Discovery of key genes for reverting cancer cells into normal cells and re-creation of use of drug

Abstract

The present invention relates to: a pharmaceutical composition for preventing or treating cancer, wherein the composition specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIH Core Complex Helicase Subunit, also referred to as Xeroderma pigmentosum group B (XPB)) to inhibit the proliferation of cancer cells while inducing normal differentiation, thereby reverting the cancer cells into normal-like cells (or normal functional cells); and a method for screening a drug for reverting cancer cells into normal-like cells (or normal functional cells) by inhibiting the proliferation of the cancer cells while inducing normal differentiation.

Description

Discovering key genes that revert cancer cells to normal cells and repurposing drugs.

[0001] The present invention relates to a pharmaceutical composition for preventing or treating cancer, characterized in that it specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal function cells).

[0002] In addition, the present invention relates to a method for screening a drug that specifically inhibits ERCC3, thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functional cells).

[0003] Anticancer drugs are broadly categorized as cytotoxic chemotherapy, targeted chemotherapy, and immunotherapy. Cytotoxic chemotherapy exploits the rapid proliferation of cancer cells compared to normal cells, killing them. Combination chemotherapy, typically using drugs with different mechanisms of action, is often used to enhance therapeutic efficacy and prevent cross-resistance. Cytotoxic chemotherapy also affects normal cells, particularly blood cells, hair follicle cells, mucosal cells, and germ cells, which grow as rapidly as cancer (tumor) cells. This damage can lead to characteristic side effects such as bone marrow dysfunction (low white blood cells, red blood cells, and platelets), hair loss, stomatitis, diarrhea, and infertility. Targeted chemotherapy drugs target overexpressed proteins that induce cancer-associated characteristics. By blocking specific proteins, they inhibit or delay the formation of blood vessels necessary for cancer growth and metastasis. Compared to cytotoxic chemotherapy, targeted chemotherapy has less of an effect on normal cells and thus fewer side effects. However, cancer cells can quickly adapt to targeted chemotherapy and develop resistance. Recently emerging immunotherapy drugs are anticancer drugs that work by blocking immune suppression of cancer cells and thereby enhancing immune function. However, immunotherapy drugs have limitations, such as low response rates, making them only applicable to a small number of patients. They also carry a risk of relapse during long-term follow-up, and have been reported to have potentially fatal side effects, such as myocarditis.

[0004] Existing cancer differentiation treatment strategies indirectly suppress cancer cell potential by inducing differentiation, but their effectiveness has been limited and has been applied only to certain types of cancer, such as neuroblastoma, thyroid cancer, and some hematological malignancies (e.g., acute promyelocytic leukemia and some subtypes of acute myeloid leukemia). The main reason for this limited effectiveness is that the differentiation state and cancer cell potential are often regulated independently, so simple differentiation induction alone cannot effectively suppress the inherent infinite proliferation ability of cancer cells. Meanwhile, in some cases of colorectal cancer, well-differentiated primary cancers are being discovered even in patients with stage IV cancer and distant metastasis.

[0005] Considering that normal-like cells (or normal functional cells) become cancerous through two key axes in the process of carcinogenesis: acquisition of stem cell potential (dedifferentiation) and acquisition of cancer cell potential, a strategy of 'reversing cancer cells into normal-like cells (or normal functional cells)' is needed to reverse the carcinogenesis process by suppressing both dedifferentiation and cancer cell potential of cancer cells.

[0006] Inducing normal differentiation of cancer cells and reducing cancer cell potential are two of the most important axes in cancer treatment. The present inventors developed a framework that can measure cancer cell differentiation when all possible genes are knocked out in a computer model of the gene network, and discovered a new target, ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], that can simultaneously reduce cancer cell differentiation and cancer cell potential.

[0007] In addition, the present inventors have discovered that when ERCC3 is inhibited, the differentiation and cancer cell function of cancer cells are suppressed together while having little effect on normal cells, thereby enabling cancer treatment, alleviation, or prevention without side effects through the reversal of cancer cells into normal-like cells (or normal functional cells).

[0008] In addition, the present inventors have discovered that small-molecule compounds such as spironolactone, which are used as anti-aldosterone agents and potassium-sparing diuretics for hypertension, edema, heart failure, ascites due to cirrhosis, primary aldosteronism, polycystic ovary syndrome, androgen excess symptoms (acne, hirsutism, etc.), hypokalemia, etc., exhibit remarkably excellent effects in reversing cancer cells into normal-like cells (or normal functioning cells) through ERCC3 inhibition.

[0009] Furthermore, the present inventors have confirmed that spironolactone inhibits the proliferation (growth) of cancer cells and induces differentiation in solid cancers such as colorectal cancer, breast cancer, lung cancer, and skin cancer (especially melanoma), thereby demonstrating that a reversible treatment strategy based on ERCC3 inhibition can be applied at the pan-cancer level.

[0010] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating cancer, characterized in that it specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and inducing normal differentiation at the same time, thereby reversing cancer cells into normal-like cells (or normal functional cells). That is, the purpose of the present invention is to enable cancer treatment, alleviation, or prevention without side effects by reversing cancer cells into normal-like cells (or normal functional cells) by inhibiting both the dedifferentiation property and cancer cell function of cancer cells while having little effect on normal-like cells (or normal functional cells).

[0011] Another object of the present invention is to provide a method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal function cells).

[0012] The present invention provides a pharmaceutical composition for preventing or treating cancer, comprising spironolactone of the following chemical formula 1 or a pharmaceutically acceptable salt thereof, or BPK-21 of the following chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient, which specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal function cells).

[0013] [Chemical Formula 1]

[0014]

[0015] [Chemical Formula 2]

[0016]

[0017] In the composition for preventing or treating cancer according to the present invention, the active ingredient spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, reduces the expression of one or more genes selected from the group consisting of KRAS (Kirsten rat sarcoma viral oncogene homolog), HMGA1 (High-Mobility Group AT-Hook 1), and G3BP1 (GTPase Activating Protein (SH3 Domain) Binding Protein 1). ERCC3 directly induces the transcription of KRAS, thereby promoting the proliferation of cancer cells. In addition, ERCC3 increases the expression of HMGA1 and G3BP1, thereby activating the WNT signaling pathway, thereby enhancing the stem cell characteristics of cancer cells. Specific binding of ERCC3 was confirmed in the promoter regions of KRAS, HMGA1, and G3BP1, and inhibition of ERCC3 significantly reduced the expression of these genes, suggesting that ERCC3 directly participates in the transcriptional activation of these genes. The genes bound by ERCC3 (KRAS, HMGA1, G3BP1) have functions that contribute to the proliferation and development of cancer, and in particular, include features related to the malignant progression of cancer, such as epithelial-mesenchymal transition (EMT). KRAS is closely related to the proliferation of colon cancer, and HMGA1 and G3BP1 are closely related to the proliferation of cancer cells and the activation of stem cell potential through the activation of the WNT signaling pathway. Therefore, spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, inhibits the proliferation of cancer cells and suppresses stem cell function.

[0018] In the composition for preventing or treating cancer according to the present invention, the active ingredient, spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, increases the expression of the BMP2 (Bone Morphogenetic Protein 2) gene. Spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, specifically inhibits ERCC3, and when ERCC3 expression is inhibited, the expression of BMP2 significantly increases, ultimately inducing normal differentiation of cancer cells into normal-like cells (or normal functional cells).

[0019] In the composition for preventing or treating cancer according to the present invention, the active ingredient spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof reduces the overexpression of MYC, a cancer-related gene, and MKI67 and PCNA, key cell proliferation genes, in cancer cells. Inhibition of ERCC3 inhibits KRAS (associated with the MAPK pathway) and the WNT signaling pathway, thereby reducing the overexpression of cancer-related genes including MYC and cell proliferation-related genes such as MKI67 and PCNA in cancer cells.

[0020] In the composition for preventing or treating cancer according to the present invention, the active ingredient spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, specifically increases the expression of KRT20 (Keratin 20), KLF4 (KLF Transcription Factor 4), or KRT20 and KLF4, which are differentiation markers of normal colon cells. The increase in the expression of KRT20, KLF4, or KRT20 and KLF4 indicates that the reversibility of colon cancer cells into normal colon-like cells (or normal colon functional cells) is induced.

[0021] In addition, in the composition for preventing or treating cancer according to the present invention, the active ingredient spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, specifically increases the expression of GATA3 (GATA Binding Protein 3), a differentiation marker of normal breast cells. The increased expression of GATA3 means that the reversibility of breast cancer cells into normal breast-like cells (or normal breast functional cells) is induced.

[0022] In addition, in the composition for preventing or treating cancer according to the present invention, the active ingredient spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, specifically increases the expression of NKX2-1 (NK2 homeobox 1), SCGB1A1 (secretoglobin family 1A member 1), or NKX2-1 and SCGB1A1, which are differentiation markers of normal lung cells. The increase in the expression of NKX2-1, SCGB1A1, or NKX2-1 and SCGB1A1 indicates that the reversibility of lung cancer cells into normal lung-like cells (normal lung function cells) is induced.

[0023] In addition, in the composition for preventing or treating cancer according to the present invention, the active ingredient spironolactone (Aldactone®) or a pharmaceutically acceptable salt thereof, or BPK-21 or a pharmaceutically acceptable salt thereof, specifically increases the expression of KRT1 (Keratin 1), a differentiation marker of normal skin cells. The increased expression of KRT1 indicates that the reversibility of melanoma cells into normal skin-like cells (normal skin functional cells) is induced.

[0024] The composition for preventing or treating cancer according to the present invention exhibits a pan-cancer level reversible effect that reduces cancer cell activity in various cancer types, including colon cancer, breast cancer, lung cancer, and skin cancer (e.g., melanoma), while simultaneously inducing normal differentiation into normal-like cells (or normal functional cells).

[0025] In addition, the present invention provides a method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functioning cells), the method comprising: (a) treating cancer cells with a candidate substance in vitro; (b) measuring the expression level of ERCC3 in cancer cells treated with the candidate substance; (c) selecting a candidate substance that exhibits a lower expression level of the ERCC3 than that of a control group not treated with the candidate substance; and (d) determining, among the candidate substances selected in step (c), a candidate substance that reduces the expression of at least one gene selected from the group consisting of KRAS, HMGA1, and G3BP1 and increases the expression of the BMP2 gene as a drug that reversibly reversibly reversing cancer cells into normal-like cells (or normal functioning cells).

[0026] In the method of screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)] of the present invention, thereby inhibiting the proliferation of cancer cells and inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functioning cells), the drug that reversibly reverts cancer cells into normal-like cells (or normal functioning cells) induces a decrease in the expression of cancer-related genes such as MYC and also reduces the overexpression of cell proliferation-related genes such as MKI67 and PCNA in cancer cells.

[0027] In the present invention, a method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functional cells), wherein the drug that reversibly reversibly reversibly reverts cancer cells into normal-like cells (or normal functional cells) specifically increases the expression of KRT20 (Keratin 20), KLF4 (KLF Transcription Factor 4), or KRT20 and KLF4, which are differentiation markers of normal colon cells. An increase in the expression of KRT20, KLF4, or KRT20 and KLF4 indicates that the reversibility of colon cancer cells into normal colon-like cells (or normal colon functional cells) is induced.

[0028] In the present invention, a method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functional cells), wherein the drug that reversibly reverses cancer cells into normal-like cells (or normal functional cells) specifically increases the expression of GATA3 (GATA Binding Protein 3), which is a differentiation marker of normal breast cells. The increase in the expression of GATA3 means that the reversal of breast cancer cells into normal breast-like cells (or normal breast functional cells) is induced.

[0029] In the present invention, a method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functional cells), the drug that reversibly reverses cancer cells into normal-like cells (or normal functional cells) specifically increases the expression of NKX2-1 (NK2 homeobox 1), SCGB1A1 (secretoglobin family 1A member 1), or NKX2-1 and SCGB1A1, which are differentiation markers of normal lung cells. An increase in the expression of NKX2-1, SCGB1A1, or NKX2-1 and SCGB1A1 indicates that reversal of lung cancer cells into normal lung-like cells (normal lung functional cells) is induced.

[0030] In the present invention, a method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and simultaneously inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal functional cells), wherein the drug that reversibly reverses cancer cells into normal-like cells (or normal functional cells) specifically increases the expression of KRT1 (Keratin 1), a differentiation marker of normal skin cells. The increased expression of KRT1 indicates that reversal of melanoma cells into normal skin-like cells (normal skin functional cells) is induced.

[0031] ERCC3 is a key target gene that reversibly transforms cancer cells into normal-like cells (or normal functioning cells), and specific inhibition of ERCC3 can be utilized as a cancer reversal treatment strategy that suppresses cancer cell function while simultaneously promoting normal differentiation.

[0032] When ERCC3 gene expression was inhibited in colon cancer cell lines and normal colon cell lines, proliferation was inhibited in the colon cancer cell lines and gene expression similar to that in normal differentiated colon epithelial cell lines, whereas proliferation (growth) inhibition was not observed in the normal colon cell lines. Therefore, ERCC3 inhibition can induce differentiation and suppress cancer cell function specifically in colon cancer without affecting normal colon cell lines. ERCC3 inhibited cancer cell proliferation and induced normal differentiation in various solid cancers, including colon cancer, breast cancer, lung cancer, and skin cancer (especially melanoma). This demonstrated that a reversible therapeutic strategy based on ERCC3 inhibition can be applied at the pan-cancer level.

[0033] Figure 1 summarizes the entire analysis process and key results for the discovery and functional verification of a drug target gene (ERCC3) that induces reversibility of colorectal cancer cells based on in silico simulation using a gene regulatory network.

[0034] (A) illustrates the experimental design overview. The left panel depicts the process of collecting tissue samples from the tumor and adjacent normal tissue of a colon cancer patient, and then using these to create colon cancer organoids and normal colon organoids. The central panel depicts the process of generating single-cell transcriptome (RNA-seq) data and constructing a gene regulatory network reflecting cell status based on this data. The right panel presents the analysis flow for performing in silico gene knockout simulations for all genes to identify candidate drug target genes that can induce cancer cell redifferentiation.

[0035] (B) presents the results of low-dimensional mapping UMAP (Uniform Manifold Approximation and Projection) analysis on single-cell transcriptome data.

[0036] (C) is a dot plot showing the expression level of representative marker genes and the proportion of expressing cells for each cell cluster.

[0037] (D) Comparison of the composition ratio of each cell type in normal colon organoids and colon cancer organoids.

[0038] (E) Visualizes the phenomenon of stem cell clusters being separated into two sub-clusters through clustering analysis based on the results of low-dimensional mapping UMAP (Uniform Manifold Approximation and Projection) analysis.

[0039] (F) is a boxplot comparing MYC target genes, cancer signatures, and cell proliferation-related signature scores between stem cell subclusters.

[0040] (G) shows the results of the Transcriptional Age Index (TAI) analysis.

[0041] (H) Comparison of the signature scores of differentially regulated (DR) genes regulated by ERCC3 between cluster 1 and differentiated cells.

[0042] (I) shows the results of gene ontology (GO) analysis for genes whose expression is regulated by ERCC3.

[0043] (J) is a violin plot comparing the expression levels of the ERCC3 gene.

[0044] (K) is a Kaplan-Meier survival curve analyzing the survival rate according to the ERCC3 expression level based on the TCGA (The Cancer Genome Atlas) colorectal cancer patient data.

[0045] Figure 2 shows the analysis of the gene regulatory function of ERCC3 and its role in promoting carcinogenesis in colon cancer, and is the result of an analysis evaluating the effect of ERCC3 on gene expression regulation during the carcinogenesis process.

[0046] (A) Schematic representation of the experimental design process for ChIP-seq (Chromatin Immunoprecipitation sequencing) analysis to identify the DNA binding site of ERCC3 in the colon cancer cell line HT29.

[0047] (B) Shows the results of ChIP-seq analysis, showing that more than 90% of the total binding regions of ERCC3 are located in distal intergenic and intron regions, and approximately 4.4% of the total binding regions are located in the promoter region of the gene.

[0048] (C) To confirm whether ERCC3 actually binds to the promoter region on the genome, signals of H3K4me3 (active promoter marker) and RNA polymerase II were compared around the ERCC3 ChIP-seq peak.

[0049] (D) is the result of confirming which gene promoter ERCC3 mainly binds to, and shows that there is a specific binding (peak) of ERCC3 in the promoter regions of KRAS, HMGA1, and G3BP1.

[0050] (E) shows the results of gene ontology (GO) analysis performed to evaluate what functions ERCC3 target genes have in common.

[0051] (F) comprehensively represents (A) to (E) above, and indicates that ERCC3 promotes cancer cell proliferation through the expression of KRAS, and induces the activation of the WNT signaling pathway and an increase in stem cell potential through the expression of HMGA1 and G3BP1, thereby playing a role in enhancing the cancer cell potential (proliferation and undifferentiation characteristics) of colon cancer.

[0052] Figure 3 analyzes the mechanism of the inhibition of KRAS-MAPK and WNT signaling pathways through suppression of ERCC3 expression and the resulting inhibition of colon cancer proliferation.

[0053] (A) shows the results of Gene Set Enrichment Analysis (GSEA) performed to confirm that the infinite proliferation ability of colon cancer is closely related to the activity of KRAS (associated with the MAPK pathway) and the WNT pathway, and to evaluate whether the decrease in ERCC3 expression leads to the inhibition of the pathway.

[0054] (B) shows the results of western blot analysis performed on the HT29 cell line to verify the experimental results of (A) above at the protein level.

[0055] (C) shows the results of gene ontology (GO) analysis to evaluate how the activity of KRAS and WNT pathways actually affects downstream proliferation-related genes.

[0056] (D) shows the results of evaluating the actual effect of ERCC3 inhibition on cell proliferation in three colon cancer cell lines (HT29, HCT116, and CACO2).

[0057] (E) shows that in the case of ERCC3, a reversible target of colon cancer cells, there is no or minimal effect on the proliferation of normal colon cells.

[0058] (F) and (G) show the results of evaluating the ERCC3 inhibitory effect after transplanting three types of colon cancer cell lines (HT29, HCT116, and CACO2) into mice.

[0059] Figure 4 shows the mechanism of inducing BMP2 expression and differentiation of colon cancer cells into normal-like (or normal-function) colon cells through ERCC3 inhibition.

[0060] (A) shows that when ERCC3 is inhibited in the colon cancer cell line HT29, cancer cell characteristics on the X-axis decrease, and differentiation characteristics into normal epithelial cells on the Y-axis increase.

[0061] (B) shows the results of gene expression analysis performed to confirm whether the expression of genes related to normal colon function is restored when differentiation is induced in colon cancer cells.

[0062] (C) shows that when ERCC3 is suppressed, the expression of genes related to brush border and tight junctions, which are representative structural features of normal colon tissue, and genes related to the apical junction complex, which are key to maintaining the polarity and barrier function of colonic epithelial cells, increases.

[0063] (D) shows that inhibition of ERCC3 in two colon cancer cell lines (HT29 and CACO2) increases the expression of both KRT20 and KLF4, which are differentiation markers of colon epithelial cells.

[0064] (E) and (F) show that the differentiation of colon cancer cells into normal colon epithelial cells is closely related to increased BMP2 expression.

[0065] (G) This explains the mechanism by which inhibition of the WNT signaling pathway by inhibition of ERCC3 induces BMP2 activity and differentiation of colon cancer cells into normal colon epithelial cells.

[0066] Figure 5 shows that spironolactone, a drug that specifically degrades ERCC3, inhibits the proliferation of colon cancer and promotes differentiation, thereby inducing the reversibility of colon cancer.

[0067] (A) When spironolactone was treated on five colon cancer cell lines corresponding to Consensus Molecular Subtype (CMS) 1-4 (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116 and CACO2), the effects of proliferation inhibition and differentiation induction through ERCC3-specific degradation were confirmed.

[0068] (B) shows that when spironolactone was treated to five colon cancer cell lines (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116 and CACO2) corresponding to CMS (Consensus Molecular Subtype) 1-4, cell proliferation decreased in a concentration-dependent manner.

[0069] (C) shows that when spironolactone was treated to five colon cancer cell lines corresponding to Consensus Molecular Subtype (CMS) 1-4 (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116 and CACO2), the expression of normal colon cell differentiation markers KRT20 and KLF4 increased.

[0070] (D) shows that there was no change in cell proliferation when spironolactone was treated in a normal colon cell line (NCM-460).

[0071] (E) shows that when spironolactone is treated in a normal colon cell line (NCM-460), the degradation of ERCC3 is promoted.

[0072] (F) IC of spironolactone in five colon cancer cell lines corresponding to Consensus Molecular Subtype (CMS) 1-4 (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116 and CACO2) and a normal colon cell line (NCM-460). 50This is the result of calculation. This shows that colon cancer cell lines are sensitive to treatment with spironolactone, whereas normal colon cell lines are insensitive to treatment with spironolactone.

[0073] (G) shows the results of analyzing the extent of cell death after ERCC3 inhibition or spironolactone treatment of a colon cancer cell line (HT29) and a normal colon cell line (NCM460). This shows that neither direct inhibition of ERCC3 gene expression nor reduction of ERCC3 following treatment with spironolactone at concentrations that induce a reversible therapeutic effect induces apoptosis of cancer cells or normal colon cells.

[0074] (H) shows that oral administration of spironolactone to mice with colon cancer transplanted into the skin significantly reduced tumor size and proliferation rate.

[0075] (I) shows that the tumor suppression effect was confirmed when spironolactone was administered intraperitoneally to mice with colon cancer transplanted into the skin.

[0076] (J) shows that oral and intraperitoneal administration of spironolactone has a tumor-inhibiting effect in a model in which colon cancer is transplanted into the intestine of a mouse.

[0077] (K) Histological images of the liver and kidneys of mice administered spironolactone orally. This demonstrates that the concentration of the drug that produces a reversible therapeutic effect by spironolactone is not toxic to the liver and kidneys of mice.

[0078] Figure 6 shows the induction of reversibility of colon cancer by BPK-21, a drug that specifically degrades ERCC3.

[0079] (A) shows that when BPK-21 was treated to five types of colon cancer cell lines (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116, and CACO2), the proliferation of colon cancer cells was significantly reduced.

[0080] (B) shows that when BPK-21 was treated in three colon cancer cell lines (HT29, HCT116, and CACO2), the expression of normal colon cell differentiation markers KRT20 and KLF4 increased.

[0081] Figure 7 shows that spironolactone, a drug that specifically degrades ERCC3, inhibits the proliferation of cancer cells and induces differentiation in breast cancer, lung cancer, and skin cancer (e.g., melanoma).

[0082] (A) shows that when spironolactone was treated to breast cancer cell line MCF7, lung cancer cell line A549, and skin cancer cell line A375, cancer cell proliferation was significantly reduced.

[0083] (B) shows that when spironolactone was treated to breast cancer cell line MCF7, lung cancer cell line A549, and skin cancer cell line A375, the expression of BMP2, a factor that induces cell differentiation, and cell differentiation markers [differentiation marker of normal breast cells (Breast luminal cells): GATA3, differentiation marker of normal alveolar cells (Lung AT1 cells): NKX2-1 and SCGB1A1, normal skin (Keratinocytes) cell marker: KRT1)] increased.

[0084] The following examples illustrate preferred embodiments of the present invention. The following examples should not be construed as limiting the scope of the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains ("one of ordinary skill in the art").

[0085] ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)] is a gene that encodes the core helicase unit (TFIIH Core Complex Helicase Subunit) of the TFIIH complex involved in DNA repair and gene transcription. The ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit also known as XPB, Xeroderma Pigmentosum group B) protein functions as a helicase that unwinds the DNA double helix during DNA replication or damage repair.

[0086] Normal cells are the fundamental units that make up all tissues and organs in our bodies. They divide and grow according to a set cell cycle, and when damaged, they undergo apoptosis, a process that maintains a balanced cell population. Key characteristics of normal cells include normal cell cycle regulation, differentiation ability, contact inhibition, a finite lifespan, and a normal morphology (regular shape and size when viewed under a microscope, with a consistent ratio of nucleus to cytoplasm).

[0087] Cancer cells are abnormally transformed cells that have undergone genetic mutations in normal cells. Cancer cells have lost their normal cellular regulatory functions, leading to uncontrolled proliferation, invasion of surrounding tissues, and the potential for metastasis to other organs. Compared to normal cells, cancer cells exhibit key characteristics such as uncontrolled proliferation, abnormal differentiation, loss of contact inhibition, evasion of apoptosis, invasion and metastasis, and abnormal morphology (e.g., large, irregular nuclei, abnormal cytoplasm, and increased nuclear-cytoplasmic ratio).

[0088] Normal-like cell or normal-functioning cell is a term used in various contexts in the medical and biological fields, and in the present invention, it is used to mean a cell with transcriptome expression, function, and morphology similar to that of a normal cell.

[0089] Example

[0090] Discovery of ERCC3 as a target gene for reversing colon cancer

[0091] From pairs of colorectal cancer organoids and normal colon organoids generated from the tumor and adjacent normal tissue of a colorectal cancer patient, the two organoids were dissociated at the single-cell level, and single-cell transcriptome data was obtained to analyze the cell distribution [see the left panel of Figure 1 (A)]. Single-cell RNA-seq data was generated by selecting surviving cells, and a gene regulatory network reflecting the cell state was constructed based on this data [see the middle panel of Figure 1 (A)]. The gene regulatory network was constructed based on the single-cell transcriptome data, and in silico gene knockout simulations were performed for all genes to identify candidate drug target genes that can induce cancer cell dedifferentiation. Through this analysis, we identified candidate drug target genes that can induce normal cancer cell differentiation and contribute to cancer cell suppression. Candidate genes were selected based on a set of genes that showed relatively low expression in normal organoids but were simultaneously highly expressed in cancer organoids. This is a strategy that prioritizes genes that are likely to contribute to the restoration of normal function when inhibited [see the right panel of Fig. 1 (A)]. Differentially regulated (DR) genes of cancer reversible drug candidates were confirmed to be highly expressed in malignant stem cells and lowly expressed in differentiated normal intestinal epithelial cells (enterocytes). From this, ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)] was discovered.

[0092] We performed low-dimensional mapping UMAP (Uniform Manifold Approximation and Projection) analysis on single-cell transcriptomes. The analysis revealed the identification of various cell populations within colon cancer organoids and normal colon organoids. The identified cell populations consisted of colon stem cells, tansit-amplifying cells, early enterocytes, and differentiated enterocytes. Figure 1 (C) shows the expression levels and proportions of representative marker genes for each cell population. KRT20 and KLF4 were identified as representative marker genes for fully differentiated intestinal epithelial cells. Comparing the compositional proportions of each cell type between normal and colon cancer organoids, we observed an increased proportion of stem cells and tansit-amplifying cells in colon cancer organoids (see Figure 1 (D)).

[0093] Clustering analysis based on the results of low-dimensional mapping UMAP (Uniform Manifold Approximation and Projection) analysis was performed to visualize the phenomenon of stem cell clusters being separated into two sub-clusters [see Fig. 1 (E)]. Cluster 1 is mainly composed of colon cancer cells, and the cell cluster was classified as colon cancer stem cells. When comparing the MYC target genes, cancer signatures, and cell proliferation-related signature scores between stem cell sub-clusters, it was confirmed that cluster 1, which differentiated into cancer stem cells, showed higher activity of cancer-related signatures [see Fig. 1 (F)]. Transcriptional Age Index (TAI) analysis, which is an index that quantitatively evaluates whether a cell has more gene expression characteristics of a primitive unicellular organism or more gene expression characteristics of a multicellular organism, was performed. A higher TAI value indicates stronger multicellular characteristics (characteristics of normal cells), and a lower TAI value indicates stronger unicellular characteristics (characteristics of cancer cells). In general, cancer cells are known to have transcriptional immaturity and many of the expression characteristics of primitive unicellular cells. The analysis results confirmed that Cluster 1 showed higher transcriptional immaturity than Cluster 2 and differentiated cells. This means that Cluster 1, which is expected to have strong cancer cell characteristics, has a lower TAI value, indicating that it exhibits more characteristics similar to primitive cells (characteristics of cancer cells).

[0094] We compared the signature scores of various cells associated with genes differentially regulated (DR) by ERCC3 between Cluster 1 and differentiated cells. As a result, Cluster 1 showed a high expression of oncogenes among genes regulated by ERCC3 [see Fig. 1(H)]. Gene ontology (GO) analysis was performed on the set of genes whose expression is regulated by ERCC3. As a result, it was confirmed that WNT signaling, cell cycle, and colorectal cancer-related signaling pathways were significantly enriched.

[0095] Comparing the expression levels of the ERCC3 gene and displaying them as a violin plot, the expression of ERCC3 in colon cancer organoids was statistically significantly higher than that in normal colon organoids [see Fig. 1 (J)]. Based on the TCGA (The Cancer Genome Atlas) colon cancer patient data, a survival analysis according to the level of ERCC3 expression was performed, and the result of displaying it as a Kaplan-Meier survival curve confirmed that the survival rate was significantly lower in the ERCC3 high-expression group [see Fig. 1 (K)].

[0096] ERCC3's cancer reversal mechanism

[0097] To specifically detect the binding site of ERCC3, the FLAG-tagged ERCC3 gene was introduced into the colon cancer cell line HT29, and the DNA binding site of ERCC3 was analyzed at the genome-wide level through ChIP-seq experiments. The design of the ChIP-seq analysis experiment to identify the DNA binding site of ERCC3 in the colon cancer cell line HT29 is shown in Fig. 1 (A). The ChIP-seq analysis results showed that more than 90% of the total binding sites of ERCC3 were located in distal intergenic and intron regions. This indicates that ERCC3 binds to sites that perform functions related to nucleotide excision repair (NER). Approximately 4.4% of the total binding sites are located in the promoter region of the gene, which suggests that ERCC3 plays a gene expression regulatory function [see Fig. 2 (B)]. Transcription at the promoter region requires dissociation of DNA hydrogen bonds. Reflecting this, we analyzed whether signals of H3K4me3 (an active promoter marker) and RNA polymerase II were present around the ERCC3 ChIP-seq peak. As a result, we confirmed that signals of H3K4me3 (an active promoter marker) and RNA polymerase II were present together around the ERCC3 peak located in the promoter region [see Figure 2 (C)].

[0098] HMGA1 is an activator of the WNT signaling pathway and induces epigenetic changes that enable transcription of WNT target genes. G3BP1 G3BP1 (GTPase Activating Protein (SH3 Domain) Binding Protein 1) inhibits the function of the Adenomatous Polyposis Coli destruction complex (APC destruction complex), which mediates the degradation of β-catenin, thereby increasing the nuclear localization of β-catenin and promoting the transcription of WNT target genes. The complex is composed of APC, AXIN, Glycogen Synthase Kinase 3 beta (GSK3β), and Casein Kinase 1 (CK1), and induces ubiquitination and degradation of β-catenin through phosphorylation. In addition, KRAS is a central gene in the RAS-MAPK signaling pathway, and is involved in cell proliferation and survival. It is known to induce cancer cell proliferation and progression through mutation or overexpression, especially in various solid cancers including colon cancer. The present inventors analyzed whether ERCC3 binds to the promoter region of specific genes and confirmed that ERCC3 specifically binds to the promoters of KRAS, HMGA1, and G3BP1. When ERCC3 was inhibited, the expression of these genes was significantly reduced, demonstrating that ERCC3 directly contributes to the transcriptional activity of these genes. Since KRAS plays a key role in cancer cell proliferation, and HMGA1 and G3BP1 play a key role in the activation of the WNT signaling pathway and maintenance of the stemness of cancer cells, it is suggested that regulating ERCC3 can simultaneously inhibit major tumor-promoting pathways in cancer cells [see Fig. 2 (D)].

[0099] To assess the common functions of ERCC3 target genes, we performed gene ontology (GO) analysis. As a result, ERCC3-bound genes primarily contributed to the proliferation and development of colorectal cancer, and in particular, contained features associated with colorectal cancer progression, such as epithelial-mesenchymal transition (EMT). We confirmed that ERCC3 directly contributes to the activation of key oncogenic pathways by binding to the promoter regions of genes involved in the KRAS and WNT signaling pathways [see Figure 2 (E)].

[0100] We found that ERCC3 promotes proliferation through KRAS expression and induces WNT signaling pathway activation, increased stemness, and cancer cell proliferation through HMGA1 and G3BP1 expression. This suggests that ERCC3 plays a role in enhancing the cancer cell potential (proliferation and undifferentiation characteristics) of colon cancer [see Fig. 2 (F)], and further suggests that suppression of ERCC3 expression may be a key molecular approach for the reversibility of colon cancer cells.

[0101] To confirm that the infinite proliferation capacity of colon cancer is closely related to the activity of KRAS (associated with the MAPK pathway) and the WNT signaling pathway, we performed gene set enrichment analysis (GSEA) to assess whether the reduction in ERCC3 expression leads to the inhibition of these pathways. As a result, ERCC3 inhibition resulted in an overall decrease in the expression of genes related to KRAS-MAPK and WNT signaling [see Figure 3 (A)]. This suggests that the reduction in ERCC3 expression can simultaneously inhibit the activity of KRAS-MAPK and WNT pathways. Furthermore, to verify the above results at the protein level, we performed western blot analysis in HT29 cells. It was clearly confirmed that ERCC3 inhibition decreased the activity of KRAS and its downstream signaling pathway, the MAPK pathway [see Figure 3 (B)]. Additionally, gene ontology (GO) analysis was performed to evaluate how the activity of the KRAS and WNT signaling pathways actually affects downstream proliferation-related genes. We confirmed that the overexpression of colon cancer proliferation-related genes, including MYC, as well as key cell proliferation genes, such as MKI67 and PCNA, in cancer cells was regulated by ERCC3 [see Fig. 3 (C)]. This suggests that ERCC3 inhibition effectively suppresses the overexpression of cancer-related genes, including MYC, as well as key cell proliferation-related genes, such as MKI67 and PCNA, in cancer cells by inhibiting KRAS (MAPK pathway) and the WNT signaling pathway.

[0102] Therapeutic effect of ERCC3 on reversible cancer using colon cancer cell lines

[0103] The effect of ERCC3 inhibition on cell proliferation through cancer reversal was evaluated in three colon cancer cell lines (HT29, HCT116, CACO2). When ERCC3 was inhibited in all three colon cancer cell lines using shERCC3 #1 of sequence number 1 (GCCATTTCTAAGACTGCTGAA) and shERCC3 #2 of sequence number 2 (CGGGAATATGTGGCAATCAAA), it was confirmed that ERCC3 inhibition significantly inhibited the proliferation of colon cancer cells [see Fig. 3 (D)]. However, it can be predicted that ERCC3, a reversible target of colon cancer cells, would have no or minimal effect on the proliferation of normal colon cells. In fact, when ERCC3 was inhibited in the normal colon epithelial cell line NCM460, it was confirmed that there was little or no change in the cell proliferation rate [see Fig. 3 (E)]. This suggests that ERCC3 inhibition acts specifically on cancer cells and may be a treatment strategy without side effects.

[0104] Therapeutic effect of ERCC3 on cancer reversibility using a colon cancer transplant mouse model

[0105] The in vivo effect of ERCC3 inhibition was evaluated by transplanting three types of colon cancer cell lines (HT29, HCT116, and CACO2) into mice. Measurements of tumor volume increase over time revealed that ERCC3 inhibition significantly reduced tumor proliferation rates in all three colon cancer cell lines [see Fig. 3 (F)]. Furthermore, measurements of tumor tissue weight at the end of the experiment revealed a significant decrease in tumor tissue weight in the ERCC3 inhibition group [see Fig. 3 (G)].

[0106] Verification of the reversibility of colon cancer through ERCC3 inhibition

[0107] Inhibition of ERCC3 expression in the colon cancer cell line HT29 resulted in a decrease in cancer cell characteristics and an increase in differentiation-related characteristics of normal colon epithelial cells. Accordingly, we confirmed that ERCC3 inhibition contributes to the induction of differentiation of colon cancer cells into normal cells. Furthermore, gene expression analysis was performed to assess whether the induction of normal differentiation in colon cancer cells restores the expression of genes related to normal colon function. We confirmed that ERCC3 inhibition increased the expression of various genes related to normal colon functions, including colon-specific digestive enzyme secretion, tight junction formation, microvilli structure maintenance, ion channels, and colon-specific transcription factor expression. When ERCC3 was suppressed, the expression of genes that are key to maintaining the polarity and barrier function of colonic epithelial cells, such as brush border, tight junction-related genes, and apical junction complex genes, which are representative structural features of normal colonic tissue, increased [see Figure 4 (A)-(C)].

[0108] To confirm the reversibility of colon cancer, we analyzed the expression of KLF4 and KRT20, markers of normal intestinal epithelial cells. KLF4 is specifically expressed in normal colonic epithelial cells and is a transcription factor that regulates the expression of intestinal alkaline phosphate (IAP), which plays a crucial role in intestinal mucosal protection. Therefore, it was selected as a marker of normal colonic epithelial cells. KRT20 was also selected as a marker of colonic epithelial cell differentiation because it has been reported to be specifically expressed in differentiated intestinal epithelial cells in normal colon tissue.

[0109] When ERCC3 was suppressed in two colon cancer cell lines (HT29 and CACO2), the expression of KRT20 and KLF4, differentiation markers of normal colon epithelial cells, both increased statistically significantly [see Fig. 4(D)]. This suggests that suppression of ERCC3 expression induces a differentiated state in colon cancer cells.

[0110] This normal differentiation phenomenon is closely related to increased BMP2 expression. Normal colonic epithelial cells begin proliferation and initial differentiation in an environment rich in WNT signaling at the base of the crypt. As they gradually migrate upward, they are exposed to an environment where WNT signaling decreases and BMP signaling increases, transforming into fully differentiated functional epithelial cells. During this process, BMP2 acts as a key signal that induces complete differentiation and functional recovery of cells. ERCC3 was thought to play a role in maintaining this differentiation-inhibiting environment. To verify this, GSEA analysis and comparison of BMP2 expression levels confirmed that suppression of ERCC3 expression significantly increased BMP2 expression [see Figures 4 (E) and (F)]. Previously, we confirmed that suppression of ERCC3 inhibited the activity of WNT signaling, and this suppression of WNT signaling induced the activation of BMP2 signaling, which in turn promoted normal differentiation of colon cancer cells. This result explains the mechanistic relationship in which the decrease in ERCC3 expression activates BMP2 signaling, thereby normalizing colon cancer cells to a state similar to normal intestinal epithelial cells [see (G) of Figure 4].

[0111] Reversible treatment of colorectal cancer using spironolactone, a selective ERCC3 inhibitor

[0112] Spironolactone is a known aldosterone receptor antagonist. However, recent studies have shown that it reduces the protein levels of ERCC3, a key component of the nucleotide excision repair (NER) pathway. This mechanism is believed to inhibit NER activity by inducing ubiquitination and proteasome-dependent degradation of ERCC3. Based on molecular characteristics, colorectal cancer is classified into four types: Consensus Molecular Subtype (CMS)1, CMS2, CMS3, and CMS4. Each CMS is known to exhibit unique gene expression characteristics and drug responsiveness. Given that ERCC3 expression is commonly important for maintaining cancer cell viability, it is anticipated that reversible therapeutic strategies targeting ERCC3 may be effective regardless of CMS subtype. From this perspective, it was confirmed that when spironolactone was treated to five colon cancer cell lines corresponding to Consensus Molecular Subtype (CMS) 1-4 (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116 and CACO2), proliferation inhibition and differentiation induction occurred through ERCC3 degradation [see Fig. 5 (A)].

[0113] When spironolactone was treated with five colon cancer cell lines corresponding to Consensus Molecular Subtype (CMS) 1-4 (CMS-1: SW48, CMS-2: NCI-H508, CMS-3: HT29, CMS-4: HCT116, and CACO2), cell proliferation decreased in a concentration-dependent manner and the expression of colon differentiation markers KRT20 and KLF4 increased [see Fig. 5 (B) and (C)]. This suggests that spironolactone inhibits the proliferation of colon cancer cells by inducing the specific degradation of ERCC3 and induces their reversibility to a state similar to normal-like cells (or normal functional cells). These results suggest that spironolactone will have relatively little effect on normal cells. In fact, when spironolactone was treated on a normal colon cell line (NCM460), it was confirmed that, unlike colon cancer cell lines, there was almost no inhibition of cell growth [see Figure 5 (D) and (E)]. In addition, when spironolactone was treated, the IC of colon cancer cell lines and normal colon cell lines 50 Comparing the values, IC for colon cancer cells 50 While this commonly appears to be less than 200 μM and is sensitive to spironolactone, normal colon cell lines have IC values ​​more than three times higher than this. 50 The values ​​show that there is a relatively high resistance to cell proliferation [see (F) in Fig. 5]. Meanwhile, when analyzing the death of colon cancer cells after spironolactone treatment and ERCC3 expression inhibition, cell death was almost not induced by ERCC3 inhibition alone through gene regulation or drug treatment [see (G) in Fig. 5]. In summary, this suggests that spironolactone can exhibit a therapeutic effect that selectively acts on cancer cells to inhibit proliferation while minimizing side effects on normal cells during the reversible treatment of colon cancer.

[0114] When Aldactone®, which contains spironolactone as its main ingredient, was orally administered to mice with subcutaneous or colonic colorectal cancer, the tumor size and proliferation rate were significantly reduced [see Fig. 5 (H) and (J)]. When spironolactone was administered intraperitoneally to mice, the tumor suppression effect was reproduced as when administered orally [see Fig. 5 (I) and (J)]. This means that spironolactone can induce the reversibility of cancer cells by specifically degrading ERCC3, inhibiting the proliferation of colorectal cancer, and simultaneously inducing normal differentiation, both in vitro and in vivo. In addition, it was confirmed that ERCC3 inhibition was excellent in the treatment of colorectal cancer, while not causing toxicity in the liver and kidney of mice [see Fig. 5 (K)]. These results suggest that the use of pharmaceutically acceptable salts based on ERCC3 inhibition in colorectal cancer patients in the future has the potential to minimize side effects.

[0115] Reversible treatment of colorectal cancer using BPK-21, an ERCC3-selective inhibitor

[0116] When BPK-21, a functional inhibitor (enzyme activity inhibitor) of ERCC3, was treated with five colon cancer cell lines (HT29, HCT116, CACO2, SW48, NCI-H508), it was confirmed that the proliferation of cancer cells was significantly reduced and the expression of colon differentiation markers KRT20 and KLF4 increased depending on the treatment concentration [see Figures 6 (A) and (B)]. This suggests that BPK-21 can effectively inhibit the function of ERCC3, thereby not only inhibiting the proliferation of colon cancer cells but also inducing a transition (reversibility) to a differentiation state similar to that of normal colon epithelial cells.

[0117] Expanding the Reversible Cancer Treatment Using Spironolactone, an ERCC3-Selective Inhibitor

[0118] When spironolactone was treated to breast cancer cell line MCF7, lung cancer cell line A549, and skin cancer (melanoma) cell line A375, it was confirmed that cancer cell proliferation decreased in a concentration-dependent manner, and at the same time, the expression of KRAS involved in cancer cell proliferation decreased. In addition, the expression of BMP2, a factor that induces cell differentiation, and the expression of cell differentiation markers (differentiation marker of normal breast cells (Breast luminal cells): GATA3, marker of normal alveolar cells (Lung AT1 cells): NKX2-1 and SCGB1A1, marker of normal skin (Keratinocytes) cells: KRT1) were confirmed to significantly increase [see Figures 7 (A) and (B)]. This demonstrates that spironolactone exerts a reversible therapeutic effect of inhibiting cancer cell potential and inducing differentiation in cancers other than colon cancer (e.g., breast cancer, lung cancer, and skin cancer, etc.) by degrading ERCC3.

Claims

A pharmaceutical composition for preventing or treating cancer, comprising spironolactone of the following chemical formula 1 or a pharmaceutically acceptable salt thereof, or BPK-21 of the following chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient, A pharmaceutical composition for preventing or treating cancer, which specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal function cells). [Chemical Formula 1] [Chemical Formula 2] A pharmaceutical composition for preventing or treating cancer, wherein the composition reduces the expression of one or more genes selected from the group consisting of KRAS, HMGA1, and G3BP1. A pharmaceutical composition for preventing or treating cancer, which increases the expression of the BMP2 gene in claim 1. A pharmaceutical composition for preventing or treating cancer, characterized in that it reduces overexpression in cancer cells of MYC, a cancer-related gene, and MKI67 and PCNA, key genes related to cell proliferation that are overexpressed in cancer cells, in claim 1. A pharmaceutical composition for preventing or treating cancer, wherein the cancer in claim 1 is selected from the group consisting of colon cancer, breast cancer, lung cancer, and melanoma. In claim 5, the cancer is colon cancer, and the composition is a pharmaceutical composition for preventing or treating cancer that increases the expression of KRT20, KLF4, or KRT20 and KLF4. A pharmaceutical composition for preventing or treating cancer, wherein the cancer is breast cancer and the composition increases the expression of GATA3. In claim 5, the cancer is lung cancer, and the composition is a pharmaceutical composition for preventing or treating cancer that increases the expression of NKX2-1, SCGB1A1, or NKX2-1 and SCGB1A1. A pharmaceutical composition for preventing or treating cancer, wherein the cancer is melanoma and the composition increases the expression of KRT1. A method for screening a drug that specifically inhibits ERCC3 (ERCC Excision Repair 3, TFIIH Core Complex Helicase Subunit) [also called XPB (Xeroderma Pigmentosum group B)], thereby inhibiting the proliferation of cancer cells and inducing normal differentiation, thereby reversing cancer cells into normal-like cells (or normal function cells). (a) a step of treating a candidate substance to cancer cells in vitro; (b) a step of measuring the expression level of ERCC3 in cancer cells treated with the candidate substance; (c) a step of selecting a candidate substance that shows a lower expression level of ERCC3 than that of the untreated control group; and (d) A method comprising a step of determining a candidate substance that reduces the expression of one or more genes selected from the group consisting of KRAS, HMGA1, and G3BP1 and increases the expression of the BMP2 gene among the candidate substances selected in the above step (c) as a drug that reverts cancer cells into normal-like cells (or normal function cells). A method for screening a drug that reverts cancer cells into normal-like cells (or normal functioning cells), wherein the drug that reverts cancer cells into normal-like cells (or normal functioning cells) reduces overexpression of MYC, a cancer-related gene, and MKI67 and PCNA, key genes related to cell proliferation, in cancer cells. A method for screening a drug that reverts cancer cells into normal-like cells (or normal function cells), wherein the cancer is selected from the group consisting of colon cancer, breast cancer, lung cancer, and melanoma. A method for screening a drug that reverts cancer cells into normal-like cells (or normal functioning cells), wherein the cancer is colon cancer, and the composition increases the expression of KRT20, KLF4, or KRT20 and KLF4. A method for screening a drug that reverts cancer cells into normal-like cells (or normal function cells), wherein the cancer is breast cancer and the composition increases the expression of GATA3. A method for screening a drug that reverts cancer cells into normal-like cells (or normal function cells), wherein the cancer is lung cancer, and the composition increases the expression of NKX2-1, SCGB1A1, or NKX2-1 and SCGB1A1. A method for screening a drug that reverts cancer cells into normal-like cells (or normal function cells), wherein the cancer is melanoma and the composition increases the expression of KRT1 in claim 12.

Images