LAMP primer set, kit and application for detecting peony yellow spot pathogen

By designing LAMP primer sets and kits, and combining simplified DNA extraction and specific amplification, the time-consuming and laborious problem of early diagnosis of peony yellow spot disease has been solved, realizing rapid and low-cost pathogen detection, which is suitable for the early diagnosis of peony yellow spot disease.

CN115820898BActive Publication Date: 2026-01-30HENAN UNIV OF SCI & TECH
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210918867.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-01
Publication Date
2026-01-30
Estimated Expiration
2042-08-01

AI Technical Summary

Technical Problem

Existing technologies are time-consuming and labor-intensive for the early diagnosis of peony yellow spot disease, requiring cumbersome aseptic operations, expensive equipment, and dependence on professional technicians, making it difficult to meet the needs of early and rapid diagnosis.

Method used

A set of LAMP primers and a matching kit were designed to simplify the DNA extraction and amplification process. LAMP technology was used to rapidly detect Paeonia lactiflora under isothermal conditions, and the results were determined by combining HNB indicator and agarose gel electrophoresis.

Benefits of technology

It enables rapid, efficient, low-cost, sensitive, and specific detection of peony yellow spot disease, shortening the diagnosis time and reducing reliance on equipment and technicians.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115820898B_ABST
    Figure CN115820898B_ABST
Patent Text Reader

Abstract

This invention relates to LAMP primer sets, kits, and applications for detecting *Pseudomonas aeruginosa*, belonging to the field of molecular biology. Based on the conserved internal transcribed spacer (ITS) region of the ribosomal DNA of *Pseudomonas aeruginosa*, this invention designs in vitro DNA amplification primers. Through color reactions and electrophoretic banding after in vitro amplification, a simple and rapid method for detecting *Pseudomonas aeruginosa* is established. This method solves some technical problems existing in the early diagnosis of peony yellow spot disease based on morphological characteristics combined with molecular sequence identification. Compared with existing technologies, the LAMP detection technology for *Pseudomonas aeruginosa* established in this invention is rapid, efficient, low-cost, highly sensitive, highly specific, and convenient for product detection, providing a theoretical basis for the early diagnosis and timely control of peony yellow spot disease in production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to LAMP primer sets, kits, and applications for detecting peony yellow spot pathogens. Background Technology

[0002] (I) Current diagnostic techniques for peony yellow spot disease

[0003] 2.1 Yellow spot disease has become one of the restrictive factors for the development of the peony industry.

[0004] Peonies are highly valued not only for their large, fragrant, and vibrant flowers, but also for their medicinal and edible qualities. Their roots contain paeonol, an antibacterial and anti-inflammatory substance, and their seeds contain over 42% α-linolenic acid, over 92% unsaturated fatty acids, and dozens of other nutrients. Developing the peony seed oil industry is crucial for addressing my country's excessive reliance on imported edible oils, ensuring edible oil security, and protecting public health. Peonies are drought-tolerant and thrive in poor soil, making them suitable for afforestation and understory planting. Intercropping them with woody oil crops like *Xanthoceras sorbifolium* in my country yields significant economic benefits and will play an increasingly important role in the industry.

[0005] With the extension of continuous cropping periods, harmful organisms pose an increasingly serious threat to peony cultivation. Among them, peony leaf diseases pose the most severe threat to peony production. One such disease is leaf spot fungus (…). Phyllosticta commonsii Yellow spot disease caused by [unspecified pathogen] is one of the most common leaf diseases of peonies. Initially, the lesions are round or nearly round, yellowish-brown or yellowish-white, slightly sunken, and 3-5 mm in size. Later, the lesions gradually merge into patches, turning yellow to brown without forming perforations. Small black dots, the conidiophores of the pathogen, appear scattered on the lesions when the air is humid. *Aureobasidium aureum* overwinters mainly as mycelium or conidiophores on diseased tissues and fallen leaves. Conidia are produced the following spring and can be spread by wind and rain. The lower leaves of peonies are affected first, and damp, rainy environments exacerbate the occurrence of yellow spot disease and reinfection by the pathogen. The early symptoms of yellow spot disease are difficult to distinguish from other leaf diseases such as leaf mold, black spot, and gray mold, often only becoming clear in the middle and later stages of the disease. This results in delayed control measures in peony plantations, where the control effect is already minimal in the later stages of the disease. Because pathogens have varying sensitivities to pesticides, spraying pesticides to control peony yellow spot disease in the late stages of the disease not only increases production costs, wastes pesticides, and pollutes the environment, but also fails to effectively control the disease. Therefore, early diagnosis of the pathogens causing peony yellow spot disease is crucial for timely control.

[0006] 2.2 Traditional techniques for early diagnosis of macular degeneration

[0007] Because the typical symptoms of Phoma leaf spot on peony leaves cannot be formed at the early stage of the disease, and the disease symptoms are difficult to distinguish from other leaf diseases at this time, the diagnosis of yellow spot disease at this time cannot use the methods of scraping, picking or hand slicing, but only use the methods of pathogen isolation, pure culture and then making slides for microscopic examination, and if necessary, combined with gene sequence analysis.

[0008] The traditional tissue isolation method of Phoma leaf spot is as follows:

[0009] 1. Preparation of materials: Prepare potato sucrose agar medium (PSA) in the laboratory, prepare sterilized culture dishes, sterile water and other materials, and the required equipment includes: essential items such as sterilization pot, clean bench, incubator, microscope, pick needle, etc.; selected items such as PCR instrument, gel electrophoresis system, pipette, PCR tube, centrifuge tube, Taq DNA polymerase, dNTP mixture, liquid nitrogen, etc. (if the pathogen does not produce spores, molecular identification is required);

[0010] 2. Pathogen isolation: pick a single diseased lesion, cut a 4-5 mm tissue block from the diseased-healthy boundary, disinfect with 75% alcohol for about 20 s, then disinfect with 3% NaClO solution for 3 min, and finally rinse with sterile water for 3 times, dry with filter paper, and then transfer to PSA medium containing lactic acid, 4-5 pieces per dish, 26°C inverted culture for 5 days, when the small pieces of diseased tissue grow concentric rings of fungal colonies without mixed bacteria, use an inoculation needle to pick a small piece from the edge of the colony to the slant medium, and culture for 3-4 days to obtain pure culture, which can be stored in the refrigerator. Observe the colony morphology to see if it is consistent with the colony morphology of Phoma leaf spot;

[0011] 3. Morphological identification: pick a little culture from the colony and place it under the microscope, observe under low power, and then transfer to high power to see if there are typical structures such as spores and conidia of Phoma leaf spot;

[0012] 4. If no spores are observed under the microscope, the genomic DNA of the pathogen needs to be extracted by CTAB method, the rDNA-ITS sequence of the pathogen is amplified according to the universal primer, and the sequence is sent to a biological company for sequencing after amplification; compare the sequence on the genome database to see if it is Phoma leaf spot.

[0013] The flow chart of early diagnosis of yellow spot disease is shown in Figure 1 .

[0014] Later, in order to simplify the isolation of the pathogen, the research group screened a selective medium for isolating Phoma exigua var. foveata based on the different sensitivities of P. exigua var. foveata and other common contaminating bacteria to fungicides such as carbendazim, fosetyl-aluminum, and mancozeb added to the basic medium (PSA). Although the operation steps of pathogen isolation were simplified, the subsequent pathogen identification could not be changed. (Reference: Xu J, Qin Y, Zhang X, Liu Z, Li P, Xia Y, Zheng W, Hou Y. A selective medium for rapid isolation of the pathogen of Phoma exigua var. foveata on peony. Journal of Pesticide Science, 2020, 22(3): 550-555.).

[0015] (II) Technical background of the present application

[0016] Loop-mediated isothermal amplification (LAMP) technology was invented and first reported by Japanese scientists Notomi et al. It can amplify nucleic acid fragments in a short time (usually <1 h) under isothermal (60-65 ℃) conditions using strand displacement Bst DNA polymerase and specific primers. This technology has the characteristics of rapid and efficient, low cost, high sensitivity, strong specificity, and convenient product detection, etc., so it has attracted widespread attention from researchers around the world. It has been widely used in clinical diagnosis, food safety, animal disease detection, plant pathogen detection, and environmental monitoring fields, and has a wide development and application prospect. In the detection of plant pathogens, it can be used to detect plant pathogenic fungi, bacteria, viruses, and nematodes, etc. The detection of LAMP products can be judged by observing the color change by adding DNA intercalating dye SYBR green I or metal ion indicator hydroxynaphthol blue (HNB) and calcium green to the reaction system; or the products can be subjected to 2.0% agarose gel electrophoresis to see if a typical ladder band is formed. However, DNA intercalating dye SYBR green I is added after the reaction is completed, which increases the opportunity for product contamination and causes false positives. In order to avoid such pollution, HNB dyeing agent can be added to the reaction system before amplification. After the LAMP reaction is completed, the positive product of the reaction solution is sky blue, while the negative product remains purple. The color change is verified again by 2.0% agarose gel electrophoresis (i.e. when using 2.0% agarose gel electrophoresis, positive amplification forms a typical ladder band, but negative products do not form).

[0017] (III) Importance of early diagnosis of plant diseases in comprehensive prevention and control of plant diseases

[0018] The basic principle of plant protection in China is "prevention first, comprehensive prevention and control". For the prevention and control of plant diseases, early detection and early treatment are much more effective than post-spraying. This requires a method for early diagnosis of a certain plant disease in production. However, the current plant disease diagnosis is often based on the symptoms formed by the pathogen at the site of disease, and the judgment is made after microscopic examination and molecular sequence comparison, which takes a long time. For the epidemic disease caused by pathogenic organisms, it takes a very short time from the early lesion to the widespread epidemic. Therefore, the current plant disease diagnosis method cannot meet the requirement of early diagnosis.

[0019] At the early stage of disease occurrence, the lesions are similar, and it is difficult to distinguish them simply from the disease symptoms. At the early stage of peony yellow spot disease, round spots are formed on the leaves, and the same is true for leaf mold disease, anthracnose disease, gray mold disease, and black spot disease. Therefore, it is difficult to judge at the early stage. Due to the different sensitivities of different pathogens to pesticides, early diagnosis of diseases is also helpful for guiding the selection of pesticides in production. Only by achieving rapid and correct early diagnosis of diseases can appropriate pesticides be selected according to the different types of pathogens, so as to achieve early detection, early diagnosis, and early prevention and control.

[0020] The defects and reasons of the existing technology for diagnosing peony yellow spot disease are analyzed.

[0021] (1) Existing technology for diagnosing peony yellow spot disease

[0022] The existing diagnosis technology for peony yellow spot disease requires symptom observation, tissue separation, purification culture of suspected diseased leaves in the field, and then morphological identification by consulting relevant information. The spore production structure and conidium morphology of the pathogen need to be observed. At the early stage of disease, the pathogen has not yet formed symptoms at the site of disease, and if early diagnosis of yellow spot disease is to be made, the pathogen needs to be extracted for genomic DNA, specific sequence amplification, sequencing, and sequence alignment, so as to determine the attribution of the pathogen. The traditional plant disease diagnosis method combining tissue separation with morphological characteristics and gene sequence can achieve early diagnosis of peony yellow spot disease, but has the following shortcomings.

[0023] 1. Long time required - time-consuming: Generally, it takes about 15 minutes to handle each diseased leaf before the separation material can be cultured; after 1 week of culture, the diseased tissue can form a colony of the pathogen; if the colony does not produce spores, the pathogen needs to be extracted for DNA, PCR amplification, gel electrophoresis, sequencing, and sequence alignment, which takes about 20 days. The whole process takes about 7-30 days; and for epidemic diseases such as yellow spot disease, if early diagnosis cannot be made and early prevention and control cannot be carried out, the disease will spread in the later stage, and it will be very difficult to control.

[0024] 2 Complicated operation - laborious: traditional diagnosis based on the morphological characteristics of the pathogen, not only requires the separation of the pathogen, but also requires the observation and identification of the morphological characteristics of the pathogen, more steps, complicated operation, laborious. Because in the process of tissue separation, it takes four steps to handle a diseased leaf, including leaf segmentation, cutting, multiple disinfection, water washing and filter paper drying. The sample treatment is more troublesome. When observing the culture of the pathogen under a microscope, it is often difficult to observe the typical sporulation structure and spore morphology of the pathogen, resulting in a judgment that cannot be made. If no spores are produced, subsequent molecular identification requires extraction of pathogen DNA, PCR expansion and gel electrophoresis analysis, which is relatively time-consuming.

[0025] 3 Strict aseptic operation requirement: tissue separation method requires that the test material be brought back to the laboratory for separation on a clean bench. For field investigation, it is impossible to do so. For non-local field investigation, it is necessary to process the test material in time because fresh diseased tissue samples have a high separation success rate. Obviously, the tissue separation method cannot meet this requirement.

[0026] 4 More reagents and consumables are needed: more culture dishes, alcohol and NaClO reagents are needed for disinfection, cleaning and pathogen culture; glass slides, cover glasses, and pick needles are needed for pathogen microscopy; centrifuge tubes are needed for molecular identification. More reagents and consumables are needed for operation.

[0027] 5 More instruments and equipment are needed: sterilization pot, clean bench, biochemical incubator, microwave oven, electromagnetic oven, etc. are needed for pathogen tissue separation and culture; microscope is needed for morphological observation of the pathogen; more expensive PCR instrument, gel electrophoresis and imaging equipment are needed for molecular identification. All the equipment costs a lot.

[0028] 6 Higher requirements for detection personnel, professional detection personnel are needed. Tissue separation method requires operators to have aseptic operation skills, otherwise it is easy to be contaminated by other bacteria; in addition, the disinfection time is also very important, it cannot be too long or too short, otherwise the mycelium of the pathogen will be killed or the disinfection will not be thorough. Even if the selective medium developed by the research group is used for pathogen separation, subsequent pathogen microscopy requires not only aseptic operation, but also certain knowledge of microbiology. Molecular identification requires higher requirements for operators and certain molecular biology operation skills. The above requires professional technical personnel with certain plant pathology and molecular biology skills to complete.

[0029] Due to the traditional method of tissue separation combined with morphological observation and molecular sequence alignment diagnosis method, there are time-consuming, laborious, strict aseptic operation requirements, more reagents and consumables required, expensive equipment needed, and also need special technical personnel, which brings the problems of low diagnosis efficiency, easy to be affected by human factors and difficult to popularize in production, etc. It cannot meet the requirements of early diagnosis of diseases, and it is necessary to develop a simple and rapid early diagnosis technology for peony yellow spot disease.

[0030] (II) Analysis of the reasons for the shortcomings of the prior art

[0031] The early diagnosis technology of peony yellow spot disease combined with pathogenic tissue separation, morphological identification and sequence analysis has the following shortcomings: peony is a small crop and has not attracted enough attention from researchers. For a long time, although the ornamental and medicinal value of peony is well known, in recent years, the edible value of peony has begun to enter the field of vision of the people, but it cannot be denied that compared with food crops such as wheat, corn and rice, and fruits and vegetables such as tomato, cucumber, apple and pear, due to its low economic value (compared with food crops and fruits and vegetables) and small planting area, it has not attracted enough attention from researchers. As for the diseases and pests of peony, it is even in the "cold palace in the cold palace", and the number of researchers is very small. The diagnosis, prevention and control of peony diseases are all based on the methods of other crop diseases, and few new methods and technologies are applied. Unlike wheat scab, tomato gray mold, and sclerotinia blight of rapeseed, which are widespread, serious and harmful to social and economic life, new technologies are widely used in disease research and have achieved a series of results, which in turn promotes the depth of disease research. SUMMARY

[0032] The traditional method of plant disease diagnosis is to identify the morphology of the structure of the pathogen, especially the spore morphology. The operation requires disease signs such as spores or mycelium structures on the diseased part, and then the disease signs are picked or scraped for microscopic examination. If there are no spore-forming structures of the pathogen on the diseased part, the pathogen needs to be isolated, and the mycelium and spores in the colony need to be identified to confirm the pathogen, so as to infer what disease the plant has. The plant disease diagnosis based on the spore morphology of the pathogen requires more reagents and consumables, and has the problems of time-consuming and complicated operation. More importantly, some pathogens do not form disease signs on the diseased part and on the culture medium, even if pure culture is obtained, further molecular amplification and sequencing are needed to determine the type of pathogen. In view of this, the present application is based on the peony yellow spot disease (pathogen: Phoma pini Phyllosticta commonsiiConserved region on ribosome DNA-internal transcribed spacer (ITS) design DNA in vitro amplification primer, through color reaction and electrophoresis band after in vitro amplification, a simple and rapid detection method of Phoma exigua var. variabilis is established, and the detection system is applied to early diagnosis of Phoma exigua var. variabilis in Luoyang peony garden.

[0033] The present application solves some technical problems in early diagnosis of peony yellow spot disease, such as time-consuming, complicated operation, low detection efficiency, high cost of detection, strict aseptic operation requirement, and the need for special technical personnel.

[0034] The specific scheme adopted by the present application is as follows:

[0035] The first aspect of the present application provides a LAMP primer set for detecting Phoma exigua var. variabilis, wherein the LAMP primer set comprises outer primers 2-F3 and 2-B3 and inner primers 2-FIP and 2-BIP; and the nucleotide sequences of the outer primers and the inner primers are respectively as follows:

[0036] 2-F3: GCCTGTTCGAGCGTCATT;

[0037] 2-B3: AGTTCAGCGGGTATCCCT;

[0038] 2-FIP: CGCCGGCTGCCAATTGTTTTGTGGTGTTGGGTGTTTGTCTC;

[0039] 2-BIP: GCGCAGTACATCTCGCGCTTCCTGATCCGAGGTCAAGAGT.

[0040] The second aspect of the present application provides a kit for detecting Phoma exigua var. variabilis, wherein the kit comprises the above-mentioned LAMP primer set.

[0041] The third aspect of the present application provides application of the above-mentioned LAMP primer set or kit in early diagnosis of peony yellow spot disease.

[0042] The fourth aspect of the present application provides a method for detecting Phoma exigua var. variabilis, comprising the following steps:

[0043] Step one, extracting total DNA of a sample to be tested;

[0044] Step two, using the DNA obtained in step one as a template, and performing amplification reaction by using the above-mentioned LAMP primer set;

[0045] Step three, according to the amplification reaction result of step two, determine whether it contains P. peucedanium.

[0046] As a further optimization of the above method, in step one, a simple method is used to extract total DNA of the sample to be tested, which comprises the following steps: collecting suspected P. peucedanium diseased leaves as the sample to be tested, cutting 30-50 lesions in a centrifuge tube, adding 200 μL of ddH2O, placing in a water bath at 65℃ for 5-10 min, centrifuging to take the supernatant as the template DNA. Further, preferably 40 lesions.

[0047] As a further optimization of the above method, in step two, the final concentration of each reagent in the reaction system is as follows: Bst 3.0 DNA polymerase 0.32 U / μL, 10×ThermoPol Buffer 2.5 μL, dNTP 1.0 mmol / L, Mg 2+ 6mmol / L, 2-F3 and 2-B3 each 0.2 μmol / L, 2-FIP and 2-BIP each 1.6 μmmol / L, HNB 0.15 mmol / L, betaine 1 mol / L, template DNA 1 μL, add ddH2O to 25 μL.

[0048] As a further optimization of the above method, in step three, the method for determining whether it contains P. peucedanium according to the amplification reaction result of step two is as follows: the LAMP amplification product is detected by HNB visualization and 2.0% agarose gel electrophoresis, if the LAMP product changes from purple to sky blue, and typical ladder-shaped bands are produced in the electrophoretogram, then the sample is positive, otherwise it is negative.

[0049] The LAMP detection technology of P. peucedanium established by the present application has the characteristics of rapid and efficient, low cost, high sensitivity, strong specificity, and convenient product detection compared with the prior art:

[0050] 1. Rapid and efficient: LAMP detection uses chain displacement Bst DNA polymerase and specific primers to amplify nucleic acid fragments in a short time (usually <1 h) under isothermal (60-65 ℃) conditions, greatly shortening the reaction time;

[0051] 2. Low cost: LAMP detection does not require expensive instruments, only a conventional constant temperature water bath that can provide 65℃ is needed;

[0052] 3. High sensitivity: the sensitivity of LAMP detection is 100 times that of ordinary PCR;

[0053] 4. Strong specificity: the LAMP detection technology for the establishment of the invention of P. peucedanium can only make P. peucedanium DNA produce positive amplification reaction, and other test strains have no such phenomenon;

[0054] 5. Convenient product detection: LAMP product detection can be observed by adding DNA intercalating dye SYBR green I or metal ion indicator hydroxynaphthol blue (HNB) and calcium chlorin in the reaction system; or the product is subjected to 2.0% agarose gel electrophoresis to see if a typical ladder band is formed to judge. No complicated separation, microscopy and molecular detection are needed. BRIEF DESCRIPTION OF DRAWINGS

[0055] Figure 1 Early diagnosis flowchart of P. peucedanium.

[0056] Figure 2 LAMP primer specificity detection result chart; A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; M: DL2000 DNA Marker; 1-3: amplification results of primer groups 1, 2 and 3, respectively; 4: negative control (ddH2O).

[0057] Figure 3 Bst 3.0 DNA polymerase concentration optimization result chart; A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; M: DL2000 DNA Marker; 1-5: Bst 3.0 DNA polymerase concentrations are 0.08, 0.16, 0.24, 0.32 and 0.40 U / μL, respectively; 6: ddH2O.

[0058] Figure 4 HNB concentration optimization result chart; A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; M: DL2000 DNA Marker; 1-5: 0.05, 0.1, 0.15, 0.2 and 0.25 mmol / L, respectively; 6: ddH2O.

[0059] Figure 5 dNTP concentration optimization result chart; A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; M: DL2000 DNA Marker; 1-5: 0.6, 0.8, 1.0, 1.2 and 1.4 mmol / L, respectively; 6: ddH2O.

[0060] Figure 6 Mg 2+Optimization results of betaine concentration; Wherein, A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; In the figure, M: DL2000 DNA Marker; 1-5: 4, 6, 8, 10 and 12 mmol / L, respectively; 6: ddH2O.

[0061] Figure 7 Optimization results of betaine concentration; Wherein, A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; In the figure, M: DL2000 DNA Marker; 1-5: 4, 6, 8, 10 and 12 mmol / L, respectively; 6: ddH2O.

[0062] Figure 8 LAMP specific detection results chart; Wherein, A: HNB visualization chart; B: 2.0% agarose gel electrophoresis chart; In the figure, M: DL2000 DNA Marker; 1-6: DNA of Pseudomonas cirsii, Phyllosticta clematidis, Alternaria clematidis, Cytospora leaf spot, Botrytis cinerea and anthracnose, respectively; 7: ddH2O.

[0063] Figure 9 LAMP sensitivity detection results chart; Wherein, A: HNB visualization chart of LAMP sensitivity detection; B: 2.0% agarose gel electrophoresis chart of LAMP sensitivity detection; C: 1.0% agarose gel electrophoresis chart of ordinary PCR sensitivity detection; In the figure, M: DL2000 DNA Marker; 1-8: amplification results of DNA template concentrations of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL and 10 fg / μL, respectively; 9: ddH2O.

[0064] Figure 10 LAMP detection results chart of DNA extracted by simple method; In the figure, M: DL2000 DNA Marker; 1-6: DNA of Pseudomonas cirsii, Phyllosticta clematidis, Alternaria clematidis, Cytospora leaf spot, Botrytis cinerea and anthracnose, respectively; 7: ddH2O.

[0065] Figure 11 LAMP detection results chart of suspected Pseudomonas cirsii leaves in the field; Wherein, A: a is suspected Pseudomonas cirsii leaves in the field, b is the front of the isolated colony, c is the back of the colony; d is the conidium morphology chart; B: HNB visualization chart; C: 2.0% agarose gel electrophoresis chart; In the figure, M: DL2000 DNA Marker; 1-3: genomic DNA; 4-6: DNA of leaves in the field; 7-9: healthy leaf control; 10: ddH2O.

[0066] Figure 12 The optimization result figure of the number of peony yellow spot disease spots; wherein, A: HNB visualization figure; B: 2.0% agarose gel electrophoresis figure; in the figure, M: DL2000 DNA Marker; 1-6: 1, 10, 20, 30, 40 and 50 respectively; 7: genomic DNA; 8: ddH2O.

[0067] Figure 13 The practicality detection result figure of LAMP of Luoyang National Peony Garden; wherein, A: HNB visualization figure; B: 2.0% agarose gel electrophoresis figure; in the figure, M: DL2000 DNA Marker; 1-5: field disease spot DNA; 6: genomic DNA; 7: ddH2O.

[0068] Figure 14 The practicality detection result figure of LAMP of Luoyang National Peony Garden; wherein, A: HNB visualization figure; B: 2.0% agarose gel electrophoresis figure; in the figure, M: DL2000 DNA Marker; 1-5: field disease spot DNA; 6: genomic DNA; 7: ddH2O.

[0069] Figure 15 The practicality detection result figure of LAMP of Luoyang International Peony Garden; wherein, A: HNB visualization figure; B: 2.0% agarose gel electrophoresis figure; in the figure, M: DL2000 DNA Marker; 1-5: field disease spot DNA; 6: genomic DNA; 7: ddH2O.

[0070] Figure 16 The practicality detection result figure of LAMP of Luoyang International Peony Garden; wherein, A: HNB visualization figure; B: 2.0% agarose gel electrophoresis figure; in the figure, M: DL2000 DNA Marker; 1-5: field disease spot DNA; 6: genomic DNA; 7: ddH2O.

[0071] Figure 17 The early diagnosis flow chart of LAMP for peony yellow spot disease. DETAILED DESCRIPTION

[0072] Conventional methods for detecting plant pathogens cannot identify them quickly, accurately, and promptly. Therefore, this study established a rapid detection method for *Pseudomonas aeruginosa* based on loop-mediated isothermal amplification (LAMP) technology. First, three sets of LAMP primers were designed targeting specific fragments of the *Pseudomonas aeruginosa* ITS sequence. The optimal specific LAMP primers were then selected, and the LAMP reaction system was optimized and established for specificity and sensitivity testing. Second, a simplified method for extracting pathogen DNA from diseased tissues was explored. Finally, the effectiveness of this technology in field applications was evaluated. This is the first application of LAMP technology in the detection of *Pseudomonas aeruginosa*.

[0073] Activation and culture of strains

[0074] Three strains of each pathogen were randomly selected from the laboratory-isolated and preserved strains for activation. Mycelia were picked and inoculated into the center of a PSA plate, which was then incubated upside down in a 25 °C incubator. Once the colonies had covered the plate, total genomic DNA could be extracted.

[0075] The bacterial strains used in this experiment, namely *Xanthomonas aurea*, *Leuciscus spp.*, *Xanthomonas aurea*, *Coelomyces spp.*, *Gray mold*, and *Anthracnose spp.*, have all been publicly disclosed, as detailed in Table 1. All strains were preserved in paraffin oil by our research group. Before use, the strains were washed three times with sterile water, blotted dry with sterile filter paper, and activated on PSA plates.

[0076] Table 1 Public information on the strains involved in this invention

[0077]

[0078] 2. Extraction of genomic DNA

[0079] In this experiment, total genomic DNA of the test strain was extracted using the CTAB method. The precipitate was then dissolved in an appropriate amount of TE buffer solution (Tris-EDTA buffer solution). The DNA concentration was adjusted to 100 ng / μL using a UV spectrophotometer and stored in a refrigerator at -20 ℃ for later use.

[0080] ITS sequencing of peony yellow spot pathogen

[0081] Since no *Pseudomonas spp.* was found in GeneBank ( P. commonsii The gene sequence of *Pseudomonas aeruginosa* was determined. Therefore, this study used universal primers ITS1 and ITS4 to perform conventional PCR amplification on the extracted DNA of *Pseudomonas aeruginosa*. After confirming the product by 1.0% agarose gel electrophoresis, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0082] LAMP primer design

[0083] The ITS sequence of P. peonyis compared with the ITS sequences of other five common pathogenic fungi on peony leaves (Mycosphaerella, Cercospora peonyis, Cytospora peonyis, Botrytis cinerea and Colletotrichum gloeosporioides) to find specific fragments of P. peonyis; the LAMP primers are designed by using the specific fragments of P. peonyis as targets and by using the online software Primer explorer V5. According to the primer design principle, three sets of primers are selected from the recommended primers. Each set of primers contains outer primers F3 and B3, inner primers FIP and BIP, and the LAMP primer information is shown in Table 2.

[0084] Table 2 Primer information of LAMP reaction of the application

[0085]

[0086] 5. Specificity detection of LAMP primers

[0087] The total volume of the LAMP reaction system is 25 μL, and the concentration and initial amount of each reaction solution are as follows: Bst 3.0 DNA polymerase (8 U / μL) 1 μL; 10×ThermoPol Buffer 2.5 μL; dNTP (10 mmol / L) 3.5 μL; Mg 2+ (100 mmol / L) 1.5 μL; betaine (5 mol / L) 5 μL; HNB (2.5 mmol / L) 2 μL; F3 and B3 (10 μmol / L) are both 0.5 μL; FIP and BIP (40 μmol / L) are both 1 μL; template DNA (100 ng / μL) 1 μL; and ddH2O is added to 25 μL. The reaction condition is 65 ℃ water bath for 60 min.

[0088] In the reaction system of the experiment, HNB is added as an indicator, and the reaction system is purple before water bath; after 65 ℃ water bath for 60 min, if the DNA sequence of P. peonyis is amplified, the LAMP product changes from purple to sky blue; then the amplification result is tested by 2.0% agarose gel electrophoresis, if a typical ladder band is produced in the electrophoretogram, it indicates that positive amplification occurs, the detection sample is positive, otherwise it is negative. The experiment is repeated for three times. The specificity of the three sets of designed primers is verified, and the most specific primer is selected from them for subsequent experiments.

[0089] The three sets of designed LAMP primers and the initial reaction system are used to perform LAMP with the genomic DNA of P. peonyis as a template, and the amplification result is visualized by HNB and tested by 2.0% agarose gel electrophoresis. Figure 2As shown, 3 sets of LAMP primers can specifically amplify the genomic DNA of P. pini, and the color is sky blue, and the electrophoretogram has ladder-like bands. Therefore, the 3 sets of LAMP primers designed in this study can specifically detect P. pini. The optimal specific primer 2 was used in the subsequent experiments.

[0090] Optimization and establishment of LAMP reaction system

[0091] According to the above initial reaction system, the optimal specific primer was used, and the concentrations of Bst 3.0 DNA polymerase, HNB, dNTP, Mg 2+ and betaine in the LAMP reaction system were optimized respectively to establish the most suitable reaction system for subsequent experiments. The test was repeated 3 times.

[0092] ①Optimization of Bst 3.0 DNA polymerase concentration

[0093] The final concentration of Bst 3.0 DNA polymerase in the LAMP reaction system was set as 0.08, 0.16, 0.24, 0.32 and 0.40 U / μL, and ddH2O was used to replace the template DNA as negative control, and the most suitable Bst 3.0 DNA polymerase concentration was screened.

[0094] From Figure 3 A, it can be seen that the color of the reaction solution is sky blue at 5 concentration gradients of 0.08 to 0.4 U / μL of the final concentration of Bst 3.0 DNA polymerase; from Figure 3 B, it can be seen that the electrophoretogram has typical ladder-like bands, and the ladder-like bands are the most significant when the final concentration is 0.32 U / μL. Therefore, the most suitable final concentration of Bst 3.0 DNA polymerase in the LAMP reaction system is 0.32 U / μL.

[0095] ②Optimization of HNB concentration

[0096] The final concentration of HNB in the LAMP reaction system was set as 0.05, 0.1, 0.15, 0.2 and 0.25 mmol / L, and ddH2O was used to replace the template DNA as negative control, and the most suitable HNB concentration was screened.

[0097] From Figure 4 A, it can be seen that the color of the reaction solution is sky blue at 5 concentration gradients of 0.05 to 0.25 mmol / L of the final concentration of HNB, and the color gradually deepens; from Figure 4 B, it can be seen that the electrophoretogram has typical ladder-like bands, and the ladder-like bands are the most significant when the final concentration is 0.15 mmol / L. Therefore, the most suitable final concentration of HNB in the LAMP reaction system is 0.15 mmol / L.

[0098] ③Optimization of dNTP concentration

[0099] The final concentration of dNTP in the LAMP reaction system was set at 0.6, 0.8, 1.0, 1.2 and 1.4 mmol / L, respectively, and ddH2O was used to replace the template DNA as a negative control, from which the optimal dNTP concentration was screened.

[0100] It can be seen from Figure 5 A that the color of the reaction solution changed to sky blue at the five concentration gradients of the final concentration of dNTP at 0.6-1.4 mmol / L; and Figure 5 B that typical ladder-shaped bands were produced in the electrophoretogram, and the ladder-shaped bands were the most significant when the final concentration of dNTP was 1.0 mmol / L. Therefore, the optimal final concentration of dNTP in the LAMP reaction system was 1 mmol / L.

[0101] ④Optimization of Mg 2+ concentration

[0102] The final concentration of Mg 2+ in the LAMP reaction system was set at 4, 6, 8, 10 and 12 mmol / L, respectively, and ddH2O was used to replace the template DNA as a negative control, from which the optimal Mg 2+ concentration was screened.

[0103] It can be seen from Figure 6 A that the color of the reaction solution changed to sky blue at the three concentration gradients of the final concentration of Mg 2+ at 4-8 mmol / L, and the color gradually deepened; and Figure 6 B that typical ladder-shaped bands were produced in the electrophoretogram at the three concentration gradients, and the ladder-shaped bands were the most significant when the final concentration of Mg 2+ was 8 mmol / L. Therefore, the optimal final concentration of Mg 2+ in the LAMP reaction system was 8 mmol / L.

[0104] ⑤Optimization of betaine concentration

[0105] The final concentration of betaine in the LAMP reaction system was set at 0.4, 0.6, 0.8, 1.0 and 1.2 mol / L, respectively, and ddH2O was used to replace the template DNA as a negative control, from which the optimal betaine concentration was screened.

[0106] It can be seen from Figure 7 A that the color of the reaction solution changed to sky blue at the five concentration gradients of the final concentration of betaine at 0.4-1.2 mol / L; and Figure 7As shown in B, all five concentration gradients in the electrophoresis diagram produce typical trapezoidal bands, with the most prominent bands observed at a final concentration of 1 mol / L. Therefore, the optimal final concentration of betaine in the LAMP reaction system is 1 mol / L.

[0107] ⑥ Establishment of the LAMP reaction system

[0108] Based on the above optimization results, the optimal final concentrations of each reagent in the reaction system are as follows: Bst 3.0 DNA polymerase 0.32 U / μL, 10×ThermoPol Buffer 2.5 μL, dNTP 1.0 mmol / L, Mg 2+ 6 mmol / L, F3 and B3 0.2 μmol / L each, FIP and BIP 1.6 μmmol / L each, HNB 0.15 mmol / L, betaine 1 mol / L, template DNA 1 μL, add ddH2O to make up to 25 μL.

[0109] LAMP specificity detection

[0110] Using total mycelial DNA from six tested strains as templates, and ddH2O as a negative control, LAMP assays were performed according to the optimized reaction system. The LAMP product was visually observed to change from purple to sky blue. The product was then subjected to 2.0% agarose gel electrophoresis to check for the formation of typical ladder-like bands. The experiment was repeated three times.

[0111] When using total mycelial DNA from six tested strains as a template for LAMP, Figure 8 As shown in A, only the DNA of *Pseudomonas aeruginosa* showed a positive amplification reaction, and the color of its reaction system changed from purple to sky blue, while other samples remained purple; From Figure 8 As shown in B, only the amplification product of *Pseudomonas aeruginosa* showed a ladder-shaped band in the electrophoresis image, while other tested strains showed no bands. Therefore, the LAMP system established in this study can specifically detect *Pseudomonas aeruginosa*.

[0112] LAMP sensitivity detection

[0113] DNA of P. peucedani was serially diluted by 10 times to obtain DNA dilutions of 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, which were used as templates for LAMP and ordinary PCR. LAMP detection was performed using the optimized reaction system, and ordinary PCR was performed using primers ITS1 and ITS4. After the reaction, the minimum concentration of DNA that could be detected by LAMP was determined by HNB visualizing color change and 2.0% agarose gel electrophoresis; the minimum concentration of DNA that could be detected by PCR was determined by 1.0% agarose gel electrophoresis to determine the maximum detection limit of LAMP detection and PCR detection. The test was repeated 3 times.

[0114] LAMP was performed using DNA dilutions of P. peucedani at 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL as templates, respectively, Figure 9 It can be seen from A that the color of the reaction solution changed to sky blue at 7 concentration gradients of DNA concentration from 100 ng / μL to 100 fg / μL; from Figure 9 B, it can be seen that typical ladder-shaped bands were produced at the 7 concentration gradients. Therefore, the maximum detection limit of LAMP detection of P. peucedani DNA was 100 fg / μL. Ordinary PCR was performed using universal primers ITS1 and ITS4, and Figure 9 C, it can be seen that ordinary PCR amplification results were tested by 1.0% agarose gel electrophoresis, and DNA at 5 concentration gradients from 100 ng / μL to 10 pg / μL could be effectively amplified. Therefore, the maximum detection limit of ordinary PCR detection of P. peucedani DNA was 10 pg / μL. In summary, the sensitivity of the LAMP detection method of P. peucedani established in this study was 100 times that of ordinary PCR.

[0115] Simplification of LAMP operation steps - simple method for extracting DNA

[0116] Because the CTAB method for extracting total mycelial DNA is time-consuming, labor-intensive, and cumbersome, we simplified the extraction process in this experiment. Specifically, we directly picked pathogenic hyphae and spores from a PSA plate into a 2 mL centrifuge tube, added 200 μL of ddH2O, and incubated it in a 65 ℃ water bath for 5-10 min. Then, we centrifuged it at 10,000 rpm for 10 min. The supernatant was used as template DNA, with ddH2O serving as a negative control for LAMP detection. The feasibility of this simplified method was verified by HNB visualization and 2.0% agarose gel electrophoresis. The experiment was repeated three times.

[0117] Depend on Figure 10 It can be seen that after DNA extraction using the simplified method, LAMP detection showed that only the culture of *Xanthomonas maculatus* was positive, while the other five pathogens were negative, proving that the simplified method for DNA extraction can be applied in LAMP detection.

[0118] Application of LAMP in field detection of peony yellow spot disease

[0119] To evaluate the feasibility of LAMP detection in field applications, 100 suspected peony yellow spot disease samples were collected from the peony garden of Henan University of Science and Technology. Under laboratory conditions, lesions were cut for tissue isolation, purification, and microscopic examination. DNA was extracted directly from the diseased lesions using a 65 ℃ water bath heating method. Simultaneously, genomic DNA of the peony yellow spot pathogen preserved in the laboratory and the supernatant from water bath treatment of healthy leaves were used as controls. ddH2O was used to replace the template DNA as a negative control for LAMP detection. The pathogen was isolated from suspected peony yellow spot diseased leaves in the field... Figure 11 As shown in Figure A, the mycelium of the pathogen is white on PSA plates, with a brown center in the colony; the conidia are elliptical under a microscope. Based on literature review, it was determined to be the causal agent of peony yellow spot disease.

[0120] LAMP assays were performed on 100 diseased leaves from the field, and all results were positive. Some results are shown below. Figure 11 B and Figure 11 As shown in C, both genomic DNA and DNA extracted from diseased leaves in the field via the water bath method can be specifically amplified to produce ladder-like bands. However, the LAMP product of DNA extracted from diseased leaves via the water bath method is green and its color is not significantly different from that of the product from healthy leaves, making it impossible to determine the disease based on color changes. Therefore, if DNA from suspected diseased leaves in the field is extracted via the water bath method for LAMP detection, it is essential to verify the presence of typical ladder-like bands using 2.0% agarose gel electrophoresis.

[0121] Optimization of the number of lesions during LAMP field testing

[0122] On the basis of the above test results, the number of P. delavayi yellow spot disease spots was optimized again. That is, the DNA of 1, 10, 20, 30, 40 and 50 spots was extracted by water bath method for LAMP detection, and the genomic DNA of P. delavayi yellow spot disease and ddH2O were taken as controls. The results are shown in Table 4. Figure 12 As shown in Table 4, when the number of spots was from 30 to 50, the color of the reaction solution gradually changed to sky blue, but was still interfered by the pigment in the spots, and the electrophoretogram had typical ladder-shaped bands from 30 to 50 spots. When the number of spots was 40, the sky blue was more obvious, and the interference of the pigment was smaller. Therefore, when extracting DNA from P. delavayi yellow spot disease spots by water bath method, the number of spots should not be too much, and 40 spots were appropriate.

[0123] The above Figures 10-12 are actually a continuous tradition. Figure 10 , which shows that DNA can be simply extracted from the bacterial colonies without the complicated operation of CTAB method; Figure 11 , which shows that the simple DNA extraction method is also applicable to P. delavayi leaves, but the number of leaf spots will have an impact. Figure 12 The number of spots was optimized, and finally 40 spots were determined to be appropriate.

[0124] Application of LAMP in P. delavayi garden and P. delavayi base

[0125] Suspected P. delavayi yellow spot disease leaves were collected in the National P. delavayi Garden in Luoyang City, the P. delavayi Garden of Henan University of Science and Technology, the International P. delavayi Garden in Luoyang City and the Chinese National Flower Garden in Luoyang City, and LAMP detection was carried out.

[0126] The results in the National P. delavayi Garden in Luoyang City are shown in Table 5. Figure 13 As shown in Table 5, 4 of the 5 LAMP products of field spot DNA showed positive, the color of the reaction solution was sky blue, but was still interfered by the pigment in the spots, and the electrophoretogram had typical ladder-shaped bands.

[0127] The results in the P. delavayi Garden of Henan University of Science and Technology are shown in Table 6. Figure 14 As shown in Table 6, the 5 LAMP products of field spot DNA all showed positive, the color of the reaction solution was sky blue, but was still interfered by the pigment in the spots, and the electrophoretogram was typical ladder-shaped bands.

[0128] The results in the International P. delavayi Garden in Luoyang City are shown in Table 7. Figure 15 As shown in Table 7, the 5 LAMP products of field spot DNA all showed positive, the color of the reaction solution was sky blue, but was still interfered by the pigment in the spots, and the electrophoretogram was typical ladder-shaped bands.

[0129] The results in the Chinese National Flower Garden in Luoyang City are shown in Table 8. Figure 16As shown: 4 of 5 LAMP products of field disease spot DNA showed positive, the color of reaction solution was sky blue, but still interfered by pigment in disease spot, and typical ladder band was produced in electrophoretogram.

[0130] In summary, the LAMP system has strong practicability in detecting P. peucedanium.

[0131] The technical roadmap of the present application is shown in Figure 17

[0132] The comparison between the existing diagnosis method and LAMP detection technology is shown in Table 2.

[0133] Table 2 Comparison between the existing diagnosis method and LAMP detection method.

[0134]

[0135] The present application is the first research of LAMP detection technology in the detection of P. peucedanium, which can provide important basis for rapid diagnosis and early monitoring of P. peucedanium.

[0136] 1. The simple and rapid method for detecting P. peucedanium established in the present application.

[0137] Firstly, 3 sets of LAMP primers were designed by taking the specific fragment of ITS sequence of P. peucedanium as a target, then the best specific LAMP primer was screened from the 3 sets of LAMP primers, and then the LAMP reaction system was optimized and established, and the specificity and sensitivity of LAMP were detected. The results show that the 3 sets of LAMP primers designed in the present application can specifically detect P. peucedanium; the best final concentration of each reagent in the reaction system is as follows: Bst 3.0 DNA polymerase 0.32 U / μL, 10×ThermoPolBuffer 2.5 μL, dNTP 1.0 mmol / L, Mg 2+ 6 mmol / L, F3 and B3 each 0.2 μmol / L, FIP and BIP each 1.6 μmmol / L, HNB 0.15 mmol / L, betaine 1 mol / L, template DNA 1 μL, and ddH2O is added to 25 μL; the specificity detection shows that only the product of P. peucedanium is positive; the sensitivity detection is 100 times of that of ordinary PCR; the simplified method of heating extraction of pathogenic bacteria DNA at 65 ℃ can be used for LAMP detection, and electrophoresis shows typical ladder band.

[0138] 2. Application in early diagnosis of P. peucedanium.

[0139] ​The application explores a simple operation method for extracting pathogenic DNA from sick tissues, and finally evaluates the effect and practicality of the technology in early field diagnosis. The DNA extracted from suspected sick leaves in the field by the simple method is detected by LAMP, and the results are all positive. However, when the water bath heating method is used to extract DNA from the sick spots, it is difficult to overcome the interference of pigments in the sick spots. When the number of sick spots is too large, it is not possible to determine whether positive amplification has occurred only by color reaction, and further verification by 2.0% agarose gel electrophoresis is required. When the water bath method is used to extract DNA from the sick spots of peony yellow spot disease, the number of sick spots should not be too large, and 40 is appropriate. The practicality of the LAMP system is very high, and only a few are negative in the four peony gardens studied in the application.

[0140] It should be noted that the above-mentioned embodiments should be understood as illustrative rather than limiting the scope of protection of the present application, and the scope of protection of the present application is subject to the claims. For those skilled in the art, some non-essential improvements and adjustments of the present application without departing from the spirit and scope of the present application still belong to the protection scope of the present application.

Claims

1. A method of detecting Pseudomonas maculicola, characterized by: The method comprises the following steps: Step one, extracting total DNA of the sample to be tested, the method is as follows: collecting suspected peony yellow spot disease leaf as the sample to be tested, cutting 30-50 diseased spots into a centrifugal tube, adding 200 μL of ddH2O, placing in a water bath at 65 DEG C for 5-10 min, centrifuging to obtain supernatant as template DNA; Step two, using the DNA obtained in step one as a template, performing amplification reaction by using a LAMP primer group; the LAMP primer group comprises outer primers 2-F3 and 2-B3 and inner primers 2-FIP and 2-BIP; the nucleotide sequences of the outer primers and the inner primers are respectively as follows: 2-F3: GCCTGTTCGAGCGTCATT; 2-B3: AGTTCAGCGGGTATCCCT; 2-FIP: CGCCGGCTGCCAATTGTTTTGTGGTGTTGGGTGTTTGTCTC; 2-BIP: GCGCAGTACATCTCGCGCTTCCTGATCCGAGGTCAAGAGT; Step three, determining whether the sample contains peony yellow spot disease bacteria according to the amplification reaction result of step two.

2. The method of claim 1, wherein the method is for detecting P. mori. The final concentrations of each reagent in the reaction system of step two or the amount used are as follows: Bst 3.0 DNA polymerase 0.32 U / μL, 10×ThermoPol Buffer 2.5 μL, dNTP 1.0 mmol / L, Mg 2+ 6 mmol / L, 2-F3 and 2-B3 each 0.2 μmol / L, 2-FIP and 2-BIP each 1.6 μmmol / L, HNB 0.15 mmol / L, betaine 1 mol / L, template DNA 1 μL, and add ddH2O to 25 μL.

3. The method of claim 1, wherein the method is for detecting P. mori. In step three, the method for determining whether the sample contains peony yellow spot disease bacteria according to the amplification reaction result of step two is as follows: the LAMP amplification product is tested by HNB visualization and 2.0% agarose gel electrophoresis, if the LAMP product changes from purple to sky blue and typical ladder-shaped bands are produced in the electrophoretogram, the sample is positive, otherwise it is negative.

Citation Information

Patent Citations

  • LAMP detection primers and LAMP detection method for panax notoginseng dollar spot pathogens

    CN111057787A