Reverse transcriptases and gene editing systems comprising such

Modified reverse transcriptase polypeptides with specific mutations enhance the efficiency and accuracy of CRISPR-Cas systems for gene editing, enabling precise genetic modifications.

WO2026015832A2PCT designated stage Publication Date: 2026-01-15ARBOR BIOTECHNOLOGIES INC
View PDF 97 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/037337
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-12
Filing Date
2025-07-11
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

Existing CRISPR-Cas systems for gene editing are limited in efficiency and accuracy, particularly when combined with reverse transcriptases, necessitating the development of more effective and precise gene editing systems.

Method used

Development of reverse transcriptase polypeptides with specific mutations and combinations with RNA-guided nucleases, such as CRISPR nucleases, to enhance gene editing efficiency and accuracy.

Benefits of technology

The modified reverse transcriptase polypeptides demonstrate enhanced gene editing capabilities, including precise introduction of nucleotide substitutions, insertions, and deletions at target genomic sites, offering improved therapeutic potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000055_0001
    Figure IMGF000055_0001
  • Figure IMGF000056_0001
    Figure IMGF000056_0001
  • Figure IMGF000057_0001
    Figure IMGF000057_0001
Patent Text Reader

Abstract

Reverse transcriptase (RT) polypeptides derived from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 and fusion polypeptides comprising such an RT polypeptide and an RNA-guided nuclease. Also provided herein are gene editing systems comprising the RT polypeptide, the RNA-guided nucleases, a guide RNA, and an RT donor RNA for use in gene editing.
Need to check novelty before this filing date? Find Prior Art

Description

Atorney Docket No.: 063586-543001WO REVERSE TRANSCRIPTASES AND GENE EDITING SYSTEMS COMPRISING SUCH CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing date of U.S. Provisional Application No.63 / 670,469, filed July 12, 2024, the entire contents of which is incorporated herein by reference. SEQUENCE LISTING The instant application contains a Sequence Listing which has been filed electronicaly in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on July 10, 2025, is named 063586-543001WO_Seq-Listing_ST26.xml and is 110,669 bytes in size. BACKGROUND Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR- associated (Cas) genes, colectively known as CRISPR-Cas or CRISPR / Cas systems, are adaptive immune systems in archaea and bacteria that defend particular species against foreign genetic elements. Reverse transcriptases (RTs) are a family of enzymes that generate a strand of DNA that is complementary to an RNA template. The combination of reverse transcriptases and CRISPR / Cas systems has shown great potential in gene editing. CRISPR-guided reverse transcription alows for introduction of desired nucleotide substitutions at a genomic site. It is therefore of great interest to develop eficient and accurate reverse transcriptase-CRISPR gene editing systems for use in disease treatment. SUMMARY OF THE PRESENT DISCLOSURE The present disclosure is based, at least in part, on the development of diverse reverse transcriptase polypeptides and variants thereof having desired gene editing activities when co- used with RNA-guided nucleases such as CRISPR nucleases. Accordingly, provided herein are reverse transcriptase (RT) polypeptides, fusion polypeptides comprising the RT polypeptides and RNA-guided nucleases, gene editing systems comprising the RT polypeptides, the RNA- guided nucleases, and RNA templates, and uses thereof in gene editing. Accordingly, in some aspects, the present disclosure features a reverse transcriptase (RT) polypeptide, which comprises (i) a polymerase domain comprising a fingers subdomain,Atorney Docket No.: 063586-543001WO a palm subdomain, and a thumb subdomain, (i) a connection subdomain, and (ii) an RNase domain or a PrimPol domain. In some instances, the RT polypeptide may further comprise (iv) a protease domain. The RT polypeptide provided here may comprise a YXDD motif, in which X represents a naturaly-occuring amino acid residue, e.g., YADD (SEQ ID NO: 87), YMDD (SEQ ID NO: 88), or YVDD (SEQ ID NO: 89). In some instances, the RT polypeptide provided herein may have a length of about 450 to 940 amino acids. In some embodiments, the RT polypeptide provided herein may which comprises an amino acid sequence at least 85% (e.g., at least 90%, at least 95%, at least 98% or above) identical to a reference sequence (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; or SEQ ID NO: 5). In some instances, the RT polypeptide comprises at least one mutation relative to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4; or SEQ ID NO: 5. In some embodiments, the RT polypeptide provided herein comprises an amino acid sequence at least 90% identical to SEQ ID NO: 1 and one or more mutations relative to SEQ ID NO: 1. The one or more mutations may comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof. In some instances, the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions W5, I13, S43, P49, L52, N53, K58, A107, A110, D114, H149, N313, G478, I501, P543, L585, D597, and L603 in SEQ ID NO: 1. For examples, the substitutions at these positions may be W5R, I13R, S43R, P49R, L52R, N53R, K58R, A107R, A110R, D114K, H149R, N313R, G478R, I501R, P543R, L585R, D597R, and / or L603R. See also Table 15 below. In some examples, the arginine / lysine substitutions may be at one or more of positions I13 (e.g., I13R), L52 (e.g., L52R), A107 (e.g., A107R), and D114 (e.g., D114K). Alternatively or in addition, the RT polypeptide may comprise or further comprise one or more amino acid residue substitutions (e.g., non-arginine or lysine substitutions) at position S316 and / or position L460. Examples include S316P and / or L460W. In some examples, the RT polypeptide provided herein may comprise a combination of mutations (e.g., a combination of amino acid substitutions and / or deletions) relative to SEQ ID NO: 1. For example, the RT polypeptide may comprise mutations at (a) position K58 (e.g., K58R), and (b) position D114 (e.g., D114K), A117 (e.g., A117R), S316 (e.g., S316P), and / or L460 (e.g., L460W) relative to SEQ ID NO: 1. Specific examples of multiple mutation positions and combinations of amino acid substitutions are listed in Table 21 or the combination of mutations listed in Table 21, each of which is within the scope of the presentAtorney Docket No.: 063586-543001WO disclosure. In one specific example, the RT polypeptide contains amino acid substitutions at positions K58, D114 and L460 of SEQ ID NO: 1 (e.g., K58R, D114K, and L460W). In another specific example, the RT polypeptide contains amino acid substitutions at positions K58, A117, S316 and L460 of SEQ ID NO: 1 (e.g., K58R, A117R, S316P, and L460W). In other embodiments, the RT polypeptide provided herein may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 2 and one or more mutations relative to SEQ ID NO: 2. The one or more mutations may comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof. In some examples, the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions T46, L47, Y61, E74, D159, Y160, S177, P206, P208, T224, L227, V243, T263, P264, E265, L289, V311, S392, L396, S467, S490, I511, T551, T554, Y555, H574, I575, P576, V578, P606, D607, P608, T609, S611, N612, N613, Q632, N639, H640, Q643, I700, E708, F731,and N751 in SEQ ID NO: 2. Examples include T46R, L47R, Y61R, E74R, D159R, Y160R, S177R, P206R, P208R, D209, T224R, L227R, L227K, V243R, T263R, P264R, E265R, L289R, L289K, V311R, S392R, L396K, S467R, S490R, I511R, T551R, T554R, Y555R, H574R, I575R, P576R, V578R, P606R, D607R, P608R, T609R, S611R, N612R, N613R, Q632R, N639R, H640R, Q643R, I700R, E708R, F731R, and / or N751R. See also Table 16 and Table 22 below. In some instances, the arginine and / or lysine substitutions may be at one or more of positions D159 (e.g., D159R), L227 (e.g., L227R), E265 (e.g., E265R), L289 (e.g., L289R or L289K), and S490 (e.g., S490R). Alternatively, or in addition, the RT polypeptide may comprise or further comprise one or more amino acid residue substitutions (e.g., non-arginine or lysine substitutions) at position S25, A156, L227, V243, L289. T296, K424, and / or P570 of SEQ ID NO: 2. Examples include S25A, A156S, L227H, V243P, L289H, T296N, K424P, and / or P570D. In some instances, the RT polypeptide provided herein may be a truncated variant of SEQ ID NO: 2, which may comprise one or more deletions in SEQ ID NO: 2. In some examples, the one or more deletions are at the N-terminus, at the C-terminus, or both. For example, the one or more deletions comprise deletions within residues 1-93 of SEQ ID NO: 2, within residues 575-751 of SEQ ID NO: 2, or a combination thereof. In one example, the truncated variant of SEQ ID NO: 2 may contain the amino acid residues 1-574 of SEQ ID NO: 2. Alternatively, the truncated variant of SEQ ID NO: 2 may contain the amino acid residues 94-751 of SEQ ID NO: 2. In another example, the truncated variant of SEQ ID NO: 2 may contain the amino acid residues 94-574 of SEQ ID NO: 2.Atorney Docket No.: 063586-543001WO In some examples, the RT polypeptide provided herein may comprise a combination of mutations (e.g., a combination of amino acid substitutions and / or deletions) relative to SEQ ID NO: 2. In some instances, the RT polypeptide may comprises a combination of amino acid residue substitutions at (a) positions T296 (e.g., T296N) and L396 (e.g., L396K), and (b) one or more of positions S25 (e.g., S25A), A156 (e.g., A156S), D209 (e.g., D209R), L227 (e.g., L227H, or L227K), V243 (e.g., V243P), L289 (e.g., L289K, L289R, or L289H), V311 (e.g., V311R), S392 (e.g., S392R), K424 (e.g., K424P), I511 (e.g., I511R), T551 (e.g., T551R), T554 (e.g., T554R), Y555 (e.g., Y555R), and P570 (e.g., P570D). Specific examples of multiple mutation positions and combinations of amino acid substitutions are listed in Table 22 or the combination of mutations listed in Table 22, each of which is within the scope of the present disclosure. In one specific example, the RT polypeptide contains substitutions at positions T296, L396, and K424 of SEQ ID NO: 2 (e.g., T296N, L396K, and K424P). In another specific example, the RT polypeptide contains substitutions at positions T296, L396, K424, and L289 of SEQ ID NO: 2 (e.g., T296N, L396K, K424P, and L289K). In yet another specific example, the RT polypeptide contains substitutions at positions T296, L396, K424, L289, and L227 of SEQ ID NO: 2 (e.g., T296N, L396K, K424P, L289K, and L227K). In other embodiments, the RT polypeptide provided herein may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 3 and one or more mutations relative to SEQ ID NO: 3. The one or more mutations may comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof. In some examples, the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions L74, G113, D132, N139, P148, Q229, I299, E310, T314, W287, A295, T314, L360, P363, L393, G394, W396, P399, N462, A463, H467, A470, D476, A489, L492, Q505, I506, A508, E509, H511, G512, T513, D516, D519, A597, H600, V601, H602, G603, E604, I605, Y606, L611, and H642 of SEQ ID NO: 3. Examples include L74R, G113R, D132K, N139K, P148R, Q229R, I299R, E310R, T314K, W287R, A295R, T314R, T314K, L360R, P363R, L393R, G394R, W396R, P399R, N462K, N462R, A463R, H467R, A470R, D476R, A489R, L492R, Q505R, I506R, A508R, E509R, H511R, G512R, T513R, D516R, D519R, A597R, H600R, V601R, H602R, G603R, E604R, I605R, Y606R, L611R, and / or H642R. See also Table 14 below. In some examples, the arginine and / or lysine substitutions can be at one or more of positions L74 (e.g., L74R), G113 (e.g., G113R), E310 (e.g., E310R), A295 (e.g., A295R), T314 (e.g., T314K), P363 (e.g., P363R), W396 (e.g., W396R), and N462 (e.g., N462K).Atorney Docket No.: 063586-543001WO Alternatively or in addition, the RT polypeptide may comprise or further comprise one or more amino acid residue substitutions (e.g., non-arginine or lysine substitutions) at position L147, D161, F164, D208, V231, F317, W321, G339, T340, L443, D457, A470, and / or N487 of SEQ ID NO: 3. Examples include L147P, D161H, F164D, D208N, V231I, V231M, F317N, W321F, G339P, T340P, L443G, D457G, A470R, and / or N487D. In some examples, the non- arginine / lysine substitutions may be at position D208 (e.g., D208N), V231 (e.g., V231I or V231M), W321 (e.g., W321F), T340 (e.g., T340P), and / or N487 (e.g., N487D). In some instances, the RT polypeptide provided herein may be a truncated variant of SEQ ID NO: 3, which may comprise one or more deletions in SEQ ID NO: 3. In some examples, the one or more deletions are at the N-terminus, at the C-terminus, or both. For example, the one or more deletions comprise deletions within residues 1-19 of SEQ ID NO: 3, within residues 495-669 of SEQ ID NO: 3, or a combination thereof. In one example, the truncated variant of SEQ ID NO: 3 may contain the amino acid residues 20-669 of SEQ ID NO: 3. Alternatively, the truncated variant of SEQ ID NO: 3 may contain the amino acid residues 1-494 of SEQ ID NO: 3. In another example, the truncated variant of SEQ ID NO: 3 may contain the amino acid residues 20-494 of SEQ ID NO: 3. In some examples, the RT polypeptide provided herein may comprise a combination of mutations (e.g., a combination of amino acid substitutions and / or deletions) relative to SEQ ID NO: 3. In some instances, the RT polypeptide may comprises a combination of amino acid residue substitutions at (a) amino acid residue substitutions at two or al of positions D208, T314, and W321 of SEQ ID NO: 3 (e.g., D208N, T314K, and W321F), and (b) amino acid residue substitutions at one or more of positions G113, D132, D161, F164, Q229, V231, G339, E310, T340, L443, D457, N462, A463, H467, N487, and L611 of SEQ ID NO: 3 (e.g., G113R, D132K, D132H, D161H, F164D, Q229R, V231I, V231M, G339P, E310R, T340P, L443G, D457G, N462K, A463R, H467R, N487D, and / or L611W). Such RT variants of SEQ ID NO: 3 may further comprise deletions within residues 1-19 of SEQ ID NO: 3, residues 495-669 of SEQ ID NO: 2, or a combination thereof. Specific examples of multiple mutation positions and combinations of amino acid substitutions are listed in Table 20 or the combination of mutations listed in Table 20, each of which is within the scope of the present disclosure. In one specific example, the RT polypeptide contains amino acid substitutions at positions D208, T314, W321, and T340 of SEQ ID NO: 3 (e.g., D208N, T314K, W321F, and T340P). Alternatively, the RT polypeptide may contain amino acid substitutions at positions D208, T314, and W321 (e.g., D208N, T314K, and W321F). In some instances, such variants may further comprise amino acidAtorney Docket No.: 063586-543001WO substitutions at position G114, V231, E310, N462, and / or N487 (e.g., G113R, V231I, E310R, N487D, and / or N462K. In other embodiments, the RT polypeptide provided herein may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 4 and one or more mutations relative to SEQ ID NO: 4. The one or more mutations may comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof. In some examples, the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions N19, N23, A26, E70, and Q88 in SEQ ID NO: 4 (e.g., N19K, N23R, A26K, E70R, and / or Q88K). Alternatively, or in addition, the RT polypeptide provided herein may be a truncated variant of SEQ ID NO: 4, which may comprise one or more deletions in SEQ ID NO: 4. In some examples, the one or more deletions are at the N-terminus, at the C-terminus, or both. For example, the one or more deletions comprise deletions within residues 457-939 of SEQ ID NO: 4 (e.g., within residues 712-939 of SEQ ID NO: 4). In one example, the truncated variant of SEQ ID NO: 4 may contain the amino acid residues 1-711 of SEQ ID NO: 4. In another example, the truncated variant of SEQ ID NO: 4 may contain the amino acid residues 1-456 of SEQ ID NO: 4. In other embodiments, the RT polypeptide provided herein may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 5 and one or more mutations relative to SEQ ID NO: 5. The one or more mutations may comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof. In some examples, the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions S2 Q14, N19, N23, P25, D31, E35, M36, N39, N40, E43, E44, E56, M67, E70, E71, Q88, Q92, Y109, P111, P175, Q178, E179, G180, G181, N289, D292, E315, and H361 of SEQ ID NO: 5. Examples include S2R, Q14R, N19R, N23R, P25R, D31R, E35R, M36R, N39R, N40R, E43R, E44R, E56R, M67R, E70R, E71R, Q88K, Q88R, Q92R, Y109R, P111R, P175R, Q178R, E179R, G180R, G181R, N289R, D292R, E315R , and / or H361R. See also Table 18 below. Alternatively, or in addition, the RT polypeptide may comprise or further comprise one or more amino acid residue substitutions (e.g., non-arginine or lysine substitutions) at position M67, E70, E71, Q88, A223, Y109, and / or I195 of SEQ ID NO: 5. Examples include M67H, E70P, E71G, Q88H, A223V. A223M, A223I, Y109H, and / or I195H. Alternatively, or in addition, the RT polypeptide provided herein may be a truncatedAtorney Docket No.: 063586-543001WO variant of SEQ ID NO: 5, which may comprise one or more deletions in SEQ ID NO: 5. In some examples, the one or more deletions are at the N-terminus, at the C-terminus, or both. For example, the one or more deletions comprise deletions within residues 712-939 of SEQ ID NO: 5. In one example, the truncated variant of SEQ ID NO: 5 may contain the amino acid residues 1-711 of SEQ ID NO: 5. In some examples, the RT polypeptide provided herein may comprise a combination of mutations (e.g., a combination of amino acid substitutions and / or deletions) relative to SEQ ID NO: 5. In some instances, such an RT polypeptide may be a truncated version of SEQ ID NO: 5 having the amino acid residues 1-711 of SEQ ID NO: 5. In some specific examples, the truncated version may further comprise one or more amino acid substitutions at positions listed in Table 23 below. Each of the specific examples of SEQ ID NO: 5 variants with combined mutations listed in Table 23 is within the scope of the present disclosure. In one example, the RT polypeptide is the 1-711 truncated version of SEQ ID NO: 5 and contains amino acid substitutions at positions N19, N23, and Q11 (e.g., N19K, N23R, and Q11R). In another example, the RT polypeptide is the 1-711 truncated version of SEQ ID NO: 5 and contains amino acid substitutions at positions Q88 and A223 (e.g., Q88K and A223V). In yet another example, the RT polypeptide is the 1-711 truncated version of SEQ ID NO: 5 and contains amino acid substitution(s) at position D31 (e.g., D31R) and / or H361 (e.g., H361R). In stil another example, the RT polypeptide is the 1-711 truncated version of SEQ ID NO: 5 and contains amino acid substitutions at positions N19 (e.g., N19K) and E70 (e.g., E70R). In another aspect, the present disclosure features a fusion polypeptide, comprising any of the RT polypeptides disclosed herein and an RNA-guided nuclease. In some instances, the RT polypeptide in the fusion polypeptide may lack its native N-terminus Met residue. Alternatively, or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N-terminus Met residue. In some embodiments, the RNA-guided nuclease is a nickase. In some examples, the RNA-guided nuclease is a Type I CRISPR nuclease, for example, a Cas9 nuclease, which optionaly can be a Cas9 nickase variant. In other examples, the RNA- guided nuclease is a Type V CRISPR nuclease, for example, a Cas12i2 nuclease. Any of the fusion polypeptide provided herein may further comprise one or more nuclear localization signals (NLS), one or more peptide linkers, or a combination thereof. In yet other aspects, the present disclosure provides a nucleic acid, comprising a nucleotide sequence encoding any of the RT polypeptides disclosed herein or any of the fusion polypeptides comprising the RT polypeptide and the RNA-guided nuclease as also disclosed herein. In some embodiments, the nucleic acid is in a vector, for example, an expressionAtorney Docket No.: 063586-543001WO vector. In some examples, the vector may be a viral vector. Further, the present disclosure provides a gene editing system comprising: (a) an RT polypeptide as disclosed herein or a first nucleic acid encoding the RT polypeptide; (b) an RNA-guided nuclease or a second nucleic acid encoding the RNA-guided nuclease; (c) a guide RNA (gRNA) or a third nucleic acid encoding the gRNA; wherein the gRNA comprises a scafold sequence recognizable by the RNA-guided nuclease and a spacer sequence specific to a target sequence within a genomic site of interest, the targeting sequence being adjacent to a cognate protospacer adjacent motif (PAM) sequence of the RNA-guided nuclease; and (d) a reverse transcription donor RNA (RT donor RNA) or a four nucleic acid encoding the RT donor RNA; wherein the RT donor RNA comprises a primer binding site (PBS) and a reverse transcription template (RTT) sequence. In some embodiments, the RT polypeptide and the RNA-guided nuclease form a fusion polypeptide (e.g., those provided herein). In some instances, the gene editing system comprises a nucleic acid encoding the fusion polypeptide. In one example, the nucleic acid is a DNA. In another example, the nucleic acid is a messenger RNA (mRNA). In some embodiments, any of the gene editing systems provided herein comprise an RNA molecule comprising the gRNA and the RT donor RNA. In some examples, the RNA molecule further comprises a protecting sequence, which optionaly is located at the 5’ end of the RNA molecule. In some instances, the template sequence in the RT donor RNA is homologous to the genomic site of interest and comprises one or more nucleotide variations relative to the genomic site of interest. In some instances, at least one nucleotide variation is located within the target sequence. Alternatively, or in addition, at least one nucleotide variation is located in the PAM sequence. Any of the gene editing systems provided herein may further comprise one or more delivery components or vehicles such as lipid excipients (which may form lipid nanoparticles), nanoparticles, liposomes, exosomes, microvesicles, and / or a gene-gun. The delivery vehicles may be associated with one or more of elements (a)-(d) in some instances. Alternatively, or in addition, the gene editing systems may comprise one or more viral particles for producing one or more of the gene editing components disclosed herein. Also within the scope of the present disclosure are a pharmaceutical composition comprising any of the gene editing systems disclosed herein and a kit comprising the elements (a)-(d) of the gene editing system. Further, the present disclosure provides a gene editing method, comprising contactingAtorney Docket No.: 063586-543001WO the gene editing system as disclosed herein with host cels to alow for gene editing of a gene targeted by the gene editing system. In some embodiments, the host cels are cultured in vitro. In other embodiments, the host cels are located in a subject who needs gene editing of the target gene. The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention wil be apparent from the folowing drawings and detailed description of several embodiments, and also from the appended claims. DETAILED DESCRIPTION OF THE INVENTION The present disclosure is based, at least in part, on the development of reverse transcriptase (RT) polypeptides, including those with designed mutations (e.g., amino acid residue substitutions and / or deletions), which exhibited desirable activities in gene editing, for example, incorporating designed edits at a target genomic site. Accordingly, provided herein are RT polypeptides, fusion polypeptides combining both an RT polypeptide and an RNA- guided nuclease (e.g., nickase), and gene editing systems comprising such and RNA components for guiding gene editing, as wel as gene editing methods involving such. The gene editing systems comprising the RT polypeptides provided herein have demonstrated successful incorporation of edits at target genomic sites. See Examples below. Such RT polypeptides and gene editing systems comprising such are expected to be efective in introducing desired nucleotide substitutions, insertions, and / or deletions at genetic sites of interest, thereby achieving desired therapeutic efects (e.g., correcting genetic defects). The gene editing system provided herein can also be used in other areas, for example, in breeding and genomic functional studies of animals and plants. I. Reverse Transcriptases and Fusion Polypeptides Thereof As used herein, the terms “reverse transcriptase” or “RT” refer to a multi-functional enzyme that typicaly has two enzymatic activities including RNA- and DNA-dependent DNA polymerization activity. A reverse transcriptase can generate DNA from an RNA template. RT enzymes commonly used in gene editing, e.g., the Moloney Murine Leukemia Virus (MMLV) RT enzyme, typicaly comprise a polymerase domain and an RNase domain (e.g., an RNase H domain), the polymerase domain including subdomains such as the fingers subdomain, the palm subdomain, the thumb subdomain, and the connection subdomain. The RT polypeptide provided herein may comprises (i) a polymerase domain, (i) aAtorney Docket No.: 063586-543001WO connection subdomain, and (ii) an RNase domain (e.g., an RNase H domain) or a PrimPol domain, and optionaly (iv) a protease domain. In some embodiments, the polymerase domain may comprise a fingers subdomain, a palm subdomain, and a thumb subdomain. The RT polypeptide provided herein may comprise a YXDD motif, in which X represents a naturaly- occuring amino acid residue, for example, YADD (SEQ ID NO: 87), YMDD (SEQ ID NO: 88), or YVDD (SEQ ID NO: 89). In some instances, the RT polypeptide provided herein may be large in size, for example, having a length of about 450 to 940 amino acids. As used herein, the term “domain” refers to a distinct functional and / or structural unit of a polypeptide. In some instances, a functional domain may be linear. In other instances, a functional domain can be discontinuous and conformational. In some embodiments, a domain may comprise a conserved amino acid sequence. In some embodiments, provided herein are RT polypeptides derived from RT_D (SEQ ID NO: 1), RT_E (SEQ ID NO: 2), RT_F (SEQ ID NO: 3), RT_G (SEQ ID NO: 4), or RT_H (SEQ ID NO: 5). The RT polypeptides of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 are also described herein as reference RTs. Such an RT polypeptide may comprise the reference RT or a variant thereof as disclosed herein, which may comprise at least one mutation relative to the reference RT. The variant RT polypeptides provided herein are expected to possess advantageous features relative to the reference RT, for example, higher gene editing eficiency as reported in Examples below. As used herein, the term “variant RT polypeptide” refers to an RT polypeptide comprising an alteration, e.g., a substitution, insertion, deletion and / or fusion, at one or more residue positions, compared to the reference RT enzyme provided herein (the reference RT of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5). The variant RT polypeptides provided herein are expected to exhibit one or more modulated activities (e.g., enhanced) relative to the reference RT enzyme. As used herein, the term “activity” refers to a biological activity. In some embodiments, activity includes enzymatic activity, e.g., polymerase activity. In some examples, the variant RT polypeptides disclosed herein have an enhanced enzymatic activity relative to the reference RT enzyme, e.g., having an enzymatic activity at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 2- fold, 5-fold, 10-fold, or greater than that of the reference RT enzyme. In some embodiments, the variant RT polypeptide provided herein share a high sequence homology relative to the reference RT enzyme. For example, the variant RT polypeptide may comprise an amino acid sequence at least 70% (e.g., at least 80%, 85%, 90%, 95%, or higher) identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, orAtorney Docket No.: 063586-543001WO SEQ ID NO: 5. In some instances, the variant RT polypeptide may comprise an amino acid sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In some instances, the variant RT polypeptide may comprise an amino acid sequence at least 95% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. In other instances, the variant RT polypeptide may comprise an amino acid sequence at least 97% (e.g., 98%, 99%, 99.5%, or greater) identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5. The “percent identity” (a.k.a., sequence identity) of two nucleic acids or of two amino acid sequences is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol.215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength-12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, word length=3 to obtain amino acid sequences homologous to the protein molecules of the invention. Where gaps exist between two sequences, Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res.25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. In some instances, the variant RT polypeptide disclosed herein may comprise one or more arginine and / or lysine substitutions (e.g., arginine substitutions) relative to a reference RT polypeptide provided herein. “Arginine substitutions” and / or “lysine substitutions” refers to the replacement of a non-arginine or non-lysine residue in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 with an arginine or lysine residue. In some instances, one or more of the substituting arginine residues may be replaced by a conservative amino acid residue such as lysine or histidine. In some embodiments, the variant RT polypeptide provided herein may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof. Alternatively, or in addition, the variant RT polypeptide disclosed herein may comprise one or more amino acid residue substitutions, for example, conservative amino acid substitutions, either taken alone or in combination with the other types of mutations disclosed herein. As used herein, a “conservative amino acid substitution” refers to an amino acidAtorney Docket No.: 063586-543001WO substitution that does not alter the relative charge or size characteristics of the protein in which the amino acid substitution is made. Variants can be prepared according to methods for altering polypeptide sequence known to one of ordinary skil in the art such as are found in references which compile such methods, e.g., Molecular Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, or Curent Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York. Conservative substitutions of amino acids include substitutions made amongst amino acids within the folowing groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. In some embodiments, the variant RT polypeptide may comprise one or more deletions, for example, at the N-terminus and / or the C-terminus, relative to the reference RT enzyme. In some instances, the RT polypeptide in the fusion polypeptide may lack its native N-terminus Met residue. Alternatively, or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N-terminus Met residue. In some instances, the deletion mutations can be in combination with the amino acid substitutions disclosed herein (e.g., arginine substitutions, non-arginine substitutions, and / or conservative substitutions). The deletion mutations may further reduce the size of the resultant variant RT polypeptide so as to facilitate delivery and other benefits associated with smal size as provided herein. (A) RT_D and Engineered Variants Thereof In some embodiments, the RT polypeptide is derived from RT_D, including both the reference RT_D enzyme (SEQ ID NO: 1), or a variant thereof such as those disclosed herein. The variant RT polypeptides of RT_D may be produced via introducing one or more mutations (e.g., one or more amino acid substitutions and / or one or more deletions) to the reference RT_D enzyme to modulate (e.g., enhance) one or more activities of the RT enzyme. RT_D (SEQ ID NO: 1; see Table 1 below) is a large-sized RT enzyme with 603 amino acid residues and comprises the YMDD (SEQ ID NO: 88) motif. This enzyme has a polymerase domain located at positions 124-437 of SEQ ID NO: 1. Within the polymerase domain, positions 124-202 and 236-269 are deemed as the fingers subdomain, positions 203- 235 and 270-356 are deemed as the palm subdomain, and positions 357-437 are deemed as the thumb subdomain. RT_D further comprises a connection domain at positions 438-556 of SEQ ID NO: 1 and an RNase domain at positions 557-690 of SEQ ID NO: 1. The RT active site is suggested to be at positions 299-302 and the RNase active sites are suggested to be at positions D572, E602, D622, and D685.Atorney Docket No.: 063586-543001WO In some embodiments, arginine and / or lysine substitutions (e.g., arginine substitutions), non-arginine substitutions (e.g., conservative substitutions) and / or deletions (e.g., at the N-terminus and / or the C-terminus) can be introduced into RT_D to increase enzymatic activity and / or gene editing activity. Alternatively, or in addition, the variant RT polypeptide of RT_D as provided herein can contain one or more alterations relative to RT_D (SEQ ID NO: 1), e.g., one or more amino acid residue substitutions, one or more deletions, one or more insertions, one or more fusions, or a combination thereof. In some embodiments, the variant RT polypeptide of SEQ ID NO: 1 may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof relative to SEQ ID NO: 1. In some examples, the variant RT polypeptide may contain up to 20 arginine and / or lysine substitutions (e.g., up to 20 arginine substitutions, up to 20 lysine substitutions, or a combination thereof), e.g., up to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In specific examples, the variant RT polypeptide may contain 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In some examples, the variant RT polypeptide provided herein contains arginine substitutions. In some instances, the arginine and / or lysine substitutions may be located at one or more of positions: W5, I13, S43, P49, L52, N53, K58, A107, A110, D114, H149, N313, G478, I501, P543, L585, D597, and L603 in SEQ ID NO: 1. Alternatively, or in addition, the variant RT polypeptide of SEQ ID NO: 1 may comprise or further comprise one or more amino acid residue substitutions (non- arginine / lysine substitutions) at one or more of positions: S316 (e.g., S316P) and / or position L460 (e.g., L460W) of SEQ ID NO: 1. In some embodiments, a variant RT polypeptide of SEQ ID NO: 1 as disclosed herein may comprise a combination of arginine / lysine substitutions, non-arginine / lysine substitutions such as conversative substitutions, and optionaly additional mutations. In some instances, the combination of mutations may comprise an amino acid substitution at position K58 (e.g., K58R) of SEQ ID NO: 1 in combination with an amino acid substation at position D114 (e.g., D114K) and / or A117 (e.g., A117R). Further amino acid substitutions may be at one or more of positions S316 (e.g., S316P) and / or L460 (e.g., L460W). Examples of such combined mutations are provided in Table 21 below, each of which is within the scope of the present disclosure. In some instances, the substituting residue in any of the exemplary substitutions may be replaced with a conversative amino acid residue thereof. For example, instead of W, theAtorney Docket No.: 063586-543001WO substituting residue at position L460 can be F or Y, which are conservative residues to W. Such substitutions for any of the positions disclosed herein are also within the scope of the present disclosure. Any of the variant RT polypeptide of RT_D (SEQ ID NO: 1) as provided herein may share a sequence identity at least 90% (e.g., 95%, 97%, 98%, 99%, 99.5%, or greater) with SEQ ID NO: 1 and cary any of the mutations or combination of mutations as disclosed herein. In some examples, the variant of RT_D may have an N-terminus methionine residue. In some examples, the variant of the RT_D may lack the N-terminus methionine residue, for example, when the variant is fused to a functional fragment (e.g., an NLS fragment) or when the variant is at the C-terminal part in the fusion polypeptide disclosed herein. Alternatively or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N- terminus Met residue. (B) RT_E and Engineered Variants Thereof In some embodiments, the RT polypeptide is derived from RT_E, including both the reference RT_E enzyme (SEQ ID NO: 2), or a variant thereof such as those disclosed herein. The variant RT polypeptides of RT_E may be produced via introducing one or more mutations (e.g., one or more amino acid substitutions and / or one or more deletions) to the reference RT_E enzyme to modulate (e.g., enhance) one or more activities of the RT enzyme. RT_E (SEQ ID NO: 2; see Table 1 below) is a large-sized RT enzyme with 751 amino acid residues and comprises the YVDD (SEQ ID NO: 89). This enzyme has a polymerase domain located at positions 151-455 of SEQ ID NO: 2. Within the polymerase domain, positions 151-227 and 262-288 are deemed as the fingers subdomain, positions 100-150, 228- 261, and 289-370 are deemed as the palm subdomain, and positions 371-455 are deemed as the thumb subdomain. RT_E further comprises a connection domain at positions 456-584 of SEQ ID NO: 2 an RNase domain at positions 585-751 of SEQ ID NO: 2, and a protease domain located at residues 9-93 of SEQ ID NO: 2. The RT active site is suggested to be at positions 312-315 and the RNase active sites are suggested to be at positions D599, E646, D669, D740. Arginine and / or lysine substitutions (e.g., arginine substitutions), non-arginine substitutions (e.g., conservative substitutions) and / or deletions (e.g., at the N-terminus and / or the C-terminus) can be introduced into RT_E to increase enzymatic activity and / or geneAtorney Docket No.: 063586-543001WO editing activity. Alternatively or in addition, the variant RT polypeptide of RT_E as provided herein can contain one or more alterations relative to RT_E (SEQ ID NO: 2), e.g., one or more amino acid residue substitutions, one or more deletions, one or more insertions, one or more fusions, or a combination thereof. In some embodiments, the variant RT polypeptide of SEQ ID NO: 2 may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof relative to SEQ ID NO: 2. In some examples, the variant RT polypeptide may contain up to 20 arginine and / or lysine substitutions (e.g., up to 20 arginine substitutions, up to 20 lysine substitutions, or a combination thereof), e.g., up to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In specific examples, the variant RT polypeptide may contain 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In some examples, the variant RT polypeptide provided herein contains arginine substitutions. In some instances, the arginine and / or lysine substitutions may be located at one or more of positions: T46, L47, Y61, E74, D159, Y160, S177, P206, P208, T224, L227, V243, T263, P264, E265, L289, V311, S392, L396, S467, S490, I511, T551, T554, Y555, H574, I575, P576, V578, P606, D607, P608, T609, S611, N612, N613, Q632, N639, H640, Q643, I700, E708, F731,and N751 in SEQ ID NO: 2. In some instances, the variant RT polypeptide of SEQ ID NO: 2 comprises one or more arginine substitutions at these positions. Alternatively, or in addition, the variant RT polypeptide of SEQ ID NO: 2 may comprise or further one or more amino acid residue substitutions (non-arginine / lysine substitutions) at one or more of positions: S25, A156, L227, V243, L289. T296, K424, and / or P570 of SEQ ID NO: 2. Examples include: S25A, A156S, L227H, V243P, L289H, T296N, K424P, and / or P570D. Alternatively, or in addition, the variant RT polypeptide of SEQ ID NO: 2 may comprise deletions relative to SEQ ID NO: 2, for example, at the N-terminus of SEQ ID NO: 2, at the C-terminus of SEQ ID NO: 2, or a combination thereof. In some examples, the deletion may be within an N-terminal fragment of SEQ ID NO: 2, for example, within residues 1-93 of SEQ ID NO: 2. In some examples, the deletion may be within a C-terminal fragment of SEQ ID NO: 2, for example, within residues 575-751 of SEQ ID NO: 2. In one example, the variant RT polypeptide of SEQ ID NO: 2 is an N-terminal truncated version of the reference enzyme, e.g., having a deletion of residues 1-93 SEQ ID NO: 2. In another example, the variant RT polypeptide of SEQ ID NO: 2 is a C-terminal truncated version of the reference enzyme, e.g., having a deletion of residues 575-751 of SEQ ID NO: 2. In yetAtorney Docket No.: 063586-543001WO another example, the variant RT polypeptide of SEQ ID NO: 2 may have deletions at both the N-terminus and the C-terminus of the reference enzyme. Such a truncated version may have the amino acid residues 94-574 of SEQ ID NO: 2. In some embodiments, a variant RT polypeptide of RT_E as disclosed herein may comprise a combination of arginine / lysine substitutions, non-arginine / lysine substitutions such as conversative substitutions, and deletions. In some instances, such a variant enzyme may comprise at least two amino acid substitutions among positions T296, L396, K424, and L289. Exemplary substitutions at such positions include T296N, L396K, K424P, L289K, L289H, or L289R. In some examples, the variant enzyme comprises three amino acid substitutions among these positions (e.g., T296N / L396K / K424P, T296N / L396K / L289K). In other examples, the variant enzyme comprises amino acid substitutions at al of the four positions (e.g., T296N / L396K / K424P / L289K). Such variants may further comprise amino acid substitutions at one or more of positions S25, A156, D209, L227, V243, V311, S392, I511, T551, T554, Y555, and P570 of SEQ ID NO: 2 (e.g., S25A, A156S, D209R, L227H, L227K, V243P, V311R, S392R, I511R, T551R, T554R, Y555R, and P570D). In some instances, the variants may further comprise a deletion within residues 1-93 of SEQ ID NO: 2, within residues 575-751 of SEQ ID NO: 2, or a combination thereof. Examples of such combined mutations are provided in Table 22 below, each of which is within the scope of the present disclosure. In some instances, the substituting residue in any of the exemplary substitutions may be replaced with a conversative amino acid residue thereof. For example, instead of D, the substituting residue at position P570 can be E, which are conservative residues to D. Such substitutions for any of the positions disclosed herein are also within the scope of the present disclosure. Any of the variant RT polypeptide of RT_E as provided herein may share a sequence identity at least 90% (e.g., 95%, 97%, 98%, 99%, 99.5%, or greater) with SEQ ID NO: 2 and cary any of the mutations or combination of mutations as disclosed herein. In some examples, the variant of the RT_E may have an N-terminus methionine residue. In some examples, the variant of the RT_E may lack the N-terminus methionine residue, for example, when the variant is fused to a functional fragment (e.g., an NLS fragment) or when the variant is at the C-terminal part in the fusion polypeptide disclosed herein. Alternatively, or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N-terminus Met residue.Atorney Docket No.: 063586-543001WO (C) RT_F and Engineered Variants Thereof In some embodiments, the RT polypeptide is derived from RT_F, including both the reference RT_F enzyme (SEQ ID NO: 3), or a variant thereof such as those disclosed herein. The variant RT polypeptides of RT_F may be produced via introducing one or more mutations (e.g., one or more amino acid substitutions and / or one or more deletions) to the reference RT_F enzyme to modulate (e.g., enhance) one or more activities of the RT enzyme. RT_F (SEQ ID NO: 3; see Table 2 below) is a large-sized RT enzyme with 669 amino acid residues and comprises the YVDD (SEQ ID NO: 89) motif. This enzyme has a polymerase domain located at positions 29-370 of SEQ ID NO: 3. Within the polymerase domain, positions 48-132 and 168-200 are deemed as the fingers subdomain, positions 29-47, 133-167, and 201-288 are deemed as the palm subdomain, and positions 371-455 are deemed as the thumb subdomain. In addition, RT_F contains a connection domain at positions 371- 505 and an RNase domain at positions 506-669. The RT active site is suggested to be at positions 230-233 and the RNase active site is suggested to be D532, E570, D591, and D661. Arginine and / or lysine substitutions (e.g., arginine substitutions), non-arginine substitutions (e.g., conservative substitutions) and / or deletions (e.g., at the N-terminus and / or the C-terminus) can be introduced into RT_F to increase enzymatic activity and / or gene editing activity. Alternatively, or in addition, the variant RT polypeptide of RT_F (SEQ ID NO: 3) as provided herein can contain one or more alterations relative to SEQ ID NO: 3, e.g., one or more amino acid residue substitutions, one or more deletions, one or more insertions, one or more fusions, or a combination thereof. In some embodiments, the variant RT polypeptide of SEQ ID NO: 3 may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof relative to SEQ ID NO: 3. In some examples, the variant RT polypeptide may contain up to 20 arginine and / or lysine substitutions (e.g., up to 20 arginine substitutions, up to 20 lysine substitutions, or a combination thereof), e.g., up to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In specific examples, the variant RT polypeptide may contain 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In some examples, the variant RT polypeptide provided herein contains arginine substitutions. In some instances, the arginine and / or lysine substitutions may be located at one or more of positions: L74, G113, D132, N139, P148, Q229, I299, E310, T314, W287, A295, T314, L360, P363, L393, G394, W396, P399, N462, A463, H467, A470, D476, A489, L492, Q505, I506, A508, E509, H511, G512, T513, D516, D519, A597, H600, V601, H602, G603,Atorney Docket No.: 063586-543001WO E604, I605, Y606, L611, and H642 of SEQ ID NO: 3. Examples include L74R, G113R, D132K, N139K, P148R, Q229R, I299R, E310R, T314K, W287R, A295R, T314R, T314K, L360R, P363R, L393R, G394R, W396R, P399R, N462K, N462R, A463R, H467R, A470R, D476R, A489R, L492R, Q505R, I506R, A508R, E509R, H511R, G512R, T513R, D516R, D519R, A597R, H600R, V601R, H602R, G603R, E604R, I605R, Y606R, L611R, and / or H642R. Alternatively or in addition, the variant RT polypeptide of SEQ ID NO: 3 may comprise one or more amino acid residue substitutions (non-arginine / lysine substitutions) at one or more of positions: L147, D161, F164, D208, V231, F317, W321, G339, T340, L443, D457, A470, and / or N487 of SEQ ID NO: 3. Exemplary amino acid substitutions at these positions include: L147P, D161H, F164D, D208N, V231I, V231M, F317N, W321F, G339P, T340P, L443G, D457G, A470R, and / or N487D. Alternatively, or in addition, the variant RT polypeptide of SEQ ID NO: 3 may comprise deletions relative to SEQ ID NO: 3, for example, at the N-terminus of SEQ ID NO: 3, at the C-terminus of SEQ ID NO: 3, or a combination thereof. In some examples, the deletion may be within an N-terminal fragment of SEQ ID NO: 3, for example, within residues 1-19 of SEQ ID NO: 3. In some examples, the deletion may be within a C-terminal fragment of SEQ ID NO: 3, for example, within residues 495-669 of SEQ ID NO: 3. In one example, the variant RT polypeptide of SEQ ID NO: 3 is an N-terminal truncated version of the reference enzyme, e.g., having a deletion of residues 1-19 of SEQ ID NO: 3. In another example, the variant RT polypeptide of SEQ ID NO: 3 is a C-terminal truncated version of the reference enzyme, e.g., having a deletion of residues 495-669 of SEQ ID NO: 3. In yet another example, the variant RT polypeptide of SEQ ID NO: 3 may have deletions at both the N-terminus and the C-terminus of the reference enzyme. Such a truncated version may have the amino acid residues 20-494 of SEQ ID NO: 3. In some embodiments, a variant RT polypeptide of RT_F as disclosed herein may comprise a combination of arginine / lysine substitutions, non-arginine / lysine substitutions such as conversative substitutions, and deletions. In some instances, the variant RT polypeptide may contain amino acid substitutions at two or more of positions D208 (e.g., D208N), T314 (e.g., T314K), and W321 (e.g., W321F), for example, D208N / T314K, D208N / W321F, or T314K / W321F. In some examples, the variant RT polypeptide contain amino acid substitutions at al of positions D208, T314, and W321 (e.g., D208N / T314K / W321F). In some instances, such variants may further comprise one or more amino acid substitutions at positions G113, D132, D161, F164, Q229, V231, G339, E310, T340, L443, D457, N462,Atorney Docket No.: 063586-543001WO A463, H467, N487, and L611 of SEQ ID NO: 3. Examples include G113R, D132K, D132H, D161H, F164D, Q229R, V231I, V231M, G339P, E310R, T340P, L443G, D457G, N462K, A463R, H467R, N487D, and / or L611W. In some examples, the variant RT polypeptide further comprises an amino acid substitution at position T340 (e.g., T340P). In other examples, the variant RT polypeptide further comprises an amino acid substitution at position G339 (e.g., G339P). In yet other examples, the variant RT polypeptide comprises amino acid substitutions at positions D208, T314, and W321 (e.g., D208N / T314K / W321F) and at one or more additional positions G113, V231, E310, N462, and N487 (e.g., G113R, V231I, E310R, N462K, and / or N487D). Examples of such combined mutations are provided in Table 20 below, each of which is within the scope of the present disclosure. In some examples, the variant RT polypeptide is a truncated version of SEQ ID NO: 3 having residues 20-494 of SEQ ID NO: 3. In some instances, the substituting residue in any of the exemplary substitutions may be replaced with a conversative amino acid residue thereof. For example, instead of N, the substituting residue at position D208 can be Q. Such substitutions for any of the positions disclosed herein are also within the scope of the present disclosure. Any of the variant RT polypeptide of RT_F as provided herein may share a sequence identity at least 90% (e.g., 95%, 97%, 98%, 99%, 99.5%, or greater) with SEQ ID NO: 3 and cary any of the mutations or combination of mutations as disclosed herein. In some examples, the variant of RT_F may have an N-terminus methionine residue. In some examples, the variant of RT_F may lack the N-terminus methionine residue, for example, when the variant is fused to a functional fragment (e.g., an NLS fragment) or when the variant is at the C-terminal part in the fusion polypeptide disclosed herein. Alternatively, or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N- terminus Met residue. (D) RT_G and Engineered Variants Thereof In some embodiments, the RT polypeptide is derived from RT_G, including both the reference RT_G enzyme (SEQ ID NO: 4), or a variant thereof such as those disclosed herein. The variant RT polypeptides of RT_G may be produced via introducing one or more mutations (e.g., one or more amino acid substitutions and / or one or more deletions) to the reference RT_G enzyme to modulate (e.g., enhance) one or more activities of the RT enzyme. RT_G (SEQ ID NO: 4; see Table 2 below) is a large-sized RT enzyme with 939 amino acid residues and comprises the YADD (SEQ ID NO: 87) motif. This enzyme has aAtorney Docket No.: 063586-543001WO polymerase domain located at positions 1-456 of SEQ ID NO: 4. Within the polymerase domain, positions 1-79 and 148-193 are deemed as the fingers subdomain, positions 80-147 and 194-282 are deemed as the palm subdomain, and positions 357-437 are deemed as the thumb subdomain. In addition, RT_G contains a connection domain at positions 325-471 and a PrimPol domain at positions 472-711. RT_G does not have an RNase domain. The RT active site is suggested to be at positions 222-225. Arginine and / or lysine substitutions (e.g., arginine substitutions), non-arginine substitutions (e.g., conservative substitutions) and / or deletions (e.g., at the N-terminus and / or the C-terminus) can be introduced into RT_G to increase enzymatic activity and / or gene editing activity. The variant RT polypeptide of RT_G (SEQ ID NO: 4) as provided herein can contain one or more alterations relative to SEQ ID NO: 4, e.g., one or more amino acid residue substitutions, one or more deletions, one or more insertions, one or more fusions, or a combination thereof. In some embodiments, the variant RT polypeptide of SEQ ID NO: 4 may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereof relative to SEQ ID NO: 4. In some examples, the variant RT polypeptide may contain up to 20 arginine and / or lysine substitutions (e.g., up to 20 arginine substitutions, up to 20 lysine substitutions, or a combination thereof), e.g., up to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In specific examples, the variant RT polypeptide may contain 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In some examples, the variant RT polypeptide provided herein contains arginine substitutions. In some instances, the arginine and / or lysine substitutions may be located at one or more of positions: N19, N23, A26, E70, and Q88 of SEQ ID NO: 4. Examples include N19K, N23R, A26K, E70R, and / or Q88K. Alternatively or in addition, the variant RT polypeptide of SEQ ID NO: 4 may comprise deletions relative to SEQ ID NO: 4, for example, at the C-terminus of SEQ ID NO: 4. In some examples, the deletion may be within residues 457-939 (e.g., within residues 712- 939) a C-terminal fragment of SEQ ID NO: 4. In one example, the variant RT polypeptide of SEQ ID NO: 4 is a C-terminal truncated version of the reference enzyme, e.g., having a deletion of residues 457-939 of SEQ ID NO: 4. In another example, the variant RT polypeptide of SEQ ID NO: 4 may have a deletion of residues 712-939 of SEQ ID NO: 4. Such a truncated version may have the amino acid residues 1-456 or amino acid residues 1-Atorney Docket No.: 063586-543001WO 711 of SEQ ID NO: 4. Any of the variant RT polypeptide of RT_G as provided herein may share a sequence identity at least 90% (e.g., 95%, 97%, 98%, 99%, 99.5%, or greater) with SEQ ID NO: 4 and cary any of the mutations or combination of mutations as disclosed herein. In some examples, the variant of RT_G may have an N-terminus methionine residue. In some examples, the variant of RT_G may lack the N-terminus methionine residue, for example, when the variant is fused to a functional fragment (e.g., an NLS fragment) or when the variant is at the C-terminal part in the fusion polypeptide disclosed herein. Alternatively, or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N- terminus Met residue. (E) RT_H and Engineered Variants Thereof In some embodiments, the RT polypeptide is derived from RT_H, including both the reference RT_H enzyme (SEQ ID NO: 5), or a variant thereof such as those disclosed herein. The variant RT polypeptides of RT_H may be produced via introducing one or more mutations (e.g., one or more amino acid substitutions and / or one or more deletions) to the reference RT_H enzyme to modulate (e.g., enhance) one or more activities of the RT enzyme. Homologous to RT_G, RT_H (SEQ ID NO: 5; see Table 2 below) is also a large-sized RT enzyme with 939 amino acid residues and comprises the YADD (SEQ ID NO: 87) motif. This enzyme has a polymerase domain located at positions 1-456 of SEQ ID NO: 5. Within the polymerase domain, positions 1-79 and 148-193 are deemed as the fingers subdomain, positions 80-147 and 194-282 are deemed as the palm subdomain, and positions 283-324 are deemed as the thumb subdomain. In addition, RT_H contains a connection domain at positions 325-471 and a PrimPol domain at positions 472-711 of SEQ ID NO: 5. RT_H does not include an RNase domain. The RT active site is suggested to be at positions 222-225. Arginine and / or lysine substitutions (e.g., arginine substitutions), non-arginine substitutions (e.g., conservative substitutions) and / or deletions (e.g., at the N-terminus and / or the C-terminus) can be introduced into RT_H to increase enzymatic activity and / or gene editing activity. Alternatively, or in addition, the variant RT polypeptide of RT_H (SEQ ID NO: 5) as provided herein can contain one or more alterations relative to SEQ ID NO: 5, e.g., one or more amino acid residue substitutions, one or more deletions, one or more insertions, one or more fusions, or a combination thereof. In some embodiments, the variant RT polypeptide of SEQ ID NO: 5 may comprise one or more arginine substitutions, one or more lysine substitutions, or a combination thereofAtorney Docket No.: 063586-543001WO relative to SEQ ID NO: 5. In some examples, the variant RT polypeptide may contain up to 20 arginine and / or lysine substitutions (e.g., up to 20 arginine substitutions, up to 20 lysine substitutions, or a combination thereof), e.g., up to 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In specific examples, the variant RT polypeptide may contain 10, 9, 8, 7, 6, 5, 4, 3, or 2 arginine substitutions, lysine substitutions, or a combination thereof. In some examples, the variant RT polypeptide provided herein contains arginine substitutions. In some instances, the arginine and / or lysine substitutions may be located at one or more of positions: S2 Q14, N19, N23, P25, D31, E35, M36, N39, N40, E43, E44, E56, M67, E70, E71, Q88, Q92, Y109, P111, P175, Q178, E179, G180, G181, N289, D292, E315, and H361 of SEQ ID NO: 5. Examples include S2R, Q14R, N19R, N23R, P25R, D31R, E35R, M36R, N39R, N40R, E43R, E44R, E56R, M67R, E70R, E71R, Q88K, Q88R, Q92R, Y109R, P111R, P175R, Q178R, E179R, G180R, G181R, N289R, D292R, E315R, and / or H361R. Alternatively or in addition, the variant RT polypeptide of SEQ ID NO: 5 may comprise one or more amino acid residue substitutions (non-arginine / lysine substitutions) at one or more of positions: M67, E70, E71, Q88, A223, Y109, and / or I195 of SEQ ID NO: 5. Exemplary amino acid substitutions at these positions include: M67H, E70P, E71G, Q88H, A223V. A223M, A223I, Y109H, and / or I195H. Alternatively or in addition, the variant RT polypeptide of SEQ ID NO: 5 may comprise deletions relative to SEQ ID NO: 5, for example, at the C-terminus of SEQ ID NO: 5. In some examples, the deletion may be within a C-terminal fragment of SEQ ID NO: 5, for example, within residues 712-939 of SEQ ID NO: 5. Such a truncated version may have the amino acid residues 1-711 of SEQ ID NO: 5. In some embodiments, a variant RT polypeptide of RT_H as disclosed herein may comprise a combination of arginine / lysine substitutions, non-arginine / lysine substitutions such as conversative substitutions, and deletions. In some instances, the variant RT polypeptide may contain amino acid substitutions at two or more of positions of Q11 (e.g., Q11R), N19 (e.g., N19K), N23 (e.g., N23R), E70 (e.g., E70R), Q88 (e.g., Q88K), and A223 (e.g., A223V, A223M, or A223I). Examples of such combined mutations are provided in Table 23 below, each of which is within the scope of the present disclosure. In some examples, the variant RT polypeptide is a truncated version of SEQ ID NO: 5 having residues 1-711 of SEQ ID NO: 5. In some instances, the substituting residue in any of the exemplary substitutions may be replaced with a conversative amino acid residue thereof. For example, instead of V, M, I, the substituting residue at position A223 can also be L. Such substitutions for any of theAtorney Docket No.: 063586-543001WO positions disclosed herein are also within the scope of the present disclosure. Any of the variant RT polypeptide of RT_H as provided herein may share a sequence identity at least 90% (e.g., 95%, 97%, 98%, 99%, 99.5%, or greater) with SEQ ID NO: 5 and cary any of the mutations or combination of mutations as disclosed herein. In some examples, the variant of the RT_H may have an N-terminus methionine residue. In some examples, the variant of RT_H may lack the N-terminus methionine residue, for example, when the variant is fused to a functional fragment (e.g., an NLS fragment) or when the variant is at the C-terminal part in the fusion polypeptide disclosed herein. Alternatively or in addition, the RNA-guided nuclease in the fusion polypeptide may lack its native N-terminus Met residue. (F) Fusion Polypeptides In some embodiments, the RT polypeptide derived from RT_D (SEQ ID NO: 1), RT_E (SEQ ID NO: 2), RT_F (SEQ ID NO: 3), RT_G (SEQ ID NO: 4), or RT_H (SEQ ID NO: 5) as provided herein may be a fusion polypeptide comprising an RT moiety as disclosed herein and one or more additional functional elements. In some instances, the one or more additional functional elements may be heterologous to the RT moiety. As used herein, the terms “fusion” and “fused” refer to the joining of at least two nucleotide or protein molecules. For example, “fusion” and “fused” can refer to the joining of at least two polypeptide domains that are encoded by separate genes in nature. The fusion can be an N-terminal fusion, a C-terminal fusion, or an intramolecular fusion. In some aspects, the domains are transcribed and translated to produce a single polypeptide. In some instances, the RT moiety in the fusion polypeptide may be the reference RT_D (SEQ ID NO: 1), RT_E (SEQ ID NO: 2), RT_F (SEQ ID NO: 3), RT_G (SEQ ID NO: 4), or RT_H (SEQ ID NO: 5). Alternatively, the RT portion in the fusion polypeptide may be a variant of any of the reference RT enzymes as disclosed herein. Exemplary additional functional moieties to include in the fusion polypeptide include a peptide tag, a fluorescent protein, a base-editing domain, a DNA methylation domain, a histone residue modification domain, a localization factor, a transcription modification factor, a light-gated control factor, a chemicaly inducible factor, a chromatin visualization factor, or a combination thereof. In some embodiments, the additional functional moiety may comprise a nuclear localization signal (NLS), a nuclear export signal (NES), or a combination thereof. In some examples, the fusion polypeptide may comprise an NLS, which may be located at either the N-terminus or the C-terminus. In specific examples, the fusion polypeptide may comprise aAtorney Docket No.: 063586-543001WO first NLS located at the N-terminus and a second NLS located at the C-terminus. The first and second NLS fragments may be identical. Alternatively, the two NLS fragments may be diferent. In some embodiments, the fusion polypeptide may comprise an NLS near the N- terminus and / or near the C-terminus (e.g., within about 1, 2, 3, 4, or 5 of the first amino acid or last amino acid of the RT polypeptide). In some embodiments, the additional functional moiety may be a flexible peptide linker, for example, an XTEN peptide linker, or a G / S rich peptide linker. Examples of such peptide linkers are provided in Example 3 and Example 4 below, which may be applicable to any of the RNA-guided nuclease polypeptides disclosed herein. In some embodiments, the fusion polypeptide provided herein may comprise any of the RT moieties disclosed herein and an RNA-guided nuclease, such as Cas9 and Cas12i2. Such a fusion polypeptide can be used for gene editing. More details are provided in the Gene Editing System section below. Exemplary fusion polypeptides comprising an RT polypeptide, an RNA-guided nuclease, and optionaly one or more NLS signals and peptide linkers are provided in Tables 3 and 8 below. (G) Preparation of RT Polypeptides and Fusion Polypeptides Comprising Such The RT polypeptides and fusion polypeptides comprising such as disclosed herein may be prepared by conventional methods or the methods disclosed herein. For example, the RT polypeptides and fusion polypeptides comprising such can be prepared by culturing host cels such as bacteria cels or mammalian cels, capable of producing the nuclease polypeptides, isolating the nuclease polypeptides thus produced, and optionaly, purifying the nuclease polypeptides. A fusion polypeptide comprising the RT polypeptide and an RNA-guided nuclease may be complexed with a gRNA. The RT polypeptides and fusion polypeptides comprising such can be also prepared by an in vitro coupled transcription-translation system. Bacteria that can be used for preparation of the RT polypeptides and fusion polypeptides comprising such are not particularly limited as long as they can produce the RT polypeptides and fusion polypeptides comprising such. Some nonlimiting examples of the bacteria include E. coli cels described herein. Unless otherwise noted, al compositions and complexes and polypeptides provided herein are made in reference to the active level of that composition or complex or polypeptide, and are exclusive of impurities, for example, residual solvents or by-products, which may be present in commercialy available sources. Enzymatic component weights are based on totalAtorney Docket No.: 063586-543001WO active protein. Al percentages and ratios are calculated by weight unless otherwise indicated. Al percentages and ratios are calculated based on the total composition unless otherwise indicated. In the exemplified composition, the enzymatic levels are expressed by pure enzyme by weight of the total composition and unless otherwise specified, the ingredients are expressed by weight of the total compositions. (i) Vectors The present disclosure provides vectors for expressing the RT polypeptides and fusion polypeptides comprising such. In some embodiments, a vector disclosed herein includes a nucleotide sequence encoding an RT polypeptide as provided herein or a fusion polypeptide thereof. In some embodiments, the vector comprises a Pol I promoter or a Pol II promoter. Expression of natural or synthetic polynucleotides is typicaly achieved by operably linking a polynucleotide encoding the RT polypeptides and fusion polypeptides comprising such to a promoter and incorporating the construct into an expression vector. The expression vector is not particularly limited as long as it includes a polynucleotide encoding the RT polypeptides and fusion polypeptides comprising such and can be suitable for replication and integration in eukaryotic cels. Typical expression vectors include transcription and translation terminators, initiation sequences, and promoters useful for expression of the desired polynucleotide. For example, plasmid vectors carying a recognition sequence for RNA polymerase (pSP64, pBluescript, etc.). may be used. Vectors including those derived from retroviruses such as lentivirus are suitable tools to achieve long-term gene transfer since they alow long-term, stable integration of a transgene and its propagation in daughter cels. Examples of vectors include expression vectors, replication vectors, probe generation vectors, and sequencing vectors. The expression vector may be provided to a cel in the form of a viral vector. Viral vector technology is wel known in the art and described in a variety of virology and molecular biology manuals. Viruses useful as vectors include, but are not limited to phage viruses, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. The kind of the vector is not particularly limited, and a vector that can be expressed in host cels can be appropriately selected. To be more specific, depending on the kind of the host cel, a promoter sequence to ensure the expression of the polypeptide(s) from theAtorney Docket No.: 063586-543001WO polynucleotide is appropriately selected, and this promoter sequence and the polynucleotide are inserted into any of various plasmids etc. for preparation of the expression vector. Additional promoter elements, e.g., enhancing sequences, regulate the frequency of transcriptional initiation. Typicaly, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as wel. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription. Further, the disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired or turning of the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metalothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter. The expression vector to be introduced can Also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cels from the population of cels sought to be transfected or infected through viral vectors. In other aspects, the selectable marker may be caried on a separate piece of DNA and used in a co- transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate transcriptional control sequences to enable expression in the host cels. Examples of such a marker include a dihydrofolate reductase gene and a neomycin resistance gene for eukaryotic cel culture; and a tetracycline resistance gene and an ampicilin resistance gene for culture of E. coli and other bacteria. By use of such a selection marker, it can be confirmed whether the polynucleotide encoding the polypeptide(s) of the present invention has been transferred into the host cels and then expressed without fail. The preparation method using recombinant expression vectors is not particularly limited, and examples thereof include methods using a plasmid, a phage or a cosmid. Any encoding nucleic acids for the RT polypeptides or fusion polypeptides comprising such, including vectors such as expression vectors, is also within the scope of the present disclosure. (i) Methods of Expression The present disclosure includes a method for protein expression, comprisingAtorney Docket No.: 063586-543001WO translating the RT polypeptides and fusion polypeptides comprising such described herein. In some embodiments, a host cel described herein is used to express the RT polypeptides and fusion polypeptides comprising such. The host cel is not particularly limited, and various known cels can be preferably used. Specific examples of the host cel include bacteria such as E. coli, yeasts (budding yeast, Saccharomyces cerevisiae, and fission yeast, Schizosaccharomyces pombe), nematodes (Caenorhabditis elegans), Xenopus laevis oocytes, and animal cels (for example, CHO cels, COS cels and HEK293 cels). The method for transferring the expression vector described above into host cels, i.e., the transformation method, is not particularly limited, and known methods such as electroporation, the calcium phosphate method, the liposome method and the DEAE dextran method can be used. After a host is transformed with the expression vector, the host cels may be cultured, cultivated or bred, for production the RT polypeptides and fusion polypeptides comprising such. After expression, the host cels can be colected and the RT polypeptides and fusion polypeptides comprising such purified from the cultures etc. according to conventional methods (for example, filtration, centrifugation, cel disruption, gel filtration chromatography, ion exchange chromatography, etc.). A variety of methods can be used to determine the level of production of a mature RT polypeptide and fusion polypeptide comprising such in a host cel. Such methods include, but are not limited to, for example, methods that utilize either polyclonal or monoclonal antibodies specific for the proteins or a labeling tag as described elsewhere herein. Exemplary methods include, but are not limited to, enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (MA), fluorescent immunoassays (FIA), and fluorescent activated cel sorting (FACS). These and other assays are wel known in the art (See, e.g., Maddox et al., J. Exp. Med.158:1211

[1983] ). The present disclosure provides methods of in vivo expression of the RT polypeptides and fusion polypeptides comprising such. Such a method may comprise providing a polyribonucleotide encoding the RT polypeptide or the fusion polypeptide comprising such to a host cel in a subject (e.g., a human subject) wherein the polyribonucleotide encodes the RT polypeptide or the fusion polypeptide comprising such expressing the polypeptide from the cel. II. RT-Mediated Gene Editing Systems In some aspects, provided herein is an RT-mediated gene editing system, which involves at least two protein components, i.e., any of the RT polypeptides disclosed hereinAtorney Docket No.: 063586-543001WO and an RNA-guided nuclease (e.g., a CRISPR nuclease polypeptide), and at least two RNA components, i.e., a guide RNA and an RT donor RNA. In specific embodiments, the two protein components can be located on a fusion polypeptide. Alternatively or in addition, the two RNA components may be located on a single RNA molecule. In some instances, the gene editing system may comprise the protein components and / or the RNA components. In other instances, the gene editing system may comprise nucleic acid(s) encoding the protein components, and / or nucleic acid(s) encoding the RNA components. In some instances, the RT- mediated gene editing system comprises an RNA-guided nuclease such as a CRISPR nuclease having nickase activity. Such a gene editing system is expected to achieve precise gene editing at a desired genomic target site. A. Protein Components The gene editing systems provided herein involve at least two enzymes, an RT polypeptide as disclosed herein and an RNA-guided nuclease such as a CRISPR nuclease. In some embodiments, the gene editing system comprises the two enzymes. In specific examples, the gene editing system may comprise a fusion polypeptide comprising the two enzyme components. Alternatively, the gene editing system may comprise one or more nucleic acids encoding the two enzyme components. For example, the gene editing system may comprise one or more expression vectors (e.g., viral vectors such as retroviral vectors, adenoviral vectors, or adeno-associated viral vectors) capable of expressing the RNA-guided nuclease, the RT, or the fusion polypeptide comprising such. In other examples, the gene editing system may comprise one or more mRNA molecules coding for the RNA-guided nuclease, the RT, or the fusion polypeptide comprising such. In some embodiments, the RNA-guided nuclease polypeptide and the RT polypeptide as disclosed herein may form a complex, which may be a heterodimer of the two protein components via a dimerization domain (e.g., a leucine zipper), an antibody, a nanobody, or an aptamer. (i) RNA-Guided Nuclease Polypeptides RNA-guided nucleases refer to nucleases (e.g., nickases) that are complexed with guide RNAs to cleave at specific DNA sites determined by the guide RNAs. With a short guide RNA (gRNA), an RNA-guided nuclease can be guided to the target site for gene editing. The gRNA determines the eficacy and specificity of gene editing by the nuclease. In some embodiments, the RNA-guided nucleases are CRISPR-Cas RNA-guidedAtorney Docket No.: 063586-543001WO nucleases (e.g., nickases), which are the primary tools used in gene editing methods. As used herein, the term “CRISPR nuclease” refers to an RNA-guided effector that is capable of binding a nucleic acid and introducing a single-stranded break or double-stranded break. As used herein, the term “CRISPR nickase” refers to an RNA-guided efector that is capable of binding a nucleic acid and cuting one strand of the nucleic acid (i.e., introducing a nick into one strand of a double-stranded nucleic acid.) Multiple types of CRISPR nucleases (e.g., Type I, Type I, Type II, Type IV, Type V, Type VI, and Type VI) have been identified. In some embodiments, the CRISPR nuclease is Cas9 (e.g., Cas9 and nCas9), Casl2a / Cpf1, Cas12b / C2c1, Casl2c / C2c3, Casl2d / CasY, Casl2e / CasX, Casl2g, Casl2h, Casl2i, and Casl2j / CasPhi). Non-limiting examples of Cas enzymes include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas8a, Cas8b, Cas8c, Cas9 (also known as Csn1 or Csxl2), Cas10, Cas10d, Casl2a / Cpfl, Casl2b / C2cl, Casl2c / C2c3, Casl2d / CasY, Casl2e / CasX, Casl2g, Casl2h, Casl2i, Casl2j / CasΦ, Cpf1, Csy1, Csy2, Csy3, Csy4, Csel, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csnl, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csx10, Csxl6, CsaX, Csx3, Csx1, CsxlS, Csx11, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, a Type I CRISPR nuclease, a Type V CRISPR nuclease, a Type VI CRISPR nuclease, CARF, DinG, homologue thereof, or modified or engineered version thereof. Other CRISPR nucleases are also within the scope of this disclosure, although they may not be specificaly listed in this disclosure. See, e.g., Makarova et al. “Classification and Nomenclature of CRISPR-Cas Systems: Where from Here?” CRISPRJ.1(5):325-36 (2018). In some embodiments, the CRISPR nuclease is a nuclease disclosed in WO2021055874, WO2020206036, WO2020191102, WO2020186213, WO2020028555, WO2020033601, WO2019126762, WO2019126774, WO2019071048, WO2019018423, WO2019005866, WO2018191388, WO2018170333, WO2018035388, WO2018035387, WO2017219027, WO2017189308, WO2017184768, WO2017106657, WO2016205749, WO2017070605, WO2016205764, WO2016205711, WO2016028682, WO2015089473, WO2014093595, WO2015089427, WO2014204725, WO2015070083, WO2014093655, WO2014093694, WO2014093712, WO2014093635, WO2021133829, WO2021007177, WO2020197934, WO2020181102, WO2020181101, WO2020041456, WO2020023529, WO2020005980, WO2019104058, WO2019089820, WO2019089808, WO2019089804, WO2019089796, WO2019036185, WO2018226855, WO2018213351, WO2018089664, WO2018064371, WO2018064352, WO2017106569, WO2017048969, WO2016196655,Atorney Docket No.: 063586-543001WO WO2016106239, WO2016036754, WO2015103153, WO2015089277, WO2014150624, WO2013176772, WO2021119563, WO2021118626, WO2020247883, WO2020247882, WO2020223634, WO2020142754, WO2020086475, WO2020028729, WO2019241452, WO2019173248, WO2018236548, WO2018183403, WO2017027423, WO2018106727, WO2018071672, WO2017096328, WO2017070598, WO2016201155, WO2014150624, WO2013098244, WO2021113522, WO2021050534, WO2021046442, WO2021041569, WO2021007563, WO2020252378, WO2020180699, WO2020018142, WO2019222555, WO2019178428, WO2019178427, or WO2019006471, which are incorporated by reference for the subject mater and purpose referenced herein. In some embodiments, the RNA-guided nuclease for use in the gene editing systems provided herein can be a Type I CRISPR nuclease. The Type I systems are further subdivided into multiple subtypes, e.g., Cas9a, Cas9b, Cas9c, and Cas9d. Jinek et al., Science, 337(6096):816-821 (2012) showed that the CRISPR / Cas9 system is useful for RNA- programmable genome editing, and international patent application publication number WO2013 / 176772 provides numerous examples and applications of the CRISPR / Cas nuclease system for site-specific gene editing. In some examples, the Type I CRISPR nuclease may be a Cas9 enzyme, for example, Cas9 from S. pyogenes, supra. In some instances, the Cas9 enzyme can be a naturaly-occurring enzyme, which comprises two nuclease domains, a HNH nuclease domain and a RuvC domain. In other instances, the Cas9 enzyme for use in the gene editing systems provided herein may be a variant Cas9 enzyme, for example, a nickase mutant of a naturaly-occuring Cas9. In some embodiments, a nickase is a variant of a CRISPR nuclease that comprises a deactivated HNH domain. In some embodiments, a nickase is a variant of a CRISPR nuclease that comprises a deactivated RuvC domain. In one example, the Cas9 enzyme is a nickase mutant comprising a mutation at position H840 (e.g., H840A), e.g., an nSpCas9 comprising an amino acid sequence such as SEQ ID NO: 8. Alternatively, the CRISPR nuclease can be of a diferent species of a Cas9 CRISPR nuclease, for example, an SaCas9 CRISPR nuclease. In some embodiments, the RNA-guided nuclease for use in the gene editing systems provided herein can be a Type V CRISPR nuclease. Type V CRISPR nuclease is a subclass of CRISPR nucleases. See, e.g., Tong et al., Front. Cel Dev. Biol., 2021, Vol.8, doi:10.3389 / fcel.2020.622103. In some embodiments, the Type V nuclease is a Cas12 CRISPR nuclease. In some embodiments, the Type V nuclease is a Cas12a (Cpf1), Cas12b (C2c1), Cas12c, Cas12d, Cas12e, Cas12f, Cas12h, Cas12i, or Cas12j (CasPhi) CRISPR nuclease. In some embodiments, the Type V nuclease is a variant (e.g., a functional variant) ofAtorney Docket No.: 063586-543001WO a Cas12a (Cpf1), Cas12b (C2c1), Cas12c, Cas12d, Cas12e, Cas12f, Cas12h, Cas12i, or Cas12j (CasPhi) CRISPR nuclease. In some embodiments, the Type V nuclease comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a wild-type Type V nuclease sequence (e.g., a wild-type amino acid sequence of Cas12a (Cpf1), Cas12b (C2c1), Cas12c, Cas12d, Cas12e, Cas12f, Cas12h, Cas12i, or Cas12j (CasPhi). In some embodiments, the Type V enzyme for use in the gene editing systems provided herein may be a variant Type V enzyme. For example, in some embodiments, the Type V enzyme is a nickase variant. In some embodiments, the Type V nuclease of the present invention is a Cas12i CRISPR nuclease. In some embodiments, the Cas12i CRISPR nuclease is a Cas12i2 CRISPR nuclease. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide described in WO / 2021 / 202800, the relevant disclosures of which are incorporated by reference for the subject mater and purpose referenced herein. In some embodiments, the variant Cas12i2 polypeptide comprises one or more of the amino acid substitutions listed in Table 2 of WO / 2021 / 202800. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 3 of PCT / US2021 / 025257. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 4 of PCT / US2021 / 025257. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 5 of PCT / US2021 / 025257. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 495 of PCT / US2021 / 025257. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 496 of PCT / US2021 / 025257. In some embodiments, the CRISPR nuclease is a variant Cas12i2 polypeptide having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atAtorney Docket No.: 063586-543001WO least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 3-146 and 495-512 of WO / 2021 / 202800, which are incorporated by reference for the subject mater and purpose referenced herein. In one specific example, the RNA-guided nuclease is a Cas12i2 polypeptide comprising the amino acid sequenced of SEQ ID NO: 37. Additional CRISPR nucleases for use in the gene editing system disclosed herein can be found, e.g., in WO2021050534, WO2022192391, and WO2024020567, the relevant disclosures of each of which are incorporated by reference herein for the subject mater and purpose referenced herein. (i) RT Polypeptides Any of the RT polypeptides, e.g., those derived from RT_D, RT_E, RT_F, RT_G, or RT_H as disclosed herein can be used in the gene editing systems provided herein. Examples are provided in Tables 1-3, 8 and 14-23 (the RT portion). See relevant disclosures herein. (ii) Fusion Polypeptides In some embodiments, the gene editing system provided herein comprise a fusion polypeptide that includes both the RT polypeptide as disclosed herein and the RNA-guided nuclease (e.g., nickase) such as a CRISPR nuclease (e.g., nickase) polypeptide as also disclosed herein. In some instances, the fusion polypeptide may further comprise one or more additional functional elements, for example, NLSs and peptide linkers. Alternatively, the gene editing system may comprise a nucleic acid (e.g., a vector such as an expression vector) encoding the fusion polypeptide. In some embodiments, the fusion polypeptide may comprise the RT polypeptide at its N-terminus and the RNA-guided nuclease (e.g., nickase) polypeptide downstream to the RT polypeptide. In other embodiments, the fusion polypeptide may comprise the RNA-guided nuclease (e.g., nickase) polypeptide at its N-terminus and the RT polypeptide downstream to the RNA-guided nuclease (e.g., nickase) polypeptide. In some embodiments, the RT polypeptide may be fused with the RNA-guided nuclease (e.g., nickase) polypeptide at an intramolecular position within the RT polypeptide, for example, the RNA-guided nuclease (e.g., nickase) polypeptide may be within a loop of the reverse transcriptase polypeptide. Any of the RT polypeptides disclosed herein and any of the RNA-guided nuclease (e.g., nickase) polypeptide such as those disclosed herein may be used for constructing the fusion polypeptides. In some instances, the RNA-guided nuclease (e.g., nickase) polypeptideAtorney Docket No.: 063586-543001WO may be a Cas9 nuclease (e.g., a nickase variant such as SEQ ID NO: 9). In some embodiments, any of the RT-nuclease (e.g., nickase) fusion polypeptides disclosed herein may comprise one or more additional functional elements, e.g., those provided herein. In some instances, the additional functional elements may be one or more NLS elements. In some examples, the fusion polypeptide may comprise an NLS at its N- terminus, at its C-terminus, or both. Alternatively, or in addition, the additional functional elements may be a flexible peptide linker, which can be located between the RNA-guided nuclease (e.g., nickase) polypeptide and the RT polypeptide. Suitable peptide linkers include, but are not limited to, G / S rich peptide linkers and XTEN peptide linkers. Examples of NLS and peptide linkers are provided in Example 3 and Example 4 below. In some examples, the RT-nuclease (e.g., nickase) fusion polypeptide provided herein comprises a peptide linker (the first peptide linker) located between the RNA-guided nuclease (e.g., nickase) polypeptide and the RT polypeptide. In some instances, the RNA-guided nuclease (e.g., nickase) polypeptide is N-terminal to the RT polypeptide. In other instances, the RNA-guided nuclease (e.g., nickase) polypeptide is C-terminal to the RT polypeptide. In some instances, an additional peptide linker and / or one or more NLS signals may be located between the RNA-guided nuclease (e.g., nickase) polypeptide and the RT polypeptide. For example, an additional peptide linker and an NLS may be place between the RNA-guided nuclease (e.g., nickase) polypeptide and the RT polypeptide, in addition to the first peptide linker. In some specific examples, the peptide linker between the RNA-guided nuclease (e.g., nickase) polypeptide and the RT polypeptide is at least 20-aa in length, for example, ranging from about 20 amino acids to 100 amino acids. Alternatively, or in addition, the RT-nuclease (e.g., nickase) fusion polypeptide provided herein may comprise at least two NLSs (the first NLS and the second NLS), at least one of which is located at the N-terminus or the C-terminus of the fusion polypeptide. In some examples, one of the two NLSs is located at the N-terminus and the other one is located at the C-terminus. In other examples, the two NLSs are located at the N-terminus. In yet other examples, the two NLSs are located at the C-terminus. In some instances, the RT-nuclease (e.g., nickase) fusion polypeptide provided herein may comprise one or more additional NLS(s) (e.g., a third NLS, and optionaly a fourth NLS). Such additional NLS(s) may be located between the RNA-guided nuclease (e.g., nickase) polypeptide and the RT polypeptide. In other examples, the additional NLS(s) may be located between the RNA-guided nuclease (e.g., nickase) / RT polypeptide and a terminal NLS, optionaly via a peptide linker.Atorney Docket No.: 063586-543001WO In other embodiments, the gene editing system provided herein may comprise a nucleic acid encoding the RT-nuclease (e.g., nickase) fusion polypeptide. In some examples, the nucleotide sequence encoding the fusion polypeptide described herein can be codon- optimized for use in a particular host cel or organism. In some examples, the nucleic acid encoding the fusion polypeptides as disclosed herein can be an mRNA molecule, which can be codon optimized. Exemplary codon-optimized nucleotide sequences encoding exemplary RT-nuclease (e.g., nickase) fusion polypeptides can be found in Tables 2, 7, 11 and 14-20 below, any of which is within the scope of the present disclosure. B. RNA Components The gene editing systems provided herein also involve at least two RNA components, a guide RNA (gRNA), which directs gene editing at a desired genetic site, and an RT donor RNA, which serves as the RNA template for the RT polypeptide in reverse transcription. The RT donor RNA comprises desired nucleotide substitutions to be inserted into the genetic site of interest. In some embodiments, the gene editing system comprises the two RNA molecules. In specific examples, the gene editing system may comprise a single RNA molecule comprising the gRNA and the RT donor RNA. Alternatively, the gene editing system may comprise one or more nucleic acids encoding the two RNA components. For example, the gene editing system may comprise one or more expression vectors (e.g., viral vectors such as retroviral vectors, adenoviral vectors, or adeno-associated viral vectors) capable of producing the gRNA, the RT donor RNA, or the single RNA molecule comprising such. In some embodiments, the gRNA and the RT donor RNA as disclosed herein may form a complex. (i) Guide RNAs The gene editing system disclosed herein further comprises one or more gRNAs or nucleic acid(s) encoding such. As used herein, the terms “RNA guide”, “RNA guide sequence,” or “guide RNA (gRNA)” refer to an RNA molecule or a modified RNA molecule that facilitates the targeting of an RNA-guided nuclease described herein to a genomic site of interest. For example, an RNA guide can be a molecule that comprises a spacer sequence and a scafold sequence. The spacer sequence recognizes (e.g., binds to) a site in a non-PAM strand that is complementary to a target sequence in the PAM strand, e.g., designed to be complementary to a specific nucleic acid sequence. The scafold sequence contains a nuclease binding sequence for binding to the RNA-guided nuclease. In some embodiments, the scafoldAtorney Docket No.: 063586-543001WO is an RNA sequence. In some instances, the gRNA disclosed herein may further comprise a linker sequence, a 5’ end and / or 3’ end protection fragment, or a combination thereof. Spacer Sequences As used herein, the term “spacer” and “spacer sequence” (a.k.a., a DNA-binding sequence) is a portion in an RNA guide that is the RNA equivalent of the target sequence (a DNA sequence). The spacer contains a sequence capable of binding to the non-PAM strand via base-pairing at the site complementary to the target sequence (which is in the PAM strand). Such a spacer is also known as specific to the target sequence. In some instances, the spacer may be at least 75% identical to the target sequence (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%), except for the RNA-DNA sequence diference. In some instances, the spacer may be 100% identical to the target sequence except for the RNA-DNA sequence diference. The gene editing system disclosed herein comprises one or more gRNAs, each comprising a spacer for targeting a genomic site of interest and a scaffold, which is recognizable by the RNA-guided nuclease contained in the gene editing system. The target sequence can be adjacent to a protospacer adjacent motif (PAM) sequence recognizable by the RNA-guided nuclease. For example, if an SpCas9 polypeptide is used in the gene editing system, the PAM sequence is 5’-NGG-3’, in which N represents any of A, C, G, and T. When a Cas12i2 nuclease is used, the PAM sequence is 5’-TTN-3’, in which N presents any of A, C, G, and T. As used herein, the term “protospacer adjacent motif” or “PAM sequence” refers to a DNA sequence adjacent to a target sequence. In some embodiments, a PAM sequence is required for binding of the RNA-guided nuclease and / or indel activity. In a double-stranded DNA molecule, the strand containing the PAM sequence is caled the “PAM-strand” and the complementary strand is caled the “non-PAM strand.” The gRNA binds to a site in the non- PAM strand that is complementary to a target sequence disclosed herein, and the PAM sequence as described herein is present in the PAM-strand. The PAM sequence can be located upstream to the target sequence. As used herein, the term “adjacent to” refers to a nucleotide or amino acid sequence in close proximity to another nucleotide or amino acid sequence. In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if no nucleotides separate the two sequences (i.e., immediately adjacent). In some embodiments, a nucleotide sequence isAtorney Docket No.: 063586-543001WO adjacent to another nucleotide sequence if a smal number of nucleotides separate the two sequences (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides). A spacer sequence as disclosed herein may have a length of from about 15 nucleotides to about 30 nucleotides. For example, the spacer can have a length of from about 15 nucleotides to about 20 nucleotides, from about 15 nucleotides to about 25 nucleotides, from about 20 nucleotides to about 25 nucleotides, or from about 20 nucleotides to about 30 nucleotides. In some embodiments, the spacer in the gRNA may be generaly designed to have a length of between 15 and 25 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25) and be complementary to a specific target sequence. In some embodiments, the spacer sequence may be designed to have a length of between 18-22 nucleotides (e.g., 20 nucleotides). In some embodiments, the spacer sequence may have at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a target sequence as described herein and is capable of binding to the complementary region of the target sequence via base-pairing. In some embodiments, the spacer sequence comprises only RNA bases. In some embodiments, the spacer sequence comprises a DNA base (e.g., the spacer comprises at least one thymine). In some embodiments, the spacer sequence comprises RNA bases and DNA bases (e.g., the DNA-binding sequence comprises at least one thymine and at least one uracil). Scafold Sequence The scaffold sequence (also caled direct repeat sequence) in the gRNA is recognizable by the RNA-guided nuclease polypeptide also in the gene editing system. For example, when the RNA-guided nuclease is SpCas9, the scaffold sequence may be: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUU GAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 19), or a variant thereof comprising a nucleotide sequence at least 80% (e.g., at least 85%, 90%, 95%, 98%, or greater) identical to SEQ ID NO: 13. The variant scafold sequence may comprise deletions, nucleotide substitutions, or a combination thereof. Alternatively, when a Cas12i2 nuclease is used, the scaffold sequence can beAtorney Docket No.: 063586-543001WO AGAAAUCCGUCUUUCAUUGACGG (SEQ ID NO: 48), or a variant thereof comprising a nucleotide sequence at least 80% (e.g., at least 85%, 90%, 95%, 98%, or greater) identical to SEQ ID NO: 40. The variant scafold sequence may comprise deletions, nucleotide substitutions, or a combination thereof. In a gRNA, the scafold may be located at the 3’ end of the spacer or the 5’ end of the spacer. In some instances, the scafold and spacer are connected directly. In other instances, the scafold and spacer may be connected via a nucleotide linker. (i) RT Donor RNA As used herein, the terms “reverse transcription donor RNA” or “RT donor RNA” refer to an RNA molecule comprising a reverse transcription template sequence (RTT sequence) and a primer binding site (PBS). An RT donor RNA may be fused to an RNA guide at either the 5’ end or 3’ end of the RNA guide. Any of the RT donor RNAs disclosed herein comprises: (i) a primer binding site (PBS), and (i) an RTT sequence. In some instances, the RT donor RNA may further comprise: (ii) a nucleotide linker sequence, (iv) a 5’ end and / or 3’ end protection fragment (see disclosures herein), or a combination thereof. In some examples, the 5’ end or 3’ end protection fragment (e.g., 3’ extension) may comprise a pseudoknot motif to protect against 3’ exonuclease activity. In some embodiments, a RT donor RNA comprises an aptamer. In some embodiments, the aptamer recruits a reverse transcriptase polypeptide. Primer Binding Site (PBS) In some embodiments, the PBS in an RT donor RNA as disclosed herein is an RNA sequence capable of binding to a DNA strand via base-paring. The DNA strand has been or can be nicked or cleaved by the RNA-guided nuclease polypeptide of the gene editing system disclosed herein. In some embodiments, the PBS comprises an RNA sequence capable of binding to a DNA strand (a PBS-targeting site) via base-pairing. The DNA strand may have a free 3’ end or a 3’ free end can be generated via cleavage by the RNA-guided nuclease polypeptide contained in the same gene editing system. In some examples, the PBS-targeting site may be located on the same DNA strand as the PAM sequence (the PAM strand). In some embodiments, the PBS may be about 5-50 nucleotides in length. For example, the PBS may be about 5-40, 5-30, or 5-20 nucleotides in length. In specific examples, the PBS may be about 5-20 (e.g., 7-17) nucleotides in length. In some examples, the PBS may containAtorney Docket No.: 063586-543001WO 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, or 20 nucleotides. As used herein, the term “PBS-targeting site” refers to the region to which a PBS binds. The PBS-targeting site may be adjacent to (e.g., upstream to) the PAM sequence. In a gene editing system comprising a RNA-guided nuclease such as a CRISPR nuclease polypeptide that is a nickase variant (e.g., comprises a disrupted HNH nuclease domain as disclosed herein), the PBS in the RT donor RNA may bind to a region (the PBS-targeting site) on the PAM strand. In some embodiments, the PBS-targeting site may partialy or completely overlap with the target sequence. In some instances, the PBS-targeting site may be located upstream to the PAM sequence. For example, the PBS-targeting site may be up to 100 nucleotides upstream to the PAM sequence, for example, up to 50 nucleotides, up to 30 nucleotides, up to 25 nucleotides, up to 20 nucleotides, up to 15 nucleotides, up to 10 nucleotides, or up to 5 nucleotides upstream to the PAM sequence. In specific examples, the PBS-targeting site may start about 3 nucleotides to about 10 nucleotides upstream of the PAM sequence (i.e., the 5’-most nucleotide of the PBS may bind about 3 nucleotides, 4, nucleotides, 5, nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides upstream of the PAM sequence.) In specific examples, the PBS-targeting site may start 1 nucleotide, 1-2 nucleotides, 1-3 nucleotides, 1-4 nucleotides, or 1-5 nucleotides, upstream of the PAM sequence. When a free 3’ end is generated by the RNA-guided nuclease polypeptide in the gene editing system within or nearby the target sequence, the PBS binding to the PAM strand at a site upstream to the PAM sequence could efficiently facilitate DNA synthesis by the RT polypeptide in the gene editing system, starting from the free 3’ end generated in the PAM strand. Reverse Transcription Template (RTT) Sequence The reverse transcription template sequence (RTT sequence) serves as the template for the reverse transcription mediated by the RT polypeptide in the gene editing system disclosed herein. In some embodiments, the RTT sequence comprises a sequence with at least one encoded edit. In some embodiments, the RTT sequence comprises sequence homology to a target sequence or its complementary region with at least one encoded edit. In some embodiments, the RTT sequence is at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13Atorney Docket No.: 063586-543001WO nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, at least 50 nucleotides, at least 60 nucleotides, at least 70 nucleotides, at least 80 nucleotides, at least 90 nucleotides, at least 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, or at least 500 nucleotides in length. In some embodiments, the RTT sequence is about 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, 110 nucleotides, or 120 nucleotides in length or any length in between. In some embodiments, the RTT sequence is about 10 nucleotides. In some embodiments, the RTT sequence is about 11 nucleotides. In some embodiments, the RTT sequence is about 12 nucleotides. In some embodiments, the RTT sequence is about 13 nucleotides. In some embodiments, the RTT sequence is about 14 nucleotides. In some embodiments, the RTT sequence is about 15 nucleotides. In some embodiments, the RTT sequence is about 16 nucleotides. In some embodiments, the RTT sequence is about 17 nucleotides. In some embodiments, the RTT sequence is about 18 nucleotides. In some embodiments, the RTT sequence is about 19 nucleotides. In some embodiments, the RTT sequence is about 20 nucleotides. In some embodiments, the RTT sequence is about 21 nucleotides. In some embodiments, the RTT sequence is about 22 nucleotides. In some embodiments, the RTT sequence is about 23 nucleotides. In some embodiments, the RTT sequence is about 24 nucleotides. In some embodiments, the RTT sequence is about 25 nucleotides. In some embodiments, the RTT sequence is about 26 nucleotides. In some embodiments, the RTT sequence is about 27 nucleotides. In some embodiments, the RTT sequence is about 28 nucleotides. In some embodiments, the RTT sequence is about 29 nucleotides. In some embodiments, the RTT sequence is about 30 nucleotides. In some embodiments, the reverse transcription template sequence comprises at least one encoded edit (e.g., at least two) relative to a target sequence. In some embodiments, the at least one encoded edit comprises at least one substitution, insertion, and / or deletion. In some embodiments, the edit in the target sequence comprises a substitution, an insertion, and / or a deletion relative to the sequence of a target sequence. In some embodiments, the reverse transcription template sequence comprises at least one LoxP site. In some embodiments, the edit can be a single or multi-nucleotide substitution, such as a G to T substitution, a G to A substitution, a G to C substitution, a T to G substitution, a T to A substitution, a T to C substitution, a C to G substitution, a C to T substitution, a C to AAtorney Docket No.: 063586-543001WO substitution, an A to T substitution, an A to G substitution, or an A to C substitution. In some embodiments, the change in sequence can convert a G:C base pair to a T:A base pair, a G:C base pair to an A:T base pair, a G:C base pair to C:G base pair, a T:A base pair to a G:C base pair, a T:A base pair to an A:T base pair, a T:A base pair to a C:G base pair, a C:G base pair to a G:C base pair, a C:G base pair to a T:A base pair, a C:G base pair to an A:T base pair, an A:T base pair to a T:A base pair, an A:T base pair to a G:C base pair, or an A:T base pair to a C:G base pair. In some embodiments, a template sequence described herein may further introduce one or more silent mutations. As used herein, a silent mutation refers to a mutation that does not change the amino acid residue encoded by the codon comprising the mutation. The RTT sequence can be transcribed into DNA by the reverse transcriptase of the gene editing system described herein. In some embodiments, the RTT sequence is transcribed from 5’ to 3’ into DNA of the PAM strand. In some embodiments, two guides with overlapping RTT regions can be used for dual flap editing, by which a nucleotide fragment can be inserted into a target site. The nucleotide fragment for insertion may range from 20-500 base pairs, for example, 20-200 base pairs. In some embodiments, the RTT sequence is 5’ of the PBS. In some embodiments, the RTT sequence is 3’ of the PBS. In some instances, the PBS and the RTT sequence in the RT donor RNA provided herein may be connected via a linker sequence to avoid steric hindrance between the two RNA components. (ii) Single RNA Molecule In some embodiments, the gene editing system provided herein comprises a single RNA molecule, which includes both the gRNA and the RT donor RNA, or a nucleic acid encoding the single RNA molecule. Such a single RNA molecule is capable of mediating cleavage at a target sequence within a genomic site of interest by the RNA-guided nuclease polypeptide and synthesis of a DNA fragment from a free 3’ end of a free DNA strand generated by the RNA-guided nuclease polypeptide cleavage based on the RTT sequence in the single RNA molecule. In some embodiments, the single RNA molecule may comprise the RNA guide linked to the RT donor RNA, optionaly via a linker. In some examples, the single RNA molecule, from 5’ to 3’ end, comprises a spacer sequence, a scafold sequence recognizable by the RNA-guided nuclease polypeptide, a RTT sequence, and a PBS. See, e.g., Tables 4 and 5. In specific examples, the single RNA molecule may comprise, from 5’ to 3’, a protectingAtorney Docket No.: 063586-543001WO fragment, an RTT sequence, a PBS, a scafold sequence (i.e., a direct repeat sequence), and a spacer sequence. See, e.g., Tables 9 and 10. Any of the single RNA molecules provided herein may further comprise a linker, which may be located between a scaffold sequence and an RTT or folowing a PBS. In some examples, the linker may comprise a hairpin structure. In some examples, the 5’ end and / or the 3’ end of the single RNA molecule, or the gRNA and / or RT donor RNA, may contain a protection fragment, which may enhance resistance of the RNA molecule to exonuclease activity. In some instances, the end protection fragment may comprise a nucleotide sequence capable of forming a secondary structure, such as hairpin, a circularization, a pseudoknot, or a triplex structure. In other instances, the end protection fragment may comprise the sequence of an exoribonuclease-resistant RNA (xrRNA), a transfer RNA (tRNA), or a truncated tRNA. In some embodiments, the modification is a Zika-like pseudoknot, a murine leukemia virus pseudoknot (MLV-PK) sequence, a red clover necrotic mosaic virus (RCNMV) sequence, a sweet clover necrotic mosaic virus (SCNMV) sequence, a carnation ringspot virus (CRSV) sequence, preQ sequence, or an RNA bacteriophage MS2 sequence. In some examples, the 5’ end of the single RNA molecule (or the 5’ end of the gRNA and / or the RT donor RNA when separate RNA molecules are used) may contain a 5’ extension motif, which can be any of the protection fragments disclosed herein. In some examples, the 3’ end of the single RNA molecule (or the 3’ end of the gRNA and / or the RT donor RNA when separate RNA molecules are used) may contain a 3’ extension motif, which can be any of the protection fragments disclosed herein. (iv) Modifications of Nucleic Acids Any of the RNA components in a gene editing system as disclosed herein, e.g., the single RNA molecule, the gRNA, and / or the RT donor RNA, may include one or more modifications. Exemplary modifications can include any modification to the sugar, the nucleobase, the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone), and any combination thereof. Some of the exemplary modifications provided herein are described in detail below. Any of the RNA components disclosed herein may include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). One or more atoms ofAtorney Docket No.: 063586-543001WO a pyrimidine nucleobase may be replaced or substituted with optionaly substituted amino, optionaly substituted thiol, optionaly substituted alkyl (e.g., methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, modifications (e.g., one or more modifications) are present in each of the sugar and the internucleoside linkage. Modifications may be modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof). Additional modifications are described herein. In some embodiments, the modification may include a chemical or celular induced modification. For example, some nonlimiting examples of intracelular RNA modifications are described by Lewis and Pan in “RNA modifications and structures cooperate to guide RNA-protein interactions” from Nat Reviews Mol Cel Biol, 2017, 18:202-210. Diferent sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may exist at various positions in the sequence. One of ordinary skil in the art wil appreciate that the nucleotide analogs or other modification(s) may be located at any position(s) of the sequence, such that the function of the sequence is not substantialy decreased. The sequence may include from about 1% to about 100% modified nucleotides (either in relation to overal nucleotide content, or in relation to one or more types of nucleotide, i.e. any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%>, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). In some embodiments, sugar modifications (e.g., at the 2’ position or 4’ position) or replacement of the sugar at one or more ribonucleotides of the sequence may, as wel as backbone modifications, include modification or replacement of the phosphodiester linkages. Specific examples of a sequence include, but are not limited to, sequences including modified backbones or no natural internucleoside linkages such as internucleoside modifications, including modification or replacement of the phosphodiester linkages. Sequences having modified backbones include, among others, those that do not have a phosphorus atom in theAtorney Docket No.: 063586-543001WO backbone. For the purposes of this application, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In particular embodiments, a sequence wil include ribonucleotides with a phosphorus atom in its internucleoside backbone. Modified sequence backbones may include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates such as 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’. Various salts, mixed salts and free acid forms are also included. In some embodiments, the sequence may be negatively or positively charged. The modified nucleotides, which may be incorporated into the sequence, can be modified on the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably. Backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with a diferent substituent. Further, the modified nucleosides and nucleotides can include the wholesale replacement of an unmodified phosphate moiety with another internucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be modified by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates). The α-thio substituted phosphate moiety is provided to confer stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a celular environment. In specific embodiments, a modified nucleoside includes an alpha-thio-nucleoside (e.g., 5’-O-(1-thiophosphate)-adenosine, 5’-O-(1-thiophosphate)-cytidine (a-thio-cytidine), 5’- O-(1-thiophosphate)-guanosine, 5’-O-(1-thiophosphate)-uridine, or 5’-O-(1-thiophosphate)-Atorney Docket No.: 063586-543001WO pseudouridine). Other internucleoside linkages that may be employed according to the present invention, including internucleoside linkages which do not contain a phosphorous atom, are described herein. In some embodiments, the sequence may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into sequence, such as bifunctional modification. Cytotoxic nucleoside may include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4’-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur (RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2’-deoxy-2’-methylidenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl-1-beta-D- arabinofuranosylcytosine, N4-octadecyl-1-beta-D-arabinofuranosylcytosine, N4-palmitoyl-1- (2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl) cytosine, and P-4055 (cytarabine 5’- elaidic acid ester). In some embodiments, the sequence includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred diferent nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197) In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of pyridin-4-one ribonucleoside, 5- aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl- pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1- taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl- pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-Atorney Docket No.: 063586-543001WO pseudouridine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4- acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl- pseudoisocytidine, pyrolo-cytidine, pyrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5- methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1- methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza- zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1- methyl-pseudoisocytidine. In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of 2-aminopurine, 2, 6-diaminopurine, 7-deaza- adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6- methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2- methylthio-N6-(cis-hydroxyisopentenyl) adenosine, N6-glycinylcarbamoyladenosine, N6- threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6- dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In some embodiments, mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza- guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7- methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1- methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine. The sequence may or may not be uniformly modified along the entire length of the molecule. For example, one or more or al types of nucleotides (e.g., naturaly-occuring nucleotides, purine or pyrimidine, or any one or more or al of A, G, U, C, I, pU) may or may not be uniformly modified in the sequence, or in a given predetermined sequence region thereof. In some embodiments, the sequence includes a pseudouridine. In some embodiments, the sequence includes an inosine, which may aid in the immune system characterizing the sequence as endogenous versus viral RNAs. The incorporation of inosine may also mediate improved RNA stability / reduced degradation. See for example, Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self”. Cel Res.25, 1283-1284, which is incorporated by reference in its entirety. In some embodiments, any RNA sequence described herein, such as an editingAtorney Docket No.: 063586-543001WO template RNA, may comprise an end modification (e.g., a 5’ end modification or a 3’ end modification). In some embodiments, the end modification is a chemical modification. In some embodiments, the end modification is a structural modification. See disclosures herein. When a gene editing system disclosed herein comprises nucleic acids encoding the RNA-guided nuclease and / or the RT polypeptide, e.g., mRNA molecules, such nucleic acid molecules may contain any of the modifications disclosed herein, where applicable. III. Gene Editing Methods Any of the gene editing systems can be used to geneticaly modify (edit) a target nucleic acid, which can be a genetic site of interest, e.g., a genetic site where gene editing is needed, for example, to fix a genetic mutation, to introduce a protective mutation, to introduce modifications for modulating expression of a gene, etc. A. Delivery of Gene Editing System to Target Cels Components of any of the gene editing systems disclosed herein may be formulated, for example, including a carier, such as a carier and / or a polymeric carrier, e.g., a liposome, and delivered by known methods to a cel (e.g., a mammalian cel). Such methods include, but not limited to, transfection (e.g., lipid-mediated, cationic polymers, calcium phosphate, dendrimers); electroporation or other methods of membrane disruption (e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV), microinjection, microprojectile bombardment (“gene gun”), fugene, direct sonic loading, cel squeezing, optical transfection, protoplast fusion, impalefection, magnetofection, exosome- mediated transfer, lipid nanoparticle-mediated transfer, and any combination thereof. In some examples, the delivery method involves the use of lipid nanoparticles to mediate delivery of one or more components of the gene editing system disclosed herein. In some embodiments, the method comprises delivering one or more nucleic acids (e.g., nucleic acids encoding the RNA-guided nuclease polypeptide, the RT polypeptide, or the fusion polypeptide comprising both, the RNA guide, the RT donor RNA, or the single RNA molecule comprising both, etc.), one or more transcripts thereof, and / or a pre-formed RNA guide / RNA-guided nuclease polypeptide / RT polypeptide complex to a cel, where a ternary complex is formed. In some embodiments, an RNA guide and / or RT donor RNA, or a fusion thereof, and an RNA encoding an RNA-guided nuclease polypeptide or a RT polypeptide, or a fusion polypeptide comprising both, are delivered together in a single composition. In some embodiments, an RNA guide and an RNA encoding an RNA-guidedAtorney Docket No.: 063586-543001WO nuclease polypeptide are delivered in separate compositions. In some embodiments, an RNA guide / RT donor RNA and an RNA encoding a RNA-guided nuclease polypeptide / RT polypeptide delivered in separate compositions are delivered using the same delivery technology. In some embodiments, an RNA guide / RT donor RNA and an RNA encoding a RNA-guided nuclease polypeptide / RT polypeptide delivered in separate compositions are delivered using diferent delivery technologies. In some embodiments, one or more of the protein components and one or more of the RNA components are delivered together. For example, the RNA-guided nuclease and / or RT polypeptide and the RNA guide and / or RT donor RNA are packaged together in a single AAV particle. In another example, the RNA-guided nuclease and / or RT polypeptide and the RNA guide and / or RT donor RNA are delivered together via lipid nanoparticles (LNPs). In some embodiments, the RNA-guided nuclease and / or RT polypeptides and the RNA guide and / or RT donor RNA are delivered separately. For example, the RNA-guided nuclease and / or RT polypeptides and the RNA guide and / or RT donor RNA are packaged into separate AAV particles. In another example, the RNA-guided nuclease and / or RT polypeptides is delivered by a first delivery mechanism and the RNA guide and / or RT donor RNA is delivered by a second delivery mechanism. Exemplary intracelular delivery methods, include, but are not limited to: viruses, such as AAV, or virus-like agents; chemical-based transfection methods, such as those using calcium phosphate, dendrimers, liposomes, or cationic polymers (e.g., DEAE-dextran or polyethylenimine); non-chemical methods, such as microinjection, electroporation, cel squeezing, sonoporation, optical transfection, impalefection, protoplast fusion, bacterial conjugation, delivery of plasmids or transposons; particle-based methods, such as using a gene gun, magnectofection or magnet assisted transfection, particle bombardment; and hybrid methods, such as nucleofection. In some embodiments, a lipid nanoparticle comprises an mRNA encoding a RT-nuclease fusion polypeptide, an editing template RNA, or an mRNA encoding such. In some embodiments, the present application further provides cels produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cels. B. Host Cels for Gene Editing Any of the gene editing systems disclosed herein can be delivered to a variety of cels (e.g., to mammalian cels such as a mouse cel, a non-human primate cel, or a human cel). In some embodiments, the cel is in cel culture or a co-culture of two or more cel types. InAtorney Docket No.: 063586-543001WO some embodiments, the cel is ex vivo. In some embodiments, the cel is obtained from a living organism and maintained in a cel culture. In some embodiments, the cel is derived from a cel line. A wide variety of cel lines for tissue culture are known in the art. Examples of cel lines include, but are not limited to, 293T, MF7, K562, HeLa, CHO, and transgenic varieties thereof. Cel lines are available from a variety of sources known to those with skil in the art (see, e.g., the American Type Culture Colection (ATCC) (Manassas, Va.)). In some embodiments, the cel is an immortal or immortalized cel. In some embodiments, the cel is a primary cel. In some embodiments, the cel is a stem cel such as a totipotent stem cel (e.g., omnipotent), a pluripotent stem cel, a multipotent stem cel, an oligopotent stem cel, or an unipotent stem cel. In some embodiments, the cel is an induced pluripotent stem cel (iPSC) or derived from an iPSC. In some embodiments, the cel is a diferentiated cel. In some embodiments, the cel is a mammalian cel, e.g., a human cel or a murine cel. In some embodiments, the murine cel is derived from a wild-type mouse, an immunosuppressed mouse, or a disease-specific mouse model. In some embodiments, the cel is a cel within a living tissue, organ, or organism. Any of the geneticaly modified cels produced using any of the gene editing system disclosed herein is also within the scope of the present disclosure. Such modified cels may comprise a disrupted target gene. Any of the gene editing systems, compositions comprising such, vectors, nucleic acids, RNA guides and cels disclosed herein may be used in therapy. Gene editing systems, compositions, vectors, nucleic acids, RNA guides and cels disclosed herein may be used in methods of treating a disease or condition in a subject. Any suitable delivery or administration method known in the art may be used to deliver compositions, vectors, nucleic acids, RNA guides and cels disclosed herein. Such methods may involve contacting a target sequence with a composition, vector, nucleic acid, or RNA guide disclosed herein. Such methods may involve a method of editing a target sequence as disclosed herein. In some embodiments, a cel engineered using an RNA guide disclosed herein is used for ex vivo gene therapy. IV. Therapeutic Applications Any of the gene editing systems or modified cels generated using such a gene editing system as disclosed herein may be used for treating a disease that is associated with the target gene, for example, a genetic defect in the target gene. In some embodiments, provided herein is a method for treating a target disease asAtorney Docket No.: 063586-543001WO disclosed herein comprising administering to a subject (e.g., a human patient) in need of the treatment any of the gene editing systems disclosed herein. The gene editing system may be delivered to a specific tissue or specific type of cels where the gene edit is needed. The gene editing system may comprise LNPs encompassing one or more of the components, one or more vectors (e.g., viral vectors) encoding one or more of the components, or a combination thereof. Components of the gene editing system may be formulated to form a pharmaceutical composition, which may further comprise one or more pharmaceuticaly acceptable cariers. In some embodiments, modified cels produced using any of the gene editing systems disclosed herein may be administered to a subject (e.g., a human patient) in need of the treatment. The modified cels may comprise a substitution, insertion, and / or deletion described herein. In some examples, the modified cels may include a cel line modified by the RNA-guided nuclease polypeptide, the RT polypeptide, or the RNA-guided nuclease-RT fusion polypeptide, and the RNA guide and RT donor RNA or the single RNA molecule comprising both. In some instances, the modified cels may be a heterogenous population comprising cels with diferent types of gene edits. Alternatively, the modified cels may comprise a substantialy homogenous cel population (e.g., at least 80% of the cels in the whole population) comprising one particular gene edit in the target gene. In some examples, the cels can be suspended in a suitable media. In some embodiments, provided herein is a composition comprising the gene editing system or components thereof. Such a composition can be a pharmaceutical composition. A pharmaceutical composition that is useful may be prepared, packaged, or sold in a formulation suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, intra-lesional, buccal, ophthalmic, intravenous, intra-organ or another route of administration. A pharmaceutical composition of the disclosure may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition (e.g., the gene editing system or components thereof), which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. A formulation of a pharmaceutical composition suitable for parenteral administration may comprise the active agent (e.g., the gene editing system or components thereof or the modified cels) combined with a pharmaceuticaly acceptable carier, such as sterile water or sterile isotonic saline. Such a formulation may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Some injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or inAtorney Docket No.: 063586-543001WO multi-dose containers containing a preservative. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Some formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. The pharmaceutical composition may be in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the cels, additional ingredients such as the dispersing agents, weting agents, or suspending agents described herein. Such sterile injectable formulation may be prepared using a non-toxic parenteraly-acceptable diluent or solvent, such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentaly-administrable formulations which that are useful include those which may comprise the cels in a packaged form, in a liposomal preparation, or as a component of a biodegradable polymer system. Some compositions for sustained release or implantation may comprise pharmaceuticaly acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt. V. Kits and Uses Thereof The present disclosure also provides kits that can be used, for example, to cary out a method described herein for genetical modification of a target gene. In some embodiments, the kits include an RNA guide and an RT donor RNA, or a single RNA molecule comprising both, a RNA-guided nuclease polypeptide, and an RT polypeptide, or a fusion polypeptide thereof. In some embodiments, the kits include the single RNA molecule and the RNA-guided nuclease-RT fusion polypeptide. In some embodiments, the kits include a polynucleotide that encodes the RNA-guided nuclease polypeptide, the RT polypeptide, or the RNA-guided nuclease-RT fusion polypeptide, and optionaly the polynucleotide is comprised within a vector, e.g., as described herein. In some embodiments, the kits include a polynucleotide that encodes the RNA components disclosed herein. The RNA-guided nuclease polypeptide, the RT polypeptide, or a fusion polypeptide thereof (or polynucleotide encoding such) and the RNA components (e.g., as a ribonucleoprotein) can be packaged within the same or other vessel within a kit or can be packaged in separate vials or other vessels, the contents of which can be mixed prior to use.Atorney Docket No.: 063586-543001WO The RNA-guided nuclease polypeptide, the RT polypeptide, and the RNA components can be packaged within the same or other vessel within a kit or can be packaged in separate vials or other vessels, the contents of which can be mixed prior to use. The kits can additionaly include, optionaly, a bufer and / or instructions for use of the RNA components, the RNA-guided nuclease polypeptide, and the RT polypeptide, or the fusion polypeptide thereof. General techniques The practice of the present disclosure wil employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cel biology, biochemistry, and immunology, which are within the skil of the art. Such techniques are explained fuly in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed.1984); Methods in Molecular Biology, Humana Press; Cel Biology: A Laboratory Notebook (J. E. Celis, ed., 1989) Academic Press; Animal Cel Culture (R. I. Freshney, ed.1987); Introduction to Cel and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cel and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Grifiths, and D. G. Newel, eds.1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwel, eds.): Gene Transfer Vectors for Mammalian Cels (J. M. Miler and M. P. Calos, eds., 1987); Curent Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mulis, et al., eds.1994); Curent Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Caty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zaneti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and I (D.N. Glover ed.1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985»; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984»; Animal Cel Culture (R.I. Freshney, ed. (1986»; Immobilized Cels and Enzymes (lRL Press, (1986»; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.). Without further elaboration, it is believed that one skiled in the art can, based on theAtorney Docket No.: 063586-543001WO above description, utilize the present disclosure to its fulest extent. The folowing specific embodiments are, therefore, to be construed as merely ilustrative, and not limitative of the remainder of the present disclosure in any way whatsoever. Al publications cited herein are incorporated by reference for the purposes or subject mater referenced herein. EXAMPLES The folowing examples are provided to further ilustrate some embodiments of the present disclosure but are not intended to limit the scope of the present disclosure; it wil be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skiled in the art may alternatively be used. Example 1 – Evaluation of Reverse Transcriptases with an In Vitro Assay In this Example, reverse transcriptase (RT) polypeptides were tested in an in vitro assay to determine eficiency of transcription of ribonucleic acid (RNA) substrates. Each RT polypeptide was synthesized in an in vitro transcription and translation (IVTT) reaction. A synthesized RNA substrate was then provided, and generation of a complementary deoxyribonucleic acid (cDNA) was measured. The cDNA sequence was converted to double- stranded DNA, barcoded for multiplexing, and sequenced on an Ilumina Next Generation Sequencer. The RNA templates contained a stretch of degenerate bases that served as unique molecular identifiers (UMIs); each unique recorded sequence represented a single reverse transcription event, thereby alowing the level of activity of each RT sequence to be assessed. Comparing the number of UMIs generated between diferent RTs alowed for quantification of the number of reverse transcription events in a particular time window. To generate the transcription template for the RNA used in the RT extension assay, overlapping primers were designed with a T7 promoter upstream of a 74bp sequence from six diferent RNAs of varying levels of secondary structure. The overlapping primers were filed in with DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs®), and a T7 RNA synthesis reaction was performed using a HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs®). RNA products were purified using Zymo RNA Clean & Concentrator columns (Zymo Research) and eluted in nuclease-free water and pooled in equimolar fashion for use in the in vitro RT extension assay. gBlock HiFi gene fragments containing each RT polypeptide downstream of a T7 RNA polymerase promoter were ordered from Integrated DNA Technologies and used as templates for polymerase chain reactions (PCR) to generate linear amplicons encompassingAtorney Docket No.: 063586-543001WO the entire gBlock. Amplicons from this reaction were then used as templates for the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs®) to generate each RT polypeptide via IVTT. The IVTT reactions containing the RT polypeptides were combined with an RT primer at a final concentration of 1µM, 500µM each dNTP, 5 µM RNA substrate (preparation described above), and 50nM ssDNA library prep control in a reaction bufer (50mM Tris-HCl, 75mM KCl, 3mM MgCl2, and 10mM DTT). In each experiment, WT MMLV, an active RT polypeptide, was included as a positive control for RNA extension activity. The RT reaction was run at 37°C for 30 minutes, and then heated to 80°C for 15 minutes to deactivate the RT polypeptide. RNase H (New England Biolabs®) and RNase cocktail (Thermo Fisher Scientific) were added, and the solution was incubated at 37°C for 20 minutes to remove the RNA template. Nucleic acids were purified using Agencourt AMPure XP (Beckman Coulter) and eluted in nuclease-free water. This solution containing first-strand cDNA was filed in using DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs®), 100µM each dNTP, 400nM primer, and NEBufer2.1(New England Biolabs®) diluted to 1X (50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100µg / mL BSA) at 37°C for 20 minutes. Thermolabile Exonuclease I (New England Biolabs®) was added directly to the reaction and further incubated at 37°C for another 10 minutes to remove unused primer. Nucleic acids were purified using Agencourt AMPure XP (Beckman Coulter) and eluted in nuclease-free water. PCR was then performed to add on Ilumina sequencing handles and barcodes, and samples were quantified with Qubit™ 3 Fluorometer (Thermo Fisher Scientific). Libraries were pooled in equimolar fashion, purified with agarose gel electrophoresis, and loaded onto the Ilumina NextSeq 550 for paired-end sequencing with a Mid Output Kit (v2.5). For each RNA transcription sample, the UMI region of the transcript was counted to record the total number of transcription events within the reaction and normalized to the number of UMI counts measured from a ssDNA library prep control doped into the transcription reaction. Two RTs, shown in Table 1, produced significantly more cDNA in the assay. Normalized UMI counts produced by an extension reaction with MMLV are shown as a comparison and were colected across multiple experiments. Most reverse transcriptases tested returned a normalized UMI count << 1.Atorney Docket No.: 063586-543001WO Table 1. Results from In Vitro RT AssayThis Example thus shows that RT_D and RT_E exhibit RT activity in vitro.Atorney Docket No.: 063586-543001WO Example 2 – Evaluation of Additional Reverse Transcriptases with an In Vitro Assay In this Example, RT_F, RT_G, and RT_H are tested in an in vitro assay to determine eficiency of transcription of ribonucleic acid (RNA) substrates. These RT sequences, shown in Table 2, were identified through sequence homology to the RTs identified in Example 1. The assay is performed as described in Example 1. Table 2. RT Homolog Polypeptide SequencesAtorney Docket No.: 063586-543001WORT_F, RT_G, and RT_H are expected to exhibit RT activity in vitro at similar or higher levels than RT_D and RT_E from Example 1. Example 3 – RNA-Templated Editing of Human Genes in HEK293T Cels Using nSpCas9-Reverse Transcriptase Fusion Polypeptides In this Example, the RT polypeptides identified in Example 1 and Example 2 were fused to the C-terminus of the H840A nickase variant of SpCas9 to introduce specific edits into the genome. A sequence encoding the nSpCas9 nickase-RT fusion polypeptide was cloned into a pcDNA3.1 vector (Invitrogen) transcribed by a CMV promoter. The fusion comprised the folowing components arranged from N- to C-termini: 1) SV40 NLS (MKRTADGSEFESPKKKRKV; SEQ ID NO: 6) 2) nSpCas9 coding sequence, 3) XTEN linker, (SGGSSGGSSGSETPGTSESATPESSGGSSGGSS; SEQ ID NO: 7), 4) an RT of Example 1 or Example 2 (human codon-optimized), and 5) nucleoplasmin NLS (KRPAATKKAGQAKKKK; SEQ ID NO: 8). The amino acid sequences of the nSpCas9-RT fusions are shown in Table 3 below. Table 3. nSpCas9-RT Fusion PolypeptidesAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOEditing template RNAs were designed to be specific to the target sequences shown in Table 4 and cloned into a pUC19 plasmid comprising a U6 PolII promoter and a 6x polyT terminator sequence. The editing templates were synthesized by GenScript and comprised the folowing four components, from 5′ to 3′: 1) spacer sequence, 2) scafold motif, 3) reverse transcription template (RTT) encoding 1-4 nucleotide substitutions or insertions, and 4) primer binding site (PBS). Guides AAVS1-T2, EMX1-T6, VEGFA-T3, and RUNX1 were used. The sequences of each component and the ful-length editing template RNA sequences are shown in Tables 4 and 5. Nicking gRNAs were designed to create a nick within 100 bp of the target site to bias the DNA repair toward incorporating the edit introduced by the RT. The nicking gRNA sequences are shown in Table 5. Table 4. Sequences of Editing Template RNA ComponentsEncoded edits shown in bolded text Table 5. Ful-Length Sequences Used for Editing with nSpCas9-RT Fusion Polypeptides.Atorney Docket No.: 063586-543001WOEncoded edits shown in bolded text For each experiment, two or three plasmids were introduced into HEK293T cels. In al editing experiments, a plasmid expressing the nSpCas9-RT fusion polypeptide and a plasmid expressing the editing template RNA were included. Some experiments also included a plasmid expressing a nicking gRNA. Approximately 16 hours prior to transfection, 25,000 HEK293T cels in DMEM / 10%FBS+Pen / Strep (D10 media) were plated into each wel of a 96-wel plate. On the day of transfection, the cels were 50-70% confluent. For each wel to be transfected, a mixture of Lipofectamine 2000™ (Thermo Fisher Scientific) and Opti-MEM™ (Thermo Fisher Scientific) was prepared and incubated at room temperature for 5 minutes (Solution 1). After incubation, the Lipofectamine 2000™: Opti-MEM™ mixture was added to a separate mixture containing the nSpCas9-RT fusion polypeptide, editing template RNA, and Opti-MEM™ (Solution 2) or nSpCas9-RT fusion polypeptide, editing template RNA, nicking gRNA, and Opti-MEM™ (Solution 2). Solutions 1 and 2 were mixed by pipeting up andAtorney Docket No.: 063586-543001WO down, then incubated at room temperature for 25 minutes. Folowing incubation, the Solution 1 and 2 mixture was added dropwise to each wel of a 96-wel plate containing the cels. Approximately 72 hours post transfection, cels were trypsinized by adding TrypLE™ (Thermo Fisher Scientific) to the center of each wel and incubating at 37ºC for approximately 5 minutes. D10 media was then added to each wel and mixed to resuspend cels. The resuspended cels were centrifuged for 10 minutes to obtain a pelet, and the supernatant was discarded. The cel pelet was then resuspended in Quick Extract™ buffer (Lucigen®), and cels were incubated at 65ºC for 15 minutes, 68ºC for 15 minutes, and 98ºC for 10 minutes. Samples were prepared for NGS by amplifying a region of approximately 200 bp centered at each editing target, then sequenced with an Ilumina NovaSeq. For each target / sample, the fraction of NGS reads containing indels were calculated. To determine the percentage of edits instaled in the target genes, NGS reads determined to contain indels were further analyzed for insertions or substitutions coresponding to the edits encoded by the editing template RNAs. For al five nSpCas9-RT fusion polypeptides, editing of the target loci was observed, both without a nicking gRNA (Table 6) and with a nicking gRNA (Table 7). Across the five diferent RTs, up to ~4% of the sequencing reads contained the encoded edit, which increased to a maximum of ~34% when the nicking guide was added. The highest level of editing occured at the VEGFA-T3 target site with the nSpyCas9-RT_E fusion polypeptide (Table 7). nSpyCas9-RT_D was also particularly active at the VEGFA-T3 target, where ~28% of the NGS reads contained the edit encoded by the editing template RNA when the nicking gRNA was included (Table 7). Table 6. Editing Eficiencies with nSpCas9-RT Fusion Polypeptide without a Nicking gRNAAtorney Docket No.: 063586-543001WOTable 7. Editing Eficiencies with nSpCas9-RT Fusion Polypeptide with a Nicking gRNAOveral, this Example shows that the tested nSpCas9-RT fusion polypeptides incorporated substitutions and insertions encoded by editing template RNAs into human genes. Example 4 – RNA-Templated Editing of Human Genes in HEK293T Cels Using Cas12i2- Reverse Transcriptase Fusion Polypeptides In this Example, RTs identified in Example 1 and Example 2 were fused to the C- terminus of Cas12i2 to introduce specific edits into the genome using a modified version of the method described in US 20230023791, which is incorporated by reference in its entirety. A sequence encoding the Cas12i2-RT fusion polypeptide was cloned into a pcDNA3.1 vector (Invitrogen) transcribed by a CMV promoter. The fusion comprised the folowing components aranged from N- to C-termini: 1) His Tag (MKIEEGKGHHHHHH; SEQ ID NO: 36), 2) Cas12i2 coding sequence, nucleoplasmin NLS (KRPAATKKAGQAKKKK; SEQ ID NO: 8), 3) XTEN linker (SGGSSGGSSGSETPGTSESATPESSGGSSGGSS; SEQ ID NO: 7), 4) an RT from Example 1 or Example 2 (human codon-optimized), and 5) SV40 NLS (MKRTADGSEFESPKKKRKV; SEQ ID NO: 6). The amino acid sequences of the Cas12i2-Atorney Docket No.: 063586-543001WO RT fusion polypeptides are shown in Table 8. Table 8. Cas12i2-RT Fusion PolypeptidesAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOEditing template RNAs were designed to be specific to target sequences in the EMX1 and AAVS1 genes downstream of a 5′-TTT-3′ PAM sequence. Each guide made two edits: 1) a transversion of the second T in the PAM sequence to an A, and 2) a 4 bp transversion in the positions 13-16 bp downstream of the PAM sequence to their reverse complements. Each edit disrupted further targeting by Cas12i2 by interupting the PAM sequence or spacer targeting sequence. Each template RNA comprised five components, as shown in Table 9: 1) protecting group containing a direct repeat and non-targeting spacer sequence (described in US 20230023791, the relevant disclosures of which is incorporated by reference herein), 2) reverse transcriptase template (RTT) matching a non-target strand sequence (described in US 20230023791), 3) primer binding site (PBS), 4) Cas12i2 direct repeat sequence, and 5) spacer sequence. The ful-length editing template RNA sequences are shown in Table 10. These guides were cloned into a pUC19 plasmid between a U6 PolII promoter and 6x polyT terminator sequence.Atorney Docket No.: 063586-543001WO Table 9. Sequences of Editing Template RNA ComponentsEncoded edits shown in bolded text Table 10. Ful-Length Sequences Used for Editing with Cas12i2-RT Fusion PolypeptidesEncoded edits shown in bolded text Approximately 16 hours prior to transfection, 25,000 HEK293T cels in DMEM / 10%FBS+Pen / Strep (D10 media) were plated into each wel of a 96-wel plate. On the day of transfection, the cels were 50-70% confluent. For each wel to be transfected, a mixture of Lipofectamine 2000™ (Thermo Fisher Scientific) and Opti-MEM™ (Thermo Fisher Scientific) was prepared and incubated at room temperature for 5 minutes (Solution 1). After incubation, the Lipofectamine 2000™: Opti-MEM™ mixture was added to a separate mixture containing the Cas12i2-RT fusion polypeptide, editing template RNA, and Opti-MEM™ (Solution 2). Solutions 1 and 2 were mixed by pipeting up and down, then incubated at room temperature for 25 minutes. Folowing incubation, the Solution 1 and 2 mixture was added dropwise to each wel of a 96-wel plate containing the cels. Approximately 72 hours post transfection, cels were trypsinized by adding TrypLE™ (Thermo Fisher Scientific) to theAtorney Docket No.: 063586-543001WO center of each wel and incubating at 37ºC for approximately 5 minutes. D10 media was then added to each wel and mixed to resuspend cels. The resuspended cels were centrifuged for 10 minutes to obtain a pelet, and the supernatant was discarded. The cel pelet was then resuspended in Quick Extract™ bufer (Lucigen®), and cels were incubated at 65ºC for 15 minutes, 68ºC for 15 minutes, and 98ºC for 10 minutes. Samples were prepared for NGS as described in Example 3. For each of the Cas12i2- RT fusion polypeptides, incorporation of the edits encoded by the editing template RNAs was observed, as indicated in Table 11. Table 11. Editing Eficiencies with Cas12i2-RT Fusion PolypeptideOveral, this Example shows that the tested Cas12i2-RT fusion polypeptides incorporated substitutions and insertions encoded by editing template RNAs into human genes. Example 5 – Efectiveness of Variant RT Polypeptides for Targeting of Exemplary Human Genes This Example describes editing assessment of exemplary human genes using variant RTs fused to nSpCas9 and transfected into HEK293T cels. Single substitutions were designed based on the primary sequence of the RT, the predicted tertiary structure of the RT, or through arginine mutagenesis of residues identified with 10 Å2 of solvent-exposed surface area. The substitutions were individualy cloned into the nSpCas9-RT fusion plasmids described in Example 3. The plasmids of Example 3 are herein refered to as the reference plasmids. Each of the mutated sequences was tested for its ability to introduce edits encoded by editing template RNAs at one or more of four potential targets – the three targets described in Table 4 and Table 5 for AAVS1-T2, EMX1-T6, and VEGFA-T3 as wel as an additional target in AAVS1 where two diferent edits of each exposed ‘flap’ from the individualAtorney Docket No.: 063586-543001WO nicking reactions overlap to introduce the complete 50 bp sequence. The sequences of the two guides used to create the 50 bp insertion (AGGTTTGTACCGTACACCACTGAGACCGCGGTGGTTGACCAGACAAACCT; SEQ ID NO: 90) are shown in Table 12 and Table 13. Each mutation was tested in an arayed screening layout, using the method described in Example 3. For edits introducing the 50 bp insertion with two template RNA guides, the nicking guide described in Example 3 was replaced by the second templating guide. Targets that were not tested with a noted fusion polypeptide and template RNA combination are marked with ‘N / A.’ Table 12. Sequences of Editing Template RNA Components for Dual Flap EditingTable 13. Ful-Length Sequences Used for Editing with nSpCas9-Variant RT Fusion PolypeptidesFor nSpCas9-RT_F, 420 individual mutations were tested. Of those, 258 exhibited lower editing activity than that of the reference plasmid, while 162 yielded at least equivalent levels of editing at one or more targets compared to the reference plasmid.53 variants yieldedAtorney Docket No.: 063586-543001WO a ≥1.5x increase in editing level at one or more of the tested targets; this data is summarized in Table 14. Table 14. Fold-Increase in Editing for nSpCas9-Variant RT_F Polypeptides Relative to the Reference nSpCas9-RT_F PolypeptideAtorney Docket No.: 063586-543001WOFor nSpCas9-RT_D, 365 individual mutations were tested. Of those, 321 exhibited lower editing activity than that of the reference plasmid, while 44 yielded at least equivalent levels of editing activity at one or more targets relative to the reference plasmid.18 variants yielded a ≥1.5x increase in editing at one or more targets compared to the reference plasmid; this data is summarized in Table 15. Table 15. Fold-Increase in Editing for nSpCas9-Variant RT_D Polypeptides Relative to the Reference nSpCas9-RT_D PolypeptideAtorney Docket No.: 063586-543001WOFor nSpCas9-RT_E, 468 individual mutations were tested. Of those, 411 exhibited lower editing activity than that of the reference plasmid, while 57 yielded at least equivalent levels of editing activity at one or more targets relative to the reference plasmid.42 variants yielded a ≥1.5x increase in editing at one or more targets compared to the reference plasmid; this data is summarized in Table 16. Table 16. Fold-Increase in Editing for nSpCas9-Variant RT_E Polypeptides Relative to the Reference nSpCas9-RT_E PolypeptideAtorney Docket No.: 063586-543001WOFor nSpCas9-RT_G, 14 individual mutations were tested. Of those, 8 exhibited lower editing activity than that of the reference plasmid, while 6 yielded at least equivalent levels of editing activity at one or more targets relative to the reference plasmid.5 variants yielded a ≥1.5x increase in editing at one or more targets compared to the reference plasmid; this data is summarized in Table 17.Atorney Docket No.: 063586-543001WO Table 17. Fold-Increase in Editing for nSpCas9-Variant RT_G Polypeptides Relative to the Reference nSpCas9-RT_G PolypeptideFor nSpCas9-RT_H, 398 individual mutations were tested, al with a truncation of the amino acid sequence to positions 1-711. Of those, 332 exhibited lower editing activity than that of the reference plasmid, while 66 yielded at least equivalent levels of editing activity at one or more targets relative to the reference plasmid.58 variants yielded a ≥1.5x increase in editing at one or more targets compared to the reference plasmid; this data is summarized in Table 18. Table 18. Fold-Increase in Editing for nSpCas9-Variant RT_H Polypeptides Relative to the Reference nSpCas9-RT_H PolypeptideAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOThis Example thus shows that fusions of the RT variants and nSpCas9 introduced edits encoded by editing template RNAs into human genes. Example 6 – Efectiveness of Truncated RT Polypeptides for Editing Exemplary Human Genes This Example describes editing assessment of exemplary human genes using truncated RTs fused to nSpCas9 and transfected into HEK293T cels. To create truncations, the tertiary structure of each RT was first predicted using AlphaFold2 (Tunyasuvunakool et al., Nature 596 (2021). Then, each predicted structure was examined for domain boundaries, specificaly looking for sequence on the N- or C-terminus that appeared unstructured or not contributing to the core reverse transcriptase domain / fold. After removing the sequences that appeared unstructured from both termini, the shortened RT sequences were cloned as nSpCas9 fusions and tested as described in Example 5. Editing data is shown in Table 19 (numbers denote the amino acid positions included from the polypeptide sequences in Table 1 and Table 2). Table 19. Editing Using nSpCas9-Truncated RTs at Exemplary TargetsFor RT_D, truncations to 2-237, 2-430, and 2-569 al resulted in a complete loss ofAtorney Docket No.: 063586-543001WO activity. However, for RT_F, truncation to 20-669 and 1-494 each retained activity close to that of the reference (untruncated) polypeptide; truncation to 20-494 was expected to also retain activity and was tested in Example 7. For RT_E, truncation to 1-574 exhibited activity higher than or comparable to the reference (untruncated) polypeptide. For RT_G, truncation to 1-456 retained activity, and truncation to 1-711 outperformed the reference (untruncated) polypeptide at each target. Because RT_G and RT_H share 98% sequence similarity, the 1- 711 truncation was also applied to RT_H, as described in Example 7. Overal, this Example thus shows that fusions of truncated RT polypeptide variants and nSpCas9 introduced edits encoded by editing template RNAs into human genes. Example 7 – Efectiveness of RT Variant Polypeptides with Multiple Substitutions or Truncations for Targeting of Exemplary Human Genes This Example describes combining the beneficial substitutions identified in Example 5 and truncations identified in Example 6 and assessing the ability of the resulting variant polypeptides to introduce edits into the human genome at exemplary targets. To engineer fusion polypeptides with multiple substitutions, up to nine of the most active individual substitutions from Example 5 were combined. In some cases, additional variants were included based on the expectation of an increase in solubility, further interaction with the RNA / DNA template, or increasing RT activity. In some cases, beneficial substitutions were combined with the truncations from Example 6 or additional truncations designed using the AlphaFold2-predicted structures. Each variant RT polypeptide sequence was cloned into an expression plasmid as a fusion to the C-terminus of nSpCas9 as described in Example 3. The nSpCas9-variant RT fusion polypeptides were tested using the method described in Example 5. Results are shown in Table 20, Table 21, Table 22 and Table 23 (numbers denote the amino acids positions included from the polypeptide sequences in Table 1 and Table 2). Data shown was calculated as the percentage of NGS reads comprising the edit encoded by the editing template RNA used or the 50 bp insertion (for the dual flap insertion condition). The nSpyCas9-RT_F variant polypeptide comprising D208N, T314K, W321F, and T340P substitutions in RT_F resulted in high levels of encoded edits across the targets tested. Additional substitutions further increased the percentage of NGS reads containing the encoded edits, including N487D, G113R, V231I, N462K, and / or E310R. Diferent combinations of these substitutions led to similar levels of improved editing activity relative to the unmodified sequence in Table 3. / w 1 gni A A 6 7 4 4 1 4 5 6 X N / 6 6 0 3 9 1 8 5ra wg V 1Sni A 36 A A A A A A A A n N . / / / / / / o Vkc i i R 6 / / g 2 N N N N N N N N t A n an A ib o / m wg o 1 ni A A A A A C SkN / / / / A / A / A / A / A / O -9 Vci R N N N N N N N N N n g W s A 1 a 0 A 0 C 3 p - la 45 S 1 - n Su no 6 V Dpi al t 9 r A / 1. A / A / A / A / A / A / A / 8 g 5 n p e N 6 N N N 3 i A F s N N N N s b0 n 5 6 A 0 5 i : U .o gn / , P , P , , , , , , ,t P ,P ,P , , , , , N i s s K K K K K KP KP KP KPe ti n n 493 404404 404 404 404 404 404 40kc d o o E i oi 133 133 133 133 133 133 133 133 143 D . t t u a T G , , T T , , T TD , , 78 T TR , , 01 T TK , , 26 T TG , , 34 T TR , , 92 T TK , , 2 3 3 T TR , , 31y 02 ti c t n NF NF NF 4 NF 3 NF 4 NF 4 NF 2 NF 1 F 1enr e s u 812 812 812 N 81 E 81 N 81 L 81 Q81 D N81 Go ltt b bu r 023 03 03 023 023 023 023 023 023 A a T S T D W2 D W2 2 2 2 2 2 2 D W D W D W D W D W D W D W / w 1 g Sni A Vk N A / A / A / A / A / A / A / c R N N N N N N N Ai n g A o / wg 1 n Si A k N A / A / A / A / A / A / A / Vci R N N N N N N N A n g A lau n Dp oi pal tr A / A / A / A / A / A / A / b F es N N N N N N N 05 n i / , , , , , , , , , , , , , s s KP KP P P RR ,P , RR ,P , , RG P KR non 4 i o 104 410 K 4 410 K 4 410409 K 12 410409 K 12 4104013 K 441042692 t it 33 u TG 33 I T1 33 TW33 T32 33 T32 33 T34 L 3342 t a T 7 T T T E Q T E Q E T Q i c , ,F 54 , , 3 F 2 , , 1 F 1 , , , , , , , , T, , , , T, , N, , ts n 6 F DK F DG F DK F G bu N1 u r 802 D N81 V N1 N1 02 82 L 82782 N1 6 82783 N1 4 82782 N1 D 682734 S T 23 23 023 02344 02344 03440384 D D D D N D W N L 2 2 4 W W W W N D W N N D W N L / 1 g Sni A N A / A 3 / 6. A / A / A / A / A / Vkci R N N 6 N N N N N A n g 2 A o / wg 1 ni A 0 Sk N A / A / 0 A / A / A / A / A / Vci R N N .0 N N N A g N N n A lau no Dp it A A A 05 10 9 1 8 pal r / / / . . 6. 5. 7. b F es N N N 6 0 5 7 4 3 8 5 n 5 5 5 4 i / , , , , , , , , , , , , , , , , , s s KP non 40KR i o 429 KP 2 40 RG KP9 KP K KP KP KP D 40 7 13 43 404 4 404 404 4048 t i 1 t 3362 1 u T4 33 T344R 13 13 1 F 13 13 134 9 3 G 3 TH2 31 3 TP7 3 TM 3 T N t a T i c , , N Q T F , , , , E L F , , 2 T 2 , , T F , ,F 3 T2 T 1 , 3 , ,F 4 T 1 , , 1 T F 3 , ,F , ts n N1 RG N1 DK Q N1 N1 D N N1 L N12 N1 G bu u r 802034 8272 82 82 8 W 82 82 V 8275 S T 2314 0238464 023 023 0 03 03 034 D W3 E L 2 2 2 2 D W N N D W D W D D W D W D W D / w 1 g Sni A k N A / A / A / A / A / A / A / A / Vci R g N N N N N N N N A n A o / wg 1 n Si A k N A / A / A / A / A / A / A / A / Vci R g N N N N N N N N A n A lau no Dp it 17 29 40 86 36 89 11 60 pal r . b F es 4 . 0 5 5 . 5 4 . . . . . 5 75 55 6 6 8 5 n 5 5 5 i / , , R , , R , , R , , , , , , , , , , s s KP 3 KP 3 KP 3 KP R KP R7 KP R0 F1 R KP K n n 4041 4041 406 4066 406 407 29 402 oi o t i 1 t 331 1 T 31 1434 144 144 144 32 146 G 3 T G 3 T A 33 T T 33 T 33 T 2 33 T4G ut a T i c , , , T, , , T, , , T, , , T, , H, T, , A, W t , Q, T, , N, 34 s n NF1 G F D F D F D F F P F 4 bur 8027 N1 5 8027 N1 8 827 N1 8 827 N1 D 8 827 N1 D 8 827 K 8 40 N1 D 4 827 L u 234 234 0234 0234 0234 0234 13 038 S T D D D W D W N D W D W 3 T T 2 4 W D W N N N N D W N / 6g Tn - i 1 kc A N A / A / A / A / 7 8 4 9 Xi n 5 R . 1. 2. 2. g N N N N 8 8 6 8 Mo E / w / w 1 g Sni A k N A / A / A / A / A / A / A / A / Vc R N N N N N N N N Ai n g A o / wg 1 ni A Sk N A / A / A / A / A / A / A / A / Vci R N N N N N N N N A n g A lau no Dp i a t 69 9 9 . 6. 7. 65 A / A / A A pl r b F es 8 4 6 . / / N N N 0 4 5 8 N 5 n 4 i / , , , , ,F , , , , F F , s s K n n 4P0R i 40 K3 N 4 81 KP 2 40 K4P0 K4 1 1 KW 1 2 2 41 oo 1 1 0 14 14 3 3 11 t it 33 T34 L 23 P 33 TH 33 3 TD T 36 ut a T i c , , E, , D, W0 , 4 T 3 , , 16 T 1 , , 46 , W, W, T, L, ts n bu NF r 81 D 027 K 82 4 F F 6 9K 1 N N F 44 T N812 D N812 F 8 K 0 4 8 N 0 812 u 3 4 - 1 03 03 2 1 03 S T 2 4 N 03 2 2 D 3 2 2 D W N 2 T D W D W T D D WAtorney Docket No.: 063586-543001WO Table 21. Editing Using nSpCas9-Combination Variant RT_D Polypeptides at Exemplary TargetsThe nSpyCas9-RT_D variant polypeptide comprising K58R, D114K, L460W, and S316P substitutions in RT_D resulted in ~44% of NGS reads containing the 50 bp insertion at AAVS1, the highest level observed at that target. The nSpyCas9-RT_D variant polypeptide comprising K58R, A117R, L460W, and S316P substitutions in RT_D generated the second highest level of encoded edits at the VEGFA-T3 site, suggesting some target specific efects of mutations near positions 114-117. Table 22. Editing Using nSpCas9-Combination Variant RT_E Polypeptides at Exemplary TargetsAtorney Docket No.: 063586-543001WOAtorney Docket No.: 063586-543001WOThe nSpyCas9-RT_E variant polypeptide comprising T296N, L396K, K424P, and L289K substitutions in RT_E exhibited the highest percentage of NGS reads comprising encoded edits at targets EMX1-T6, VEGFA-T3, and RUNX1. At the AAVS1 target, the highest editing activity was observed with the variant containing T296N, L396K, K424P, L289K, and L227K. Table 23. Editing Using nSpCas9-Combination Variant RT_H Polypeptides at Exemplary TargetsAtorney Docket No.: 063586-543001WOThe nSpyCas9-RT_H variant polypeptide comprising the 1-711 truncation and N19K, N23R, and Q11R substitutions in RT_H demonstrated the highest percentage of NGS reads comprising encoded edits (~43%) with the 50 bp insertion at AAVS1. Multiple other variant polypeptides demonstrated higher levels of activity at the VEGFA-T3 target, including 1-711 with Q88K and A233V. Thus, multiple combinations of substitutions led to increased levels of editing relative to reference fusion polypeptide in Example 3. This Example thus shows that fusions of the RT combination variants and nSpCas9 introduced edits encoded by editing template RNAs into human genes. Example 8 – Efectiveness of RT Variant Polypeptides to Introduce Insertions into Exemplary Human Genes This Example describes assessing the ability of variant RT polypeptides to introduce edits 38 bp or longer into the human genome at exemplary targets. Additional editing template RNAs were designed to be specific to two nearby sites within three targets in the HEK3, FANCF, and HEK4 genes and replace the sequence between the targets within each gene with either 38 or 108 bp (HEK3) or 150 bp (FANCF and HEK4) of new sequence. Each member of a pair of template RNAs writes half of the newAtorney Docket No.: 063586-543001WO sequence of of the two liberated ‘flaps’ folowing nickase activity of nSpCas9. Those newly writen sequences then anneal together to complete the fuly inserted sequence, resulting in the original sequence between the two guides being replaced. The editing template RNAs were designed and cloned as described in Example 5. The individual parts of each template RNA are indicated in Table 24, and the ful sequences cloned into the plasmids for mammalian expression are in Table 25. Table 24. Sequences of Editing Template RNA Components for Dual Flap Editing at HEK3, FANCF and HEK4 TargetsAtorney Docket No.: 063586-543001WOTable 25. Ful-Length Sequences Used for Editing with nSpCas9-Variant RT Fusion Polypeptides at HEK3, FANCF and HEK4 TargetsAtorney Docket No.: 063586-543001WOTen variant RT polypeptides fused to nSpCas9 were tested for insertion of 38 bp or 108 bp at the HEK3 target, 50 bp at the AAVS1 target, or 150 bp at the FANCF target using the guide pairs described in Table 13 and Table 25. Some of the nSpCas9-RT fusions contained additional substitutions or truncations as described in Example 5 or Example 7, while others contained no additional substitutions beyond the sequences in Table 1 and Table 2. Results are shown in Table 26. Data shown was calculated as the percentage of NGS reads comprising the edit encoded by the pair of editing template RNAs. Table 26. Demonstration of Editing Longer Regions with RT Variant PolypeptidesAtorney Docket No.: 063586-543001WOAl 10 of the nSpCas9-RT fusion polypeptides demonstrated >5% reverse transcription activity for the 38 bp and 50 bp insertions. nSpCas9-RT fusions with RT_F, RT_D, and RT_E showed the highest levels of encoded edits at the 150 bp insertions. The RT_F D208N, T314K, W321F, and T340P variant in particular displayed over 10% reverse transcription activity at both 150 bp targets. Additionaly, some of the top-performing mutants from Examples 5-7 for RT_F, RT_D, RT_E, and RT_H were tested to reverse transcribe 38 bp into HEK3 and 150 bp into HEK4 using the method described in Example 5. Results are shown in Table 27, Table 28, Table 29, and Table 30. Data shown was calculated as the percentage of NGS reads comprising the edit encoded by the pair of editing template RNAs. Table 27. Editing Using nSpCas9-Variant RT_F Polypeptides at Exemplary Large Insertion TargetsIntroducing L74R, A295R, and P363R single substitutions into RT_F increased the percentage of NGS reads containing the edit for HEK338 bp. The variant containing D208N, T314K, W321F, and T340P demonstrated over a 5-fold increase in the number of NGS reads containing the encoded 38 bp edit at HEK3, and a 4-fold increase for the 150 bp edit at HEK4.Atorney Docket No.: 063586-543001WO Table 28. Editing Using nSpCas9-Variant RT_D Polypeptides at Exemplary Large Insertion TargetsIntroducing the L52R, A107R, and D114K single substitutions into RT_D increased the percentage of NGS reads containing the edit for HEK338 bp. Combinations of substitutions are expected to increase the 150 bp HEK4 insertion, based on the data in Table 22. Table 29. Editing Using nSpCas9-Variant RT_E Polypeptides at Exemplary Large Insertion TargetsIntroducing the S490R, D159R, and E265R single substitutions into RT_E increased the percentage of NGS reads containing the 38 bp edit for HEK3 as wel as the 150 bp insertion in HEK4. The L227R variant only improved the 150 bp insertion at HEK4. The variant containing T296N, L396K, K424P, and L289K demonstrated increased edit incorporation compared to the reference RT_E for the 150 bp insertion at HEK4. Table 30. Editing Using nSpCas9-Variant RT_H Polypeptides at Exemplary Large Insertion TargetsAtorney Docket No.: 063586-543001WO Introducing the 1-711 truncation of RT_H with the D31R and H361R substitutions showed an increase in the percentage of NGS reads containing the 38 bp insertion at HEK3. A combination variant comprising the N19K and E70R substitutions with the 1-711 truncation demonstrated an increase in the percentage of reads comprising the 150 bp insertion at HEK4. This Example thus shows that fusions of the RT variants and nSpCas9 introduced edits up to about 150 bp in length into human genes. OTHER EMBODIMENTS Al of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, one skiled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims. EQUIVALENTS While several inventive embodiments have been described and ilustrated herein, those of ordinary skil in the art wil readily envision a variety of other means and / or structures for performing the function and / or obtaining the results and / or one or more of the advantages described herein, and each of such variations and / or modifications is deemed to be within the scope of the inventive embodiments described herein. More generaly, those skiled in the art wil readily appreciate that al parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and / or configurations wil depend upon the specific application or applications for which the inventive teachings is / are used. Those skiled in the art wil recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments mayAtorney Docket No.: 063586-543001WO be practiced otherwise than as specificaly described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods, if such features, systems, articles, materials, kits, and / or methods are not mutualy inconsistent, is included within the inventive scope of the present disclosure. Al definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms. Al references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject mater for which each is cited, which in some cases may encompass the entirety of the document. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and / or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and / or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionaly be present other than the elements specificaly identified by the “and / or” clause, whether related or unrelated to those elements specificaly identified. Thus, as a non-limiting example, a reference to “A and / or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionaly including elements other than B); in another embodiment, to B only (optionaly including elements other than A); in yet another embodiment, to both A and B (optionaly including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” shal be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionaly, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” wil refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shal only be interpreted as indicating exclusive alternatives (i.e. “one or the other but notAtorney Docket No.: 063586-543001WO both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentialy of,” when used in the claims, shal have its ordinary meaning as used in the field of patent law. As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specificaly listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also alows that elements may optionaly be present other than the elements specificaly identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specificaly identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and / or B”) can refer, in one embodiment, to at least one, optionaly including more than one, A, with no B present (and optionaly including elements other than B); in another embodiment, to at least one, optionaly including more than one, B, with no A present (and optionaly including elements other than A); in yet another embodiment, to at least one, optionaly including more than one, A, and at least one, optionaly including more than one, B (and optionaly including other elements); etc. It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

Claims

Atorney Docket No.: 063586-543001WO WHAT IS CLAIMED IS:

1. A reverse transcriptase (RT) polypeptide, which comprises (i) a polymerase domain comprising a fingers subdomain, a palm subdomain, and a thumb subdomain, (i) a connection subdomain, and (ii) an RNase domain or a PrimPol domain, and optionaly (iv) a protease domain; wherein the RT polypeptide comprises a YXDD motif, in which X represents a naturaly-occuring amino acid residue; and wherein the RT polypeptide contains about 450 to 940 amino acids in length.

2. The RT polypeptide of claim 1, which comprises an amino acid sequence at least 85% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; or SEQ ID NO: 5; optionaly wherein the RT polypeptide comprises at least one mutation relative to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4; or SEQ ID NO:

5.

3. The RT polypeptide of claim 2, comprising an amino acid sequence at least 90% identical to SEQ ID NO: 1 and one or more mutations relative to SEQ ID NO: 1; wherein the one or more mutations comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof.

4. The RT polypeptide of claim 3, wherein the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions W5, I13, S43, P49, L52, N53, K58, A107, A110, D114, H149, N313, G478, I501, P543, L585, D597, and L603 in SEQ ID NO: 1; optionaly wherein the substitutions are W5R, I13R, S43R, P49R, L52R, N53R, K58R, A107R, A110R, D114K, H149R, N313R, G478R, I501R, P543R, L585R, D597R, and / or L603R.

5. The RT polypeptide of claim 3 or claim 4, wherein RT polypeptide comprises one or more amino acid residue substitutions at position S316 and / or position L460 of SEQ ID NO: 1; optionaly wherein the amino acid residue substitution is S316P and / or L460W.

6. The RT polypeptide of claim 3, wherein the RT polypeptide comprises a combination of amino acid residue substitutions at (a) position K58, and (b) position D114,Atorney Docket No.: 063586-543001WO A117, S316, and / or L460 relative to SEQ ID NO: 1; optionaly wherein the amino acid residue substitution is K58R, D114K, A117R, S316P, and / or L460W.

7. The RT polypeptide of claim 3, which comprises amino acid substitutions at the folowing positions relative to SEQ ID NO: 1: (1) K58 and A117, optionaly K58R and A117R; (2) K58 and D114, optionaly K58R and D114K; (3) K58 and L460, optionaly K58R and L460W; (4) K58 and S316; optionaly K58R and S316P; (5) K58, A117, and L460, optionaly K58R, A117R, and L460W; (6) K58, A117, and S316, optionaly K58R, A117R, and S316P; (7) K58, D114, and L460, optionaly K58R, D114K, and L460W; (8) K58, D114, and S316, optionaly K58R, D114K, and S316P; (9) K58, A117, S316, and L460, optionaly K58R, A117R, S316P, and L460W, (10) K58, D114, S316, and L460, optionaly K58R, D114K, S316P, L460W, or (11) K58, D114, A117,and L460, optionaly K58R, D114K, A117R, S316P, and L460W.

8. The RT polypeptide of claim 2, comprising an amino acid sequence at least 90% identical to SEQ ID NO: 2 and one or more mutations relative to SEQ ID NO: 2; wherein the one or more mutations comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof.

9. The RT polypeptide of claim 8, wherein the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions T46, L47, Y61, E74, D159, Y160, S177, P206, P208, T224, L227, V243, T263, P264, E265, L289, V311, S392, L396, S467, S490, I511, T551, T554, Y555, H574, I575, P576, V578, P606, D607, P608, T609, S611, N612, N613, Q632, N639, H640, Q643, I700, E708, F731,and N751 in SEQ ID NO: 2; optionaly wherein the substitution is T46R, L47R, Y61R, E74R, D159R, Y160R, S177R, P206R, P208R, D209, T224R, L227R, L227K, V243R, T263R, P264R, E265R, L289R, L289K, V311R, S392R, L396K, S467R, S490R, I511R, T551R, T554R, Y555R, H574R, I575R, P576R, V578R, P606R, D607R, P608R, T609R, S611R, N612R, N613R,Atorney Docket No.: 063586-543001WO Q632R, N639R, H640R, Q643R, I700R, E708R, F731R, and / or N751R.

10. The RT polypeptide of claim 8 or claim 9, wherein RT polypeptide comprises one or more amino acid residue substitutions at position S25, A156, L227, V243, L289, T296, K424, and / or P570 of SEQ ID NO: 2; optionaly wherein the substitution is S25A, A156S, L227H, V243P, L289H, T296N, K424P, and / or P570D.

11. The RT polypeptide of any one of claims 8-10, wherein the RT polypeptide is a truncation variant of SEQ ID NO: 2 comprising one or more deletions in SEQ ID NO: 2; optionaly wherein the one or more deletions are at the N-terminus, at the C-terminus, or both.

12. The RT polypeptide of claim 11, wherein the one or more deletions comprise deletions within residues 1-93 of SEQ ID NO: 2, within residues 575-751 of SEQ ID NO: 2, or a combination thereof.

13. The RT polypeptide of claim 12, wherein the RT polypeptide is a truncated version of SEQ ID NO: 2 having amino acid residues 1-574 of SEQ ID NO: 2, amino acid residues 94-751 of SEQ ID NO: 2, or amino acid residues 94-574 of SEQ ID NO:

2.

14. The RT polypeptide of any one of claims 8-11, wherein the RT polypeptide comprises a combination of amino acid residue substitutions at (a) positions T296 and L396, optionaly T296N and L396K, and (b) one or more of positions S25, A156, D209, L227, V243, L289, V311, S392, K424, I511, T551, T554, Y555, and P570, optionaly S25A, A156S, D209R, L227H, L227K, V243P, L289K, L289H, L289R, V311R, S392R, K424P, I511R, T551R, T554R, Y555R, and P570D, relative to SEQ ID NO: 2; optionaly wherein the RT polypeptide further comprises a deletion within residues 1- 93 of SEQ ID NO: 2, within residues 575-751 of SEQ ID NO: 2, or a combination thereof.

15. The RT polypeptide of claim 14, which comprises the folowing mutations relative to SEQ ID NO: 2: (1) substitutions at positions T296, L396, and K424, optionaly T296N, L396K, and K424P;Atorney Docket No.: 063586-543001WO (2) substitutions at positions T296, L396, K424, and L289, optionaly T296N, L396K, K424P, and L289K; (3) substitutions at positions T296, L396, K424, and V243, optionaly T296N, L396K, K424P, and V243P; (4) substitutions at positions T296, L396, K424, and D209, optionaly T296N, L396K, K424P, and D209R; (5) substitutions at positions T296, L396, K424, L289, S392, A156, and V243, optionaly T296N, L396K, K424P, L289K, S392R, A156S, and V243P; (6) substitutions at positions T296, L396, K424, L289, S392, V243, and D209, optionaly T296N, L396K, K424P, L289K, S392R, V243P, and D209R; (7) substitutions at positions T296, L396, K424, L289, S392, A156, and D209, optionaly T296N, L396K, K424P, L289K, S392R, A156S, and D209R; (8) substitutions at positions T296, L396, K424, L289, A156, V243, and D209, optionaly T296N, L396K, K424P, L289K, A156S, V243P, and D209R; (9) substitutions at positions T296, L396, K424, S392, A156, V243, and D209, optionaly T296N, L396K, K424P, S392R, A156S, V243P, and D209R; (10) substitutions at positions T296, L396, K424, L289, S392, A156, V243, and D209, optionaly T296N, L396K, K424P, L289K, S392R, A156S, V243P, and D209R; (11) substitutions at positions T296, L396, K424, and L227, optionaly T296N, L396K, K424P, and L227K; (12) substitutions at positions T296, L396, K424, and P570, optionaly T296N, L396K, K424P, and P570D; (13) substitutions at positions T296, L396, K424, and V311, optionaly T296N, L396K, K424P, and V311R; (14) substitutions at positions T296, L396, K424, and S392, optionaly T296N, L396K, K424P, and S392R; (15) substitutions at positions T296, L396, K424, and A156, optionaly T296N, L396K, K424P, and A156S; (16) substitutions at positions T296, L396, and L289, optionaly T296N, L396K, and L289K; (17) substitutions at positions T296, L396, K424, L289, and S25, optionaly T296N, L396K, K424P, L289K, and S25A;Atorney Docket No.: 063586-543001WO (18) substitutions at positions T296, L396, K424, L289, and L227, optionaly T296N, L396K, K424P, L289K, and L227K; (19) substitutions at positions T296, L396, K424, and L289, optionaly T296N, L396K, K424P, and L289R or L289H; (20) substitutions at positions T296, L396, K424, L289, and L227, optionaly T296N, L396K, K424P, L289H, and L227H; (21) substitutions at positions T296, L396, K424, L289, and I511, optionaly T296N, L396K, K424P, L289K, and I511R; (22) substitutions at positions T296, L396, K424, L289, and T551, optionaly T296N, L396K, K424P, L289K, and T551R; (23) substitutions at positions T296, L396, K424, L289, and T554, optionaly T296N, L396K, K424P, L289K, and T554R; (24) substitutions at positions T296, L396, K424, L289, and Y555, optionaly T296N, L396K, K424P, L289K, and Y555R; (25) substitutions at positions T296, L396, K424, L289, and V243, optionaly T296N, L396K, K424P, L289K, and V243P; (26) substitutions at positions T296, L396, K424, L289, S392, and V243, optionaly T296N, L396K, K424P, L289K, S392R, and V243P; (27) a truncated version containing residues 1-574 of SEQ ID NO: 2 with substitutions at positions T296, L396, K424, and L289, optionaly T296N, L396K, K424P, and L289K; or (28) a truncated version containing residues 94-574 of SEQ ID NO: 2 with substitutions at positions T296, L396, K424, and L289, optionaly T296N, L396K, K424P, and L289K.

16. The RT polypeptide of claim 2, comprising an amino acid sequence at least 90% identical to SEQ ID NO: 3 and one or more mutations relative to SEQ ID NO: 3; wherein the one or more mutations comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof.

17. The RT polypeptide of claim 16, wherein the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions L74, G113, D132, N139, P148, Q229, I299, E310, T314, W287, A295,Atorney Docket No.: 063586-543001WO T314, L360, P363, L393, G394, W396, P399, N462, A463, H467, A470, D476, A489, L492, Q505, I506, A508, E509, H511, G512, T513, D516, D519, A597, H600, V601, H602, G603, E604, I605, Y606, L611, and H642 of SEQ ID NO: 3; optionaly wherein the substitution is L74R, G113R, D132K, N139K, P148R, Q229R, I299R, E310R, T314K, W287R, A295R, T314R, T314K, L360R, P363R, L393R, G394R, W396R, P399R, N462K, N462R, A463R, H467R, A470R, D476R, A489R, L492R, Q505R, I506R, A508R, E509R, H511R, G512R, T513R, D516R, D519R, A597R, H600R, V601R, H602R, G603R, E604R, I605R, Y606R, L611R, and / or H642R.

18. The RT polypeptide of claim 16 or claim 17, wherein the one or more amino acid residue substitutions are at positions L147, D161, F164, D208, V231, F317, W321, G339, T340, L443, D457, A470, and / or N487 of SEQ ID NO: 3, optionaly substitutions L147P, D161H, F164D, D208N, V231I, V231M, F317N, W321F, G339P, T340P, L443G, D457G, A470R, and / or N487D.

19. The RT polypeptide of any one of claims 16-18, wherein the one or more deletions comprise deletions within residues 1-19 of SEQ ID NO: 3, residues 495-669 of SEQ ID NO: 2, or a combination thereof; optionaly wherein the RT polypeptide is a truncated version of SEQ ID NO: 3 having amino acid residues 20-669, amino acid residues 1-494, or amino acid residues 20-494 of SEQ ID NO:

3.

20. The RT polypeptide of claim 16, which comprises a combination of mutations relative to SEQ ID NO: 3, wherein the combination of mutations comprises (a) amino acid residue substitutions at two or al of positions D208, T314, and W321 of SEQ ID NO: 3, optionaly at least two of D208N, T314K, and W321F; optionaly wherein the combination of mutations further comprises (b) amino acid residue substitutions at one or more of positions G113, D132, D161, F164, Q229, V231, G339, E310, T340, L443, D457, N462, A463, H467, N487, and L611 of SEQ ID NO: 3, optionaly substitutions G113R, D132K, D132H, D161H, F164D, Q229R, V231I, V231M, G339P, E310R, T340P, L443G, D457G, N462K, A463R, H467R, N487D, and / or L611W; and / or optionaly deletions within residues 1-19 of SEQ ID NO: 3, residues 495-669 of SEQ ID NO: 2, or a combination thereof.Atorney Docket No.: 063586-543001WO 21. The RT polypeptide of claim 16, which comprises the folowing mutations relative to SEQ ID NO: 3: (1) substitutions at positions D208, T314, and W321, optionaly D208N, T314K, and W321F; (2) substitutions at positions D208, T314, W321, and T340, optionaly D208N, T314K, W321F, and T340P; (3) substitutions at positions D208, T314, W321, and G339, optionaly D208N, T314K, W321F, and G339P; (4) substitutions at positions D208, T314, W321, T340, and N487, optionaly D208N, T314K, W321F, T340P, and N487D; (5) substitutions at positions D208, T314, W321, T340, and E310, optionaly D208N, T314K, W321F, T340P, and E310R; (6) substitutions at positions D208, T314, W321, T340, and N462, optionaly D208N, T314K, W321F, T340P, and N462K; (7) substitutions at positions D208, T314, W321, T340, and L443, optionaly D208N, T314K, W321F, T340P, and L443G; (8) substitutions at positions D208, T314, W321, T340, and Q229, optionaly D208N, T314K, W321F, T340P, and Q229R; (9) substitutions at positions D208, T314, W321, T340, and D132, optionaly D208N, T314K, W321F, T340P, and D132K; (10) substitutions at positions D208, T314, W321, T340, and G113, optionaly D208N, T314K, W321F, T340P, and G113R; (11) substitutions at positions D208, T314, W321, T340, and D457, optionaly D208N, T314K, W321F, T340P, and D457G; (12) substitutions at positions D208, T314, W321, T340, and V231, optionaly D208N, T314K, W321F, T340P, and V231I or V231M; (13) substitutions at positions D208, T314, W321, T340, and L611, optionaly D208N, T314K, W321F, T340P, and L611W; (14) substitutions at positions D208, T314, W321, T340, N487, E310, N462, and Q229, optionaly D208N, T314K, W321F, T340P, N487D, E310R, N462K, and Q229R; (15) substitutions at positions D208, T314, W321, T340, N487, E310, L443,Atorney Docket No.: 063586-543001WO and Q229, optionaly D208N, T314K, W321F, T340P, N487D, E310R, L443G, and Q229R; (16) substitutions at positions D208, T314, W321, T340, N487, E310, N462, and L443, optionaly D208N, T314K, W321F, T340P, N487D, E310R, N462K, and L443G; (17) substitutions at positions D208, T314, W321, T340, N487, N462, L443, and Q229, optionaly D208N, T314K, W321F, T340P, N487D, N462K, L443G, and Q229R; (18) substitutions at positions D208, T314, W321, T340, E310, N462, L443, and Q229, optionaly D208N, T314K, W321F, T340P, E310R, N462K, L443G, and Q229R; (19) substitutions at positions D208, T314, W321, T340, N487, E310, N462, L443, and Q229, optionaly D208N, T314K, W321F, T340P, N487D, E310R, N462K, L443G, and Q229R; (20) substitutions at positions D208, T314, W321, and G339, optionaly D208N, T314K, W321F, and G339P; (21) substitutions at positions D208, T314, W321, T340, and D132, optionaly D208N, T314K, W321F, T340P, and D132H; (22) substitutions at positions D208, T314, W321, T340, D457, and N487, optionaly D208N, T314K, W321F, T340P, D457G, and N487D; (23) substitutions at positions D208, T314, W321, T340, D457, and G113, optionaly D208N, T314K, W321F, T340P, D457G, and G113R; (24) substitutions at positions D208, T314, W321, T340, N487, and G113, optionaly D208N, T314K, W321F, T340P, N487D, and G113R; (25) substitutions at positions D208, T314, W321, T340, N487, and A463, optionaly D208N, T314K, W321F, T340P, N487D, and A463R; (26) substitutions at positions D208, T314, W321, T340, N487, and A463, optionaly D208N, T314K, W321F, T340P, N487D, and T466R; (27) substitutions at positions D208, T314, W321, T340, N487, and H467, optionaly D208N, T314K, W321F, T340P, N487D, and H467R; (28) substitutions at positions D208, T314, W321, T340, N487, and A470, optionaly D208N, T314K, W321F, T340P, N487D, and A470R; (29) substitutions at positions T314, W321, T340, and Q229, optionalyAtorney Docket No.: 063586-543001WO T314K, W321F, T340P, and Q229R; (30) substitutions at positions D208, T314, W321, T340, N487, N462 and L443, optionaly D208N, T314K, W321F, T340P, N487D, N462K, and L443G; (31) substitutions at positions D208, T314, W321, T340, N487, E310, N462, and L443, optionaly D208N, T314K, W321F, T340P, N487D, E310R, N462K, and L443K; (32) substitutions at positions D208, T314, W321, T340, and D161, optionaly D208N, T314K, W321F, T340P, and D161H; (33) substitutions at positions D208, T314, W321, T340, and F164, optionaly D208N, T314K, W321F, T340P, and F164D; (34) substitutions at positions D208 and T314, optionaly D208N and T314K; (35) substitutions at positions T314 and W321, optionaly T314K, and W321F; (36) substitutions at positions D208 and W321, optionaly D208N and W321F; (37) substitutions at positions D208, T314, W321, and L611, optionaly D208N, T314K, W321F, and L611W; or (38) a truncated version having amino acid residues 20-494 of SEQ ID NO: 3 with amino acid substitutions at positions D208, T314, W321, and T340, optionaly D208N, T314K, W321F, and T340P.

22. The RT polypeptide of claim 2, comprising an amino acid sequence at least 90% identical to SEQ ID NO: 4 and one or more mutations relative to SEQ ID NO: 4; wherein the one or more mutations comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof.

23. The RT polypeptide of claim 20, wherein the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions N19, N23, A26, E70, and Q88 in SEQ ID NO: 4; optionaly N19K, N23R, A26K, E70R, and / or Q88K.

24. The RT polypeptide of claim 22 or claim 23, wherein the one or more deletions comprise deletions within residues 457-939 of SEQ ID NO: 4; optionaly wherein the RT polypeptide is a truncated version of SEQ ID NO: 4 having amino acid residues 1-711 or amino acid residues 1-456 of SEQ ID NO: 4.Atorney Docket No.: 063586-543001WO 25. The RT polypeptide of claim 2, comprising an amino acid sequence at least 90% identical to SEQ ID NO: 5 and one or more mutations relative to SEQ ID NO: 5; wherein the one or more mutations comprise one or more amino acid residue substitutions, one or more deletions, or a combination thereof.

26. The RT polypeptide of claim 25, wherein the one or more amino acid residue substitutions are arginine and / or lysine substitutions, optionaly arginine substitutions, at one or more of positions S2 Q14, N19, N23, P25, D31, E35, M36, N39, N40, E43, E44, E56, M67, E70, E71, Q88, Q92, Y109, P111, P175, Q178, E179, G180, G181, N289, D292, E315, and H361 of SEQ ID NO: 5; optionaly wherein the substitution is S2R, Q14R, N19R, N23R, P25R, D31R, E35R, M36R, N39R, N40R, E43R, E44R, E56R, M67R, E70R, E71R, Q88K, Q88R, Q92R, Y109R, P111R, P175R, Q178R, E179R, G180R, G181R, N289R, D292R, E315R, and / or H361R.

27. The RT polypeptide of claim 25 or claim 26, which comprises or further comprises an amino acid residue substitution at position M67, E70, E71, Q88, A223, Y109, and / or I195 of SEQ ID NO: 5, optionaly M67H, E70P, E71G, Q88H, A223V. A223M, A223I, Y109H, and / or I195H.

28. The RT polypeptide of any one of claims 25-27, wherein the one or more deletions comprise deletions within residues 712-939 of SEQ ID NO: 5; optionaly wherein the RT polypeptide is a truncated version of SEQ ID NO: 4 having the amino acid residues 1- 711 of SEQ ID NO:

5.

29. The RT polypeptide of claim 25, which is a truncated version of SEQ ID NO: 5 having the amino acid residues 1-711 of SEQ ID NO: 5, and wherein the RT polypeptide further comprises the folowing mutations relative to SEQ ID NO: 5: (1) substitutions at positions N19 and E70, optionaly N19K and E70R; (2) substitutions at positions N19 and N23, optionaly N19K and N23R; (3) substitutions at positions Q88 and N23, optionaly Q88K and N23R; (4) substitutions at positions N19, N23, and Q11, optionaly N19K, N23R, and Q11R; (5) substitutions at positions N19, N23, and Q88, optionaly N19K, N23R, andAtorney Docket No.: 063586-543001WO Q88K; (6) substitutions at positions Q88, N23, and Q11, optionaly Q88K, N23R, and Q11R; (7) substitutions at positions N19, N23, Q11, and Q88, optionaly N19K, N23R, Q11R, Q88K or Q88H; (8) substitutions at positions Q88 and A223, optionaly Q88K and A223V; Q88K and A223M, or Q88K and A223I; (9) substitutions at positions Q88, Y109, and A223, optionaly Q88K, Y109H, A223V, A223M, or A223I; (10) substitutions at positions Q88 and Y109, optionaly Q88K, Y109H or Y109R; (11) substitutions at positions Q88 and E315, optionaly Q88K and E315R; (12) substitutions at positions Q88 and M67, optionaly Q88K, M67R or M67H; (13) substitutions at positions Q88 and I195, optionaly Q88H and I195H; (14) substitutions at positions E70 and E71, optionaly E70P, E71R, or E71G; (15) substitutions at positions D31 and H361, optionaly D31R and H361R; or (16) substitutions at positions N19 and E70, optionaly N19K and E70R.

30. A fusion polypeptide, comprising an RT polypeptide set forth in any one of claims 1-29 and an RNA-guided nuclease.

31. The fusion polypeptide of claim 30, wherein the RNA-guided nuclease is a nickase.

32. The fusion polypeptide of claim 30 or claim 31, wherein the RNA-guided nuclease is a Type II CRISPR nuclease.

33. The fusion polypeptide of claim 32, wherein the Type I CRISPR nuclease is a Cas9 nuclease, which optionaly is a Cas9 nickase variant.

34. The fusion polypeptide of claim 30 or claim 31, wherein the RNA-guided nuclease is a Type V CRISPR nuclease.Atorney Docket No.: 063586-543001WO 35. The fusion polypeptide of claim 34, wherein the Type V CRISPR nuclease is Cas12i2.

36. The fusion polypeptide of any one of claims 30-35, which further comprises one or more nuclear localization signals (NLS), one or more peptide linkers, or a combination thereof.

37. A nucleic acid, comprising a nucleotide sequence encoding an RT polypeptide set forth in any one of claims 1-30 or encoding a fusion polypeptide set forth in any one of claims 31-36.

38. The nucleic acid of claim 37, which is in a vector, which optionaly is a viral vector.

39. A gene editing system comprising: (a) an RT polypeptide set forth in any one of claims 1-30 or a first nucleic acid encoding the RT polypeptide; (b) an RNA-guided nuclease or a second nucleic acid encoding the RNA-guided nuclease; (c) a guide RNA (gRNA) or a third nucleic acid encoding the gRNA; wherein the gRNA comprises a scafold sequence recognizable by the RNA-guided nuclease and a spacer sequence specific to a target sequence within a genomic site of interest, the targeting sequence being adjacent to a cognate protospacer adjacent motif (PAM) sequence of the RNA-guided nuclease; and (d) a reverse transcription donor RNA (RT donor RNA) or a four nucleic acid encoding the RT donor RNA; wherein the RT donor RNA comprises a primer binding site (PBS) and a reverse transcription template (RTT) sequence.

40. The gene editing system of claim 39, wherein the RT polypeptide and the RNA-guided nuclease form a fusion polypeptide.

41. The gene editing system of claim 40, wherein the fusion polypeptide is set forth in any one of claims 31-36.Atorney Docket No.: 063586-543001WO 42. The gene editing system of claim 40 or claim 41, wherein the gene editing system comprises a nucleic acid encoding the fusion polypeptide.

43. The gene editing system of claim 42, wherein the nucleic acid is a DNA.

44. The gene editing system of claim 42, wherein the nucleic acid is a messenger RNA (mRNA).

45. The gene editing system of any one of claims 39-44, which comprises an RNA molecule comprising the gRNA and the RT donor RNA.

46. The gene editing system of any one of claims 39-45, wherein the template sequence in the RT donor RNA is homologous to the genomic site of interest and comprises one or more nucleotide variations relative to the genomic site of interest.

47. The gene editing system of claim 46, wherein at least one nucleotide variation is located within the target sequence; and / or wherein at least one nucleotide variation is located in the PAM sequence.

48. The gene editing system of any one of claims 45-47, wherein the RNA molecule further comprises a protecting sequence, which optionaly is located at the 5’ end of the RNA molecule.

49. The gene editing system of any one of claims 39-48, wherein the gene editing system comprises one or more lipid excipients associated with one or more of elements (a)- (d); optionaly wherein the lipid excipients form lipid nanoparticles; and / or wherein the gene editing system comprises one or more viral particles for producing one or more of elements (a)-(d).

50. A pharmaceutical composition comprising the gene editing system of any one of claims 39-49.Atorney Docket No.: 063586-543001WO 51. A kit comprising the elements (a)-(d) of the gene editing system set forth in any one of claims 39-49.

52. A gene editing method, comprising contacting the gene editing system of any one of claims 39-49 with host cels to alow for gene editing of a gene targeted by the gene editing system.

53. The gene editing method of claim 52, wherein the host cels are cultured in vitro.

54. The gene editing method of claim 52, wherein the host cels are located in a subject who needs gene editing of the target gene.

Citation Information

Patent Citations

  • Gene editing systems comprising a crispr nuclease and uses thereof

    US20230023791A1

  • Modified cascade ribonucleoproteins and uses thereof

    WO2013098244A1

  • Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

    WO2013176772A1

  • Crispr-CAS component systems, methods and compositions for sequence manipulation

    WO2014093595A1

  • Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation

    WO2014093635A1