Probe-resolved melting curve analysis for identifying microorganisms in clinical samples
A single nucleic acid amplification reaction using broad-taxonomic-range primers and detection probes addresses the limitations of current methods by enhancing high-resolution melting curve analysis, facilitating rapid and accurate bacterial identification in clinical samples.
Patent Information
- Application Number
- PCT/NL2025/050354
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-18
- Filing Date
- 2025-07-18
- Publication Date
- 2026-01-22
AI Technical Summary
Current molecular diagnostic methods for bacterial identification in clinical samples face challenges with high-throughput analysis capacity, specificity, and complexity, particularly due to overlapping high-resolution melting curves and the need for extensive post-amplification analysis, which increases time and cost.
A method utilizing a single nucleic acid amplification reaction with broad-taxonomic-range primers and detection probes to generate high-resolution melting curves, combined with species-specific detection signals, allows for accurate identification of multiple pathogens in a closed-tube system, reducing downstream analysis requirements.
Enables rapid, high-throughput identification of hundreds of bacterial species in clinical samples with improved accuracy and reduced logistical complexity, suitable for standard PCR instruments.
Smart Images

Figure IMGF000100_0001 
Figure IMGF000100_0002 
Figure 00000112_0000
Abstract
Description
[0001]P135427PC00 Title: Probe-resolved melting curve analysis for identifying microorganisms in clinical samples. FIELD OF THE INVENTION The present invention is in the field of microbial diagnostics, in particular directed to high-throughput screening of clinical samples, such as urine and blood samples, for the presence of specific microorganisms and identification of microorganisms present in clinical samples. The invention relates to methods of rapid microbial detection and identification based on DNA analysis of PCR amplified genomic sequences, such as Internal Transcribed Spacer (ITS) regions in rRNA genes. In particular the invention relates to methods for identifying bacteria on the basis of the high resolution melting curve profile of PCR amplicons, and probe-verified resolution of ambiguities in species identification. BACKGROUND OF THE INVENTION In clinical settings, bacterial infection in body fluids and tissues is typically diagnosed by classic culture techniques including biochemical and metabolic profiling. These techniques are insufficiently sensitive and require at least 24 to 48 hours to identify the bacterial species involved. More advanced molecular techniques are readily available for the identification of the cause of infection, and information on the appropriate antibiotic therapy may also be obtained based on the presence of resistance markers. Molecular techniques for bacterial detection and identification generally involve various Nucleic Acid Amplification Techniques (NAAT), optionally in combination with next-generation sequencing (NGS) and comparison of the obtained sequences to a database of known bacterial sequences. In blood testing, the presence of large amounts of human DNA affects both sensitivity and specificity of these tests, and PCR amplification and subsequent detection of pathogen-specific DNA, such as bacterial 16S rDNA, is needed to overcome this problem. To enable detection of pathogens at a high level of specificity, such as at the genus or species level, this target specificity must be addressed in the assay, either pre- or post-amplification. In a conventional PCR detection assay, use can be made of one or more sets of species-specific PCR amplification primers, preferably in a multiplex format to allow parallel detection of multiple pathogens. Alternatively, PCR amplification of bacterial sequences may be performed using a set of broad- taxonomic-range PCR primers followed by post-amplification detection of species-specific sequences in the amplicon, such as by NGS. Currently, there are several commercial culture-independent diagnostic platforms available for use in clinical practice that are based on PCR and NGS technology. However, these molecular diagnostics methods generally demonstrate either increased sensitivity at the expense of specificity, or acceptable specificity with moderate sensitivity. Improvement may be expected from technological advances in PCR and NGS machinery, but these may not be affordable for most clinical laboratories. There is, therefore, still a need to improve culture-independent diagnostic methods. It is generally recognized that quantitative PCR (qPCR), as widely applied and standardized in high-throughput analysis, is suitable for routine screening of clinical samples, but that the degree of multiplexing needed for species-specific detection of most clinically relevant pathogens is hampered by the limited analysis capacity of any PCR instrument. In addressing the analysis capacity of qPCR without loss of specificity, WO2013116780 and WO2020010137 propose to measure multiple analytes per PCR color channel using a combinatorial scheme whereby individual analytes are detected at distinct end-point fluorescence intensities or ranges thereof, for instance, by using different probe concentrations for different analytes. These methods do not require further post-amplification analysis steps, but rely solely on species-specific primer and / or probe hybridizations during or after PCR amplification. The multitude of primer / probe sets needed for species-specific detection of most clinically relevant pathogens, however, still hampers broad application of this method, especially in daily practice, as the limited number of color channels in a PCR machine restricts the number of simultaneous detections, and because high loads of oligonucleotides in a reaction mixture have an adverse effect on the assay. WO2021112673 describes a qPCR amplification method wherein PCR primers against conserved bacterial genomic regions are used to generate a broad-taxonomic-range amplicon of a microbial rRNA internal transcribed spacer (ITS) region, and wherein information of the species identity is derived from the high-resolution melting curve profile and the fragment length of the amplicon. The need for amplicon length determination, which is a post-amplification analysis, is due to the similarity between melting curves of different bacterial species, even in the case of ribosomal DNA ITS amplicons, in combination with inter-assay variability in the melting curve profile for a single species due to biological variation and equipment noise. This inherent analytical and biological variation may result in an overlap of the observed high-resolution melting curves of the amplicons obtained from different species and may lead to misidentification. Although resulting in accurate identification of the bacterial species in many cases, that is, for many different pathogenic species, the post-amplification amplicon length analysis capacity cannot keep pace with qPCR amplicon generation, limiting high-throughput application in clinical settings. In fact, each post- amplification analysis step adds complexity, time, and costs to the process. Moreover, each post-amplification analysis step adds logistical demands and harbors the problem of contaminating the assay-environment with amplicons. At present, there still exists a need for a high-throughput assay for detection of microorganisms in clinical samples by PCR, with as few downstream analysis steps as possible, and which allows for accurate identification of many hundreds of different species in a single assay, preferably in less than 4 hours. There is also a need to provide a high- throughput assay for detection of microorganisms from a comprehensive list of candidate microorganisms wherein the assay comprises the least number of reagents possible (such as primers, probes, etc.) in order to minimize the risk of disturbances, unspecific reactions and background noise in the assay. SUMMARY OF THE INVENTION The present inventors have now realized that downstream analysis of the amplification product after nucleic acid amplification (such as by PCR or qPCR) is the bottleneck in high-throughput screening of clinical samples for (infectious) microbes. In order to address this problem, the solution is not in preventing the need for downstream processing and analysis altogether, but rather in collecting more information from a single amplification product. It was determined by the present inventors that increasing the level of informative data that is obtained from a single amplification reaction (e.g. from a single-well or from a closed-tube PCR assay), will lower the downstream analysis capacity requirement by a factor of 10 or more. A lower downstream analysis capacity requirement brings high-throughput analysis of hundreds or thousands of clinical samples within reach of all laboratories with a standard PCR inventory. The present inventors have further realized that the accurate detection and identification of bacterial species in clinical samples using high-resolution melting curve (hrMC) data of PCR amplified variable and hypervariable regions in conserved genes is largely hampered by the inherent analytical and biological variation in the results, leading to overlap of hrMCs between species with potential misidentification. Therefore, some downstream analysis is required. The present inventors have discovered that this overlap-generating “noise” only interferes with accurate identification of clinically relevant, e.g. pathogenic, microorganisms at the species-level in a limited number of cases, and that the problem can be overcome by using only a limited number of detection probes that resolve hrMC ambiguities. This finding now allows for the development of a single closed-tube amplification and detection system for detecting and identifying a large number of pathogenic microorganisms in a biological sample by a single nucleic acid amplification reaction. Preferably, this identification is at species-level. The present invention provides in a first aspect a method for detecting and identifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: - an aliquot of said biological sample or nucleic acids isolated therefrom; - at least one pair of broad-taxonomic-range amplification primers for amplifying a variable or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon; - a DNA intercalating dye for recording a high resolution melting curve from said amplicon; - at least one detection probe comprising for detecting a target sequence in said amplicon, wherein said detection probe comprises at least one detectable label for generating a detection signal, and wherein said target sequence is specific for at least one microorganism in a group of at least two microorganisms that cannot be distinguished based on the high- resolution melting curve (hrMC) of their corresponding amplicons. Corresponding amplicons are amplicons obtainable by using genomic DNA or RNA of said at least two microorganisms and performing a PCR reaction using the same at least one pair of broad-taxonomic-range amplification primers. The next steps in the method of the invention are: c) performing a nucleic acid amplification reaction on the mixture of step b) to generate said amplicon; d) recording an hrMC for said amplicon generated in step c); e) recording the detection signal from said at least one detection probe; f) comparing the high resolution melting curve recorded in step c) with a database comprising hrMCs of reference amplicons from reference microbial species of known taxonomic identity, to thereby obtain a first taxonomic identity indicator of a microorganism present in said sample; g) observing that the comparison in step f) places the microorganism from which said amplicon is derived in said group of at least two microorganisms that cannot be distinguished based on their hrMC as defined in step b); h) obtaining a second taxonomic identity indicator of said microorganism present in said sample based on the recorded detection signal from said at least one detection probe in step e); i) identifying the microorganism present in said sample based on said first taxonomic identity indicator or said first and second taxonomic identity indicators, and preferably wherein steps c) through e) are carried out in a single closed reaction container, or wherein steps d) and e) are performed on separate closed reaction containers comprising the amplicon generated in step c). A single reaction container includes reference to any suitable container, e.g. a tube or a well, for performing a PCR reaction and for simultaneously detecting fluorescence signals generated from fluorophores during said amplification. Fluorophores can be detected by exciting them at a specific wavelengths and measuring their emission intensity at a higher wavelength in the form of a detection signal. In a preferred embodiment of a method of the invention the method is a method for detecting and identifying a microorganism in a biological sample at species level. In a preferred embodiment of a method of the invention the at least one detection probe comprises a taxon-specific detection probe and / or a multispecies detection probe for detecting a target sequence in said amplicon, wherein said target sequence is specific for at least one microorganism in a group of at least two microorganisms that cannot be distinguished based on the high-resolution melting curve (hrMC) of their corresponding amplicons. A taxon-specific detection probe detects a taxon- specific target sequence, which may be a genus- or species-specific target sequence. A multispecies detection probe detects a multispecies target sequence which is a sequence that a multitude of species have in common, but that is absent in other species. For a multispecies detection probe, the species do not need to be taxonomically related to one another. In fact, the multispecies target sequence is merely used to partition one group of species from another group of species and detect only one of those groups with the multispecies detection probes. The reaction mixture may for instance comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more taxon-specific or multispecies detection probes. Each detection probe is preferably labeled with one fluorescent label for detection in one qPCR color channel. When using a set of three difference probes, each having a different fluorophore, a total of 8 taxa (species or genera) or multispecies groups can be detected based on the probes alone. Hence, when used in combination with hrMC data, the present invention provides for a very high resolution in species detection. In a preferred embodiment of a method of the invention the at least one detection probe comprises at least two different detection signals, preferably wherein the at least two different detection signals are two different fluorescent labels. In a preferred embodiment of a method of the invention the detection signal of each of the at least one detection probe is a fluorescent label and wherein detection probes with the same fluorescent label are provided in said reaction mixture at different concentrations to thereby allow detection of each probe at a distinct end-point fluorescence intensity. In a preferred embodiment of a method of the invention, said conserved microbial gene is a microbial ribosomal DNA (rDNA) gene or an rDNA internal transcribed spacer (ITS) region in between rDNA genes, preferably between small-subunit ribosomal RNA (rRNA) and large-subunit rRNA genes. In a preferred embodiment of a method of the invention, said nucleic acid amplification reaction is a polymerase chain reaction (PCR). In another preferred embodiment of a method of the invention, the biological sample is a normally sterile sample, such as a sample from blood, urine, or an aspirate from a sterile compartment, such as cerebrospinal fluid (CSF), deep abscesses, synovial fluid, peritoneal fluid, pleural fluid or deep tissue biopsy. In another preferred embodiment of a method of the invention, the biological sample is a selected from whole blood, serum, plasma, urine, and cerebrospinal fluid / liquor. In yet another preferred embodiment of a method of the invention, said microorganism is a bacterium or a fungus. In yet another preferred embodiment of a method of the invention, database comprises rDNA or rDNA ITS sequences and corresponding taxonomic identity data of bacteria and / or fungi. In another preferred embodiment of a method of the invention, said broad-taxonomic-range amplification primers are for amplifying a microbial rDNA or rDNA ITS region of multiple, preferably essentially all, species from a microbial genus, family, order, class, phylum, kingdom and / or domain, more preferably essentially all species from a microbial phylum, still more preferably essentially all species from a microbial kingdom, most preferably bacteria and / or fungi. In another preferred embodiment of a method of the invention, said broad-taxonomic-range amplification primers comprise a forward and reverse primer for amplifying a variable or hypervariable region or a fragment thereof in a conserved microbial gene or in an RNA transcript thereof. Preferably, the conserved microbial gene is selected from a ribosomal RNA (rRNA) gene, a ribosomal protein gene (e.g., RPSA, RPS2 or RPL6), a DNA gyrase (subunit A) (GyrA) gene, a DNA gyrase (subunit B) (GyrB) gene, a RecA protein gene, an ATPase subunit gene (e.g., atpB, atpD), an RNA polymerase subunit gene (e.g., rpoB, rpoC), an Elongation factor thermal unstable Tu (EF-Tu) gene, an Elongation factor G (EF-G)gene, a Protein translocase subunit SecY (secY) gene, and a beta-tubulin(tubB) gene. Preferably, the amplified variable or hypervariable region comprises, or is a fragment of, an rDNA ITS region, such as a 16S-23S rDNA ITS region, a 23S-5S rDNA ITS region, an 18S-5.8S rDNA ITS region, a 5.8-26S / 28S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region (including both ITS1 and ITS2 of eukaryotic microorganism species). More preferably, the amplicon comprises a 16S-23S rDNA ITS region or an 18S- 5.8S-26S / 28S rDNA ITS region, or a fragment thereof. In another preferred embodiment of a method of the invention, said set of broad-taxonomic-range amplification primers comprises each of the amplification primers of SEQ ID NOs: 1 and 3-5, or each of the amplification primers of SEQ ID NOs: 2-5, or each of the amplification primers of SEQ ID NOs: 1-5. In another preferred embodiment of a method of the invention, said set of broad-taxonomic-range amplification primers comprises each of the amplification primers of SEQ ID NOs: 6 and 7-13. In another preferred embodiment of a method of the invention, said set of broad-taxonomic-range amplification primers is a set of universal bacterial amplification primers, said set preferably comprising each of the amplification primers of SEQ ID NOs: 14-15. In other preferred embodiments of aspects of the invention, said set of broad-taxonomic-range amplification primers broad taxonomic-range primer set comprises primers to amplify the ITS region of fungal rDNA as described herein (e.g. ITS1F, ITS4R, ITS2, ITS3, ITS5, ITS1-F, ITS4-B, 5.8S, 5.8SR, and / or SR6R). In another preferred embodiment of a method of the invention, PCR is qPCR and wherein the detection probe is a hydrolysis probe. In another preferred embodiment of aspects of the invention, said reaction mixture comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 75, 80, 85, 90, 95 or 100 detection probes. In another preferred embodiment of aspects of the invention, said at least one detection probe is labeled with one of at least 2 different fluorescent labels for detection in one of at least 2 distinct qPCR color channels. In another preferred embodiment of aspects of the invention, said at least one detection probe is labeled with one of at least 3 different fluorescent labels for detection in one of at least 3 distinct qPCR color channels. In another preferred embodiment of aspects of the invention, said at least one detection probe is labeled with one of at least 4, 5, or 6 different fluorescent labels for detection in, respectively, one of at least 4, 5, or 6 distinct qPCR color channels. In another preferred embodiment of aspects of the invention, 2 or more detection probes are labeled with fluorescent labels that are detectable in the same color channel when the microorganism for which the probes are specific can be distinguished based on the hrMC of said amplicon. Hence, in aspects of the invention, wherein said reaction mixture comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more detection probes, said probes may be labeled with fluorescent labels that are detectable in the same color channel if the microorganism for which the probes are specific can be distinguished based on hrMC data. If that is not the case, one or more other detection probes may be used to provide a third or further taxonomic identity indicator. In another preferred embodiment of aspects of the invention, detection probes labeled with fluorescent labels that are detectable in the same color channel are pathogen-specific detection probes. In another preferred embodiment of aspects of the invention, probes with fluorescent labels that are detectable in the same color channel are provided in said reaction mixture at different concentrations, to thereby allow detection of each probe-target at a distinct end-point fluorescence intensity. In another preferred embodiment of a method of the invention, said target sequence is a species-specific target sequence, preferably a pathogen- specific target sequence. In another preferred embodiment of a method of the invention, said group of taxa of microorganisms that cannot be distinguished based on the hrMC of said rDNA or rDNA ITS amplicon is selected from: - the group comprising, preferably consisting of, Chlamydia trachomatis and Proteus mirabilis; - the group comprising, preferably consisting of, any two or more of Citrobacter braakii, Citrobacter freundii, Citrobacter werkmanii, Citrobacter youngae, Enterobacter asburiae, and Enterobacter cloaca; - the group comprising, preferably consisting of, Citrobacter freundii, and Citrobacter youngae; - the group comprising, preferably consisting of, any two or more of Citrobacter werkmanii, Citrobacter braakii, Citrobacter freundii, Citrobacter youngae, and Enterobacter asburiae; - the group comprising, preferably consisting of, any two or more of Citrobacter youngae, Citrobacter braakii, Citrobacter freundii, Citrobacter werkmanii; - the group comprising, preferably consisting of, any two or more of Enterobacter asburiae, Citrobacter braakii, Citrobacter werkmanii, Enterobacter cloaca, Escherichia coli, Klebsiella oxytoca, and Klebsiella pneumoniae; - the group comprising, preferably consisting of, any two or more of Enterobacter cloaca, Citrobacter braakii, Enterobacter asburiae, Escherichia coli, Klebsiella aerogenes, and Klebsiella pneumoniae; - the group comprising, preferably consisting of, Enterococcus faecalis, and Enterococcus faecium; - the group comprising, preferably consisting of, any two or more of Klebsiella aerogenes, Enterobacter asburiae, Enterobacter cloacae, Klebsiella oxytoca, and Klebsiella pneumoniae; - the group comprising, preferably consisting of, any two or all of Proteus mirabilis, Proteus penneri, and Proteus vulgaris; - the group comprising, preferably consisting of, Proteus vulgaris and Proteus mirabilis; - the group comprising, preferably consisting of, Providencia stuartii and Morganella morganii; - the group comprising, preferably consisting of, Serratia marcescens and Escherichia coli; - the group comprising, preferably consisting of, Staphylococcus aureus and Stapylococcus epidermidis; - the group comprising, preferably consisting of, Staphylococcus capitis and Staphylococcus aureus; - the group comprising, preferably consisting of, any two or more of Staphylococcus epidermidis, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli; - the group comprising, preferably consisting of, Staphylococcus saprophyticus and Staphylococcus capitis; - the group comprising, preferably consisting of, Streptococcus dysgalactiae and Streptococcus agalactiae; - the group comprising, preferably consisting of, Stenotrophomonas maltophilia and Cutibacterium acnes; - the group comprising, preferably consisting of, any two or more of Mycobacterium spp., including at least two of Mycobacterium avium, Mycobacterium bovis, Mycobacterium intracellulare, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium smegmatis, Mycobacterium tuberculosis, and Mycobacterium ulcerans; - the group comprising, preferably consisting of, any two or more of Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus candidus, Aspergillus clavatus, and Aspergillus terreus; - the group comprising, preferably consisting of, any two or more of Aspergillus nidulans, Candida albicans, Candida glabrata and Malassezia sympodialis; - the group comprising, preferably consisting of, Candida parapsilosis and Candida auris; - the group comprising, preferably consisting of, Candida tropicalis and Rhizopus arrhizus; - the group comprising, preferably consisting of, Aspergillus fumigatus and Trichophyton mentagrophyte; - the group comprising, preferably consisting of, any two or more of Aspergillus flavus, Aspergillus niger, Aspergillus candidus, Aspergillus fumigatus, Aspergillus terreus, and Trichophyton mentagrophytes.. Preferably, said group of taxa of microorganisms that cannot be distinguished based on the hrMC of said rDNA or rDNA ITS amplicon is selected from the below listed groups of clinically relevant species, including, but not limited to: - the group comprising, preferably consisting of, Cutibacterium acnes and Stenotrophomonas maltophilia; - the group comprising, preferably consisting of, Streptococcus dysgalactiae and Streptococcus mitis; - the group comprising, preferably consisting of, Neisseria menigitidis and Streptococcus constellatus; - the group comprising, preferably consisting of, Enterococcus faecalis and Enterococcus faecium; - the group comprising, preferably consisting of, Fusobacterium nucleatum and Listeria monocytogenes; - the group comprising, preferably consisting of, Acinetobacter baumanii and Klebsiella oxytoca; - the group comprising, preferably consisting of, Pseudomonas aeruginosa and Morganella morganii; - the group comprising, preferably consisting of, Staphylococcus aureus and Staphylococcus epidermidis; - the group comprising, preferably consisting of Streptococcus pneumoniae and Streptococcus mitis; - the group comprising, preferably consisting of, Enterobacter cloacae and Klebsiella pneumoniae; - the group comprising, preferably consisting of, Escherichia coli and Proteus mirabilis, and - the group comprising, preferably consisting of, Mycobacterium spp., including at least two of Mycobacterium avium, Mycobacterium bovis, Mycobacterium intracellulare, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium smegmatis, Mycobacterium tuberculosis, and Mycobacterium ulcerans. Preferably, said group of taxa of microorganisms that cannot be distinguished based on the hrMC of said rDNA or rDNA ITS amplicon comprises at least two groups selected from the above listed groups, more preferably at least 2, 3, 4, 5, 6, 7.8, 9, or 10 groups selected from the above listed groups, more preferably wherein said groups comprises clinically relevant species as indicated herein, for instance as indicated in the drawings or in the Examples. In another preferred embodiment of a method of the invention, the method is performed in a miniaturized device, preferably a lab-on-a-chip (LOC) device. DESCRIPTION OF THE DRAWINGS Figure 1. Example of multiple melting curves from various strains of two different species showing noisy variation. The MCs of C. braakii are quite similar to those of C. freundii, leading to a potential identification clash. Figure 2. Clash matrix of 30 clinically relevant species. Values of 0 indicate absence of a clash, higher values indicate higher risk of a clash. Figure 3. Binary visualization of the symmetrized clash matrix of figure 2. Clashes are shown in red. Figure 4. Cycling schedule for amplification and melting curve analysis as described in the Examples. Figure 5. Melting curves (upper) and amplification curves (lower) of Finegoldia magna and Hafnia alvei strains. Figure 6. Melting curves (upper) and amplification curves (lower) of Cutibacterium acnes and Stenotrophomonas maltophilia strains. Figure 7. Melting curves (upper) and amplification curves (lower) of S. aureus and S. epidermidis strains. Figure 8. Melting curves (upper) and amplification curves (lower) of different strains of Citrobacter species. Figure 9. Melting curves (upper) and amplification curves (lower) of Bordetella pertussis and Moraxella osloensis strains. Figure 10. Clash sheet providing a number of clinically relevant species of microorganisms that cannot be distinguished based on the hrMC of their rDNA ITS amplicon, i.e., the species that form the clash, and how the identification is resolved by the present invention. Where possible, two probe options, each directed to one of the two species per clash, are provided. In the table, a “1” in green indicates where probe binding occurs, and a “0” indicates that no probe binding to amplicon of that species occurs. Figure 11. Exemplary graph coloring using 14 species-specific detection probes having three different detectable labels and recording detection signals from said labels in three PCR color channels. Figure 12. Exemplary graph coloring using only 4 group-specific detection probes (dense probes) having three different detectable labels and recording detection signals from said labels in three PCR color channels. Figure 13. High resolution melting curves for amplicons generated from Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus candidus, Aspergillus clavatus, and Aspergillus terreus, showing that species are indistinguishable based on hrMC data alone. Figure 14. High resolution melting curves for amplicons generated from Aspergillus nidulans, Candida albicans, Candida glabrata and Malassezia sympodialis, showing that species are indistinguishable based on hrMC data alone. Figure 15. High resolution melting curves for amplicons generated from Candida parapsilosis and Candida auris, showing that species are indistinguishable based on hrMC data alone. Figure 16. High resolution melting curves for amplicons generated from Candida tropicalis and Rhizopus arrhizus, showing that species are indistinguishable based on hrMC data alone. Figure 17. High resolution melting curves for amplicons generated from Aspergillus fumigatus and Trichophyton mentagrophyte, showing that species are indistinguishable based on hrMC data alone. Figure 18. High resolution melting curves for amplicons generated from Aspergillus flavus, Aspergillus niger, Aspergillus candidus, Aspergillus fumigatus, Aspergillus terreus, and Trichophyton mentagrophytes, showing that species are indistinguishable based on hrMC data alone. Figure 19 provides the mathematical description of the method of the present invention according to Embodiment 1. DETAILED DESCRIPTION OF THE INVENTION Definitions The term “nucleic acid sequence”, or “nucleotide sequence”, which terms can be used interchangeably herein, refers to the base sequence of a DNA or RNA molecule in single or double stranded form, such as a DNA sequence encoding an ITS region of the ribosomal RNA gene. The term “nucleic acid sequence” is for example also used to refer to a DNA or RNA molecule. An "isolated nucleic acid sequence" refers to a nucleic acid molecule which is no longer in the natural environment from which it was isolated. The term inter alia refers to a nucleic acid molecule that has been separated from at least about 50%, 75%, 90%, or more of proteins, lipids, carbohydrates, or other materials with which it is naturally associated, e.g. in a microbial host cell. The term “microbial”, as used herein, refers to an element as originating from a microorganism, or microbe, which generally refers to an organism that is microscopic, which means too small to be seen by the unaided human eye. Microorganisms in the context of this invention include archaea, bacteria, viruses, protozoa, and fungi. Preferably, a microorganism is a (opportunistic) pathogenic microorganism capable of causing disease, preferably selected from pathogenic bacteria, viruses, protozoa, or fungi, most preferably pathogenic bacteria or fungi. The term “rDNA internal transcribed spacer (ITS) region” or its equivalent “ITS region of the ribosomal RNA gene”, in short referred to as the “internal transcribed spacer (ITS) region”, as used herein, refers to the spacer DNA situated between the small-subunit ribosomal RNA (rDNA) and large-subunit rDNA genes in the chromosome or the corresponding transcribed region in the polycistronic rDNA precursor transcript of the microorganism. In bacteria and archaea, the rrn operons contain the coding sequences for the 16S rRNA gene, the 23S rRNA gene, and the 5S rRNA gene and may be found in 1–15 copies per genome. The typical gene configuration of a bacterial rRNA operon is 16S-23S-5S rRNA, wherein subunit genes are separated by internal transcribed spacer regions that show a high degree of variability in both sequence and size at the genus and species level. The highly polymorphic nature of these spacer sequences may be analyzed by PCR, using conserved sequences from the adjacent S genes as primers. This method is known as internal transcribed spacer-PCR (ITS- PCR). In preferred embodiments of this invention, the hypervariable region in a conserved microbial gene is the 16S–23S ITS region in bacteria, or the combined ITS1 and ITS2 in eukaryotes (wherein ITS1 is the spacer between the 18S and 5.8S rDNA genes and ITS2 is the spacer between the 5.8S and 28S rDNA genes). Tens of thousands of full-length fungal ITS sequences associated with a Latin binominal are available in GenBank. The 18S nuclear ribosomal small subunit rDNA gene (SSU) is commonly used in phylogenetics of eukaryotic microorganisms such as fungi, and although its homolog (16S) is often used as a species diagnostic for bacteria, it has fewer hypervariable domains in fungi. The 28S nuclear ribosomal large subunit rDNA gene (LSU) sometimes discriminates species on its own. In fungi, the internal transcribed spacer (ITS) region has the highest probability for successful identification of a broad-taxonomic-range of fungi. The nuclear rDNA cistron has been used for fungal diagnostics and phylogenetics for more than 20 years. Although in some preferred embodiments of this invention, the full length ITS of fungi may advantageously be used for eukaryotic microorganisms, use may also be made of either ITS1 or ITS2 in alternative embodiments. In one alternative preferred embodiment of aspects of this invention the internal transcribed spacer (ITS) region is ITS2. The term “fungus”, as used herein, refers to eukaryotic organisms including yeasts, molds, and fleshy fungi (mushrooms). Yeasts are microscopic, unicellular fungi; molds are multinucleated, filamentous fungi (such as mildews, rusts, and common household molds); the fleshy fungi include mushrooms and puffballs. Fungal infections, or mycosis, are diseases caused by pathogenic fungi (yeast or mold). Hence, in preferred embodiments of this invention, fungus refers to yeast or mold. The term “fungus”, as referred to herein, may include species of Aphanoascus, Absidia, Acremonium, Adiaspiromyces, Akanthomyces, Alternaria, Apophysomyces, Arthrobotrys, Arthroderma, Aspergillus, Basidiobolus, Batrachochytrium, Beauveria, Bipolaris, Blastomyces, Candida, Chrysosporium, Cladophialophora, Cladosporium, Clavispora, Clonostachys, Coccidioides, Colletotrichum, Conidiobolus, Coniothyrium, Cryphonectria, Cryptococcus, Cunninghamella, Curvularia, Cutaneotrichosporon, Cyphellophora, Dichotomophthora, Dissitimurus, Emergomyces, Epicoccum, Epidermophyton, Eremothecium, Exophiala, Falciformispora, Fomitopsis, Fonsecaea, Fusarium, Ganoderma, Geotrichum, Gymnoascus, Histoplasma, Ilyonectria, Keratinomyces, Lacazia, Lasiodiplodia, Lecanicillium, Lichtheimia, Lomentospora, Lophophyton, Madurella, Magnusiomyces, Malassezia, Medicopsis, Metarhizium, Microascus, Microsporum, Mortierella, Mucor, Mycocentrospora, Nannizzia, Neocosmospora, Neocucurbitaria, Neoscytalidium, Neotestudina, Nigrograna, Nigrospora, Ochroconis, Ophiostoma, Ovulinia, Paecilomyces, Paracoccidioides, Paraconiothyrium, Peronosclerospora, Phaeoacremonium, Phellinus, Phialemonium, Phialophora, Phoma, Pichia, Pleurostoma, Pneumocystis, Pseudochaetosphaeronema, Pseudogymnoascus, Pyrenophora, Pythium, Quambalaria, Redaellia, Rhinocladiella, Rhinosporidium, Rhizomucor, Rhizopus, Saksenaea, Sarocladium, Scedosporium, Schizophyllum, Sclerophtora, Scopulariopsis, Sporothrix, Stagonosporopsis, Stenella, Syncephalastrum, Talaromyces, Trematosphaeria, Trichoderma, Trichomonascus, Trichophyton, Trichosporon, Tritirachium, Verruconis, and Verticillium spp., as well as teleomorphs and anamorphs thereof. The term “domain”, as used herein, refers to a taxonomic rank, as well as a taxonomic unit, a taxon, in that rank, comprising the domains Bacteria (Eubacteria), Archaea (Archaebacteria), and Eukarya (Eukaryota). The term “Kingdom”, as used herein, refers to a taxonomic rank, including all taxonomic units or taxa in that rank, selected from the kingdoms Bacteria, Archaea, Protozoa, Chromista, Plantae, Fungi, and Animalia. The term “phylum”, as used herein, refers to a taxonomic rank, including all taxonomic units or taxa in that rank, that is below the taxonomic level of the kingdom and domain. The domain or kingdom Bacteria comprises about 40 bacterial phyla that have been validly published according to the Bacteriological Code (Euzéby JP, Parte AC. "Names of phyla". List of Prokaryotic names with Standing in Nomenclature (LPSN), retrieved 3 April 2022). Important phyla of (opportunistic) pathogenic bacteria include Firmicutes, Fusobacterium, Deferribacteres, Spirochaetes, Cyanobacteria, Acidobacteria, Nitrospina, Nitrospirae, Caldithrix, Haloanaerobiales, Verrrucomicrobia, Chlamydiae, Planctomycetes, Gemmimonas, Fibrobacteres, Chlorobi, Bacteroidetes, Proteobacteria (Pseudomonadota), Thermotogae, Corprothermobacter, Synergites, Thermodesulfobacteria, Desulfurobacterium, Aquificae, Deinococcus-Thermus, Chloroflexi, Tenericutes and Actinobacteria. These phyla are known to the person skilled in the art and have been described, inter alia, in Schloss 2004 (Microb. Mol. Biol. Rev.6 (4): 686-691), or in the Bergey manual of systematics of archaea and bacteria (2015, John Wiley & Sons, Inc., Online ISBN: 9781118960608). The term “class”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the phylum. The phylum Proteobacteria, for instance, comprises the classes Acidithiobacillia, Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Hydrogenophilalia, and Zetaproteobacteria. The term “order”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the class. The class Gammaproteobacteria, for instance, inter alia comprises the orders Enterobacterales, Legionellales, Pseudomonadales, and Vibrionales. The term “family”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the order. The order Enterobacterales, for instance, inter alia comprises the families Enterobacteriaceae, Erwiniaceae, Morganellaceae, and Yersiniaceae. The term “genus”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of family. The family Enterobacteriaceae, for instance, inter alia comprises the genera Enterobacter, Escherichia, Citrobacter, Klebsiella, Salmonella and Shigella. The term “species”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the genus. The family Klebsiella, for instance, inter alia comprises the species K. aerogenes, K. oxytoca, and K. pneumoniae. The term “subspecies”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the species. The term “strain”, as used herein, refers to the lowest taxonomic rank, that is below the level of the species. The term “strain” includes reference to an “isolate” or a group of isolates exhibiting characteristics that set it apart from other isolates belonging to the same species. The term “polymerase chain reaction (PCR)”, as used herein refers to the well-known in vitro technique to make numerous copies of a specific segment of target DNA from a template DNA - i.e., the DNA that contains the target region to be copied. During the reaction a mixture containing the target DNA, primers, dNTPs, and a heat-stable DNA polymerase is heated to 90-95°C to denature the strands of the target DNA. The solution is cooled to a temperature that allows the primers (single-stranded DNA molecules of about 18 to 30 nucleotides long) to anneal to their complementary sequence on the target DNA and provide the 3'-OH required for DNA synthesis. Subsequently, the DNA polymerase synthesizes a new DNA strand complementary to the target by extending the primer, usually at a temperature of about 72°C. The thermal cycling scheme of denaturing / primer annealing / primer extension is repeated numerous times with the DNA synthesized during the previous cycles serving as a template for each subsequent cycle. The result is a doubling of the target DNA present with each cycle, and exponential accumulation of target DNA sequences over the course of 20-40 cycles. A heating block with an automatic thermal cycler is used for precise temperature control. A preferred method for use in the present invention is qPCR amplification (also known as real- time PCR), wherein typically the amplification of a targeted DNA molecule is monitored during the PCR (i.e., in real time), using non-specific fluorescent dyes that intercalate with any double-stranded DNA (e.g. SYBR® Green or EvaGreen®), or sequence-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter for the detection of PCR products in real-time. As used herein, the term "primer" refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, i.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer ("buffer" includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term "forward primer" as used herein means a primer that anneals to the anti-sense strand of double- stranded DNA (dsDNA). A "reverse primer" anneals to the sense-strand of dsDNA. As used herein, the term "primer pair" refers to a forward and reverse primer pair (i.e., a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest. As used herein, the term "probe" refers to an oligonucleotide that interacts with a target nucleic acid via hybridization. A probe is for example fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, on the function of the probe. Probes are for example labeled or unlabeled, or modified in any of a number of ways well known in the art. A probe will specifically hybridize to its target nucleic acid. Probes are for example DNA, RNA or a RNA / DNA hybrid. Probes are for example oligonucleotides, peptide nucleic acid (PNA), locked nucleic acid (LNA), oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes comprise for example modified nucleobases, modified sugar moieties, and modified internucleotide linkages. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length. The term “hydrolysis probe”, as used herein, refers to an oligonucleotide labeled with one or more fluorescent reporters at or near the 5' end and one or more quenchers of fluorescence at or near the 3' end (or vice versa) or at other positions in the oligonucleotide. Hydrolysis probes are also known as Taqman™ probes. The background fluorescence of probe is prevented by the presence of the quencher in close proximity. During the annealing step in PCR, both probe and primers anneal to the DNA target. Once Taq polymerase reaches the probe in the extension step, its 5' to 3' exonuclease activity degrades the probe, breaking the reporter-quencher proximity and thus allowing the emission of fluorescence. The amount of nucleic acid present during each amplification cycle is based on the level of the fluorescence signal, while increase in fluorescent signal is directly proportional to the quantity of exponentially accumulating amplicons produced during amplification. Suitable fluorescent reporters (with emission maxima) for use in aspects of this invention are, for instance, 6-FAM (6- carboxyfluorescein, 520nm), TET (tetrachlorofluorescein, 539nm), YAK (Yakima Yellow®, 549nm), VIC (CAS # 1414265-81-8, 554), SUN (Integrated DNA Technologies, 554nm), HEX (hexachlorofluorescein, 555nm), JOE (5'- dichloro-dimethoxy-fluorescein, 548nm), which may be used in combination with quenchers such as TAMRA (tetramethylrhodamine), Black Hole Quencher 1 (BHQ®-1) or Iowa Black FQ (single-quenched) or ZEN-Iowa Black FQ (double-quenched); alternatively, or in addition, suitable fluorescent reporters (with emission maxima) for use in aspects of this invention are, for instance, Cy3®(564nm), ATTO ™ 550 (575nm), TAMRA (583), ATTO 565 (591nm), PET®(595nm), ROX (carboxy-X-rhodamine, 608nm), Texas Red®-X (617nm), JUN® (617nm), ATTO 633 (657nm), LIZ®(655nm), Cy5®(668nm), and ATTO 647 (669nm), which may be used in combination with quenchers such as Black Hole Quencher-2 (BHQ-2), Iowa Black RQ (single-quenched), or TAO–Iowa Black RQ (double-quenched). All these fluorophores and quenchers are commercially available. The term “detection probe” refers to a probe used in the method of the present invention comprising a targeting sequence for targeting an complementary nucleotide sequence in an amplicon and further comprising a detectable label for generating a detection signal. In aspects of this invention, a detection probe may target a single amplicon, which is defined by a unique nucleotide sequence, and which will often be species-specific. However, in aspects of this invention at least two detection probes are used that target multiple amplicons, each having a different and unique nucleotide sequence, but each comprising the target sequence of the detection probe, wherein said multiple amplicons are generated through amplification of variable or hypervariable regions in a conserved microbial gene from multiple microorganism species using a single set of broad- taxonomic-range amplification primers. The multiple amplicons targeted by the at least two detection probes in aspects of this invention detect the amplicon of a distinct selection of microorganism species from the group of N microorganism species, wherein each distinct selection comprises at least two microorganism species. The group of microorganism species within each selection may or may not overlap between the group of microorganism species of other distinct selections. A primer or probe is typically at least 10, 15, 20, 30, 40 or 50 nucleotides in length. In some embodiments, primers are preferably between about 15 to about 40 nucleotides in length, and most preferably between about 20 to about 35 nucleotides in length. An optimal length for a particular primer application may be readily determined in the manner described in PCR Technology, Principles and Application for DNA Amplification, Henry A. Erlich (ed.), 1st ed.1989, Palgrave Macmillan, London. The term “molecular beacon”, as used herein, refers to a dye-labeled oligonucleotide (25–40 nt) that forms a hairpin structure with a stem and a loop. The 5' and 3' ends of the probe have complementary sequences of 5–6 nucleotides that form the stem structure. The loop portion of the hairpin is designed to specifically hybridize to a 15–30 nucleotide section of the amplicon, which section equals the molecular beacon’s target sequence. A fluorescent reporter molecule is attached to the 5' end of the molecular beacon, and a quencher is attached to the 3' end or in close proximity of those positions. Formation of the hairpin brings the reporter and quencher together, so no fluorescence is emitted. During the annealing step of the amplification reaction, the loop portion of the molecular beacon binds to its target sequence, causing the stem to denature. The reporter and quencher are thus separated, quenching is abolished, and the reporter fluorescence is detectable. Because fluorescence is emitted from the probe only when it is bound to the target, the amount of fluorescence detected is proportional to the amount of target in the reaction. Unlike hydrolysis assays, molecular beacons are displaced but not destroyed during amplification due to the use of a DNA polymerase lacking 5' exonuclease activity. Reporter and quencher pairs can be as described for hydrolysis probes. The term “degenerate”, as used herein for primers and probes refer to mixtures of similar oligonucleotide sequences that incorporate variations at specific positions to account for the degeneracy of the genetic code. The term “template”, as used herein, refers to the nucleic acid from which an amplicon is generated in a nucleic acid amplification reaction. The template comprises primer binding sites for hybridization of amplification primers. The term “isolating”, as used herein in the context of isolating nucleic acid sequences from a biological sample, refers to an in vitro process wherein nucleic acids, preferably genomic DNA, are extracted from a sample of interest. The process may generally involve, but is not limited to, lysis of a (cells in) biological sample using a guanidine-detergent lysing solution that permits selective precipitation of DNA from a (cell) lysate, and precipitation of the genomic DNA from the lysate with ethanol. Following an ethanol wash, precipitated DNA may be solubilized in either water or 8 mM NaOH and used as template in a PCR reaction. Genomic DNA samples analysis with diagnostic purpose may be obtained by using generally known techniques for DNA isolation. The total genomic DNA may be purified by using, for instance, a combination of physical and chemical methods. Very suitably commercially available systems for DNA isolation may be used, such as the NucliSENS® easyMAG® nucleic acid extraction system (bioMérieux, Marcy l'Etoile, France) or the MagNA Pure 96 System (Roche Diagnostics GmbH, Mannheim, Germany). The term “PCR mixture”, as used herein, refers to the small volume of biochemical reactants in aqueous liquid for performing the PCR reaction, preferably comprising the (genomic) template DNA comprising the target DNA sequence(s), a set of at least two oligonucleotide primers that hybridize to opposite strands of the target DNA sequence(s) and flank the region to be amplified, a thermo-stable DNA polymerase, the four deoxyribonucleoside triphosphates (dNTPs), and Mg2+ ions. The term “amplification primers”, as used herein, refers to the oligonucleotide primers that hybridize to opposite strands of the target DNA sequence(s) and flank the region to be amplified. The terms “amplification product”, and “amplicon”, as used interchangeably herein, refer to a nucleic acid fragment that is the product of a nucleic acid amplification or replication event, such as for instance formed in the polymerase chain reaction (PCR). The term “PCR amplicon”, as used herein, refers to the PCR product or amplified target DNA. The term “broad-taxonomic-range amplification”, as used herein refers to the amplification of at least one variable or hypervariable region in a conserved microbial gene from genomic DNA to produce homologous amplicons across different broad groupings or taxa of microorganisms, i.e. to produce homologous amplicons from genomic DNA of essentially all species within a taxonomic rank selected from order, class, phylum or kingdom. For example, broad-taxonomic-range amplification refers to amplification of at least one rDNA or rDNA ITS region from genomic DNA to produce homologous amplicons from genomic DNA of essentially all species within a taxonomic rank selected from phylum or kingdom. Essentially all in this context refers to at least 80%, 85%, 90%, 95%, or 99% of the species within the taxa of said taxonomic rank. Preferably, ribosomal RNA-targeted primer pairs are pairs of broad-taxonomic-range primers directed to conserved regions in the rDNA gene that flank variable or hypervariable (e.g. ITS) regions in said gene or genetic region. The term “broad-taxonomic-range” as used herein, refers to a collection of microorganisms at a higher order taxonomic ranking, such as at the rank of class, phylum, or kingdom, which collection includes essentially all lower taxonomic ranked groupings comprised therein, such as species genus, family, and order. For instance, in the context of a primer, the term “broad-taxonomic-range” refers to a primer that may be used to amplify a gene of interest across essentially all species genera, or families of microorganisms within a phylum, or kingdom. A broad-taxonomic-range primer thus has a high level (e.g. at least 70%, 80%, 90%, 95%, or 98%, or 99%) of coverage, i.e., the proportion of sequences within a given sequence set that is matched. The term "specific" as used herein in reference to a primer pair or probe means that the primer pair generates no amplicons from, and that the probe does not bind to, any targets other than the target of interest. This is, inter alia, deemed to be the case when the nucleotide sequence of the primer(s) or probe has a high level of sequence identity with a portion of the nucleic acid to be amplified when the primer and the target nucleic acid are aligned. An amplification primer or hybridization probe that is specific for a nucleic acid is one that, under stringent hybridization conditions, hybridizes to the target of interest and not to nucleic acids which are not of interest. Higher levels of sequence identity between the primer and the target are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 85-95% and more preferably at least 95% sequence identity. Sequence identity is based on the percentage of identical bases over the entire length of the comparison window when target and primer or probe are aligned, or, preferably, over the entire length of the primer or probe. Sequence identity can be determined using a commercially available computer program with a default setting that employs algorithms well known in the art. A non-specific PCR amplicon may result from primers that are not “specific”, as used herein, and is a potential by-product in PCR, consisting of amplified DNA that is not target DNA, usually resulting from a specific annealing (hybridization) of the primer molecules to other nucleic acid sequences in the template DNA, such as human DNA or non-target microbial DNA. A non-specific PCR amplicon results in a hrMC that is different from the PCR amplicon generated from a target microbial DNA sequence. As used herein, a primer pair is “taxon-specific” when it generates an amplicon from genomic DNA of a group of microorganisms of interest, e.g. whose presence or absence is to be confirmed or whose hrMC ambiguity is to be resolved, while it does not generate an amplicon from a group of microorganisms of a higher taxonomic ranking that comprises microorganisms that do not belong to the (lower ranking) taxon of microorganisms of interest. As used herein, a probe is “taxon-specific” when it binds to an amplicon generated from genomic DNA of a group of microorganisms of interest, e.g. whose presence or absence is to be confirmed or whose hrMC ambiguity is to be resolved, while it does not bind to an amplicon generated from a group of microorganisms of a higher taxonomic ranking that comprises microorganisms that do not belong to the (lower ranking) taxon of microorganisms of interest. The term “taxon- specific” therefore generally indicates specificity of the primers and / or probes to a taxon of a lower ranking than the taxon or group of taxa covered by the broad-taxonomic-range primers as defined herein. The term “high-resolution melting curve (hrMC) analysis”, as used herein, refers to a post-PCR analysis method used to identify variations in nucleic acid sequences. The method is based on detecting small differences in PCR melting (dissociation) curves. The temperature-dependent dissociation between two DNA-strands can be measured using a DNA- intercalating fluorophore such as SYBR green, EvaGreen or a "saturation dye" (a dye that does not inhibit PCR even if used at concentrations that give maximum fluorescence (saturation)) like LCGreen® I, LCGreen Plus or Cyto9, in conjunction with real-time PCR instrumentation that has precise temperature ramp control and advanced (fluorescence) data capture capabilities. Data are analyzed and manipulated using software designed specifically for hrMC analysis. For hrMC analysis, software is often included in the qPCR equipment, but can also be obtained from third parties. High- resolution melting curves are generated by ramping through a temperature gradient with a high level of accuracy (e.g.0.1 °C or less), and measuring the level offluorescence of an intercalating dye at each step. The melting temperature of a DNA molecule is determined by nucleic acid sequence and length, and differences in these nucleotide sequences between samples result in melting profiles that are unique to a particular species, even when amplicons are generated using universal primers. Details of the hrMC analysis procedure are well known to those skilled in the art and are for instance described in Reed et al., 2007, Pharmacogenomics 8:597–608; US7,297,484; US7,387,887; US7,524,632; US20090117553 and US20100041044, which contents are incorporated herein by reference. The term “high-resolution melting curve (hrMC)”, as used herein, refers to the dissociation curve describing the temperature-dependent dissociation between two DNA-strands, preferably as measured using a DNA-intercalating fluorophore. The high-resolution melting curve may refer to the graph of the negative first derivative of the melting curve which makes it easier to pin-point the temperature of dissociation (defined as 50% dissociation), by virtue of the peaks thus formed. The term “to distinguish”, as used herein, refers to the ability to observe dissimilarity between diagnostic data, as output of an analytical measurement, for different species of microorganisms, wherein the observable dissimilarity allows for discrimination between the species. “to distinguish” follows from the analysis that the data is more likely derived from one species than from another species of microorganism, and allows for the positive identification of a microorganism in a sample as belonging to a distinct species, such as identifying a microorganism as Citrobacter braakii, rather than as Citrobacter freundii, Citrobacter werkmanii, Citrobacter youngae, or Enterobacter asburiae. For instances, the hrMC of a rDNA ITS amplicon may be sufficient to arrive at an unambiguous species identification. In practice, the identification of unknown microorganisms may, for instance, occur through pattern matching, of the hrMC obtained with a library containing the characteristic hrMC information of various species in the form of, for instance, profiles, peaks, or spectra or derivatives thereof. The library information is preferably generated by several measurements of known bacterial species and strains under slightly different conditions, and then extracting the specific hrMC information. Additionally the library information can be generated or supplemented in- silico with predicted melting curves from known DNA sequences. As an average, the library may contain about 20 hrMC profiles per species, preferably including multiple strains or isolates. Software may be used to automatically generate the hrMC profile (e.g., as a peak pattern or spectrum) of an unknown microorganism and to compare it to the database. A matching score, or similarity measure, based on profile correlation or pattern matching may be generated and used for ranking of the results. The highest similarity would result in the identification of the unknown microorganism. It is possible to add statistical confidence levels to the identification in aspects of this invention, based on the similarity or dissimilarity of the hrMC obtained to hrMCs in the library or database used for identification. However, if the unknown profile correlates with two or more profiles in the library, the hrMC information of the unknown microorganism is insufficient to distinguish between microorganisms and cannot lead to unambiguous identification of the unknown microorganism. The term “cannot be distinguished” in the sense that microorganisms cannot be distinguished based on hrMC information, refers to the situation that at least two hrMCs in the library exhibit a high degree of similarity between them. In practice, this means that the profiles of those at least two hrMCs in the library may overlap, be similar or even be identical. The term “negative control reaction”, as used herein, refers to a post- PCR mixture comprising no PCR amplicon(s) as a result of the deliberate absence of target nucleic acid sequences or template DNA in the pre-PCR mixture. The term "quantification cycle" or "Cq" as used herein includes reference to a measurement taken in a real time PCR assay or qPCR assay, whereby a positive reaction is detected by accumulation of a signal, such as a fluorescent signal. The Cq (quantification cycle) can be defined as the number of cycles required for the signal to cross the threshold (i.e. exceeds background level). Cq levels are inversely proportional to the amount of target nucleic acid in the sample (i.e. the lower the Cq level the greater the amount of target nucleic acid in the sample). The term "biological sample", as used herein, includes reference to a sample from a human or animal subject, in particular, the term refers to a clinical sample obtained from a human patient. In preferred embodiments, a sample is a tissue or bodily fluid collected from a subject. Sample sources include, but are not limited to, mucus, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial wash (BW), synovial fluid, blood, bodily fluids, skin or skin lesions, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material). Preferred sample sources include plasma, serum, whole blood, urine and cerebrospinal fluid. The term "subject", as used herein is intended to refer to any individual or patient on a biological sample of which a method as described herein is performed. Generally the subject is human, although as will be appreciated by those in the art, the subject may be an animal. Thus other animals, including mammals and birds are included within the definition of subject. Detailed description of preferred embodiments Samples and optional nucleic acid extraction A method of the present invention comprises as a first step the provision of a biological sample suspected of comprising a microorganism and optionally isolating nucleic acids from said biological sample. The biological sample may be provided in the form of a dry or moist swab, a needle aspirate, such as a biopsy, a sample of blood drawn from a vein of a subject, a lumbar puncture to obtain CSF, or a urine sample aspirated from the bladder or a lung aspirate obtained by catheter or a joint aspirate, or a pus aspirate or tissue biopsy. Samples may also suitably be obtained by lavage or by a midstream clean-catch method such as in the case of urine. A biological sample is suspected of comprising a microorganism if the subject from which the sample is obtained or taken suffers from symptoms that are potentially caused by a microbial infection, such as a bacterial infection in the case of sepsis. The sample may be used directly in a method of the invention, meaning that an aliquot of the sample is mixed into the nucleic acid amplification mixture, optionally wherein the microorganism is first concentrated from the sample, for instance by centrifugation. In some preferred embodiments, nucleic acids are isolating from said biological sample. In alternative preferred embodiments, nucleic acids are not isolating from said biological sample. Nucleic acid isolation may increase PCR amplification efficiency by removing PCR inhibitors present in the biological sample. Moreover, nucleic acid isolation may increase PCR amplification efficiency by concentrating the low quantities of microbial DNA present in many biological samples, such as blood. In order to successfully extract nucleic acids, the sample may, as indicated above, first be subjected to (staged) centrifugation in order to concentrate the microbial cells, or selectively remove human cells of the subject or patient, such as blood cells or leucocytes. Another option is to first selectively lyse human cells containing DNA, after which all free DNA is degraded. In a next step, bacteria are lysed (optionally after concentrating them by a centrifugation or a filtering step) and their DNA is isolated, leading to a selective isolation of bacterial DNA over host (human) DNA. This is for blood samples a most preferred embodiment. When using centrifugation in urine samples, crystal formation is preferably avoided, such as by using Tris-EDTA dissolution of urine crystals. Nucleic acids may then be isolated from the sample or from the concentrated microbial sample obtained therefrom, by either extraction of total nucleic acids (TNA), DNA or RNA following a cell-lysis step. Preferably, total nucleic acid (DNA plus RNA) is extracted from the cell lysate. Use may be made of classical two-step DNA isolation from cell lysates using guanidine thiocyanate and isobutyl alcohol. Preferably, use is made of standardized commercially available TNA extraction systems, which are usually based on guanidine hydrochloride-based cell lysis and nucleic acid extraction and may further rely on the capture of lysed-cell- released TNA by magnetic silica particles, followed by the purification of the TNA by several washing steps, the release from the silica by heating, and the removal of the silica, to thereby provide a purified sample of isolated nucleic acids comprising microbial genomic DNA present in said biological sample. Broad-taxonomic-range amplification of variable or hypervariable regions in a conserved microbial gene from genomic DNA In a method of the invention, a nucleic acid amplification reaction is performed using an aliquot of the biological sample or nucleic acids isolated therefrom. In methods of this invention, the amplification reaction is preferably a reaction for amplifying DNA, and is preferably performed by PCR. Nucleic acid amplification is performed in a reaction container. Such a container comprises a nucleic acid amplification reaction mixture comprising microbial genomic DNA template, amplification primers, polymerase enzyme, deoxynucleoside triphosphates (dNTPs) mixture, a DNA-intercalating fluorescence dye, a reaction buffer, optionally including magnesium ion (Mg2+) cofactor, preferably said buffer supports activity of the polymerase enzyme. The reaction container comprising the complete reaction mixture is then preferably closed, to form a closed container or closed-tube assay system. Broad-taxonomic-range amplification primers The amplification reaction requires the presence of amplification primers in the reaction mixture. The amplification primers in aspects of this invention comprise at least one pair of broad-taxonomic-range amplification primers for amplifying a variable or hypervariable region in a conserved microbial gene, preferably selected from a microbial ribosomal DNA (rDNA) gene and a microbial rDNA internal transcribed spacer (ITS) region, from the, optionally isolated, nucleic acids in said sample and for generating an amplicon. A broad-taxonomic-range amplification primer may suitably comprise a primer sequence that corresponds to a conserved region of the microbial genome, allowing for amplification of DNA from a wide range of microbial species. In bacteria, these primers are suitably designed to target highly conserved regions in the 16S rDNA gene and / or in the 23S rDNA gene, which genes are present in most bacteria within the rrn operon and exhibit sufficient sequence conservation to serve as a target for such primers. Broad-taxonomic-range primers may include degenerate primers, meaning that the primer comprises alternative bases at one or more positions to increase the number of matches within a given sequence set of microbial rDNA sequences. While a higher degeneracy facilitates higher coverage, it also can lead to unspecific amplification. Therefore, degenerate primer design is a trade-off between specificity and coverage (sensitivity). Computer programs for optimal design of broad-taxonomic-range primers, such as DegePrime, are well known to one of skill in the art (e.g. Hugerth et al., 2014. Appl. Environ. Microbiol.80(16): 5116 –5123), which programs finds a degenerate oligomer of as high coverage as possible for each position of a multiple sequence alignment, and outputs its coverage among taxonomic divisions. Aligned bacterial 16S rDNA gene sequences may be downloaded from RDP, v.9 (Cole et al., Nucleic Acids Res.37:D141–D145). With respect to broad-taxonomic-range primers for amplification of bacterial rDNA or rDNA ITS sequences may for instance include 27F (5'- AGAGTTTGATCMTGGCTCAG-3'), 341F (5’-CCTACGGGNGGCWGCAG-3’); 341’F (5’-CCTAHGGGRBGCAGCAG-3’); 515F (5’- GTGYCAGCCGCCGCGGTAA-3’); 515’F (5’-GTGBCAGCMGCCGCGGTAA- 3’), 805R (5’-GACTACHVGGGTATCTAATCC-3’), and 1492R (5'- TACGGYTACCTTGTTACGACT-3'), wherein N is (A / G / C / T); W is (A / T); H is A / C / T; R is (A / G); B is (C / G / T); Y is (C / T); M is (A / C); V is (A / C / G). Such primers are also referred to as universal primers. In order to amplify the 16S–23S rDNA ITS region of bacterial rDNA, one of skill will understand that the complementary strand of said primer annealing sites of the above broad-taxonomic-range 16S rDNA primers may also be used as a target for a forward or reversed primer, in order to arrive at a primer set for broad- taxonomic-range DNA amplification of said ITS region. Preferred bacterial broad range amplification primers include SEQ ID NOs: 14 and 15. With respect to broad-taxonomic-range primers for amplification of bacterial rDNA or rDNA ITS sequences of bacteria, in addition to the above universal primers, suitable primers may for instance also include phylum- specific primers as disclosed herein. Preferred broad taxonomic grouping of fungi include the species of the Ascomycota division including, but not limited to, Aspergillus spp., Blastomyces spp., Candida spp., Coccidioides spp., Epidermophyton spp. Histoplasma spp., Microsporum spp., Paracoccidioides spp., Pneumocystis spp., Sporothrix spp., Trichoderma spp. and Trichophyton spp.; the Basidiomycota division including, but not limited to, Cryptococcus spp., Malassezia spp. and Trichosporon spp.; and the Mucoromycota division including, but not limited to, Rhizopus spp., Mucor spp., Rhizomucor spp., Syncephalastrum spp., Apophysomyces spp., Lichtheimia spp., Cunninghamella spp. and Saksenaea spp. With respect to broad-taxonomic- range primer pairs employed for amplification of fungal rDNA or rDNA ITS sequences, a broad taxonomic-range primer set consisting of ITS1F (5’- TCCGTAGGTGAACCTGCGG-3’) / ITS4R (5’-TCCTCCGCTTATTGATATGC- 3’) may be used to amplify the ITS region of fungal rDNA flanked by these conserved sequences as primer annealing sites for DNA amplification. These primers amplify a ~600-base pair (bp) DNA fragment of the ITS region of fungi (White et al., 1990, pp.315–322. In: Innis, Gelfand, Sninsky & White, eds. PCR protocols a guide to methods and applications. Academic Press, San Diego, CA.). Other suitable broad taxonomic-range fungal ITS region primers include (sequence provided in 5’-3’ orientation) ITS2 (5’- GCTGCGTTCTTCATCGATGC-3’), ITS3 (5’-GCATCGATGAAGAACGCAGC- 3’) and ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’) (White et al., 1990. supra.); ITS1-F (5’-CTTGGTCATTTAGAGGAAGTAA-3’), ITS4-B (5’- CAGGAGACTTGTACACGGTCCAG-3’) (Gardes & Bruns, 1993, Mol. Ecol.2: 113–118), 5.8S (5’-CGCTGCGTTCTTCATCG-3’), 5.8SR (5’- TCGATGAAGAACGCAGCG), SR6R (5’-AAGWAAAAGTCGTAACAAGG-3’), wherein W=G,T (Vilgalys & Hester, 1990, J. Bacteriol.172: 4238–4246; Gizard et al., 2014. Ecology and Evolution 4(7): 1140–1157). Polymerase enzymes The amplification reaction requires the presence in the reaction mixture of polymerase enzymes for de novo DNA synthesis using the genomic DNA as a template. Preferably, the reaction mixture contains a DNA polymerase. The reaction mixture may optionally further comprise reverse transcriptase, helicase, recombinase, restriction endonuclease, and or RNA polymerase enzymes. One of skill in the art will be aware of the various polymerase and DNA modifying enzymes required in various nucleic acid amplification procedures that may suitably be used in aspects of this invention, such as for instance isothermal amplification technologies. In aspects of this invention, use is preferably made of PCR, more preferably qPCR, wherein the reaction mixture contains a Taq DNA polymerase. Detection probe The amplification reaction requires the presence in the reaction mixture of at least one detection probe comprising at least a detectable label for detecting a target sequence in the amplicon. The detection probe generates a detection signal in the presence of an amplicon comprising said taxon-specific sequence. The purpose of the at least one detection probe is to resolve ambiguities in the hrMC of microorganisms that belong (taxonomically) to distinct species, but that produce a similar or highly overlapping hrMC using the same set of broad-taxonomic-range amplification primers. For example, when the species belong to the same genus, the detection probe distinguishes the PCR amplicon of one species from the amplicon of another species, solely based on sequence differences in their amplicons. The detection probe will then be based on species-specific sequence differences in the amplicon. Likewise, when the species belong to different genera, the detection probe may distinguish the PCR amplicons of one genus from the amplicons of another genus, based on genus-specific sequence differences in their amplicons, thereby also resolving a situation where microorganisms cannot be distinguished based solely on the hrMC of the amplicon generated. Likewise, when the species belong to different phyla of microorganisms, the taxon-specific detection probe may distinguish the PCR amplicons from one phylum from the amplicons of another phylum, based on phylum-specific sequence differences in their amplicons, thereby also resolving a situation where microorganisms cannot be distinguished based on the hrMC alone. In general, if a group of distinct taxa of microorganisms cannot be distinguished based on the hrMC of their amplicon as amplified using the broad-range-taxonomic primers as described herein, the detection probe detects a target sequence within that amplicon (e.g., a taxon-specific sequence) that is specific for at least one taxa of microorganisms in said group. The present inventors have established that a group of taxa that cannot be distinguished based on the hrMC is always relatively small, e.g. less than 50, less than 20, less than 15, or less than 10 members, and mostly even less than 5 members, of which only 1 or 2 may be clinically relevant, and that therefore use of at least one detection probe, such as a probe that is specific for the pathogenic species within said group, can resolve hrMC ambiguities within said group. Such hrMC ambiguities are also referred to herein as “clashes”. Because the unknown microorganism in the sample may be one of multiple groups that comprise microorganisms that cannot be distinguished as defined herein (i.e. that result in a “clash”), the amplification reaction mixture may comprise multiple detection probes for resolving potential misidentifications in multiple groups of hrMC-indistinguishable microorganisms. For instance, the reaction mixture may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 75, 80, 85, 90, 95 or 100 detection probes. Each detection probe is for example taxon-specific to distinguish amplicons that cause hrMC clashes between different taxa (taxon-specific detection probes). Each detection probe is for example species-specific to distinguish hrMC clashes between different species (species-specific detection probes). In such cases, each of these detection probes may be directed to one species that is a member of a “clash” group. In preferred embodiments of aspects of the present invention detection probes are so-called “dense probes” or “combinatorial dense probes”, which are detection probes that detect multiple species. Those species are not necessarily taxonomically related, but their amplicons are selected as target of a single dense probe due to sequence similarities in their amplicons. Aspects of the present invention in preferred embodiments, include the presence or use of at least two of such dense probes. The dense probes preferably comprise different detectable labels, that is, each of the at least two dense preferably comprises a different detectable label. However, with as dictated by instrument constraints, the number of detectable labels will be limited. For instance, the number of detectable labels may be limited to 3, 4, 5, or 6. However, a dense probe may also comprise a detectable label that is detectably the same as that comprised in another of the at least two dense probes. This results in a situation where a single detection signal may be obtained from two different probes, indicating the presence of amplicons of any one or more of the microorganism species whose amplicons comprise either of the target sequences of both probes. In aspects of this invention, it is preferred that each of the at least two dense detection probes comprises a targeting sequence that detects the amplicon of a selection of at least two species selected from the N microorganism species where N is greater than two and the number of microorganism species in the selection is smaller than N. Hence, the targeting sequence of each dense detection probe according to the present invention detects a specific selection of multiple microorganism species from the group of N microorganism species as a sub- group. The targeting sequence of each dense detection probe provides for specific detection of a target sequence within the amplicon that the selection of microorganism species as a sub-group have in common. This allows a single dense probe to detect multiple species which is an aspect of the present invention, as it increases the amount of information that can be retrieved from a single probe and thereby allows for improved detection of microorganisms. The targeting sequence of the detection probes of the invention is selected to detect an amplicon having a target sequence of 15-25 consecutive bases that is present in the variable and / or hypervariable region of a conserved microbial gene of all species contained in a distinct sub-group selected from the group of N microorganism species. The targeting sequence of the detection probes according to the present invention facilitate specific binding to or hybridization with its target sequence which is contained in the amplicon. The targeting sequence facilitate binding / hybridization of the detection probe to / with an amplicon or a microorganism species, wherein the amplicon comprises an amplified fragment from a rDNA gene, a rDNA ITS region, a 16S-23S rDNA ITS region, a 23S-5S rDNA ITS region, a 18S-5.8S rDNA ITS region or a 5.8-26S / 28S rDNA ITS region. Preferably the amplicon comprises a 16S-23S rDNA ITS region. The targeting sequence of a detection probe according to the present invention may suitably comprise from 5 – 50, 10 – 45, 15 – 40, 20 – 35, or 25 – 30 consecutive nucleotide bases. The targeting sequence of a detection probe according to the present invention may suitably comprise 15 – 25 consecutive nucleotide bases. The targeting sequence of a detection probe according to the present invention may suitably be 100% complementary to its target sequence. The targeting sequence of a detection probe according to the present invention is preferably at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92% at least 93% at least 94, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to its target sequence. The term “complementary” herein indicates the percentage of sequence identity over the length of the target sequence. The targeting sequence of the detection probe according to the present invention may suitably comprise nucleotide modifications. One or more nucleotides of the targeting sequence may for instance be modified in order to increase stability of the detection probe. One or more nucleotides of the targeting sequence may for instance be modified in order to increase the strength of binding or hybridization to the target sequence of an amplicon. Suitable nucleotide modifications of the detection probes may for instance comprise phosphorylation, 3’or 5’end amino modification, and inclusion of spacers, fluorophores, quenchers, modified bases, and phosphorothioate bonds. The detection probe may suitably be a degenerate probe. A degenerate probe may comprise one or more degenerate bases, in order to facilitate simultaneous detection of amplicons having one or more base differences in the target sequence. Preferably the detection probes do not contain more than 2, 3, 4, 5, 6, 7, 8, 9 or 10 degenerate nucleotide bases. Aspects of the present invention in preferred embodiments, may suitably include the presence or use of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen or at least fifteen, or more, detection probes each comprising a detectable label. For example, the invention may comprise the use of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 75, 80, 85, 90, 95 or 100 detection probes. Figure 10 provides an example of how to resolve 11 potential clashes between clinically relevant species, including nucleotide sequences for probes that resolve the clash. In the Example of Figure 10, only clashes comprising two species are provided, and it is evident that a single probe suffices to provide positive identification of the species from which the amplicon is derived. In such instances, the probe hybridizes either with species 1 or species 2. In the case of clashes with multiple species, these can be resolved with multiple probes. Preferably, a taxon-specific detection probe exhibits minimal cross-reactivity with other common species. In the case of Figure 10, it may be noticed that the K. pneumoniae-specific probe that resolves the clash between E. cloacae and K. pneumoniae cross-reacts with K. aerogenes. However, this is not a problem as K. aerogenes and K. pneumoniae have similar clinical implications. Some examples of suitable taxon-specific detection probes are provided in Figure 10. However, the present invention is in no way limited thereto. It is well within the ordinary skill of the skilled person to provide suitable taxon-specific detection probes for use in the present invention. Briefly, a selection of relevant species of microorganisms is provided, and primers are selected for amplifying a variable or hypervariable region in a conserved microbial gene in all species in that selection. In-vitro or in-silico (or both) melting curves of the amplicons for all species in the selection. Preferably, this is done for multiple strains per species to estimate intra- species variation. It is then determined which melting curves are so similar that a clash may potentially occur, which means that the melting curves cannot be distinguished well enough to make a species identification with high certainty. In order to design the taxon-specific detection probes, the sequences of the amplicons in question for the species in selection are obtained (either by sequencing or from public databases). Preferably, multiple strains per species are included to account for biological variation. The amplicon sequences of the clashing species are then compared, e.g. by alignment, in order to identify sequences that are unique to one of the species in the clash (or to more species in the case of a clash with multiple species), to the extent that those sequences are not present in the other species of the clash. Within the unique sequence an area is then identified that meets the requirements for a nucleic acid hybridization probe in terms of (i) length (preferably >20 bp), (ii) melting temperature (preferably match the amplification conditions, so probes preferably anneal at a temperature higher than the annealing temperature of the amplification primers) and (iii) degeneracy (preferably there are not more than 2-5 degenerate bases in the probe sequence). The probe is usually the reverse complement of the target sequence, but in the amplicon, both DNA strands are present. Preferably, cross-reactivity of the probes with other species in the species selection (i.e. all species that should be included in the detection and identification method) is tested and excluded. Detection probes according to the present invention are for example not taxon-, or species-specific, but group (or multi-species) specific. This means that detection probes may be used in the method of the present invention are specific to a group of microorganism, preferably a subgroup of the group of N microorganisms the presence of at least one of which is to be determined in the sample. For example, at least two group-specific detection probes are used in the present invention, wherein the at least two group- specific detection probes have at least two different detection signals. The at least two group-specific detection probes according to the present invention, each comprising a detection signal, wherein the at least two detection probes comprise at least two different detection signals, provide the technical effect to significantly reduce the number of required detection probes in the reaction mixture of the method of the present invention. Group-specific probes according to the present invention are also considered “dense probes”. A detection probe according to the present invention is at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length. The detection probes may comprise modified nucleotides within the targeting sequence and / or within regions flanking the targeting sequence. The detectable label of the detection probe is preferably a fluorescent label. A fluorescent label for example allows its detection following or during the period that the nucleic acid amplification reaction is being performed in the closed reaction tube. Thereto, the fluorescent label is preferably detectable in the closed-tube and preferably by the amplification equipment, such as in a specific (color) channel of the (q)PCR instrument. The fluorescent label used as detectable label may, for example, be selected from the group of 6-FAM (520nm), TET (539nm), YAK (Yakima Yellow®, 549nm), VIC (554), SUN (554nm), HEX (555nm), JOE (555nm) in combination with quenchers TAMRA, Black Hole Quencher 1 (BHQ®-1) or Iowa Black FQ (single-quenched) or ZEN-Iowa Black FQ (double-quenched); fluorescent reporters Cy®3 (564nm), ATTO ™ 550 (575nm), TAMRA (583), ATTO 565 (591nm), PET® (595nm), ROX (608nm), Texas Red®-X (617nm), JUN® (617nm), ATTO 633 (657nm), LIZ® (655nm), Cy5 (668nm), and ATTO 647 (669nm) in combination with quenchers Black Hole Quencher-2 (BHQ-2), Iowa Black RQ (single-quenched), or TAO–Iowa Black RQ (double- quenched). The detection probe in aspects of this invention may be a hydrolysis probe or a molecular beacon. The detection probe according to the invention is for example a hydrolysis probe. An example of a hydrolysis probe is a TaqMan-probe. The TaqMan probe principle relies on the 5´–3´ exonuclease activity of Taq polymerase to cleave a dual-labeled oligonucleotide probe, having a fluorophore covalently attached to the 5’-end and a quencher at the 3’-end, during hybridization to the complementary target sequence and fluorophore-based detection. As in other quantitative PCR methods, the resulting fluorescence signal permits quantitative measurements of the accumulation of the amplicon during PCR. The detection probes may, in embodiments, comprise two detectable labels. The two detectable labels on one detection probe may be the same or different, and are preferably different. Decorating a detection probe according to the present invention for example improves signal intensity and / or detection accuracy. Multicolor taxon-specific detection probes As exemplified in the Examples below, the detection probe may be a species-specific detection probe having a first detectable label, preferably fluorescent, that is detectable in a first color channel of a PCR instrument. In embodiments of this invention, use may be made of a large number of species-specific detection probes that are all added to the reaction mixture, and wherein each of these probes may comprise a different detectable label, preferably a fluorescent label, that is detectable in a different color channel of a PCR instrument. However, as the number of different color channels in a PCR instrument is limited (e.g., 3, 4, or 5 different color channels), the maximum number of species detectable using species-specific probes having a different fluorescent label as detection signal is accordingly limited to the number of available color channels (e.g.3, 4, or 5 different color channels). Therefore, in embodiments of this invention the detection signals on a detection probe may be multiplexed. This means that the detection of microorganism using taxon-specific, more preferably species-specific detection probes, is based on a unique detection signal combination (i.e., a combination of at least two recorded detection signals). For example, if the detection signal is a fluorescent label, more than one microorganism may be positive for a single fluorescent label, but every detectable microorganism is identifiable by a unique combination of fluorescent labels. In another embodiment, detection probes of the invention may have at least two different detectable labels to provide two distinct detection signals. For example, detection probes of the present invention may have at least two fluorescent labels as detection signal. For example, a detection probe used in aspects of the present invention may provide a detection signal in at least two color channels of a PCR instrument, and may be referred to as a multicolor probe. A multicolor probe provides a virtual additional color as a combination of the two individual labels. For example, with the use of detection probes having a fluorescent label which provide a specific color / label combination the maximum number of such detection probes is defined by the number of color channels in a (q)PCR instrument. The maximum number of multicolor detection probes is for example calculated by 2^(no. of channels). This means, the maximum number of taxon / species-specific detection probes providing unique signal / label combinations is for example 2 for 1 color channel, 4 for 2 color channels, 8 for 3 color channels, 16 for 4 color channels, 32 for 5 color channels, etc. However, this includes also a scenario where all colors / channels are off. Such scenario may not be desirable for detection. For example, all colors / channels off is used in the method of the present invention to identify species outside the assay. If the all colors / channels off scenario should to be avoided the maximum number of taxon / species-specific detection probes is for example 1 for 1 color channel, 3 for 2 color channels, 7 for 3 color channels, 15 for 4 color channels, 31 for 5 color channels, etc. according to 2^(no. of channels) – 1. As further exemplified in the Examples below, the taxon-specific detection probe may be a species-specific detection probe having a first detection signal, preferably fluorescent label, that is detectable in a first color channel of a PCR instrument, and a at least a second detection signal, preferably a second fluorescent label that is detectable in a second color channel of a PCR instrument. Selections from the group of N microorganism species When using group-specific or dense probes, a method of the invention comprises a step a2) of defining a group of N microorganism species the presence of at least one of which is to be determined in said biological sample wherein N is greater than two. The detection probes are then designed to detect a group of multiple microorganism species that is selected from said group of N as a sub-group or “selection” based on the presence of identical sequences in their amplicons, or by the use of different probes targeting distinct amplicon sequences but labeled with the same detectable label. The reaction mixture then preferably contains at least two of such dense detection probes to detect these sub-groups, preferably -wherein each of said at least two detection probes detects theamplicon of a distinct selection of at least two microorganism species from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, -wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, -wherein the total number of detection probes is smaller than M A selection of microorganism species selected from the N microorganism species that is detectable by at least one of the at least two detection probes may consist of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more microorganism species. The at least two dense detection probes in these embodiments of the invention define distinct selections of multiple microorganism species selected from the group of N microorganism species. A selection from N microorganism species is based on the presence of a common target sequence within the amplicon obtained from these microorganism species and which can be detected by a selection-specific (dense) detection probe. Alternatively, if such subgroups are to be detected in a single color channel, multiple probes targeting distinct target sequences of the amplicons of the microorganism species in the subgroup may be use, wherein said multiple probes have a detectable label that is detectable in the same instrument channel. Preferably, a subgroup selection from N microorganism species as a target of a dense probe is based on the presence of a common target sequence within the amplicon. In aspects of this invention, the selection of microorganism species (subgroups) may be completely independent from the taxonomic position or relationship between the different microorganism species that constitute the selection. For instance, the selection of microorganism species does not need to comprise microorganisms species that belong to the same genus, family of order. They may belong to completely different genera or families. For example, a first selection of multiple microorganism species selected from the group of N microorganism species which is detected by a first detection probe may consist of Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Staphylococcus aureus, Staphylococcus epidermidis, Stenotrophomonas maltophilia, Streptococcus constellatus, Streptococcus dysgalactiae, and Streptococcus mitis. For example, a further selection of multiple microorganism species selected from the group of N microorganism species which is detected by a further detection probe may consist of Neisseria meningitidis, and Pseudomonas aeruginosa. For example, a further selection of multiple microorganism species selected from the group of N microorganism species which is detected by a further detection probe may consist of Enterococcus faecium, Streptococcus constellatus and Streptococcus dysgalactiae. For example, a further selection of multiple microorganism species selected from the group of N microorganism species which is detected by a further detection probe may consist of Staphylococcus aureus and Streptococcus dysgalactiae. As shown in the Examples, the use of 3, 4, or 5 dense probes facilitates the detection of many microorganism species to the species-level. The combination of the different detection signals generated by the dense probes partitions the group of N microorganism species into distinct subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets. Selecting a targeting sequences of a dense detection probe In aspects of the present invention, a subgroup selection of multiple microorganism species selected from the group of N microorganism species which is detected by a dense detection probe requires the definition of the target sequence for said probe. Selection of target sequences may, for example, comprise the provision of a database comprising the nucleotide sequence of species-specific variable and / or hypervariable regions of a conserved microbial gene, preferably the 16S-23S rDNA ITS region, which sequences are annotated to the microorganisms species from which the sequence was obtained. The database is suitably a public database comprising species-specific variable and / or hypervariable regions of a conserved microbial gene with species annotation. Suitable data may be extracted from public databases, such as GenBank. Selecting target sequences may further comprise generating one or more sequence alignment of species-specific variable and / or hypervariable regions of a conserved microbial gene of all N microorganism species whose presence is to be detected. Further, selecting target sequences for example comprises selecting at least a first target sequence which is exclusive present in a first subgroup of microorganism species and absent in microorganism species not belonging to said first group, preferably absent in the remainder of the group of N microorganism species, in order to provide a target for a first dense detection probe. Additionally, in order to provide a second dense detection probe, at least a second target sequence is selected which is exclusive present in at least a second subgroup of microorganism species and absent in microorganism species not belonging to said second subgroup, preferably absent in the remainder of the group of N microorganism species, in order to provide a target for a second dense detection probe. The at least first subgroup and at least second subgroup have at least one microorganism species not in common. For example, the at least first subgroup and at least second subgroup have at least one microorganism species in common. The combination of detection signals for the first and second dense probes then provide information on the microorganism species that is present. The target sequence may suitably comprise a sequence of 15 – 30, preferably 20-25 consecutive nucleotide bases. Selecting target sequences for the detection probes is for example performed manually or using a computer program. For example, a computer program may be used to detect a region of consecutive bases that is present in the amplicon of a multitude of microorganism species, and that is not present in other microorganism species in the group of the N microorganism species. If needed, degenerate bases can be introduced into the targeting sequence of the detection probe to create degenerate probes which facilitate simultaneous detection of multiple microorganisms species that have the target sequence in their amplicon, and excludes detection of other microorganism species that do not contain the target sequence in their amplicon. For example, the computer program may provide a sequence alignment of species-specific variable and / or hypervariable regions of a conserved microbial gene of all N microorganism species which should be detected by a single detection probe. In essence, at least one target sequence of consecutive nucleotide bases is selected that is present in the variable and / or hypervariable region of a conserved microbial gene of multiple species selected from the group of N microorganism species and which target sequence is not present in other species of the group of N microorganism species, in order to provide a target sequence for a first detection probe. The present invention further provides a method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species, the presence of at least one of which is to be determined in said biological sample, wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species, and (iii) at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a subgroup selection comprising at least two microorganism species selected from said group of N microorganism species, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon, e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, and f) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset within the M subsets. In aspects of the invention, the total number of detection probes is preferably smaller than M, the number of subsets. Steps c) and d) are preferably carried out in the same single closed reaction container. The subgroups selection of microorganisms species from the group of N microorganism species, the provision of the at least two detection probes for these subgroup selections, and the detection capacity of the detection instrument to detect different detection signals from these probes, ensures that each unique combination of detection signals identifies the presence of one and only one subset of the M subsets. Depending on the number of sensors or color channels in a detection instrument, which constraints the number of detection signals, the maximum number of subsets in a partition in accordance with the present combinatorial dense probe design is 2^x, wherein x is the number of color channels. Hence, in a method of the invention the group of N microorganism species is divided into subgroup selections such that each microorganism species from the group of N microorganism species is detected by at least one detection probe. These detection probes preferably target multiple species, but may also target single species. At least two detection probes detect at least two species. The number of individual species that can then be partitioned into distinct subsets, defined on the basis of their combined detection signals for the individual combinatorial dense probes, is 2^x. If the group of N microorganism species is larger than M (2^x), and species identification to the species level is required, additional probes and additional color channels are needed. If the maximum number of color channels is already used, additional color channels can be readily made available by performing a parallel amplification reaction with the additional probes, in order to allow for the partitioning of the original group of N microorganism species into more subsets. Each subset may comprise 0, 1 or multiple species, for species-level identification each subset should contain 1 species, such that the minimum number of probes for detecting, e.g., 45 species at species level is 6 probes, which can easily be divided over 2 parallel reactions. Preferably, the subset wherein all probes are “off” (no target detected) is not used. Further, the invention provides a selection of combinatorial dense probes as detection probes which are subgroup-specific and may be used in a method of the invention, as well as a kit of parts comprising a selection of at least two combinatorial dense probes as detection probes in accordance with the invention. The kit of parts may further comprise at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon. The present inventors have realized that a combination of detection probes that target various sequences in an amplicon can be used for detection of specific microorganism, and that such a combination of probes can be designed in a manner that results in an increase in the informative data from a single amplification reaction. The complex design of the combination of detection probes facilitates a multiplexed detection analysis of microorganism species in clinical samples. Surprisingly, the present inventors have discovered that, rather than using species-specific detection probes, a combination of multiple probes can be designed in such a way that each of the probes detects multiple known species from a group that is to be detected, wherein the detection signals of the probes together form a combinatorial partition of distinct sets and wherein each microorganism species from the group is present in one and only one of the sets. The inventors named this design a combinatorial dense probes design. The use of combinatorial dense probes allows for the detection and identification of a high number of (pathogenic) microorganisms in a biological sample, either at species level or in groups, by the use of a single nucleic acid amplification reaction and the use of a relatively low number of distinct detection probes. A high number of distinct detection probes, which is required when using only species-specific probes (i.e., probes that detect only one microorganism species), may often negatively impact an amplification reaction, such as a polymerase chain reaction (PCR), due to probe interferences, increased background noise, unspecific reactions, etc., hampering accurate identification and detection. The present invention provides in a first aspect a method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species the presence of at least one of which is to be determined in said biological sample wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species, (iii) at least two nucleic acid detection probes, -wherein each of said detection probes detects the amplicon of asubgroup selection of at least two microorganism species selected from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, -wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon, e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, f) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset within the M subsets. In a preferred embodiment of a method of the invention, steps d) and e) are carried out in the same single closed reaction container. In another preferred embodiment of a method of the invention, the reaction mixture comprises a DNA intercalating dye, and step e) further comprises recording the signal of the DNA intercalating dye and establishing the presence or absence of an amplicon based on a recorded signal of the DNA intercalating dye, and wherein the presence or absence of an amplicon establishes the presence or absence of a microorganism in said biological sample, preferably wherein the signal of the DNA intercalating dye is different from the detection signal of said detection probes. In another preferred embodiment of a method of the invention, said variable and / or hypervariable region in a conserved microbial gene comprises at least a part of an rDNA internal transcribed spacer (ITS) region, preferably at least a part of the 16S-23S rDNA-ITS, more preferably the complete 16S-23S rDNA-ITS region. In another preferred embodiment of a method of the invention, said at least two detection probes each comprise a targeting sequence the nucleic acid sequence of which comprises at least 50%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% sequence identity to a target sequence in the amplicon or the reverse complement thereof, and wherein the targeting sequences of said at least two detection probes is identified by: a) providing a database comprising nucleic acid sequences of said amplicon predicted to be generated in step e) annotated to each microorganism species in the group of N microorganism species; b) having a computer program select target sequences for each of said at least two detection probes in said predicted amplicon sequences of the group of N microorganism species, wherein said target sequences have a length of about 15-40, preferably from about 20-30 consecutive bases, and wherein said target sequence is present in a subgroup selection of at least two microorganism species selected from said group of N microorganism species, and wherein said target sequence is not present in any other microorganism species from said group of N microorganism species, to thereby provide nucleic acid targets for the detection probes in the amplicon. The subgroup selection of at least two microorganism species selected from said group of N microorganism species is based on the presence in their amplicon of one or more common targets for one or more combinatorial detection probes as defined herein, preferably wherein the one or more combinatorial detection probes that define a first subgroup selection comprise detectable labels of which the detection signals are detectable in a first single color channel, and wherein the one or more combinatorial detection probes that define a second subgroup selection comprise detectable labels of which the detection signals are detectable in a second single color channel. The combination of detection signals of the combinatorial detection probes in the first and second single color channel define a subset partitioning of the group of N microorganism species. In preferred embodiments of aspects of the invention, the subset as defined by the combination of said at least two different detection signals is comprised of multiple microorganism species of which the high resolution melting curves (hrMCs) of their respective amplicons have distinguishable profiles. In another preferred embodiment of a method of the invention, step d) and e) are performed on a PCR instrument comprising distinct color channels for detecting distinct detection signals from said at least two detection probes and wherein the detection probes in said reaction mixture generate between 2 and X distinct detection signals, wherein X is the number of distinct color channels of the PCR instrument. In another preferred embodiment of a method of the invention, the detection probes comprise degenerate probes. Alternatively, two or more detection probes that have similar or identical detectable labels (e.g. that are detected in the same color channel of the PCR instrument) together target said distinct selection of microorganism species from said group of N microorganism species. In another preferred embodiment of a method of the invention, the biological sample is selected from whole blood, serum, synovial fluid, plasma, urine, and cerebrospinal fluid / liquor. In another preferred embodiment of a method of the invention, the nucleic acid amplification reaction is a polymerase chain reaction (PCR), preferably a quantitative polymerase chain reaction (qPCR). In another aspect, the present invention provides a kit of parts comprising at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a distinct selection of at least two microorganism species from a group of at least three microorganism species the presence of at least one of which group is to be determined in a biological sample, wherein said amplicon is obtainable by performing a nucleic acid amplification reaction on an aliquot of said biological sample or nucleic acids isolated therefrom using at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon comprises the 16S-23S rDNA-ITS, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of at least three microorganism species into distinct subsets wherein each microorganism species of said group of at least three microorganism species is in one and only one of these distinct subsets, and wherein the total number of detection probes is smaller than the number of distinct subsets. In preferred embodiments of aspects of this invention, the detection probes are hydrolysis probes. In preferred embodiments of aspects of this invention, the at least two detection probes comprise 3 detection probes for detecting the presence or absence of 8, preferably 7, distinct (subsets of) microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 4 detection probes for detecting the presence or absence of 16, preferably 15, distinct (subsets of) microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 5 detection probes for detecting the presence or absence of 32, preferably 31, distinct (subsets of) microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 3, 4, 5, or more detection probes for detecting the presence or absence of respectively 8, 16 or 32 or 2^xdistinct microorganism species or groups of microorganism species in said biological sample wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals. In other preferred embodiments of aspects of this invention, the total number of detection probes needed for detecting and classifying each microorganism species from said group of N microorganism species is divided over multiple separate reaction containers, that may be analysed in parallel, such that in each separate reaction container the number of distinct detection signals obtained from the detectable labels of the detection probes is no more than x, preferably x-1, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals. The mathematical description of the combinatorial dense probe design is provided in Figure 19. The method is described as follows. In figure 19, the set X represents the group of N microorganism species, the presence of at least one of which is to be determined in said biological sample, wherein N is greater than two (e.g., all the microorganism species the presence of which can be expected in the sample of interest). The probes are actual probes, and one or more probes attached to a color (i.e. the combination of the detection probe plus its detection signal) form a sensor. What the sensors do is partition the set of species into subsets. This term partition is used herein in its common mathematical sense. A partition is a collection of sets that together form the original set (in the present case, of species that could be in the sample) in such a way that each member of the original set ends up in one and only one of the subsets of the partition. This means that through this method each species ends up in a different set that can be identified, which is called a subset herein. There will be no overlap. Some of these subsets can be empty, but the subsets do not overlap, which means that a species cannot end up in two different subsets, or no subset at all. There is an important conceptual difference between the prior art probe design and the combinatorial dense probe design of the present invention. In the context of prior art probe design, a detection probe may have any detectable label and is designed to identify a specific group of species, such as a group of taxonomic species, while another probe with a different detectable label is designed to identify another specific group of species. The result is that there is no collective information from the combination of signals of such probes. In the combinatorial dense probe design, the individual probes or sensors (probes attached to a color) may individually be less meaningful, but the combined information of a multitude of such probes provides for a very powerful diagnostic tool. By consequence, the individual targets of a dense detection probe in the context of the present invention are not really important, and the targets for an individual probe can be quite “random”, what is important is that all the probes, assigned to all their colors, collectively make a design that creates the partitioning that has surprising diagnostic power. Hence, an individual probe (in the context of the selection of its targeting sequence) only has meaning in the entire design where together with all other probes and their colors assigned, it has the effect of creating the desired partition. If one probe in the design is changed, it may be necessary to change all other probes at the same time, to still make the partition work. The dense probe in the context of the present invention therefore may be addressed as a combinatorial probe, or a multiplexing probe to emphasize the design of the combined probes as a whole. The present invention therefore provides a method of detection using combinatorial dense probes which, through their targeting of specific sequences, facilitate an integrated effect of multiplexed detection signal analysis, enabling both rapid and reliable detection of microorganism subsets and / or even individual microorganisms at the species level. The advantage of using the combinatorial dense probes design in diagnostic methods may be understood more readily from the following. In attempting to identify or classify individual species in a set of species, the prior art detection methods provide species-specific probes for each species separately, and each probe has one unique label (color) and the number of species that can be detected in a single reaction is limited to the number of color channel. Thus, each color channel indicates the presence of one unique species, limiting the number of detectable species to the number of color channels. The method of the present invention, by contrast, starts with the definition of the set of species that need to be identified or classified, and then defining the diagnostic goal, which is to partition this set of species in a specific way to answer relevant diagnostic questions. The solution involves designing a set of probes and assigning colors such that they, through their combined outputs, create the required partition. A number of constraints may be defined for the required design: preferably, there is at least one probe that detects multiple species (density constraint); preferably, the number of probes is less than the number of species that are identified, either individually or as part of a set in the partition (density constraint); preferably, when working with 2 detection probes with two different labels, there are at least 3 non-empty sets in the partition where at least one of the detection signals is active (combinatorial constraint); preferably, there are more non-empty sets in the partition than there are detection signals (combinatorial constraint). In essence, the combinatorial dense probes approach yields more information per probe used than would be the case if only species specific probes were used. The information output of the process is increased and the throughput in screening samples is thereby enhanced. In addition, by allowing for “abstract” partitioning that does not resolve individual species but serves a broader diagnostic purpose, information that is not relevant for the diagnostic method does not have to be produced and hence the throughput is further enhanced. Thus, it is an advantage of the method of the present invention that the diagnostic method uses a lower number of distinct probes than would be needed by prior art methods using species- specific rather than combinatorial dense probes. It is a further advantage of the method of the present invention that the method allows for a much wider variety of diagnostic methods using partitions where partitions do not necessarily have to mean that its subsets are individual species, but possibly a group of species and that such subsets can have different diagnostic meaning such as, “dangerous”, “more tests needed”, “intervene by specific antibiotic treatment”, etc. DNA-intercalating dye The amplification reaction requires the presence in the reaction mixture of a DNA-intercalating dye (also referred to as saturating intercalating dye) for monitoring the amplification reaction and for recording a hrMC profile of the amplicon. The DNA-intercalating dye in the reaction mixture is preferably provided for recording a high-resolution melting curve for the amplicon. In preferred embodiments of aspects of this invention, the DNA intercalating dye is selected from the group consisting of, but not limited to, LC Green, SYTO9, Eva Green, Chromofy, BEBO, or SYBR Green, preferably Eva Green. The saturating intercalating dye should preferably not inhibit PCR. A saturating dye is sometimes defined as a dye that can be used at concentrations sufficiently high to saturate all DNA binding sites without inhibiting the PCR. The term saturating intercalating dye also includes reference to the fact that the dye is used at concentrations sufficient to saturate all DNA binding sites of the amplicon product at the end of amplification. Performing PCR in a method of the invention In a method of the invention, a step of amplifying DNA is preferably performed by the polymerase chain reaction (PCR), although other methods of DNA amplification may also be used, such as polymerase chain reaction (PCR, Mullis et al., 1986, Cold Spring Harb Symp Quant Biol 51, 263-273), ligation-mediated amplification (LAR, Wu & Wallace, 1989, Genomics 4, 560–569), Nucleic Acid Sequence Based Amplification (NASBA, Guatelli, et al., 1990, Proc. Natl. Acad. Sci. U.S.A.87, 1874–1878), Strand Displacement Amplification (SDA, Walker et al., 1992, Nucleic Acids Res. 20, 1691–1696), Loop-Mediated Isothermal Amplification (LAMP, Notomi et al., 2000, Nucleic Acids Res.28 (12): 63e–63), Ligase Chain Reaction (LCR, Wu et al., 2001, J. Clin. Microbiol.39, 2794–2798) and, helicase-dependent amplification (HDA, Vincent et al., 2004, EMBO Rep.5(8): 795–800), Rolling Circle Amplification (RCA, Larsson et al., 2004, Nat. Meth.1, 227–232), Recombinase Polymerase Amplification (RPA, Piepenburg et al., 2006, PloS Biol.4 (7), e204), all these methods are well known to one of skill in the art (for an overview see Monis & Giglio, 2006, Infection, Genetics and Evolution 6, 2–12 and Wang et al., 2023, Biosensors 13, 160). Preferably, PCR is a qPCR or real-time PCR (Higuchi et al., 1992, Biotechnology (NY) 10, 413– 417; Heid et al., 1996 , Genome Res.6, 986–994; Edwards, et al., 2004, In: Real-time PCR, An Essential Guide. Horizon Bioscience, Wymondham, p. 346.). The present invention relates, inter alia, to methods involving a broad-taxonomic-range amplification or universal amplification of at least one variable or hypervariable region in a conserved microbial gene, preferably selected from a microbial ribosomal DNA (rDNA) gene and a microbial rDNA internal transcribed spacer (ITS) region, from microbial genomic DNA in a sample. The skilled person is well aware of methods and means for setting up such a DNA amplification reaction, such as a PCR reaction. In one preferred embodiment, a method of the invention is for detecting or identifying a bacterium or bacterial DNA in a sample. Exemplary primer sets for amplifying a 16S–23S rDNA ITS region from genomic DNA of one or more of the bacterial phyla Firmicutes, Bacteroidetes or Proteobacteria are provided as SEQ ID NOs:1-13. An exemplary primer set for universally amplifying a 16S–23S rDNA ITS region from genomic DNA of bacteria is provided as SEQ ID NOs:14-15. It is within the routine capabilities of the skilled person to design further primer sets that allow for broad-taxonomic- range amplification of microbial DNA, such as fungal or bacterial DNA. Recording the detection signal of at least two detection probes The present invention comprises a step of recording the detection signals of the at least two detection probes, such as a fluorophore labels, which are comprised in the reaction mixture. Fluorophore labels may readily be detected by recording emission spectra in distinct color channels of a PCR or qPCR instrument. The detection probe of the present invention is preferably fluorescently labeled to allow its detection following or during the performance of the nucleic acid amplification reaction in the closed reaction tube. Thereto, the fluorescent label is preferably detectable in the closed-tube and preferably by the amplification equipment, such as in a specific (color) channel of the (q)PCR instrument. For example, for recording the respective detection signals of two detection probes each having a fluorophore label as detection signal two distinct color channels of a PCR or qPCR are used. For example, for recording the respective detection signals of three detection probes each having a fluorophore label as detection signal three distinct color channels of a PCR or qPCR are used. For example, for recording the respective detection signals of four detection probes each having a fluorophore label as detectable label four distinct color channels of a PCR or qPCR are used. For example, for recording the respective detection signal of each subsequent detection probe having another fluorophore label as detection signal a subsequent distinct color channel of a PCR or qPCR is used. The number of distinct color channels of a PCR or qPCR which are required for recording detection signals is dependent on the number of different fluorophore labels used in the method of the invention. Accordingly, if for example three detection probes are used all having different fluorophore labels as detection signals, three distinct color channels are required for recording. If for example three detection probes are used wherein two detection probes have the same fluorophore label as detection signals, two distinct color channels are required for recording. The skilled person is well aware how to record distinct signals of detectable labels in distinct color channels of a (q)PCR instrument. For example, recording the respective detection signals of the at least two detection probes comprises recording the presence of one detection signal of one detection probe in one color channel and the absence of another detection signal of another detection probe in another color channel. Recording the respective detection signals of the at least two detection probes having different detectable labels may comprise recording the presence or absence of a first detection signal of a first detection probe in a first color channel and the presence or absence of a second detection signal of a second detection probe in a second color channel. The presence or absence of the detection signal of a first detection probe provides a specific indicator for the presence or absence of one or more microorganism species of the selection of microorganism species from the group of N microorganism species that comprise the target sequence of the first detection probe, while the presence or absence of the detection signal of a second detection probe provides a specific indicator for the presence or absence of one or more microorganism species of the selection of microorganism species from the group of N microorganism species that comprise the target sequence of the second detection probe. The combination of detection signals of the first and second detection probes then provides an indicator for the presence or absence of a subset from the N microorganism species as a subset-specific indicator. For example, a first subset-specific indicator may be obtained if no detection signal is recorded for either of the two detection probes. Alternatively, a second subset-specific indicator may be obtained if a detection signal is recorded for both of the two detection probes. Still further, a third subset-specific indicator may be obtained if a detection signal is recorded only for the first detection probe, and a fourth subset-specific indicator may be obtained if a detection signal is recorded only for the second detection probe. When using three different detection probes in accordance with the present invention, a total of eight subset- specific indicators may be obtained if distinct signals can be recorded for each probe. When using four different detection probes in accordance with the present invention, a total of 16 subset-specific indicators may be obtained if distinct signals can be recorded for each probe. Each of the above subset-specific indicators may comprise multiple or single species of microorganisms. hrMC measurements The present invention comprises characterization of the amplicons generated during the amplification reaction by high resolution melting curve (hrMC) analyses. Nucleic acid characterization by hrMC analysis of amplicons is a powerful technique for identifying the microorganism species from which the amplicon originates when used in combination with a database comprising known hrMC data for known species of microorganisms. By measuring the fluorescence of a saturating intercalating dye as PCR-amplified DNA fragments are heated and disassociate, sequence-defined melting curves can be generated with single- nucleotide resolution. In a method of the present invention, an hrMC profile for the PCR amplicons may be generated during the step of PCR amplification, or after the step of PCR amplification, by measuring the fluorescence of a saturating intercalating dye of amplicons present in a post-PCR sample. As used herein, a "melting profile" refers to a profile generated by hrMC analysis. One of skill in the art is well aware how hrMC is to be performed. Ample guidance can be found, for instance in Reed et al.2007 Pharmacogenomics 8(6): 597-608 and Wittwer et al.2003 Clin Chem.49:853–860. High-resolution melting curve analysis may occur using qPCR (i.e. real-time PCR) or using digital PCR. In digital PCR, each partition contains only a single sample template, which means that all amplicons for each partition originate from a single template. This homogeneity allows for easier interpretation of hrMC profiles and allows for direct comparison with other partitions. In a method of the present invention, an hrMC profile of a post- PCR sample is generated. The generated hrMC profile is compared to (predetermined) reference hrMC profiles of one or more corresponding amplicons of known (i.e., taxonomically identified) species of microbes. Preferably, said reference hrMC profiles of one or more corresponding amplicons of known species is comprised in a library or database of reference hrMC profiles. Such a library or database can, for instance, be established by (i) in vitro generating rDNA or rDNA ITS PCR amplicons of individual microorganism species, (ii) performing an hrMC analysis of said amplicons, and (iii) storing said reference hrMC profiles in a library or database of reference hrMC profiles, wherein the species identity is annotated to the hrMC profile. Thus, in some embodiments, the database comprising hrMCs of reference amplicons from reference microbial species of known taxonomic identity is obtainable by using genomic DNA of said reference microbial species and using said at least one pair of broad-taxonomic-range amplification primers to produce an amplicon by PCR and recording the high-resolution melting curve for the amplicon obtained. Alternatively, a database or library of reference hrMC profiles can be generated by in silico prediction of an hrMC profile of one or more rDNA or rDNA ITS PCR amplicons of individual strains and / or species of microbes. From a clinical perspective, if a hrMC profile of an rDNA or rDNA ITS PCR amplicon in a PCR sample indicates that a microorganism of known species identity, such as a specific bacterial species, is present in said clinical sample, the clinician can already make an important first treatment decision: start administering a therapeutic amount of an anti-microbial agent for which the microbial species is known to be sensitive. In some instances, PCR followed by hrMC analysis of the PCR product can provide a definitive answer as to the species identity of the microbe if there is a clear match with a reference hrMC profile in the database. PCR followed by hrMC analysis of the PCR product will result in a definitive identification of the microorganism species to the species level if the microorganism species present in the sample is not part of a “clash” group. This may for instance be achieved in preferred embodiments of this invention by the use of multiple dense probes as defined herein such that the combined detection signals of multiple dense detection probes allocate the microorganism species as a member of a specific subset as defined herein that comprises microorganism species with distinguishable hrMC profiles. In other cases, such as when more than one microbe is present in said sample, hrMC analysis may still provide actionable information to the clinician regarding the identity of the microbes present. However, in cases of a high level of similarity between the hrMC of the amplicons between different bacterial species, conclusive identification may not be possible, or cannot occur with sufficient certainty, and probe-base resolution of the clash is needed as described herein. The present invention is based on the realization that identification of the bacterial species may be conclusive only for a limited number of species. Hence, confirmation by an internal control reaction, that resolves the ambiguity, e.g. in the form of one or more hybridization probes, is only needed in the case that a hrMC of the amplicon is found for which it is known that it has a high level of similarity with the hrMC of the amplicon from other bacterial species. A high level of similarity between the hrMC data of 16S-23S rDNA ITS amplicons of different bacterial species can be seen in Figure 1A (Citrobacter braakii) and 1B (Citrobacter freundii). A situation where the hrMC data will not allow conclusive identification of the species is herein referred to as a “conflict”, a “clash”. A clash as defined herein is the result of ambiguous hrMC data, wherein a group of at least two microorganisms cannot be distinguished based on the high-resolution melting curve (hrMC) of their respective amplicons. An example of a “clash matrix” is provided in Figures 2 and 3. In methods of the present invention, the second taxonomic identity indicator (the taxon-specific detection probe) resolves an ambiguity in the first taxonomic identity indicator (the hrMC data). The present invention is based on the realization that the detection / identification of individual microorganism species based on the detection probes of the present invention is for example only conclusive when a subset according to the present invention consist of only one microorganism species. The detection / identification of individual microorganism species solely based on the detection probes of the present invention is not possible if a detected subset consist of at least two individual microorganism species. hrMC analysis is for example used to resolve such ambiguity provided that the individual microorganism species have distinguishable hrMCs. In order to discover (in advance) which species can potentially not be distinguished based on the hrMC analysis alone and and are therefore preferably identified by the use of (dense) detection probes, a large number of melting curves may be generated, for instance from rDNA or rDNA ITS amplicons of species of interest (either in silico, using sequences from public databases, or in vitro using samples of known species of microorganisms). Per species, multiple strains are preferably tested in order to identify the biological variation in the hrMC signature of the species. Moreover, per strain, preferably multiple melting curves are generated, either in the same run, between runs and on different instruments operated by different technicians, to estimate the impact of different sources of technical variation on resulting melting curves. Alternatively, artificial noise could be added to MCs to simulate various sources of variation. A classifier (such as in the form of a computer machine learning algorithm) is for example used to classify the various hrMCs and annotate or link them to bacterial species. Various classifiers are suitable for this purpose. With this approach, a similarity matrix can be generated that compares every hrMC to every other hrMC in the dataset. A “clash” is defined as the situation wherein the similarity of hrMCs from two different bacterial species is higher than a predefined threshold. In such instances, there is a realistic chance, given biological and technical noise that can occur, that the actual hrMC obtained from a clinical sample results in misidentification of the species. In the Examples, a simulation of the biological and technical noise that can occur when generating a hrMC from different C. braakii strains and C. freundii strains is provided. Although these species can be distinguished in most cases when run within the same experiment, strain variation and instrumental variation results in a situation where conclusive identification based on the hrMC is not sufficiently certain. Further embodiments of the invention In further embodiments the present invention provides a method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species the presence of at least one of which is to be determined in said biological sample wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species; (iii) a DNA intercalating dye for recording a high-resolution melting curve from said amplicon; (iv) at least two nucleic acid detection probes, -wherein each of said detection probes detects the amplicon of adistinct selection of at least two microorganism species from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, -wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets,- preferably wherein these subsets comprise microorganism speciesof which the amplicon is distinguishable by hrMC analysis, -wherein the total number of detection probes is smaller than M,d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon; e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, f) recording a hrMC for said amplicon generated in step d); g) comparing the high-resolution melting curve recorded in step f) with a database comprising hrMCs of reference amplicons from reference microbial species of known taxonomic identity obtainable by using genomic DNA of said reference microbial species and using said at least one pair of broad-taxonomic-range amplification primers, to thereby obtain a first taxonomic identity indicator of a microorganism present in said sample; h) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset, to thereby obtain a second taxonomic identity indicator of a microorganism present in said sample; i) identifying the microorganism present in said sample at species level based on said first taxonomic identity indicator or said first and second taxonomic identity indicators, preferably wherein steps d) through f) are carried out in a single closed reaction container, or wherein steps d) and f) are performed on separate closed reaction containers comprising the amplicon generated in step d). In another preferred embodiment of a method of the invention, the method comprises the step of recording the signal of the DNA intercalating dye and establishing the presence or absence of an amplicon based on a recorded signal of the DNA intercalating dye, and wherein the presence or absence of an amplicon establishes the presence or absence of a microorganism in said biological sample. In preferred embodiments, the detection signal of the DNA intercalating dye is different from the detection signal of the detection probes. In another preferred embodiment of a method of the invention, said variable and / or hypervariable region in a conserved microbial gene comprises at least a part of a rDNA internal transcribed spacer (ITS) region, preferably at least a part of the 16S-23S rDNA-ITS, more preferably the complete 16S-23S rDNA-ITS region. In another preferred embodiment of a method of the invention, said at least two detection probes each comprise a targeting sequence the nucleic acid sequence of which comprises at least 50%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% sequence identity to a target sequence in the amplicon or the reverse complement thereof, and wherein the targeting sequences of said at least two detection probes is identified by: a) providing a database comprising nucleic acid sequences of said amplicon predicted to be generated in step e) annotated to each microorganism species in the group of N microorganism species; b) having a computer program select target sequences for each of said at least two detection probes in said predicted amplicon sequences of the group of N microorganism species, wherein said target sequences have a length of about 15-40, preferably from about 20-30 consecutive bases, and wherein said target sequence is present in a distinct selection of at least two microorganism species from said group of N microorganism species, and wherein said target sequence is not present in any other microorganism species from said group of N microorganism species, to thereby provide nucleic acid targets for the detection probes in the amplicon. In another preferred embodiment of a method of the invention, said distinct selection of at least two microorganism species from said group of N microorganism species is comprised of microorganism species of which the high resolution melting curves (hrMC) of their respective amplicons have distinguishable profiles. In another preferred embodiment of a method of the invention, step d) and e) are performed on a PCR instrument comprising distinct color channels for detecting distinct detection signals from said at least two detection probes and wherein the detection probes in said reaction mixture generate between 2 and X-1 distinct detection signals, wherein X is the number of distinct color channels of the PCR instrument. In another preferred embodiment of a method of the invention, the detection probes comprise degenerate probes. Alternatively, two or more detection probes that have similar or identical detectable labels (e.g. that are detected in the same color channel of the PCR instrument) together target said distinct selection of microorganism species from said group of N microorganism species. In another preferred embodiment of a method of the invention, the biological sample is selected from whole blood, serum, synovial fluid, plasma, urine, and cerebrospinal fluid / liquor. In another preferred embodiment of a method of the invention, the nucleic acid amplification reaction is a polymerase chain reaction (PCR), preferably a quantitative polymerase chain reaction (qPCR). In another aspect, the present invention provides a kit of parts comprising at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a distinct selection of at least two microorganism species from a group of at least three microorganism species the presence of at least one of which group is to be determined in a biological sample, wherein said amplicon is obtainable by performing a nucleic acid amplification reaction on an aliquot of said biological sample or nucleic acids isolated therefrom using at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon comprises the 16S-23S rDNA-ITS, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of at least three microorganism species into distinct subsets wherein each microorganism species of said group of at least three microorganism species is in one and only one of these distinct subsets, and wherein the total number of detection probes is smaller than the number of distinct subsets. In another aspect, the present invention provides a kit of parts comprising: a) a set of broad-taxonomic-range amplification primers for generating a PCR amplicon from DNA of microorganisms, said set comprising each of the amplification primers of SEQ ID NOs: 1 and 3-5 from Table 10, or each of the amplification primers of SEQ ID NOs: 2-5 from Table 10, or each of the amplification primers of SEQ ID NOs: 1-5 from Table 10, or each of the amplification primers of SEQ ID NOs: 6 and 7-13 from Table 10, or a set of universal bacterial amplification primers, preferably each of the amplification primers of SEQ ID NOs: 14-15 from Table 10, and b) a DNA-intercalating dye for recording a high-resolution melting curve for said PCR amplicon, and c) at least two nucleic acid detection probes for detecting said PCR amplicon, preferably selected from probes having the sequence of SEQ ID NO. 30-33 from Table 7, preferably said at least two nucleic acid detection probes comprises four probes having the sequence of SEQ ID NO.30-33 from Table 7. In preferred embodiments of aspects of this invention, the detection probes are hydrolysis probes. The detection probes in aspects of this invention comprise a fluorophore label detectable by at least one color channels of a PCR or qPCR instrument. In preferred embodiments of aspects of this invention, the at least two detection probes comprise 3 detection probes for detecting the presence or absence of 7 distinct microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 4 detection probes for detecting the presence or absence of 15 distinct microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 5 detection probes for detecting the presence or absence of 31 distinct microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the total number of detection probes needed for detecting and classifying each microorganism species from said group of N microorganism is divided over multiple separate reaction containers, such that each reaction container comprises x-1 distinct detection probes, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals. In a preferred embodiment of a kit of part of the present invention, said kit of parts further comprises a pair of broad-taxonomic- range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from a microorganism species as defined herein. In a preferred embodiment of a kit of part of the present invention, all elements a) – c) of said kit of parts are provided a single PCR reaction well or in a single PCR-reaction tube. In another aspect, the present invention provides a system for detecting and / or identifying microorganisms, said system comprising a) a kit of parts as described above, and b) a PCR or qPCR instrument for producing a PCR amplicon, for recording a high resolution melting curve from said amplicon, and for detecting said detection probes. The present invention provides improved methods for detecting and / or identifying a high number of (pathogenic) microorganisms. Further, the present invention provides a single closed-tube amplification and detection system for detecting and / or identifying a high number of pathogenic microorganisms in a biological sample by a single nucleic acid amplification reaction. Further embodiments of the present invention include the following numbered embodiments wherein combinatorial dense probes are used for detecting and classifying a microorganism present in a biological sample as described herein: Embodiment 1. A method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species, the presence of at least one of which is to be determined in said biological sample, wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species, (iii) at least two nucleic acid detection probes, -wherein each of said detection probes detects the amplicon of asubgroup selection comprising at least two microorganism species selected from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, -wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, -wherein the total number of detection probes is smaller than M,d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon, e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, f) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset within the M subsets. Embodiment 2. The method according to embodiment 1, wherein steps d) and e) are carried out in the same single closed reaction container. Embodiment 3. The method according to embodiment 1 or 2, wherein the reaction mixture comprises a DNA intercalating dye, and step e) further comprises recording the signal of the DNA intercalating dye and establishing the presence or absence of an amplicon based on a recorded signal of the DNA intercalating dye, and wherein the presence or absence of an amplicon establishes the presence or absence of a microorganism in said biological sample, preferably wherein the signal of the DNA intercalating dye is different from the detection signal of said detection probes. Embodiment 4. The method according to any one of embodiments 1-3, wherein said conserved microbial gene is selected from a ribosomal RNA (rRNA) gene, a ribosomal protein gene, a DNA gyrase (subunit A) (GyrA) gene, a DNA gyrase (subunit B) (GyrB) gene, a RecA protein gene, an ATPase subunit gene, an RNA polymerase subunit gene, an Elongation factor thermal unstable Tu (EF-Tu) gene, an Elongation factor G (EF-G)gene, a Protein translocase subunit SecY (secY) gene, and a beta-tubulin(tubB) gene, preferably wherein the amplicon comprises a 16S-23S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region or a fragment thereof. Embodiment 5. The method according to any one of the preceding embodiments 1-4, wherein said at least two detection probes each comprise a targeting sequence the nucleic acid sequence of which comprises at least 50%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% sequence identity to a target sequence in the amplicon or the reverse complement thereof, and wherein the targeting sequences of said at least two detection probes is identified by: a) providing a database comprising nucleic acid sequences of said amplicon predicted to be generated in step e) annotated to each microorganism species in the group of N microorganism species; b) having a computer program select target sequences for each of said at least two detection probes in said predicted amplicon sequences of the group of N microorganism species, wherein said target sequences have a length of about 15-40, preferably from about 20-30 consecutive bases, and wherein said target sequence is present in a subgroup selection of at least two microorganism species selected from said group of N microorganism species, and wherein said target sequence is not present in any other microorganism species from said group of N microorganism species, to thereby provide nucleic acid targets for the detection probes in the amplicon. Embodiment 6. The method according to any one of the preceding embodiments 1-5, wherein said subset as defined by the combination of said at least two different detection signals is comprised of multiple microorganism species of which the high resolution melting curves (hrMCs) of their respective amplicons have distinguishable profiles. Embodiment 7. The method according to any one of the preceding embodiments 1-6, wherein step d) and e) are performed on a PCR instrument comprising distinct color channels for detecting distinct detection signals from said at least two detection probes and wherein the detection probes in said reaction mixture generate between 2 and X distinct detection signals, wherein X is the number of distinct color channels of the PCR instrument. Embodiment 8. The method according to any one of the preceding embodiments 1-7 , wherein the detection probes comprise degenerate probes, or wherein two or more detection probes that have similar or identical detectable labels together target said subgroup selection of microorganism species selected from said group of N microorganism species. Embodiment 9. The method according to any one of the preceding embodiments 1-8, wherein the biological sample is selected from whole blood, serum, synovial fluid, plasma, urine, and cerebrospinal fluid / liquor. Embodiment 10. The method according to any one of the preceding embodiments 1-9, wherein the nucleic acid amplification reaction is a polymerase chain reaction (PCR), preferably a quantitative polymerase chain reaction (qPCR). Embodiment 11. A kit of parts comprising at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a subgroup selection of at least two microorganism species selected from a group of at least three microorganism species the presence of at least one of which group is to be determined in a biological sample, wherein said amplicon is obtainable by performing a nucleic acid amplification reaction on an aliquot of said biological sample or nucleic acids isolated therefrom using at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon comprises the 16S-23S rDNA-ITS, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of at least three microorganism species into distinct subsets wherein each microorganism species of said group of at least three microorganism species is in one and only one of these distinct subsets, and wherein the total number of detection probes is smaller than the number of distinct subsets. Embodiment 12. Method according to any one of embodiments 1-10 or kit of part according to embodiment 11, wherein the detection probes are hydrolysis probes. Embodiment 13. Method according to any one of embodiments 1-10 or kit of part according to embodiment 11, wherein the at least two detection probes comprise 3, 4, 5, or more detection probes for detecting the presence or absence of respectively 8, 16 or 32 or 2^xdistinct microorganism species or distinct groups of microorganism species in said biological sample, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals. Embodiment 14. Method according to any one of embodiments 1-10 or kit of part according to embodiment 11, wherein the total number of detection probes needed for detecting and classifying each microorganism species from said group of N microorganism is divided over multiple separate reaction containers, preferably wherein each reaction container comprises multiple detection probes that in combination have no more than x distinct detectable labels, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals of said x distinct detectable labels. Embodiment 15. Kit of parts according to any of embodiments 11-14, wherein said kit further comprises a pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from a microorganism species. For the purpose of clarity and a concise description, features are described herein as part of the same or separate embodiments, however, it will be appreciated that the disclosure includes embodiments having combinations of all or some of the features described. The content of the documents referred to herein is incorporated by reference. The invention is illustrated in greater detail in the examples below. EXAMPLES The below Examples illustrate the method of the invention to discriminate between common species of microorganisms using different types of probes for resolving ambiguities in melting curve analysis of amplicons from broad-taxonomic-range amplification of ITS sequences from rrn operons. In the present examples, fluorescent hydrolysis probes are incorporated in accordance with a set of specific criteria. The Examples illustrate the importance of supplementing the melting curve analysis of the amplicons with probe information, to enhance the discriminatory capability of the test. Taxon-specific probes are included in the amplification reaction in the following cases: Differentiating species on a high taxonomic level (e.g. phylum), distinguishing multiple potential melting curve “clashes” at once (Example 1). Differentiation between a common skin commensal and an important pathogen within the same genus (Example 2); differentiation between pathogenic species of the same genus that require alternative clinical treatment (Example 3); Providing conformation about a rare or important pathogenic species (Example 4); Strain selection and cultivation Clinical isolates of confirmed taxonomic identity were used: Citrobacter amalonaticus, Citrobacter braakii, Citrobacter koseri / farmeri, species of the Citrobacter freundii complex, Cutibacterium acnes, Enterococcus faecalis, Enterococcus faecium, Fusobacterium nucleatum, Listeria monocytogenes, Morganella morganii, Neisseria menigitidis, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Streptococcus constellatus, Streptococcus dysgalactiae, Streptococcus mitis, Staphylococcus aureus, and Staphylococcus epidermidis. Bacterial strains were cultured at 37°C on sheep blood agar (BioMerieux), incubated for 2 days aerobically. DNA isolation A bacterial suspension of 10^8 CFU / mL (50 µl) was combined with 250 µl of Shock Buffer 1 (inBiome, Amsterdam, Netherlands) and incubated at 95°C for 10 minutes while shaking at 800 rpm. Subsequently, 25 µl of Shock Buffer 2 (inBiome) was added. One ml of NUCLISENS® EASYMAG® lysis buffer (bioMérieux) plus 1 ml of AL buffer (Qiagen) was added before extraction of DNA using the Specific A Protocol in the automated EMAG® extraction system (bioMérieux). DNA was eluted in a volume of 70 µl. All DNA was stored at 4°C. PCR A PCR amplification reaction was performed on the DNA of each of the DNA samples using a set of broad-taxonomic-range amplification primers for amplifying the 16S / 23S rDNA ITS region (forward primer: 5’ CGGTGAATACGTTCCCGGIIIIIGTACAC 3’ (SEQ ID NO:14) and reverse primer 5’ CGTCCTTCDTCGVCTBIIIIIGCCARG-3’ (SEQ ID NO:15). The inosines bind to all 4 DNA bases, ensuring broad reactivity. The PCR reaction mixture contained EvaGreen, which is an intercalating dye, that becomes fluorescent upon binding to double-stranded DNA. Additionally the PCR mix is supplemented with a number of hydrolysis probes, which were labeled with a fluorophore and an associated quencher. Amplification and hrMC analysis of the amplicon was performed in an OPUS96 (Bio-Rad) using the cycling schedule shown in Figure 4. In brief, the PCR conditions were set as pre-incubation at 95 °C for about 10 min; annealing at 66-57 °C for 30 sec to 1 min; amplification for 35 cycles at 72 °C for 30 sec to 1 min; a final 4 min extension, and melting curve from 50 °C to 97 °C for 60 s, and 95 °C for 15 s. The results were analysed using CT values. The program ends with a melting curve analysis, where all PCR amplicons are slowly heated. The temperature at which the DNA strands melt apart will depend on amplicon sequence and length. A melting curve was recorded by cooling to 35°C, and heating at a rate of 0.2°C / s until 85°C. Fluorescence was measured continuously during the slow temperature rise to monitor dissociation of the intercalating dye from the amplicon. Fluorescence signal was plotted in real time versus temperature (T) to produce melting curves. High resolution melting curves were then converted into melting peaks by plotting the negative derivative of fluorescence versus T. A first taxonomic identity indicator was obtained by comparing the hrMC obtained (i.e. the negative derivative) with a database of hrMC data annotated to known bacteria, species for the amplicon involved (proprietary database inBiome). A second taxonomic identity indicator was derived from the amplification curves in the different fluorescent channels, corresponding to the signals of the taxon-specific probes as present in the reaction mixture. Example 1. Taxon-specific probes at a higher taxonomic level. Possibility to cover multiple hrMC clashes with a single probe In Figure 5, two species with overlapping hrMCs are displayed. The upper panel shows the hrMC of the amplicon generated from Hafnia alvei (red / dark grey), a species from the phylum Proteobacteria, with the hrMC of the amplicon generated from Finegoldia magna (blue / light grey), a species from the phylum Firmicutes. Both species have very different clinical implications and indicated treatments. Figure 6 shows the overlap between the hrMC of the amplicon generated from Cutibacterium acnes (pink / light grey), a species from the phylum Actinobacteria, and the hrMC of the amplicon generated from Stenotrophomonas maltophilia (blue / dark grey), a species from the phylum Proteobacteria, resulting in two separate clashes. While C. acnes is a ubiquitous contaminant, S. maltophilia can be found as a difficult-to-treat pathogen, especially in the immunocompromised. Both these clashes could be resolved using a single Quasar 705 (705–730 nm; Channel 4) labeled taxon-specific detection probe, specific for the phylum Proteobacteria. Presence or absence of a signal from this probe lead to definitive species identification for all four species (Figures 5-6 lower panels) when combined with hrMC data. The group of microorganisms that could not be distinguished based on the hrMC of the rDNA ITS amplicon in each individual case consisted of two taxa of microorganisms, and the taxon- specific detection probe for detecting a taxon-specific sequence in the rDNA ITS amplicon in the present example comprised a taxon-specific detection probe at phylum level for detecting species belonging to the phylum Proteobacteria. Example 2. Discriminating between a closely related commensal and a pathogen Figure 7 (top panel) shows the hrMCs obtained for the amplicon generated from various Staphylococcus aureus (maroon / dark grey) and Staphylococcus epidermidis (blue / light grey) isolates. It is clear that these hrMCs are highly similar, which prevents accurate species identification based on hrMCs data alone. A species-specific Taqman® probe for Staphylococcus aureus was added to the PCR reaction mixture. This probe was labeled with a HEX label (560–580 nm; Channel 1) and an appropriate quencher. A second taxonomic identity indicator was thus obtained by determining fluorescence intensity from the Taqman® probe. Positive identification of Staphylococcus aureus as the origin of the amplification product was obtained for all Staphylococcus aureus isolates, whereas in the case of Staphylococcus epidermidis, no Taqman® probe fluorescence signal could be detected. Hence, this method allowed definitive identification within a single qPCR reaction or assay. Now that Staphylococcus epidermidis is a common skin commensal and a frequently occurring species in clinical samples, a hrMC associated with presence of this species will often be encountered. Staphylococcus aureus, on the other hand, is less common, but is clinically relevant as it is one of the most important causative organisms of sepsis, joint infections as well as skin and soft tissue infections. Therefore, the resolution of the hrMC ambiguity as described above via the addition to the reaction mixture of a taxon-specific detection probe (in this example, a species-specific detection probe for Staphylococcus aureus), provides for a very advantageous single assay that reduces additional downstream analysis of the PCR reaction product, a faster diagnosis, and reduced lab work. Example 3. Discriminating species which require distinct courses of action: Citrobacter case. In Figure 8, hrMCs of the amplicon generated from four different species of Citrobacter were obtained using the methods described above, but using clinical isolates of defined Citrobacter spp., including Citrobacter amalonaticus, Citrobacter braakii, and Citrobacter koseri / farmeri, and species of the Citrobacter freundii complex. The results of the hrMC are displayed in the upper panel of Figure 8. The Citrobacter species shown exhibit a high genetic similarity and their amplicons show highly similar hrMCs, which precludes species determination based on the hrMC data alone. Although all of these Citrobacter species are recognized as pathogenic to humans, it is vital to distinguish C. freundii from the other Citrobacter species, as it requires a different antibiotic treatment due to the presence of the ampC antibiotic resistance gene in C. freundii. The addition of a species-specific Taqman® probe for C. freundii as the taxon-specific detection probe enables correct identification of this pathogenic species. The amplification plots in Figure 8 show that the amplification of the C. freundii rDNA ITS-region is specifically detected by a Texas Red (610–650 nm; Channel 2) labeled Taqman® probe. Additionally, probe signal in channel 4 is detected for all Citrobacter species using a Proteobacteria-specific taxon-specific detection probe at phylum level, as all belong to the Proteobacteria phylum. Example 4. Establishing high confidence in identification of a rare pathogen. In this example, melting curves of Bordetella pertussis are identified. Although there is no exact overlap found with the hrMC of other microorganisms in the database used, a probe proved useful to confirm the presence of B. pertussis, because relatively similar hrMCs were found to be present in the database. B. pertussis can cause severe disease and is a notifiable pathogen. However, as B. pertussis is so rare, false positive identification based on hrMC data alone must be avoided since antibiotic treatment should start as early as possible. Such false positive hrMC data may, however, originate from species that are not included in the database, or that may be the result of a mixture of amplicons generated from two or more unrelated species present in the sample. The use of a taxon-specific detection probe for B. pertussis amplicons, may also avoid confusion with the relatively similar hrMCs of other, more prevalent bacterial species, such as Moraxella osloensis. Apart from a similar hrMC, these two species both belong to the Proteobacteria phylum, which prevents differentiation by a taxon-specific probe at phylum level as in Example 3. A taxon-specific detection probe at species level proves useful for such very rare, but highly pathogenic microorganisms, with a very low a-priori probability of occurring. By including a Cy5 (675–690 nm; Channel 3) labeled taxon- specific probe at species level for this rare pathogen, the specificity of B. pertussis detection is significantly increased, ensuring its confident identification (Figure 9). This application of a taxon-specific detection probe at species level results in faster and more accurate diagnosis, preventing false positive or false negative diagnoses and enables rapid application of required measures for dangerous pathogens. The above Examples are merely to illustrate the invention and are not intended to be limiting. The total possibilities are much broader. Also, it should be noted that multiple probes may be present, that may give cumulative sources of information. For example, a probe specific for Citrobacter freundii may give a signal in a specific channel (e.g. channel 2), while another probe, specific for the phylum Proteobacteria may additionally give a signal in a different channel (e.g. channel 4), as Citrobacter freundii is also a species from the phylum Proteobacteria (Figure 8). It should further be noted that probes with very different targets may give a signal in the same channel. For example, a probe specific for the species C. freundii may be present in the same assay and give a signal in the same channel as a probe specific for the species E. coli. The detection of a probe signal in a channel should be interpreted in the context of the measured hrMC. A probe signal in the same channel could imply E. coli, when found together with an E. coli-like hrMC, while it would imply C. freundii when found together with a C. freundii-like hrMC. Ultimately, the combined information from the hrMC and the taxon-specific detection probe signals in the different channels yields a specific ‘fingerprint’, of which the corresponding taxon can be retrieved from a database comprising hrMCs of reference amplicons generated from reference microbial species (e.g. bacterial and / or fungal species) of known taxonomic identity using the same set of broad-taxonomic-range amplification primers. Example 5. Resolving many simultaneous clashes using 2 color channels As explained in the general description herein above, microbial species identification based on hrMC data has its limitations, as melting curves may be too similar between species to discriminate them. This is called a ‘clash’ herein. The inventors have described methods and embodiments to resolve such clashes in the examples above. Theoretically, in a group of N species, there may be as much as (N-1)^2 / 2 potential clashes. If so many clashes occur, the hrMC data of the rDNA or rDNA ITS amplicon will provide very limited information, and the problem is to be solved by the use of taxon-specific detection probes entirely, as will be shown herein. Although this is not an aspect of the present invention, the inventors have realized that the probe-design based on clash-resolution as explained herein provides for very advantageous solutions that are also useful for microbial detection and / or identification without the use of hrMC data. In the present Example, a method of identifying each individual bacterial species in a group of 14 clinically relevant bacterial species with the following clashes in the hrMC for the species listed in the table below (clash between species A and species B). Notice that the first 7 clashes are actual clashes occurring for 16S-23S ITS rDNA amplicons (e.g. figure 3) and that the remainder (9 clashes, in light grey) are artificially and randomly generated to illustrate this example. Species A Species B C.acnes S.maltophilia S.dysgalactiae S.mitis N.menigitidis S.constellatus E.faecalis E.faecium F.nucleatum L.monocytogenes P.aeruginosa M.morganii S.aureus S.epidermidis F.nucleatum E.faecalis S.constellatus S.dysgalactiae M.morganii S.maltophilia M.morganii E.faecalis M.morganii S.mitis C.acnes E.faecalis S.maltophilia S.dysgalactiae S.dysgalactiae S.aureus P.aeruginosa S.aureus Table 1: List of microorganism having non-distinguishable hrMC (hrMC clashes). In order to design as few probes as possible to solve this problem, the inventors used graph theory. If a graph is created wherein all species are nodes, and the clashes are edges (lines), then the method needs to be able to discern each node (species) that is connected through an edge (clash) by these species, thus requiring that these species are detectable from one another (i.e. discernable) by distinct labels. The problem may be viewed as a graph coloring problem. Graph coloring is a very well researched topic in mathematics, wherein: ●Each graph that consists of more than one connected node needs atleast 2 colors. ●More complex graphs may need more than 2 colors.● The minimum amount of colors needed to color the graph is called thechromatic number, χ (greek chi). For the present example, the chromatic number is 3, i.e., there are no solutions to color the graph with less than 3 colors. Figure 11 shows a possible solution for our graph with 3 colors. In order to resolve the clashes by the use of probes, one way is to use three colors, to find a unique probe for each species, and assign the correct color to that probe. Given the unique probes available for these species, resolving the clash with three colors could result in the following table: Color (Background pattern in B / W Species Probe Fig.11) GTAATACAAACCGAGAACACCGCG (SEQ E.faecium ID NO.16) Yellow ( / / / / ) GGCACCAAGAGCCGATGAAGGACG C.acnes (SEQ ID NO. 17) Yellow ( / / / / ) CGTTTCGGTTTATTTTCTTGTTAC S.constellatus (SEQ ID NO. 18) Red (\\\) GTTCCCGTACGGATACCTTGTTAC F.nucleatum (SEQ ID NO. 19) Red (\\\) L.monocytogenes CTATGCTAACTTTACTAACTTTCT Green (no (SEQ ID NO. 20) background pattern) Green (no GTAGACCTCTCAAAACTGAACAAA background E.faecalis (SEQ ID NO. 21) pattern) ATAAGCTCCCACACGAATTGCTTG P.aeruginosa (SEQ ID NO. 22) Red (\\\) GCTTGCCACGGTGTGGCCGATGAC S.maltophilia (SEQ ID NO. 23) Red (\\\) CACCCAAATACTGTGTTTGTTTTC N.menigitidis (SEQ ID NO. 24) Yellow ( / / / ) CCTAGGGGACGCCAGTCTGCGCGG M.morganii (SEQ ID NO. 25) Yellow ( / / / ) AGATATACTAGTAAAAGATAAGGT S.dysgalactiae (SEQ ID NO. 26) Yellow ( / / / ) GCCAGCCTAAGGTGGGATAGATGA S.mitis (SEQ ID NO. 27) Red (\\\) Green (no TAGGAGCTAGCCGTCGAAGGTGGG background S.aureus (SEQ ID NO. 28) pattern) TCCCTCATCTTCGTAGAAGATGTT S.epidermidis (SEQ ID NO. 29) Red (\\\) Table 2: Resolving a clash using species-specific detection probes having one of three detectable labels in distinct colors (in the greyscale version of Figure 11 indicated by 3 distinct background patterns). Improvement 1: Multiplexing color channels In the previous solution, we use three color channels of the PCR, red, green and yellow. The total number of colors available in a PCR instrument is commonly at least four. This would limit the number of colors to color our graph to be four, which for some more complex situations would not be enough. However, we can multiplex colors. So, a species may be positive for multiple colors at the same time. As long as the combination is unique, we would be able to discern more “virtual colors”. As an example, using three color channels, we can create the following combined groups or subsets. Red Channel Green Channel Yellow Channel Group / subset 00 0 10 0 1 20 1 0 30 1 1 41 0 0 51 0 1 61 1 0 71 1 1 8Table 3: Exemplary detection signal combination using 3 color channels in a PCR instrument. So effectively permutations allow us to create new “colors”. The following table shows the number of “colors” available given the amount of available channels, which is 2^(# of channels). No of unique detection No Channels signals 122 43 84 16Table 4: Exemplary representation of unique detection signal (combinations) according to the number of channels. Notice however, that one of these colors is always “white” meaning that all channels are off. This may not be desirable, as “0” signal in all channels (white) may indicate the presence of a species that is not detectable with the assay, and provides an inconclusive assay result. So in the previous example, with only two detection channels, there are effectively four colors, or, if “white” is excluded, three channels, which would satisfy the resolution in the graph of Fig.11. The solution therefore could look like this (colors correspond to background patterns indicated in Table 2):Species Probe Group Color 1 Color 2GTAATACAAACCGAGAACACCG E.faecium CG (SEQ ID NO.16) 1 Red Green GGCACCAAGAGCCGATGAAGGA C.acnes CG (SEQ ID NO.17) 1 Red Green CGTTTCGGTTTATTTTCTTGTTA S.constellatus C (SEQ ID NO.18) 2 Red GTTCCCGTACGGATACCTTGTTA F.nucleatum C (SEQ ID NO.19) 2 Red CTATGCTAACTTTACTAACTTTC L.monocytogenes T (SEQ ID NO.20) 3 Green GTAGACCTCTCAAAACTGAACA E.faecalis AA (SEQ ID NO.21) 3 Green ATAAGCTCCCACACGAATTGCTT P.aeruginosa G (SEQ ID NO.22) 2 Red GCTTGCCACGGTGTGGCCGATG S.maltophilia AC (SEQ ID NO.23) 2 Red CACCCAAATACTGTGTTTGTTTT N.menigitidis C (SEQ ID NO.24) 1 Red GreenM.morganii CCTAGGGGACGCCAGTCTGCGC 1 Red Green GG (SEQ ID NO.25) AGATATACTAGTAAAAGATAAG S.dysgalactiae GT (SEQ ID NO.26) 1 Red Green GCCAGCCTAAGGTGGGATAGAT S.mitis GA (SEQ ID NO.27) 2 Red TAGGAGCTAGCCGTCGAAGGTG S.aureus GG (SEQ ID NO.28) 3 Green TCCCTCATCTTCGTAGAAGATGT S.epidermidis T (SEQ ID NO.29) 2 Red Table 5: Exemplary detection signal combination using two-color species- specific detection probes and 2 color channels So one can effectively solve the problem with only 2 color channels in the PCR and effectively creating “yellow” from a combination of red and green color channels. Improvement 2: Multispecies Probes In the previous example, probes were used that are specific to a single taxon (species, genus, phylum, etc.) of bacteria. Their specificity is based on taxonomic affiliation or relatedness of the microorganisms the amplicon of which is detected with the probe. These probes can be called “sparse”, since they can only detect the microorganism at the species level in very few cases, and the interpretation of these probes is very simple. However, when the number of clashes (species identification not possible due to indistinguishable hrMC profiles) becomes high, and each species would require a unique probe in order to resolve the species-identification, the number of probes needed to make identification at the species level becomes so high that the probes negatively impact the PCR reaction. It is proposed herein to combine the detection of different species by using, what is called herein, “dense” probes. In fact, as is shown from the previous solution, actually only 2 probes are needed. Species of Group A (combination of group 1 and 2 from table 5) (Detectable by using a detection probe having a red detection signal.) E.faecium C.acnes S.constellatus F.nucleatum P.aeruginosa S.maltophilia N.meningitidis M.morganii S.dysgalactiae S.mitis S.epidermidis Table 6A: Exemplary specificity of a group-specific detection probe for a 1stgroup of microorganism having a red detection signal. Species of Group B (combination of group 1 and 3 from table 5) (Detectable by using a detection probe having a green detection signal.) E.faecium C.acnes L.monocytogenes E.faecalis N.meningitidis M.morganii S.dysgalactiae S.aureus Table 6B: Exemplary specificity of a group-specific detection probe for a 2ndgroup of microorganism having a green detection signal. The provision of these two detection probes (based on sequence similarities in the DNA of the species involved, and to which sequence the probes can hybridize), provides the exact same solution, with the exact same coloring scheme as that of Tables 2 and 5, but only using two “dense” probes, instead of 14 species-specific, or “sparse”, probes. Notice that there is overlap in species between Tables 6A and 6B (which are detectable by probes for both the red and green channel, resulting in the color coding “yellow”). Effectively all species in group 1 (of Table 5) are detected by both probes. The above example presents an ideal situation for the detection of 14 species of microorganisms. In practice, it may not always be possible to find probes that only detect a desired group given of species. The present inventors have developed methods to find large numbers of dense probes that are useful for solving the problem of species identification when hrMC profiles are indistinguishable. A Solution for 3 colors In our example finding a minimum probe set for 3 color channels yields the following solution: Detection Probe Detection Sequence signal No.1 CCTTCCGATACGGCTACCTTGTTA (SEQ ID NO.30) Color 1 No.2 TTACCACGGWRTGMTTCATGACTGGG (SEQ ID NO.31) Color 1 No.3 GTTCGATCCCGCTAGGCTCCATTA (SEQ ID NO.32) Color 2 No.4 TTAGGAGCYAGCCGYCKAAGGTGGGA (SEQ ID NO.33) Color 3 Table 7: Exemplary group-specific detection probes defining four distinct groups of microorganisms having three different detection signals.GroupDetection probe Microorganism species No. 1 No. 1E. faecalis, E. faecium, L. monocytogenes, Staphylococcus aureus, Staphylococcus epidermidis, Stenotrophomonas maltophilia, S. constellatus, S. dysgalactiae, and S. mitis No. 2 No. 2N. meningitidis, and P. aeruginosa No. 3 No. 3Enterococcus faecium, Streptococcus constellatus and Streptococcus dysgalactiae No. 4 No. 4 Staphylococcus aureus and Streptococcusdysgalactiae Table 8: Individual microorganism targeted by the group specific detection probes. Color 1 Color 2 Color 3 SubsetCutibacterium acnes 0 0 0 1Enterococcus faecalis 1 0 0 2Enterococcus faecium 1 1 0 4Fusobacterium nucleatum 0 0 0 1Listeria monocytogenes 1 0 0 2Morganella morganii 0 0 0 1Neisseria meningitidis 1 0 0 2Pseudomonas aeruginosa 1 0 0 2Staphylococcus aureus 1 0 1 3Staphylococcus epidermidis 1 0 0 2Stenotrophomonas maltophilia 1 0 0 2Streptococcus constellatus 1 1 0 4Streptococcus dysgalactiae 1 1 1 5Streptococcus mitis 1 0 0 2Table 9: Exemplary microorganism subset identification based on a unique detection signal combination. The method used to search this solution gives a very dense configuration in color 1. Different search algorithms can be used to find suitable probe sequences. Figure 12 shows the resulting graph coloring of the clash matrix using four group-specific detection probes comprising four different sequences and three different fluorophore labels as detection signals for recording in three color channels. There are many ways to tune this method to use different channels of colors given preferences of how many probes need to be used, whether they can be taxon-specific or multispecies probes. In conclusion, the combination of hrMC with taxon-specific or multispecies dense probes as defined herein can result in the identification of bacteria to the species level for almost any selection of species with a minimal number of probes. This opens up the possibility to create almost any bacterial detection and identification assay in a single-well solution for a large number of species without the limitations of traditional multiplexing. Primers for phyla Firmicutes and Bacteroides SEQ ID Primer name Type Sequence (5'-3') No FirISf Forward CTGGATCACCTCCTTTCTAWG 1 BacISf Forward CTGGAACACCTCCTTTCTGGA 2 DUISr1 Reverse AGGCATCCACCGTGCGCCCT 3 DUISr2 Reverse AGGCATTCACCRTGCGCCCT 4 DUISr3 Reverse AGGCATCCRCCATGCGCCCT 5 Primers for phylum Proteobacteria SEQ ID Primer name Type Sequence (5'-3') No ProtISf Forward CCGCCCGTCACACCATGG 6 DPISr1 Reverse AATCTCGGTTGATTTCTTTTCCT 7 DPISr2 Reverse AATCTCGGTTGATTTCTTCTCCT 8 DPISr3 Reverse AATCTCTTTTGATTTCTTTTCCTCG 9 DPISr4 Reverse AATCTCATTTGATGTCTTTTCCTCG 10 DPISr5 Reverse AATCTCTTTTGATTTCTTTTCCTTCG 11 DPISr6 Reverse AATCTCTCTTGATTTCTTTTCCTTCG 12 DPISr7 Reverse AATCTCAATTGATTTCTTTTCCTAAGG 13 Universal bacterial primers SEQ ID Primer name Type Sequence (5'-3') No ITS1FD Forward CGGTGAATACGTTCCCGGIIIIIGTACAC 14 ITS2RD Reverse CGTCCTTCDTCGVCTBIIIIIGCCARG 15 Table 10: Exemplary primer sequences for amplification.
Claims
Claims 1. A method for detecting and identifying a microorganism in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: - an aliquot of said biological sample or nucleic acids isolated therefrom; - at least one pair of broad-taxonomic-range amplification primers for amplifying a variable or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon; - a DNA intercalating dye for recording a high-resolution melting curve from said amplicon; - at least one oligonucleotide detection probe for detecting a target sequence in said amplicon, wherein said target sequence is specific for at least one microorganism in a group of at least two microorganisms that cannot be distinguished based on the high-resolution melting curve (hrMC) of their respective amplicons obtainable by using genomic DNA of said at least two microorganisms and using said at least one pair of broad- taxonomic-range amplification primers c) performing a nucleic acid amplification reaction on the mixture of step b) to generate said amplicon; d) recording an hrMC for said amplicon generated in step c); e) recording the at least one detection signal from said at least one oligonucleotide detection probe;f) comparing the high-resolution melting curve recorded in step c) with a database comprising hrMCs of reference amplicons from reference microbial species of known taxonomic identity obtainable by using genomic DNA of said reference microbial species and using said at least one pair of broad-taxonomic-range amplification primers, to thereby obtain a first taxonomic identity indicator of a microorganism present in said sample; g) observing that the comparison in step f) places the microorganism from which said amplicon is derived in said group of at least two microorganisms that cannot be distinguished based on their hrMC as defined in step b); h) obtaining a second taxonomic identity indicator of said microorganism present in said sample based on the recorded detection signal from said at least one oligonucleotide detection probe in step e); i) identifying the microorganism present in said sample at species level based on said first taxonomic identity indicator or said first and second taxonomic identity indicators, and preferably wherein steps c) through e) are carried out in a single closed reaction container, or wherein steps d) and e) are performed on separate closed reaction containers comprising the amplicon generated in step c).
2. The method according to claim 1, the reaction mixture comprises at least one taxon-specific detection probe for detecting a taxon-specific target sequence in said amplicon, wherein said taxon-specific target sequence is specific for at least one microorganism in a group of at least two microorganisms that cannot be distinguished based on the high-resolution melting curve (hrMC) of their respective amplicons obtainable by using genomic DNA of said at least two microorganisms and using said at least one pair of broad-taxonomic-range amplification primers.
3. The method according to claim 1 or 2, wherein the reaction mixture comprises at least a first and second taxon-specific detection probe, each comprising a different detectable label for generating two different detection signals, or wherein the reaction mixture further comprises at least a first, a second, a third taxon-specific detection probe comprising both of said different detectable labels in combination.
4. The method according to any one of claims 1 – 3, wherein said reaction mixture comprises at least 4 taxon-specific detection probes that are detectable in at least 4 different PCR color channels.
5. The method according to any one of claims 1 – 4, wherein the method comprises the step of defining a group of N microorganism species the presence of at least one of which is to be determined in said biological sample wherein N is greater than two, and further wherein said reaction mixture comprises at least two nucleic acid detection probes, -wherein each of said detection probes detects the amplicon of adistinct subgroup selection of at least two microorganism species selected from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, -wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets,- preferably wherein these subsets comprise microorganism speciesof which the amplicon is distinguishable by hrMC analysis.
6. The method according to any one of claims 1 –5, wherein the detection signal of each of the at least one detection probes has a fluorescent label and wherein detection probes with the same fluorescent label are provided in said reaction mixture at different concentrations to thereby allow detection of each probe at a distinct end-point fluorescence intensity.
7. Method according to any one of the preceding claims, wherein said conserved microbial gene is selected from a ribosomal RNA (rRNA) gene, a ribosomal protein gene (e.g., RPSA, RPS2 or RPL6), a DNA gyrase (subunit A) (GyrA) gene, a DNA gyrase (subunit B) (GyrB) gene, a RecA protein gene, an ATPase subunit gene (e.g., atpB, atpD), an RNA polymerase subunit gene (e.g., rpoB, rpoC), an Elongation factor thermal unstable Tu (EF-Tu) gene, an Elongation factor G (EF-G) gene, a Protein translocase subunitSecY (secY) gene, and a beta-tubulin (tubB) gene,preferably, wherein the amplified variable or hypervariable region comprises, or is a fragment of, an rDNA ITS region, such as a 16S-23S rDNA ITS region, a 23S-5S rDNA ITS region, an 18S-5.8S rDNA ITS region, a 5.8-26S / 28S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region (including both ITS1 and ITS2 of eukaryotic microorganism species), more preferably, the amplicon comprises a 16S-23S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region, or a fragment thereof.
8. Method according to any one of the preceding claims, wherein said nucleic acid amplification reaction is a polymerase chain reaction (PCR), preferably qPCR.
9. The method according to any one of the preceding claims, wherein the biological sample is a selected from whole blood, serum, synovial fluid, plasma, urine, and cerebrospinal fluid / liquor.
10. The method according to any one of the preceding claims, wherein said microorganism is a bacterium or fungus, and said database comprises rDNA ITS sequences and corresponding taxonomic identity data of bacteria and fungi.
11. The method according to any one of the preceding claims, wherein said broad-taxonomic-range amplification primers are for amplifying a microbial rDNA ITS region of multiple, preferably essentially all, species from a microbial genus, family, order, class, phylum, kingdom and / or domain, more preferably essentially all species from a microbial phylum, still more preferably essentially all species from a microbial kingdom, most preferably bacteria or fungi.
12. The method according to any one of the preceding claims, wherein said set of broad-taxonomic-range amplification primers comprises each of the amplification primers of SEQ ID NOs: 1 and 3-5, or each of the amplification primers of SEQ ID NOs: 2-5, or each of the amplification primers of SEQ ID NOs: 1-5, optionally wherein said set of broad-taxonomic- range amplification primers comprises each of the amplification primers of SEQ ID NOs: 6 and 7-13.
13. The method according to any one of the preceding claims, wherein said set of broad-taxonomic-range amplification primers is a set of universal bacterial amplification primers, said set preferably comprising each of the amplification primers of SEQ ID NOs: 14-15.
14. The method according to any one of the preceding claims, wherein said group of microorganisms that cannot be distinguished based on the hrMC of said rDNA ITS amplicon is selected from: - the group comprising, preferably consisting of, Chlamydia trachomatis and Proteus mirabilis; - the group comprising, preferably consisting of, any two or more of Citrobacter braakii, Citrobacter freundii, Citrobacter werkmanii, Citrobacter youngae, Enterobacter asburiae, and Enterobacter cloaca; - the group comprising, preferably consisting of, Citrobacter freundii, and Citrobacter youngae; - the group comprising, preferably consisting of, any two or more of Citrobacter werkmanii, Citrobacter braakii, Citrobacter freundii, Citrobacter youngae, and Enterobacter asburiae; - the group comprising, preferably consisting of, any two or more of Citrobacter youngae, Citrobacter braakii, Citrobacter freundii, Citrobacter werkmanii; - the group comprising, preferably consisting of, any two or more of Enterobacter asburiae, Citrobacter braakii, Citrobacter werkmanii, Enterobacter cloaca, Escherichia coli, Klebsiella oxytoca, and Klebsiella pneumoniae; - the group comprising, preferably consisting of, any two or more of Enterobacter cloaca, Citrobacter braakii, Enterobacter asburiae, Escherichia coli, Klebsiella aerogenes, and Klebsiella pneumoniae; - the group comprising, preferably consisting of, Enterococcus faecalis, and Enterococcus faecium; - the group comprising, preferably consisting of, any two or more of Klebsiella aerogenes, Enterobacter asburiae, Enterobacter cloacae, Klebsiella oxytoca, and Klebsiella pneumoniae; - the group comprising, preferably consisting of, any two or all of Proteus mirabilis, Proteus penneri, and Proteus vulgaris;- the group comprising, preferably consisting of, Proteus vulgaris and Proteus mirabilis; - the group comprising, preferably consisting of, Providencia stuartii and Morganella morganii; - the group comprising, preferably consisting of, Serratia marcescens and Escherichia coli; - the group comprising, preferably consisting of, Staphylococcus aureus and Stapylococcus epidermidis; - the group comprising, preferably consisting of, Staphylococcus capitis and Staphylococcus aureus; - the group comprising, preferably consisting of, any two or more of Staphylococcus epidermidis, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli; - the group comprising, preferably consisting of, Staphylococcus saprophyticus and Staphylococcus capitis; - the group comprising, preferably consisting of, Streptococcus dysgalactiae and Streptococcus agalactiae; - the group comprising, preferably consisting of, Stenotrophomonas maltophilia and Cutibacterium acnes; - the group comprising, preferably consisting of, any two or more of Mycobacterium spp., including at least two of Mycobacterium avium, Mycobacterium bovis, Mycobacterium intracellulare, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium smegmatis, Mycobacterium tuberculosis, and Mycobacterium ulcerans; - the group comprising, preferably consisting of, any two or more of Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus candidus, Aspergillus clavatus, and Aspergillus terreus; - the group comprising, preferably consisting of, any two or more of Aspergillus nidulans, Candida albicans, Candida glabrata and Malassezia sympodialis;- the group comprising, preferably consisting of, Candida parapsilosis and Candida auris; - the group comprising, preferably consisting of, Candida tropicalis and Rhizopus arrhizus; - the group comprising, preferably consisting of, Aspergillus fumigatus and Trichophyton mentagrophyte; - the group comprising, preferably consisting of, any two or more of Aspergillus flavus, Aspergillus niger, Aspergillus candidus, Aspergillus fumigatus, Aspergillus terreus, and Trichophyton mentagrophytes.
Citation Information
Patent Citations
Nucleic acid melting analysis with saturation dyes
US20090117553A1
Amplicon melting analysis with saturation dyes
US20100041044A1
Characterization of single stranded nucleic acids by melting analysis of secondary structure using double strand-specific nucleic acid dye
US7297484B2
Nucleic acid melting analysis with saturation dyes
US7387887B2
Species identification by melting analysis of secondary structure of single stranded nucleic acids
US7524632B2