Method for preparing low-immunogenicity induced pluripotent stem cell, method for preparing hematopoietic stem / progenitor cell induced therefrom, and use thereof
By knocking out the B2M gene with CRISPR/Cas9 and optimizing the differentiation system, low-immunogenic CD34+CD45+ hematopoietic stem/progenitor cells were generated, solving the problems of immune rejection and infection in hematopoietic stem cell transplantation and improving the transplantation success rate.
Patent Information
- Application Number
- PCT/CN2025/110899
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-02
- Filing Date
- 2025-07-28
- Publication Date
- 2026-02-05
AI Technical Summary
Current hematopoietic stem cell transplantation methods have several drawbacks. The hematopoietic stem cells are present in relatively small amounts in peripheral blood, cannot be cultured for long periods, and are prone to immune rejection and infection after transplantation, especially due to immune rejection caused by the expression of HLA class I antigens.
By knocking out the B2M gene in induced pluripotent stem cells using the CRISPR/Cas9 system and reducing the expression of HLA class I molecules, combined with an optimized three-stage cell differentiation system, low-immunogenic CD34+CD45+ hematopoietic stem/progenitor cells were induced in vitro.
This method achieves efficient differentiation and generation of a large number of low-immunogenic hematopoietic stem cells, reducing immune rejection and infection risks, and improving the success rate and application scope of hematopoietic stem cell transplantation.
Smart Images

Figure PCTCN2025110899-FTAPPB-I100001 
Figure PCTCN2025110899-FTAPPB-I100002 
Figure PCTCN2025110899-FTAPPB-I100003
Abstract
Description
A method for preparing low-immunogenic induced pluripotent stem cells and their induced hematopoietic stem / progenitor cells, and their applications. Technical Field
[0001] This invention relates to the field of stem cell technology, specifically to a method for preparing a low-immunogenic induced pluripotent stem cell line, a method for inducing differentiation from the cell line to prepare hematopoietic stem / progenitor cells, and its application in the medical field. Background Technology
[0002] Pluripotent stem cells (PSCs) are stem cells with unlimited differentiation potential, capable of differentiating into all tissues and organs. They are generally divided into two categories: embryonic stem cells (ESCs) derived from blastocysts and induced pluripotent stem cells (iPSCs) induced from adult somatic cells. Induced pluripotent stem cells (iPSCs) have become a research hotspot in the field of stem cells in recent years. They are similar to embryonic stem cells in morphology, gene and protein expression, epigenetic modification status, cell proliferation capacity, ability to form embryoid bodies and teratomas, and differentiation capacity. Furthermore, unlike classic embryonic stem cell techniques and somatic cell nuclear transfer techniques, iPSCs do not use human embryonic stem cells or oocytes, thus avoiding ethical controversies. Induced pluripotent stem cells can be induced to differentiate into hematopoietic stem cells in vitro, providing a new source of cells for hematopoietic stem cell transplantation therapy.
[0003] Currently, hematopoietic stem cell transplantation still faces the following challenges: First, hematopoietic stem cells are scarce in peripheral blood and cannot be cultured in vitro for extended periods. Second, if the dosage of pre-transplant chemotherapy or immunosuppressive drugs is insufficient, immune rejection is highly likely after transplantation, resulting in a low success rate. Furthermore, in the early stages after hematopoietic stem cell transplantation, bone marrow hematopoietic function has not yet recovered, granulocytes are deficient, and the body's resistance to bacteria and viruses is weak. Combined with high-dose pre-transplant chemotherapy and the use of immunosuppressants after transplantation, the probability of infection after transplantation increases significantly, leading to a high mortality rate. Human leukocyte antigen (HLA) is an expression product of the human histocompatibility complex (MHC) and is a crucial antigenic substance contributing to transplant rejection. HLA class I antigens are distributed on the surface of almost all nucleated cells in the body and are the most important antigens causing allogeneic immune rejection. β2-microglobulin (B2M) is a component of the MHC light chain structure, linked non-covalently to other polypeptide chains (α chains), thereby stabilizing the tertiary structure of MHC class I molecules. Its expression is also of great importance. Therefore, knocking out the B2M gene in iPSCs affects the expression of HLA on the cell surface, thereby reducing the immunogenicity of iPSCs. Then, inducing the differentiation of iPSCs with the B2M gene knocked out into hematopoietic stem cells in vitro yields a large number of universal, low-immunogenic hematopoietic stem cells, broadening the clinical application of hematopoietic stem cell transplantation. Summary of the Invention
[0004] This invention provides a method for preparing a low-immunogenic induced pluripotent stem cell line and a method for inducing differentiation from this cell line to prepare universal low-immunogenic hematopoietic stem / progenitor cells. Specifically, this invention obtains a B2M gene knockout induced pluripotent stem cell line mediated by CRISPR / Cas9. By stage-specific regulation of key signaling pathways related to hematopoietic stem cell development, it achieves efficient differentiation of B2M gene knockout iPSCs into CD34+CD45+ hematopoietic stem / progenitor cells in vitro. This can provide a new source of low-immunogenic hematopoietic stem cells for clinical research and application, thus broadening the clinical application scope of hematopoietic stem cell transplantation.
[0005] The first aspect of the present invention provides a method for preparing low-immunogenic induced pluripotent stem cells, comprising the following steps: A) knocking out the B2M gene of induced pluripotent stem cells using a CRISPR / Cas9 system, thereby downregulating the expression of the B2M gene; B) selecting induced pluripotent stem cells from the cells obtained in step A) whose expression of HLA class I molecules on the cell surface is downregulated or absent.
[0006] In a preferred embodiment, the knockout comprises introducing a plasmid containing a polynucleotide encoding a Cas9 protein and an sgRNA targeting B2M into induced pluripotent stem cells, the sequence of which is shown in SEQ ID NO:1.
[0007] In a preferred embodiment, the plasmid is constructed by ligating a polynucleotide encoding an sgRNA targeting the B2M gene into a PX459 plasmid containing CAS9.
[0008] In a preferred embodiment, the importation method is electroporation.
[0009] In a preferred embodiment, the selection includes HLA-negative sorting by flow cytometry.
[0010] In a preferred embodiment, the pluripotent stem cells are human pluripotent stem cells.
[0011] A second aspect of the present invention provides a method for preparing low-immunogenic hematopoietic stem cells / progenitor cells induced by induced pluripotent stem cells, characterized in that it includes steps A) and B), and step C), wherein step C) includes:
[0012] C0: Low-immunogenic induced pluripotent stem cells obtained in step B) to generate a monolayer of adherent cells;
[0013] C1: Culture a monolayer of adherent cells to differentiate into mesodermal cells;
[0014] C2: Culture mesodermal cells to differentiate into hematopoietic mesodermal cells:
[0015] C3: Culture hematopoietic mesodermal cells to differentiate into hematopoietic stem cells / progenitor cells.
[0016] In a preferred embodiment, stage C1 is day 0-1, stage C2 is day 1-3, and stage C3 is day 3-12.
[0017] In a preferred embodiment, a monolayer of adherent cells is generated on day 0.
[0018] In a preferred embodiment, step C) includes:
[0019] C1: On day 0, monolayer adherent induced pluripotent stem cells were cultured in medium 1, which was APEL2 medium supplemented with rHSA, ascorbic acid and GSK3 inhibitor;
[0020] C2: On day 1, replace medium 1 with medium 2, which is APEL2 medium supplemented with GlutaMAX, penicillin / streptomycin, ascorbic acid, human total transferrin, thioglycerol, VEGF and bFGF, and culture the mesodermal cells for 2 days.
[0021] C3: On day 3, hematopoietic mesodermal cells were collected and cultured in medium 3 instead of medium 2. Medium 3 consisted of medium 2 with the addition of TPO, IL-3, SCF, IL-6, IL-11, IGF-1, BMP4 and FLT3. The medium was changed daily until day 12.
[0022] In a preferred embodiment, the rHSA concentration is 0.5-2 mg / ml, preferably 1 mg / ml; and / or,
[0023] The ascorbic acid concentration is 0.5-2 mM, preferably 1 mM; and / or, the GSK3 inhibitor comprises 5-15 μM CHIR99021, preferably 6 μM CHIR99021; and / or, the GlutaMAX concentration is 1-3 mM, preferably 2 mM; and / or, the penicillin / streptomycin concentration is 5-15 ng / ml, preferably 10 ng / ml; and / or, the human total transferrin concentration is 100-200 μg / ml, preferably... The concentration is selected as 150 μg / ml; and / or, the thioglycerol concentration is 0.3-0.5 mM, preferably 0.4 mM; and / or, the VEGF concentration is 10-30 ng / ml, preferably 20 ng / ml; and / or, the bFGF concentration is 10-30 ng / ml, preferably 20 ng / ml; and / or, the TPO concentration is 40-60 ng / ml, preferably 50 ng / ml; and / or, the IL-3 concentration is 5-15 ng / ml. IL-3, preferably 10 ng / ml; and / or, the SCF concentration is 40-60 ng / ml, preferably 50 ng / ml; and / or, the IL-6 concentration is 40-60 ng / ml, preferably 50 ng / ml; and / or, the IL-11 concentration is 4-6 ng / ml, preferably 5 ng / ml; and / or, the IGF-1 concentration is 20-30 ng / ml, preferably 25 ng / ml; and / or, the BMP4 concentration is 10-30 ng / ml, preferably 20 ng / ml; and / or,
[0024] The FLT3 concentration is 5-15 ng / ml, preferably 10 ng / ml.
[0025] In a preferred embodiment, step C) includes:
[0026] C1: Day 0, cultured in monolayer adherent induced pluripotent stem cells in medium 1, wherein medium 1 is APEL2 medium supplemented with 1 mg / ml rHSA, 1 mM ascorbic acid and 6 μM CHIR99021;
[0027] C2: On day 1, replace medium 1 with medium 2, which is APEL2 medium supplemented with 2mM GlutaMAX, 10ng / ml penicillin / streptomycin, 1mM ascorbic acid, 150μg / ml human total transferrin, 0.4mM thioglycerol, 20ng / ml VEGF and 20ng / ml bFGF. Culture the mesodermal cells for 2 days.
[0028] C3: On day 3, hematopoietic mesodermal cells were collected and cultured in medium 3 instead of medium 2. Medium 3 consisted of medium 2 with the addition of 50 ng / ml TPO, 10 ng / ml IL-3, 50 ng / ml SCF, 50 ng / ml IL-6, 5 ng / ml IL-11, 25 ng / ml IGF-1, 20 ng / ml BMP4 and 10 ng / ml FLT3. The medium was changed daily until day 12.
[0029] In a preferred embodiment, the monolayer adherent induced pluripotent stem cells are generated by the following steps: two days before induction (day -2), the low immunogenic induced pluripotent stem cells are enzymatically dissociated into a single-cell suspension and cultured in ncTarget hPSC medium for 2 days.
[0030] In a preferred embodiment, the culture conditions were 37°C and 5% CO2.
[0031] In a preferred embodiment, step C) further includes a C4 purification step, which includes sorting cells using a commercially available CD34 and / or CD45 positive selection kit.
[0032] A third aspect of the present invention provides a low-immunogenicity induced pluripotent stem cell or hematopoietic stem cell / progenitor cell obtained by the above-described preparation method.
[0033] The low-immunogenic pluripotent stem cells or low-immunogenic hematopoietic stem cells / progenitor cells refer to cells with reduced immunogenicity compared to their corresponding wild-type stem cells, and have at least one of the following characteristics: 1) downregulation of B2M mRNA or protein expression levels by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, or 95%; 2) downregulation or absence of HLA class I molecule expression; 3) reduced proportion or degree of T cell activation or proliferation; 4) reduced level of induced inflammatory response or cytokine levels.
[0034] In one embodiment, the hematopoietic stem cells / progenitor cells are CD34. + CD45 + Hematopoietic stem / progenitor cells.
[0035] A fourth aspect of the present invention provides a composition comprising the above-described cells.
[0036] In a preferred embodiment, the cells or composition have a reduced immune rejection response.
[0037] A fifth aspect of the invention provides the use of the above-described cells or compositions in the preparation of products or medicines for cell therapy, stem cell transplantation, or organ transplantation.
[0038] A sixth aspect of the present invention provides the use of the above-described cells or compositions in hematopoietic stem cell transplantation.
[0039] In a preferred embodiment, the hematopoietic stem cell transplantation is used to treat blood diseases.
[0040] In a preferred embodiment, the blood disease includes, but is not limited to, leukemia, lymphoma, myeloma, and aplastic anemia.
[0041] The advantages of this invention are mainly reflected in the following aspects;
[0042] Through optimized sgRNA design, the B2M gene of induced pluripotent stem cells was efficiently knocked out. Bioinformatics analysis showed a high modification efficiency of 70.27%, without causing unexpected mutations or chromosomal rearrangements. RT-qPCR, WB, and cell loss detection all showed efficient knockout of the B2M gene, with mRNA expression inhibition rate of over 60%, protein expression inhibition rate of over 75%, and a significant reduction in HLA-I-expressing cells.
[0043] Through an optimized three-stage cell differentiation system, up to 78.7% of CD34 cells can be harvested by day 12. + CD45 + Hematopoietic stem cells have a high yield.
[0044] The low-immunogenicity hematopoietic stem / progenitor cells obtained by B2M-KO iPSC induction have the following advantages:
[0045] 1) Multi-lineage hematopoietic potential, capable of generating hematopoietic colonies including erythroid colonies CFU-E / BFU-E, granulocyte-macronuclear colonies CFU-GM, and mixed-lineage colonies CFU-GEMM.
[0046] 2) Reduced stimulation of T cells inhibits their activation or proliferation, for example, CD8. + The T cell activation rate decreased from 58.97% to 36.17%; and there was no increase in NK cell stimulation.
[0047] 3) In vivo reconstruction capacity, which can promote the generation of various myeloid and lymphocytes, including T cells, B cells, NK cells, neutrophils and monocytes.
[0048] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0049] Figure 1: DNA Sanger sequencing results, the overlapping peaks demonstrate the genome editing of the B2M target sequence.
[0050] Figure 2: Off-target percentages of WT cells and B2M knockout cells at two off-target prediction sites. No unexpected editing or adverse changes were observed in either cell line.
[0051] Figure 3: RT-qPCR detection of the relative expression of B2M in B2M knockout iPSCs, normalized according to the ratio of the WT group.
[0052] Figure 4: Western blotting statistics showing the relative expression of β2-microglobulin, normalized to the ratio of the WT group.
[0053] Figure 5: Western blotting grayscale graph shows the relative expression of β2-microglobulin before and after B2M knockout.
[0054] Figure 6: Flow cytometry histograms of HLA-ABC (HLA-I) expression in B2M-KO iPSCs (red line) and WT (blue line).
[0055] Figure 7: Schematic diagram of the three-stage differentiation scheme for generating HSPC from iPSC.
[0056] Figure 8: Representative bright-field images of cells at different differentiation stages, with specific differentiation times and magnifications shown in the figure.
[0057] Figure 9: Flow cytometry characterization of CD34 and CD45 expression in hematopoietic stem cells / progenitor cells from day 10 to day 12. The peak of HSPCs occurred on day 12. Figure 9A: day 10; Figure 9B: day 11; Figure 9C: day 12.
[0058] Figure 10: Purified CD34 + Cell flow cytometry counting plot, with CD34 derived from iPSCs + CD45 + Cells as the starting point, CD34 + CD34 cells after positive selection + The cell content can reach 83.2%.
[0059] Figure 11: Typical morphologies of hematopoietic colonies formed by B2M-KO iPSC-induced hematopoietic PCs under bright-field phase contrast microscopy (4× magnification): erythroid colony CFU-E / BFU-E (left), granulocyte-megakaryocytic colony CFU-GM (middle), and mixed colony CFU-GEMM (right).
[0060] Figure 12: Relative distribution of hematopoietic progenitor cell colony subtypes induced by unedited cells or B2M-KO cells as determined by CFU assay. Two-way ANOVA with multiple comparisons showed no significant difference in the means of each lineage between the WT group and the B2M-KO group. n=3, p>0.05.
[0061] Figure 13: CD3 based on CFSE tagging method + CD8 + T cell proliferation was assessed, and representative FCM overlay histograms showed the intensity of CFSE in different groups across the three donors (Figure 13A XW0120111W, Figure 13B XW0120112W, Figure 13C XW0120113W). PBMCs co-cultured without target cells served as a negative control, and PBMCs not labeled with CFSE served as a background control. Gating was performed using the negative control, and CD3+ was determined by detecting the reduced CFSE fluorescence ratio. + CD8 + The percentage of T cell proliferation. Unmodified iPSC-derived HSPCs are referred to as the WT group, and B2M-KO iPSC-derived HSPCs are abbreviated as the B2M-KO group; the same abbreviation will be used below. In Figure 13A-C, the peaks from left to right are: unlabeled PBMCs (background control), WT-iPSC-derived hematopoietic progenitor cells, B2M-KO iPSC-derived hematopoietic progenitor cells, and CFSE-labeled unstimulated PBMCs (negative control).
[0062] Figure 14: Bar chart showing CD3 values from different donors + CD8 + Statistical data on the proliferation rate of T cells. Unpaired two-tailed t-tests were used to determine the statistical differences between the WT and B2M-KO groups within each donor group. Data are mean with SD, n=3; *p<0.05; **p<0.01; p<0.001.
[0063] Figure 15: B2M-KO iPSC-derived HSPCs did not stimulate NK cell proliferation. A representative FCM dot plot shows that in donor XW0812077W, CD107a and IFNγ at CD56 + Expression status on NK effector cells.
[0064] Figure 16: CD56+ CD107a in NK cells + IFNγ + Quantitative analysis of the proportion of double-positive cells. NK cells co-incubated with PMA and iomycin served as a positive control. There was no significant difference in NK cell proliferation among all donors after stimulation with wild-type and B2M-KO iPS-derived HSPCs. NK, natural killer. Unpaired one-way ANOVA was performed, followed by Tukey's multiple comparison test. Data are mean with SD, n=3; ns, not significant, ***p<0.001, ****p<0.0001.
[0065] Figure 17: hCD45 + The implantation level is statistically significant, with data representing the mean of SD, n=5.
[0066] Figure 18: FCM dot plot of representative mice showing artificial blood cells (hCD45) + The proportion of hCD45 cells in total CD45 cells and the status of multi-lineage reconstitution in peripheral blood 8 weeks after transplantation. + The cell population was further phylogeneticized based on lymphocyte and myeloid expression markers. The data showed the proportion of lymphocyte lineage cells: B cells (CD19...) + ), T cells (CD3) + NK cells (CD56) + Markers and myeloid lineage: Neutrophils (CD66) + ) and monocytes (CD14) + ).
[0067] Figure 19: Typical immunohistochemical (IHC) images of CD3 (left) and NCR1 markers (right) in spleen tissue of humanized M-NSG mice. Example
[0068] Example 1. Establishment of B2M gene knockout induced pluripotent stem cell lines
[0069] 1.1 Cell Culture
[0070] Human induced pluripotent stem cells (iPSCs) ATCC-DYR0100 (ACS-1011) were purchased from ATCC. iPSCs were cultured in Corning (1:40 dilution) plates coated with ncTarget hPSC medium (Nuwacell, RP01020) containing 10 μM ROCK inhibitor Y-27632 (Stemcell, 72302). Cells were passaged every four days at a ratio of 1:15–1:20 using TrypLE Express (Gibco). Cells were incubated at 37°C in a 5% CO2 incubator, with the medium changed daily.
[0071] 1.2 CRISPR / Cas9-mediated B2M knockout
[0072] 1.2.1 sgRNA Design
[0073] Multiple pairs of single guide RNAs (sgRNAs) were designed to target exon 1 and exon 2 of the B2M gene (NCBI Gene: 567), respectively. These sgRNAs were annealed and ligated into the eSpCas9-2A-Puro(PX459) plasmid (Addgene, ID 48139). Their function was verified based on Sanger sequencing results, and editing efficiency was analyzed using Synthego ICE (https: / / ice.synthego.com / ). The pair of guide oligonucleotides with the highest efficiency was selected to construct an expression plasmid for knocking out the B2M gene.
[0074] The sgRNA sequence is GAGTAGACGCGAGCACAGCTA (SEQ ID NO:1), targeting exon 1 (-), and the oligonucleotides are as follows: Oligo-Forward5'-caccGAGTAGCGCGAGCACAGCTA-3' (SEQ ID NO:2), Oligo-Reverse 5'-aaacTAGCTGTGCTCGCGCTACTC-3' (SEQ ID NO:3).
[0075] 1.2.2 Electro-rotation
[0076] use The system (Lonza) uses a 20 μL electrode strip system. The optimal electroporation program was selected from the carriers. Next, at 1×10⁻⁶... 6 Nuclear transfection was performed on iPSC single-cell suspensions using 4 μg B2M-gRNA plasmid, primary P3 solution, and the optimal DC-100 program used in preliminary experiments. The electroporated cells were then transferred to ncTarget hPSC medium (Nuwacell, RP01020) substrate-coated plates containing 10 μM ROCK inhibitor Y-27632 and incubated for 24 hours. Untransfected cells were removed by selection with puromycin (0.5 mg / mL, incubated for 24 hours).
[0077] 1.2.3 Sequencing and Off-Target Analysis
[0078] After transfection and puromycin selection, the knockout of B2M in iPSCs was verified by Sanger sequencing. The bimodal phenomenon proved the genome editing of the B2M target sequence (Figure 1).
[0079] A major problem in the application of the CRISPR / Cas9 system is its off-target effects. Therefore, two potential off-target sites were predicted using a computational algorithm (Table 1), and precise targeting was performed using amplicon-based next-generation sequencing (NGS).
[0080] Table 1. Potential off-target sites predicted by computer simulation tools
[0081] Primers for PCR amplification were designed based on the target sequences. An NGS library was constructed, including obtaining clean data using cutadapt V1.18 and merging reads using FLASH v1.2.11. The merged reads were then sequence-aligned with the amplified regions using Bwa V0.7.12 and Samtools V1.6. The mapping results determined the frequency of modifications, including INDEL (insertion-deletion) and SNV (single nucleotide variant). Potential off-target sites for the selected gRNAs were screened using CHOPCHOP (https: / / chopchop.rc.fas.harvard.edu) and Cas-OFFinder, and the off-target probability was analyzed using Azenta's internal scripts.
[0082] Reads near the target site visualized the editing efficiency of the selected sgRNA; the percentages of InDel and SNVs indicated a modification efficiency as high as 70.27%. Furthermore, no unexpected mutations or chromosomal rearrangements were induced during editing. At the two predicted off-target sites, the off-target ratios of gene knockout cells were consistent with those of unedited (wild-type, WT) cells (Figure 2).
[0083] 1.3 The reduction in β2-microglobulin (B2M) expression was verified by RT-qPCR and Western blotting.
[0084] 1.3.1 Real-time quantitative polymerase chain reaction (RT-qPCR)
[0085] Total RNA was extracted from cells using MagZol Reagent (Magen, R4801-02) and reverse transcribed into cDNA using the HiScript III RT SuperMix for qPCR kit (Vazyme, R323-01). RT-qPCR was performed using PowerUp SYBR Green premixed buffer (Thermo Fisher, A25742) on a QuantStudio 5 real-time quantitative PCR system (Applied Biosystems). The housekeeping gene GAPDH was used as a reference standard for mRNA level normalization. -ΔΔCTThe relative fold change in B2M expression was determined using a method. The primers used were: B2M F(5′-TCGCGCTACTCTCTCTTTCTG-3′, SEQ ID NO:4) and R(5′-TTCTCTGCT
[0086] GGATGACGTGAG-3′, SEQ ID NO:5), GAPDH F(5′-GGAGCGAGATCCC
[0087] TCCAAAAT-3', SEQ ID NO:6) and R(5'GGCTGTTGTCATACTTCTCATGG-3', SEQ ID NO:7).
[0088] 1.3.2 Western blotting
[0089] Cells were harvested and lysed using RIPA lysis buffer supplemented with benzyl sulfonyl fluoride (PMSF; Servicebio, G2008), a protease inhibitor, and a phosphatase inhibitor (Servicebio, G2007). Total protein was obtained from the supernatant of the lysed samples, and its concentration was measured using a BCA protein assay kit (Servicebio, G2026). Total protein was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a 0.45 μm PVDF membrane (Servicebio, G6015). The membrane was then blocked with 5% skim milk. After blocking, the membrane was incubated with the corresponding antibody. The antibodies and their dilutions used in this study are as follows: anti-β-2-microglobulin [EP2978Y] antibody (1:1000, Abcam, ab75853), anti-GAPDH antibody (1:30000, Servicebio, ZB15004-HRP), and HRP-conjugated goat anti-rabbit IgG (H+L) antibody (1:5000, Servicebio, GB23303). Protein bands were visualized on the membrane using a chemiluminescence imaging system (Servicebio, SCG-W2000). Integrated density values were measured using AIWBwell software (Servicebio). The relative content of β2-microglobulin in the samples was calculated as the ratio of the B2M integrated density value to the GAPDH control, and normalized to the ratio of the WT group.
[0090] The results showed that B2M knockout reduced the relative expression level of B2M mRNA (Figure 3) and further reduced the expression of β2-microglobulin (Figures 4 and 5).
[0091] 1.4 Flow cytometry was used to determine the expression of HLA-I on the cell surface.
[0092] After confirming B2M disruption, HLA-I expression on the cell surface was measured by flow cytometry. Cells were collected and stained with primary antibody: anti-HLA class 1 ABC antibody [EMR8-5] (Abcam, ab70328, 1 μg / 1x10⁻¹). 6 Cells were stained at 22°C for 30 minutes, and then stained with goat anti-mouse IgG H&L (Alexa). The secondary antibody (488)(Abcam, ab150113) was diluted 1 / 2000 at 22°C for 30 minutes. Results showed a significant reduction in HLA-I expression (Figure 6). Induced pluripotent stem cell lines with the B2M gene knocked out were obtained by sorting the HLA-ABC negative population.
[0093] Example 2. Generation of B2M-KO iPSC-induced hematopoietic stem cells / progenitor cells (HSPCs)
[0094] 2.1 Production of in vitro iPSCs hematopoietic progenitor cells
[0095] We established a 12-day, three-stage differentiation protocol. The first stage induces cells into a mesodermal state, further differentiating them into hematopoietic mesodermal cells. Then, in the next stage, hematopoietic endothelial cells emerge as precursors to hematopoietic cells. Finally, hematopoietic endothelial cells undergo endothelial-to-hematopoietic transition (EHT) to produce hematopoietic stem cells (HSPCs). The specific three stages (Figure 7) are: Stage 1, mesodermal formation (days 0-1); Stage 2, hematopoietic mesodermal specialization (days 1-3); Stage 3, HSC-induced hematopoietic endothelialization and endothelial-to-hematopoietic transition (days 3-12).
[0096] The morphological characteristics of cells at the critical differentiation time point are shown in Figure 8: Human iPSCs were cultured for 2 days before induction, and a monolayer of adherent cell clones was generated on day 0. One day after mesodermal induction, the edges of the clones showed significant shrinkage. On day 3, the mesodermal cells underwent hematopoietic mesoderm specialization and proliferated rapidly. The hematopoietic mesodermal cells exhibited a mesenchymal cell morphology and were relatively loosely arranged. On day 6, hematopoietic endothelial-like cells were generated through the intermediate endothelial state during the gradual transformation to endothelial-hematopoietic (EHT). From day 8 onwards, morphological changes in cells from adherent endothelial cells to hematopoietic cell clusters could be observed, followed by the continuous generation of suspended hematopoietic cells from the hematopoietic site. On days 11 and 12 of induction, a large number of round hematopoietic progenitor cells could be harvested from the culture supernatant.
[0097] Flow cytometry analysis of progenitor cell marker (CD34) and pan-hematopoietic cell marker (CD45) expression in the final days of differentiation showed continuous expansion and maturation of hematopoietic stem cells / progenitor cells (Figure 9). Furthermore, the results indicated that day 12 was the optimal harvest time, allowing for the harvesting of up to 78.7% CD34. + CD45 + Cells. The specific implementation plan is as follows:
[0098] 2.1.1 On day -2, WT and B2M-KO iPSCs were dissociated into single-cell suspensions using Accutase (Stemcell Technologies, 07922) and then subjected to a 6×10⁻⁶ ppm concentration. 3 / cm 2 The cells were seeded at a density of 100% onto a matrix gel-coated culture plate and cultured in ncTarget hPSC medium for two days to form a monolayer of adherent cell clones.
[0099] 2.1.2 On day 0, the cells were at approximately 30-40% confluence. To induce the cells to enter a mesodermal-like state, the ncTarget hPSC medium was replaced with APEL2 medium (Stemcell Technologies, 05275) supplemented with 1 mg / ml rHSA (Sigma, A9731), 1 mM ascorbic acid (Sigma, A4544), and 6 μM CHIR99021 (MedChemExpress, HY-10182).
[0100] 2.1.3 On day 1, replace the culture medium with one supplemented with 2 mM GlutaMAX. TM STEMdiff of (Gibco, 25030149), 10 ng / ml penicillin / streptomycin, 1 mM ascorbic acid, 150 μg / ml human total transferrin (Sigma, T0665), 0.4 mM thioglycerol, 20 ng / ml VEGF (Peprotech, 100-20) and 20 ng / ml bFGF (Gibco, PHG0367) TM APEL2 medium (Stemcell Technologies, 05275). Mesodermal cells were incubated at 37°C in a 5% CO2 incubator for 2 days to induce hematopoietic mesodermal specialization.
[0101] 2.1.4 On day 3, hematopoietic mesodermal cells were collected at a concentration of 1.44 × 10⁻⁶. 5 Cells / well density were re-seeded onto a matrix gel-coated 6-well plate and compared with additive-containing STEMdiff at the same density as Day 1. TMAPEL2 medium was supplemented with 50 ng / ml TPO, 10 ng / ml IL-3, 50 ng / ml SCF, 50 ng / ml IL-6, 5 ng / ml IL-11, 25 ng / ml IGF-1, 20 ng / ml BMP4 and 10 ng / ml FLT3.
[0102] 2.1.5 Change the fluid daily thereafter.
[0103] 2.1.6 Starting from day 6, the process of hematopoietic endothelial cell production can be observed through cell morphology. Hematopoietic endothelial cells (HEPs) undergo endothelial-to-hematopoietic transformation (EHT) and ultimately produce hematopoietic stem cells / progenitor cells (HSPCs).
[0104] 2.1.7 By day 10, floating cells can be seen in the culture, and their numbers increase in the following days.
[0105] 2.1.8 At the end of the 12-day protocol, round hematopoietic progenitor cells can be harvested from the culture supernatant for flow cytometry analysis of CD34 and CD45.
[0106] 2.2 Purification of hematopoietic stem cells / progenitor cells
[0107] To reduce the safety risks posed by teratomas caused by undifferentiated iPSCs during induction, and to increase CD45 levels... + / CD34 + To improve cell purity and promote in vivo regeneration, we use EasySep. TM Human CD34 Positive Selection Kit II (Stemcell Technologies, 17856) and EasySep TM The magnet (Stemcell technologies, 18000) allowed for efficient purification. In the example, human CD34... + Cell purity increased from 29.8% to 83.2% (Figure 10).
[0108] Example 3 Characterization of hematopoietic colony formation capacity of HSPCs derived from B2M-KO iPSCs
[0109] To assess the differentiation potential of HSPC, we used MethoCult according to the instructions. TMColony-forming units (CFU) of cells differentiated on day 10 were measured using SF H4636 semi-solid medium (Stemcell, 04636). Each cell sample was diluted to two different concentrations, differing by 2-3 times (200 or 500 cells per 35 mm culture dish). 0.4 mL of the diluted cells was added to 4 mL of pre-amplified MethoCult medium. TM 1.1 mL per experimental group, repeated three times. The mixture was then gently transferred to SmartDish using a sterile Luerlock syringe with a sterile 16-gauge blunt needle. TM In a 6-well plate, in SmartDish TM Add 4-8 mL of sterile water to the gaps between the wells. Incubate the cells at 37°C, 5% CO2, and ≥95% humidity. Perform CFU assay and colony identification and classification on day 14 of culture.
[0110] By observing various cell types and classifying different cell morphologies, the multi-lineage hematopoietic potential of B2M-KO iPSC-induced hematopoietic stem / progenitor cells was confirmed. The results showed that iPSC-derived hematopoietic progenitor cells maintained their differentiation capacity, capable of generating hematopoietic colonies including erythroid CFU-E / BFU-E, granulocyte-megakaryocytic CFU-GM, and mixed-lineage CFU-GEMM (Figure 11). The relative distribution of these three different lineages is shown in Figure 12. Statistical analysis showed no significant difference between the unedited group and the gene knockout group, and both primarily produced erythroid CFU-E / BFU-E colonies.
[0111] Example 4: In vitro detection of the response of HLA I-deficient hematopoietic progenitor cells / stem cells to human immune cells.
[0112] 4.1 Detection of CD8 by dilution assay of carboxyfluorescein diacetate succinimide (CFSE) + T cell proliferation
[0113] PBMCs from three different donor sources were purchased from Selex Biotechnology. After resuscitation, the PBMCs were cultured overnight in RPMI-1640 supplemented with 10% heat-inactivated human AB serum (Gemibo, 10-512) and 50 μmol / L β-mercaptoethanol. They were stained with 2 μM CFSE (Invitrogen, C1157) for 7 minutes and then washed twice with DPBS.
[0114] WT and B2M-KO-derived hematopoietic progenitor / stem cells were treated with 25 μg / mL mitomycin C (37°C, 30 min) to inhibit proliferation and serve as cell stimulators. Stimulatory cells were co-cultured in 96-well U-plates at a ratio of 1:10. 4Cells were reacted with PBMCs for 6 days (cells / well) using RPMI-1640 supplemented with glutamine, 10% heat-inactivated human FBS, and 25 ng / mL IFN-γ. Unstimulated PBMCs labeled with CFSE were used as a negative control (rightmost peak in flow cytometry 13), and unlabeled PBMCs were used as a background control (leftmost peak in flow cytometry 13). CD3 count was analyzed by flow cytometry using the CFSE dye dilution method. + CD8 + T cell proliferation.
[0115] Decreased surface expression of HLA-I on cells inhibits CD8. + T cells recognize it. The results showed that, compared to unmodified cells (second peak from the left in flow cytometry 13), B2M-KO iPSC-derived hematopoietic progenitor cells (second peak from the right in flow cytometry 13) showed greater recognition of CD3+ in human PBMCs. + CD8 + The stimulation of T cells was significantly reduced, and the same trend was observed in all donors (Figure 13), indicating that HSPCs derived from B2M-KO iPSCs have an inhibitory effect on T cell proliferation.
[0116] Among the XW0120112W donors, HSPCs derived from B2M-KO iPSCs support CD8. + The inhibitory effect on T cell activation is the greatest, CD8 + The proportion of activated T cells decreased from 58.97% to 36.17% (Figure 14). Therefore, compared with unmodified cells, the destruction of HLA-I in iPSC-derived HSPCs makes them less susceptible to CD8+ T immune activation.
[0117] 4.2 NK cell proliferation was measured by flow cytometry.
[0118] Since HLA-I molecules are also ligands for NK cells, iPSC-HSPCs lacking HLA-I expression may activate NK cell proliferation. To investigate the effect of HLA-I-deficient iPSC-HSPCs on NK cell proliferation, we co-cultured HSPCs derived from WT and B2M-KO iPSCs with NK cells and measured the proportion of CD107a and IFNγ double-positive cells on the NK cell surface (Figure 15). Compared with the unstimulated group, the positive control group showed a significant activation effect on NK cells, while there was no significant difference between the WT group and the B2M-KO group, with the co-expression ratios of CD107a and IFNγ in both groups only slightly higher than baseline. The results also indicated that B2M-KO did not increase NK cell stimulation (Figure 16).
[0119] The specific implementation plan is as follows: NK cells were isolated from PBMCs of different donors, and CD56+ cells (>90%) were sorted by flow cytometry. NK cells and stimulated cells were mixed at a 1:1 ratio in NK cell culture medium containing anti-huCD107a-APC antibody (Biolegend, 328620). Unstimulated NK cells were used as a negative control, while NK cells stimulated with 50 ng / mL PMA (phorbol 12-myristate-13-acetate) (MCE, HY-18739) and 1 mM iomycin (MCE, MCE, HY-13434) were used as a positive control. After incubation for 1 hour, Brefeldin A solution (Invitrogen, 00-4506-51) and Monensin solution (Invitrogen, 00-4505-51) were added to the cells and incubated for another 4 hours. Cell mixtures were collected and stained with PE-anti-human CD56 antibody (Biolegend, 318305) at 4°C for 1 hour. After cell fixation and permeabilization (BD Biosciences, 554714), cells were stained with FITC-anti-IFN-γ antibody (Biolegend, 502505) and washed twice before flow cytometry analysis. The stimulation of NK cell proliferation by different cell types was assessed by analyzing the differences in the co-expression ratios of CD107a and IFNγ in CD56+ NK cells.
[0120] Example 5. Assessment of in vivo reconstitution capacity
[0121] We evaluated the in vivo reconstitution capacity of iPSC-HSPCs in hIL3-hCSF2-Tg (M-NSG) mice. Flow cytometry results showed that the proportion of hCD45 in the total CD45 cell count in peripheral blood peaked at over 3% after 10 weeks of implantation (Figure 17). HSPCs derived from B2M-KO iPSCs promoted the generation of myeloid and lymphocytes, including T cells, B cells, NK cells, neutrophils, and monocytes (Figure 18). At the experimental endpoint, immunohistochemistry (IHC) was used to detect immune cell infiltration in spleen tissue. The results showed that human CD3 and NK cells were also implanted in the spleen of transplanted mice (Figure 19).
[0122] The specific implementation plan is as follows: hIL3-hCSF2-Tg (M-NSG) mice (catalog number NM-KI-215006) were purchased from Shanghai Model Organisms Center Co., Ltd. For the cell xenotransplantation experiment, 6-week-old hIL3-hCSF2-Tg mice were selected and subjected to sublethal dose irradiation to disrupt the hematopoietic function of the mice's own bone marrow. 1×10 7 CD34 obtained by flow cytometry separation induced by B2M-KO iPSC+ CD45 + Hematopoietic progenitor cells were injected into five mice via tail vein injection. Peripheral blood was collected every two weeks starting at week 4 post-transplantation, and human CD45+ cell chimerism was measured by flow cytometry. The level of reconstitution in xenograft mice was defined as [hCD45% / (hCD45%+mCD45%)]×100. Flow cytometry was performed on a Beckman Cytoflex XR and analyzed using Flowjo V10.8.1. At the experimental endpoint, immunohistochemistry (IHC) was used to detect immune cell infiltration in spleen tissue. Detailed information and marker dilutions are shown below (Table 2).
[0123] Table 2. Detailed information on antibodies used in flow cytometry and IHC
Claims
1. A method for preparing low-immunogenicity induced pluripotent stem cells, characterized in that, Includes the following steps: A) Knock out the B2M gene in induced pluripotent stem cells using the CRISPR / Cas9 system to downregulate B2M gene expression; B) Select induced pluripotent stem cells from the cells obtained in step A) that have downregulated or absent HLA I molecule expression on their cell surface.
2. The preparation method according to claim 1, characterized in that, The knockout involves introducing a plasmid containing a polynucleotide encoding the Cas9 protein and an sgRNA targeting B2M into induced pluripotent stem cells, the sequence of which is shown in SEQ ID NO:
1.
3. A method for preparing low-immunogenic hematopoietic stem cells / progenitor cells induced by induced pluripotent stem cells, characterized in that, Including steps A) and B) as described in claim 1, and step C), wherein step C) includes: C0: Low-immunogenic induced pluripotent stem cells obtained in step B) to generate a monolayer of adherent cells; C1: Culture a monolayer of adherent cells to differentiate into mesodermal cells; C2: Culture mesodermal cells to differentiate into hematopoietic mesodermal cells; C3: Culture hematopoietic mesodermal cells to differentiate into hematopoietic stem cells / progenitor cells.
4. The preparation method according to claim 3, characterized in that, Step C) includes: C1: On day 0, monolayer adherent induced pluripotent stem cells were cultured in medium 1, which was APEL2 medium supplemented with rHSA, ascorbic acid and GSK3 inhibitor; C2: On day 1, replace medium 1 with medium 2, which is APEL2 medium supplemented with GlutaMAX, penicillin / streptomycin, ascorbic acid, human total transferrin, thioglycerol, VEGF and bFGF, and culture the mesodermal cells for 2 days. C3: On day 3, hematopoietic mesodermal cells were collected and cultured in medium 3 instead of medium 2. Medium 3 was medium 2 with the addition of TPO, IL-3, SCF, IL-6, IL-11, IGF-1, BMP4 and FLT3. The medium was changed daily until day 12. The culture conditions were 37℃ and 5% CO2.
5. The preparation method according to claim 4, characterized in that, The rHSA concentration is 0.5-2 mg / ml, preferably 1 mg / ml; and / or, The ascorbic acid concentration is 0.5-2 mM, preferably 1 mM; and / or, The GSK3 inhibitor comprises 5-15 μM CHIR99021, preferably 6 μM CHIR99021; and / or, The GlutaMAX concentration is 1-3 mM, preferably 2 mM; and / or, The concentration of penicillin / streptomycin is 5-15 ng / ml, preferably 10 ng / ml; and / or, The concentration of the human total transferrin is 100-200 μg / ml, preferably 150 μg / ml; and / or, The concentration of the thioglycerol is 0.3-0.5 mM, preferably 0.4 mM; and / or, The VEGF concentration is 10-30 ng / ml, preferably 20 ng / ml; and / or, The concentration of bFGF is 10-30 ng / ml, preferably 20 ng / ml; and / or, The TPO concentration is 40-60 ng / ml, preferably 50 ng / ml; and / or, The IL-3 concentration is 5-15 ng / ml, preferably 10 ng / ml; and / or, The SCF concentration is 40-60 ng / ml, preferably 50 ng / ml; and / or, The IL-6 concentration is 40-60 ng / ml, preferably 50 ng / ml; and / or, The IL-11 concentration is 4-6 ng / ml, preferably 5 ng / ml; and / or, The IGF-1 concentration is 20-30 ng / ml, preferably 25 ng / ml; and / or, The BMP4 concentration is 10-30 ng / ml, preferably 20 ng / ml; and / or, The FLT3 concentration is 5-15 ng / ml, preferably 10 ng / ml.
6. The preparation method according to claim 4, characterized in that, Step C) includes: C1: On day 0, monolayer adherent induced pluripotent stem cells were cultured in medium 1, which was APEL2 medium supplemented with 1 mg / ml rHSA, 1 mM ascorbic acid and 6 μM CHIR99021. C2: On day 1, replace medium 1 with medium 2, which is APEL2 medium supplemented with 2mM GlutaMAX, 10ng / ml penicillin / streptomycin, 1mM ascorbic acid, 150μg / ml human total transferrin, 0.4mM thioglycerol, 20ng / ml VEGF and 20ng / ml bFGF. Culture the mesodermal cells for 2 days. C3: On day 3, hematopoietic mesodermal cells were collected and cultured in medium 3 instead of medium 2. Medium 3 consisted of medium 2 with the addition of 50 ng / ml TPO, 10 ng / ml IL-3, 50 ng / ml SCF, 50 ng / ml IL-6, 5 ng / ml IL-11, 25 ng / ml IGF-1, 20 ng / ml BMP4 and 10 ng / ml FLT3. The medium was changed daily until day 12. The culture conditions were 37℃ and 5% CO2.
7. The preparation method according to claim 3, characterized in that, The monolayer adherent cells are generated through the following steps: Two days before induction (day -2), low immunogenic induced pluripotent stem cells are enzymatically dissociated into a single-cell suspension and cultured in ncTarget hPSC medium at 37°C and 5% CO2 for 2 days.
8. The preparation method according to claim 3, characterized in that, Step C) further includes a C4 purification step, which includes sorting cells using a commercially available CD34 and / or CD45 positive selection kit.
9. Low immunogenic induced pluripotent stem cells obtained by the preparation method according to any one of claims 1 or 2, or hematopoietic stem cells / progenitor cells obtained by the preparation method according to any one of claims 3-8.
10. A composition comprising the cells as described in claim 9.
11. Use of the cell of claim 9 or the composition of claim 10 in the preparation of a product or medicament for cell therapy, stem cell transplantation, or organ transplantation.
12. The use of the cells of claim 9 or the composition of claim 10 in hematopoietic stem cell transplantation; preferably, the hematopoietic stem cell transplantation is used to treat blood diseases; more preferably, the blood diseases include leukemia, lymphoma, myeloma, and aplastic anemia.
Citation Information
Patent Citations
HLA class i-deficient NK-92 cells with decreased immunogenicity
CN109804064A
METHOD FOR GENE EDITING OF CELL ON BASIS OF CRISPR / Cas SYSTEM
CN112805371A
Systems and methods for enhanced immunotherapy
CN114981415A
Stem cell multiple CRISPR / Cas genome editing method
CN116732099A
Universal donor cells
US20200080114A1