Peptide-coated DNA nanostructures as a platform for control of lysosomal function in cells

Abstract

Described herein is a DNA nanostructure-based platform that can modulate a number of cellular functions depending on the concentration and surface decoration of the nanostructure. Utilizing different peptides for surface functionalization of DNA nanostructures, lysosomal activity was able to be modulated which in turn translated into the control of cellular functionality, ranging from changes in cell morphology to modulation of immune signaling and cell death. This demonstrates the rational design of a new generation of versatile DNA-based nanoplatforms that can be used in various biomedical applications such as the development of combinatorial anti-cancer platforms, efficient systems for endolysosomal escape, and nanoplatforms modulating lysosomal pH.

Description

[0001]PEPTIDE-COATED DNA NANOSTRUCTURES AS A PLATFORM FOR CONTROL OF LYSOSOMAL FUNCTION IN CELLS CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No.63 / 674,948, filed on July 24, 2024, which is incorporated by reference herein in its entirety. FEDERALLY SPONSORED RESEARCH This invention was made with government support under grant numbers GM132931 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING This application was filed with a Sequence Listing XML in ST.26 XML format accordance with 37 C.F.R. § 1.831 and PCT Rule 13ter. The Sequence Listing XML file submitted in the USPTO Patent Center, “208192-0024-WO01_sequence_listing_xml_17-JUL-2025.xml,” was created on July 17, 2025, contains 11 sequences, has a file size of 12.0 kilobytes (12,288 bytes), and is incorporated by reference in its entirety into the specification. BACKGROUND Despite decades of intensive research, the targeted delivery of functional nanomaterials to specific subcellular compartments remains a critical challenge in the field of nano-biomedicine. To facilitate cellular targeting and uptake, surface functionalization with specific receptor-binding moieties is usually employed, leading to enhanced formation of endocytic vesicles. These vesicles follow a sequence of fusion events, first with early and then with late endosomes, culminating in fusion with lysosomal compartment. Of note, the majority of the primary targets of nanocarriers often reside outside the endolysosomal system, so for efficient therapeutic effect, it is important for the carriers to escape these compartments in order to avoid lysosomal degradation. Consequently, strategies promoting lysosomal escape of functionalized nanocarriers have become a major research direction for enhancing therapeutic efficacy. However, emerging evidence suggests that despite these efforts, most nanoparticles and their cargo predominantly accumulate in the lysosomes, and do not reach their intended targets. It is worth noting that alterations in lysosomal activity and / or dysfunction are tightly linked with the progression of many human diseases, such as lysosomal storage disorders, cancer, autoimmune disorders, neurodegenerative diseases, and cardiovascular diseases. Consequently, emerging evidence on the relation between lysosomal function / dysfunction and disease has provided a solid foundation for the development of therapeutic strategies that specifically target regulation of lysosome function via several approaches. It is possible to target lysosomes with pharmacological agents that directly affect the lysosomal environment, such as lysosomal acidification inhibitors (e.g., chloroquine), or v-ATPase inhibitors (e.g., bafilomycin A1). It is also possible to restore lysosomal functions by either delivering active lysosomal components or through genetic manipulation. Additionally, an emerging strategy proposes utilizing selectively biodegradable materials that target lysosomal degradation pathways. Of note, the ability of nanoparticles to accumulate in lysosomes has inspired promising approaches for the selective regulation of lysosomal function to improve therapeutic outcomes. Particular advances were achieved in the design of protein-loaded nanosystems, which can be used in enzyme replacement therapies for several lysosomal storage disorders. However, because lysosomes are actively involved in cell death regulation, such a targeting strategy might generate adverse effects and even systemic toxicity. Alternatively, different dynamic pH- dependent nanocarrier systems were proposed to overcome systemic toxicity and improve the modulation of lysosomal functions, such as proton-driven nano-transformers, mixed-charge nanoparticles, and DNA nano-frameworks. However, all these platforms targeted the modulation of only one cellular physiological outcome, providing either immunomodulatory or cytotoxic effects. Recently, a nanoformulation based on proton-driven dynamic DNA nano-frameworks was proposed to rationally control several functions of lysosomes, a phenomenon termed lysosome interference. Lysosomal interference is characterized by the modulation of lysosomal acidity, which is accompanied by alterations in hydrolase activity. These changes ultimately influence a range of cellular responses, from cell motility to the regulation of cell death pathways. What is needed are compositions and methods for selectively controlling and modulating lysosomal function in cells. SUMMARY One embodiment described herein is a method of selectively modulating lysosomal activity in a cell, the method comprising delivering to the cell a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with a peptide coating. In one aspect, the DN comprises a 6-helix bundle (6HB) nanostructure. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size. In another aspect, the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence having at least 90–99% identity to any one of SEQ ID NO: 7–11. In another aspect, the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence selected from any one of SEQ ID NO: 7–11. In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7). In another aspect, the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 9). In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide flanked by two copies of an aurein 1.2 peptide (SEQ ID NO: 10). In another aspect, the nanoparticle composition modulates lysosomal pH by inducing lysosomal acidification or alkalization in the cell. In another aspect, the nanoparticle composition does not induce lysosomal damage or lysosomal membrane permeabilization. In another aspect, the nanoparticle composition inhibits metabolic activity in the cell. In another aspect, the nanoparticle composition modulates the morphology of the cell. In another aspect, the nanoparticle composition modulates immune signaling pathways and immune-related protein expression in the cell. In another aspect, the nanoparticle composition is cytotoxic to the cell and decreases cell viability. In another aspect, the nanoparticle composition is stable in lysosomal compartments of the cell for up to about 24 h of incubation. In another aspect, the nanoparticle composition is enzymatically degraded in the cell by lysosomal enzymes. In another aspect, the nanoparticle composition is delivered to the cell at a concentration ranging from about 10 nM to about 500 nM. In another aspect, the cell is incubated with the nanoparticle composition for a period of time of about 4 h to about 72 h. In another aspect, the nanoparticle composition further comprises a therapeutic agent. In another aspect, the nanoparticle composition further comprises one or more lysosomal acidification inhibitors or v-ATPase inhibitors. In another aspect, the cell is a cancer cell. DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. FIG.1A–B show design of functionalized DNA nanostructures for control over lysosomal activity in cells. FIG.1A shows a scheme of DN synthesis and peptide coating. FIG.1B shows a schematic representation of DN-driven impact on lysosomal function. FIG. 2A–C show functionalized DNA nanostructures affect the total metabolic activity of cells, checked with an alamarBlue assay. Cells were treated with different DNs (10, 100 and 500 nM) for 24, 48 and 72 h. The data were normalized to control values (no DN particle exposure), which were set as 100% of the total metabolic activity of cells. Control cells were untreated. As a positive control, cells were treated with 20% ethanol for 30 min. Data are expressed as means ± SEM (n = 3). (*) P < 0.05, (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG.2A shows the total metabolic activity of Alexander cells. FIG. 2B shows the total metabolic activity of HepG2 cells. FIG. 2C shows the total metabolic activity of Huh7 cells. FIG. 3A–C show functionalized DNA nanostructures affect the viability of cells. The viability of cells was checked using propidium iodide. Cells were treated with different DNs (10, 100 and 500 nM) for 24, 48 and 72 h. After the treatment, cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy, and the numbers of dead (PI-positive) cells and total number (Hoechst- stained) of cells were counted using the ImageJ software (NIH). The viability was expressed as the ratio of PI-negative cells to total cells. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denotes statistically significant differences. FIG.3A shows Alexander cells. FIG.3B shows HepG2 cells. FIG.3C shows Huh7 cells. FIG. 4A–D show lysosomal degradation of DNA nanostructures. FIG. 4A shows a schematic presentation of principle of FRET microscopy analysis of DNA nanostructures degradation. Intact nanostructures labeled with FRET reporter dyes (6-carboxyfluorescein donor and TAMRA acceptor) show a high FRET index, whereas degradation of nanostructures leads to the increase in distance between donor and acceptor dyes, lowering the FRET index. FIG.4B shows the quantification of FRET index images in mean gray values. Confocal images were taken and analyzed for FRET using the “FRET and colocalization analyzer” ImageJ plug-in. “Colocalized FRET index” images present the calculated amount of FRET for each pixel in the FRET channel. Mean gray values of resultant “colocalized FRET index” images were measured using the ImageJ software (NIH). Representative images are shown in FIGS. 15, 16, and 17. FIG. 4C shows the Pearson coefficient statistics for analyzing the colocalization of DNs with lysosomes. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. After incubation, cells were labeled with lysosomal marker LysoTracker Blue DND-22 (Thermo Fisher Scientific). Stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). The Pearson correlation coefficient for fluorophore pairs DNA–Lysosomes was calculated using the Coloc 2 tool available in ImageJ software (NIH) and is presented as means of n = 30-70 cells. (***) P < 0.001 denotes significant differences. Representative images are shown in FIGS.19–21. FIG.4D shows the colocalization analysis of different DNs after 48 h of treatment. Cells were treated and processed as described in FIG.4C. FIG.5A–B show lysosome interference caused by DNA nanostructures. FIG.5A shows the quantification of fluorescence intensity of LysoSensor from images in FIG. 22. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. After incubation, cells were labeled with lysosomal pH marker LysoSensor™ Blue DND-167 (Thermo Fisher Scientific). Stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). The fluorescence intensity of LysoSensor was quantified using the ImageJ software (NIH). Data collected from n = 50 cells out of three independent experiments. (*) P < 0.05, (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG. 5B shows the lysosomal integrity as measured by acridine orange (AO) red fluorescence decrease. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h, stained with 5 µg / ml acridine orange (AO). After staining the fluorescence intensity was measured using a fluorescent microplate reader. Data are expressed as means ± SEM (n = 4). (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG.6A–B show effects of functionalized DNA nanostructures on lysosomal size. FIG.6A shows representative super-resolution images of lysosomes in living Alexander, HepG2 and Huh7 cells. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. To visualize lysosomes, cells transduced with CellLight® LAMP1-RFP. FIG.6B shows the quantification of lysosomal size and circularity. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. To visualize lysosomes, cells were transduced with CellLight® LAMP1-RFP. Nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. Representative images are shown in FIG. 24. Lysosomal size and circularity were measured using the ImageJ software (NIH), n = 50 cells. (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG.7A–C show immunostimulatory effects of functionalized DNA nanostructures. FIG. 7A shows the relative expression of IFI6 determined in Alexander, HepG2 and Huh7 cells 48 h after treatment with different DNs at 10 and 50 nM concentrations. GAPDH was used as internal control. Results are presented as mean ± SEM (n = 3). Differences were considered significant at (**) P < 0.01 and (***) P < 0.001. Transfection with IFNL4 was used as positive control. FIG. 7B shows the activation of JAK-STAT signaling was determined by immunoblot analysis of Alexander, HepG2 and Huh7 cells 48 h after treatment with different DNs at 50 nM concentration; β-actin served as the loading control. FIG.7C shows graphs of the densitometric quantification of p-STAT1 / STAT1 ratio of immunoblots. Results are presented as mean ± SEM (n = 3). Differences were considered significant at (*) P < 0.05, (**) P < 0.01 and (***) P < 0.001. FIG. 8A–C show functionalized DNA nanostructures upregulate STING expression in hepatic cells. FIG. 8A shows the determination of the expression of STING by immunoblot analysis of Alexander, HepG2 and Huh7 cells 48 h after treatment with different DNs at 50 nM concentration; β-actin served as the loading control. FIG.8B shows graphs of the densitometric quantification of STING immunoblots. Results are presented as mean ± SEM (n = 3). Differences were considered significant at (*) P < 0.05. FIG.8C shows Schematics of the immunostimulatory effects of functionalized DNA nanostructures. FIG.9A–B show functionalized DNA nanostructures induce cell death in liver cancer cells. FIG.9A shows cells (Alexander, HepG2 or Huh7) treated with different types of DNs (at 500 nM concentration) for 48 h. After treatment, cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. The blue dashed rectangle highlights cell scattering, and the red dashed rectangle indicates cellular toxicity. FIG.9B shows cells (Alexander, HepG2 or Huh7) treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment, cells were stained with CellMask™ Orange (red) and the nuclei were counterstained with Hoechst 33342 (blue). Labeled cells were then imaged by confocal microscopy. The white dashed rectangle shows zoomed region, the blue dashed rectangle highlights cells losing cell-cell contacts, and the red dashed rectangle indicates cells with compromised membrane integrity. FIG.10A–C show functionalized DNA nanostructures affect the integrity of the lysosomal membrane in liver cancer cells. FIG.10A shows a schematic of the lysosomal damage induced by aurein-coated DNA nanostructures. FIG. 10B shows lysosomal integrity as measured by acridine orange (AO) red fluorescence decrease. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 500 nM concentration) for 48 h, stained with 5 µg / ml acridine orange (AO). After staining, the fluorescence intensity was measured using a fluorescent microplate reader. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denotes statistically significant differences. FIG.10C shows Lysosomal integrity as measured by assessment of morphodynamical changes in LysoTracker Red. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 500 nM concentration) for 48 h, stained with LysoTracker Red and nuclei were counterstained with Hoechst 33342 (blue). Labeled cells were then imaged by confocal microscopy. As a positive control, cells were treated with 20% ethanol for 60 min. FIG.11A–C show the effects of functionalized DNA nanostructures on mitochondria in liver cancer cells. Cells were treated with different types of DNs (at 50 and 500 nM concentrations) for 48 h, stained with 5 μM MitoSOX for 10 min and analyzed by flow cytometry. Positive control 1 mM H2O2for 60 min was used. The red dashed rectangle indicates cells with elevated mitochondrial ROS. FIG.11A shows Alexander cells. FIG.11B shows HepG2 cells. FIG.11C shows Huh7 cells. FIG. 12A–D show aurein-coated DNA nanostructures induce profound cell death in different cancer multicellular aggregates. Multicellular aggregates of cell lines were treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment multicellular aggregates were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. Representative images out of four independent replicates. FIG.12A shows Alexander cells. FIG.12B shows HepG2 cells. FIG. 12C shows Huh7 cells. FIG.12D shows glioblastoma cells. FIG. 13 shows a scheme of the controlled modulation of lysosomal functions by functionalized DNA nanostructures. FIG. 14 shows a summary of physicochemical characterization of DNA nanostructures. Hydrodynamic diameters of nanoparticles as measured by laser light scattering. Surface characterization of the particles dissolved either in PBS measured with a Zetasizer Nano (zeta potential). FIG.15 shows FRET microscopy images of Alexander cells treated with 6HB labeled with FRET reporter dyes (6-carboxyfluorescein donor and TAMRA acceptor). Images of the three detection channels (donor, acceptor, and FRET) are shown. The calculated colocalization diagram and colocalized FRET index after the subtraction of spectral bleed-through. Alexander cells were treated with a 50 nM concentration of 6HB labeled with FRET reporter dyes for 24, 48 and 72 h. Nuclei were counterstained with Hoechst 33342 (Thermo Fisher Scientific). Confocal images were taken and analyzed for FRET using the “FRET and colocalization analyzer” ImageJ plug-in. “Colocalized FRET index” images present the calculated amount of FRET for each pixel in the FRET channel. The ImageJ plug-in color codes the relative FRET efficiency ranging from blue (none FRET efficiency) to red-yellow (high FRET efficiency). The “Colocalization diagram” plots display pixel colocalization as well as color coded FRET efficiency in a 2D plot. FIG. 16 shows FRET microscopy images of HepG2 cells treated with 6HB labeled with FRET reporter dyes (6-carboxyfluorescein donor and TAMRA acceptor). Images of the three detection channels (donor, acceptor, and FRET) are shown. The calculated colocalization diagram and colocalized FRET index after the subtraction of spectral bleed-through. HepG2 cells were treated with a 50 nM concentration of 6HB labeled with FRET reporter dyes for 24, 48 and 72 h. Nuclei were counterstained with Hoechst 33342 (Thermo Fisher Scientific). Confocal images were taken and analyzed for FRET using the “FRET and colocalization analyzer” ImageJ plug-in. “Colocalized FRET index” images present the calculated amount of FRET for each pixel in the FRET channel. The ImageJ plug-in color codes the relative FRET efficiency ranging from blue (none FRET efficiency) to red-yellow (high FRET efficiency). The “Colocalization diagram” plots display pixel colocalization as well as color coded FRET efficiency in a 2D plot. FIG. 17 shows FRET microscopy images of Huh7 cells treated with 6HB labeled with FRET reporter dyes (6-carboxyfluorescein donor and TAMRA acceptor). Images of the three detection channels (donor, acceptor, and FRET) are shown. The calculated colocalization diagram and colocalized FRET index after the subtraction of spectral bleed-through. Huh7 cells were treated with a 50 nM concentration of 6HB labeled with FRET reporter dyes for 24, 48 and 72 h. Nuclei were counterstained with Hoechst 33342 (Thermo Fisher Scientific). Confocal images were taken and analyzed for FRET using the “FRET and colocalization analyzer” ImageJ plug-in. “Colocalized FRET index” images present the calculated amount of FRET for each pixel in the FRET channel. The ImageJ plug-in color codes the relative FRET efficiency ranging from blue (none FRET efficiency) to red-yellow (high FRET efficiency). The “Colocalization diagram” plots display pixel colocalization as well as color coded FRET efficiency in a 2D plot. FIG. 18 shows control FRET assessment of Alexander, HepG2 and Huh7 cells treated with 6HB labeled with FRET reporter dyes (6-carboxyfluorescein donor and TAMRA acceptor). 6HB labeled were labelled either with 6-carboxyfluorescein donor only or with TAMRA acceptor only structures. Cells were treated with a 50 nM concentration of 6HB labeled with FRET reporter dyes for 24, 48 and 72 h. Quantification of FRET index images in mean gray values. Confocal images were taken and analyzed for FRET using the “FRET and colocalization analyzer” ImageJ plug-in. “Colocalized FRET index” images present the calculated amount of FRET for each pixel in the FRET channel. Mean gray values of resultant “colocalized FRET index” images were measured using the ImageJ software (NIH). FIG. 19A–B show representative images of colocalization of DNs with lysosomes. Alexander cells were treated with different types of DNs (at 50 nM concentration) for 48 h. After incubation, cells were labeled with lysosomal marker LysoTracker Blue DND-22 (Thermo Fisher Scientific). Stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). FIG.19A shows overviews of cells. FIG.19B shows images zoomed to see single cells. FIG.20A–B show representative images of colocalization of DNs with lysosomes. HepG2 cells were treated with different types of DNs (at 50 nM concentration) for 48 h. After incubation, cells were labeled with lysosomal marker LysoTracker Blue DND-22 (Thermo Fisher Scientific). Stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). FIG.20A shows overviews of cells. FIG.20B shows images zoomed to see single cells. FIG.21A–B show representative images of colocalization of DNs with lysosomes. Huh7 cells were treated with different types of DNs (at 50 nM concentration) for 48 h. After incubation, cells were labeled with lysosomal marker LysoTracker Blue DND-22 (Thermo Fisher Scientific). Stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). FIG.21A shows overviews of cells. FIG.21B shows images zoomed to see single cells. FIG.22 shows assessment of lysosomal pH changes using LysoSensor™ Blue DND-167. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. After incubation, cells were labeled with lysosomal pH marker LysoSensor™ Blue DND-167 (Thermo Fisher Scientific). Stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). FIG. 23A–B show representative super-resolution images of lysosomes in living Alexander, HepG2 and Huh7 cells. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 h (FIG.23A) or 48 h (FIG.23B). To visualize lysosomes, cells transduced with CellLight® LAMP1-RFP. FIG. 24 shows lysosomal size assessment by confocal microscopy. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. To visualize lysosomes, cells transduced with CellLight® LAMP1-RFP. Nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. FIG. 25 shows the expression of STING was determined by immunoblot analysis of Alexander, HepG2 and Huh7 cells 48 h after treatment with DNs coated with scrambled aurien peptide (scEE) at 50 nM concentration; β-actin served as the loading control. FIG.26 shows functionalized DNs do not induce release of interferon beta (IFN-β). Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for 48 h. IFN-β secretion was detected by ELISA. Data are presented from at least three independent experiments. FIG. 27 shows Alexander cells were treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. FIG. 28 shows HepG2 cells were treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. FIG. 29 shows Huh7 cells were treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. FIG.30 shows cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment cells were stained with CellMask™ Orange (red) and nuclei were counterstained with Hoechst 33342 (blue). Labeled cells were then imaged by confocal microscopy. FIG. 31 shows lysosomal integrity as measured by assessment of morphodynamical changes in LysoTracker Red. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 500 nM concentration) for 48 h, stained with LysoTracker Red and nuclei were counterstained with Hoechst 33342 (blue). Labeled cells were then imaged by confocal microscopy. As a positive control, cells were treated with 20% ethanol for 60 min. FIG.32 shows lysosomal integrity as measured by acridine orange (AO) red fluorescence decrease. Cells (Alexander, HepG2 or Huh7) were treated with DNs coated with scrambled aurien peptide (scEE) (at 500 nM concentration) for 48 h, stained with 5 µg / ml acridine orange (AO). After staining the fluorescence intensity was measured using a fluorescent microplate reader. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG. 33 shows penetration of DNs into multicellular aggregates of different cancer cell lines. Multicellular aggregates of Alexander, HepG2, Huh7 and glioblastoma cell lines were treated with different types of fluorescently labelled (green) DNs (at 500 nM concentration) for 48 h. After the treatment multicellular aggregates nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. Representative images out of four independent replicates. FIG. 34A–D show the characterization of functionalized DNA nanostructures. FIG. 34A shows the use of agarose gel electrophoresis (1.5% agarose) to determine the synthesis efficacy of the 6 helix bundle (6HB). FIG. 34B shows the use of agarose gel electrophoresis (1.5% agarose) to determine the coating of 6HB with K10 and EE peptides. FIG. 34C shows the characterization of the particles dissolved in PBS measured with a Zetasizer Nano (Malvern Instruments). Full data on size distribution is presented in FIG. 36. FIG. 34D shows the AFM characterization of the DNs. Scale bar is 200 nm. FIG.35A–C show the effects of peptides on functionality of liver cancer cells. FIG.35A shows the total metabolic activity of Alexander, HepG2 and Huh7 cells was checked with an alamarBlue assay. Cells were treated with either K10 or EE peptides (500 nM and 15 µM) for 24, 48 and 72 h. The data were normalized to control values (no peptide exposure), which were set as 100% of the total metabolic activity of cells. Control cells were untreated. As a positive control, cells were treated with 20% ethanol for 30 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denote statistically significant differences. FIG. 35B shows a comparison of cytotoxic effect elicited by EE DNs and EE peptide. The viability of Alexander, HepG2 and Huh7 cells was checked using propidium iodide. Cells were treated with either EE DNs (500 nM) or EE peptide (500 nM and 15 µM) for 48 h. After the treatment, cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy, and the numbers of dead (PI-positive) cells and total number (Hoechst- stained) of cells were counted using the ImageJ software (NIH). The viability was expressed as the ratio of PI-negative cells to total cells. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denotes statistically significant differences. FIG.35C shows lysosomal integrity as measured by acridine orange (AO) red fluorescence decrease. Cells (Alexander, HepG2 or Huh7) were treated with either EE DNs (500 nM) or EE peptide (500 nM and 15 µM) for 48 h, stained with 5 µg / ml acridine orange (AO). After staining, the fluorescence intensity was measured using a fluorescent microplate reader. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). Differences were considered significant at (*) P < 0.05, (**) P < 0.01 and (***) P < 0.001. FIG. 36 shows the hydrodynamic diameters of nanoparticles (6HB, K10 and EE) as measured by laser light scattering. Original size distribution from Zetasizer Nano. DLS of the particles dissolved in PBS was performed using a Zetasizer Nano (Malvern Instruments). FIG.37 shows the hydrodynamic diameters of freshly prepared 6HB and those stored for 1 month were measured by laser light scattering. DLS of the particles dissolved in PBS was performed using a Zetasizer Nano (Malvern Instruments). Data are supplemented with original size distribution from Zetasizer Nano. FIG.38 shows the hydrodynamic diameters of freshly prepared K10 and those stored for 1 month were measured by laser light scattering. DLS of the particles dissolved in PBS was performed using a Zetasizer Nano (Malvern Instruments). Data are supplemented with original size distribution from Zetasizer Nano. FIG.39 shows the hydrodynamic diameters of freshly prepared EE and those stored for 1 month were measured by laser light scattering. DLS of the particles dissolved in PBS was performed using a Zetasizer Nano (Malvern Instruments). Data are supplemented with original size distribution from Zetasizer Nano. FIG. 40 shows the effects of peptides on viability of liver cancer cells. The viability of Alexander, HepG2 and Huh7 cells was checked using propidium iodide. Cells were treated with either K10 or EE peptides (500 nM and 15 µM) for 24, 48 and 72 h. After the treatment, cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy, and the numbers of dead (PI-positive) cells and total number (Hoechst-stained) of cells were counted using the ImageJ software (NIH). The viability was expressed as the ratio of PI-negative cells to total cells. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denotes statistically significant differences. FIG. 41 shows the effects of peptides on lysosomal integrity of liver cancer cells. Cells were treated with either K10 or EE peptides (500 nM and 15 µM) for 48 h. After the treatment, cells were stained with 5 µg / ml acridine orange (AO). After staining, the fluorescence intensity was measured using a fluorescent microplate reader. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denote statistically significant differences. FIG. 42A–E show the effects of DNs on functionality of non-cancerous HEK293T cells. FIG.42A shows the metabolic activity of HEK293T cells under DNs treatment. Cells were treated with different DNs (10, 100 and 500 nM) for 48 h. The data were normalized to control values (no DN particle exposure), which were set as 100% of the total metabolic activity of cells. Control cells were untreated. As a positive control, cells were treated with 20% ethanol for 30 min. Data are expressed as means ± SEM (n = 3). (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG.42B shows the viability of HEK293T cells under DNs treatment. Cells were treated with different DNs (10, 100 and 500 nM) for 48 h. After the treatment, cells were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy, and the numbers of dead (PI-positive) cells and total number (Hoechst-stained) of cells were counted using the ImageJ software (NIH). The viability was expressed as the ratio of PI-negative cells to total cells. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (***) P < 0.001 denotes statistically significant differences. FIG. 42C shows the lysosomal integrity of HEK293T cells under DNs treatment. Cells were treated with different DNs (10, 100 and 500 nM) for 48 h. After the treatment, cells were stained with 5 µg / ml acridine orange (AO). After staining, the fluorescence intensity was measured using a fluorescent microplate reader. As a positive control, cells were treated with 20% ethanol for 60 min. Data are expressed as means ± SEM (n = 3). (**) P < 0.01 and (***) P < 0.001 denote statistically significant differences. FIG.42D shows the comparison of cytotoxicity elicited by EE DNs treatment in Huh7 and HEK293T cells. Huh7 and Hek293T cells were treated with EE DNs (500 nM) for 48 h. After the treatment viability was assessed as in FIG.42B. (*) P < 0.05 denotes statistically significant differences. FIG.42E shows the comparison of lysosomal damage elicited by EE DNs treatment in Huh7 and HEK293T cells. Huh7 and Hek293T cells were treated with EE DNs (500 nM) for 48 h. After the treatment lysosomal integrity was assessed as in FIG. 42C. (**) P < 0.01 denotes statistically significant differences. DETAILED DESCRIPTION Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of biochemistry, molecular biology, immunology, microbiology, genetics, cell and tissue culture, and protein and nucleic acid chemistry described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein. As used herein, the terms “amino acid,” “nucleotide,” “nucleic acid,” “ribonucleic acid,” “deoxyribonucleic acid,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein. Nucleic acids may be single stranded or double stranded or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid thereof, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. As used herein, terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting essentially of,” and “consisting of” the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, “comprising,” is an “open- ended” term that does not exclude additional, unrecited elements or method steps. As used herein, “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim. As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified. As used herein, the term “or” can be conjunctive or disjunctive. As used herein, the term “and / or” refers to both the conjunctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely. As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol “~” means “about” or “approximately.” All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1–2.0 includes 0.1, 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points, or as described above in the definition of “about.” As used herein, the terms “room temperature,” “RT,” or “ambient temperature” refer to the typical temperature in an indoor laboratory setting. In one aspect, the laboratory setting is climate controlled to maintain the temperature at a substantially uniform temperature or with a specific range of temperatures. In one aspect, “room temperature” refers a temperature of about 15–30 °C, including all integers and endpoints within the specified range. In another aspect, “room temperature” refers a temperature of about 15–30 °C; about 20–30 °C; about 22–30 °C; about 25–30 °C; about 27–30 °C; about 15–22 °C; about 15–25 °C; about 15–27 °C; about 20–22 °C; about 20–25 °C; about 20–27 °C; about 22–25 °C; about 22–27 °C; about 25–27 °C; about 15 °C ± 10%; about 20 °C ± 10%; about 22 °C ± 10%; about 25 °C ± 10%; about 27 °C ± 10%; ~20 °C, ~22 °C, ~25 °C, or ~27 °C, at standard atmospheric pressure. As used herein, the terms “active ingredient” or “active pharmaceutical ingredient” refer to a pharmaceutical agent, active ingredient, compound, or substance, compositions, or mixtures thereof, that provide a pharmacological, often beneficial, effect. As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments or control cells. As used herein, the term “dose” denotes any form of an active ingredient formulation or composition, including cells, that contains an amount sufficient to initiate or produce a therapeutic effect with at least one or more administrations. “Formulation” and “composition” are used interchangeably herein. As used herein, the term “prophylaxis” refers to preventing or reducing the progression of a disorder, either to a statistically significant degree or to a degree detectable by a person of ordinary skill in the art. As used herein, the terms “effective amount” or “therapeutically effective amount,” refers to a substantially non-toxic, but sufficient amount of an action, agent, composition, or cell(s) being administered to a subject that will prevent, treat, or ameliorate to some extent one or more of the symptoms of the disease or condition being experienced or that the subject is susceptible to contracting. The result can be the reduction or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An effective amount may be based on factors individual to each subject, including, but not limited to, the subject’s age, size, type or extent of disease, stage of the disease, route of administration, the type or extent of supplemental therapy used, ongoing disease process, and type of treatment desired. As used herein, the term “subject” refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e.g., humans, male or female; infant, adolescent, or adult), non- human primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In one embodiment, the subject is a primate. In one embodiment, the subject is a human. As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments. As used herein, the terms “inhibit,” “inhibition,” or “inhibiting” refer to the reduction or suppression of a given biological process, condition, symptom, disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process. As used herein, “treatment” or “treating” refers to prophylaxis of, preventing, suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of biological process including a disorder or disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term “treatment” also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. “Repressing” or “ameliorating” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject after clinical appearance of such disease, disorder, or its symptoms. “Prophylaxis of” or “preventing” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject prior to onset of the disease, disorder, or the symptoms thereof. “Suppressing” a disease or disorder involves administering a cell, composition, or compound described herein to a subject after induction of the disease or disorder thereof but before its clinical appearance or symptoms thereof have manifested. As used herein, “administration” or “administering” refers to providing, contacting, and / or delivery of an action, agent, compound, composition, or cell(s) by any appropriate route to achieve a desired effect. In some embodiments, the term “administering” may also refer to the placement of a compound or a composition as disclosed herein into a subject by a method or route that results in at least partial localization of the compound or composition at a desired site in the subject. Administration may include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, intracardiac, infusion (e.g., cardiac catheter infusion), subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional or intracranial injection), enteral, transdermal, topical, buccal, rectal, vaginal, nasal, ophthalmic, via inhalation, and implants. Via the parenteral route, the compound or composition may be in the form of solutions or suspensions for infusion or injection, or as lyophilized powders. Via the enteral route, the compound or composition may be in the form of capsules, gel capsules, tablets, sugar-coated tablets, syrups, suspensions, solutions, powders, granules, emulsions, or microspheres, nanospheres, lipid vesicles, or polymer vesicles allowing for controlled release. Via the topical route, the compound or composition may be in the form of an aerosol, spray, powder, lotion, cream, paste, gel, ointment, oil, suspensions, solutions, or emulsions. As used herein, the term “DNA nanostructure” refers to nanomaterial compositions comprising DNA and exhibiting defined, self-assembling 3D structure on the nanometer scale. As used herein, the term “6-helix bundle nanostructure” or “6HB nanostructure” refers to a type of DNA nanostructure made up of six interconnected double helices. A 6HB nanostructure is typically a rigid and monomeric assembly roughly 7 × 6 nm2in size. The bundles may be designed to have different properties based on how the specific DNA helices are arranged and linked, for example, through different inter-helical crossover patterns. In some aspects, the design of a 6HB nanostructure may involve folding a single-stranded DNA scaffold into six parallel double helices using various staples. In certain non-limiting exemplary aspects, a 6HB nanostructure may comprise six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. As used herein, the term “peptide coating” refers to a composition comprising a polypeptide used to surround or encapsulate a payload, such as a DNA nanostructure as described herein, and impart beneficial properties not observed in uncoated payload. In some aspects, a peptide coating may comprise one or more endolysosomal escape peptides. An “endolysosomal escape peptide,” as used herein, refers to a peptide or a group of peptides that may enhance the release of a biomolecule (e.g., DNA nanostructure) from endosomes or lysosomes into the cytoplasm of a cell. In certain non-limiting exemplary aspects, an endolysosomal escape peptide may comprise an amino acid sequence having at least 90–99% identity to any one of SEQ ID NO: 7–11. As used herein, the term “lysosomal activity” refers to a cellular or biological function mediated by the endolysosomal system. For example, lysosomal activity is involved in degradation of cellular components, the immune response, cell death pathways, and cell motility. Altered lysosomal activity is associated with lysosomal storage disorders, cancer, autoimmune disorders, neurodegenerative diseases, and cardiovascular diseases. As used herein, the term “lysosomal interference” refers to the modulation of lysosomal properties, such as pH, and associated alterations in lysosomal characteristics or activity, such as hydrolase activity. As used herein, “variants” can include, but are not limited to, those that include conservative amino acid (AA) substitutions, SNP variants, degenerate variants, and biologically active portions of a gene or nucleotide. A “degenerate variant” as used herein refers to a variant that has a mutated nucleotide sequence, but still encodes the same polypeptide due to the redundancy of the genetic code. There are 20 naturally occurring amino acids; however, some of these share similar characteristics. For example, leucine and isoleucine are both aliphatic, branched, and hydrophobic. Similarly, aspartic acid and glutamic acid are both small and negatively charged. Conservative substitutions in proteins often have a smaller effect on function than non-conservative mutations. Although there are many ways to classify amino acids, they are often sorted into six main groups on the basis of their structure and the general chemical characteristics of their R groups. A mutation among the same class of amino acids is considered a conservative amino acid substitution. The term “functional” when used in conjunction with “variant” or “fragment” refers to an entity or molecule which possess a biological activity that is substantially similar to a biological activity of the entity or molecule of which it is a variant or fragment thereof. In accordance with the present disclosure, a nucleotide or peptide described herein may be modified, for example, to facilitate or improve identification, activity, expression, isolation, storage and / or administration, so long as such modifications do not reduce the function of the nucleotide or peptide to an unacceptable level. As used herein, “substantial identity” of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 25% sequence identity compared to a reference sequence as determined using programs known in the art (e.g., Basic Local Alignment Search Tool (BLAST)). In preferred embodiments, percent identity can be any integer from 25% to 100%. More preferred embodiments include polynucleotide sequences that have at least about: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference sequence. These values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. Accordingly, polynucleotides of the present disclosure encoding a protein or polypeptide of the present disclosure include nucleic acid sequences that have substantial identity to the nucleic acid sequences that encode the proteins or polypeptides of the present disclosure. Polynucleotides encoding a polypeptide comprising an amino acid sequence that has at least about: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference polypeptide sequence are also preferred. As used herein, “substantial identity” of amino acid sequences (and of peptides or polypeptides having these amino acid sequences) means that an amino acid sequence comprises a sequence that has at least 25% sequence identity compared to a reference sequence as determined using programs known in the art (e.g., BLAST). In preferred embodiments, percent identity can be any integer from 25% to 100%. More preferred embodiments include amino acid or polypeptide sequences that have at least about: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference sequence. Polypeptides that are “substantially identical” share amino acid sequences except that residue positions which are not identical may differ by one or more conservative amino acid changes. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Exemplary conservative amino acid substitution groups include valine-leucine-isoleucine, phenylalanine-tyrosine, lysine- arginine, alanine-valine, aspartic acid-glutamic acid, and asparagine-glutamine. Accordingly, peptides, polypeptides, or proteins, encoded by the polynucleotides of the present disclosure, include amino acid sequences that have substantial identity to the amino acid sequences of the reference polypeptide sequences. DNA nanotechnology is a rapidly growing field that provides a set of tools for advancing biomedical applications. Targeting lysosomal functions with nanomaterials, such as DNA nanostructures (DNs), represents a rational and systematic way to control cell functionality. Here, a versatile DNA nanostructure-based platform is described that can modulate a number of cellular functions depending on the concentration and surface decoration of the nanostructure. Utilizing different peptides for surface functionalization of DNs, lysosomal activity was able to be rationally modulated, which in turn translated into the control of cellular functionality, ranging from changes in cell morphology to modulation of immune signaling and cell death. This study holds promise for the rational design of a new generation of versatile DNA-based nanoplatforms that can be used in various biomedical applications, like the development of combinatorial anti-cancer platforms, efficient systems for endolysosomal escape, and nanoplatforms modulating lysosomal pH. As described herein, lysosomal interference was modulated with biodegradable DNs. Due to their excellent self-assembly properties, biocompatibility, and programmability, DNs have been recognized as versatile nanoplatform for tailored design of nanomaterials for various biomedical applications. Although DNs have been shown to successfully target lysosomes and modulate their function, there are no studies on using a single DN platform to modulate multiple lysosomal functions via lysosome interference. A 6-helix bundle (6HB) nanostructure was used as a platform for decoration with electrostatic peptide coatings, and functionalization with an endosome escape peptide sequence. After accumulation in lysosomes, DNs were degraded by lysosomal enzymes, and the products of degradation were released into the cytosol. Modulation of lysosomal function was observed due to lysosome interference, which originated via distinct protonation effects that were dependent on both the surface coating and the concentration of the DNs. As a result, using the same biodegradable DNs platform with different coatings, distinct cellular responses were able to be selectively stimulated, ranging from metabolic activity inhibition and immunomodulatory effects to cell death. One embodiment described herein is a method of selectively modulating lysosomal activity in a cell, the method comprising delivering to the cell a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with a peptide coating. In one aspect, the DN comprises a 6-helix bundle (6HB) nanostructure. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size. In another aspect, the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence having at least 90–99% identity to any one of SEQ ID NO: 7–11. In another aspect, the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence selected from any one of SEQ ID NO: 7–11. In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7). In another aspect, the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 9). In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide flanked by two copies of an aurein 1.2 peptide (SEQ ID NO: 10). In another aspect, the nanoparticle composition modulates lysosomal pH by inducing lysosomal acidification or alkalization in the cell. In another aspect, the nanoparticle composition does not induce lysosomal damage or lysosomal membrane permeabilization. In another aspect, the nanoparticle composition inhibits metabolic activity in the cell. In another aspect, the nanoparticle composition modulates the morphology of the cell. In another aspect, the nanoparticle composition modulates immune signaling pathways and immune-related protein expression in the cell. In another aspect, the nanoparticle composition is cytotoxic to the cell and decreases cell viability. In another aspect, the nanoparticle composition is stable in lysosomal compartments of the cell for up to about 24 h of incubation. In another aspect, the nanoparticle composition is enzymatically degraded in the cell by lysosomal enzymes. In another aspect, the nanoparticle composition is delivered to the cell at a concentration ranging from about 10 nM to about 500 nM. In some aspects, the nanoparticle composition may be delivered to the cell at a concentration ranging from about 10 nM to about 25 nM, about 25 nM to about 50 nM, about 50 nM to about 75 nM, about 75 nM to about 100 nM, about 100 nM to about 125 nM, about 125 nM to about 150 nM, about 150 nM to about 175 nM, about 175 nM to about 200 nM, about 200 nM to about 225 nM, about 225 nM to about 250 nM, about 250 nM to about 275 nM, about 275 nM to about 300 nM, about 300 nM to about 325 nM, about 325 nM to about 350 nM, about 350 nM to about 375 nM, about 375 nM to about 400 nM, about 400 nM to about 425 nM, about 425 nM to about 450 nM, about 450 nM to about 475 nM, or about 475 nM to about 500 nM, including all integers and endpoints within these specified ranges. In another aspect, the cell is incubated with the nanoparticle composition for a period of time of about 4 h to about 72 h. In some aspects, the cell may be incubated with the nanoparticle composition for a period of time of about 4 h to about 7 h, about 7 h to about 10 h, about 10 h to about 13 h, about 13 h to about 16 h, about 16 h to about 19 h, about 19 h to about 22 h, about 22 h to about 25 h, about 25 h to about 28 h, about 28 h to about 31 h, about 31 h to about 34 h, about 34 h to about 37 h, about 37 h to about 40 h, about 40 h to about 43 h, about 43 h to about 46 h, about 46 h to about 49 h, about 49 h to about 52 h, about 52 h to about 55 h, about 55 h to about 58 h, about 58 h to about 61 h, about 61 h to about 64 h, about 64 h to about 67 h, about 67 h to about 70 h, or about 70 h to about 72 h, including all integers and endpoints within these specified ranges. In another aspect, the nanoparticle composition further comprises a therapeutic agent. In another aspect, the nanoparticle composition further comprises one or more lysosomal acidification inhibitors or v-ATPase inhibitors. In another aspect, the cell is a cancer cell. It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof. Various embodiments and aspects of the inventions described herein are summarized by the following clauses: Clause 1. A method of selectively modulating lysosomal activity in a cell, the method comprising delivering to the cell a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with a peptide coating. Clause 2. The method of clause 1, wherein the DN comprises a 6-helix bundle (6HB) nanostructure. Clause 3. The method of clause 2, wherein the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. Clause 4. The method of clause 2, wherein the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6. Clause 5. The method of clause 2, wherein the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size. Clause 6. The method of clause 1, wherein the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence having at least 90– 99% identity to any one of SEQ ID NO: 7–11. Clause 7. The method of clause 1, wherein the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence selected from any one of SEQ ID NO: 7–11. Clause 8. The method of clause 7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7). Clause 9. The method of clause 7, wherein the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 9). Clause 10. The method of clause 7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide flanked by two copies of an aurein 1.2 peptide (SEQ ID NO: 10). Clause 11. The method of clause 1, wherein the nanoparticle composition modulates lysosomal pH by inducing lysosomal acidification or alkalization in the cell. Clause 12. The method of clause 1, wherein the nanoparticle composition does not induce lysosomal damage or lysosomal membrane permeabilization. Clause 13. The method of clause 1, wherein the nanoparticle composition inhibits metabolic activity in the cell. Clause 14. The method of clause 1, wherein the nanoparticle composition modulates the morphology of the cell. Clause 15. The method of clause 1, wherein the nanoparticle composition modulates immune signaling pathways and immune-related protein expression in the cell. Clause 16. The method of clause 1, wherein the nanoparticle composition is cytotoxic to the cell and decreases cell viability. Clause 17. The method of clause 1, wherein the nanoparticle composition is stable in lysosomal compartments of the cell for up to about 24 h of incubation. Clause 18. The method of clause 1, wherein the nanoparticle composition is enzymatically degraded in the cell by lysosomal enzymes. Clause 19. The method of clause 1, wherein the nanoparticle composition is delivered to the cell at a concentration ranging from about 10 nM to about 500 nM. Clause 20. The method of clause 1, wherein the cell is incubated with the nanoparticle composition for a period of time of about 4 h to about 72 h. Clause 21. The method of clause 1, wherein the nanoparticle composition further comprises a therapeutic agent. Clause 22. The method of clause 1, wherein the nanoparticle composition further comprises one or more lysosomal acidification inhibitors or v-ATPase inhibitors. Clause 23. The method of clause 1, wherein the cell is a cancer cell. EXAMPLES Example 1 Materials and Methods A detailed summary of the chemicals, fluorescent probes, assays, and antibodies utilized in this study is described below. The information, including manufacturers, catalogue numbers, and dilutions, can be found in Tables 1–4. Sequences of DNA staples and peptides used in the study are summarized in Tables 5 and 6 Table 1. Chemical Probes Reagent Catalog No Manufacturer Opti-MEMTM I Reduced Serum Medium 31985062 GibcoTM LipofectamineTM 3000 Transfection Reagent L3000001 Thermo Fisher Scientific Buffer RLT Buffer RDD 1011132 Qiagen RNeasy® Mini Kit 74106 Qiagen DNase I TaqManTM Fast Advanced Master Mix 4444557 Thermo Fisher Scientific RevertAid H Minus First Strand cDNA K1632 Thermo Fisher Scientific Synthesis Kit Water for Molecular Biology 3-07F04-I BioConcept RIPA Lysis Buffer, 10× 20-188 Millipore Phosphatase Inhibitor Cocktail 3 P0044 Sigma-Aldrich Protease Inhibitor Cocktail P8340 Sigma-Aldrich Micro BCATM Protein Assay Kit 23235 Thermo Fisher Scientific Acrylamide / Bis Solution, 29:1 (30% w / v) 10687.01 Serva Sodium dodecyl sulfate L3771 Sigma-Aldrich Ammonium Persulfate 17874 Thermo Fisher Scientific N,N,N′,N′-tetramethyl-ethylenediamine T9281 Sigma-Aldrich Resolving Gel Buffer 1610798 Bio-Rad Stacking Gel Buffer 1610799 Bio-Rad 4× Laemmli Sample Buffer 1610747 Bio-Rad 2-Mercaptoethanol 1610710 Bio-Rad Precision Plus Protein Dual Color Standards 1610374 Bio-Rad Precision Plus Protein WesternC Standards 1610376 Bio-Rad InvitrolonTM PVDF Filter Paper Sandwich LC2005 Thermo Fisher Scientific Bovine Serum Albumin A2153 Sigma-Aldrich Skim milk powder for blotting 42590.02 Serva Trizma® base T1503 Sigma-Aldrich Glycine G8898 Sigma-Aldrich Methanol 34885 Honeywell 10× TBS 1706435 Bio-Rad 10% Tween 20 Solution 1610781 Bio-Rad Clarity MaxTM Western ECL Substrate 1705062 Bio-Rad ClarityTM Western ECL Substrate 1705060 Bio-Rad alamarBlueTM HS Cell Viability Reagent A50100 Thermo Fisher Scientific Acridine Orange (10 mg / mL in water) A3568 Thermo Fisher Scientific Quantikine® QuicKitTM ELISA Human IFN- β QK410 R&D Systems HBSS (1×) 14025092 GibcoTM Table 2. Fluorescent Probes Catalog Dilution / Concentr Reagent No ation Manufacturer Hoechst 33342 Solution (20 mM) 62249 0.005 mg / mL Thermo Fisher Scientific Propidium Iodide Ready ProbesTM Reagent R37108 2 drops / mL Thermo Fisher Scientific MitotrackerTM Red CMXRos M7512 1:10000 Thermo Fisher Scientific LysoSensorTM Blue DND-167 L7533 1 µM Thermo Fisher Scientific LysoTrackerTM Blue DND-22 L7525 100 nM Thermo Fisher Scientific LysoTracker Red DND-99 L7528 100 nM Thermo Fisher Scientific CellLightTM Lysosomes-RFP, BacMam 2.0 C10597 30 particles per cell Thermo Fisher Scientific Table 3. Antibodies Antibody Clone / catalog No Dilution Manufacturer WB IF Cell Signalling Stat1 D1K9Y / 9172T 1:1000 N.A. Technology Stat1 C-136 / sc-464 1:1000 N.A. Santa Cruz Biotechnology phospho-Stat1 Cell Signalling (Ser727) D3B7 / 8826S 1:1000 N.A. Technology STING D2P2F / 13647S 1:1000 N.A. Cell Signalling Technology β-Actin 8H10D10 / 3700S 1:1000 N.A. Cell Signalling Technology Anti-Mouse IgG, Thermo Fisher HRP G21040 1:10000 N.A. Scientific Anti-Rabbit IgG, HRP Thermo Fisher Scientific WB – Western Blot, IF – immunofluorescence, N.A. – not applicable, HRP – horseradish peroxidase. Table 4. TaqMan Probes for qPCR Name Gene Assay ID Manufacturer TaqMan GAPDH FAM GAPDH Hs02786624_g1 Thermo Fisher Scientific TaqMan MX1 FAM MX1 Hs00895608_m1 Thermo Fisher Scientific TaqMan IFI27 FAM IFI27 Hs00271467_m1 Thermo Fisher Scientific TaqMan IFI6 FAM IFI6 Hs00242571_m1 Thermo Fisher Scientific TaqMan RSAD2 FAM RSAD2 Hs00369813_m1 Thermo Fisher Scientific TaqMan ISG15 FAM ISG15 Hs00192713_m1 Thermo Fisher Scientific TaqMan IFITM1 FAM IFITM1 Hs01652522_g1 Thermo Fisher Scientific Cell Culture The human hepatocellular cell lines Alexander (PLC / PRF / 5) (American Type Culture Collection, ATCC) and Huh7 (Japanese Collection of Research Bioresources, JCRB) and human hepatoblastoma cell line HepG2 (American Type Culture Collection, ATCC) were cultured in EMEM medium without L-Glutamine (BioConcept Ltd., Switzerland, cat. no. 1-31S01-I) supplemented with 10% fetal bovine serum (FBS, qualified, heat inactivated, Brazil, GibcoTM, cat. no.10500-064), 1% Penicilin-Streptomycin-Glutamine Solution 100× (Serana Europe GmbH, Germany, cat. no. RAL-001-100ML) in a humidified 5% CO2atmosphere at 37 °C. Cells were regularly checked for common culture contamination, such as Mycoplasma using MycoAlert Detection Assay (Lonza, Switzerland). All cell lines were authenticated by short tandem repeat (STR) DNA profiling (ATCC, Manassas, VA, USA). HEK293T cells (American Type Culture Colection, ATCC) were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% Penicilin-Streptomycin-Glutamine Solution 100x (Serana Europe GmbH, Germany, cat. no. RAL-001-100ML) in a humidified 5% CO2atmosphere at 37 °C. The human glioblastoma cell line U87MG was kindly provided by the Department of Neuroregeneration, Institute of Experimental Medicine of the Czech Academy of Sciences, v. v. i. The U87MG cells were cultured in DMEM / F12 medium (Gibco™, United Kingdom, cat. no.2331- 020) supplemented with 1% L-Glutamine 200mM (100×) (Gibco™, United Kingdom, cat. no. 25030-081), 10% fetal bovine serum (Fetal Bovine Serum, value (formerly USDA-approved in North America or qualified, Brazil in other regions), Gibco™, United Kingdom, cat. no. A5256701), and 1% Penicillin-Streptomycin (100×) (Gibco™, USA, cat. no. 15070-063) in a humidified 5% CO2atmosphere at 37 °C. Fabrication and Characterization of DNs DNs were synthesized and characterized as described previously. See Smolková et al., ACS Applied Mat. Interf.13: 46375-46390 (2021). Briefly, all oligonucleotides were obtained from Integrated DNA Technologies (Coralville, Iowa) and purified using 8% urea-based denaturing polyacrylamide gel electrophoresis (PAGE). One strand was labeled with AlexaFluor-488 for imaging in the agarose gels and in microscopy experiments. Each strand was added to a mixture at 5 µM in 1× Tris-acetic acid-EDTA (TAE) buffer with 12.5 mM MgCl2and annealed from 95 to 4 °C over 2 hours. The successful formation of the 6-helix bundle was confirmed using agarose gel electrophoresis. DN size and zeta potential were characterized utilizing a Zetasizer Nano (Malvern Instruments). DNs were dispersed in PBS, pH 7.4. The different DNA sequences used to make up the 6-helix bundle DN are shown in Table 5. Table 5. DNA Sequences Making up the 6-helix Bundle DN Name DNA Sequence (5′→3′) SEQ ID NO AGCGAACGTGGATTTTGTCCGACATCGGCAAGCTCCCTTTTTCGAC 6HB-BlueTATT1CCGATGTCGGACTTTTACACGATCTTCGCCTGCTGGGTTTTGGGAG 6HB-GreenCTTG2CGAAGATCGTGTTTTTCCACAGTTGATTGCCCTTCACTTTTCCCAG 6HB-YellowCAGG3AATCAACTGTGGTTTTTCTCACTGGTGATTAGAATGCTTTTGTGAA 6HB-Orange 4TCACCAGTGAGATTTTTGTCGTACCAGGTGCATGGATTTTTGCATT 6HB-Red 5CCTGGTACGACATTTTTCCACGTTCGCTAATAGTCGATTTTATCCA 6HB-PurpleTGCA-Alexa Fluor 4886Abbreviations: Alexa Fluor 488 – Alexa Fluor™ 488 dye Atomic force microscopy (AFM) images were captured using a Bruker Multimode 8 system with a Nanoscope V controller in ScanAsyst in Fluid mode, utilizing ScanAsyst-Fluid+ AFM probes (Bruker, k ~0.7 N / m, tip radius < 10 nm). A 2 μL sample was deposited on freshly cleaved mica, followed by the addition of 48 μL of 1× TAE with 12.5 mM Mg2+for 2 minutes. To enhance the adsorption of DNA nanostructures on the mica surface, the surface was pre-treated using a 1 mM NiCl2buffer. Peptide Synthesis and Characterization To obtain the molecules for coating the DNs, peptides were synthesized using Fmoc- based solid phase peptide synthesis (CEM Liberty Blue) and characterized via MALDI-TOF mass spectrometry (Bruker Microflex). The different peptides used for coating DNs are shown in Table 6. Table 6. Peptides Name Amino Acid Sequence SEQ ID NO K10KKKKKKKKKK7K10-FITCFluorescein-GSGKKKKKKKKKK8Aurein 1.2 Endosomal Escape Peptide (EE)GLFDIIKKIAESF9K10-EEGLFDIIKKIAESFGGKKKKKKKKKKGGFSEAIKKIIDFLG10K10-EE scrambleIKAFKGFDESILIGGKKKKKKKKKKGGILISEDFGKFAKI11DN Coating and Characterization The DNs (1 µM) were mixed with the desired K10-containing peptide (sequence: KKKKKKKKKK; SEQ ID NO: 7) at a 1:1 N:P ratio in PBS (pH 7.4) and incubated at room temperature for a minimum of 2 hours. In order to determine the optimal N:P ratio for complete coating of the DNs, the structures were electrophoresed using 1.5% agarose gels at 65 V for 60 minutes and imaged using a 1:10 mol ratio of fluorescein-labeled K10 (SEQ ID NO: 8) to K10 (SEQ ID NO: 7). Total Cellular Metabolic Activity Assay The alamarBlue reagent (Thermo Fisher Scientific, Waltham, MA, USA) was utilized to analyze metabolic activity of cells treated with DNs. AlamarBlue was successfully implemented in the assessment of metabolic activity of human cell lines in vitro. Briefly, the method is based on the enzymatic cleavage of resazurin to resorufin by metabolically active cells. This cleavage results in elevated alamarBlue color intensity. Subsequently, the percentage of metabolically active cells in the culture is calculated based on the absorbance. Metabolic activity assessment of cells was performed via the alamarBlue assay according to guidelines of the manufacturer. Cell lines (Alexander, HepG2 or Huh7) were grown in 96-well plates at the density of 5000 cells per well and incubated with different concentrations of DNs for 24, 48 or 72 h. Afterwards, the alamarBlue reagent was supplemented to each well, and plates were incubated for 2 h at 37 °C. The absorbance of the alamarBlue was measured by TECAN microplate reader SpectraFluor Plus (TECAN, Mannedorf, Switzerland) at 570 nm. Readings were done in triplicate, with three independent experiments performed for each measurement. Previously, it was checked that synthesized DNs do not interfere with the alamarBlue assay readout, providing reliable results. Cell Viability Analysis Cell viability was assessed by monitoring loss of plasma membrane integrity microscopically. Cells were treated with different DNs (10, 100, and 500 nM) for 24, 48 and 72 h. After the treatment, cells were stained with propidium iodide (PI) and the nuclei were counterstained with Hoechst 33342. As a membrane-impermeable dye, PI is typically excluded from viable cells. Conversely, cells with ruptured plasma membrane accumulate PI, where it stains nuclear DNA, amplifying its fluorescence by 20 to 30 times. Assessment of the plasma membrane integrity loss by PI staining is recognized as a universal indicator of cell death. Labeled cells were then imaged by confocal microscopy at 20× magnification, and the numbers of dead (PI-positive) cells and the total number (Hoechst-stained) of cells were counted using the ImageJ software (NIH, Bethesda, MD, USA). The viability was expressed as the ratio of PI-negative cells to total cells. Cell viability was calculated as a percentage of viable cells as follows: cell viability (%) = [number of Hoechst-stained cells – number of PI-positive cells] / [number of Hoechst-stained cells] × 100%. In total, n = 10–20 randomly selected fields per condition out of three independent experiments were assessed to achieve reliable statistical sampling. As a positive control, cells were treated with 20% ethanol for 60 min. Analysis of DN Degradation by Cells Using FRET Imaging An Olympus confocal imaging system (Olympus, Tokyo, Japan) was used for FRET measurements. Cells were grown in 6-channel µ-Slides (Ibidi, Martinsried) and incubated with 6HB containing FRET reporter dyes [6-carboxyfluorescein (FAM) donor and TAMRA acceptor] at a 50 nM concentration for distinct periods of time (24, 48, and 72 h). Briefly, the FAM probe in cells underwent excitation with a 488 nm laser, and fluorescence was gathered through a BA510- 550 filter (Olympus, Tokyo, Japan). Simultaneously, the FRET signal was detected using a BA575IF filter (Olympus, Tokyo, Japan). In the case of TAMRA probe imaging, a 561 nm excitation laser was employed, and emission was captured through a BA575IF filter (Olympus, Tokyo, Japan). Confocal images were analyzed for FRET efficacy using the “FRET and colocalization analyzer” ImageJ plug-in. “Colocalized FRET index” images, that present the calculated amount of FRET for each pixel in the FRET channel, were generated. Mean gray values of resultant “colocalized FRET index” images were measured using the ImageJ software (NIH, Bethesda, MD, USA). 6HBs containing either 6-carboxyfluorescein (FAM) donor or TAMRA acceptor only were used as negative controls. Lysosomal pH Measurements Semiquantitative confocal microscopy imaging was utilized for lysosomal acidity measurements. Cells (Alexander, HepG2 or Huh7) were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. After incubation, cells were labeled with lysosomal pH marker LysoSensor™ Blue DND-167 (Thermo Fisher Scientific, Waltham, MA, USA). The LysoSensor™ dyes function as acidotropic probes, seemingly concentrating in acidic organelles due to protonation. This protonation process yields an increase in fluorescence intensity. Consequently, the LysoSensor™ reagents demonstrate a pH-dependent elevation in fluorescence intensity when subjected to acidification. After staining, living cells were washed with PBS three times, and then immediately imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). The fluorescence intensity of LysoSensor was quantified using the ImageJ software (NIH, Bethesda, MD, USA). Data were collected from n = 50 cells out of three independent experiments. Cell Transduction To specifically label the lysosomes, CellLightTM Lysosomes-RFP, BacMam 2.0 (Thermo Fisher Scientific, Waltham, MA, USA) was used, a fusion construct of LAMP1, which enables accurate and specific targeting to cellular lysosomes with red fluorescent protein (RFP). Transduction was performed according to guidelines of the manufacturer. Typically, a multiplicity of infection (MOI) of 30 was employed for transfection at 37 °C for 24 h. The expression level of RFP protein was next confirmed by using fluorescence imaging prior to further experiments. Nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. Lysosomal size and circularity were measured using the ImageJ software (NIH, Bethesda, MD, USA). RNA Isolation and Real-Time PCR Alexander, HepG2 and Huh7 cells were treated with different DNs at 10 and 50 nM concentrations for 48 h. After the treatment, the total RNA from cells was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany), followed by DNA removal using RNase-Free DNase Set (Qiagen, Hilden, Germany). A Nanodrop One microvolume UV-Vis spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) was used to cross-check the integrity and quantity of the isolated RNA. Subsequently, cDNA was synthesized using Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). 2 µg of RNA was utilized to synthesize cDNA according to previously published protocols. Next, quantitative real-time PCR was performed on a QuantStudio™ 6 Flex Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) utilizing the Fast Advanced TaqMan Gene expression Master mix (Thermo Fisher Scientific, Waltham, MA, USA) and specific TaqMan Gene Expression Assays (Table 4). Data were assessed using MS Excel and the MaxStat Pro 3.6 software (MaxStat, Cleverns, Germany). The expression of target genes was normalized to GAPDH expression utilizing the 2−ΔΔCt methodology. Cell Extracts and Immunoblot Analysis An analysis of protein expression in samples of DN-treated cells (Alexander, HepG2 and Huh7) was conducted employing the semiquantitative method of immunoblot analysis. To achieve rapid and efficient cell lysis and protein solubilization, a radioimmunoprecipitation (RIPA) buffer from Millipore, Burlington, VT, USA, was used following both the manufacturer's instructions. To ensure the equal loading of proteins, the total protein concentration in cell lysates was determined using the Micro BCA Protein assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer's instructions. Subsequently, samples of whole-cell lysates were prepared with an equivalent protein concentration of 1 mg / mL. The protein samples were separated through SDS-PAGE and then transferred onto polyvinylidene difluoride (PVDF) membranes. Blocking of membranes was performed by incubating them with 5% (w / v) nonfat dried milk or alternatively with 5% (w / v) BSA for 1 hour. Following blocking, PVDF membranes were incubated overnight at 4 °C with various specific primary antibodies, as summarized in Table 3. Afterward, the membranes were washed in tris-buffered saline with 0.1% Tween® 20 detergent (TBST) buffer and incubated with the corresponding HRP-conjugated secondary antibody (Table 3) for 1 hour. the chemiluminescence signal was detected by the imaging system G:BOX CHEMI XRQ (Syngene, Synoptics Group, Cambridge, UK), using the acquisition software GeneTools (Syngene, Synoptics Group, Cambridge, UK). Densitometric quantification of the intensity of the bands was carried out using the GeneTools quantification software (Syngene, Synoptics Group, Cambridge, UK). Lysosomal Integrity Assay Cells were plated onto 96-well clear bottom plates at a density of 5000 cells per well. Following a 48-hour treatment of cells (Alexander, HepG2, or Huh7) with various concentrations (50 and 500 nM) of different types of DNs, lysosomal stability was assessed using an acridine orange (AO) assay. The AO assay adhered to a previously validated protocol, wherein cells with incorporated nanoparticles were labeled with 5 µg / mL AO in culture medium for 15 minutes at 37 °C. Following nanoparticle treatment, the intensity of orange fluorescence was measured using a microplate reader SpectraFluor Plus (TECAN, Mannedorf, Switzerland). Readings were done in triplicate. Three independent experiments were performed for each measurement. Normalized fluorescence data are presented as means ± SEM. Furthermore, lysosomal integrity was assessed microscopically through lysosomal labeling with LysoTracker Red (Thermo Fisher Scientific, Waltham, MA, USA). LysoTracker Red, known for its high selectivity for acidic organelles such as lysosomes, exhibits fluorescence intensity corresponding to its accumulation in these structures. Any ongoing lysosomal membrane permeabilization results in the loss of accumulated LysoTracker Red fluorescence signal. The reduction in fluorescence intensity was analyzed using a confocal imaging system (Olympus, Tokyo, Japan). Mitochondrial Damage Assessment Mitochondrial damage was assessed by detection of elevated mitochondrial reactive oxygen species (ROS). Mitochondrial ROS were measured using flow cytometry. Cells (Alexander, HepG2 or Huh7), were treated with different types of DNs (at 50 and 500 nM concentrations) for 48 h, stained with 5 μM MitoSOX Red (Thermo Fisher Scientific, Waltham, MA, USA) for 10 min and analyzed by flow cytometry. Flow cytometry measurements were conducted utilizing a CytoFLEX flow cytometer B53013 (Beckman Coulter, Brea, CA, USA). The acquired data were analyzed using CytExpert software (Beckman Coulter, Brea, CA, USA). MitoSOX Red was excited by a 488 nm laser, and data were collected at forward and side scatter, specifically in the fluorescence channel 582 / 42 nm (FL2). The fluorescence of MitoSOX Red was measured the FL2 channel. Cell debris, identifiable by a distinctive low forward scatter, was excluded from the analyses through gating procedures. High-Resolution Spinning Disk Confocal Microscopy In order to be able to reveal clear subcellular details of DNs localization, a novel IXplore SpinSR Olympus high-resolution imaging system (Olympus, Tokyo, Japan) was utilized. 6- channel µ-Slides (Ibidi, Martinsried) were utilized for cell seeding. Afterwards, cells were treated with different concentrations of fluorescently-labelled DNs. Next, cells were stained for specific cellular structures using fluorescent probes, as summarized in Table 2. The imaging system consists of the following units: an inverted microscope (IX83; Olympus, Tokyo, Japan) and a spinning disc confocal unit (CSUW1-T2S SD; Yokogawa, Musashino, Japan). Fluorescence data for image reconstruction were collected via either a 100× silicone immersion objective (UPLSAPO100XS NA 1.35 WD 0.2 silicone lens, Olympus, Tokyo, Japan) or a 20× objective (LUCPLFLN20XPH NA 0.45 air lens, Olympus, Tokyo, Japan). The following lasers were used to excite fluorophores: 405 nm laser diode (50 mW), 488 nm laser diode (100 mW), and 561 nm laser diode (100 mW). Confocal images were acquired at a 2,048 ×  2,048-pixel resolution. The fluorescent images were collected by appropriate emission filters (BA420-460; BA575IF; BA510- 550; Olympus, Tokyo, Japan) and captured concurrently by two digital CMOS cameras ORCA- Flash4.0 V3 (Hamamatsu, Hamamatsu City, Japan). Fluorescence confocal images were acquired using software cellSens (Olympus, Tokyo, Japan). Quantitative image analysis was performed by selecting randomly ∼ 5–10 visual fields per each sample, using the same setting parameters (i.e., spinning disk speed, laser power and offset gain). Spinning Disk Super-Resolution Microscopy To analyze visualize lysosomes in living cells with high resolution and contrast, the IXplore SpinSR Olympus super-resolution imaging system (Olympus, Tokyo, Japan) was used. Cells (Alexander, HepG2 or Huh7) were seeded in 6-channel µ-Slides (Ibidi, Gräfelfing, Germany). Next, cells were treated with different types of DNs (at 50 nM concentration) for either 24 or 48 h. To visualize lysosomes, cells were transduced with CellLight® LAMP1-RFP. Fluorescence images were acquired using the cellSens acquisition software (Olympus, Tokyo, Japan). ImageJ software (NIH, Bethesda, MD, USA) was used for image processing and analysis. Image Quantification To measure lysosomal size and circularity, cells were stained with LysoTracker Red and CellLight® LAMP1-RFP (both probes from Thermo Fisher Scientific, Waltham, MA, USA). Nuclei were counterstained with Hoechst 33342 (Thermo Fisher Scientific, Waltham, MA, USA). The stained cells were imaged using spinning disk confocal microscopy IXplore SpinSR (Olympus, Tokyo, Japan). The average lysosomal size per cell was measured using ImageJ software (NIH, Bethesda, MD, USA), and lysosomal circularity was assessed using the particle analyzer plugin in ImageJ software. To investigate the release of DNs from lysosomal compartments, colocalization analysis was conducted. Following the incubation, cells were labeled with the lysosomal marker LysoTracker® Blue DND-22 (Thermo Fisher Scientific). The stained cells were subsequently analyzed using the abovementioned confocal system. Fluorescence images were captured using the cellSens software (Olympus, Tokyo, Japan). For a quantitative assessment of colocalization, the Pearson correlation coefficient was calculated. This coefficient provides a robust estimate of the overall association between probes, measuring pixel-by-pixel correlation and normalized mean values ranging from -1 (anticorrelation) to 1 (correlation). The calculation of the Pearson correlation coefficient was performed using the Coloc 2 tool available in ImageJ. Generation of 3D Multicellular Aggregates of Cancer Cells. 3D multicellular aggregates were created utilizing a hanging drop technique. In summary, Huh7, HepG2, Alexander, and glioblastoma cells were separately suspended in complete culture medium (DMEM / F12 with 10% FBS). Then, the suspensions (20000 cells / well) were seeded to BIOFLOAT™ 96-well Cell Culture Plate with Ultra-low attachment surface (faCellitate, cat. no. F202003). To achieve the aggregation of cells, cells were cultured for 3 days with media change after 2 days in culture. At day 4, the generated multicellular aggregates were treated with different types of DNs (at 500 nM concentration) for 48 h. After the treatment, multicellular aggregates were stained with propidium iodide (PI) and nuclei were counterstained with Hoechst 33342. Labeled cells were then imaged by confocal microscopy. Statistical Analysis Cellular viability and metabolic activity were analyzed and represented as mean ± SEM. The ANOVA analysis with subsequent Newman-Keuls test was utilized to assess the statistical significance of differences between the groups. MaxStat Pro 3.6 software (MaxStat Software, Germany) was used to perform all statistical analyses. Differences were considered statistically significant at (*) P  < 0.05. Quantitative assessment of fluorescence microscopy analysis, specifically evaluating lysosomal acidity, size, circularity, and DNA nanostructure-lysosome colocalization, adhered to well-defined guidelines. Guidelines for quantitative confocal microscopy, were employed for this analysis. The quantitative microscopy analysis utilized images from three independent experiments, with each experiment encompassing 10 randomly selected fields from each sample. The determination of the sample size followed a statistical methodology outlined in a prior publication. Accordingly, the sample size for 95 % confidence level and 0.9 statistical power is calculated as n = 30. Therefore, a minimum of 30 randomly selected cells were analyzed for statistically relevant fluorescence microscopy image quantification. The determination of the sample size was based on a statistical methodology assuming a 95% confidence level and 0.9 statistical power. Example 2 Synthesis and Characterization of Peptide-Coated DNA Nanostructures To test the hypothesis that DNA nanostructures can interact and selectively modulate lysosomal functions in living cells, a 6-helix bundle (6HB) platform was used (FIG. 1A). This bundle is a rigid and monomeric DNA nanostructure, roughly 7 × 6 nm in size (FIGS.1A and 14). Overall, DNA nanotechnology enables the design and synthesis of versatile tools for various biomedical applications, but one advantage of the 6HB structure is that it is small (consisting of just six strands), which enables relatively high concentrations of particles to be used, and it is easy to form in a simple annealing step. The 6HB nanoplatform has also been found to selectively interact with several cell types. 6HB nanostructures may form nanopores in cellular membranes after modification with hydrophobic moieties, via changes in the lipid bilayer structure. It was previously shown that such structures effectively target lysosomes in living cells, but it was not explored whether they possess long-lasting effects on lysosomes, and whether 6HB can be used as a versatile platform for modulating the lysosomal functions. It is worth noting that DNA nanoplatforms were shown to control only a single specific lysosomal function. Intriguingly, proton-driven self-assembly of DNA nano-frameworks recently were found to modulate several functions of lysosomes. In the cited study, the DNA nanoplatform was self-assembled inside lysosomes, leading to a reduction in acidity and an inhibition of hydrolase activity. It was hypothesized that utilizing a self-assembled, biodegradable DNA nanostructure system would enable control over lysosomal functions upon its enzymatic degradation (FIG.1B). Given the fact that the 6HB nanostructure can be easily functionalized with bioactive peptides via cationic oligolysine peptide interactions, this platform was used in the current study to affect lysosomal activity (FIG.1). It has been shown that the 6HB can be easily coated with a decalysine peptide (K10) (SEQ ID NO: 7), or with a peptide that flanks a central K10 block with two copies of an aurein 1.2 peptide (a known endosomal escape sequence, SEQ ID NO: 9); termed K10-[aurein 1.2]2 peptide or “EE” (sequence:GLFDIIKKIAESFGGKKKKKKKKKKGGFSEAIKKIIDFLG; SEQ ID NO: 10) (FIG. 1A). It is important to highlight that coating DNs with oligolysine has been shown to significantly enhance their stability against denaturation under physiological conditions, without causing any noticeable distortion or aggregation of the structures. The use of oligolysine offers several advantages, primarily due to the simplicity and efficiency of the synthesis process. This method leverages electrostatic interactions, making it straightforward to implement. The coating is easily achieved by mixing stock solutions of DNs and oligolysine at appropriate stoichiometric ratios, followed by a brief incubation at room temperature. Building on this approach, the strategy was extended to coat DNs with a functional endosome escape peptide, specifically aurein 1.2. This was accomplished by flanking a central K10 block with two copies of the aurein 1.2 peptide, which allowed us to improve the synthesis yield and accelerate the peptide coating process. Thus, in this study three types of DNs were used: bare 6HB nanostructures, K10-coated 6HBs, and EE- coated 6HBs. The K10-coated 6HBs served as control DNs to demonstrate that the observed cellular effects were specifically due to the K10-[aurein 1.2]2 coating, rather than the decalysine peptide alone. The physicochemical properties of these three DNs were previously characterized, and a summary of these parameters is presented in FIG. 14. Briefly, 6HB is a platform for decoration with peptides. It can be synthesized with a high production yield through a straightforward annealing process (FIG.34A). The resulting bundle structure, approximately 7 x 6 nm in size, is a rigid monomeric assembly (FIG. 34A–D). 6HB can be easily coated with designed peptides via electrostatic interactions (FIG. 34B–D). Apart from differences in zeta potential resulting from the different coatings, the DNs also showed slightly different mean hydrodynamic diameters: 13.5 nm, 20 nm, and 28.5 nm for the 6HB, K10 and EE nanostructures (FIGS.34C, FIG.14, and FIG.36) respectively. The greater diameter for the latter two structures is in line with their expected sizes given the respective peptide coatings. An assessment of DNs using AFM and dynamic light scattering (DLS) revealed that all three types of DNs structures in buffer solution are predominantly monodisperse, with minimal aggregation (FIG. 34C–D). This indicates that the peptide coating did not induce particle aggregation. Furthermore, size distribution analysis of all three types of DNs by DLS after one month of storage showed similar size profiles (FIGS.37–39), demonstrating the stability of the DNs following peptide coating and during prolonged storage. While coating DNs with oligolysine peptides was successfully demonstrated in previous studies, the current work marks a significant advancement by being the first to incorporate the endosome escape signal aurein 1.2 into the design. Additionally, the current approach utilizes a simple, bundle nanostructure composed of only six strands. This streamlined design offers several advantages over traditional DNA origami nanostructures, which typically consist of around 200 strands. The method is not only more cost-effective and scalable but also holds greater potential for in vivo applications. Unlike DNA origami, which requires complex addressability and precise control over size, shape, curvature, and aspect ratio, the six-strand bundle provides a more straightforward and efficient alternative when such intricate features are not necessary. This in turn makes the design a more practical option for a wider range of research and therapeutic applications. Biocompatibility of Peptide-Coated DNA nanostructures The sequestration of nanomaterials by the liver upon systemic administration represents a challenge for their successful clinical translation. On the other hand, the liver stands out as a crucial target organ for diverse nanoparticle-mediated therapies. These treatments have been employed in addressing a range of liver-related conditions, including hyperlipidemia and viral infections. Thus, it is important to study DN interactions with distinct liver cell types, but studies on DN-hepatic cell interactions are rather limited in the current literature. It was previously shown that all three types of DNs (6HB, K10 and EE) are not toxic for hepatic cell lines (Alexander, HepG2 and Huh7), at concentrations up to 500 nM for a short period of time (24 h of treatment). However, long-lasting effects of DNs on metabolic activity of cells was not assessed, and potential long-term cytotoxicity. In this study the impact of these three types of DNs on the metabolic activity of hepatic cell lines (HepG2, Huh7, and Alexander cells) was first analyzed after prolonged treatment. To assess the metabolic activity, an alamarBlue assay was used, based on enzymatic cleavage of resazurin to resorufin by metabolically active cells. Short term incubation (i.e., 24 h) with all three types of DNs (with concentrations as high as 500 nM) did not affect cellular metabolism in these three cell lines (FIG.2). By contrast, 48 h of treatment with aurein-coated DNs (EE) at a 500 nM concentration triggered dramatic inhibition in the metabolic activities of all three cell lines (FIG. 2). Interestingly, the K10-coated DNs had a considerably lower effect on metabolic activity inhibition compared with the EE-coated nanostructures (FIG.2). Treatment with K10 DNs at a concentration of 500 nM for 48 hours reduced metabolic activity by up to 40% in all three cell lines, whereas EE DNs achieved more than 80% inhibition (FIG. 2). These findings suggest that coating the 6HB with different peptides results in varying cellular outcomes. EE DNs could have a greater effect on lysosomal activity compared to K10 DNs due to the more significant disruption of lysosomal function caused by the aurein peptide. The Huh7 cell line was found to be the most susceptible to EE DN treatment, showing an inhibitory effect on metabolic activity at concentration of only 100 nM after 48 h (FIG. 2C). Additionally, K10 at 100 nM after 72 h of incubation slightly inhibited the metabolism of Huh7 cells (FIG. 2). These data imply that the genetic background of even closely related cell lines is important to consider when comparing effects of DNs. Although HepG2, Huh7, and Alexander cells resemble the epithelial morphology of hepatic cells, they show differences in gene and protein expression. It is important to note that cell assays based on metabolic readouts do not provide reliable information about the extent of cell death. For instance, early-phase apoptosis events (e.g., mitochondrial damage, elevated ATP levels) can proceed without cell death execution. Therefore, to verify the cytotoxic potential of DNs, an end-point cell death marker was further assessed, the loss of plasma membrane integrity. To this end, a propidium iodide (PI) exclusion assay was performed. Assessment of the plasma membrane integrity loss by PI staining is recognized as a universal indicator of cell death. In line with the metabolic activity findings (FIG.2), PI staining revealed that short-term incubation (i.e., 24 h) with all three types of DNs (with concentrations up to 100 nM) did not elicit cytotoxicity in HepG2, Huh7, and Alexander cells (FIG.3). Treatment with EE DNs at a concentration of 500 nM induced a time-dependent cytotoxic response starting after 24 h of incubation in all three cell lines (FIG.3). Slight toxicity was observed in Huh7 cells treated with 500 nM of K10 DNs after 72 h of incubation (FIG. 3C). However, this toxicity was mild in comparison with the drastic effect that the K10 DN samples exerted on metabolic activity in Huh7 cells (FIG.3C). It was concluded that both K10 and EE nanostructures at high concentrations and prolonged incubation times, showed significant time-dependent inhibitory effect on metabolic activity of all three cell lines (FIG.2). However, only the EE DNs elicited profound time-dependent cytotoxicity at high concentrations of 500 nM (FIG.3). Example 3 Intracellular Enzymatic Degradability of DNA Nanostructures Like most nanoparticles upon uptake by cells, DNs will end up in lysosomes. Lysosomes, organelles containing over 60 distinct hydrolases, are known to play a crucial role in facilitating the breakdown of extracellular particles and intracellular components. In fact, the considerable resilience of diverse DNA nanostructures has been demonstrated by numerous research, indicating that they persist unchanged in various physiological environments, and even inside cells for a minimum of 24 hours. It was previously shown that the three types of DNs explored herein (i.e., 6HB, K10 and EE) colocalize with lysosomes after cellular uptake and stay structurally intact for up to 24 h of treatment time. However, DN structural stability can be affected by temperature, exposure time, and nanostructure design. Thus, it was next assessed whether DNs can be degraded by cells after prolonged incubations. To analyze the intracellular stability of DNs, a Förster resonance energy transfer (FRET)-based technique was used that was previously successfully adopted for assessment of 6HB stability (FIG.4A). DNs are labeled with pair of the FRET reporter dyes; structurally intact DNs keep the dyes in close proximity, resulting in a high FRET efficiency, whereas upon degradation and disassembly of the DN structure the distance between donor and acceptor dyes increases, subsequently leading to a decrease in FRET efficiency (FIG.4A). For the FRET analysis, 6HB structures labelled with FRET reporter dyes (6- carboxyfluorescein (donor) and TAMRA (acceptor)) were used. This FRET pair is characterized by a Förster distance of ∼5 nm, which enables sensitive detection of DN structural changes by monitoring FRET efficiency. In fact, prolonged treatment of cells with a 50 nM concentration of DNs for 48 and 72 h resulted in dramatic decrease in FRET (FIGS.4B, 15–17). In order to validate that single FRET reporter dyes do not interfere with resultant FRET efficiency, DNs labeled with either donor-only or acceptor-only fluorophores were used, which served as negative controls (FIG.18). These data imply that after 48 h of treatment, cells enzymatically degrade DNs, leading to dramatic structural changes after 72 h of incubation (FIGS.4B, 15–17). In a previous study, it was found that DNs are stable within living cells for the shorter incubation period of 24 h. Example 4 Modulation of Lysosomal Activity by DNA Nanostructures It is worth noting that the biodegradability of various nanomaterials is being utilized in therapeutic strategies to either deliver active drugs or modulate / restore lysosomal functions via the products of nanoparticle degradation. Additionally, biodegradability quite often is associated with biocompatibility and / or low toxicity of the material. Thus, it was hypothesized that biodegradable DNs (FIG.4B), which do not elicit cytotoxic response at concentrations up to 100 nM (FIG.3), may be used as a platform to modulate lysosomal activity. Additionally, EE DNs contain approximately 42 copies of the aurein 1.2 peptide (sequence: GLFDIIKKIAESF; SEQ ID NO: 9), which was shown to effectively deliver cargos to the cytosol by inducing endolysosomal escape via membrane disruption. Of note, this membrane permeation was not associated with triggering a cytotoxic response. It was previously shown that protein corona formation hinders the capability of aurein to induce endolysosomal escape. However, in that study, the effect of protein corona only after a short (24 h) period of treatment was assessed. Generally, with different nanomaterials it has been shown that prolonged treatment results in the degradation of the protein corona in lysosomes, which may lead to the reappearance of nanoparticle activity, including cytotoxicity. In fact, one recent study showed that nanoparticles and their protein corona are separated and sorted into distinct vesicles intracellularly. Having found that DNs are degraded by cells after prolonged incubation, it was hypothesized that the particles might elicit distinct effects on lysosomal function via the peptide coating that is co- delivered along with the nanostructure. Thus, it was checked whether prolonged incubation with DNs may have an effect on their retention in lysosomes, and whether the aurein coating would impact endolysosomal escape. Additionally, it was determined that 48 h was the appropriate time point where DN degradation shows a significant effect (FIG. 4B). One reliable and robust method to study endolysosomal escape is microscopic colocalization imaging analysis. DNs with green fluorescence-labelled DNA and a lysosomal fluorescent probe (LysoTracker® Blue DND-220) were used to observe nanostructures and endo / lysosomes, respectively, through confocal microscopy. Indeed, colocalization of three types of DNs with lysosomes showed marked decrease in all three cell lines after 48 h, compared with 24 h of incubation (FIG. 4C). This finding suggests that the products of DN lysosomal degradation are being released from lysosomes after prolonged incubation. Furthermore, the aurein coating significantly enhanced DN release from lysosomes in comparison with the K10 and 6HB samples (FIGS.4D, 19–21). Taken together, these results indicate that prolonged incubation with DNs leads to the lysosomal degradation of the particles with some of the degradation products being released from the lysosomes. Additionally, the aurein coating enhances endolysosomal escape following extended incubation. Next, the effect of DNs on lysosomal functionality was explored, including lysosomal acidity and integrity of the lysosomal membrane. LysoSensor Blue DND-167, a pH-dependent probe, was utilized to semiquantitatively assess the pH in lysosomes. LysoSensor Blue DND-167 has been shown to reliably assess lysosomal pH in living cells, markedly enhancing the fluorescence intensity upon increase in lysosomal acidity. Semiquantitative confocal microscopy analysis showed that 24 h treatment with all three DNs types strongly increases the fluorescence intensity of the LysoSensor probe, indicating enhanced lysosomal acidity (FIG. 5A and 22). Current evidence suggests that maturation of endosomes into lysosomes during nutrition and / or nanoparticle uptake is associated with increased acidification of vesiculas, creating acidified compartments for effective degradation and recycling of cellular components and / or engulfed material. Furthermore, nutrient turnover is known to enhance lysosomal activity by increasing acidification and delivery of hydrolases, which is needed to facilitate lysosomal degradation, so it is not surprising that DN short-term uptake is associated with an increase in lysosomal acidity (FIG.5A and 22). Longer incubation with 6HB revealed that lysosomal acidity restores back to the control levels after 48 h of treatment (FIG.5B and 22). Given the observation of significant degradation of DNs by this time point (FIG. 4B), this result suggests stabilization of pH after facilitation of lysosomal degradation. Interestingly, K10 DN treatment for 48 h led to sustained lysosomal acidification (FIG.5B and 22). By contrast, prolonged incubation of EE DNs with cells resulted in moderate alkalization of lysosomal pH (FIG.5B and 22). It is worth noting that these lysosomal pH changes were not associated with the induction of lysosomal membrane permeabilization upon treatment with all three types of DNs (FIG.5B). In other words, K10 DNs induced acidification and EE DNs induced alkalization of lysosomal pH, without lysosomal damage, which could potentially trigger cell death. When the pH within lysosomes approaches the nearly neutral pH found in the cytosol, there is a potential for the lysosomal membrane to undergo lysis. Emerging evidence suggests that various cationic nanoparticles may induce buffering of the lysosomal pH, mitigating endolysosomal escape, a hypothesis termed the “proton sponge” effect. Buffering of the lysosomal pH has been found for distinct nanomaterials, like poly-(ethylenimine), ethylenediamine, DNA nanoframeworks, cationic gold nanorods, and silver nanocrystallites. In this case, the alkalization of lysosomal pH is presumably due to functionalization with the aurein peptide. Bare 6HB DNs do not induce a disturbance in lysosomal pH after 48 h (FIG. 4A), and short-term treatment with 6HB induces acidification of lysosomes due to the endocytic process (FIG.5A). Only the aurein coating results in alkalization of the lysosomal pH without lysosomal damage (FIG. 5). It is worth noting that aurein 1.2 has been shown to have endolysosomolytic properties. In fact, endolysosomolytic agents are known to induce loss of acidity and membrane leakage of endo / lysosomes. The precise mechanism of aurein action on membranes is not fully understood. One hypothesis, termed the “carpet mechanism,” postulates that aurein interacts with the membrane surface in a way that facilitates the interaction of hydrophobic residues with lipid tails, while hydrophilic residues engage with polar lipid head groups. Another hypothesis proposes pore formation by aurein. Of note, membrane leakage induced by aurein was found to enhance endolysosomal escape without massive membrane disruption, and without leading to cytotoxic effects. Thus, summarizing these data and the current literature about the action of aurein, it can be concluded that the peptide, which is presumably released from the DN, modulates the alkalization of lysosomal pH. Furthermore, K10-coated DNs, in addition to modulating lysosomal pH, induce acidification (FIG. 5A) without concomitant disruption of the lysosomal membrane (FIG. 5B). Interestingly, specific amino acid supplementation, including lysine, has been found to induce vacuolar-type H+-ATPase (a proton-pumping membrane protein) activation, resulting in lysosomal acidification. Thus, it is reasonable to posit that K10 release during DN degradation stimulates acidification of lysosomes. To further validate the effects of DNs on lysosomal pH and activity, morphodynamic assessment of lysosomes was performed. Under normal physiological conditions, alterations in nutrients lead to a temporary increase in lysosomal size, followed by a reduction. This phenomenon is attributed to membrane fusion and subsequent fission events. Upon the completion of lysosomal degradation, lysosomes revert to their typical small sizes through a process known as lysosomal reformation. Alternatively, elevations in both vesicular content and osmolarity can lead to the enlargement of the lysosomal compartments. Uncontrolled progressive accumulation of undigested materials and osmotic imbalance may eventually result in lysosomal rupture. In order to more accurately analyze lysosomal dynamics, ready-to-use construct CellLight Lysosomes-RFP BacMam 2.0 was used, which enables robust and efficient labeling of lysosomes via expression of a fusion construct of LAMP1 (lysosomal associated membrane protein 1) with red fluorescent protein (RFP) in live cells. Analysis of lysosomal size upon DN uptake revealed that, after 24 h of treatment with 50 nM of all three types of DNs, lysosomal size increased (FIG.6A–B and 23–24). Longer incubation (48 h treatment) with 6HB and K10 showed signs of lysosomal reformation, i.e., lysosomal size reverted back to the original size (FIGS.6A– B and 23, 24). It is worth noting that the observed lysosomal reformation may suggest that 6HB and K10 DNA nanostructures are integrated into the lysosomal nucleic acid catabolism pathway. This is further supported by the cytosolic release of DN degradation products (FIG.4C), indicating that these structures are likely processed and broken down within the lysosome before being released into the cytosol. Conversely, EE treatment resulted in sustained lysosome enlargement after 48 h of treatment (FIGS.6A–B and 23). Interestingly, neither type of DN changed lysosomal circularity (FIG.6B). Analysis of lysosomal size supports lysosomal pH assessment, indicating that the peptide decoration of the DNs, and not DNA vehicle itself, affects lysosomal functionality. Example 5 Low Concentrations of DNA Nanostructures Modulate Immune Signaling in Hepatic Cells Accumulating evidence suggests that alteration of lysosomal function can be a contributing factor to inflammation. For instance, the release of undegraded substrates, such as DNA or lysosome hydrolases, from compromised lysosomes has been demonstrated to trigger inflammatory responses. Indeed, enlarged lysosomes have been shown to induce cell stress and / or inflammation. Additionally, free DNA is a well-known trigger for the type-I interferon inflammatory response. Thus, it was hypothesized that it should be plausible to utilize DNs for immune signaling modulation. Next, whether the treatment with DNs leads to upregulated expression of main interferon- stimulated genes (ISGs) was analyzed using qPCR. It was found that only EE treatment at 50 nM for 48 h resulted in significant upregulation of IFI6 gene (FIG.7A). However, other ISGs (e.g., RSAD2, ISG15, IFITM1, IFI27 and MX1) were not affected by EE treatment (Tables 7–9). Cell treatment with either 6HB DNs or K10 DNs did not affect ISG expression (FIG.7A and Tables 7– 9). Next, the JAK-STAT signaling pathway was assessed (a well-known regulator of the interferon-mediated inflammatory response). Immunoblot analysis revealed that all three types of DNs induced upregulation of the STAT1 protein (FIG.7B). However, no consistent pattern in the triggering of the phosphorylated, active form of STAT1, pSTAT1, by DNs was observed (FIG. 7B–C). In Huh7 cells, only EE DNs induced STAT1 activation (FIG.7B–C). Stimulation of HepG2 cells with both K10 and EE DNs resulted in STAT1 activation (FIG. 7B–C). By contrast, in Alexander cells pSTAT1 expression was insensitive to DN stimulation (FIG.7B–C). These data imply that while DNs induce endogenous STAT1 upregulation, it is not clear why EE DNs treatment stimulated IFI6 gene expression (FIG.7A). Table 7. Quantitative PCR results for selected inflammation related genes expression in Alexander cells Treatment Expression value RSAD2 ISG15 IFITM1 IFI27 MX1 Control 1.16 ± 0.22 1.35 ± 0.31 1.07 ± 0.12 1.18 ± 0.22 1.19 ± 0.23 Pos control 9727.20 ± 175.88 ± 79.24 ± 1361.65 ± 6832.61 ± 1514.69 (***) 38.36 (***) 16.94 (***) 86.47 (***) 269.76 (***) 10 nM 1.10 ± 0.32 2.24 ± 0.82 1.43 ± 0.37 0.49 ± 0.24 0.81 ± 0.18 nM 2.05 ± 0.86 1.37 ± 0.44 1.17 ± 0.33 0.88 ± 0.02 1.09 ± 0.18 EE 10 nM 1.78 ± 0.52 1.46 ± 0.31 1.25 ± 0.18 1.17 ± 0.05 1.31 ± 0.15 6HB 50 nM 1.20 ± 0.23 1.48 ± 0.31 1.55 ± 0.26 0.70 ± 0.12 2.42 ± 0.77 K1050 nM 1.60 ± 0.59 1.75 ± 0.25 1.92 ± 0.17 0.50 ± 0.13 2.19 ± 0.74 EE 50 nM 1.16 ± 0.58 1.69 ± 0.19 1.76 ± 0.15 0.70 ± 0.23 2.10 ± 0.62 Relative expression of selected genes was determined in cells 48 h after treatment with different DNs at 10 and 50 nM concentrations. GAPDH was used as internal control. Results are presented as mean ± SEM (n = 3). Differences were considered significant at (**) P < 0.01 and (***) P < 0.001. Transfection with IFNL4 was used as positive control. The relative gene expression was normalized to GAPDH expression and calculated using the 2−ΔΔCT method. Table 8. Quantitative PCR results for selected inflammation related genes expression in HepG2 cells Treatment Expression value RSAD2 ISG15 IFITM1 IFI27 MX1 Control 1.04 ± 0.16 1.02 ± 0.04 1.01 ± 0.02 1.03 ± 0.13 1.01 ± 0.09 Pos control 9885.96 ± 74.30 ± 174.26 ± 9835.97 ± 6.02 ± 0.43 3586.33 (***) 22.62 (***) 39.93 (***) 959.24 (***) (***) 6HB 10 nM 0.64 ± 0.39 0.88 ± 0.44 0.30 ± 0.11 1.07 ± 0.15 1.10 ± 0.23 K1010 nM 0.75 ± 0.45 0.93 ± 0.50 0.34 ± 0.14 0.95 ± 0.19 0.74 ± 0.03 EE 10 nM 1.06 ± 0.71 1.12 ± 0.49 0.43 ± 0.15 1.15 ± 0.24 0.88 ± 0.05 6HB 50 nM 0.43 ± 0.21 0.61 ± 0.21 0.84 ± 0.31 1.16 ± 0.38 0.70 ± 0.07 K1050 nM 0.81 ± 0.33 0.59 ± 0.20 0.78 ± 0.26 0.89 ± 0.34 0.65 ± 0.09 EE 50 nM 1.59 ± 0.65 0.58 ± 0.27 0.77 ± 0.32 1.13 ± 0.41 0.77 ± 0.02 Relative expression of selected genes was determined in cells 48 h after treatment with different DNs at 10 and 50 nM concentrations. GAPDH was used as internal control. Results are presented as mean ± SEM (n = 3). Differences were considered significant at (**) P < 0.01 and (***) P < 0.001. Transfection with IFNL4 was used as positive control. The relative gene expression was normalized to GAPDH expression and calculated using the 2−ΔΔCT method. Table 9. Quantitative PCR results for selected inflammation related genes expression in Huh7 cells Treatment Expression value RSAD2 ISG15 IFITM1 IFI27 MX1 Control 1.01 ± 0.03 1.02 ± 0.03 1.04 ± 0.05 1.03 ± 0.06 1.02 ± 0.04 3214.81 ± 47.78 ± 474.45 ± 57.79 ± 733.68 ± Pos control 457.33 (***) 10.84 (***) 47.90 (***) 23.04 (***) 181.64 (***) 6HB 10 nM 0.55 ± 0.35 0.68 ± 0.23 0.84 ± 0.25 1.57 ± 0.14 0.79 ± 0.15 K1010 nM 0.97 ± 0.55 0.83 ± 0.28 1.08 ± 0.27 1.45 ± 0.10 0.75 ± 0.08 EE 10 nM 2.49 ± 1.40 1.17 ± 0.58 1.69 ± 0.83 1.51 ± 0.15 0.62 ± 0.08 6HB 50 nM 1.03 ± 0.42 0.59 ± 0.30 1.31 ± 0.52 0.96 ± 0.21 0.80 ± 0.06 K1050 nM 0.96 ± 0.37 0.66 ± 0.36 1.35 ± 0.34 1.45 ± 0.20 0.89 ± 0.10 EE 50 nM 1.17 ± 0.43 1.05 ± 0.39 2.09 ± 0.75 1.69 ± 0.04 0.95 ± 0.11 Relative expression of selected genes was determined in cells 48 h after treatment with different DNs at 10 and 50 nM concentrations. GAPDH was used as internal control. Results are presented as mean ± SEM (n = 3). Differences were considered significant at (**) P < 0.01 and (***) P < 0.001. Transfection with IFNL4 was used as positive control. The relative gene expression was normalized to GAPDH expression and calculated using the 2−ΔΔCT method. Stimulator of interferon response cGAMP interactor (STING) is a crucial regulator of the interferon-mediated inflammatory response to free DNA. In fact, EE treatment resulted in minor but significant STING upregulation (FIG.8A–B). Of note, EE enhanced the release of products of DN degradation from lysosomes (FIG.3D). Further, as previously noted, EE treatment induced both an increase in lysosomal pH (FIG.5A) and lysosomal size (FIG.6). All these results taken together imply that the aurein coating of DNs stimulates antiviral signaling modulation in hepatic cells (FIG.8C). In order to verify the specificity of aurein action, DNs were functionalized with the “scrambled” aurein 1.2 sequence (IKAFKGFDESILIGGKKKKKKKKKKGGILISEDFGKFAKI; SEQ ID NO: 11), which was previously shown to abrogate the endosome escape ability of the nanoparticles. Indeed, DNs coated with this scrambled peptide showed no effect on STING activation (FIG.25). Next, whether aurein-coated DN treatment leads to active release of IFN-β, the main interferon released upon viral stimulus, was verified. ELISA analysis revealed that all three types of DNs were incapable of inducing the release of IFN-β (FIG. 26). Although the precise physiological relevance is not known, it has been shown that some ISGs can be elevated by viral stimulus without concomitant interferon release. Summarizing all these data, it can be concluded that the EE nanostructures modulate the inflammatory response by upregulating the STING protein level and expression of the IFI6 gene without the active release of IFN-β (FIG.8C). Example 6 High Concentrations of DNA Nanostructures Effectively Kill Tumor Cells It is worth noting here that modulation of lysosomal activity by material accumulation is a progressive and dynamic process that may eventually lead to lysosomal membrane permeabilization (LMP) and cell death. Emerging evidence suggests that distinct nanoparticles can activate LMP and subsequent cell death in a progressive manner, so it is possible that DNs show progressive alteration of lysosomal function. Treatment with a high concentration of DNs (500 nM) was then explored, which induced dramatic changes in both the metabolic activity (FIG. 2) and viability (FIG.3) of cells. Imaging of PI-stained cells treated with all three types of DNs at a concentration of 500 nM for 48 h was performed. Treatment with EE DNs at this concentration showed a marked toxicity in all three cell lines (FIGS. 9A, 27–29). Furthermore, cell death triggered by EE DNs was confirmed by membrane blebbing and vesicular shedding (FIG. 9B). Neither 6HB nor K10 DNs affected cell viability at a 500 nM concentration (FIGS. 9A, 27–29). Interestingly, K10 at 500 nM affected HepG2 clustering, resulting in marked cell-cell dissociation (FIG. 9A). In fact, different growth factors (e.g., hepatocyte growth factor, TGF-β) have been shown to disrupt cell-cell adhesion of epithelial cells, such as HepG2, a phenomenon known as “cell scattering.” High-resolution confocal imaging revealed loss of cell-cell contacts and morphological changes not only in HepG2 cells upon K10 treatment, but in Alexander and Huh7 cells as well (FIG. 9B and 30). Importantly, it has been found that lysosomal activity mediates loss of cell-cell contacts and cell scattering. It is hypothesized that aurein-coated DNs at high concentration may lead to lysosomal membrane destabilization and eventually to lysosomal rupture, which in turn activates cells death (FIG. 10A). In fact, a lysosomal leakage assay revealed that treatment with EE DNs leads to massive lysosomal damage nearly equal to acute toxic doses of ethanol (FIG.10B). To verify the specificity of aurein-mediated induction of lysosomal destabilization, DNs coated with the scrambled aurein were utilized, which did not induce any lysosomal destabilization (FIG. 32). Furthermore, to confirm lysosomal damage, LysoTracker Red staining was performed. Confocal imaging revealed that treatment with EE DNs at a 500 nM concentration led to lysosomal swelling and loss of LysoTracker Red fluorescent intensity, indicating lysosomal rupture (FIGS.10C and 31). Conversely, treatment with 6HB or K10 DNs resulted in lysosomal size increase (FIGS.10C and 31) but without noticeable lysosomal damage (FIG.10B). To further assess the impact of the peptides on the metabolic activity and viability of liver cancer cells, a series of analyses were conducted using pure peptides in the absence of DNs. Given that EE DNs incorporate approximately 42 copies of the aurein 1.2 peptide, a 15 µM concentration of pure peptides was used to match the amount of peptide on the 500 nM concentration of EE DNs. As expected, a 500 nM concentration of either the K10 or EE peptide did not significantly affect the metabolic activity (FIG.35A) or viability (FIG.40) of liver cancer cell lines, even after 72 hours of treatment. The K10 peptide showed no impact on either metabolic activity or cell viability at concentrations up to 15 µM. In contrast, the EE peptide at 15 µM (equivalent to 500 nM of EE DNs) significantly inhibited metabolic activity (FIG.35A) and induced notable cytotoxicity as early as 24 hours post-incubation (FIG. 40). However, the inhibition kinetics of the pure EE peptide differed from those of the EE DNs, with the former showing a slight recovery in metabolic activity after 72 hours of treatment (FIG.35A), which was not observed with EE DN treatment. The cytotoxicity induced by the pure EE peptide was associated with lysosomal rupture (FIG. 41); nonetheless, EE DNs demonstrated greater potency in inducing cell death compared to the pure EE peptide (FIG. 35B). Furthermore, EE DNs were more effective in triggering lysosomal rupture than the pure EE peptide (FIG.35C). These findings clearly indicate that, although the pure EE peptide elicits similar cellular effects as EE DNs, the DNs are more potent in inducing lysosomal rupture (FIG. 35C) and subsequently triggering cytotoxicity (FIG. 35B). This enhanced efficacy of EE DNs likely results from their ability to overcome the limited cytosolic bioavailability associated with pure peptides. It is well-known that lysosomal permeabilization results in the release of lysosomal enzymes into the cytosol, leading to mitochondrial damage and cell death, accompanied by mitochondrial ROS production. Further, the leakage of lysosomal enzymes directly stimulates mitochondrial ROS production and stimulation. Indeed, only treatment with EE DNs at 500 nM concentration resulted in dramatic mitochondrial ROS production (FIG.11). Of note, lysosome hypertrophy is observed in cancer cells, making those lysosomes more fragile and susceptible to LMP. Consequently, directing interventions towards lysosomes to induce lysosomal leakage represents a promising cancer therapy, especially for enhancing therapeutic effectiveness and circumventing typical resistance mechanisms. Indeed, different types of nanomaterials have been employed to induce tumor cell death by rupturing their lysosomes. To determine whether DNs exhibit specificity towards cancerous cells, their cytotoxic effects on the non-cancerous HEK293T cell line were evaluated. As anticipated, treatment with K10 DNs at concentrations up to 500 nM did not result in any significant inhibition of metabolic activity (FIG.42A), cytotoxicity (FIG.42B), or lysosomal rupture (FIG.42C). By contrast, treating HEK293T cells with 500 nM of EE DNs led to a notable inhibition of metabolic activity (FIG.42A), induction of cytotoxicity (FIG. 42B), and lysosomal destabilization (FIG. 42C). However, it is important to highlight that EE DNs at the same concentration (500 nM) exhibited significantly higher cytotoxicity in the cancerous Huh7 cell line compared to the non-cancerous HEK293T cells (FIG.42D). This increased cytotoxicity in Huh7 cells was accompanied by more severe lysosomal damage than in HEK293T cells (FIG. 42E). Despite this, the cytotoxicity observed in non- cancerous HEK293T cells was still notably high (FIG.42B). At this stage, it is important to note that DNs were not intentionally targeted towards cancer cells through additional surface modifications with cancer-specific ligands. The focus is on presenting a DN-based platform capable of modulating various cellular functions, rather than on optimizing cancer cell specificity. Next, DNs were explored as a potential platform to induce cell death of different tumor cells. The data indicate that at least in Huh7, Alexander, and HepG2 cells, the aurein-coated DNs at 500 nM induce cell death (FIG.9) via marked lysosomal leakage (FIG.10). To further expand the scope of the platform, a three-dimensional (3D) culture of multicellular aggregates was utilized. Recent research suggests that conventional 2D culturing comes with certain limitations, hindering the translation of in vitro findings to in vivo models. In contrast, 3D models offer conditions better mimicking in vivo systems and providing more realistic outcomes. Furthermore, to validate the anti-tumor potential of aurein-coated DNs, an additional cell line was employed, namely glioblastoma. Glioblastomas are known to be a highly aggressive form of cancer with significant resistance to radiation and chemotherapy. First, it was checked whether DNs penetrate into 3D multicellular aggregates. Confocal imaging revealed that all three types of DNs successfully penetrated into 3D aggregates, including glioblastoma (FIG.33). Next, imaging of PI staining of 3D multicellular aggregates treated with all three types of DNs at a 500 nM concentration for 48 h was performed. EE treatment at 500 nM showed marked toxicity in all cell lines including glioblastoma (FIG. 12). High concentrations of EE induce lysosomal rupture, leading to mitochondrial damage, a feature that can be used to induce cell death. K10 treatment at high concentration does not lead to cell death, but it biases lysosomal activity, leading to loss of cell-cell contacts and morphological alterations of cells. In summary, in this study, a versatile DNA nanostructure-based platform was investigated that can modulate a number of cellular functions depending on (1) the nanoparticle concentration and (2) the surface decoration with specific peptide sequences (FIG. 13). Utilizing the 6HB nanostructure as an initial DN platform, it was decorated with either K10 or aurein 1.2 peptides. Taking advantage of lysosomal function modulation via lysosome interference, differently-coated DNs induced distinct cellular responses affecting lysosomal activity (FIG. 13). K10 at low concentration induced acidification of lysosomes (FIG.5A), which translated into modulation of metabolic activity of susceptible cells, such as Huh7 (FIG.2). By contrast, treatment with EE DNs resulted in alkalization of the lysosomal lumen (FIG.5A), leading to STING activation (FIG.8A– B) and modulation of antiviral signaling (FIG. 7A). Treatment with a high concentration of K10 DNs led to lysosomal swelling, loss of cell-cell contacts, and changes in cellular morphology but without concomitant cell death. Treatment with EE DNs at a high concentration led to lysosomal rupture and mitochondrial damage, resulting in marked cytotoxicity, an effect that was profound even in 3D multicellular aggregates and highly resistant glioblastoma cancer cells. The advantages in controlled environments, cost efficiency, and ethical considerations make in vitro analysis an ideal approach for studying emerging phenomena like lysosomal interference, despite its limitations. This work offers insight for a DN-based platform to rationally modulate lysosomal functions utilizing surface decoration with distinct peptides. This study provides an understanding of the mechanism underlying the impact of peptide-coated DNs on lysosomal functionality via lysosomal pH modulation and how these effects translate on subcellular functions and cellular behaviors. This study holds promise for the rational design of a new generation of DNA-based nanomaterials. The DNs in general provide numerous benefits over conventional nanoparticles, including lower cytotoxicity, well-defined 3D architectures of arbitrary shape and size at the nanoscale, easy functionalization using various peptides or other biomolecules, and superior adaptability. The methodology that was proposed here can in principle be generalized to target diverse pathophysiological conditions that are associated with changes in lysosomal activity and functions, such as lysosomal storage disorders, cancer, autoimmune disorders, neurodegenerative diseases, and cardiovascular diseases. The proposed approach of using DNs as a delivery vehicle for peptides into lysosomes represents a foundation for future anti-cancer therapeutic strategies. Peptide-functionalized DNs may offer a combination therapy for viral cancers by lysosomal disruption and activation of STING.

Claims

CLAIMS What is claimed:

1. A method of selectively modulating lysosomal activity in a cell, the method comprising delivering to the cell a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with a peptide coating.

2. The method of claim 1, wherein the DN comprises a 6-helix bundle (6HB) nanostructure.

3. The method of claim 2, wherein the 6HB nanostructure comprises six different double- stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6.

4. The method of claim 2, wherein the 6HB nanostructure comprises six different double- stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6.

5. The method of claim 2, wherein the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size.

6. The method of claim 1, wherein the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence having at least 90–99% identity to any one of SEQ ID NO: 7–11.

7. The method of claim 1, wherein the peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence selected from any one of SEQ ID NO: 7–11.

8. The method of claim 7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7).

9. The method of claim 7, wherein the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 9).

10. The method of claim 7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide flanked by two copies of an aurein 1.2 peptide (SEQ ID NO: 10).

11. The method of claim 1, wherein the nanoparticle composition modulates lysosomal pH by inducing lysosomal acidification or alkalization in the cell.

12. The method of claim 1, wherein the nanoparticle composition does not induce lysosomal damage or lysosomal membrane permeabilization.

13. The method of claim 1, wherein the nanoparticle composition inhibits metabolic activity in the cell.

14. The method of claim 1, wherein the nanoparticle composition modulates the morphology of the cell.

15. The method of claim 1, wherein the nanoparticle composition modulates immune signaling pathways and immune-related protein expression in the cell.

16. The method of claim 1, wherein the nanoparticle composition is cytotoxic to the cell and decreases cell viability.

17. The method of claim 1, wherein the nanoparticle composition is stable in lysosomal compartments of the cell for up to about 24 h of incubation.

18. The method of claim 1, wherein the nanoparticle composition is enzymatically degraded in the cell by lysosomal enzymes.

19. The method of claim 1, wherein the nanoparticle composition is delivered to the cell at a concentration ranging from about 10 nM to about 500 nM.

20. The method of claim 1, wherein the cell is incubated with the nanoparticle composition for a period of time of about 4 h to about 72 h.

21. The method of claim 1, wherein the nanoparticle composition further comprises a therapeutic agent.

22. The method of claim 1, wherein the nanoparticle composition further comprises one or more lysosomal acidification inhibitors or v-ATPase inhibitors.

23. The method of claim 1, wherein the cell is a cancer cell.