Extracellular vesicles derived from hematopoietic stem cells or natural killer cells and use thereof

Abstract

The present invention relates to extracellular vesicles derived from hematopoietic stem cells (HSCs) or natural killer cells (NK cells) differentiated from induced pluripotent stem cells (iPSCs), a method for producing same, and use thereof. Exosomes derived from HSCs differentiated from iPSCs, according to the present invention, promote the growth of human vascular endothelial cells, and exhibited the effect of promoting wound healing in a wound healing assay performed in human fibroblast cell lines. It was also confirmed that exosomes derived from NK cells differentiated from iPSCs include specific miRNA. The exosomes not only exhibited anti-inflammatory activity in macrophages, but also inhibited the gene expression of fibrosis marker proteins (a-SMA, COL1A1) in hepatic stellate cells. Since the exosomes derived from HSCs or NK cells differentiated from iPSCs, according to the present invention, are obtained from single iPSCs, there is no inconvenience of collecting tissues or blood from donors. In addition, the exosomes have uniform properties and can be mass-produced. Therefore, the extracellular vesicles according to the present invention can be used to treat various diseases such as infectious diseases, fibrosis, cancer, neurological diseases, autoimmune diseases, and skin diseases.

Description

Extracellular vesicles derived from hematopoietic stem cells or natural killer cells and their uses

[0001] The present invention relates to extracellular vesicles derived from hematopoietic stem cells and / or natural killer cells differentiated from induced pluripotent stem cells, a method for producing the same, and a use thereof.

[0002] Extracellular vesicles (ESVs) are double-membrane lipid-bound substances secreted by cells. They contain various bioactive substances, including proteins, lipids, and genetic material. They are known to serve as mediators for various information exchanges between cells (Cell Commun Signal. 21:77 (2023)). Therefore, active research is being conducted not only on the components and functions of these ESVs, but also on the elucidation of disease pathogenesis and treatment based on these findings.

[0003] However, to extract these extracellular vesicles, the source cells for isolating them must be isolated from tissue or blood. However, isolating these source cells requires obtaining tissue or blood, and the separation and purification process is complex and time-consuming. Furthermore, the limited availability of these cells hinders the ability to obtain large quantities of extracellular vesicles. Furthermore, the limited availability of donors can lead to differences in the properties and therapeutic efficacy of the extracellular vesicles.

[0004] Therefore, there is an urgent need for a technology that can obtain active extracellular vesicles from stem cells without using donor tissue or blood.

[0005] Accordingly, the inventors of the present invention completed the present invention by differentiating a single induced pluripotent stem cell into a mesenchymal stem cell, a hematopoietic stem cell, or an NK cell, and then isolating exosomes from each of the cells to confirm the characteristics and activity of the exosomes.

[0006] To achieve the above purpose, one aspect of the present invention provides extracellular vesicles derived from hematopoietic stem cells (HSCs) or cells differentiated from hematopoietic stem cells.

[0007] Another aspect of the present invention provides a method for obtaining extracellular vesicles derived from hematopoietic stem cells differentiated from iPSCs, comprising the steps of: ii) seeding a single induced pluripotent stem cell (iPSC) population in a cell culture vessel and performing adherent culture to produce an iPSC colony; ii) differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population; iii) differentiating the mesodermal cell population into a hematopoietic stem cell population; and iv) obtaining extracellular vesicles from a culture medium of the hematopoietic stem cell population.

[0008] Another aspect of the present invention provides a method for obtaining extracellular vesicles derived from natural killer cells differentiated from iPSCs, comprising the steps of: i) seeding a single induced pluripotent stem cell (iPSC) population in a cell culture vessel and performing adherent culture to produce an iPSC colony; ii) differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population; iii) differentiating the mesodermal cell population into a hematopoietic stem cell population; iv) differentiating the hematopoietic stem cell population into a natural killer cell (NK cell) population; and v) obtaining extracellular vesicles from a culture medium of the natural killer cell population.

[0009] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating a disease comprising the extracellular vesicles as an active ingredient.

[0010] Another aspect of the present invention provides a cosmetic composition for improving skin condition comprising the extracellular vesicles as an active ingredient.

[0011] Another aspect of the present invention provides a use for preventing or treating a disease of the extracellular vesicles.

[0012] Another aspect of the present invention provides a method for preventing or treating a disease comprising administering the extracellular vesicles to a subject.

[0013] HSC-derived exosomes differentiated from iPSCs according to the present invention were confirmed to promote the growth of human vascular endothelial cells and to promote wound healing in a wound healing assay performed on a human fibroblast cell line. In addition, it was confirmed that NK cell-derived exosomes differentiated from iPSCs contain specific microRNAs. These exosomes not only exhibited anti-inflammatory activity in macrophages but also suppressed gene expression of fibrosis marker proteins (α-SMA, COL1A1) in hepatic stellate cells. Since the exosomes derived from HSCs or NK cells differentiated from iPSCs according to the present invention are obtained from a single iPSC, there is no need to collect tissue or blood from a donor. In addition, they have uniform properties and can be mass-produced. Therefore, the extracellular vesicles according to the present invention can be used to treat various diseases, including infectious diseases, fibrosis, cancer, neurological diseases, autoimmune diseases, and skin diseases.

[0014] Figure 1 is a drawing showing the activity and utilization method of the induced pluripotent stem cells (iPSCs) of the present invention and various cell-derived exosomes differentiated from iPSCs of the present invention.

[0015] Figures 2a to 2c and Figure 3 are graphs showing the results of comparing the expression levels of microRNAs expressed in iNK cell-derived exosomes and the expression levels of microRNAs in HEK293 cell-derived exosomes.

[0016] Figures 4a to 4c are diagrams showing four methods for mass culturing induced pluripotent stem cells (iPSCs).

[0017] Figure 5 is a graph and diagram showing the results of analyzing the size (A to D) and shape (E to H) of iPSC spheroids produced through the four methods of mass culture of iPSCs mentioned above.

[0018] Figure 6 is a drawing and graph showing the results of culturing iPSCs using a 2D culture method (A) or a 3D culture method (B), obtaining each exosome, and confirming the concentration of the exosome (C) and the expression of iPSC marker proteins (D).

[0019] Figure 7a is a diagram showing the results of confirming the expression of proteins specifically expressed in exosomes (Hsp70, TSG101) and proteins not expressed in exosomes (calnexin) in iPSC-derived exosomes using Western blot.

[0020] Figure 7b is a graph showing the results of FACS analysis confirming the expression of an exosome-specific protein (CD63) in iPSC-derived exosomes.

[0021] Figure 7c is a graph showing the results of analyzing the size and distribution of iPSC-derived exosomes using a nanoparticle tracking analyzer.

[0022] Figure 7d is a graph showing the results of confirming the anti-inflammatory activity of iPSC-derived exosomes in macrophages (THP-1 cells).

[0023] Figure 8a is a drawing and graph showing the results of confirming the shape of cells and the expression of MSC marker proteins through microscopic and FACS analysis, respectively, after differentiation of iPSCs into mesenchymal stem cells (MSCs).

[0024] Figure 8b is a graph showing the results of analyzing the size and distribution of exosomes derived from MSCs differentiated from iPSCs (hereinafter referred to as iMSCs) using a nanoparticle tracking analyzer.

[0025] Figure 8c is a graph showing the results of confirming the cell proliferation induction effect of MSC-derived exosomes differentiated from iPSCs in a human fibroblast cell line (BJ6 cells).

[0026] Figure 9a is a graph showing the results of analyzing the size and distribution of exosomes isolated from hematopoietic stem cells (HSCs) differentiated from iPSCs using a nanoparticle tracking analyzer.

[0027] Figures 9b and 9c are graphs showing the results of confirming the stability of exosomes by storing HSC-derived exosomes differentiated from iPSCs at 4°C (Figure 9b) or -80°C (Figure 9c), then thawing them and measuring the size of the exosomes by date.

[0028] Figure 10 is a graph showing the results of FACS analysis of the expression of CD59, NKG2D, and TRA-1-60 after differentiation into natural killer cells (NK cells) from iPSCs (hereinafter referred to as iNK or EiNK).

[0029] Figure 11 is a graph showing the results of FACS analysis confirming the expression of CD34 protein in iHSCs differentiated from iPSCs.

[0030] Figure 12 is a graph showing the results of confirming the cell proliferation promoting effect of exosomes derived from HSCs (iHSCs) differentiated from iPSCs in human vascular endothelial cell lines (HUVEC cells).

[0031] Figure 13 is a drawing and graph showing the results of confirming the wound healing promoting effect of HSC (iHSC)-derived exosomes differentiated from iPSCs using a human fibroblast cell line (BJ6 cells).

[0032] Figure 14a is a diagram showing the results of confirming the expression of proteins (Hsp70, TSG101) specifically expressed in exosomes and proteins (calnexin) not expressed in exosomes by isolating exosomes derived from iNK cells (or EiNK) differentiated from iPSCs, using Western blot.

[0033] Figure 14b is a graph showing the results of FACS analysis to confirm the expression of a protein (CD63) specifically expressed in exosomes derived from iNK cells (or EiNK) differentiated from iPSCs.

[0034] Figure 14c is a diagram showing the results of Western blot analysis of the expression of IFN-γ protein in iNK (or EiNK) differentiated from iPSCs, NK cells obtained from peripheral blood mononuclear cells (PBMCs) (PBNK), or exosomes derived from 293T cells.

[0035] Figure 14d is a graph showing the results of confirming the cell proliferation-inducing effect of EiNK (or iNK)-derived exosomes differentiated from iPSCs in a human fibroblast cell line (BJ6 cells). L: low concentration (25 ug), H: high concentration (50 ug).

[0036] Figure 15 is a graph showing the results of confirming the stability of exosomes by evaluating the anti-inflammatory activity of iNK (or EiNK)-derived exosomes differentiated from iPSCs after long-term storage and then thawing.

[0037] Figure 16 is a drawing and graph showing the results of confirming the shape (A) and expression of NK cell marker proteins (B) of iNK (or EiNK) differentiated from iPSCs through microscopic and FACS analysis, respectively.

[0038] Figure 17 is a diagram showing an experimental schedule for confirming the anti-inflammatory activity of iNK-derived exosomes differentiated from iPSCs using human monocytes (THP-1 cells).

[0039] Figure 18 is a diagram showing the results of observing cell morphology after treating human monocytes (THP-1 cells) with iNK-derived exosomes differentiated from iPSCs after LPS treatment. A: Serum-free medium, B: LPS treatment group, C: LPS + exosome treatment group.

[0040] Figure 19 is a graph showing the results of confirming cell viability (A) and gene expression of proinflammatory cytokines (TNF-α (B), IL-6 (C), IL-1β (D)) after treating human monocytes (THP-1 cells) with iNK-derived exosomes differentiated from iPSCs following LPS treatment.

[0041] Figure 20 is a graph showing the results of confirming NO production and cell viability after treating THP-1 macrophages with iNK-derived exosomes differentiated from iPSCs following LPS treatment.

[0042] Figure 21 is a diagram showing an experimental schedule for confirming the gene expression of TSLP after treating human keratinocyte cell lines (HaCaT cells) with iNK-derived exosomes differentiated from iPSCs following TNF-α / IL-4 treatment.

[0043] Figures 22a and 22b are drawings and graphs showing the results of examining cell morphology (Figure 22a) and TSLP gene expression (Figure 22b) after treating human keratinocyte cell lines (HaCaT cells) with iNK-derived exosomes differentiated from iPSCs following TNF-α / IL-4 treatment. Figure 22a A represents the control group (ctl), B represents the TNF-α / IL-4 treatment group, and C represents the EiNK exo treatment group.

[0044] Figure 23 is a graph showing the results of confirming the gene expression of fibrosis marker proteins (α-SMA, COL1A1) after treating human hepatic stellate cell line (LX-2 cells) with TGF-β1 or TGF-β1 and iNK-derived exosomes differentiated from iPSCs.

[0045] Figure 24 is a diagram showing the results of Western blot analysis of the expression of CD63, MHC-I, and MHC-II in iNK (or EiNK), PBNK, or 293T cell-derived exosomes and iNK lysates differentiated from iPSCs.

[0046] Figure 25 is a graph showing the results of measuring the concentration of intracellular COL1α1 in human fibroblast cell lines (BJ6 cells) after treatment with iPSC or iNK (or EiNK)-derived exosomes differentiated from iPSC alone or in combination.

[0047] Figure 26 is a graph showing the results of confirming the expression of TRA-1-60 in iPSCs through FACS analysis.

[0048] One aspect of the present invention provides extracellular vesicles derived from hematopoietic stem cells (HSCs) or cells differentiated from hematopoietic stem cells.

[0049] hematopoietic stem cells

[0050] The term "hematopoietic stem cell (HSC)" used herein may be used interchangeably with "hematopoietic progenitor cell", "hematopoietic stem cell" or "hematopoietic progenitor cell", and refers to a precursor cell capable of differentiating into a hematopoietic cell. That is, a hematopoietic stem cell (HSC) refers to a multipotent stem cell that produces all blood cell types, including myeloid (monocytes and macrophages), granulocytes (neutrophils, basophils, eosinophils and mast cells), erythrocytes, megakaryocytes / platelets, dendritic cells) and lymphoid (T cells, B cells, natural killer cells). The hematopoietic stem cell is a cell that expresses CD34, has self-renewal function, and exists in about 1% of the total bone marrow in adults, and also exists in small numbers in peripheral blood.

[0051] The hematopoietic stem cells of the present invention may be derived from any animal, including humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, and rabbits, and are preferably human-derived hematopoietic stem cells. The hematopoietic stem cells may be obtained from any source, such as bone marrow, peripheral blood, umbilical cord blood, etc., or may be cells differentiated from embryonic stem cells or induced pluripotent stem cells (iPSCs). Specifically, the hematopoietic stem cells may be differentiated from induced pluripotent stem cells.

[0052] The term "differentiation" used in the present invention refers to the phenomenon in which cells divide, proliferate, and become specialized in structure or function during the growth of the entire organism. In other words, it refers to the process by which cells, tissues, etc. of a living organism transform into forms and functions appropriate for their respective roles. In the present invention, the process by which induced pluripotent stem cells transform into specific cells and the expression of specific differentiation traits can all be included within the definition of differentiation.

[0053] More specifically, the hematopoietic stem cells may be induced to differentiate through the following steps.

[0054] First, it may include a step of seeding a single induced pluripotent stem cell (iPSC) or a population of iPSCs formed from a single induced pluripotent stem cell and producing an iPSC colony by adherent culture.

[0055] The term "stem cell" as used herein refers to a relatively undifferentiated cell that has not yet developed and has the ability to differentiate into specific tissue cells under suitable conditions. The stem cell can self-renew and produce daughter cells that maintain its undifferentiated characteristics, and at the same time, produce daughter cells that differentiate into specific cell types. Marker proteins of stem cells include Lgr5, Lrp4, Msi-1, Sca-1, SCF, SSEA-4, TRA-1-60, and TRA-1-81. The stem cells include embryonic stem cells, adult stem cells, and induced pluripotent stem cells.

[0056] As used herein, the term "induced pluripotent stem cells (iPSCs)" refers to cells that are generated by inducing dedifferentiation of non-pluripotent somatic cells to have pluripotency similar to embryonic stem cells. Induced pluripotent stem cells may also be called induced pluripotent stem cells. The induced pluripotent stem cells may be generated using somatic cells from a fetus, newborn, child, or adult. The induced pluripotent stem cells may be derived from fibroblasts, keratinocytes, blood cells, or renal epithelial cells. The induced pluripotent stem cells may be produced by reprogramming somatic cells. Methods for producing induced pluripotent stem cells by reprogramming somatic cells can utilize known methods, such as the method described in Takahashi K, Yamanaka S (2006), Cell. 126:663-676.

[0057] The above iPSC population may be an iPSC population formed by seeding and then culturing to become a single cell.

[0058] The iPSCs seeded to become the single cells can be cultured in a medium containing a ROCK inhibitor. The ROCK inhibitor can be selected from the group consisting of Y-27632, thiazovivin, fasudil, GSK429286A, RKI-1447, H-1152, and azaindole 1. The iPSCs can be cultured in a medium containing a ROCK inhibitor for about 10 minutes to about 1 week, about 30 minutes to about 6 days, about 1 hour to about 5 days, about 2 hours to about 4 days, about 3 hours to about 3 days, about 6 hours to about 2 days, about 12 hours to about 2 days, or about 18 hours to about 1 day.

[0059] The above iPSCs or iPSC populations can be cultured using an adherent culture method. Single iPSC cells can be cultured for about 1 day to about 2 weeks, about 2 days to about 13 days, about 3 days to about 12 days, about 4 days to about 11 days, about 5 days to about 10 days, about 6 days to about 9 days, or about 7 days to about 8 days after attachment to a cell culture vessel.

[0060] The above iPSC colony may be a mass of cells grown by attaching and culturing a single iPSC cell or an iPSC population formed from a single iPSC cell. The iPSC colony may be cells having the same genetic information.

[0061] At this time, the iPSC colony may be a cell population in which TRA-1-60 is expressed by at least about 90% or more. Specifically, the iPSC colony may be a cell population in which TRA-1-60 is expressed by at least about 90% or more, at least about 91% or more, at least about 92% or more, at least about 93% or more, at least about 94% or more, at least about 95% or more, or at least about 96% or more.

[0062] Additionally, the iPSC colony may be a cell population in which CD34 is expressed by at least about 20% or less. Specifically, the iPSC colony may be a cell population in which CD34 is expressed by at least about 20% or less, at least about 19% or less, at least about 18% or less, at least about 17% or less, at least about 16% or less, at least about 15% or less, at least about 14% or less, at least about 13% or less, at least about 12% or less, at least about 11% or less, or at least about 10% or less.

[0063] Second, it may include a step of differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population.

[0064] As used herein, the term "mesodermal cell" refers to a layered cell population that exists between the ectoderm and endoderm during gastrulation, and is found in flatworms and other mammals. Mesodermal cells can differentiate into muscle, bone, cartilage, fat, and other connective tissues, including blood cells, vascular endothelial cells, smooth muscle, and cardiac muscle.

[0065] The above iPSC colonies can be cultured in a medium capable of culturing stem cells. At this time, the medium can contain one or more selected from the group consisting of a glycogen synthase kinase-3 (GSK3) inhibitor, an activin-like receptor kinase 5 (ALK5) inhibitor, a bone morphogenetic protein 4 (BMP4), a stem cell factor (SCF), and a vascular endothelial growth factor (VEGF). The GSK3 inhibitor can be selected from the group consisting of CHIR-99021, SB216763, AT7519, CHIR-98014, TWS119, tideglusib, SB415286, and BIO (6-bromoindirubin-3-oxime, 6-bromoindirubin-3'-oxime). The above ALK5 inhibitor may be selected from the group consisting of SB431542, galunisertib, LY2109761, SB525334, SB505124, GW788388, and LY364947. The iPSC colonies may be cultured in a medium containing CHIR-99021 and BMP4, and then cultured in a medium containing SB431542 and VEGF. The iPSC colonies may be cultured in a medium containing CHIR-99021, SB431542, BMP4, and VEGF.

[0066] The iPSC colonies can be cultured in the medium for about 1 hour to about 2 weeks, about 12 hours to about 2 weeks, about 1 day to about 2 weeks, about 2 days to about 13 days, about 3 days to about 12 days, about 4 days to about 11 days, about 5 days to about 10 days, about 6 days to about 9 days, or about 7 days to about 8 days. Preferably, the iPSC colonies can be cultured for about 2 days to about 4 days, but the present invention is not limited thereto.

[0067] The above mesodermal cells may be mesodermal stem cells.

[0068] At this time, the mesodermal cell population may be one that expresses any one selected from the group consisting of CD90, CD73, CD105, and combinations thereof. At this time, the CD90, CD73, and CD105 may be a cell population that expresses at least about 95% or more, at least about 96% or more, at least about 97% or more, at least about 98% or more, or at least about 99% or more, respectively.

[0069] Additionally, the mesodermal cell population may be cells that do not express TRA-1-81.

[0070] The above "CD90 (cluster of differentiation 90)", also known as Thy-1, is a marker protein for the axonal processes of stem cells and mature neurons. The above "CD73" is also known as ecto-5'-nucleotidase. The above "CD105" is a cell surface protein also known as endoglin. In the present invention, the CD90, CD73, and CD105 can be used as marker proteins for mesenchymal stem cells, and the above TRA-1-81 can be used as a marker protein for induced pluripotent stem cells.

[0071] Third, it may include a step of producing a hematopoietic stem cell population by differentiating the mesodermal cells into hematopoietic stem cells.

[0072] At this time, the mesodermal cells can be cultured in a medium containing SCF (stem cell factor), Flt3L (FMS-like tyrosine kinase 3 ligand) or a combination thereof. The mesodermal cells can be cultured for about 1 day to about 2 weeks, about 2 days to about 13 days, about 3 days to about 12 days, about 4 days to about 11 days, about 5 days to about 10 days, about 6 days to about 9 days, or about 7 days to about 8 days. Preferably, the culture can be performed for about 2 days to about 8 days, but is not limited thereto.

[0073] The cell population differentiated into hematopoietic stem cells from the above mesodermal cells may be a cell population in which CD34 is expressed by at least about 90% or more. The cell population differentiated into hematopoietic stem cells may be a cell population in which CD34 is expressed by at least about 90% or more, at least about 91% or more, at least about 92% or more, at least about 93% or more, at least about 94% or more, at least about 95% or more, at least about 96% or more, at least about 97% or more, or at least about 98% or more.

[0074] The above-mentioned iPSC differentiation into hematopoietic stem cells can be performed in vitro. The above-mentioned induced pluripotent stem cell differentiation into hematopoietic stem cells can be performed by culturing for about 22 days. Specifically, the above-mentioned iPSC differentiation into natural killer cells can be performed by culturing for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, or 22 days.

[0075] natural killer cells

[0076] In the present invention, the cells differentiated from the hematopoietic stem cells may include blood cells of the myeloid lineage (monocytes and macrophages), granulocytes (neutrophils, basophils, eosinophils, and mast cells), erythrocytes, megakaryocytes / platelets, dendritic cells), or lymphoid lineage (T cells, B cells, natural killer cells). Specifically, the cells differentiated from the hematopoietic stem cells may be natural killer cells.

[0077] As used herein, the term "natural killer (NK) cell" refers to a lymphocyte that accounts for approximately 15% of peripheral blood lymphocytes and plays a crucial role in the innate immune response. NK cells activate dendritic cells and induce cytotoxic T lymphocytes (CTLs) to specifically respond to tumors, thereby eliminating tumor cells. Natural killer cells directly kill malignant tumors such as sarcoma, myeloma, carcinoma, lymphoma, and leukemia. Most NK cells present in the body of a normal person are in an inactive state and are activated in response to interferon or macrophage-derived cytokines. NK cells can be generated from hematopoietic cells, such as hematopoietic stem or progenitor cells, placental or umbilical cord-derived stem cells, induced pluripotent stem cells, or cells differentiated therefrom, from any source, such as placental tissue, placental perfusate, umbilical cord blood, placental blood, peripheral blood, bone marrow, spleen, liver, etc.

[0078] In the present invention, the natural killer cells may be natural killer cells differentiated from hematopoietic stem cells differentiated from induced pluripotent stem cells. More specifically, the natural killer cells may be natural killer cells differentiated from induced pluripotent stem cells. The induced pluripotent stem cells and hematopoietic cells are the same as those described above.

[0079] Specifically, the natural killer cells may be cells obtained by additionally performing the following steps on hematopoietic stem cells differentiated from the induced pluripotent stem cells.

[0080] Fourth, it may be obtained by differentiating a hematopoietic stem cell population differentiated from the above-mentioned induced pluripotent stem cell into a natural killer cell population.

[0081] At this time, the hematopoietic stem cells differentiated from the induced pluripotent stem cells are the same as described above. The hematopoietic stem cells can be cultured in a medium containing SCF, Flt-3L, or a combination thereof to be induced to differentiate into natural killer cells. The hematopoietic stem cells can be cultured in the medium for about 1 hour to about 2 weeks, about 12 hours to about 2 weeks, about 1 day to about 2 weeks, about 2 days to about 13 days, about 3 days to about 12 days, about 4 days to about 11 days, about 5 days to about 10 days, about 6 days to about 9 days, or about 7 days to about 8 days. Preferably, the culture can be performed for about 2 days to about 4 days, but is not limited thereto.

[0082] The natural killer cell population may be a cell population in which at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, or at least about 88% expresses CD45. In addition, the cell population may be a cell population in which at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, or at least about 88% expresses CD34.

[0083] At this time, differentiation of hematopoietic stem cells into natural killer cells can be performed in vitro. The differentiation of hematopoietic stem cells into natural killer cells can be performed by culturing for about 8 days. Specifically, the differentiation of hematopoietic stem cells into natural killer cells can be performed by culturing for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or 8 days.

[0084] Therefore, differentiation from iPSCs into natural killer cells can be performed by culturing for about 30 days. Specifically, differentiation from the iPSCs into natural killer cells can be performed by culturing for 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, or 30 days.

[0085] Additionally, in the present invention, the natural stem cell population derived from hematopoietic stem cells can be additionally co-cultured with autologous support cells.

[0086] As used herein, the term "feeder cell" refers to a cell that is co-cultured with a second type of cell and provides growth factors and nutrients to the second type of cell so that the second type of cell can grow. The feeder cell may be derived from a species that is homologous or heterologous to the cell it is supporting. For example, certain types of human cells, including stem cells, can be supported by cultures of mouse embryonic fibroblasts and non-apoptotic mouse embryonic fibroblasts. The feeder cell may be a human-derived feeder cell, such as human dermal fibroblasts or human embryonic stem cells. In this case, the feeder cell may be inactivated by treatment with an anti-mitogenic agent such as irradiation or mitomycin. Through this inactivation, when co-cultured with the second type of cell, the feeder cell can regulate the differentiation and growth of the second type of cell by producing and secreting cellular metabolites in a state of arrested cell division.

[0087] The above-described co-cultured natural killer cell population may express any one natural killer cell marker protein selected from the group consisting of CD56, NKG2D, and combinations thereof. Additionally, the above-described natural killer cell population may have little expression of TRA-1-60.

[0088] Specifically, the natural killer cell population may express CD56 at least about 90% or more, at least about 91% or more, at least about 92% or more, at least about 93% or more, at least about 94% or more, at least about 95% or more, at least about 96% or more, at least about 97% or more, or at least 98% or more.

[0089] The natural killer cell population may express NKG2D by at least about 70% or more, at least about 75% or more, at least about 80% or more, at least about 81% or more, at least about 82% or more, at least about 83% or more, at least 84% or more, at least 85% or more, at least 86% or more, at least 87% or more, at least 88% or more, or at least about 89% or more.

[0090] The above "CD56" is also known as neural cell adhesion molecule (NCAM) and is a protein expressed on the surface of neurons, glia, and skeletal muscles. In hematopoietic cells, it is mainly expressed on natural killer cells, and is also known to be expressed on gamma delta (γδ) T cells, activated CD8+ T cells, and dendritic cells.

[0091] The above "NKG2D" is a protein mainly expressed in activated cytotoxic immune cells. It is known to be mainly expressed in NK cells, γδT cells, and CD8+αβT cells.

[0092] Additionally, the co-cultured natural killer cell population may express TRA-1-60 at least about 2% or less, at least about 1% or less, at least about 0.9% or less, at least about 0.8% or less, at least about 0.7% or less, at least about 0.6% or less, at least about 0.5% or less, at least about 0.4% or less, at least about 0.3% or less, at least about 0.2% or less, or at least about 0.1% or less.

[0093] In one specific example, the natural killer cell population may be one in which CD56 is expressed by at least about 90% or more and NKG2D is expressed by at least about 70% or more. In one specific example, the natural killer cell population may be one in which CD56 is expressed by at least about 90% or more and TRA-1-60 is expressed by at least about 2% or less.

[0094] extracellular vesicles

[0095] The term "extracellular vesicle" used herein refers to a nano-sized vesicle derived from a cell, and is classified into exosomes, microvesicles, ectosomes, microparticles, membrane vesicles, nanovesicles, outer membrane vesicles, etc. depending on the secretion form and size. The extracellular vesicles are particle-shaped structures in which various biomolecules such as growth factors, chemokines, cytokines, transcription factors, RNAs (mRNA, miRNA, etc.), and lipids are encapsulated in the cell membrane of the same lipid bilayer as the cell membrane of the cell from which they are derived. Therefore, the extracellular vesicles enable the exchange of materials between cells by mediating the transport of proteins, lipids, genetic materials, etc., and act as mediators that transmit physiological / pathological signals.

[0096] In the present invention, the extracellular vesicles serve as a means of transmitting information between cells and may include any vesicle having a composition similar to that of extracellular vesicles (e.g., exosomes, microvesicles, multivesicles, extracellular vesicle-like vesicles). Specifically, the extracellular vesicles may be exosomes or microvesicles.

[0097] The above exosome has an average particle size of about 40 nm to about 150 nm, and is an intraluminal vesicle created when the endosomal membrane is inwardly inward during the maturation of a multi-vesicular endosome, and is secreted when the multi-vesicular endosome binds to the cell surface. Known marker proteins of the exosome include CD63, CD9, TSG101, Hps70, and ESCRT.

[0098] The above "microvesicle" is a type of membrane-structured extracellular vesicle secreted into the extracellular space. Microvesicles have an average particle size of about 100 nm to about 1000 nm, and are vesicles that are separated by the plasma membrane protruding outward and secreted outside of the cell. Known markers of the microvesicles include integrin-β, CD40, and selectin.

[0099] In the present invention, the extracellular vesicles may have an average particle diameter of about 5 nm to about 2000 nm. Specifically, the extracellular vesicles may have an average particle diameter of about 5 nm to about 2000 nm, about 10 nm to about 1800 nm, about 20 nm to about 1500 nm, about 30 nm to about 1000 nm, or about 40 nm to about 700 nm.

[0100] As used herein, the term "cell derived extracellular vesicle" means an extracellular vesicle isolated from a culture medium of a cell from which the extracellular vesicle originates, such as an induced pluripotent stem cell or a cell differentiated from an induced pluripotent stem cell, or a source cell or cell line.

[0101] Specifically, in the present invention, the extracellular vesicles may be extracellular vesicles derived from hematopoietic stem cells. More specifically, the extracellular vesicles may be extracellular vesicles derived from hematopoietic stem cells differentiated from induced pluripotent stem cells.

[0102] In the present invention, the extracellular vesicles may be extracellular vesicles derived from natural killer cells. More specifically, the extracellular vesicles are extracellular vesicles obtained after differentiating hematopoietic stem cells differentiated from induced pluripotent stem cells into natural killer cells. Therefore, the extracellular vesicles may be obtained from natural killer cells differentiated from induced pluripotent stem cells.

[0103] The above natural killer cell-derived extracellular vesicles may express IFNγ and MHC-II. Additionally, the above extracellular vesicles may not express MHC-I.

[0104] The above "interferon-gamma (IFN-γ)" is a cytokine produced by activated T cells, NK cells, and CD4- and CD8-positive lymphocytes. As a mitogen or growth factor, interferon-gamma is involved in the activation, proliferation, and differentiation of various cells, including T lymphocytes, and in enhancing MHC expression on antigen-presenting cells, playing a crucial role in immune and inflammatory responses. Interferon-gamma is also clinically used to treat infections and autoimmunity.

[0105] The above "major histocompatibility complex (MHC)" is a protein that presents antigen fragments to immune cells so that they can distinguish between self and non-self molecules. There are two types: MHC-I and MHC-II. MHC-I is found in all cells with a nucleus, while MHC-II is found in antigen-presenting cells.

[0106] In addition, the natural killer cell-derived extracellular vesicles may have increased expression of any one miRNA selected from the group consisting of miR-223, miR-142, miR-10a, miR-146a, miR-23a, miR-155, miR-181a, miR-215, miR-122, let-7, miR-129, miR-147, miR-24, miR-139, miR-16, miR-197, miR-195, miR-29, miR-152, miR-107, miR-140, miR-15, miR-124 and combinations thereof compared to the kidney-derived extracellular vesicles. In one embodiment, the kidney-derived cells may be HEK293 cells.

[0107] As used herein, the term "microRNA (miRNA)" is a small non-expressed RNA molecule consisting of approximately 22 nucleotides found in plants, animals, viruses, etc., which functions in RNA silencing and post-transcriptional gene expression regulation.

[0108] Specifically, the expression of miR-223, miR-142 or miR-10a in the extracellular vesicles derived from natural killer cells may be about 100 times or more, about 200 times or more, about 300 times or more, about 400 times or more, about 500 times or more, about 3000 times or less, about 2500 times or less, about 2000 times or less, about 1000 times or less, about 500 times or less, about 100 times or more and about 3000 times or less, or about 300 times or more and about 2500 times or less compared to the extracellular vesicles derived from kidney cells. The above miR-146a, miR-107, miR-140, miR-15 or miR-124 may be expressed at about 50 times or more, about 60 times or more, about 70 times or more, about 80 times or more, about 90 times or more, about 100 times or more, about 150 times or more, about 200 times or more, about 250 times or more, about 300 times or more, about 500 times or less, about 400 times or less, about 50 times or more and about 500 times or less, or about 50 times or more and about 400 times or less. The above miR-23a, miR-155, miR-181a, miR-215, miR-122, let-7, miR-129, miR-147, miR-24, miR-139, miR-16, miR-197, miR-195, miR-29 or miR-152 may be expressed at about 1.1 times or more, about 2 times or more, about 3 times or more, about 4 times or more, about 5 times or more, about 6 times or more, about 7 times or more, about 7 times or more, about 8 times or more, about 10 times or more, about 50 times or less, about 40 times or less, about 30 times or less, about 1.1 times or more and about 50 times or less, or about 2 times or more and about 40 times or less.

[0109] Additionally, in one embodiment, the extracellular vesicles may be isolated from a culture of induced pluripotent stem cells or mesenchymal stem cells differentiated from induced pluripotent stem cells. In one embodiment, the extracellular vesicles may be isolated from a culture of the HEK293 cell line. In one embodiment, the extracellular vesicles may be obtained from a culture of natural killer cells obtained from peripheral blood.

[0110] The extracellular vesicles may be obtained directly from the culture medium of the cells. Alternatively, the extracellular vesicles may be obtained from the culture medium of the cells and then preserved by refrigeration, freezing, or lyophilization.

[0111] As used herein, the term "freezing" refers to the phenomenon in which moisture within an object freezes to form ice crystals when the temperature of the object is below 0°C, and may be used interchangeably with the term "freezing." Furthermore, the term "lyophilization" refers to a method of obtaining a dried product by freezing an aqueous solution or a material containing a large amount of moisture and then removing the moisture by sublimating the ice through depressurization.

[0112] At this time, the extracellular vesicles can be suspended in PBS or physiological saline and stored in a refrigerator.

[0113] When the extracellular vesicles are preserved by freezing or lyophilization, the extracellular vesicles may be preserved or lyophilized after being mixed with a cryopreservative and frozen.

[0114] The term "cryopreservative" as used herein means an agent that inhibits or blocks adverse effects, such as damage to the structure or tissue of cells, decreased viability of microorganisms, and decreased activity of foods and pharmaceuticals, resulting from freezing or freeze-drying, which are widely used as methods for preserving and storing samples containing moisture, such as cells or tissues of plants or animals, microorganisms, foods, and pharmaceuticals.

[0115] The cryopreservative may include any one sugar selected from the group consisting of sucrose, trehalose, and mannitol; and maltose. The cryopreservative may be used in the form of an aqueous solution containing any one sugar selected from the group consisting of sucrose, trehalose, and mannitol; and maltose.

[0116] In addition, the freeze-dried extracellular vesicles can be recovered and used after thawing.

[0117] The term "repair" as used herein refers to restoring lyophilized extracellular vesicles to their original state, and can be accomplished by adding an aqueous solution to the lyophilized extracellular vesicles. The aqueous solution may be, but is not limited to, physiological saline, a phosphate buffer solution, purified water, water for injection, or deionized water.

[0118] Manufacturing method

[0119] Another aspect of the present invention provides a method for producing extracellular vesicles derived from hematopoietic stem cells differentiated from induced pluripotent stem cells or natural killer cells differentiated from said hematopoietic stem cells. The induced pluripotent stem cells, hematopoietic stem cells, natural killer cells, differentiation, and extracellular vesicles are the same as described above.

[0120] Differentiation of the above induced pluripotent stem cells into hematopoietic stem cells involves the following steps:

[0121] i) A step of inoculating a population of induced pluripotent stem cells (iPSCs) into a cell culture vessel and producing an iPSC colony from a single induced pluripotent stem cell by adherent culture;

[0122] ii) a step of differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population; and

[0123] iii) A step of differentiating the above mesodermal cell population into a hematopoietic stem cell population.

[0124] Differentiation into natural killer cells differentiated from the above hematopoietic stem cells may additionally include the following steps:

[0125] iv) A step of differentiating the above hematopoietic stem cell population into a natural killer cell population.

[0126] Extracellular vesicles derived from hematopoietic stem cells differentiated from the above-mentioned induced pluripotent stem cells or natural killer cells differentiated from the above-mentioned hematopoietic stem cells can be prepared by obtaining them from a culture medium of the differentiated hematopoietic stem cell population or natural killer cell population.

[0127] The above mesodermal cells are the same as described above.

[0128] In the present invention, various methods known in the art, such as ultracentrifugation, ultrafiltration, and SEC (size exclusion chromatography), can be used to obtain extracellular vesicles from the culture medium of the hematopoietic stem cells or natural killer cells. In one specific example, exosomes can be separated from the culture medium using a commercially available exosome separation reagent (e.g., ExoQuick-TCTM) or a tangential flow filtration (TFF) method, but are not limited thereto.

[0129] The above method for producing extracellular vesicles may further include a step of preserving the obtained extracellular vesicles. In this case, the extracellular vesicles may be preserved by refrigeration, freezing, or lyophilization.

[0130] When the extracellular vesicles are stored in a refrigerator, the extracellular vesicles can be stored in a refrigerator by mixing them with PBS or physiological saline.

[0131] When cryopreserving the above-mentioned extracellular vesicles, the extracellular vesicles can be preserved in the freezer by mixing them with a cryopreservative. When preserving the above-mentioned extracellular vesicles by lyophilization, the extracellular vesicles can be preserved by mixing them with a cryopreservative, freezing them, and then lyophilizing them. At this time, the lyophilized exosomes can be preserved at room temperature, refrigerated, or frozen.

[0132] The frozen or lyophilized extracellular vesicles described above can be thawed and used. In addition, the lyophilized extracellular vesicles can be subjected to an additional step of recovery after thawing.

[0133] Pharmaceutical composition

[0134] Another aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of a disease, comprising the extracellular vesicles as an active ingredient. The extracellular vesicles may be derived from hematopoietic stem cells or natural killer cells differentiated from induced pluripotent stem cells. The induced pluripotent stem cells, hematopoietic stem cells, natural killer cells, and extracellular vesicles are the same as those described above.

[0135] The pharmaceutical composition of the present invention can be used for the prevention or treatment of any one disease selected from the group consisting of infectious diseases, fibrosis, cancer, nervous system diseases, autoimmune diseases, and skin diseases.

[0136] The above infectious diseases may be infectious diseases caused by hepatitis B, hepatitis C, human papilloma virus (HPV) infection, cytomegalovirus infection, viral respiratory disease, and influenza.

[0137] As used herein, the term "fibrosis" refers to the formation of excessive fibrous connective tissue in an organ or tissue. This can be distinguished from fibrous tissue as a normal component of an organ or tissue. Fibrosis can be understood as a fatal disease that continuously causes loss of human tissue function due to stiffening of organ tissues due to excessive accumulation of extracellular matrices such as fibronectin and collagen by fibroblasts. Specifically, the fibrosis may be any one selected from the group consisting of liver fibrosis, pulmonary fibrosis, skin fibrosis, joint fibrosis, nerve fibrosis, pancreatic fibrosis, muscle fibrosis, and peritoneal fibrosis, but is not limited thereto.

[0138] The above cancers may be liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, colon cancer, cervical cancer, thyroid cancer, laryngeal cancer, leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, lymphoma, etc.

[0139] The above "neurological disease" may be a neurological disease caused by nerve damage or abnormal nerves, or a degenerative brain disease. Here, the nerve damage may be neuropraxia, axonal damage (axonotmesis), or nerve transection (neurotmesis).

[0140] The above-mentioned nervous system disease caused by nerve damage or abnormal nerves may be a nervous system disease caused by nerve damage or abnormal nerves in the central nervous system, or a nervous system disease caused by nerve damage or abnormal nerves in the peripheral nervous system.

[0141] The above-mentioned central nervous system nerve damage or nervous system disease caused by abnormal nerves may be an organic disease and dysfunction of the central nervous system, epilepsy, multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's, Lewy body dementia, Huntington's disease, Parkinson's disease, schizophrenia, traumatic brain injury, stroke, Pick's disease, Creutzfeldt-Jakob disease, progressive supranuclear palsy, multiple system atrophy, corticobasal degeneration, spinocerebellar degeneration, cerebellar atrophy, post-traumatic stress disorder, amnesia, vascular dementia, cerebral infarction, etc.

[0142] The above peripheral nervous system nerve damage or nervous system disease caused by abnormal nerves may be peripheral neuropathy, diabetic neuropathy, peripheral neuropathic pain, peripheral neuropathy due to chemotherapy, complex regional pain syndrome, optic neuropathy, mononeuropathy, mononeuropathy multiplex (mononeuritis multiplex), polyneuropathy, Guillain-Barré syndrome (acute inflammatory demyelinating polyneuropathy), chronic inflammatory demyelinating polyneuropathy, hereditary neuropathies, plexus disorders, glaucoma, macular degeneration, amyotrophic lateral sclerosis, progressive muscular atrophy, progressive bulbar palsy, polio, post-polio syndrome, spastic-person syndrome, Isaacs syndrome, myasthenia gravis, neonatal myasthenia, botulism, Eaton-Lambert syndrome, thoracic outlet syndrome, Charcot-Marie-Tooth disease, spinal muscular atrophy, etc.

[0143] The above "degenerative brain disease" refers to a disease that occurs in the brain among degenerative diseases that occur with age, and may include all diseases caused by death of brain nerve cells, problems in the formation or function of synapses that transmit information between brain nerve cells, or abnormal increase or decrease in the electrical activity of brain nerves.

[0144] The above degenerative brain diseases may include, but are not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, mild cognitive impairment, cerebral amyloid angiopathy, Down syndrome, amyloid stroke, systemic amyloid disease, Dutch amyloidosis, Niemann-Pick disease, senile dementia, amyotrophic lateral sclerosis, spinocerebellar atrophy, Tourette's syndrome, Friedrich's ataxia, Machado-Joseph's disease, Lewy body dementia, dystonia, progressive supranuclear palsy, frontotemporal dementia, etc.

[0145] The term "autoimmune disease" as used herein refers to a general term for diseases caused by an antigen-antibody reaction due to antibodies produced against one's own biological substances or body tissues. The autoimmune diseases may include, but are not limited to, Crohn's disease, erythema multiforme, atopy, rheumatoid arthritis, Hashimoto's thyroiditis, pernicious anemia, Addison's disease, type 1 diabetes, lupus, chronic fatigue syndrome, fibromyalgia, hypothyroidism and hyperthyroidism, scleroderma, Behcet's disease, inflammatory bowel disease, multiple sclerosis, myasthenia gravis, Meniere's syndrome, Guillian-Barré syndrome, Sjogren's syndrome, vitiligo, endometriosis, psoriasis, vitiligo, systemic scleroderma, asthma, ulcerative colitis, etc.

[0146] The above skin disease may be any one selected from the group consisting of, but not limited to, inflammatory skin disease, wounds, skin wrinkles, skin aging, loss of skin elasticity, dry skin, sensitive skin, skin pigmentation, skin irritation, skin regeneration, wound or wound healing, and combinations thereof.

[0147] The above inflammatory skin disease may be one or more selected from the group consisting of atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, papular urticaria, alopecia, erythema nodosum, erythema multiforme, keratosis pilaris, eczema, irritant contact dermatitis, allergic contact dermatitis, and autosensitization dermatitis.

[0148] The term "prevention" used herein can comprehensively mean preventing a disease in advance or reducing the likelihood or frequency of occurrence by administering the pharmaceutical composition in a pharmaceutically effective amount. For example, it can mean reducing the probability of occurrence or the probability of recurrence in a patient who is likely to develop a disease or a patient who has previously developed the disease. The "pharmaceutically effective amount" has the same meaning as "therapeutically effective amount," and can be easily determined by those skilled in the art based on factors well known in the academic field, such as the type of disease, the patient's age, weight, health, sex, the patient's sensitivity to drugs, administration route, administration method, number of administrations, treatment period, combination, or concurrently used drugs.

[0149] The term "treatment" used herein may comprehensively mean improving a disease by administering the pharmaceutical composition in a pharmaceutically effective amount, may provide relief or cure of the symptoms of the disease in a shorter period of time compared to natural healing, and may improve one or most of the symptoms caused by the disease. The pharmaceutically effective amount is the same as described above. The pharmaceutical composition of the present invention may be a composition for treating a disease on its own, or may be administered together with other pharmacological ingredients and applied as a therapeutic adjuvant for the disease. Accordingly, the term "treatment" includes the meaning of "treatment adjuvant."

[0150] In the above pharmaceutical composition, the active ingredient may be included in any amount (effective amount) depending on the intended use, formulation, mixing purpose, etc., as long as it can exhibit activity. The pharmaceutical composition of the present invention may include the extracellular vesicles as an active ingredient in an amount of about 1 ug to about 1000 ug, about 5 ug to about 800 ug, about 10 ug to about 600 ug, about 20 ug to about 400 ug, or about 40 ug to about 300 ug. Here, "effective amount" means the amount of the active ingredient that can induce a disease prevention or treatment effect. Such an effective amount can be experimentally determined within the ordinary ability of a person skilled in the art.

[0151] Meanwhile, the pharmaceutical composition of the present invention is administered in a "therapeutically effective amount." The therapeutically effective amount is the same as described above.

[0152] As used herein, the term "administration" means introducing a given substance into an individual in an appropriate manner, and the route of administration of the composition may be administered through any common route as long as it can reach the target tissue. It may be intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, topical administration, intranasal administration, intrapulmonary administration, and rectal administration, but is not limited thereto. In addition, it may be subcutaneous administration or transdermal administration. The pharmaceutical composition of one embodiment of the present invention may be administered by any device that allows the active substance to travel to the target tissue or cell. In addition, the pharmaceutical composition may be directly applied to the skin. When applying the pharmaceutical composition to the skin, it may include directly applying the pharmaceutical composition according to the present invention to the skin or spraying it, depending on its form.

[0153] Here, the subject to which the pharmaceutical composition can be administered may be a mammal, and specifically, a human.

[0154] The appropriate dosage of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, administration method, patient age, body weight, sex, pathological condition, diet, administration time, administration route, excretion rate, and response sensitivity. The dosage of the pharmaceutical composition according to the present invention may be administered in one to several divided doses at a dose of about 0.001 mg / kg to about 100 mg / kg for adults. Such dosage should not be construed as limiting the scope of the present invention in any way.

[0155] The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" herein means that the carrier does not inhibit the activity of the active ingredient and does not exhibit toxicity beyond what the subject of application (prescription) can tolerate. The carrier may be present in an amount of about 0.01 wt% to about 99.99 wt%, preferably about 90 wt% to about 99.99 wt%, based on the total weight of the pharmaceutical composition of the present invention.

[0156] The pharmaceutically acceptable carrier may be any non-toxic material suitable for delivery to a patient. Examples of such carriers include distilled water, alcohol, fats, waxes, and inert solids. Pharmaceutically acceptable adjuvants (buffers, dispersants) may also be included in the pharmaceutical composition, but are not limited thereto. Suitable pharmaceutically acceptable carriers and formulations are described in detail in "Remington's Pharmaceutical Sciences (19th ed., 1995)," which is incorporated herein by reference.

[0157] When the above pharmaceutical composition is prepared as a parenteral dosage form, it can be formulated in the form of injections, transdermal administration, nasal inhalants, and suppositories according to a method known in the art together with a suitable carrier. Preferably, the pharmaceutical composition of the present invention can be prepared as an injection. The injection may be an aqueous injection, a non-aqueous injection, an aqueous suspension injection, a non-aqueous suspension injection, or a solid injection that is dissolved or suspended, but is not limited thereto. Depending on the type of the injection, the injection may contain at least one of distilled water for injection, vegetable oil (e.g., peanut oil, sesame oil, camellia oil, etc.), monoglyceride, diglyceride, propylene glycol, camphor, estradiol benzoate, bismuth subsalicylate, sodium arsenobenzol, or streptomycin sulfate, and may optionally contain a stabilizer or preservative.

[0158] As a specific example, when the pharmaceutical composition of the present invention is used as a drug for preventing or treating skin diseases, the pharmaceutical composition may be prepared as a skin external preparation. At this time, the pharmaceutical composition may be formulated in the form of an ointment, a liquid, a cream, a spray, a patch, etc. At this time, as long as the effects of the present invention are not impaired, ingredients commonly used in cosmetics or skin external preparations, such as moisturizers, antioxidants, oily ingredients, ultraviolet absorbers, emulsifiers, surfactants, thickeners, alcohols, powdered ingredients, coloring agents, aqueous ingredients, water, various skin nutrients, etc., may be appropriately blended as needed.

[0159] As a specific example, when the pharmaceutical composition of the present invention is used as a drug for preventing or treating skin diseases, the pharmaceutical composition may also be prepared in the form of an injectable filler. For example, the pharmaceutical composition may include one or more carriers selected from the group consisting of alginic acid, carboxymethyl cellulose, chitosan, dextran, collagen, gelatin, pectin, agar, amylose, cyclodextrin, and elastin. When the injectable filler composition includes hyaluronic acid, the hyaluronic acid may have a cross-linked structure. Additionally, biodegradable polymer scaffolds may include, for example, hyaluronic acid, polyglycolic acid (PGA), polylactic acid (PLA), polylactic acid-glycolic acid copolymer (PLGA), poly-ε-caprolactone (PCL), polyamino acid, polyanhydride, polyorthoester, and copolymers thereof.

[0160] In addition, the filler injection according to the present invention may include a local anesthetic, an antihistamine, vitamins, etc. The local anesthetic may include, for example, lidocaine, etidocaine, bupivacaine, tetracaine, mepivacaine, procaine, prilocaine, ropivacaine, etc., but is not particularly limited as long as it is a local anesthetic for injection. The antihistamine may include, for example, piprinhydrinate, chlorpheniramine, diphenylpyraline (piprinhydrinate), diphenhydramine, cetirizine, etc., but is not particularly limited as long as it is an antihistamine for injection.

[0161] The pharmaceutical composition of the present invention may additionally contain or be used in combination with a known substance that exhibits a preventive or therapeutic effect against the disease, if necessary.

[0162] Another aspect of the present invention provides a method for preventing or treating a disease, comprising administering to a subject the extracellular vesicle or a pharmaceutical composition comprising the same as an active ingredient.

[0163] Another aspect of the present invention provides a use of the extracellular vesicles or a pharmaceutical composition comprising the same as an active ingredient for the prevention or treatment of a disease.

[0164] Here, the extracellular vesicles, pharmaceutical compositions, diseases, prevention and treatment are the same as described above.

[0165] The subject may be any animal, including rats, mice, and livestock, including humans, that has developed or may develop the disease. Preferably, the subject may be a human. The dosage may vary depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity. Those skilled in the art can appropriately adjust the dosage by taking these factors into consideration.

[0166] The pharmaceutical composition of the present invention may be used in combination with a known substance that exhibits a preventive or therapeutic effect against the disease, if necessary.

[0167] Cosmetic composition

[0168] Another aspect of the present invention provides a cosmetic composition for improving skin condition, comprising the extracellular vesicles as an active ingredient. The extracellular vesicles may be derived from hematopoietic stem cells or natural killer cells differentiated from induced pluripotent stem cells. The induced pluripotent stem cells, hematopoietic stem cells, natural killer cells, and extracellular vesicles are the same as those described above.

[0169] The above skin condition improvement may be any one selected from the group consisting of improvement in inflammatory skin disease, inhibition of wrinkles, inhibition of skin aging, improvement in skin elasticity, whitening, moisturizing, improvement in skin irritation, skin regeneration, wound healing, relief of skin irritation, and combinations thereof. Furthermore, the skin condition may be characterized by protecting the skin from deterioration or loss of skin cell function, improving the skin condition, or preventing or improving a skin disease. The inflammatory skin disease is the same as described above.

[0170] In the above cosmetic composition, the active ingredient may be included in any amount (effective amount) depending on the intended use, formulation, mixing purpose, etc., as long as it can exhibit activity. The cosmetic composition of the present invention may include the extracellular vesicles as an active ingredient in an amount of about 1 ug to about 1000 ug, about 5 ug to about 800 ug, about 10 ug to about 600 ug, about 20 ug to about 400 ug, or about 40 ug to about 300 ug. Here, "effective amount" means an amount of the active ingredient that can induce a skin condition improvement effect. Such an effective amount can be experimentally determined within the ordinary ability of a person skilled in the art.

[0171] The above cosmetic composition can be formulated into a cosmetic formulation commonly manufactured in the art. The cosmetic composition can be formulated into, for example, a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray, but is not limited thereto. More specifically, the cosmetic composition can be formulated into a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, cleansing water, a pack, a spray, or a powder. In addition, the cosmetic composition can be manufactured into a cosmetic filler.

[0172] Cosmetic fillers can be applied by applying them to the skin surface, and can include, for example, fragrances, xanthan gum, waxes, butters, oils, surfactants, moisturizers, alcohols, etc., and can include any of the components of a cosmetic composition that can be typically included without particular limitation. In addition, when the cosmetic filler composition includes hyaluronic acid, the hyaluronic acid can have a non-crosslinked structure.

[0173] When the formulation of the cosmetic composition according to the present invention is a paste, cream or gel, it may include a carrier component selected from the group consisting of animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide and mixtures thereof.

[0174] The formulation of the cosmetic composition according to the present invention may include a carrier component selected from the group consisting of a solvent, a solvating agent, an emulsifying agent, and mixtures thereof, which are solutions or emulsions. Examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol, sorbitan fatty acid esters, and mixtures thereof.

[0175] When the formulation of the cosmetic composition according to the present invention is a suspension, it may include a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, and a carrier component selected from the group consisting of microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth and mixtures thereof.

[0176] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and the scope of the present invention is not limited to these examples.

[0177] Example 1. Comparison of iPSCs according to iPSC mass culture methods

[0178] Example 1.1. Comparison of iPSC spheroid sizes according to iPSC mass culture methods.

[0179] In order to establish an optimal method for producing iPSC-derived iNK cells, the characteristics of iPSC spheroids according to the mass culture method of iPSCs were compared using the following four methods (Figs. 4a to 4c).

[0180] Method 1: iPSC spheroids were formed by culturing for 1 day using a 96-well plate, then transferred to a 24-well plate and cultured for 2 days. The iPSC spheroids were then transferred to a 6-well plate and cultured for 1 day, and then transferred to a Vertical-Wheel® Bioreactor and cultured for 8 days (12 days in total) (Fig. 4b, A).

[0181] Method 2: After culturing for 2 days using a 96-well plate to form spheroids, the spheroids were transferred to a 6-well plate and cultured for 1 day. Thereafter, the iPSC spheroids were transferred to a Vertical-Wheel® Bioreactor and cultured for 9 days (12 days in total) (Fig. 4B).

[0182] Method 3: Cells were seeded in a 6-well plate and cultured for 3 days, then transferred to a Vertical-Wheel® Bioreactor and cultured for more than 24 days (total 29 days) (C in Fig. 4c).

[0183] Method 4: Cells were seeded in a Vertical-Wheel® Bioreactor and cultured for 7 days. During the culture period, medium (3 mL) was obtained, and the size of spheroids in the medium was measured (Fig. 4c, d).

[0184] Each iPSC spheroid cultured using the above method was collected at each culture period and compared for size.

[0185] As a result, in the case of iPSC spheroids cultured using the culture method of Method 1 (A and E of Figure 5), the size of the spheroids cultured for 12 days was approximately 350 uM, but the size of the spheroids varied and the surface was uneven.

[0186] In the case of iPSC spheroids cultured using the culture method of Method 2 (B and F in Fig. 5), the size of the spheroids cultured for 12 days was approximately 400 uM, and the shape of the spheroids was confirmed to be consistent compared to the spheroids of Method 1.

[0187] In the case of iPSC spheroids cultured using the culture method of Method 3 (C and G of Fig. 5), spheroids were cultured for the longest period of time (total of 29 days), and the size of the cultured spheroids was approximately 500 to 600 uM. The spheroids were formed to have similar sizes, and it was confirmed that the surfaces were formed evenly (D and H of Fig. 5).

[0188] Example 1.2. Comparison of iPSC-derived exosome concentrations according to iPSC mass culture methods.

[0189] After culturing iPSCs using 2D or 3D culture methods, exosomes were obtained from each culture and their concentrations were compared. For 2D culture, iPSCs were seeded in T-300 flasks, and for 3D culture, iPSCs were seeded in a Vertical-Wheel® Bioreactor (Fig. 6, A and B). Exosomes derived from iPSCs cultured using the two methods were obtained, and the concentration of exosomes and iPSC marker proteins (SSEA4 and TRA-1-60) were confirmed. The expression of the marker proteins was confirmed using FACS analysis.

[0190] As a result, the concentration of exosomes obtained through the 2D culture method or the 3D culture method was 1×10 6The concentrations were 22.8 ug or 35.7 ug per cell, respectively. At this time, it was confirmed that iPSC cells cultured using the 2D or 3D culture methods were iPSCs expressing SSEA4 at 99.34%, respectively. In addition, more than 99% of 2D cultured iPSC cells expressed TRA-1-60. Through the above results, it was confirmed that more exosomes could be obtained per the same number of cells in the 3D culture method than in the 2D culture method (Figs. 6C and D, and Fig. 26).

[0191] Example 2. Evaluation of the characteristics and efficacy of iPSC-derived exosomes.

[0192] Example 2.1. Exosome separation using tangential flow filtration

[0193] iPSCs were seeded in a bioreactor at 5×10 per flask. 7 After inoculating with the cell number, the cells were cultured for 4 days. After 4 days, the medium was changed to fresh medium and cultured for an additional 3 days, and the entire culture was collected. After collecting the culture medium, it was centrifuged (3,000 rpm, 10 min) and filtered through a 0.22 um filter to remove impurities such as cell debris. The culture medium from which impurities were removed was used to isolate and concentrate exosomes using the tangential flow filtration (TFF) method.

[0194] Specifically, cartridge filters (Xampler ultrafiltration hollow fiber cartridges, Cyriva) with a molecular weight cutoff (MWCO) of 300,000 Da or 500,000 Da were used as filters for the TFF method. After selectively separating and concentrating exosomes by MWCO, particles smaller than MWCO or low-molecular-weight compounds were removed. At this time, the concentration was 10-fold with respect to the starting volume, and diafiltration was performed using sterile saline solution in a volume 10 to 15 times or more of the concentrated volume. The exosomes (iExo) isolated through the above process were stored at -80℃ until performing other experiments.

[0195] Example 2.2. Characterization of iPSC-derived exosomes

[0196] The characteristics of exosomes were confirmed for iPSC-derived exosomes obtained by the method of Example 2.1 above.

[0197] First, the expression of exosome marker proteins (Hsp70, TSG101, CD63) and cell lysate marker proteins (calnexin) was confirmed through Western blot or FACS analysis.

[0198] Western blot was performed using the following method. Briefly, the isolated exosomes were lysed using RIPA buffer to obtain a lysate. The exosome lysate was quantified using a BCA assay, and 15 μg of protein was subjected to SDS-PAGE. The proteins separated by electrophoresis were transferred to a PVDF membrane, and the membrane was blocked with 5% skim milk or 5% BSA. The membrane was treated with primary antibody and incubated overnight at 4°C, washed three times with TBST buffer, and incubated with secondary antibody for 1 hour. The membrane was washed three times with TBST buffer, treated with ECL solution (ThermoFisher), and protein expression was confirmed using an imaging device. At this time, the primary antibody was anti-Hsp70 antibody (Abcam, ab181606), anti-TSG101 antibody (Abcam, ab125011), or anti-calnexin antibody (Abcam, ab133615) diluted 1:1000, and the secondary antibody was anti-rabbit antibody diluted 1:3000.

[0199] FACS analysis was performed as follows. Briefly, 30 μg of exosomes and 20 μL of CD63 microbeads (Invitrogen, 10606D) were mixed and incubated for 1 day in a refrigerator. Then, 5 μL of anti-CD63-PE antibody (BD Biosciences, 556020) was added and incubated for an additional 1 day in a refrigerator. The reaction mixture was washed with FACS buffer and analyzed by flow cytometry.

[0200] As a result, as shown in Figures 7a and 7b, it was confirmed that the exosome markers Hsp70 and TSG101 were expressed, but the cell lysate marker calnexin was not expressed. In addition, the expression rate of CD63 was also approximately 95% or higher.

[0201] Next, the size and concentration of exosome particles were measured using the nanoparticle tracking analysis (NTA) method.

[0202] Specifically, the exosomes were diluted in DPBS (1:1000 to 1:10,000) and the size and number of exosomes were measured at 25°C using a nanoparticle tracking analyzer Zetaview® (Particle metrix) equipped with a 488 nm laser. The measurement results were analyzed using Zetaview® software.

[0203] As a result, it was confirmed that the size of iPSC-derived exosomes was approximately 100 nm on average (Fig. 7c).

[0204] Example 2.3. Confirmation of the anti-inflammatory effect of iPSC-derived exosomes.

[0205] In order to confirm the anti-inflammatory activity of iPSC-derived exosomes (iExo) isolated by the method of Example 2.1 above, the amount of NO production was measured after iExo treatment in macrophages in which an inflammatory response was induced.

[0206] Specifically, THP-1 cells were seeded at 1×10 per well in a 12-well plate. 6 After inoculation with cells, LPS (lipopolysaccharides from Escherichia coli, 1 ug / mL) was treated and cultured for 1 hour. At this time, serum-free RPMI1640 was treated as a control. After 1 hour, iExo (40 ug / well) was treated and cultured for an additional 24 hours. The culture medium was harvested and the NO production and cell viability (MTS assay) were determined, respectively.

[0207] As a result, as shown in Fig. 7d, compared to the control group, the LPS-only treatment group showed an approximately five-fold increase in NO production. In contrast, compared to the LPS-treatment group, the iExo-treatment group showed a significant decrease in NO production. At this time, no cytotoxicity was observed in any of the treatment groups.

[0208] Example 3. Characterization and efficacy of iMSC-derived exosomes differentiated from iPSCs.

[0209] Example 3.1. Production of iPSC-derived iMSCs

[0210] iPSCs were subcultured using StemFit medium (Ajinomoto) at 37°C and 5% CO2.

[0211] To differentiate the above iPSCs into mesenchymal stem cells (MSCs), iPSCs were seeded at 1 × 10 per well in a 6-well ultra-low attachment plate (ThermoFisher). 6 After inoculation at the cell concentration (differentiation day 0), the cells were cultured at 37°C and 5% CO2 using StemFit medium containing 10 uM ROCK inhibitor.

[0212] Spheroids were cultured at 2-4 day intervals using a 50 μm cell strainer (Pluriselect) to maintain the spheroid size below 50 μm until single-attachment culture.

[0213] On the second day of differentiation, the cell culture medium was replaced with medium containing 10 uM SB43152 and cultured for an additional 3 days. On the fifth day of differentiation, the cell culture medium was replaced with MSC differentiation medium (αMEM medium containing 10% human platelet lysate (hPL), 10 uM ROCK inhibitor, and 10 uM SB43152) and cultured for 10 days. On the 15th day of differentiation, the spheroids were dissociated into single cells using a 50 um cell strainer to culture single adherent cells, and then dispensed into 35 mm cell culture dishes for culture. When the cells proliferated to about 70% to about 80% of the cell culture dish, they were subcultured at intervals of 3 to 4 days. On the 21st day of differentiation, the cell culture medium was replaced with MSC maintenance medium (αMEM medium containing 10% hPL) and cultured until the 35th day of differentiation to induce differentiation and maturation of the cells (Fig. 8a).

[0214] The expression of mesenchymal stem cell marker proteins (CD90, CD105, CD73) and iPSC marker protein (TRA-1-81) in the differentiated MSCs was confirmed through FACS analysis. Anti-CD90 antibody (BD Biosciences, 562556), anti-CD105 antibody (BD Biosciences, 562408), anti-CD73 antibody (BD Biosciences, 550257), or anti-TRA-1-81 antibody (eBioscience, 12-8883-82) was used.

[0215] As a result, it was confirmed that CD90, CD105, and CD73 were expressed in more than 95% of the cells, whereas TRA-1-81 was not expressed (Fig. 8a).

[0216] The iPSC-derived mesenchymal stem cells differentiated as described above were described interchangeably with “iMSC”.

[0217] Example 3.2. Isolation and Characterization of iMSC-Derived Exosomes

[0218] Exosomes derived from iMSCs, which were differentiated from iPSCs using the method of Example 3.1, were separated using the tangential flow filtration method, and the size and number of the exosomes were measured using a nanoparticle tracking analyzer Zetaview® (Particle metrix). At this time, exosome separation and size analysis were performed using the same methods as in Example 2.1 and Example 2.2.

[0219] As a result, as shown in Fig. 8b, it was confirmed that the size of the iMSC-derived exosomes was about 150 nm on average.

[0220] Example 3.3. Confirmation of the efficacy of iMSC-derived exosomes

[0221] In order to confirm the cell proliferation promoting effect of iMSC-derived exosomes (iMSC Exo) obtained by the method of Example 3.2 above, BJ6 cells, which are human fibroblasts, were treated with iMSC-derived exosomes and cell viability was confirmed.

[0222] Specifically, BJ6 cells were seeded at 5×10 per well in a 96-well plate. 3 After inoculating the cells at a concentration of 100 μg, they were cultured for 24 hours. After treating the cells with 25 μg of iMSC Exo, they were cultured for an additional 24 or 48 hours, respectively. The cell culture fluids were collected and cell proliferation was confirmed. Cell proliferation was confirmed using a CCK-8 solution.

[0223] As a result, as shown in Figure 8c, it was confirmed that cell proliferation increased in the iMSC Exo treatment group compared to the control group (PBS treatment group). In particular, the results after 48 hours of culture confirmed that cell proliferation increased by approximately 300% compared to the control group.

[0224] Example 4. Confirmation of the characteristics and efficacy of iHSC-derived exosomes.

[0225] Example 4.1. Production of iPSC-derived iHSCs

[0226] Example 4.1.1. Differentiation of iPSCs into mesodermal cells

[0227] To differentiate iPSCs into mesenchymal stem cells, iPSC spheroid formation was first induced.

[0228] Specifically, iPSCs were treated with TypLE (Gibco, 12604013) to separate them into single cells, and then more than 750 single cells were seeded per well in a 96-well plate.

[0229] The next day, 1 uL of iMatrix-511 per cm2 was diluted in 150 uL of DPBS (Cytiva, SH3002802) into a T150 flask, coated for more than 1 hour, and then treated with iPSC culture medium (Ajinomoto, AJBASIC04) (30 mL) containing 10 uM Y27632. Then, all iPSC spheroids seeded in one well of a 96-well plate per T150 flask were seeded. From the day after inoculation, the cell culture medium was replaced with StemFit04 medium (30 mL) without Y27632, and cultured for 3 days (4 days in total) with daily medium changes. After confirming colonies attached to the bottom of the T150 flask, the medium was replaced with medium containing CHIR-99021 (Peprotech, 2520691) and BMP4 (R&D Systems) and cultured for an additional 2 days. After 2 days, SB431542 (Peprotech, 3014193) and VEGF (R&D Systems, 293-VE / CF) were added to the medium and cultured for 2 days to differentiate into mesodermal cells for a total of 4 days.

[0230] Example 4.1.2. Differentiation of iPSC-derived mesodermal cells into hematopoietic stem cells.

[0231] In order to differentiate mesodermal cells into hematopoietic stem cells, the cell culture medium of the differentiated mesodermal cells of Example 4.1.1 was replaced with DMEM medium (Gibco, 10566-016) containing 50 ng / mL of SCF (R&D systems, 255-SC / CF) and 50 ng / mL of Flt-3 Ligand (Flt-3L, R&D systems, 308-FK / CF), and cultured for 4 days. After 4 days of culture, the cell culture medium was replaced with the above medium and cultured for an additional 4 days (total of 8 days of culture).

[0232] After differentiation was completed, it was confirmed that more than 98% of the differentiated cells simultaneously expressed CD34 and CD45, which are hematopoietic stem cell-specific markers (Fig. 11).

[0233] HSC cells induced to differentiate from iPSCs through the above process are hereinafter referred to as “iHSCs.”

[0234] Example 4.2. Isolation and Characterization of iHSC-Derived Exosomes

[0235] Exosomes from HSCs (iHSCs) differentiated from iPSCs using the method of Example 4.1 were separated using the tangential flow filtration method, and the size and number of the exosomes were measured using a nanoparticle tracking analyzer Zetaview® (Particle metrix). At this time, the exosome separation and size analysis were performed in the same process as in Example 2.1 and Example 2.2.

[0236] As a result, as shown in Fig. 9a, the size of the iHSC-derived exosomes was confirmed to be approximately 200 nm.

[0237] In addition, the iHSC-derived exosomes were stored at 4°C and -80°C for 14 days, respectively, and the size of the exosomes was checked daily to confirm the stability of the exosomes. As a result, as shown in Figures 9b and 9c, it was confirmed that the particle size of the HSC-derived exosomes was maintained at approximately 200 nm for up to 14 days after thawing under both conditions.

[0238] Example 4.3. Confirmation of the efficacy of iHSC-derived exosomes.

[0239] In order to evaluate the physiological activity of iHSC-derived exosomes isolated by the method of Example 4.2 above, the effects of promoting cell proliferation and wound healing by iHSC-derived exosomes were confirmed in HUVEC cells, a vascular endothelial cell line, and human fibroblast cells, respectively.

[0240] First, to confirm the effect of iHSC-derived exosomes on the proliferation of vascular endothelial cells, HUVEC cells were seeded in a 96-well plate at a density of 5 × 10 per well. 3 Cells were seeded and cultured for 24 hours to prepare. The cell culture medium of the cells was replaced with serum-free DMEM, and 50 μg of iHSC-derived exosomes (HSC exosomes) were treated and cultured in a CO2 incubator at 37°C for 24, 48, or 72 hours. The cells were treated with 20 μL of CCK-8 solution per well, reacted for 2 hours, and cell proliferation was confirmed by measuring the absorbance (420 nm).

[0241] As a result, as shown in Fig. 12, it was confirmed that the proliferation rate of HUVEC cells treated with iHSC-derived exosomes increased over time.

[0242] Next, to confirm the effect of iHSC-derived exosomes on wound healing, BJ6 cells, a human fibroblast cell line, were seeded at 3 × 10 per well in a 35 mm cell culture vessel with a silicone insert 2 well (ibidi). 4The cells were seeded and cultured for 24 hours in a 37°C, 5% CO2 incubator. At this time, the cell culture medium used was DMEM containing 10% FBS. After 24 hours, the silicone insert was removed to form a damaged area, and 2 × 10 iHSC-derived exosomes were added. 10 The particles / well concentration was treated and the damaged area was analyzed by observing under a microscope at hourly intervals (5 hours, 24 hours, and 48 hours). The damaged area analysis was performed using Image J.

[0243] As a result, as shown in Fig. 13, it was confirmed that the area of ​​the damaged area decreased over time in the iHSC-derived exosome-treated group compared to the control group (PBS).

[0244] Example 5. Confirmation of the characteristics and efficacy of iNK-derived exosomes.

[0245] Example 5.1. Production of iPSC-derived iNK

[0246] The cell culture medium of iHSCs differentiated in the same manner as in Example 4 was replaced with DMEM medium containing 50 ng / mL of SCF, 50 ng / mL of Flt-3L, and 50 ng / mL of IL-15, and cultured for 2 days. After 2 days, the same amount of medium was added, and cultured for an additional 4 days. After 4 days, half of the cell culture medium in the flask was taken, centrifuged, the supernatant was removed, and the same amount of medium was added to the cells, resuspended, and added to the flask. The above process was repeated twice, and cultured for a total of 14 days.

[0247] After differentiation was completed, observation of floating cells under a microscope confirmed that most cells had the same shape (Fig. 16A).

[0248] The expression of natural killer cell (NK cell) markers (CD56, CD45, NKG2D) and iPSC marker proteins (SSEA4, TRA-1-60) in the above cells was confirmed through FACS analysis.

[0249] At this time, the antibodies used were anti-CD56 antibody (BD Biosciences, 555518), anti-CD45 antibody (BD Biosciences, 555483), anti-SSEA4 antibody (R&D Systems, FAB1435A), anti-NKG2D antibody, or anti-TRA-1-60 antibody (eBioscience, 12-8863-82).

[0250] As a result, as shown in FIG. 16B and FIG. 10, it was confirmed that the cells in which CD56 and CD45, which are natural killer cell marker proteins, were simultaneously expressed were more than about 95%, and the cells in which CD56 and NKG2D were simultaneously expressed were more than about 89%, whereas the iPSC marker proteins SSEA4 and TRA-1-60 were hardly expressed. In particular, the cells in which CD56 was expressed by more than 99%, while TRA-1-60, which reflects iPSC, was expressed by less than 0.1%.

[0251] As described above, natural killer cells differentiated from iPSCs are referred to herein as “iNK” or “EiNK.”

[0252] Example 5.2. Isolation and Characterization of iNK-Derived Exosomes

[0253] NK cells (iNK) differentiated from iPSCs using the method of Example 5.1 were cultured in bulk for 21 days. On the final 19th day, the cell culture medium was replaced with fresh medium and cultured. The cell culture medium was then collected and separated using a tangential flow filtration method in the same manner as in Example 2.1.

[0254] The expression of exosome marker proteins (Hsp70, TSG101, CD63) and proteins not expressed in exosomes (calnexin) in the exosomes separated as described above was confirmed using the same method as in Example 2.2.

[0255] As a result, as shown in Figures 14a and 14b, expression of Hsp70 and TSG101 was observed in iNK-derived exosomes, while expression of calnexin was not observed. In addition, it was confirmed that CD63 was expressed in approximately 95% of the exosomes.

[0256] In addition, the expression of IFN-γ, CD63, MHC-I, or MHC-II in exosomes (PBNK exo, HEK293 exo) isolated from peripheral monocyte-derived NK cells (PBNK) and human kidney cell line HEK293 cells, and in the iNK-derived exosomes (iNK exo), was confirmed through Western blot. At this time, anti-CD63 antibody (Abcam, ab217345), anti-MHC-I antibody (Abcam, ab134189), or anti-MHC-II antibody (Abcam, ab180779) was used as the primary antibody, and anti-rabbit antibody (Genetex, GTX213110-01) was used as the secondary antibody.

[0257] Additionally, exosomes derived from PBNK or HEK293 cells, which were used as controls for iPSC-derived exosomes, were isolated using the following method.

[0258] Exosomes of PBNK exo and HEK293 exo were isolated using the same method as the TFF method of Example 2.1. Cartridge filters (Xampler ultrafiltration hollow fiber cartridges, Cyriva) with a molecular weight cutoff (MWCO) of 300,000 Da or 500,000 Da were used as filters. After selectively separating and concentrating exosomes by MWCO, particles smaller than MWCO or low-molecular-weight compounds were removed. At this time, the concentration was 10-fold with respect to the starting volume, and diafiltration was performed using sterile saline solution in a volume 10 to 15 times or more of the concentrated volume.

[0259] As a result, expression of IFN-γ was not observed in HEK293 exo, but expression of IFN-γ was observed in both NK cell-derived exosomes (iNK exo and PBNK exo) (Fig. 14c). In addition, as shown in Fig. 24, expression of CD63, an exosome marker protein, was observed in all exosomes, and expression of MHC-II was observed in iNK-derived exosomes and PBNK-derived exosomes. In addition, expression of MHC-I was observed in PBNK-derived exosomes and iNK cell lysate, but not in iNK-derived exosomes.

[0260] In the same manner as in Example 3.3, the iNK-derived exosome (EiNK exo) was treated (25 ug, 50 ug) to BJ6 cells, a fibroblast cell line, and the cell proliferation rate was confirmed.

[0261] As a result, as shown in Fig. 14d, it was confirmed that cell proliferation in the EiNK exo treatment group increased over time compared to the control group.

[0262] Example 5.3. Confirmation of the physiological activity of iNK-derived exosomes.

[0263] Example 5.3.1. Evaluation of anti-inflammatory activity in macrophage cell lines

[0264] The anti-inflammatory activity of iNK-derived exosomes isolated from macrophages using the method of Example 5.2 was confirmed.

[0265] Specifically, THP-1 cells (Korea Cell Line Bank) were seeded at 1 × 10 per well in a 12-well plate. 6 After seeding with cells, each well was treated with 100 nM PMA (phorbol 12-myristate 13-acetate) and cultured for 72 hours. After 72 hours, the cells were washed with serum-free medium, treated with LPS (1 ug / mL), and reacted for 1 hour. Serum-free medium was used as a control. After 1 hour, iNK-derived exosomes (160 ug) were treated, and after an additional 24 hours of culture, cell viability and proinflammatory cytokine expression were confirmed. The cell viability was confirmed by measuring the absorbance (420 nm) after treating with CCK-8 solution (2 hours), and the expression of proinflammatory cytokines (TNF-α, IL-6, IL-1β) was confirmed through RT-qPCR (Fig. 17).

[0266] To confirm gene expression, RNA was first extracted from cells using the RNeasy mini kit (QIAGEN). cDNA was synthesized using Prime script RT master mix kit (Takara) using 1 ug of total RNA as a template, and the cDNA was then purified using Power SYBR TM Mix with green PCR master mix (Applied biosystems) and studio TM 5 qPCR was performed on a Real-time PCR (Applied biosystems) device. β-actin was used as an internal control for mRNA. -ΔΔCt Gene expression was calculated using the following method. The primers used for PCR are shown in Table 1.

[0267] Primer name Forward (5' to 3') Reverse (5' to 3') TNF-αTTCTCCTTCCTGATCGTGGCAG (SEQ ID NO: 1) TGATGGCAGAGAGGAGGTTGAC (SEQ ID NO: 2) IL-6CAAATTCGGTACATCCTCGACG (SEQ ID NO: 3) TGTCCTGCAGCCACTGGTTCTG (SEQ ID NO: 4) IL-1βCGATCACTGAACTGCACGCTC (SEQ ID NO: 5) TTATATCCTGGCCGCCTTTGG (SEQ ID NO: 6) GAPDHAGCGAGATCCTCCAAAATC (SEQ ID NO: 7) GGCAGAGATGATGACCCTTT (SEQ ID NO: 8) TSLPCTAAGGCTGCCTTAGCTATC (SEQ ID NO: 9) AAGCGACGCCACAATCCTTG (SEQ ID NO: 10) α-SMAGGCAAGTGATCACCATCGGA (SEQ ID NO: 11) GTGGTTTCATGGATGCCAGC (SEQ ID NO: 12) COL1A1 GAGGGCCAAGACGAAGACATC (SEQ ID NO: 13) CAGATCACGTCATCGCACAAC (SEQ ID NO: 14) β-actin AACTGGGACGACATGGAGAAAA (SEQ ID NO: 15) GGATAGCACAGCCTGGATAGCAA (SEQ ID NO: 16)

[0268] As a result, no cytotoxicity was observed by iNK-derived exosome treatment compared to the LPS treatment group (Figs. 18 and 19A). In addition, the expression of TNF-α, IL-6, and IL-1β, which had increased by LPS treatment (21-fold, 231-fold, and 91-fold increases, respectively, compared to the control group), was reduced by iNK-derived exosome treatment (12-fold, 11-fold, and 37-fold decreases, respectively, compared to the LPS-only treatment group) (Figs. 19B to D).

[0269] In addition, the NO production inhibitory ability of iNK-derived exosomes was confirmed using the same method as in Example 2.3. At this time, HEK293 cell-derived exosomes were used as an exosome control, and each exosome was treated at a concentration of 100 ug or 200 ug. Cell viability under the above treatment conditions was confirmed through a CCK-8 assay.

[0270] As a result, as shown in Figure 20, compared to the control (vehicle) treatment group, LPS treatment increased NO production to approximately 14.7 uM. In contrast, when iNK-derived exosomes were treated after LPS treatment, the amount decreased to approximately 4 uM. At this time, no cytotoxicity was observed.

[0271] Through the above results, it was confirmed that the iNK-derived exosomes according to the present invention exhibit anti-inflammatory activity.

[0272] Example 5.3.2. Evaluation of anti-inflammatory activity in keratinocyte cell lines

[0273] The anti-inflammatory activity of iNK-derived exosomes isolated from human keratinocyte cell lines using the method of Example 5.2 was confirmed (Fig. 21).

[0274] Specifically, human keratinocyte cell line HaCaT cells (ATCC) were seeded at 5 × 10 per well in a 12-well plate. 4 After inoculation with cells, they were cultured for 72 hours to achieve cell confluency of 70% or higher. After 72 hours, the culture medium of the cells was replaced with serum-free medium (DMEM), and TNF-α (20 ng / mL) (Peprotech, 300-01A) and IL-4 (100 ng / mL) (Peprotech, 200-04) were treated and reacted for 2 hours. Then, 0.1 uM dexamethasone (positive control) or iNK-derived exosomes (160 ug) were treated and cultured for an additional 24 hours. The morphology of the cells was observed under a microscope, and RNA was extracted and the expression of the TSLP (thymic stromal lymphopoietin) gene was confirmed through RT-qPCR. RT-qPCR was performed in the same manner as in Example 5.3.1. At this time, the primer sequences of TSLP used are shown in Table 1 above.

[0275] As a result, as shown in Figures 22a and 22b, compared to the control group (ctl), TNF-α / IL-4 treatment increased the expression of the TSLP gene (approximately 96-fold), but iNK-derived exosome treatment decreased the expression of TSLP. At this time, no cytotoxicity was observed.

[0276] Example 5.3.3. Evaluation of anti-inflammatory activity in hepatic stellate cell lines

[0277] The anti-inflammatory activity of iNK-derived exosomes isolated from human hepatic stellate cells using the method of Example 5.2 was confirmed (Fig. 23).

[0278] Specifically, LX-2 cells (ATCC), a human hepatic stellate cell line, were seeded at 1 × 10 per well in a 12-well plate. 5 The cells were seeded at a concentration of 10 cells / mL and cultured in a 37°C, 5% CO2 incubator for 24 hours. After 24 hours, 5 ng / mL of recombinant human TGF-β1 (R&D systems) and iNK-derived exosomes were treated at various concentrations (0, 80, 160, 240 ug / mL) and cultured for an additional 24 hours. After 24 hours, RNA was extracted from the cells, and gene expression of α-SMA (alpha-smooth muscle actin) and CoL1A1 (collagen type I alpha 1 chain), which are liver fibrosis marker proteins, was confirmed using RT-PCR. The RT-qPCR was performed in the same manner as in Example 5.3.1, and the primers used are shown in Table 1.

[0279] As a result, as shown in Fig. 23, it was confirmed that the gene expression of hepatic stellate cell activation marker genes α-SMA and CoL1A1 increased by treatment with TGF-β1 alone compared to the control group. On the other hand, the expression of the above genes decreased in a concentration-dependent manner in the iNK-derived exosome-treated group (iNK exosome+TGF-β1) compared to the TGF-β1 alone-treated group. Through the above results, it was confirmed that the iNK-derived exosome according to the present invention inhibits the activity of human hepatic stellate cells.

[0280] Example 5.3.4. Confirmation of the effect of promoting collagen secretion in fibroblast cell lines.

[0281] The effect of collagen secretion by treatment with iNK-derived exosomes isolated by the method of Example 5.2 was confirmed in BJ6 cells, a human fibroblast cell line (Fig. 25).

[0282] As a result, as shown in Figure 25, when iNK-derived exosomes and iPSC-derived exosomes were each treated alone, it was confirmed that collagen secretion significantly increased compared to the untreated group (vehicle). In addition, when iNK-derived exosomes and iPSC-derived exosomes were treated together, it was confirmed that collagen secretion increased compared to the group treated alone.

[0283] Example 5.4. Confirmation of the stability of iNK-derived exosomes.

[0284] To evaluate the stability of iNK-derived exosomes, iNK-derived exosomes that had been frozen for approximately 6 months to 1 year were thawed, and then anti-inflammatory activity was confirmed in THP-1 cells using the same method as in Example 5.3.1.

[0285] As a result, as shown in Figure 15, it was confirmed that the expression of TNF-α and IL-1β, which increased by LPS treatment, was reduced by treatment with cryopreserved iNK-derived exosomes. At this time, no cytotoxicity was observed. These results confirmed that the physiological activity of iNK-derived exosomes is stably maintained even when stored for a long period.

[0286] Example 6. miRNA analysis of iNK-derived exosomes

[0287] We confirmed the expression of microRNAs (miRNAs) specifically expressed in iNK-derived exosomes differentiated from iPSCs. Exosomes isolated from HEK293 cells, a human normal kidney cell line, were used as a control.

[0288] Specifically, total RNA was extracted from exosomes isolated from each cell using TRIzol reagent (15596026, Thermo Fisher Scientific). RNA quality was assessed using an Agilent 2100 Bioanalyzer and RNA 6000 Pico Chip, and RNA quantity was measured using a Nanodrop 2000 Spectrophotometer system. A microRNA library was constructed using the NEB Next Multiplex Small RNA Library Prep Kit (E7330L, New England BioLabs). 1 μg of total RNA from each sample was used to ligate adapters, and cDNA was synthesized using reverse transcriptase using adapter-specific primers. The library was amplified using PCR and purified using the QIAquick PCR Purification Kit (Qiagen). The yield and size distribution of the small RNA library were assessed by high-sensitivity DNA analysis using an Agilent 2100 Bioanalyzer. High-throughput sequences were generated by single-end 75 sequencing using the Illumina Next Seq500 system. Sequence reads were mapped using the Bowtie2 software tool, and read counts mapped to mature miRNA sequences were extracted using Bedtools (v2.25.0) and Bioconductor.

[0289] The expression level of miRNA in iNK-derived exosomes analyzed by the above method was compared with the expression level of miRNA in HEK293 cell-derived exosomes.

[0290] As a result, as shown in Figures 2a to 2c, it was confirmed that the expression of miR-10a was increased the most (about 2,500-fold) in iNK-derived exosomes compared to HEK293 cell-derived exosomes. miR-10a is known to increase cell survival, inhibit apoptosis, and restore tissue function by rejuvenating stem cells. In addition, it was confirmed that the expression of miR-146a was increased by about 100-fold or more compared to HEK293 cells. miRNA-146a is known to have the function of suppressing inflammatory responses by inhibiting the secretion of IL-1β, IL-6, and TNF-α. In addition, the expression of miR-23a, which exhibits anti-inflammatory activity by suppressing the expression of TNF-α, IL-1β, and IL-8, was confirmed to be increased by about 23-fold compared to iNK-derived exosomes. Furthermore, the expression of miR-223 (inhibitory function of neutrophil immune cell activation and NLRP3 inflammasome signaling) and miR-142 (regulation of CD4 T cell function) in iNK-derived exosomes was increased by approximately 500-fold compared to exosomes from HEK293 cells, and the expression of miR-155 (immune regulation) and miR-181a was confirmed to increase by approximately 5.7-fold and approximately 3.3-fold, respectively.

[0291] In addition, as shown in Fig. 3, various microRNAs were increased in iNK-derived exosomes, and it was confirmed that the increased microRNAs were involved in biological functions related to cancer suppression and differentiation / regeneration.

Claims

1. Extracellular vesicles derived from hematopoietic stem cells (HSCs) or cells differentiated from hematopoietic stem cells.

2. In paragraph 1, The above hematopoietic stem cells are extracellular vesicles differentiated from induced-pluripotent stem cells (iPSC).

3. In paragraph 2, The above hematopoietic stem cells i) A step of inoculating a single induced pluripotent stem cell (iPSC) population into a cell culture vessel and producing an iPSC colony by adherent culture; ii) a step of differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population; and iii) Extracellular vesicles obtained from a hematopoietic stem cell population produced by differentiating the mesodermal cell population into hematopoietic stem cells.

4. In paragraph 3, The above induced pluripotent stem cell (iPSC) colony is an extracellular vesicle composed of a population of iPSC cells in which TRA-1-60 is expressed by at least 90%.

5. In paragraph 4, The above induced pluripotent stem cell (iPSC) colony is an extracellular vesicle composed of a population of iPSC cells in which CD34 is expressed by at least 20%.

6. In paragraph 4, The above hematopoietic stem cell population is an extracellular vesicle in which at least 90% of the cells express CD34.

7. In paragraph 1, Extracellular vesicles in which cells differentiated from the above hematopoietic stem cells are natural killer cells.

8. In paragraph 7, The above extracellular vesicles are extracellular vesicles in which IFNγ and MHC-II are expressed.

9. In paragraph 7, An extracellular vesicle, wherein the extracellular vesicle has increased expression of any one microRNA selected from the group consisting of miR-223, miR-142, miR-10a, miR-146a, miR-23a, miR-155, miR-181a, miR-215, miR-122, let-7, miR-129, miR-147, miR-24, miR-139, miR-16, miR-197, miR-195, miR-29, miR-152, miR-107, miR-140, miR-15, miR-124 and combinations thereof, compared to an extracellular vesicle derived from a normal cell.

10. In paragraph 7, The above microRNA is overexpressed by more than three times compared to the microRNA in the extracellular vesicles derived from normal cells.

11. In paragraph 7, The above natural killer cells are extracellular vesicles obtained from a cell population produced by differentiating the hematopoietic stem cells of clause 5 into natural killer cells.

12. In paragraph 11, The above natural killer cell population is an extracellular vesicle in which at least 90% of the cells are CD56.

13. In paragraph 12, The above natural killer cell population is an extracellular vesicle in which TRA-1-60 is at least 2% or less.

14. In paragraph 12, The above natural killer cell population is an extracellular vesicle in which NKG2D is at least 70%.

15. In paragraph 1, An extracellular vesicle, wherein the extracellular vesicle is selected from the group consisting of exosomes, microvesicles, multivesicles, extracellular vesicle-like vesicles, and combinations thereof. 16.i) A step of inoculating a single induced pluripotent stem cell (iPSC) population into a cell culture vessel and producing an iPSC colony by adherent culture; ii) a step of differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population; iii) a step of differentiating the mesodermal cell population into a hematopoietic stem cell population; and iv) A method for producing extracellular vesicles from iPSC-derived hematopoietic stem cells, comprising the step of obtaining extracellular vesicles from a culture medium of the hematopoietic stem cell population. 17.i) A step of inoculating a single induced pluripotent stem cell (iPSC) population into a cell culture vessel and producing an iPSC colony by adherent culture; ii) a step of differentiating the iPSC colony into mesodermal cells to produce a mesodermal cell population; iii) a step of differentiating the mesodermal cell population into a hematopoietic stem cell population; and iv) A step of differentiating the hematopoietic stem cell population into a natural killer cell population; v) A method for producing extracellular vesicles from iPSC-derived natural killer cells, comprising the step of obtaining extracellular vesicles from a culture medium of the above natural killer cell population.

18. A pharmaceutical composition for the prevention or treatment of a disease, comprising the extracellular vesicle of paragraph 1 as an active ingredient.

19. In paragraph 18, A pharmaceutical composition for the prevention and treatment of a disease, wherein the disease is one selected from the group consisting of infectious diseases, fibrosis, cancer, nervous system diseases, autoimmune diseases, and skin diseases.

20. In paragraph 19, A pharmaceutical composition for the prevention and treatment of a disease, wherein the infectious disease is one selected from the group consisting of hepatitis B, hepatitis C, human papilloma virus (HPV) infection, cytomegalovirus infection, viral respiratory disease, and influenza.

21. In paragraph 19, A pharmaceutical composition for preventing or treating a disease, wherein the fibrosis is any one selected from the group consisting of liver fibrosis, pulmonary fibrosis, skin fibrosis, joint fibrosis, nerve fibrosis, pancreatic fibrosis, muscle fibrosis, and peritoneal fibrosis.

22. In paragraph 19, A pharmaceutical composition for the prevention and treatment of a disease, wherein the cancer is one selected from the group consisting of liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, colon cancer, cervical cancer, thyroid cancer, laryngeal cancer, leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, and lymphoma.

23. In paragraph 19, A pharmaceutical composition for the prevention and treatment of a disease, wherein the above-mentioned nervous system disease is a nervous system disease or a degenerative brain disease caused by nerve damage or abnormal nerves.

24. In paragraph 23, A pharmaceutical composition for the prevention and treatment of a disease, wherein the nerve damage is one selected from the group consisting of neuropraxia, axonal damage (axonotmesis), and neurotmesis.

25. In paragraph 23, A pharmaceutical composition for the prevention and treatment of a disease, wherein the neurological disease caused by the above nerve damage or abnormal nerve is a neurological disease caused by nerve damage or abnormal nerve in the central nervous system, or a neurological disease caused by nerve damage or abnormal nerve in the peripheral nervous system.

26. In paragraph 25, A pharmaceutical composition for the prevention and treatment of a disease, wherein the neurological disease caused by nerve damage or abnormal nerves of the central nervous system is one selected from the group consisting of organic diseases and dysfunctions of the central nervous system, epilepsy, multiple sclerosis, amyotrophic lateral sclerosis, Alzheimer's disease, dementia with Lewy bodies, Huntington's disease, Parkinson's disease, schizophrenia, traumatic brain injury, stroke, Pick's disease, Creutzfeldt-Jakob disease, progressive supranuclear palsy, multiple system atrophy, corticobasal degeneration, spinocerebellar degeneration, cerebellar atrophy, post-traumatic stress disorder, amnesia, vascular dementia, and cerebral infarction.

27. In paragraph 25, The above peripheral nervous system nerve damage or nervous system disease caused by abnormal nerves is one selected from the group consisting of peripheral neuropathy, diabetic neuropathy, peripheral neuropathic pain, peripheral neuropathy due to chemotherapy, complex regional pain syndrome, optic neuropathy, mononeuropathy, mononeuropathy multiplex (mononeuritis multiplex), polyneuropathy, Guillain-Barré syndrome (acute inflammatory demyelinating polyneuropathy), chronic inflammatory demyelinating polyneuropathy, hereditary neuropathies, plexus disorders, glaucoma, macular degeneration, amyotrophic lateral sclerosis, progressive muscular atrophy, progressive bulbar palsy, polio, post-polio syndrome, spastic-person syndrome, Isaacs syndrome, myasthenia gravis, neonatal myasthenia, botulism, Eaton-Lambert syndrome, thoracic outlet syndrome, Charcot-Marie-Tooth disease, and spinal muscular atrophy. A pharmaceutical composition for the prevention and treatment of diseases.

28. In paragraph 19, A pharmaceutical composition for the prevention and treatment of a disease, wherein the above-mentioned nervous system disease is a degenerative brain disease.

29. In paragraph 28, The above degenerative brain disease is one selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, mild cognitive impairment, cerebral amyloid angiopathy, Down syndrome, amyloid stroke, systemic amyloid disease, Dutch amyloidosis, Niemann-Pick disease, senile dementia, amyotrophic lateral sclerosis, spinocerebellar atrophy, Tourette's syndrome, Friedrich's ataxia, Machado-Joseph's disease, Lewy body dementia, dystonia, progressive supranuclear palsy, and frontotemporal dementia. A pharmaceutical composition for the prevention or treatment of a disease.

30. In paragraph 19, A pharmaceutical composition for preventing or treating a disease, wherein the autoimmune disease is one selected from the group consisting of Crohn's disease, erythema, atopy, rheumatoid arthritis, Hashimoto's thyroiditis, pernicious anemia, Addison's disease, type 1 diabetes, lupus, chronic fatigue syndrome, fibromyalgia, hypothyroidism and hyperthyroidism, scleroderma, Behcet's disease, inflammatory bowel disease, multiple sclerosis, myasthenia gravis, Meniere's syndrome, Guilian-Barre syndrome, Sjogren's syndrome, vitiligo, endometriosis, psoriasis, vitiligo, systemic scleroderma, asthma, and ulcerative colitis.

31. In paragraph 19, A pharmaceutical composition for preventing or treating a disease, wherein the skin disease is any one selected from the group consisting of inflammatory skin disease, wound, skin wrinkle, skin aging, loss of skin elasticity, dry skin, sensitive skin, skin pigmentation, skin irritation, skin regeneration, wound or wound healing, and combinations thereof.

32. In paragraph 31, A pharmaceutical composition for preventing or treating a disease, wherein the inflammatory skin disease is one or more selected from the group consisting of atopic dermatitis, allergic dermatitis, psoriasis, seborrheic dermatitis, contact dermatitis, lupus erythematosus, papular urticaria, alopecia, erythema nodosum, erythema multiforme, keratosis pilaris, eczema, irritant contact dermatitis, allergic contact dermatitis, and autosensitization dermatitis.

33. A cosmetic composition for improving skin condition, comprising the extracellular vesicle of paragraph 1 as an active ingredient.

34. In paragraph 33, A cosmetic composition for improving skin condition, wherein the improvement in skin condition is any one selected from the group consisting of improvement in inflammatory skin disease, inhibition of wrinkle occurrence, inhibition of skin aging, improvement in skin elasticity, whitening, moisturizing, improvement in skin irritation, skin regeneration, wound healing, relief of skin irritation, and combinations thereof.

35. Use for preventing or treating diseases of extracellular vesicles of paragraph 1.

36. A method for preventing or treating a disease, comprising administering the extracellular vesicle of paragraph 1 to an individual.

Images