) of the capped polynucleotide of the present invention (100%) is, for example, 30% or more, 50% or more, 70% or more, 80% or more, or 90% or more.

[0096] At least one compound selected from the group consisting of the capped polynucleotides of the present invention, polynucleotides comprising a stem-loop containing guanine in the loop portion, and compounds in which a 5' cap structure is linked to PreQ1 directly or via a linker can be used, for example, in pharmaceuticals (or pharmaceutical compositions, such as vaccines), reagents, etc. (sometimes referred to herein as "drugs of the present invention").

[0097] The pharmaceutical agent of the present invention is not particularly limited as long as it contains an active ingredient, and may further contain additives as necessary, such as bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, moisturizers, colorants, fragrances, and chelating agents.

[0098] The mode of use of the agent of the present invention is not particularly limited, and an appropriate mode of use can be adopted depending on the type of agent. Depending on the intended use, the agent of the present invention can be used, for example, in vitro (e.g., added to a culture medium for cultured cells) or in vivo (e.g., administered to an animal).

[0099] The pharmaceutical agent of the present invention can also be used simultaneously or separately with a polynucleotide containing a stem-loop containing a guanine in the loop portion and a compound having a 5'-cap structure linked to PreQ1 directly or via a linker. The capped polynucleotide of the present invention can be produced by contacting the two in vivo or in vitro. For example, when used in vivo (administered to an animal), the polynucleotide can be pre-present in the living body and the compound can be added at the desired timing for protein or peptide expression. In one embodiment, the pharmaceutical agent of the present invention can be used in a method in which the polynucleotide and the compound are simultaneously administered in vivo. In another embodiment, the pharmaceutical agent of the present invention can be used in a method in which the polynucleotide is pre-administered in vivo and the compound is added at any desired timing thereafter. In one embodiment, the present invention relates to a pharmaceutical or reagent containing at least one selected from the group consisting of the polynucleotide and the compound, and used to allow the polynucleotide and the compound to come into contact in vivo or in vitro. In this case, the polynucleotide and the compound are used in combination. Used in combination (for example, used concomitantly) includes not only cases where the agent of the present invention contains both, but also cases where the agent of the present invention contains only one of the agents and is used to administer in combination with the other (administered simultaneously, on the same day, or, for example, with an interval of 1 to 7 days).

[0100] In one aspect, the agent of the present invention, which is a pharmaceutical, is a pharmaceutical in which the capped polynucleotide of the present invention and a polynucleotide comprising a stem loop containing guanine in the loop portion are used in combination.

[0101] The agents of the present invention may be applied to any mammal, including, but not limited to, humans, monkeys, mice, rats, dogs, cats, rabbits, pigs, horses, cattle, sheep, goats, and deer. Examples of cells include animal cells. The types of cells are also not particularly limited, including, but not limited to, blood cells, hematopoietic stem cells and progenitor cells, gametes (sperm, eggs), fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, hepatocytes, keratinocytes, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, and cancer cells.

[0102] The agents of the present invention can be in any dosage form, for example, oral formulations such as tablets (including orally disintegrating tablets, chewable tablets, effervescent tablets, lozenges, jelly drops, etc.), pills, granules, fine granules, powders, hard capsules, soft capsules, dry syrups, liquids (including drinks, suspensions, syrups), and jellies; or parenteral formulations such as injectable preparations (e.g., drip injections (e.g., intravenous drip preparations), intravenous injections, intramuscular injections, subcutaneous injections, and intradermal injections), topical preparations (e.g., ointments, poultices, lotions), suppositories, inhalants, eye drops, eye ointments, nasal drops, and ear drops. The active ingredient can also be administered in a complexed state with particles (e.g., lipid particles or exosomes) or encapsulated in the particles.

[0103] The route of administration of the drug of the present invention is not particularly limited as long as the desired effect can be obtained, and examples thereof include oral administration; enteral administration such as tube feeding and enema administration; and parenteral administration such as intravenous administration, intraarterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, intraperitoneal administration, and nasal administration.

[0104] The content of the active ingredient in the drug of the present invention depends on the mode of use, the subject to which it is applied, the condition of the subject to which it is applied, etc., and is not limited thereto, but can be, for example, 0.0001 to 100% by weight, preferably 0.001 to 50% by weight.

[0105] The dosage of the agent of the present invention when administered to an animal is not particularly limited as long as it is an effective amount that exerts a pharmacological effect, and is generally 0.1 to 1000 mg / kg body weight, preferably 0.5 to 500 mg / kg body weight per day in terms of the weight of the active ingredient, when administered orally, and 0.01 to 100 mg / kg body weight, preferably 0.05 to 50 mg / kg body weight per day in terms of the weight of the active ingredient when administered parenterally. The dosage can be increased or decreased as appropriate depending on the age, pathological condition, symptoms, etc.

[0106] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0107] Synthesis Example 1. Synthesis of cap analogue 1

[0108]

[0109]

[0110]

[0111]

[0112] Synthesis Example 1-1. Synthesis of N2-trityl PreQ0 (N2-trityl-6-cyano-6-deazaguanine) A 300 mL recovery flask was charged with PreQ0 (7.01 g, 49 mmol, 1.0 equiv) and DMF (80 mL), and stirring was initiated. N,O-bis(trimethylsilyl)acetamide (29.4 mL, 120 mmol, 3.0 equiv) was added dropwise to the reaction solution. After stirring for 3 hours, the volatiles were removed under reduced pressure and the mixture was dried overnight using a vacuum pump. Pyridine (80 mL) and trityl chloride (13.4 g, 48 mmol, 1.2 equiv) were added to the residue, and the mixture was stirred at 40°C for 24 hours. After the reaction was complete, the mixture was poured into 5% aqueous sodium bicarbonate solution (200 mL) and extracted with dichloromethane. The organic layer was dried over sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. Addition of hexane to the residue produced a precipitate, which was filtered, washed with hexane, and dried to give the desired N2-trityl-6-cyano-6-deazaguanine (N2-trityl PreQ0, 1:1 pyridine mixture, 11.1 g, 22.3 mmol, 56%).

[0113] Synthesis Example 1-2. Synthesis of N2-trityl-6-formyl-6-deazaguanine. A 100 mL recovery flask was charged with N2-trityl PreQ0 (1:1 pyridine mixture, 9.93 g, 20.0 mmol, 1.0 equiv), ammonium sulfate (8.3 mg), toluene (16 mL), and hexamethyldisilazane (HMDS, 8 mL) and refluxed for 1 hour. After the reaction solution was cooled to room temperature, the volatiles were removed under reduced pressure. The resulting residue was dissolved in dichloromethane (80 mL) and cooled to -78°C. While stirring the reaction solution, diisopropylaluminium hydride (DIBAL-H, 1 M in hexane, 40 mL, 40 mmol, 2.0 equiv) was added dropwise, and stirring was continued at the same temperature. After 3 hours, DIBAL-H (1 M in hexane, 20 mL, 20 mmol, 1.0 equiv) was added dropwise and stirred for 10 hours. After completion of the reaction, the mixture was quenched by adding water / acetic acid (9 / 1, 15 mL) and diluted with water / ethyl acetate (1 / 1, 200 mL). The resulting precipitate was filtered off, and the filtrate was extracted with dichloromethane (100 mL). The organic layer was dried over sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. Diethyl ether (200 mL) was added to the resulting residue to precipitate the desired product, and excess solvent was removed by filtration. The resulting solid was washed with diethyl ether and dried under vacuum to give N2-trityl-6-formyl-6-deazaguanine (0.28 equiv AcOEt, 0.44 equiv Et2O mixture, 7.26 g, 15.2 mmol, 76%).

[0114] Synthesis Example 1-3. Synthesis of 1-bromo-6-phthalimidylhexane. A 100 mL recovery flask was charged with potassium phthalimide (3.7 g, 20 mmol, 1.0 equiv), acetone (40 mL), and 1,6-dibromohexane (15.2 mL, 100 mL, 5.0 equiv) and refluxed for 18 hours. After cooling to room temperature, the reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane / ethyl acetate, 9 / 1) to obtain the desired 1-bromo-6-phthalimidylhexane (4.65 g, 15.0 mmol, 75%).

[0115] Synthesis Example 1-4. Synthesis of di-tert-butyl 6-phthalimidylhexyl phosphate. 1-Bromo-6-phthalimidylhexane (775 mg, 2.5 mmol, 1.0 equiv), potassium di-tert-butylphosphate (930 mg, 3.75 mmol, 1.5 equiv), tetrabutylammonium iodide (185 mg, 0.50 mmol, 0.20 equiv), and DMF (25 mL) were added to a 100 mL recovery flask and stirred at 60°C for 48 hours. After cooling to room temperature, saturated aqueous sodium bicarbonate (100 mL) was added and the mixture was extracted with ethyl acetate. The organic layer was dried over sodium sulfate and then filtered. The filtrate was concentrated under reduced pressure and dried to give the desired di-tert-butyl 6-phthalimidylhexyl phosphate (904.0 mg, 2.06 mmol, 82%).

[0116] Synthesis Example 1-5. Synthesis of di-tert-butyl 6-aminohexyl phosphate. Di-tert-butyl 6-phthalimidylhexyl phosphate (527 mg, 1.2 mmol, 1.0 equiv), methanol (5 mL), and hydrazine monohydrate (233 μL, 4.8 mmol, 4.0 equiv) were added to a 30 mL vial, the screw cap was tightened, and the mixture was refluxed for 15 hours. The reaction solution was cooled to room temperature, and the formation of a white precipitate was confirmed. This precipitate was filtered off, and the filtrate was concentrated under reduced pressure, resulting in the formation of a white precipitate. This precipitate was filtered off again, and the filtrate was concentrated and dried under reduced pressure to obtain the desired di-tert-butyl 6-aminohexyl phosphate (298 mg, 0.963 mmol, 80%).

[0117] Synthesis Example 1-6. Synthesis of N6-6-(phosphoryloxy)hexyl PreQ1. A 30 mL vial was charged with N2-trityl-6-formyl-6-deazaguanine (84.1 mg, 0.20 mmol, 1.0 equiv), sodium sulfate (114 mg, 0.80 mmol, 4.0 equiv), di-tert-butyl 6-aminohexyl phosphate (124 mg, 0.40 mmol, 2.0 equiv), and methanol (6 mL) and stirred at room temperature for 15 hours. The reaction solution was cooled to 0°C, sodium borohydride (15.1 mg, 0.40 mmol, 2.0 equiv) was added, and the mixture was allowed to warm to room temperature with stirring. After stirring for 6 hours, saturated aqueous sodium bicarbonate (1 mL) was added and the mixture was stirred for 30 minutes. The reaction solution was diluted with water / ethyl acetate (1 / 1, 40 mL) and extracted with ethyl acetate. The organic layer was dried over sodium sulfate, filtered, and concentrated under reduced pressure. Trifluoroacetic acid / dichloromethane (1 / 1, 6 mL) was added to the residue, which was stirred at room temperature for 4 hours and then concentrated. TBAB buffer solution (0.2 M, 5 mL) was added to the residue, and the resulting precipitate was filtered off. The filtrate was purified by reversed-phase column chromatography (C18, eluent A: 50 mM TBAA buffer solution with 0.5% acetonitrile; eluent B: acetonitrile, 0-60% B) and desalted (C18, eluent A: MQ water; eluent B: acetonitrile, 0-100% B). The fractions containing the desired product were concentrated under reduced pressure and lyophilized to yield N6-6-(phosphoryloxy)hexyl PreQ1 (16.6 mg, 0.0360 mmol, 18%).

[0118] Synthesis example 1-7. m 7Synthesis of Gppp-PreQ1. A 1.5 mL Eppendorf tube was charged with N6-6-(phosphoryloxy)hexyl PreQ1 (4.6 mg, 10 μmol, 1.0 equiv), 7N-methylguanosine diphosphate imidazolide (11.1 mg, 20 μmol, 2.0 equiv), DMSO (400 μL), and zinc chloride (21.8 mg, 160 μmol, 16 equiv) and stirred at room temperature for 24 h. After the reaction was completed, the mixture was quenched by adding EDTA buffer solution (0.5 M, 320 μL) and diluted with MQ water (5 mL). The mixture was purified by reverse-phase HPLC (C18, eluent A: 50 mM TEAA buffer solution with 0.5% acetonitrile, eluent B: acetonitrile, B 0-80%). The fractions containing the target compound were centrifuged and lyophilized to obtain the target compound, m. 7 Gppp-PreQ1 was obtained.

[0119] Synthesis Example 1-8. Synthesis of N7-6-hydroxyhexyl PreQ1. A 50 mL recovery flask was charged with 7-deaza-7-formyl-N2-tritylguanine (88 wt%, 478 mg, 1.0 mmol, 1.0 equiv), sodium sulfate (568 mg, 4.0 mmol, 4.0 equiv), 6-amino-1-hecanol (234 mg, 2.0 mmol, 2.0 equiv), and methanol (10 mL). The mixture was stirred at room temperature for 15 hours, after which the formation of a yellow precipitate was confirmed. The reaction solution was cooled to 0°C, and sodium borohydride (75.7 mg, 2.0 mmol, 2.0 equiv) was added. The mixture was stirred at room temperature for 5 hours, yielding a reddish-brown solution. The reaction was quenched with saturated aqueous NaHCO3 (5 mL) and diluted with water (100 mL) / dichloromethane (100 mL). The aqueous layer was extracted with dichloromethane, dried over sodium sulfate, concentrated under reduced pressure, and the resulting precipitate was dried to give the desired product (476 mg, 0.913 mmol, 91%).

[0120] Synthesis Example 1-9. Synthesis of N6-6-(phosphoryloxy)hexyl PreQ1. A 9 mL vial was charged with N7-(6-hydroxyhexyl)-N2-trityl PreQ1 (476 mg, 0.91 mmol, 1.0 equiv) and trimethyl phosphate (1 mL, 9.1 mmol, 10 equiv), and then phosphoryl chloride (170 μL, 1.82 mmol, 2.0 equiv) was added dropwise at 0°C. The mixture was stirred for 4 hours, and then cold water (50 mL) was added to quench the reaction. Ethyl acetate was added to the reaction solution, and the mixture was extracted with MQ water. The resulting aqueous layer was purified by reversed-phase column chromatography (C18, eluent A: 50 mM TEAA buffer solution with 0.5% acetonitrile, eluent B: acetonitrile, B 0-100%), desalted (C18, eluent A: MQ, eluent B: acetonitrile, B 0-100%), and then lyophilized to obtain the desired product (130 mg, 0.362 mmol, 40%).

[0121] Synthesis example 1-10. Nb 2’-O m 7Synthesis of Gppp-PreQ1: A 15 mL Falcon tube was charged with N6-6-(phosphoryloxy)hexyl PreQ1 (35.9 mg, 0.10 mmol, 1.0 equiv), 2'-O-(2-(2-nitrophenyl)-1-tert-butylethyl)-7N-methylguanosine diphosphate imidazolide (149 mg, 0.20 mmol, 2.0 equiv), DMSO (2 mL), and zinc chloride (273 mg, 2.0 mmol, 20 equiv) and stirred at room temperature for 60 h. After completion of the reaction, the reaction was quenched by adding a mixture of MQ water (50 mL) and EDTA buffer solution (0.5 M, 4 mL). After filtering the supernatant, the product was purified by reversed-phase column chromatography (C18, eluent A: 50 mM TEAA buffer solution, 0.5% acetonitrile, eluent B: acetonitrile, B 0-80%) and ion-exchange column chromatography (DEAE, eluent A: MQ, eluent B: 1 M TEAA buffer solution, 10% acetonitrile, B 0-80%). After desalting (eluent A: MQ, eluent B: acetonitrile, B 0-100%), the product was lyophilized to obtain the target product, Nb. 2’-O m 7 Gppp-PreQ1 (1.8 mg, 1.8 μmol, 2%) was obtained.

[0122] Example 1: Preparation of Recombinant TGT Enzyme. Protein expression strain E. coli BL21(DE3) was transformed with the expression plasmid (pMA-TGT-His) and spread onto an LB plate containing 100 μg / ml ampicillin to obtain single colonies. This was added to 500 ml of AIM (LB medium, 2 g / L lactose, 0.5 g / L glucose, 0.15 g / L MgSO) and cultured at 37°C, 160 rpm, and 24 h. The cells were harvested by centrifugation at 4°C, 8000 rpm, and 10 min. The resulting pellet was suspended in 40 ml of Buffer A. The mixture was placed on ice and disrupted using a Q500 ultrasonic homogenizer (Qsonica) with an Amp of 30%, pulse on for 1 sec, pulse off for 3 sec, and time of 10 min. Debris was removed by centrifugation at 4°C, 12,000 rpm, for 20 minutes, and the supernatant was used for affinity purification.

[0123] A 5 ml HisTrap HP column (Cytiva) was attached to an AKTA go (Cytiva) and equilibrated with 25 ml of 95% Buffer A, 5% Buffer B. The flow rate throughout the purification procedure was 1 ml / min. The supernatant was then passed through the column to adsorb the recombinant TGT enzyme. After washing with 25 ml of 95% Buffer A, 5% Buffer B, the eluate was increased from 5% to 60% Buffer B over 60 min, and the target protein was eluted and collected using a fraction collector. Each fraction was analyzed by SDS-PAGE, and fractions containing the target protein with sufficient purity were pooled. The pooled fractions were concentrated using an Amicon Ultra-15 30 kDa (MerckMillipore) and then eluted with Storage Buffer 1. The mixture was then mixed with 1.25 equivalents of Storage Buffer 2 and stored at -30°C.

[0124] The base sequence of the plasmid used (pMA-TGT-His) is shown in Tables 1 and 2. The end of Table 1 is linked to the beginning of Table 2 (SEQ ID NO: 20). The underline indicates the T7 promoter, the ruled box indicates the TGT CDS, and the double underline indicates the T7 terminator.

[0125]

[0126]

[0127]

[0128] Test Example 1. Capping using TGT enzyme Capping was carried out using TGT enzyme (tRNA-guanine transglycosylase). The reaction scheme is shown in Figure 1. Specifically, the procedure was as follows.

[0129] <Synthesis of 17-base RNA substrate> GCA GAC UGU AAA UCU GC (SEQ ID NO: 1) or GCA GAC UCU AAA UCU GC (SEQ ID NO: 2) was synthesized using an automatic nucleic acid synthesizer (amidite: 2'-O-TOM nucleic acid amidite 50 mM acetonitrile solution, oxidizing agent: iodine 50 mM pyridine / water (9:1) solution, activator: 5-benzylthio-1H-tetrazole 25 mM acetonitrile solution, cap A: acetic anhydride 10% THF solution, cap B: 1-methylimidazole 10% THF / pyridine (8:1) solution).

[0130] Aqueous ammonia (28%, 500 μL) and methylamine (40%, 500 μL) were added to the resin obtained by the automated nucleic acid synthesizer and incubated at 60°C for 30 minutes to cleave the oligonucleotide from the resin and deprotect the acyl groups. The reaction solution was dried under reduced pressure, and the resulting residue was added to a THF solution of TBAF (1 M, 1 mL) and incubated at room temperature for 15 hours to deprotect the TOM group. The solution was then neutralized with Tris-HCl buffer (1 M, pH 7.5, 1 mL). The THF in the solution was removed under reduced pressure to reduce the volume to approximately 1 mL, and the solution was desalted through a NAP-25 column. Aqueous sodium acetate and isopropyl alcohol were added to the resulting solution, which was then incubated at -30°C for 1 hour to obtain a precipitate. The precipitate was collected by centrifugation, washed with ethanol, and dried to obtain the target RNA (62 μM, 600 μL, 37.2 nmol, 19%).

[0131] <Capping reaction using TGT enzyme> A reaction buffer solution (100 mM HEPES-KOH, pH 7.3, 5 mM DTT, 20 mM MgCl2) was prepared in a 200 μL PCR chip, and a cap analog (Synthesis Example 1-7: m 7 Gppp-PreQ1 or Synthesis Example 1-10: Nb 2’-O m 7 Gppp-PreQ1 (100 μM), substrate RNA (10 μM), and TGT enzyme (10 μM) were added, and the total volume was adjusted to 50 μL with MQ water. The reaction mixture was incubated at 37°C for 2 hours, and then the reaction was analyzed using denaturing polyacrylamide gel and LC-MS.

[0132] <Results> The results are shown in Figures 2 to 5.

[0133] Figure 2: m as a cap analogue 7 The results of a denaturing acrylamide gel analysis of the reaction using Gppp-PreQ1 are shown. When the TGT enzyme was used, a band of RNA with a molecular weight larger than the starting substrate, 17-base RNA, was observed. This band was not observed under conditions where the TGT enzyme was omitted, suggesting that transglycosylation leads to m 7It is believed that Gppp-PreQ1 was introduced.

[0134] Figure 3: m as a cap analogue 7 The results of LC-MS analysis of the reaction using Gppp-PreQ1 are shown below. When the molecular weight of the substance eluted at around 9.8 minutes (peak top: 9.79 minutes) was analyzed, 6051.42 was observed, which is m 7 This showed good agreement with the molecular weight of the Gppp-PreQ1-introduced RNA (theoretical value: 6054.4).

[0135] Figure 4: Nb as a cap analogue 2’-O m 7 The results of a denaturing acrylamide gel analysis of the reaction using Gppp-PreQ1 are shown below. When the TGT enzyme was used, a band of RNA with a molecular weight larger than the starting substrate, 17-base RNA, was observed. This band was not observed under conditions where the TGT enzyme was omitted, suggesting that Nb was produced by transglycosylation. 2’-O m 7 Furthermore, when RNA in which the guanosine in the loop structure of the model RNA was replaced with cystidine was used in the reaction, no base substitution reaction was observed, suggesting the position specificity of this reaction.

[0136] Figure 5: Nb as a cap analogue 2’-O m 7 The results of LC-MS analysis of the reaction using Gppp-PreQ1 are shown below. Analysis of the molecular weight of the substance eluted at 12.7-13.0 minutes revealed a molecular weight of 6279.02, which is the molecular weight of Nb 2’-O m 7 This showed good agreement with the molecular weight of the Gppp-PreQ1-introduced RNA (theoretical value: 6276.5).

[0137] Test Example 2. Evaluation of translation activity of mRNA with an m7G cap structure introduced by TGT reaction. RNA containing a TGT recognition motif (TGT-17, TGT-25) with a stem-loop length of 17 bases and a loop length of 7 bases or a stem-loop length of 25 bases and a loop length of 7 bases) was prepared by transcription reaction, and an m7G cap structure was introduced using TGT enzyme. The mRNA was introduced into cultured HeLa cells using a commercially available lipofection reagent, and after incubation, the amount of translation product contained in the cell lysate was measured. Specifically, the procedure was as follows.

[0138] <mRNA sequence> The recognition sequence of the TGT enzyme is underlined. The transglycosylation site is G in the middle of the underlined sequence CUGUAA in (a) and (c), and G in the middle of the underlined sequence CXGXAA in (b). X = N 1 -methylpseudouridine modification.

[0139] (a) 192-nt linear mRNA containing TGT-17: 5'_GGCGCAUAUUAAGGUGCAGACUGUAAAUCUGCGGUAAAGCCACCAUGGUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGCGGGAGCUCCGGUAGUAUAAUCAACUUUGAAAAACUGUGAUAAGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA_3' (SEQ ID NO: 3) 200-nt linear mRNA containing TGT-25: 5'_GGCGCAUAUUAAGGUGGGAGCAGACUGUAAAUCUGCUCCCGGUAAAGCCACCAUGGUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGCGGGAGCUCCGGUAGUAUAAUCAACUUUGAAAAACUGUGAUAAGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA_3' (SEQ ID NO: 4).

[0140] (b) 192-nucleotide linear mRNA containing TGT-17: 5'_GGCGCAXAXXAAGGXGCAGACXGXAAAXCXGCGGXAAAGCCACCAXGGXGAGCGGCXGGCGGCXGXXCAAGAAGAXXAGCGGGAGCXCCGGXAGXAXAAXCAACXXXGAAAAACXGXGAXAAGCXGGAGCCXCGGXGGCCAXGCXXCXXGCCCCXXGGGCCXAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA_3' (SEQ ID NO: 5) 200-nucleotide linear mRNA containing TGT-25 5'_GGCGCAXAXXAAGGXGGGAGCAGACXGXAAAXCXGCXCCCGGXAAAGCCACCAXGGXGAGCGGCXGGCGGCXGXXCAAGAAGAXXACGGGGAGCXCCGGXAGXAXAAXCAACXXXGAAAAACXGXGAXAAGCXGGAGC (Sequence number 6).

[0141] (c) 192-base circular mRNA containing TGT-17 (5') GGCGCAUAUUAAGGUGCAGACUGUAAAUCUGCGGUAAAGCCACCAUGGUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGCGGGAGCUCCGGUAGUAUAAUCAACUUUGAAAAACUGUGAUAAGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (3') (SEQ ID NO: 7) 200-base circular mRNA containing TGT-25 (5') GGCGCAUAUUAAGGUGGGAGCAGACUGUAAAUCUGCUCCCGGUAAAGCCACCAUGGUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGCGGGAGCUCCGGUAGUAUAAUCAACUUUGAAAAACUGUGAUAAGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (3') (SEQ ID NO: 8).

[0142] Linear RNA was prepared by in vitro transcription using T7 RNA polymerase according to standard procedures. The transcription reaction mixture consisted of 5 ng / μL DNA template (PCR product), 2 mM ATP, 2 mM GTP, 2 mM UTP, 2 mM CTP, 10 mM GMP, 40 mM Tris-HCl (pH 8.0), 8 mM magnesium chloride, 2 mM spermidine, 5 mM DTT, 0.0002 U / μL pyrophosphatase (New England Biolabs), and 10 U / μL T7 RNA polymerase (Takara Bio). 1 N-methylpseudouridine-modified RNA was obtained by replacing UTP in the reaction solution with the same concentration of N1-methylpseudouridine 5'-triphosphate (Yamasa). After incubating the transcription reaction solution at 37°C for 2 hours, Recombinant Dnase I (Takara Bio) was added to the reaction solution to a final concentration of 0.1 U / μL, and the mixture was then incubated at 37°C for 15 minutes. A 7.5 M lithium chloride solution (half the volume of the reaction solution) was added, and the mixture was left to stand at -30°C for 30 minutes. The mixture was then centrifuged (15,000 rpm, 20 minutes) to recover the crude RNA precipitate. This was then purified by reverse-phase HPLC under the following conditions.

[0143] Column: YMC-TriartBio C4 (250 mm × 4.6 mm ID); Solvent A: 100 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; Solvent B: 100 mM triethylammonium acetate (pH 7.0), 50% acetonitrile; Linear gradient of B: 10–30% (0–20 min); Flow rate: 1 mL / min; Detection wavelength: 254 nm; Column temperature: 50°C.

[0144] The purified RNA was recovered from the eluate by alcohol precipitation and used in subsequent experiments. Circular RNA was then generated by enzymatically ligating the 5' and 3' ends of the RNA. The enzyme reaction mixture consisted of 2 μM RNA, 4 μM splint DNA oligo (5' ACCTTAATATGCGCCTTTTTTTTTTTTTTT 3' (SEQ ID NO: 9)), 10 (w / v)% PEG8000, 50 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 2 mM DTT, 0.4 mM ATP, and 25 ng / μL T4 RNA ligase 2. The reaction mixture was incubated at 37°C for 1 hour, and the progress of the ligation reaction was monitored by denaturing polyacrylamide gel electrophoresis. The reaction mixture was deproteinized by mixing with an equal volume mixture of TE-saturated phenol and chloroform, and the RNA was recovered by alcohol precipitation. The target RNA cyclized product was isolated and purified by reversed-phase HPLC.

[0145] The m7G cap structure was introduced into the mRNA prepared as described above using TGT enzyme. The reaction mixture consisted of 5 μM RNA, 50 μM Nb2'-Om7Gppp-PreQ1, 100 mM HEPES-KOH (pH 7.3), 5 mM DTT, 20 mM MgCl2, and 10 μM TGT enzyme. The reaction mixture was incubated at 37°C for 2 hours. Taking advantage of the hydrophobic nature of the introduced m7G cap structure, RNA bearing this structure was isolated by reverse-phase HPLC (YMC-TriartBio C4 (250 mm × 4.6 mm ID), eluent A: 50 mM TEAA buffer solution with 5% acetonitrile; eluent B: acetonitrile, linear gradient of B 0–20% over 20 min, column temperature 50°C, flow rate 1 mL / min). The hydrophobic protecting group of the m7G cap structure was removed by irradiation with 365 nm light (4.0 mW / cm2, 10 min, Asahi Spectroscopy 300 W Xenon Light Source MAX-350).

[0146] The resulting mRNA was transfected into HeLa cells (RIKEN Cell Bank) using a commercially available transfection reagent (Lipofectamine® MessengerMAX™ reagent, Thermo Scientific). Translation activity was assessed. HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, HeLa cells (1.0 × 10E4 cells / well) seeded in a 96-well multiwell plate were transfected with mRNA (10 ng / well). After 8 hours of culture, the amount of mRNA translation product was measured using a Nano Glo HiBiT Lytic Detection System (Promega). Luminescence was measured using a TriStar 5 multiwell plate reader (Berthold).

[0147] <Results> The results are shown in FIGS.

[0148] Figure 6(a) shows that a 192-base-long linear RNA was capped using TGT enzyme and analyzed by HPLC. After the starting RNA (peak top: 16.5 min), the capped RNA was observed at 19.2 min. The capping efficiency was 83% based on the peak area ratio.

[0149] (b) When a 200-base-long linear RNA was subjected to capping reaction using the TGT enzyme and analyzed by HPLC, the raw RNA (peak top: 16.6 min) was eluted, followed by the capped RNA at 20.0 min. The capping efficiency was 78% based on the peak area ratio.

[0150] (c) When a 192-base-long linear RNA modified with pseudouridine was subjected to a capping reaction using TGT enzyme and analyzed by HPLC, the raw RNA (peak top: 16.7 min) was eluted, followed by the capped RNA at 19.5 min. The capping efficiency was 30% based on the peak area ratio.

[0151] (d) When a 200-base-long linear RNA modified with pseudouridine was subjected to a capping reaction using the TGT enzyme and analyzed by HPLC, the raw RNA (peak top: 16.8 min) was eluted, followed by the capped RNA at 20.6 min. The capping efficiency was 25% based on the peak area ratio.

[0152] (e) 192-mer circular RNA was subjected to capping reaction using TGT enzyme and analyzed by HPLC. After the starting RNA (peak top: 12.7 min), capped RNA was observed at 15.4 min. The peak area ratio indicated a capping efficiency of 60% (linear:cyclic = 1:2.0).

[0153] (f) 200-base-long circular RNA was subjected to capping reaction using TGT enzyme and analyzed by HPLC. After the raw RNA (peak top: 12.7 min), capped RNA was observed at 16.3 min. The peak area ratio indicated a capping efficiency of 60% (linear:circular = 1:1.5).

[0154] (g) After capping of 192- or 200-mer circular RNAs using TGT enzyme, the resulting fractions were purified by HPLC and analyzed on a denaturing polyacrylamide gel. Capped circular RNAs were observed in both the 192-mer and 200-mer circular RNAs.

[0155] Figure 7(a) shows that the introduction of the m7G cap structure enhanced translation activity when using both the 192-nt mRNA containing TGT-17 upstream of the HiBiT peptide coding sequence and the 200-nt mRNA containing TGT-25 upstream of the HiBiT peptide coding sequence as substrates. The increase in translation activity was 5.0-fold for the TGT-17 construct and 5.9-fold for the TGT-25 construct compared to the pre-introduction stage. Furthermore, purification using the hydrophobic tag at the m7G motif further enhanced activity (m7G(+) vs m7G(+) purified). The increase in translation activity was 5.8-fold for the TGT-17 construct and 7.5-fold for the TGT-25 construct compared to the pre-introduction stage.

[0156] (b) We also confirmed that the m7G cap structure was introduced into the 192-nt mRNA containing N1-methylpseudouridine-modified TGT-17 and the 200-nt mRNA containing TGT-25 using the TGT enzyme, and that the translation activity of the mRNA was improved after the introduction. The increase in translation activity compared to before introduction was 16-fold for TGT-17 and 10-fold for TGT-25.

[0157] (c) The introduction of the m7G cap structure into 192 / 200 base-long circular mRNAs containing the TGT-17 and TGT-25 motifs using TGT enzyme resulted in an increase in translation activity, with the TGT-17 and TGT-25 motifs increasing 9.7-fold and 2.8-fold, respectively, compared to the pre-introduction levels.

[0158] Test Example 3: Evaluation of Translation Activity of Linear RNA with an m7G Cap Structure Introduced into the Branched Chain. A 121-base-long RNA was prepared by ligating two chemically synthesized oligo-RNA strands (each with a different 54-base 5' fragment and a common 67-base 3' fragment) using T4 RNA ligase 2. The RNA oligos used as the ligation substrates were synthesized using an automated nucleic acid synthesizer according to the standard phosphoramidite method. In particular, a commercially available amidite reagent (Asymmetric Doubler (Lev) Phosphoramidite, Glen Research) was used to introduce the branched structure. The synthesized oligo-RNA was deprotected and purified using standard methods, and then the m7G cap structure was introduced as previously reported (Abe et al., ACS Chem. Biol. 2022, 17, 6, 1308-1314). The purity and molecular weight of the obtained oligo RNA were confirmed by LC-MS analysis (Agilent 6125 LC / MSD, Agilent 1290 Infinity II, 6530 LC / Q-TOF).

[0159] 54-nt RNA_1 5' p-GGCGCAUAUUAAGGUGACGCGUGUGGCCUCGAACACCGAGGGUAAAGCCACCAU 3' (SEQ ID NO: 10) Calced mass, 17,523.5; found, 17,524.2 (+0.7).

[0160] 54-nt RNA_2 5' p-GGCGCAUAUUAAGGUGACGCGUGUGGCCUCGAACACCGAGGGUA-X-AAGCCACCAU 3' (SEQ ID NO: 11). Here, X is a branched structure derived from Asymmetric Doubler (Lev) Phosphoramidite, and the 5' m 7 G-ppp-mG_mG_AGCG binds (mG = 2'-O-methyl G). Calculated mass: 20,438.4; found mass: 20,439.3 (+0.9).

[0161] 54-nt RNA_3 5' m 7G-ppp-GGCGCAUAUUAAGGUGACGCGUGUGGCCUCGAACACCGAGGGUAAAGCCACCAU 3′ (SEQ ID NO: 12) Calced mass, 17,962.7, found 17,963.4 (+0.7).

[0162] 67-nt RNA 5' p-GGUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGCUGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3' (SEQ ID NO: 13) Calculated mass, 21,986.5; found, 21,987.0 (+0.5).

[0163] The 54-nt 5' fragment and the 67-nt 3' fragment were ligated using a complementary oligonucleotide (5' CGCCAGCCGCTCACCATGGTGGCTTTACCC 3' (SEQ ID NO: 14)) with T4 RNA ligase 2 (2 μM 54-nt RNA, 2 μM 67-nt RNA, 2.4 μM oligonucleotide, 10% (w / v) PEG 8000, 50 mM Tris-HCl (pH 7.5), 2 mM magnesium chloride, 2 mM DTT, 0.4 mM ATP, 100 ng / μL T4 RNA ligase 2, 37°C, 1 hour). The ligated product was purified by denaturing polyacrylamide gel electrophoresis (Abe et al., Angew Chem Int Ed, 2013, 52, 7004-7008).

[0164] The three 121-nt RNAs (Figure 7(a)) obtained as described above were transfected into HeLa cells (RIKEN Cell Bank) using a commercially available transfection reagent (Lipofectamine® MessengerMAX™ reagent, Thermo Scientific). Translation activity was assessed. HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, mRNA (25 ng / well or 50 ng / well) was transfected into HeLa cells (1.0 × 10E4 cells / well) seeded in a 96-well multiwell plate. After 6 hours of incubation, the amount of translation product was measured using a Nano Glo HiBiT Lytic Detection System (Promega). Luminescence was measured using a TriStar 5 multiwell plate reader (Berthold).

[0165] <Results> The results are shown in FIG.

[0166] a) The three 121-nt RNAs used were shown. A branched chain containing an m7G cap structure was introduced upstream of the HiBiT peptide-encoding region by enzymatic ligation (121-nt RNA_2). For control experiments, a sequence without the branched chain (121-nt RNA_1) and a similar sequence with a cap structure at the 5' end (121-nt RNA_3) were also prepared using the same method.

[0167] b) The results of denaturing polyacrylamide gel electrophoresis analysis of the synthesized target RNA are shown. The band positions were consistent with the expected bands, and the purity was confirmed to be sufficiently high.

[0168] c) The results of RNA translation activity evaluation using HeLa cultured cells are shown. RNA with a capped branched chain (121-nt RNA_2) showed 21- and 32-fold higher translation activity than RNA without a capped chain (121-nt RNA_1). In addition, the translation activity of RNA with a capped chain end (121-nt RNA-2) was equivalent to that of RNA with an m7G capped chain at the 5' end (121-nt RNA_3).

[0169] Test Example 4: Evaluation of translation activity of a 211-base-long bicistronic RNA (FLAG-His / HiBiT) with an internal cap introduced into it. An m7G cap structure was introduced into a 211-base-long mRNA containing a cap structure at the 5' end using TGT enzyme, and the translation activity of the resulting mRNA was evaluated using cultured HeLa cells.

[0170] A 211-nt linear RNA encoding a FLAG tag, a His tag, and the HiBiT peptide was prepared by in vitro transcription using T7 RNA polymerase with a DiPure cap analog, as previously reported (Inagaki et al., Nature Commun., 2023, 14, 2657).

[0171] 5' m7G-ppp-GGGAAAGCCACCAUGGACUACAAGGACGACGACGAUAAGAUCAUCGACUAUAAAGACGACGACGAUAAACACCACCACCACCACCACUGAGGCGCAUAUUAAGGUGGGAGCAGACUGUAAAUCUGCUCCCGGUAAAGCCACCAUGGUGAGCGGCUGGCGGCUGUUCAAGAAGAUUAGCUGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3' (SEQ ID NO: 15). Here, the recognition sequence for the TGT enzyme is underlined. The transglycosylation site is G in the middle CUGUAA of the underlined sequence.

[0172] The m7G cap structure was introduced into this mRNA using TGT enzyme. The reaction mixture consisted of 1 μM RNA, 50 μM Nb2'-Om7Gppp-PreQ1, 100 mM HEPES-KOH (pH 7.3), 5 mM DTT, 20 mM MgCl2, and 10 μM TGT enzyme. The reaction mixture was incubated at 37°C for 2 hours, and the m7G-capped RNA was isolated by reverse-phase HPLC (YMC-TriartBio C18 (250 mm × 4.6 mm ID), eluent A: 100 mM TEAA buffer solution, 5% acetonitrile; eluent B: 100 mM TEAA buffer solution, 50% acetonitrile; linear gradient of B 15–30% over 30 min; column temperature: 50°C; flow rate: 1 mL / min). After isolating the target product, the mRNA was irradiated with 365 nm light (4.0 mW / cm2, 10 minutes, Asahi Spectroscopy 300 W Xenon Light Source MAX-350), and the RNA was recovered by alcohol precipitation.

[0173] The resulting mRNA was transfected into HeLa cells (RIKEN Cell Bank) using a commercially available transfection reagent (Lipofectamine® MessengerMAX™ reagent, Thermo Scientific). Translation activity was assessed. HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, HeLa cells (5.0 × 10E4 cells / well) were seeded in a 24-well multiwell plate and transfected with mRNA (500 ng / well). After 6 hours of incubation, the amount of mRNA translation product was measured by sandwich ELISA using anti-FLAG antibody as the detection antibody (Abe et al., ACS Chem. Biol. 2022, 17, 6, 1308-1314) and luminescence measurement using the Nano Glo HiBiT Lytic Detection System (Promega). A TriStar 5 multiwell plate reader (Berthold) was used for colorimetric and luminescent measurements.

[0174] <Results> The results are shown in Figure 9. After the introduction of the internal cap, we confirmed the enhanced expression of the second gene located downstream of the internal cap structure in the RNA. Compared to the mRNA before m7G introduction (m7G(-)), the expression level of Nluc in the mRNA after introduction (m7G(+)) was increased by 1.6-fold.

[0175] Test Example 5: Evaluation of translation activity of a 2413-base-long bicistronic RNA (Fluc / Nluc) with an internal cap introduced into it. A 2413-base-long mRNA containing a cap structure at its 5' end was introduced with an m7G cap structure using TGT enzyme, and the change in translation activity was evaluated using cultured HeLa cells.

[0176] Linear RNAs encoding Fluc luciferase (Fluc) and Nluc luciferase (Nluc), each consisting of 2413 bases, were prepared by in vitro transcription using T7 RNA polymerase with DiPure cap analogs, as previously described (Inagaki et al., Nature Commun., 2023, 14, 2657).

[0177]

[0178] The m7G cap structure was introduced into this mRNA using TGT enzyme. The reaction mixture consisted of 1 μM RNA, 50 μM Nb2'-Om7Gppp-PreQ1, 100 mM HEPES-KOH (pH 7.3), 5 mM DTT, 20 mM MgCl2, and 10 μM TGT enzyme. The reaction mixture was incubated at 37°C for 2 hours. The mRNA was irradiated with 365 nm light (4.0 mW / cm2, 10 minutes, Asahi Spectroscopy 300 W Xenon Light Source MAX-350), and the RNA was recovered by alcohol precipitation.

[0179] The obtained mRNA was transfected into HeLa cells (RIKEN Cell Bank) using a commercially available transfection reagent (Lipofectamine® MessengerMAX™ reagent, Thermo Scientific). Translation activity was assessed. The day before transfection, mRNA (10 ng / well or 20 ng / well) was transfected into HeLa cells (1.0 × 10E4 cells / well) seeded in a 96-well multiwell plate. After 24 hours of culture, the amount of translation product was measured using the Nano-Glo® Dual-Luciferase® Reporter Assay System (Promega). Colorimetric and luminescent measurements were performed using a TriStar 5 multiwell plate reader (Berthold).

[0180] <Results> The results are shown in Figure 10. Enhanced expression of Nluc, the second gene located downstream of the internal cap structure, was confirmed in mRNA (m7G(+)) after introduction of the internal m7G cap structure. Compared with mRNA (m7G(-)) before m7G introduction, expression levels of Nluc in mRNA (m7G(+)) after introduction were 17-fold and 14-fold higher (at mRNA introduction levels of 10 ng / well and 20 ng / well, respectively).

[0181] Test Example 6: Evaluation of translation activity of internally capped bicistronic RNA (GFP / mCherry) <Synthesis of linear mRNA by co-transcription reaction> Linear RNA was synthesized by transcription using T7 RNA polymerase with double-stranded DNA as a template. The template double-stranded DNA was obtained by amplification using PCR. The reaction solution consisted of the following: 1 ng / μL DNA vector, 1× KOD buffer, 0.2 mM dNTPs, 0.3 μM primers, 1.5 mM MgSO4, and 0.02 units / μL polymerase. The sequences of the plasmid DNA and primers used are listed below.

[0182]

[0183] A transcription reaction mixture (template DNA 10 ng / μL, 1× T7 RNA Polymerase buffer (Takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl2, 2 mM spermidine), 10% T7 RNA polymerase (Takara), 5 mM DTT, 2 mM ATP, 2 mM UTP, 2 mM CTP, 2 mM GTP, 8 mM ARCA) was prepared and incubated at 37°C for 1 hour. Recombinant DNase (Takara) was added to the reaction mixture at a concentration of 0.1 U / μL, and the mixture was incubated at 37°C for 30 minutes to degrade the template DNA.

[0184] After the reaction, 7.5 M LiCl was added in an amount equal to half the volume of the IVT reaction solution, and the mixture was left at -30°C for 30 minutes. The mixture was then centrifuged at 15,000 rpm for 30 minutes to obtain a precipitate, which was then purified by reverse-phase HPLC.

[0185] Column: YMC-TriartBioC4 (250 mm × 4.6 mm ID); Solvent A: 100 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; Solvent B: 100 mM triethylammonium acetate (pH 7.0), 50% acetonitrile; Linear gradient: 10–30% Solvent B (0–20 min); Flow rate: 1 mL / min; Detection wavelength: 260 nm; Column temperature: 50°C.

[0186] <Capping reaction of bicistronic RNA using TGT enzyme> A reaction buffer solution (100 mM HEPES-KOH, pH 7.3, 5 mM DTT, 20 mM MgCl2) was prepared in a 200 μL PCR chip, and cap analog (50 μM), substrate RNA (1 μM), and TGT enzyme (10 μM) were added. MQ water was added to the total volume to 10 μL. This reaction solution was incubated at 37°C for 1 or 2 hours, followed by phenol-chloroform extraction and subsequent isopropyl alcohol precipitation to obtain the desired capped RNA.

[0187] <Evaluation of intracellular translation activity> HeLa cells (RIKEN Cell Bank) were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, HeLa cells (1.0 × 10 4 The next day, the medium was removed and replaced with 90 μL / well of Opti-MEM® (Thermo Fisher Scientific). 0.15 μL of Lipofectamine® MessengerMAX™ was added. 25 or 50 ng of mRNA was diluted in 10 μL of Opti-MEM® and transfected into the cells. After 2 hours, the medium was replaced with Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen). After 22 hours of incubation at 37°C, the medium was removed and the cells were washed twice with 150 μL of PBS. 100 μL of PBS was added per well, and fluorescence measurements were performed (GFP (Ex; 475 nm, Em; 520 nm), mCherry (Ex; 570 nm, Em; 615 nm)).

[0188] <Results> The results are shown in Figure 11. The expression of mCherry located downstream of the introduced cap was observed by changing the reaction time of transglycosylation to introduce the cap. The highest level was observed when the cap introduction reaction was carried out for 2 hours, which was 8.1-fold higher than when no cap was introduced.

[0189] Synthesis example 2. Synthesis of cap analogue 2

[0190]

[0191] Synthesis Example 2-1. Synthesis of O-di-tert-butylphosphorylated N2-trityl-N7-6-hydroxyhexyl PreQ1. N7-(6-hydroxyhexyl)-N2-trityl PreQ1 (1.04 g, 2.0 mmol, 1.0 equiv) was dissolved in THF / DCM (1:1, 40 mL) and stirred at 0 °C. Tetrazole (701 mg, 10 mmol, 5.0 equiv) and di-tert-butyl N,N-diisopropylphosphoramidite (1.87 mL, 6.0 mmol, 3.0 equiv) were added sequentially, and the mixture was stirred at the same temperature for 6 hours. Hydrogen peroxide (30% solution, 2.4 mL, 20 mmol, 10 equiv) was then added, and the mixture was stirred at room temperature for 2 hours. The reaction mixture was treated with 1 N NaSO (100 mL) to quench the hydrogen peroxide, and the aqueous layer was extracted with DCM. The organic layer was dried over sodium sulfate, concentrated, and purified on a silica gel column (DCM / MeOH = 9 / 1 with 1% NEt) to give the desired product (937 mg, 1.31 mmol, 66%).

[0192] Synthesis Example 2-2. Synthesis of O-phosphorylated N7-6-hydroxyhexyl PreQ1. N2-Trityl PreQ1 phosphate (579 mg, 1.1 mmol, 1.0 equiv) was dissolved in DCM / TFA (1:1, 20 mL) and allowed to stand at room temperature for 2 hours. Volatile substances were then removed under reduced pressure, and methanol was added for further concentration. Acetone was added to the resulting residue, and the formation of a white precipitate was confirmed. This precipitate was collected by centrifugation, washed with acetone, and dried under reduced pressure to obtain the desired product (308 mg, 0.651 mmol, 51%).

[0193] Synthesis example 2-3. Nb 2’-O m 7 Synthesis of Gppp-hex-PreQ1: Add N6-hydroxyhexyl PreQ1 to a 15 mL Falcon tube. 1 A mixture of 7N-methylguanosine diphosphate (94.7 mg, 0.20 mmol, 1.0 equiv), 2'-O-(2-(2-nitrophenyl)-1-tert-butylethyl)-7N-methylguanosine diphosphate imidazolide (309 mg, 0.40 mmol, 2.0 equiv), DMSO (4 mL), and zinc chloride (545 mg, 2.0 mmol, 20 equiv) was added and stirred at 37°C for 48 hours. After completion of the reaction, the mixture was quenched by adding EDTA buffer solution (pH = 8.0, 0.5 M, 8 mL) while maintaining the temperature at room temperature, and then diluted with MQ water. The mixture was purified by reversed-phase column chromatography (C18, eluent A: 50 mM TEAA buffer solution 0.5% acetonitrile, eluent B: acetonitrile, B 20-80%) and ion-exchange column chromatography (DEAE, eluent A: MQ, eluent B: 1 M TEAA buffer solution 10% acetonitrile, B 0-80%). After desalting (eluent A: MQ, eluent B: acetonitrile, B 0-100%), the mixture was lyophilized to obtain the target product, m 7 Gppp-PreQ1 (66.1 mg, 62.1 μmol, 31%) was obtained.

[0194] Synthesis Example 3. Synthesis of cap analogue 3

[0195]

[0196]

[0197] Synthesis Example 3-1. Synthesis of N2-trityl-6-tert-butyldiphenylsilyloxyhexyl PreQ1 N7-(6-hydroxyhexyl)-N2-trilyl PreQ1 (4.17 g, 8.0 mmol, 1.0 equiv) and imidazole (1.63 g, 24 mmol, 3.0 equiv) were dissolved in DCM (16 mL), and tert-butyldiphenylsilyl chloride (4.15 mL, 16 mmol, 2.0 equiv) was added dropwise at 0 °C. After stirring at room temperature for 24 hours, the mixture was purified using a silica gel column (DCM / MeOH = 9 / 1) to obtain the desired product (6.87 g, 6.43 mmol, 80%).

[0198] Synthesis Example 3-2. Synthesis of N7-trifluoroacetyl-N7-6-tert-butyldiphenylsilyloxyhexyl PreQ1. O-TBDPS-N2-triryl C6-PreQ1 (4.78 g, 6.0 mmol, 1.0 equiv) and triethylamine (8.32 mL, 60 mmol, 10 equiv) were dissolved in DCM (80 mL), and trifluoroacetic anhydride (4.17 mL, 30 mmol, 5.0 equiv) was added dropwise at 0 °C. After stirring at room temperature for 20 hours, the reaction solution was washed with saturated aqueous sodium bicarbonate, and the organic layer was dried over sodium sulfate. Purification was carried out using a silica gel column (DCM / MeOH = 19 / 1) to obtain the target product (4.33 g, quant).

[0199] Synthesis Example 3-3. Synthesis of N7-trifluoroacetyl-N7-6-hydroxyhexyl-N2-octanoyl PreQ1. A pyridine solution (2 mL) containing O-TBDPS-N-TFA C6-PreQ1 (1.23 g, 2.0 mmol, 1.0 equiv) and octanoyl chloride (1.03 mL, 6.0 mmol, 3.0 equiv) was stirred at 85 °C for 3 hours. The reaction solution was poured into saturated aqueous sodium bicarbonate and extracted with DCM. The organic layer was dried over sodium sulfate and concentrated. Tetrabutylammonium fluoride (1 M in THF, 4 mL) was added to the resulting residue and stirred overnight at room temperature. The reaction solution was poured into 1 M aqueous sodium bicarbonate and extracted with DCM. The organic layer was dried over sodium sulfate and purified using a silica gel column (DCM / MeOH 10%) to obtain the desired product (1.00 g, 1.22 mmol, 61%).

[0200] Synthesis Example 3-4. Synthesis of mG(N2-i-Pr)-p(CE)-hex-PreQ1 (N7-TFA, N2-octanoyl) 7N-TFA-(6-hydroxyhexyl)-2N-octanoyl-PreQ1 (502 mg, 1.0 mmol, 1.0 equiv) and mG phosphoramidite (1.0 g, 1.15 mmol, 1.15 equiv) were dissolved in acetonitrile and concentrated under reduced pressure three times. The mixture was dissolved in acetonitrile (3 mL), 3Å molecular sieves (115 mg) were added, and the mixture was stirred at room temperature for 1 hour. Next, 4,5-dicyanoimidazole (177 mg, 1.5 mmol, 1.5 equiv) was added and stirred for 1 hour. After this, tert-butyl hydroperoxide (70 wt% in water, 274 μL, 2 mmol, 2 equiv) was added and stirred for an additional 30 minutes. The mixture was poured into an aqueous solution containing sodium sulfite (5 equiv) and sodium bicarbonate (10 equiv) and extracted with DCM. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over sodium sulfate, and concentrated under reduced pressure. 80% acetic acid was added to the resulting residue and stirred at room temperature for 1 hour. Extraction with DCM was then performed. The resulting organic layer was washed with water, saturated aqueous sodium bicarbonate, and dried over sodium sulfate. Diethyl ether was added to the concentrated organic layer, resulting in the formation of a precipitate of the reaction product. This precipitate was washed with diethyl ether and then dried under reduced pressure to give the desired product (629 mg, 0.639 mmol, 64%).

[0201] Synthesis Example 3-5. Synthesis of p(di-CE)-mG(N2-i-Pr)-p(CE)-hex-PreQ1(N7-TFA, N2-octanoyl) Molecular sieves 3Å (60 mg), N,N-diisopropyl-di(2-cyanoethyl)phosphoramidite (470 μL, 1.8 mmol, 3.0 equiv), and dicyanoimidazole (106 mg, 0.9 mmol, 1.5 equiv) were added to an acetonitrile solution (3 mL) of the alcohol precursor (590 mg, 0.6 mmol, 1.0 equiv) and the mixture was stirred at room temperature for 1 hour. Then, ert-butyl hydroperoxide (70 wt% in water, 411 μL, 3 mmol, 5 equiv) was added and the mixture was stirred for an additional 30 minutes. The mixture was poured into an aqueous solution containing sodium sulfite (5 equiv) and sodium bicarbonate (10 equiv) and extracted with DCM. The organic layer was washed with saturated aqueous sodium bicarbonate and saturated brine, dried over sodium sulfate, and concentrated under reduced pressure. Purification was carried out using a silica gel column (DCM / MeOH = 92 / 8) to give the desired product (655 mg, 0.559 mmol, 93%).

[0202] Synthesis Example 3-6: Synthesis of pmGp-hex-PreQ1. NH3 / MeOH (7N, 10 mL) was added to the precursor (0.56 mmol) and stirred at 60 °C for 18 hours, followed by concentration under reduced pressure. The mixture was purified by reversed-phase column chromatography (C18 column, A: 50 mM TEAA with 0.5% ACN, B: ACN, linear gradient 0-30% B). The fractions were lyophilized to obtain the desired product (101 mg, 0.110 mmol, 20%).

[0203] Synthesis example 3-7. Nb-m 7 Synthesis of GpppmGp-hex-PreQ1 p-mGp-hex-PreQ1 (46 mg, 0.050 mmol, 1.0 equiv) and Im-Nb 2’-O m 7DMSO (1 mL) was added to GDP (116 mg, 0.15 mmol, 3.0 equiv), and zinc chloride (136 mg, 1.0 mmol, 20 equiv) was then added. The solution was then stirred for 48 hours while maintaining the temperature at 37 °C. EDTA buffer (pH = 8.0, 0.5 M, 2 mL) was added to the reaction solution while maintaining the solution temperature at room temperature, and the mixture was then diluted with MQ water. This solution was purified by reversed-phase column chromatography (C18, solvent A: 50 mM TEAA + 0.5% ACN, solvent B: ACN, B 0-60% linear gradient) and ion-exchange column chromatography (DEAE, solvent A: MQ, solvent B: 1 M TEAA + 10% ACN, B 0-100% linear gradient). After desalting (C18 column, A: MQ, B: ACN, 0-100%), the resulting fraction was lyophilized to give the desired product (9.3 mg, 6.43 μmol, 13%).

[0204] Synthesis Example 4. Synthesis of PreQ1 column support

[0205]

[0206] Synthesis Example 4-1. Synthesis of O-succinimidylcarbonyl N7-trifluoroacetyl-N7-6-hydroxyhexyl-N2-octanoyl PreQ1. 7N-TFA-(6-hydroxyhexyl)-2N-octanoyl-PreQ1 (100 mg, 0.20 mmol, 1.0 equiv) was dissolved in MeCN / DCM (1:1, 2 mL), and disuccinimidyl carbonate (61.5 mg, 0.24 mmol, 1.2 equiv) and pyridine (20.2 μL, 0.25 mmol, 1.25 equiv) were added. After stirring at room temperature for 20 hours, the volatiles were removed under reduced pressure. The residue was dissolved in DCM and washed with saturated aqueous sodium bicarbonate and saturated aqueous sodium chloride. The organic layer was dried over sodium sulfate and concentrated to obtain the desired product (125 mg, 0.195 mmol, 98%).

[0207] Synthesis Example 4-2. Synthesis of O-2-hydroxy-3-(4,4'-dimethoxytrityloxy)-propylaminocarbonyl N7-trifluoroacetyl-N7-6-hydroxyhexyl-N2-octanoyl PreQ1. To a solution of N-DMT-3-amino-1,2-propandiol (73.2 mg, 0.186 mmol, 1.0 equiv) and triethylamine (30.9 uL, 0.223 mmol, 1.2 equiv) in THF (1 mL) was added 7N-TFA-(6-succinimidylcarbonyloxyhexyl)-2N-octanoyl-PreQ1 (mg, 0.195 mmol, 1.05 equiv) at 0 °C. After stirring at the same temperature for 2 hours, the mixture was poured into saturated aqueous sodium bicarbonate and extracted with DCM. The organic layer was washed with saturated aqueous sodium chloride solution, dried over sodium sulfide, and then purified with a silica gel column (DCM / MeOH = 9 / 1 with 1% pyridine) to obtain the target product (267 mg, quant).

[0208] Synthesis Example 4-3. Synthesis of O-2-(3-carboxypropanoyloxy)-3-(4,4'-dimethoxytrityloxy)-propylaminocarbonyl N7-trifluoroacetyl-N7-6-hydroxyhexyl-N2-octanoyl PreQ1. To a solution of the precursor alcohol (267 mg, 0.186 mmol, 1.0 equiv) in DCM / pyridine (4 / 1, 2 mL) was added DMAP (68.2 mg, 0.558 mmol, 3.0 equiv) and succinic anhydride (55.8 mg, 0.558 mmol, 3.0 equiv) and stirred at room temperature for 2 hours. The mixture was then diluted with DCM and washed with 10% aqueous ammonium chloride and saturated aqueous sodium chloride. The organic layer was dried over sodium sulfate and concentrated to give the desired product (173 mg, 0.170 mmol, 91%).

[0209] Synthesis Example 4-4. Synthesis of 3' PreQ1 Modifier CPG. i-Pr2NEt (116 μL, 179 μmol, 4.0 equiv) and HBTU (67.9 mg, 179 μmol, 1.05 equiv) were added to a solution of the precursor carboxylic acid compound (170 μmol, 1.0 equiv) in MeCN (17 mL) to form a homogeneous solution. After 5 minutes, native amino CPG (1.5 g) was added, followed by gentle end-over-end stirring at room temperature for 20 hours. The resin was separated, washed with MeCN, MeOH, MeCN, and ether (40 mL each), and then dried under vacuum. A cap A / cap B mixture (1:1, 20 mL) was added to the resulting resin, and the mixture was gently end-over-end stirred at room temperature for 20 hours. The resin was separated, washed with MeCN, MeOH, MeCN, and ether (40 mL each), and then dried using a vacuum pump to obtain the target product (19.0 μmol / g, 1.5 g).

[0210] Synthesis Example 5. Synthesis of Cap Analogs 4 Synthesis Example 5-1. Synthesis of p-oligo-PreQ1 Using an automated nucleic acid synthesizer, p-mGmAA GC-PreQ1, p-mGmAG GUC AAG C (SEQ ID NO: 21)-PreQ1, or p-mGmAC GAG CUU AUC GGU CAA GC (SEQ ID NO: 22)-PreQ1 was synthesized (amidite: 2'-O-TOM nucleic acid amidite 50 mM acetonitrile solution, oxidizing agent: iodine 50 mM pyridine / water (9:1) solution, activator: 5-benzylthio-1H-tetrazole 25 mM acetonitrile solution, cap A: acetic anhydride 10% THF solution, cap B: 1-methylimidazole 10% THF / pyridine (8:1) solution). Aqueous ammonia (28%, 500 μL) and methylamine (40%, 500 μL) were added to the resin obtained by the automated nucleic acid synthesizer and reacted at 60°C for 30 minutes to cleave the oligonucleotide from the resin and deprotect the acyl groups. The reaction solution was dried under reduced pressure, and the resulting residue was added to a THF solution (1 M, 1 mL) of TBAF and left at room temperature for 15 hours to deprotect the TOM group. The mixture was then neutralized with Tris-HCl buffer (1 M, pH 7.5, 1 mL). The THF in the solution was removed under reduced pressure to reduce the volume to approximately 1 mL, and the mixture was then passed through a NAP-25 column for desalting. The resulting solution was concentrated and lyophilized. The resulting solid was dissolved in water to a concentration of approximately 1 mM. Aqueous sodium acetate and ethanol were added to the solution, and the mixture was left at -30°C for 1 hour to obtain a precipitate. The precipitate was collected by centrifugation, washed with ethanol, and then dried to obtain the target RNA (276 μM, 200 μL, 55.2 nmol, 28%; 500 μM, 200 μL, 100 nmol, 50%; 265 μM, 200 μL, 53.0 nmol, 27%).

[0211] Synthesis example 5-2. Nb-m 7 Synthesis of Gppp-oligo-PreQ1

[0212] p-oligo-PreQ1 (10 nmol) was mixed with CaCl2 aqueous solution (100 mM, 100 μL), and then lyophilized for 2 hours. 7 GppIm (15 mM in DMSO, 666 μL) and 2-nitroimidazole (100 mM in DMSO, 100 μL) were added and incubated at 55°C for 3 hours. The reaction solution was returned to room temperature, and MQ water, aqueous sodium acetate solution, ethanol, and glycogen were added. The mixture was then left to stand at -30°C for 1 hour to obtain a precipitate. The precipitate was collected by centrifugation, washed with ethanol, and dried to obtain the crude target product. This mixture was purified by reverse-phase HPLC to obtain the target product.

[0213] Test Example 7: Evaluation of translation activity when a nucleotide linker is used <Preparation of circular RNA> The sequence of the circular RNA used in this experiment is as follows: (SEQ ID NO: 23) (The underlined portion indicates the TGT motif.)

[0214] <Synthesis of Linear RNA by Transcription Reaction> Linear RNA was synthesized by transcription using double-stranded DNA as a template with T7 RNA polymerase. A transcription reaction mixture (template DNA 2.5 ng / μL, 1× T7 RNA Polymerase buffer (Takara) (40 mM Tris-HCl (pH 8.0), 8 mM MgCl2, 2 mM spermidine), 2.5 U / μL T7 RNA polymerase (Takara), 5 mM DTT, 2 mM ATP, 2 mM UTP, 2 mM CTP, 2 mM GTP, 10 mM GMP) was prepared and incubated at 37°C for 2 hours. Recombinant DNase (Takara) was added to the reaction mixture at a concentration of 0.1 U / μL, and the mixture was incubated at 37°C for 30 minutes to degrade the template DNA. After the reaction, an equal volume of 7.5 M LiCl was added to the IVT reaction mixture, and the mixture was incubated at -30°C for 30 minutes. The precipitate was then centrifuged at 15,000 rpm for 30 minutes. The precipitate was purified by reverse-phase HPLC. Column: YMC-TriartBioC4 (250 mm x 4.6 mm ID); Solvent A: 100 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; Solvent B: 100 mM triethylammonium acetate (pH 7.0), 50% acetonitrile; Linear gradient: 10–30% Solvent B (0–20 min); Flow rate: 1 mL / min; Detection wavelength: 260 nm; Column temperature: 50°C.

[0215] <Circularization using T4 RNA ligase 2> The transcribed linear RNA was circularized using T4 RNA ligase 2 (New England Biolabs) and 30-nt DNA (guide DNA). 0.5 μM linear RNA and 1.0 μM guide DNA were annealed in T4 RNA ligase 2 buffer (50 mM Tris-HCl (pH 7.5), 2 mM MgCl2, 1 mM DTT, and 0.4 mM ATP), followed by incubation at 37°C for 1 hour with 0.1 U / μL T4 RNA ligase 2 and 10% PEG 8000. The circularized RNA and the starting linear RNA were separated by 5% denaturing PAGE.

[0216] <Preparation of capped circular RNA> An enzyme reaction solution (1.0 μM circular RNA, 50 μM cap analog, 10 μM TGT enzyme, 100 mM HEPES-KOH, pH 7.3, 5 mM DTT, 20 mM MgCl2) was prepared and incubated at 37°C for 1 hour. After that, an equal volume of 7.5 M LiCl was added to the IVT reaction solution. The mixture was then incubated at -30°C for 30 minutes and centrifuged at 15,000 rpm for 30 minutes to obtain a precipitate. The precipitate was then purified by reverse-phase HPLC. Column: YMC-TriartBioC4 (250 mm × 4.6 mm ID); Solvent A: 100 mM triethylammonium acetate (pH 7.0), 5% acetonitrile; Solvent B: 100 mM triethylammonium acetate (pH 7.0), 50% acetonitrile; Linear gradient: 15–30% Solvent B (0–20 min); Flow rate: 1 mL / min; Detection wavelength: 260 nm; Column temperature: 50°C

[0217] The RNA solution was added to a transparent 96-well multiwell plate and illuminated with a MAX-305 light source (Asahi Spectroscopy) at 4 mW / cm 2 The hydrophobic tag was deprotected by irradiation with 365 nm light at a light intensity of 1000 kJ / min for 10 minutes.

[0218] <Evaluation of intracellular translation activity> HeLa cells (RIKEN Cell Bank) were cultured in Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen) at 37°C and 5% CO2. The day before transfection, HeLa cells (1.0 × 10 4 The next day, the medium was removed and replaced with 100 μL / well of Opti-MEM® (Thermo Fisher Scientific). TM 10 ng of mRNA was diluted in 5 μL of Opti-MEM® and transfected into the cells. After 2 hours, the medium was replaced with Dulbecco's modified Eagle's medium (DMEM; WAKO) supplemented with 10% fetal bovine serum (FBS; Invitrogen). After 24 hours of incubation at 37°C, 20 μL / well of 1× Cell Lysis Buffer (Promega) was added to lyse the cells. Luminescence was measured using the Nano-Glo® luciferase assay (Promega).

[0219] Test Example 8: Intracellular Capping of Circular RNA The intracellular capping scheme for circular RNA in this test example is shown in Figure 13a. <Creation of TGT-Expressing HeLa Cells> A pLVSIN vector (synthesized by VectorBuilder) containing a cassette expressing E. coli-derived TGT enzyme (coding sequence the same as in Production Example 1) under the control of a CMV promoter was prepared and lipofected into HEK293 cells (using ThermoFisher's Lipofectamine 30000) together with Lentiviral High Titer Packaging Mix (Takara). The medium was replaced once 24 hours after transfection, and the medium supernatant was collected 72 hours later as a lentivirus solution. The above lentivirus solution was added to HeLa cells at a volume 1 / 100 of the medium volume to allow integration of the TGT enzyme expression cassette into the genome. 24 hours after virus addition, puromycin was added to a concentration of 10 μg / ml for selection. HeLa cells that survived selection were used as TGT-expressing HeLa cells in subsequent experiments. TGT expression was determined using One Step TB Green® PrimeScript TM The results were confirmed by RT-qPCR using the PLUS RT-PCR Kit (Takara) and CFX Connect (BioRad) (Figure 13b). <Intracellular capping of circular RNA by TGT> 2.5 x 10 HeLa cells expressing TGT were cultured as described above. 4The cells were seeded at 392 μL / well in a 96-well plate (CELLSTAR uClear 96-well microplate TC, clear bottom, 34 mm², Greiner) and cultured for 24 hours in D-MEM (Fujifilm Wako Pure Chemical Industries, Ltd.) containing 10% FBS. Circular mRNA containing TGT-25 as a stem-loop (the recognition sequence for the TGT enzyme is underlined): (SEQ ID NO: 24) was transfected at 0.1 pmol / well, and PreQ1 was transfected at 0.05 pmol / well or 0.2 pmol / well using Lipofectamine Messenger Max and RNAi Max (ThermoFisher, Ltd.), respectively.Twenty-four hours after transfection, the cells were washed once with 100 μl of D-PBS (Nacalai Tesque), and the expression of nanoluciferase was assessed as luminescence intensity using the Nano-Glo® Luciferase Assay System (Promega). Addition of PreQ1 increased the translation yield by up to 1.3-fold (Figure 13c).

Claims

A capped polynucleotide comprising two or more translation units each comprising a 5' cap structure and a protein or peptide coding sequence located downstream thereof. The capped polynucleotide of claim 1, wherein at least one of the 5' cap structures is linked to a base within a stem loop in the polynucleotide. The capped polynucleotide of claim 2, wherein the base is PreQ1. The capped polynucleotide of any one of claims 1 to 3, which is circular. The capped polynucleotide of any one of claims 1 to 3, which is non-circular. A capped polynucleotide comprising one translation unit comprising a 5' cap structure and a protein or peptide coding sequence located downstream thereof, wherein the 5' cap structure is linked to a base within a stem loop in the polynucleotide. The capped polynucleotide of claim 6, which is circular. A compound in which a 5' cap structure is linked to PreQ1 directly or via a linker. The compound according to claim 8, wherein a 5' cap structure is linked to the amino group on the aminomethyl group of PreQ1 via a linker. A method for producing the capped polynucleotide of any one of claims 1 to 3, 6 and 7, comprising reacting a polynucleotide comprising a stem-loop containing guanine in the loop portion with the compound of claim 8 in the presence of tRNA-guanine transglycosylase. A pharmaceutical or reagent comprising at least one member selected from the group consisting of a capped polynucleotide according to any one of claims 1 to 3, 6 and 7, a polynucleotide comprising a stem-loop containing guanine in the loop portion, and the compound according to claim 8. The pharmaceutical or reagent described in claim 11, which contains at least one selected from the group consisting of a polynucleotide comprising a stem loop containing guanine in the loop portion and the compound described in claim 8, and is intended to be used so that the polynucleotide and the compound come into contact in vivo or in vitro. The pharmaceutical according to claim 11, wherein the capped polynucleotide according to any one of claims 1 to 3, 6 and 7 and a polynucleotide comprising a stem loop containing guanine in the loop portion are used in combination. The reagent according to claim 11, comprising at least one member selected from the group consisting of the capped polynucleotide according to any one of claims 1 to 3, 6 and 7, and a polynucleotide comprising a stem loop containing guanine in the loop portion. General form (4): wherein X independently in each occurrence represents an oxygen atom, a sulfur atom, or a selenium atom; L represents a linker; R a and R b are the same or different and represent a protecting group for a hydroxy group. c represents a protecting group for a hydrogen atom or an amino group. A compound represented by the formula: General form (5): [In the formula: R d represents a protecting group for a hydroxy group. e represents a protecting group for the amino group. f represents a protecting group for an amino group.] A carrier modified with a group represented by the formula:

Citation Information

Patent Citations

  • Capped RNA and method for producing same, apparatus for producing protein, and method for producing protein

    WO2023167276A1

  • Method for purifying nucleotides, device for purifying nucleotides, hydrophobic reagent, and hydrophobic substrate

    WO2023282245A1