Sirna for inhibiting MASP2 gene expression, and modifier thereof and use thereof

By designing modified siRNAs of specific lengths and sequences, and combining nucleotide modifications and ligand linkage, the problem of lacking efficient inhibition of MASP2 expression in existing technologies has been solved, achieving effective inhibition of the MASP2 gene and showing potential for treating MASP2-related diseases.

WO2026026712A1PCT designated stage Publication Date: 2026-02-05NANJING QIANYAN BIOTECH
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/110900
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-06-27
Filing Date
2025-07-28
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Currently, there are no effective drugs targeting MASP2. Existing drugs are mainly antibodies or small molecule drugs, which are in the clinical stage and lack efficient methods to inhibit MASP2 expression.

Method used

We designed and synthesized siRNAs of specific lengths and sequences, combined with nucleotide modifications, including 2'-methoxy, 2'-fluoro, and thiophosphate group modifications, and ligand linkage, for efficient inhibition of MASP2 expression.

Benefits of technology

It achieves efficient inhibition of the MASP2 gene, reduces MASP2 expression levels, and has the potential to treat MASP2-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025110900-FTAPPB-I100001
    Figure PCTCN2025110900-FTAPPB-I100001
  • Figure PCTCN2025110900-FTAPPB-I100002
    Figure PCTCN2025110900-FTAPPB-I100002
  • Figure PCTCN2025110900-FTAPPB-I100003
    Figure PCTCN2025110900-FTAPPB-I100003
Patent Text Reader

Abstract

Provided in the present invention is a double-stranded MASP2-targeting RNA molecule, specifically an siRNA. The siRNA provided in the present invention is capable of effectively inhibiting MASP2 expression, and can be used for preventing and treating diseases associated with MASP2 high expression or abnormal activation.
Need to check novelty before this filing date? Find Prior Art

Description

A siRNA for inhibiting MASP2 gene expression and its modifications and applications

[0001] Cross-references to related applications

[0002] This patent application claims priority to Chinese invention patent application No. CN202411043184X, filed on July 31, 2024, and Chinese invention patent application No. CN2025108766854, filed on June 27, 2025, the entire contents of which are incorporated herein by reference for all purposes. Technical Field

[0003] This invention belongs to the field of biomedicine and relates to an siRNA for inhibiting MASP2 gene expression, its modifications, and applications. Background Technology

[0004] The gene MASP2 (MBL-associated serine protease 2) is located on the short arm of chromosome 1, region 36 (1p36.22), and encodes MASP2. MASP2 is a protein composed of 686 amino acids, with a pathogen recognition domain at its C-terminus and a collagen-like domain at its N-terminus.

[0005] The complement system is an important defense system of the body. Its inherent components exist in an inactive form and are activated through a cascade of enzymatic reactions. There are three main complement activation pathways: the classical pathway (CP), the lectin pathway (LP), and the alternative pathway (AP); MASP2 is a key effector enzyme in the lectin pathway.

[0006] Regarding the activation mechanism of the lectin pathway, ficolins or mannose-binding lectins (MBLs) are important initiating molecules. When pathogenic microorganisms such as bacteria invade the body, ficolins or MBLs bind to sugars (such as N-acetyl or mannose) on the surface of microorganisms through their pathogen recognition domains, and simultaneously bind to MASP2 and MASP1 through their collagen-like domains. This forms the MASP-Ficolin-microorganism or MASP-MBL-microorganism complex, which in turn activates MASP1 and MASP2. Subsequently, the activated MASP2 exerts serine protease activity, cleaving complement component C4. The resulting C4b fragment covalently binds to the pathogen surface and interacts with complement component C2. Subsequently, MASP2 cleaves C2 to produce C2a, while C4b binds to C2a to form C3 convertase (C4b2a). Downstream cascade reactions of the complement lectin pathway are activated, ultimately forming the membrane attack complex (MAC, C5b6789), which clears pathogenic microorganisms through cytolytic effects.

[0007] As mentioned above, the MASP2-mediated lectin pathway is one of the body's important defense systems, possessing defensive and resistance functions against various pathogenic microorganisms. However, MASP2 overactivation can lead to autoimmune diseases such as IgA nephropathy, atypical hemolytic uremic syndrome, hematopoietic stem cell transplantation-related thrombotic microangiopathy, clinical stage II, SARS-CoV-2 infection, thrombotic microangiopathy, and lupus nephritis.

[0008] Given the important role of MASP2 in disease, it has become a target for drug development. However, there are currently no drugs targeting MASP2 on the market. Drugs under development are still in the clinical stage and are all antibodies or small molecule drugs. For example, Narsoplimab (OMS721), a fully human IgG4 monoclonal antibody developed by Omeros Corporation, is in Phase 3 clinical trials for hematopoietic stem cell transplantation-related thrombotic microangiopathy.

[0009] Therefore, developing drugs that target MASP2 is of great significance. Summary of the Invention

[0010] The purpose of this invention is to provide a highly efficient siRNA for inhibiting MASP2 expression.

[0011] In a first aspect, the present invention provides an siRNA comprising at least partially paired sense and antisense strands forming a double-stranded region, wherein the length of the double-stranded region is 15-30 base pairs.

[0012] Furthermore, the length of the double-stranded region can be 23-27 base pairs.

[0013] Furthermore, the length of the double-stranded region can be 21-23 base pairs.

[0014] Furthermore, the length of the double-stranded region can be 19-21 base pairs.

[0015] Furthermore, the length of the double-stranded region can be 17-25 base pairs.

[0016] Furthermore, the length of the double-stranded region can be 17-23 base pairs.

[0017] Furthermore, the length of the double-stranded region can be 17-19 base pairs.

[0018] Preferably, in the siRNA described above, the length of the sense strand does not exceed 30 nucleotides, and / or the length of the antisense strand does not exceed 30 nucleotides.

[0019] Furthermore, the sense strand and antisense strand may each have 15-30 nucleotides.

[0020] Furthermore, the sense strand and antisense strand may each have 19-30 nucleotides.

[0021] Preferably, in the siRNA described above, the length of the sense strand does not exceed 19 nucleotides, and / or the length of the antisense strand does not exceed 21 nucleotides.

[0022] More preferably, the sense strand of the siRNA comprises the following nucleotide sequence:

[0023] A1) The nucleotide sequence represented by any odd-numbered sequence from SEQ ID NO.1 to SEQ ID NO.130; or

[0024] A2) A nucleotide sequence that is more than 90% homologous to any of the odd-numbered nucleotide sequences in SEQ ID NO.1 to SEQ ID NO.130.

[0025] More preferably, the antisense strand of the siRNA comprises the following nucleotide sequence:

[0026] A3) The nucleotide sequence represented by any even number in SEQ ID NO.1 to SEQ ID NO.130; or

[0027] A4) A nucleotide sequence that is more than 90% homologous to the nucleotide sequence shown in any even numbered SEQ ID NO.1 to SEQ ID NO.130.

[0028] According to a specific embodiment of the present invention, the siRNA provided by the present invention comprises one sense strand and one antisense strand selected from the following:

[0029] The sense strand comprises the nucleotide sequence represented by any odd number n from SEQ ID NO.1 to SEQ ID NO.130, and the antisense strand comprises the nucleotide sequence represented by any even number n+1 from SEQ ID NO.1 to SEQ ID NO.130, where n is an odd number between 1 and 130.

[0030] Furthermore, at least one nucleotide in the sense or antisense strand of the siRNA provided by the present invention can be a modified nucleotide.

[0031] In the siRNA described above, the modified nucleotide is either a compound formed by replacing the 2' hydroxyl group of the ribosyl group of the nucleotide with other groups or by modifying the bases on the nucleotide.

[0032] Furthermore, in the siRNA provided by the present invention, the modified nucleotides can be linked by phosphate thioester groups.

[0033] The modified nucleotide may be selected from at least one of the following: 2'-methoxy-modified nucleotides, 2'-fluorine-modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, and nucleotides containing 5'-phosphate ester mimics.

[0034] Preferably, in the siRNA provided by the present invention, the modified nucleotide is any one of a1)-a4):

[0035] a1) 2'-methoxy modified nucleotides;

[0036] a2) 2'-fluorinated modified nucleotides;

[0037] a3) nucleotides modified with 2'-methoxy and thiophosphate groups;

[0038] a4)2'-fluoromodified and thiophosphate-modified nucleotides.

[0039] Furthermore, in the siRNA provided by this invention, the sense strand may include any one of B1)–B4), and / or the antisense strand may include any one of C1)–C4).

[0040] B1) At least one modified nucleotide;

[0041] B2) At least two modified nucleotides;

[0042] B3) At least three modified nucleotides;

[0043] B4) At least four modified nucleotides;

[0044] C1) At least one modified nucleotide;

[0045] C2) At least two modified nucleotides;

[0046] C3) At least three modified nucleotides;

[0047] C4) at least four modified nucleotides.

[0048] Preferably, the sense strand of the siRNA provided by the present invention contains the modified nucleotides described in B4) (i.e., contains at least 4 modified nucleotides), and the antisense strand contains the modified nucleotides described in C4) (i.e., contains at least 4 modified nucleotides).

[0049] Preferably, the siRNA provided by the present invention comprises a 2'-methoxy-modified nucleotide, wherein the 2'-methoxy-modified nucleotide is located in both the antisense strand and the sense strand of the siRNA, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 1-6 and 10-19 of the sense strand are 2'-methoxy-modified nucleotides; and at least the nucleotides at positions 1, 3-5, 7-13, 15 and 17-21 of the antisense strand are 2'-methoxy-modified nucleotides.

[0050] Furthermore, the siRNA provided by the present invention further includes 2'-fluorinated nucleotides, wherein the 2'-fluorinated nucleotides are located in the antisense strand and the sense strand of the siRNA, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 7, 8 and 9 of the sense strand are 2'-fluorinated nucleotides, and at least the nucleotides at positions 2, 6, 14 and 16 of the antisense strand are 2'-fluorinated nucleotides.

[0051] Furthermore, the siRNA provided by the present invention further includes at least one phosphate thioester group modification, wherein the phosphate thioester group modification is located in both the sense strand and the antisense strand of the siRNA, and, in the direction from the 5' end to the 3' end, the phosphate backbone between at least the 1st to 3rd nucleotides of the sense strand is modified with a phosphate thioester group (i.e., at least the 1st and 2nd nucleotides, and the 2nd and 3rd nucleotides are linked by a phosphate thioester group), and the phosphate backbone between at least the 1st to 3rd nucleotides and the 19th to 21st nucleotides of the antisense strand is modified with a phosphate thioester group (i.e., at least the 1st and 2nd nucleotides, the 2nd and 3rd nucleotides, the 19th and 20th nucleotides, and the 20th and 21st nucleotides are linked by a phosphate thioester group).

[0052] According to a specific embodiment of the present invention, the siRNA modification method provided by the present invention is as follows:

[0053] Following the 5'-to-3' direction, the nucleotides at positions 7, 8, and 9 of the sense strand are 2'-fluorinated nucleotides; following the 5'-to-3' direction, the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides; the remaining nucleotides are 2'-methoxyinated nucleotides. Further, following the 5'-to-3' direction, the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by thiophosphate groups. In a specific embodiment of the present invention, the aforementioned modification method is also referred to as "M1" modification.

[0054] Further, the siRNA is selected from any one of the following: hM-by239M1, hM-by240M1, hM-by244M1, hM-by362M1, hM-by363M1, hM-by368M1, hM-by375M1, hM-by376M1, hM-by380M1, hM-by384M1, hM-by385M1, hM-by386M1, hM-by392M1, hM-by393M1, hM-by395 ... M1, hM-by435M1, hM-by556M1, hM-by615M1, hM-by617M1, hM-by618M1, hM-by689M1, hM-by692M1, hM-by693M1, hM-by700M1, hM-by704M1, hM-by705M1, hM-by707M1, hM-by708M1, hM-by709M1, hM-by710M1, hM-by711M1, hM-b y740M1, hM-by745M1, hM-by746M1, hM-by747M1, hM-by748M1, hM-by749M1, hM-by751M1, hM-by752M1, hM-by75 3M1, hM-by754M1, hM-by755M1, hM-by756M1, hM-by757M1, hM-by758M1, hM-by759M1, hM-by760M1, hM-by827M1 hM-by828M1, hM-by829M1, hM-by833M1, hM-by839M1, hM-by848M1, hM-by850M1, hM-by852M1, hM-by854M1, hM-by857M1, hM-by887M1, hM-by889M1, hM-by890M1, hM-by892M1, and hM-by895M1; the nucleotide sequences of the aforementioned siRNA sense and antisense strands are described in the Examples section.

[0055] The siRNA is further specifically selected from any of the following: hM-by239M1, hM-by376M1, hM-by386M1, hM-by392M1, hM-by438M1, hM-by689M1, hM-by708M1, hM-by710M1, hM-by747M1, hM-by749M1, hM-by756M1, h M-by757M1, hM-by758M1, hM-by759M1, hM-by760M1, hM-by827M1, hM-by829M1, hM-by8 39M1, hM-by848M1, hM-by854M1, hM-by886M1, hM-by889M1, hM-by890M1 and hM-by895M1.

[0056] The siRNA is further specifically selected from any one of the following: hM-by756M1, hM-by758M1, hM-by759M1, hM-by760M1, hM-by827M1, hM-by839M1, hM-by854M1, hM-by889M1, hM-by890M1, and hM-by895M1.

[0057] Furthermore, based on the M1 modification mode, the siRNA provided by this invention can also be modified at the 5' end of the antisense strand with 5'-(E)-VP (that is, the 5' hydroxyl group of the first nucleotide at the 5' end of the antisense strand is replaced with (E)-ethylene phosphate).

[0058] Accordingly, the siRNA is further specifically selected from any of the following: hM-by756M1VP, hM-by758M1VP, hM-by759M1VP, hM-by760M1VP, hM-by827M1VP, hM-by839M1VP, hM-by854M1VP, hM-by889M1VP, hM-by890M1VP, and hM-by895M1GVP; the nucleotide sequences of the sense and antisense strands of the aforementioned siRNA are given in the Examples section.

[0059] The siRNA is further specifically selected from any one of the following: hM-by756M1, hM-by758M1, hM-by759M1, hM-by760M1, hM-by756M1VP, hM-by758M1VP, hM-by759M1VP, hM-by760M1VP.

[0060] According to a specific embodiment of the present invention, the present invention provides a modified siRNA comprising a sense strand and an antisense strand as shown below:

[0061] (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.132;

[0062] Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm(SEQ ID NO.131);

[0063] Antonym chain: AmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm(SEQ ID NO.132);

[0064] (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.134;

[0065] Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm(SEQ ID NO.133);

[0066] Antonym chain: UmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.134);

[0067] (3) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.136;

[0068] Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm(SEQ ID NO.135);

[0069] Antonym chain: UmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.136);

[0070] (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.138;

[0071] Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm(SEQ ID NO.137);

[0072] Antonym chain: UmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.138);

[0073] (5) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.151;

[0074] Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm(SEQ ID NO.131);

[0075] Antisense strand: VPAmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm (SEQ ID NO. 151);

[0076] (6) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.152;

[0077] Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm(SEQ ID NO.133);

[0078] Antonym chain: VPUmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.152);

[0079] (7) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.153;

[0080] Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm(SEQ ID NO.135)

[0081] Antonym chain: VPUmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.153)

[0082] or

[0083] (8) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.154;

[0084] Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm(SEQ ID NO.137)

[0085] Antonym chain: VPUmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.154).

[0086] In the above nucleotide sequence, m indicates that the nucleotide to the left of m is a 2'-methoxy modified nucleotide, s indicates a thiophosphate group modification, that is, the two nucleotides adjacent to the letter s are connected by a thiophosphate group, f indicates that the nucleotide to the left of f is a 2'-fluoro modified nucleotide, and VP indicates that the nucleotide to the right of VP is a 5'-(E)-vinyl phosphate modified nucleotide.

[0087] Furthermore, the siRNA provided by the present invention has a ligand attached to the 3'-end or 5'-end of the positive strand or to any nucleotide in the positive strand.

[0088] The ligand can be a small molecule, antibody, peptide, protein, or aptamer.

[0089] Preferably, the ligand is a polypeptide, such as RGD.

[0090] Preferably, the ligand is a small molecule, such as a ligand containing N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0091] Preferably, the ligand is a protein, such as albumin or other proteins.

[0092] Furthermore, in the siRNA provided by the present invention, the ligand can be linked to the siRNA via a linker.

[0093] Furthermore, the ligand is L96 as shown in the following formula:

[0094] According to a specific embodiment of the present invention, the siRNA and ligand connection method provided by the present invention is as follows: L96 is coupled to the 3' end of the positive strand of the modified siRNA.

[0095] Further, the siRNA is selected from any one of the following: hM-by756M1G, hM-by756M1GVP, hM-by758M1G, hM-by758M1GVP, hM-by759M1G, hM-by759M1GVP, hM-by760M1G, hM-by760M1GVP, hM-by827M1G, hM-by827M1GVP, hM-b y839M1G, hM-by839M1GVP, hM-by854M1G, hM-by854M1GVP, hM-by889M1G, hM-by889M1GVP, hM-by890M1G, hM-by890M1GVP, hM-by895M1G, hM-by895M1G; the nucleotide sequences of the aforementioned siRNA sense and antisense strands are described in the Examples section.

[0096] The siRNA is further specifically selected from any one of the following: hM-by756M1G, hM-by756M1GVP, hM-by758M1G, hM-by758M1GVP, hM-by759M1G, hM-by759M1GVP, hM-by760M1G, and hM-by760M1GVP.

[0097] According to a specific embodiment of the present invention, the present invention provides a modified siRNA having an L96 coupled to the 3' end of the sense strand and / or a (E)-VP modified 5' end of the antisense strand, the siRNA comprising the sense strand and antisense strand as shown below:

[0098] (1) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.131 and is coupled with L96 at the 3' end, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.132;

[0099] Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm-L96 (SEQ ID NO.131);

[0100] Antonym chain: AmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm(SEQ ID NO.132);

[0101] (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.151;

[0102] Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm-L96 (SEQ ID NO.131);

[0103] Antisense strand: VPAmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm (SEQ ID NO. 151);

[0104] (3) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.134;

[0105] Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm-L96 (SEQ ID NO.133);

[0106] Antonym chain: UmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.134);

[0107] (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.152;

[0108] Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm-L96 (SEQ ID NO.133);

[0109] Antonym chain: VPUmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.152);

[0110] (5) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.136;

[0111] Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm-L96 (SEQ ID NO.135)

[0112] Antonym chain: UmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm (SEQ ID NO.136)

[0113] (6) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.135 and is coupled with L96 at the 3' end, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.153;

[0114] Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm-L96 (SEQ ID NO.135)

[0115] Antonym chain: VPUmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.153)

[0116] (7) The sense strand comprises the nucleotide sequence shown in SEQ ID NO.137 and is coupled with L96 at the 3' end, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.138;

[0117] Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm-L96 (SEQ ID NO.137)

[0118] Antonym chain: UmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.138);

[0119] or

[0120] (8) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.154;

[0121] Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm-L96 (SEQ ID NO.137)

[0122] Antonym chain: VPUmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.154).

[0123] In the above nucleotide sequence, m indicates that the nucleotide to the left of m is 2'-methoxy modified, s indicates phosphate thioester modification, that is, the two nucleotides adjacent to the letter s are linked by phosphate thioester groups, and f indicates that the nucleotide to the left of f is 2'-fluoro modified; in addition, the structure of L96 is as follows:

[0124] VP indicates that the nucleotide has an (E)-vinyl phosphate modification at the 5' position. The structure of the nucleotide with (E)-vinyl phosphate modification at the 5' position and methoxy modification at the 2' position (i.e., "VPNm" below) is as follows:

[0125] In a second aspect, the present invention provides a composition comprising the siRNA described in the first aspect of the present invention.

[0126] The compositions provided by this invention may also include pharmaceutically acceptable carriers.

[0127] Preferably, the composition is a pharmaceutical composition.

[0128] Furthermore, the pharmaceutical composition may also contain an unbuffered solution. This unbuffered solution may be physiological saline or water. Alternatively, the pharmaceutical composition may also contain a buffer solution. This buffer solution contains acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof. For example, the buffer solution is phosphate-buffered saline (PBS).

[0129] The pharmaceutically acceptable carrier may be an excipient, stabilizer, suspending agent, or diluent, as is well known to those skilled in the art.

[0130] Thirdly, the present invention provides a cell comprising the siRNA described in the first aspect of the present invention.

[0131] Fourthly, the present invention provides the use of the siRNA described in the first aspect, the composition described in the second aspect, or the cell described in the third aspect in the preparation of a medicament for treating diseases caused by abnormal MASP2 expression.

[0132] Furthermore, the diseases caused by abnormal MASP2 expression can be diseases caused by upregulation of MASP2 expression. Further, the diseases caused by abnormal MASP2 expression include autoimmune diseases, rare diseases, or various common diseases, specifically including but not limited to age-related macular degeneration (AMD), kidney diseases (such as IgA nephropathy, lupus nephritis, glomerulonephritis, nephrotic syndrome, diabetic nephropathy, membranous nephropathy), ischemia-reperfusion injury (such as renal ischemia-reperfusion, myocardial ischemia-reperfusion, ischemic stroke), paroxysmal nocturnal hemoglobinuria, hemolytic uremic syndrome, rheumatoid arthritis, multiple sclerosis, moderate to severe active systemic lupus erythematosus, neuroimmunological diseases, optic neuritis, thrombocytopenia, relapsing multiple sclerosis, and IgG4. Related diseases, glomerulonephritis, myasthenia gravis, non-Hodgkin's lymphoma, autoantibody-positive systemic lupus erythematosus, relapsed / refractory multiple myeloma, generalized myasthenia gravis, neuromyelitis optica, mantle cell lymphoma, myeloma, neuromyelitis optica spectrum disorders, steroid-resistant nephrotic syndrome, ANCA-associated vasculitis, scleroderma, Sjögren's syndrome, connective tissue disease-associated thrombocytopenia, kidney transplant rejection, hereditary angioedema, thrombotic microangiopathy (such as atypical hemolytic uremic syndrome), geographic atrophy, diabetic retinopathy, retinitis pigmentosa, macular edema, Parkinson's disease, etc.

[0133] Fifthly, the present invention provides a method for treating diseases caused by abnormal MASP2 expression, the method comprising administering to a subject in need the siRNA described in the first aspect, the composition described in the second aspect, or the cells described in the third aspect.

[0134] Furthermore, the disease caused by abnormal MASP2 expression can be a disease caused by upregulation of MASP2 expression.

[0135] Furthermore, the diseases caused by abnormal MASP2 expression can be diseases caused by upregulation of MASP2 expression. Further, the diseases caused by abnormal MASP2 expression include autoimmune diseases, rare diseases, or various common diseases, specifically including but not limited to age-related macular degeneration (AMD), kidney diseases (such as IgA nephropathy, lupus nephritis, glomerulonephritis, nephrotic syndrome, diabetic nephropathy, membranous nephropathy), ischemia-reperfusion injury (such as renal ischemia-reperfusion, myocardial ischemia-reperfusion, ischemic stroke), paroxysmal nocturnal hemoglobinuria, hemolytic uremic syndrome, rheumatoid arthritis, multiple sclerosis, moderate to severe active systemic lupus erythematosus, neuroimmunological diseases, optic neuritis, thrombocytopenia, relapsing multiple sclerosis, and IgG4. Related diseases, glomerulonephritis, myasthenia gravis, non-Hodgkin's lymphoma, autoantibody-positive systemic lupus erythematosus, relapsed / refractory multiple myeloma, generalized myasthenia gravis, neuromyelitis optica, mantle cell lymphoma, myeloma, neuromyelitis optica spectrum disorders, steroid-resistant nephrotic syndrome, ANCA-associated vasculitis, scleroderma, Sjögren's syndrome, connective tissue disease-associated thrombocytopenia, kidney transplant rejection, hereditary angioedema, thrombotic microangiopathy (such as atypical hemolytic uremic syndrome), geographic atrophy, diabetic retinopathy, retinitis pigmentosa, macular edema, Parkinson's disease, etc.

[0136] The method for treating diseases caused by abnormal MASP2 expression provided by this invention can be used for non-diagnostic purposes or for scientific research purposes.

[0137] Sixthly, the present invention provides a method for inhibiting MASP2 expression in cells, the method comprising:

[0138] (a) Contacting the cells with the siRNA described in the first aspect, the composition described in the second aspect, or the cells described in the third aspect.

[0139] (b) Maintain the cells produced in step (a) for a period of time sufficient to allow for the degradation of the mRNA transcript of the MASP2 gene, thereby suppressing MASP2 expression in the cells.

[0140] Further, in step (a), the cells may be located within the body of a subject suffering from a disease caused by abnormal MASP2 expression. The subject may be an animal, such as a mammal, including primates (e.g., humans or non-human primates, such as monkeys or chimpanzees), or non-primates (e.g., cattle, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, mice, horses, or whales). In some embodiments, the subject is a mouse.

[0141] Further, in step (b), the inhibition of MASP2 expression in cells means that the MASP2 expression level is reduced by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100% compared to before contact.

[0142] The method for inhibiting MASP2 expression in cells provided by this invention can be used for non-diagnostic purposes or for scientific research purposes.

[0143] In a seventh aspect, the present invention provides the use of the siRNA described in the first aspect, the composition described in the second aspect, or the cell described in the third aspect in the preparation of a medicament for inhibiting MASP2 expression in cells.

[0144] The inhibition of MASP2 expression in cells means that the siRNA or a drug prepared from the siRNA can reduce the MASP2 expression level by at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, or about 100%.

[0145] In this invention, "modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or a nucleotide in which the bases on the nucleotide are modified bases. "Methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine. "Nucleotide analog" refers to a group that can replace a nucleotide in nucleic acids, but whose structure differs from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides.

[0146] In one embodiment of the present invention, a "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0147] In one embodiment of the present invention, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art, and these nucleotides may be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0148] In one embodiment of the present invention

[0149] 2'-alkoxy modified nucleotides are 2'-methoxy (2'-OMe) modified nucleotides, as shown in formula (2), i.e., methoxy modified; 2'-substituted alkoxy modified nucleotides, for example, can be 2'-O-methoxyethyl (2'-MOE) modified nucleotides, as shown in formula (3); 2'-amino (2'-NH2) modified nucleotides are shown in formula (4); 2'-deoxynucleotides (DNA) are shown in formula (5):

[0150] In one embodiment of the present invention, the nucleotide analogue refers to a group that can replace a nucleotide in nucleic acids, but whose structure is different from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

[0151] In one embodiment of the present invention, the nucleotide analog may be a heteronucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0152] In one embodiment of the invention, the bridged nucleic acid (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation of a five-membered ring, a six-membered ring, or a seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide.

[0153] In one embodiment of the present invention, the BNA may be LNA, ENA, cET BNA, etc., wherein LNA is as shown in formula (6), ENA is as shown in formula (7), and cET BNA is as shown in formula (8):

[0154] In one embodiment of the present invention, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate ester groups with modifying groups.

[0155] In one embodiment of the present invention, the phosphate ester group with the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.

[0156] In one embodiment of the invention, the phosphate group having the modifying group is a thiophosphate group having the structure shown in formula (9). In one embodiment of the invention, the nucleotide linked to the thiophosphate group is shown in formula (10), and the thiophosphate group linkage is present at least at one of the following positions: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination thereof.

[0157] In one embodiment of the present invention, the VP-modified nucleotide is a vinyl phosphate ester modified. In one embodiment of the present invention, the VP-modified and methoxy-modified nucleotide, namely the nucleotide modified with 5'-(E)-vinyl-2'-methoxy-modified phosphonate group (5'-(E)-VP-2'-OMe), is as shown in formula (11).

[0158] In the siRNA preparation method described in this invention, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the desired siRNA. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for siRNA synthesis. All nucleoside monomers used in this invention are commercially available.

[0159] In this application, the positive strand of the siRNA is conjugated to a ligand attached to the 3'-end, wherein the ligand is one or more GalNAc derivatives attached using a divalent or trivalent branched linker.

[0160] The siRNA conjugate formed by GalNAc and siRNA molecules in this invention has the following structure:

[0161] This invention provides a novel double-stranded RNA molecule targeting MASP2, specifically siRNA. In vitro and in vivo experiments demonstrate that the siRNA provided by this invention can effectively inhibit MASP2 expression.

[0162] Based on the mechanism of action of siRNA, the MASP2-targeting siRNA provided in this invention, upon entering the cell, mediates the formation of an siRNA silencing induction complex (RISC). The activated RISC, through base pairing, localizes to a specific site on the MASP2 mRNA, causing efficient degradation of the MASP2 mRNA and thus significantly reducing the MASP2 protein level. Therefore, the siRNA provided in this invention can be used to prevent and treat diseases related to MASP2 overexpression or abnormal activation, including but not limited to bacterial or viral infections, IgA nephropathy, atypical hemolytic uremic syndrome, thrombotic microangiopathy, kidney diseases, systemic lupus erythematosus, lupus nephritis, and hematopoietic stem cell transplantation-related thrombotic microangiopathy. Attached Figure Description

[0163] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0164] Figure 1 shows the relative expression levels of MASP2 protein in the serum of cynomolgus monkeys after administration of different siRNAs. Detailed Implementation

[0165] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0166] definition

[0167] The abbreviations for nucleotide monomers in nucleic acid sequences are shown in Table 1. It should be noted that when these monomers are present in oligonucleotides, they are interconnected via 5'-3'-phosphodiester bonds; and it should be understood that when a nucleotide contains a 2'-fluorine modification, the fluorine replaces the hydroxyl group at that position in the parent nucleotide (i.e., it is a 2'-deoxy-2'-fluoronucleotide).

[0168] Table 1. Abbreviations and explanations of nucleotide monomers in nucleic acid sequences

[0169] In the context of this disclosure, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, bases on one strand are paired in a complementary manner with bases on the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the strand can be inferred from the sequence of its complementary strand.

[0170] In the context of this disclosure, particularly in describing methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates of the present invention, unless otherwise specified, a nucleoside monomer refers to a modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. The nucleoside monomers used in the embodiments of this disclosure are commercially available.

[0171] In the context of this disclosure, "coupling" refers to the covalent connection between two or more chemical parts, each with a specific function; correspondingly, "coupling" refers to a compound formed by the covalent connection between these chemical parts. Further, "siRNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to siRNA. siRNA conjugates should be understood, depending on the context, as a collective term for multiple siRNA conjugates or a siRNA conjugate represented by a specific chemical formula. In the context of this disclosure, "coupling molecule" should be understood as a specific compound that can be reactively coupled to siRNA to ultimately form the siRNA conjugate of this disclosure.

[0172] In the context of this disclosure, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes both the possibility that the event or condition occurs and the possibility that it does not occur. For example, "alkyl" in "optionally substituted" includes "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable.

[0173] In the context of this disclosure, the terms “treatment,” “relief,” or “improvement” are used interchangeably herein. These terms refer to methods of achieving beneficial or desired outcomes, including, but not limited to, treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, although the subject may still be suffering from the underlying disorder.

[0174] In the context of this disclosure, “prevention” and “protection” are used interchangeably. These terms refer to methods of obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” the composition may be given to a subject at risk of developing a particular disease, or to a subject who reports one or more pathological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0175] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all performed in triplicate, and the results are averaged.

[0176] Example 1: Preparation of siRNA

[0177] 1. MASP2 mRNA

[0178] MASP2 mRNA refers to mRNA with the sequences shown in GeneBank accessions NM_006610.4, NM_139208.3, XM_045380955.1, XM_005544814.3, NM_001003893.2, or NM_010767.3. The siRNA sequences used in the experiments were synthesized by Suzhou Genecast Co., Ltd., and stored at -20℃.

[0179] 2. siRNA sequence

[0180] siRNAs were designed based on the NM_006610.4 transcript of MASP2 mRNA, and their sequences are shown in Table 2.

[0181] Table 2. Unmodified siRNA

[0182] In Table 2 above, column 1 is the name of the MASP2 siRNA, column 2 is the sense strand of the MASP2 siRNA, column 4 is the antisense strand of the MASP2 siRNA, column 3 is the sequence number of the sense strand of the MASP2 siRNA in column 2, and column 5 is the sequence number of the antisense strand of the MASP2 siRNA in column 4.

[0183] The MASP2 siRNA sequences shown in Table 2 were modified using the M1 modification pattern. The M1 modification pattern involves 2'-fluorination of nucleotides 7, 8, and 9 on the sense strand, and 2'-methoxyination of the remaining nucleotides, from the 5' end to the 3' end. Similarly, 2'-fluorination of nucleotides 2, 6, 14, and 16 on the antisense strand, and 2'-methoxyination of the remaining nucleotides, are performed. Phosphothioester linkages are formed between nucleotides 1 and 2, and between nucleotides 2 and 3 on the sense strand, and between nucleotides 1 and 2, 2 and 3, 19 and 20, and 20 and 21 on the antisense strand, resulting in the modified MASP2 siRNA. The modified siRNA is named according to "name of the original siRNA" + "modification pattern". For example, the modified hM-by239 obtained by modifying the sense and antisense strands of hM-by239 with M1 is named "hM-by239M1" or simply "239M1".

[0184] M1 Modification Mode:

[0185] Chain of Justice 5'-3':

[0186] NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm

[0187] Antisense chain 5'-3':

[0188] NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm

[0189] Where N represents a nucleotide (A, U, G, or C), m indicates that the nucleotide to the left of m is 2'-methoxy modified, s indicates phosphate thioester modification, meaning that the two nucleotides adjacent to the letter s are linked by phosphate thioester groups, and f indicates that the nucleotide to the left of f is 2'-fluoro modified. Exemplary M1-modified siRNAs are shown in Table 3.

[0190] Table 3. Exemplary M1-modified siRNAs

[0191] In the modified siRNA sequence above, "m" is OMe modification (2'-O-methyl modification), and it indicates that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; "f" is 2'F modification (2'-fluorine modification), and it indicates that the nucleotide adjacent to the left of the letter f is a fluorinated nucleotide; "s" is PS modification (phosphothiophosphate modification), and it indicates that the two nucleotides adjacent to the letter s are linked by phosphothiophosphate groups.

[0192] Example 2: Detection of siRNA activity in inhibiting MASP2 gene expression

[0193] (a) Using the psiCHECK vector to detect the knockdown activity of siRNA on MASP2 mRNA expression

[0194] Use psiCHECK TM -2 vectors were used to construct detection plasmids for the siRNAs provided in this disclosure.

[0195] In psiCHECK TM In the -2 vector, the firefly luciferase gene served as an internal reference reporter gene for normalization; the *Lysimachia foetida* luciferase gene served as the master reporter gene for monitoring the regulatory activity of siRNA. In this experiment, the MASP2 gene fragment was cloned into psiCHECK. TM The detection plasmid was obtained by finding a multiple cloning site downstream of the translation stop codon of Renali luciferase in the vector. When siRNA binds to the MASP2 mRNA transcribed from this plasmid, it leads to the degradation of the Renali luciferase-MASP2 fusion mRNA, thereby decreasing Renali luciferase expression. The strength of the siRNA's knockdown activity on MASP2 mRNA expression can be determined by detecting the degree of decrease in the amount of luminescent products catalyzed by Renali luciferase.

[0196] 1. Based on psiCHECK TM Construction of plasmid for detecting -2

[0197] Three different fragments of the hMASP2 gene (Table 5) were cloned into psiCHECK. TMThree detection plasmids were obtained by extracting the Xho I / Not I sites of the vector -2, as shown in Table 4.

[0198] Table 4. Detection of plasmids

[0199] 2. Cell culture and transfection

[0200] In a 96-well plate, add 5 μL of siRNA to each well (the final concentration of siRNA in each well will be 1 nM, 0.1 nM, or 0.01 nM), then add 12.5 μL of Opti-MEM (containing any one of the three detection plasmids shown in Table 5, 20 ng), followed by a mixture of 32.5 μL of Opti-MEM and 0.3 μL of Lipofectamine 2000 (purchased from Invitrogen, catalog number 11668-019); mix well at room temperature and let stand for 15 minutes. Then, add 1 × 10⁻⁶ ppm of siRNA to each well. 6 50 μL of DMEM medium suspension (complete DMEM medium, purchased from Transgen Biotech, catalog number FI101-01) was added to each HEK293T cell, and the cell plate was then incubated in a 37°C incubator with 5% CO2 and 95% air for 24 hours. In addition, a Mock group (solvent control group) was set up, in which 5 μL of DEPC water was added to replace the siRNA; and an NC group (siRNA with meaningless sequences) was set up.

[0201] 3. Dual-luciferase assay

[0202] After 24 hours of culture, remove the cell plate, aspirate 20 μL of culture medium from each well, and then add 75 μL of [unspecified ingredient] to each well. Luciferase Reagent was used, and the cell plates were then incubated at 30 rpm for 20 minutes at room temperature to induce lysis. The lysis buffer was then thoroughly mixed, and 75 μL was transferred to each well of the cell assay plate. The Firefly fluorescence values ​​were read using a microplate reader. Then, 75 μL of Luciferase Reagent was added to each well of the assay plate. Stop & Reagent was used to detect the fluorescence value of Renilla using a microplate reader.

[0203] The Renilla fluorescence values ​​in each well were normalized using the Firefly fluorescence values, with the formula R = Renilla fluorescence value / Firefly fluorescence value. The fluorescence ratio for each test group or solvent control group was the average of the fluorescence ratios of its three culture wells. Compared with the control group, the knockdown degree of MASP2 mRNA expression level by each siRNA was expressed as a percentage (inhibition rate), with inhibition rate % = (1 - R). 测试组 / R MOCK )×100%.

[0204] The inhibition rates of the siRNAs provided in this disclosure are shown in Tables 5 to 7 (in each table, "residual activity" refers to R...). 测试组 / R MOCK ).

[0205] Table 5. Inhibition rate of siRNA (plasmid psiCHECK2) TM -hMASP2-1)

[0206] Table 6. Inhibition rate of siRNA (plasmid psiCHECK2) TM -hMASP2-2)

[0207] Table 7. Inhibition rate of siRNA (plasmid psiCHECK2) TM -hMASP2-3)

[0208] The results showed that multiple siRNAs achieved inhibition rates higher than 60% at a concentration of 1 nM, namely hM-by239M1, hM-by240M1, hM-by244M1, hM-by362M1, hM-by363M1, hM-by368M1, hM-by375M1, hM-by376M1, hM-by380M1, hM-by384M1, hM-by385M1, hM-by386M1, hM-by392M1, and hM... -by393M1, hM-by395M1, hM-by435M1, hM-by556M1, hM-by615M1, hM-by617M1, hM-by618M1, hM-by689M1, hM- by692M1, hM-by693M1, hM-by700M1, hM-by704M1, hM-by705M1, hM-by707M1, hM-by708M1, hM-by709M1, hM-by 710M1, hM-by711M1, hM-by740M1, hM-by745M1, hM-by746M1, hM-by747M1, hM-by748M1, hM-by749M1, hM-by7 51M1, hM-by752M1, hM-by753M1, hM-by754M1, hM-by755M1, hM-by756M1, hM-by757M1, hM-by758M1, hM-by759 M1, hM-by760M1, hM-by827M1, hM-by828M1, hM-by829M1, hM-by833M1, hM-by839M1, hM-by848M1, hM-by850M 1. hM-by852M1, hM-by854M1, hM-by857M1, hM-by887M1, hM-by889M1, hM-by890M1, hM-by892M1 and hM-by895M1.

[0209] (II) Detection of the knockdown activity of siRNA on MASP2 mRNA expression level using MASP2-expressing cells

[0210] 1. Construction of stable MASP2 lentivirus cells

[0211] HepG2 cells were purchased from the Cell Bank of the Chinese Academy of Sciences. The following methods were used to construct stable transfected MASP2 lentivirus cells, HepG2MASP2 LV:

[0212] HepG2 cells were digested with trypsin, resuspended in complete culture medium, and the cell concentration was adjusted to 6 × 10⁶ cells / year. 4Cells were cultured at a concentration of 100 μL / mL, and then 500 μL was seeded into each well of a 24-well plate. After 12-20 hours of seeding, 100 μL of lentivirus expressing MASP2 (purchased from Suzhou Gemma Gene Co., Ltd., MASP2 transcription number NM_006610.4) was added to each well, and the medium was replaced with fresh medium after 12-20 hours. After 72 hours, puromycin was added to each well to a final concentration of 2 μg / mL, and the medium was replaced with fresh medium containing 2 μg / mL puromycin every 2-3 days. After 48 hours of puromycin selection, cell samples were collected, RNA was extracted, and validated by RT-PCR.

[0213] The culture conditions for HepG2 MASP2 LV were MEM + 10% FBS + 1% P.S + 1% sodium pyruvate + 1% NEAA + 1ug / mL puromycin.

[0214] 2. siRNA transfection of cells

[0215] Cultured HepG2 MASP2 LV cells were routinely trypsinized, resuspended in complete culture medium, and diluted to 6 × 10⁻⁶. 5 The sample was inoculated at 50 μL / well in a 96-well plate for subsequent experiments.

[0216] The siRNA test group was set up with a final transfection concentration of 1 nM, using Thermo Fisher Scientific's Lipofectamine transfection reagent. TM RNAiMAX was used to transfect HepG2 MASP2LV cells in the 96-well plate with siRNA according to the manufacturer's instructions. Forty-eight hours after transfection, the cell culture medium in each well was discarded, and 50 μL of cell lysis buffer (Germage) was added to each well. After incubation for 5 minutes for complete lysis, 5 μL of stop solution was added to each well to obtain the final lysis product. In addition, NC, MOCK, and BLANK groups were set up as controls; the MOCK group contained no siRNA in the cell wells; the BLANK group contained only cells; and the NC group contained siRNA with a meaningless sequence.

[0217] 3. RT-qPCR detection

[0218] The cell lysis products obtained from the above groups were added to DNase I to remove genomic DNA, and RNA templates were obtained after treatment. RT-qPCR was performed using human GAPDH (hGAPDH) as an internal reference gene, with the primers and probes shown in Table 8.

[0219] Table 8. Primers and probes used for RT-qPCR

[0220] Amplification was performed according to the standard RT-qPCR procedure, and fluorescence was collected. The relative quantification of the target gene MASP2 in each group was calculated using the Ct(ΔΔCt) method, as follows:

[0221] ΔCt(test group) = Ct(test group) 目标基因 –Ct(test group) 内参基因 )

[0222] ΔCt(control group) = Ct(control group) 目标基因 )–Ct(control group) 内参基因 )

[0223] ΔCt(test group) = ΔCt(test group) - ΔCt(control group) 平均 )

[0224] ΔCt(control group) = ΔCt(control group) - ΔCt(control group) 平均 )

[0225] Among them, ΔCt (control group) 平均 ) is the arithmetic mean of ΔCt (control group) for each sample in the control group (i.e., the Mock group); thus, each sample in the test group and the control group corresponds to a ΔCt value.

[0226] Using the control group as a baseline, the expression level of MASP2 mRNA in the test group was normalized, and the expression level of MASP2 mRNA in the control group was defined as 100%.

[0227] The relative expression level of MASP2 mRNA in the test group = 2 - ΔΔCt(test group) × 100%

[0228] The inhibition rate (100% - relative expression level) was further calculated, and the results are shown in Table 9.

[0229] Table 9. Inhibition rate of siRNA on MASP2 mRNA

[0230] The results showed that siRNA transfection of HepG2 MASP2 LV cell lines achieved MASP2 mRNA silencing, with 24 siRNAs showing relatively better silencing effects: hM-by239M1, hM-by376M1, hM-by386M1, hM-by392M1, hM-by438M1, hM-by689M1, hM-by708M1, hM-by710M1, hM-by747M1, hM-by749M1, and hM-by7 56M1, hM-by757M1, hM-by758M1, hM-by759M1, hM-by760M1, hM-by827M1, hM-by829M1, hM- by839M1, hM-by848M1, hM-by854M1, hM-by886M1, hM-by889M1, hM-by890M1 and hM-by895M1.

[0231] (III) IC50 of siRNA knockdown of MASP2 mRNA expression level

[0232] Following the method described in Part (II) above, 24 siRNAs were transfected into HepG2 MASP2 LV, with the difference being that the final siRNA concentrations at transfection were 10 nM, 1 nM, 0.333 nM, 0.111 nM, 0.037 nM, 0.012 nM, 0.004 nM, and 0.001 nM.

[0233] Using the log value of siRNA concentration as the X-axis and the inhibition rate as the Y-axis, the dose-response curve was fitted using the analysis software GraphPadPrism8 to obtain the IC50 value of each siRNA.

[0234] In HepG2 MASP2 LV cells, the IC50 values ​​for knocking down MASP2 or GAPDH mRNA expression levels with each siRNA are shown in Tables 10 to 14.

[0235] Table 10. IC50 of siRNA inhibiting MASP2 mRNA levels (Test 1)

[0236] Table 11. IC50 of siRNA inhibiting MASP2 mRNA levels (Test 2)

[0237] Table 12. IC50 of siRNA inhibiting MASP2 mRNA levels (Test 3)

[0238] Table 13. IC50 of siRNA inhibiting MASP2 mRNA levels (Test 4)

[0239] Table 14. IC50 of siRNA inhibiting MASP2 mRNA levels (Test 5)

[0240] The results showed that transfection with hM-by756M1, hM-by758M1, hM-by759M1, hM-by760M1, hM-by827M1, hM-by839M1, hM-by854M1, hM-by889M1, hM-by890M1, and hM-by895M1 resulted in better silencing of MASP2 mRNA.

[0241] Example 3: Study on the activity of siRNA silencing the MASP2 gene with different modification modes

[0242] (I) Synthesis of siRNAs with different modification patterns

[0243] The high-performing MASP2 siRNAs were further modified using different modification patterns. Specifically, hM-by756 was further modified using M2, M3, and M4 modification patterns; hM-by759 was further modified using M2 and M4 modification patterns; and hM-by758, hM-by760, hM-by827, hM-by839, hM-by854, hM-by889, hM-by890, and hM-by895 were further modified using M2, M3, M4, and M5 modification patterns, respectively, thus obtaining the corresponding modified MASP2 siRNAs. The modified siRNAs were named according to "original siRNA name" + "modification pattern". The M2, M3, M4, and M5 modification patterns are as follows.

[0244] M2:

[0245] Chain of Justice 5'-3':

[0246] NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm

[0247] Antisense chain 5'-3':

[0248] NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmsNmsNm

[0249] M3:

[0250] Chain of Justice 5'-3':

[0251] NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm

[0252] Antisense chain 5'-3':

[0253] NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm

[0254] M4:

[0255] Chain of Justice 5'-3':

[0256] NmsNmsNfNmNfNmNfNfNfNmNfNmNfNmNfNmNfNmNf

[0257] Antisense chain 5'-3':

[0258] NmsNfsNmNfNmNfNmNfNmNfNmNmNmNfNmNfNmNfNmsNmsNm

[0259] M5:

[0260] Chain of Justice 5'-3':

[0261] N(LNA)sNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm

[0262] Antisense chain 5'-3':

[0263] NmsNfsNmNmNmNfNmNfNfNmNmNmNmNfNmNfNmNmNmsNmsNm

[0264] Where N represents a nucleotide (A, U, G, or C), m indicates that the nucleotide to the left of m is a 2'-methoxy modified nucleotide, s indicates a phosphate thioester group modification, meaning that the two nucleotides adjacent to the letter s are linked by a phosphate thioester group, f indicates that the nucleotide to the left of f is a 2'-fluoro modified nucleotide, and (LNA) indicates that the nucleotide to the left is a locked nucleic acid modified as follows:

[0265] (II) IC50 of siRNA knockdown of MASP2 mRNA expression levels with different modification modifiers

[0266] Referring to the method described in Part (II) of Example 2, siRNA was transfected into HepG2 MASP2 LV, except that the final concentration of siRNA at the time of transfection was 10 nM, 1 nM, 0.333 nM, 0.111 nM, 0.037 nM, 0.012 nM, 0.004 nM, and 0.001 nM.

[0267] The IC50 values ​​of each siRNA were obtained by fitting dose-response curves using the log value of siRNA concentration as the X-axis and the percentage inhibition rate as the Y-axis. The results are shown in Table 15.

[0268] Table 15. IC50 of siRNA knockdown of MASP2 mRNA expression level

[0269] Example 4: L96 conjugation and VP modification of siRNA

[0270] Based on the M1 modification pattern, further 5'-(E)-VP modification is performed at the 5' end of the antisense strand (that is, the 5' hydroxyl group of the first nucleotide at the 5' end of the antisense strand is replaced with (E)-ethylene phosphate) to obtain siRNA modified by the M1VP modification pattern. The M1VP modification pattern is as follows:

[0271] M1VP:

[0272] Chain of Justice 5'-3':

[0273] NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm

[0274] Antisense chain 5'-3':

[0275] VPNmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm

[0276] The modified siRNA is named according to "name of the original siRNA" + "modification pattern". For example, the modified hM-by200 obtained by modifying the sense and antisense strands of hM-by200 with M1VP is named hM-by200M1VP.

[0277] Based on the M1 modification pattern, L96 was further coupled to the 3' end of the positive strand of the modified siRNA. The modification pattern of the L96-coupled siRNA is as follows:

[0278] M1G:

[0279] Chain of Justice 5'-3':

[0280] NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm-L96

[0281] Antisense chain 5'-3':

[0282] NmsNfsNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm

[0283] The modified siRNA is named according to "name of the original siRNA" + "modification pattern". For example, the modified hM-by200 obtained by modifying the sense and antisense strands of hM-by200 with M1G is named hM-by200M1G.

[0284] Based on the M1VP modification pattern, L96 was further coupled to the 3' end of the positive strand of the modified siRNA. The modification pattern of the siRNA coupled with L96 and 5'(E)-VP is as follows:

[0285] M1GVP:

[0286] Chain of Justice 5'-3':

[0287] NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm-L96

[0288] Antisense chain 5'-3':

[0289] VPNmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmsNmsNm

[0290] N represents a nucleotide (A, U, G, or C), m indicates that the nucleotide to the left of m is a 2'-methoxy modified nucleotide, s indicates a thiophosphate group modification, that is, the two nucleotides adjacent to the letter s are connected by a thiophosphate group, f indicates that the nucleotide to the left of f is a 2'-fluoro modified nucleotide, and VP indicates that the nucleotide has an (E)-vinyl phosphate modification at the 5' position.

[0291] The modified siRNA is named according to "name of the original siRNA" + "modification pattern". For example, the modified hM-by200 obtained by modifying the sense and antisense strands of hM-by200 with M1GVP is named "hM-by200M1GVP".

[0292] Using the above modification method, siRNA coupled with L96 and siRNA further modified with VP were prepared. Some of the siRNAs obtained are shown in Table 16.

[0293] Table 16. Exemplary VP-modified siRNAs and L96-coupled siRNAs

[0294] Example 5: In vivo mouse experiment on the effect of siRNA in inhibiting MASP2 gene expression.

[0295] (I) Experiment on the silencing effect of siRNA on MASP2 mRNA

[0296] Single-concentration administration experiments were conducted on hMASP2 transgenic mice. These transgenic mice were constructed by Suzhou Genecasting Co., Ltd.

[0297] The siRNA to be tested was diluted with 1 OD / 40 μL of physiological saline. Mice were grouped as follows: saline group: three female and three male mice; test group for each siRNA: one female and one male mouse. The dosage for mice was 3 mg / kg based on the mass of siRNA / mouse weight, administered in 100 μL volumes (physiological saline or a saline dilution of siRNA), via subcutaneous injection on day 0.

[0298] On day 14 after administration, a total of 112 mice were euthanized, and a piece of liver tissue was taken, 20 mg per piece, cut into small pieces, and placed in RNA protection solution overnight at -4°C. The next day, the tissue was placed at -20°C.

[0299] For RT-qPCR detection, DNase I was added to the liver tissue lysate to remove genomic DNA, and the resulting RNA template was obtained. Following the description in Part (II) of Example 2, mouse GAPDH (mGAPDH) was used as an internal reference gene to detect the in vivo inhibition rate of each siRNA on MASP2 mRNA expression levels; the RT-qPCR primers and probes used for mGAPDH were as follows:

[0300] Forward primer: CCTTCATTGACCTCAACTACATGG (SEQ ID NO.148);

[0301] Reverse primer: CTCGCTCCTGGAAGATGGTG (SEQ ID NO.149);

[0302] Probe: ATGTTCCAGTATGACTCCACTCACGGCA(FAM) (SEQ ID NO.150).

[0303] The results are shown in Table 17.

[0304] Table 17. In vivo inhibition rate of siRNA against MASP2 mRNA

[0305] The test results showed that the siRNA of the present invention, when administered to hMASP2 transgenic mice, basically achieved the silencing effect of MASP2 mRNA. Among them, hM-by756M1G, hM-by758M1G, hM-by759M1G, hM-by760M1G, hM-by827M1G, hM-by839M1G, hM-by854M1G, hM-by889M1G, hM-by890M1G, and hM-by895M1G showed relatively better silencing effects.

[0306] (II) In vivo gene expression knockdown effect experiment

[0307] As described in Part (I) of this embodiment, the activity of siRNA in inhibiting MASP2 gene expression was again detected in hMASP2 transgenic mice.

[0308] Similarly, the siRNA to be tested was diluted with 1 OD / 40 μL of physiological saline. Mice were grouped as follows: three mice in each saline group and three mice in each siRNA test group. The dosage for mice was 2.5 mg / kg, and the administration volume was 100 μL (physiological saline or physiological saline dilution of siRNA), administered subcutaneously on the same day.

[0309] On day 14 after administration, a total of 33 mice were euthanized, and a piece of liver tissue was taken, 20 mg per piece, cut into small pieces, and placed in RNA protection solution overnight at -4°C. The next day, it was placed at -20°C.

[0310] For RT-qPCR detection, DNase I was added to the liver tissue lysate to remove genomic DNA, and the resulting RNA template was obtained. Following the description in Part (II) of Example 2, mGAPDH was used as an internal reference gene (RT-qPCR primers and probes were the same as above) to detect the relative expression of MASP2 mRNA after administration of each siRNA. The results are shown in Table 18.

[0311] The results showed that the siRNA of the present invention reduced MASP2 mRNA expression in hMASP2 transgenic mice after administration.

[0312] Table 18. In vivo inhibition rate of siRNA against MASP2 mRNA (within-group mean)

[0313] (III) In vivo pharmacodynamic experiments of siRNA with different modification modes inhibiting MASP2 gene expression

[0314] As described in Part (I) of this embodiment, the activity of siRNA knockdown of MASP2 mRNA expression with different modification patterns was again detected in hMASP2 transgenic mice.

[0315] Similarly, the siRNA to be tested was diluted with 1 OD / 40 μL of physiological saline. Mice were grouped as follows: three mice in each saline group and three mice in each siRNA test group. The dosage for mice was 1 mg / kg, and the administration volume was 200 μL (physiological saline or physiological saline dilution of siRNA), administered subcutaneously on the same day.

[0316] siRNA is hM-by756M1G, hM-by756M2G, hM-by756M3G, hM-by756M4G, hM-by759M1G, hM-by759M2G, hM-by759M4G, hM-by758M1G, hM-by758M2G, hM- by758M3G, hM-by758M4G, hM-by760M1G, hM-by760M2G, hM-by760M3G, hM-by760M4G, hM-by827M1G, hM-by827M2G, hM-by827M3G, hM-by827M4G.

[0317] Six mice were used in each group. On day 14 after drug administration, three mice were euthanized, and one piece of liver tissue (20 mg per piece) was taken, chopped, and placed in RNA protection solution overnight at -4°C. The next day, the tissue was placed at -20°C. On day 28 after drug administration, three mice were euthanized, and one piece of liver tissue (20 mg per piece) was taken, chopped, and placed in RNA protection solution overnight at -4°C. The next day, the tissue was placed at -20°C.

[0318] During RT-qPCR detection, DNase I was added to the liver tissue lysate to remove genomic DNA, and the resulting RNA template was obtained. Following the description in Part (II) of Example 2, mGAPDH was used as an internal reference gene (RT-qPCR primers and probes were the same as above), and the in vivo inhibition rate of each siRNA on the expression level of MASP2 mRNA was detected.

[0319] The results showed that different modified siRNAs had different inhibitory effects on mRNA expression when administered to hMASP2 transgenic mice.

[0320] (iv) Experiment on gene expression knockdown effect of siRNA in hMASP2 transgenic mice

[0321] As described in Part (I) above, the activity of the siRNA in inhibiting MASP2 gene expression was tested again.

[0322] Similarly, the siRNA to be tested was diluted with 1 OD / 40 μL of physiological saline. Based on different dosages, the experiments were divided into the following two groups:

[0323] Experiment 1: Mice were grouped as follows: the saline group and the test group for each siRNA contained at least 9 mice. The dosage of the drug was 1 mg / kg, and the administration volume was 200 μL (saline or saline dilution of siRNA), administered subcutaneously on the same day. A model group (NA group) was also set up.

[0324] Experiment 2: Mice were grouped as follows: the saline group and the test group for each siRNA contained at least 15 mice. The dosage was 3 mg / kg, and the administration volume was 200 μL (saline or saline dilution of siRNA), administered subcutaneously on the same day. A model group (NA group) was also set up.

[0325] Mice in Experiment 1 were euthanized 6 days before drug administration (NA group), on the day of drug administration (NA group), and on days 14, 21, and 28 after drug administration. Mice in Experiment 2 were euthanized 6 days before drug administration (NA group), on the day of drug administration (NA group), and on days 14, 21, 28, 42, and 56 after drug administration, for a total of 266 mice. After euthanasia, one piece of liver tissue (20 mg per piece) was taken, cut into small pieces, and placed in RNA protection solution overnight at -4°C, and then placed at -20°C the next day.

[0326] For RT-qPCR detection, DNase I was added to the liver tissue lysate to remove genomic DNA, and the resulting RNA template was obtained. Following the description in Part (II) of Example 2, mGAPDH was used as an internal reference gene (RT-qPCR primers and probes were the same as above) to detect the relative expression level of MASP2 mRNA after administration of each siRNA. The results are shown in Table 19 (Experiment 1) and Table 20 (Experiment 2).

[0327] Table 19. Relative expression levels of MASP2 mRNA after siRNA administration (within-group mean)

[0328] Note: " / " indicates that no valid data was obtained.

[0329] Table 20. Relative expression levels of MASP2 mRNA after siRNA administration (within-group mean)

[0330] Example 6: siRNA off-target analysis

[0331] Hep3B cells were purchased from the Chinese Academy of Sciences Cell Bank and cultured under the following conditions: MEM + 10% FBS + 1% P.S + 1% sodium pyruvate + 1% NEAA.

[0332] MASP2 lentiviral stable-transformed cells, HepG2 MASP2 LV and Hep3B cells, cultured in 10cm culture dishes, were routinely trypsinized after 48 hours of passage. The cells were resuspended in complete culture medium and diluted to 3.75 × 10⁻⁶. 5 cells / mL and 1.875×10 5 400 μL / well was seeded into a 24-well plate for subsequent experiments.

[0333] siRNA concentration set at 10 nM for transfection, transfection reagent Lipofectamine TM RNAiMAX dosage: 1.25 μL / well. Prepare the transfection complex by diluting siRNA and Lipofectamine separately with 50 μL opti-MEM for each cell well. TM After the RNAiMAX transfection reagent has been left to stand for 5 minutes, the two components are mixed and left to stand for 20 minutes.

[0334] After the settling time is up, add 100 μL of the transfection complex to the corresponding cell wells, making a final volume of 500 μL per well. After 24 hours of transfection, remove the transfected 24-well plate.

[0335] RNA was extracted from cells using the Trizol method and sequenced. Statistical methods were used to compare differences in gene expression; the results are shown in Table 21.

[0336] Table 21. RNA-seq sequencing results

[0337] Example 7: In vivo verification of siRNA inhibition of MASP2 gene expression in cynomolgus monkeys

[0338] Single-concentration administration experiments were conducted on siRNA in cynomolgus monkeys.

[0339] The siRNA to be tested was diluted with physiological saline. The cynomolgus monkeys were divided into groups of three males for each siRNA. The dosage for the cynomolgus monkeys was 3 mg / kg, administered via a single subcutaneous injection through the loose skin below the scapula on the back.

[0340] Blood samples were collected before and at different time points after drug administration to detect the expression level of MASP2 protein in serum and calculate the relative expression level (%). The results are shown in Figure 1.

[0341] The results showed that in cynomolgus monkeys, each siRNA could effectively inhibit the expression of MASP2 protein in serum, and even at week 16, it could still maintain a protein inhibition efficiency of more than 85%.

[0342] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. An siRNA comprising a sense strand and an antisense strand: the sense strand comprising a nucleotide sequence represented by any odd number n from SEQ ID NO.1 to SEQ ID NO.130, and the antisense strand comprising a nucleotide sequence represented by any even number n+1 from SEQ ID NO.1 to SEQ ID NO.130, where n is an odd number between 1 and 130.

2. The siRNA according to claim 1, characterized in that, The siRNAs are selected from: hM-by759, hM-by756, hM-by757, hM-by758, hM-by760, hM-by827, hM-by895, hM-by828, hM-by829, hM-by833, hM-by839, hM-by848, hM-by850, hM-by852, hM-by8 54. hM-by857, hM-by887, hM-by889, hM-by890, hM-by892, hM-by239, hM-by240, hM-by 244. hM-by362, hM-by363, hM-by368, hM-by375, hM-by376, hM-by380, hM-by384, hM-b y385, hM-by386, hM-by392, hM-by393, hM-by395, hM-by435, hM-by556, hM-by615, hM- by617, hM-by618, hM-by689, hM-by692, hM-by693, hM-by700, hM-by704, hM-by705, hM -by707, hM-by708, hM-by709, hM-by710, hM-by711, hM-by740, hM-by745, hM-by746, h M-by747, hM-by748, hM-by749, hM-by751, hM-by752, hM-by753, hM-by754 or hM-by755.

3. The siRNA according to any one of claims 1 to 2, characterized in that, At least one nucleotide in the sense or antisense strand of the siRNA is a modified nucleotide.

4. The siRNA according to claim 3, wherein the modified nucleotide is selected from at least one of the following: 2'-methyl modified nucleotides, 2'-fluorine modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl alcohol-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, and nucleotides containing 5'-phosphate ester mimics.

5. The siRNA according to any one of claims 3 to 4, wherein the modified nucleotide is selected from 2'-methyl modified nucleotides or 2'-fluorine modified nucleotides.

6. The siRNA according to any one of claims 1 to 5, characterized in that, The siRNA further includes at least one thiophosphate group modification, which is located in both the sense and antisense strands of the siRNA.

7. The siRNA according to any one of claims 1 to 6, characterized in that, The siRNA is modified in the following way: Following the 5'-to-3' direction, the nucleotides at positions 7, 8, and 9 of the sense strand are 2'-fluorinated nucleotides; following the 5'-to-3' direction, the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides; the remaining nucleotides are 2'-methoxyinated nucleotides. Further, following the 5'-to-3' direction, the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by thiophosphate groups.

8. The siRNA according to any one of claims 1 to 7, characterized in that, The siRNA is selected from hM-by759M1, hM-by756M1, hM-by757M1, hM-by758M1, hM-by760M1, hM-by827M1, hM-by828M1, hM-by829M1, hM-by833M1, hM-by839M1, hM-by848M1, hM-by850M1, hM-by852M1, hM-by854M1, and hM-by857M1.

1. hM-by887M1, hM-by889M1, hM-by890M1, hM-by892M1, hM-by895M1, hM-by239M1, hM-by240M1, hM-by24 4M1, hM-by362M1, hM-by363M1, hM-by368M1, hM-by375M1, hM-by376M1, hM-by380M1, hM-by384M1, hM-by3 85M1, hM-by386M1, hM-by392M1, hM-by393M1, hM-by395M1, hM-by435M1, hM-by556M1, hM-by615M1, hM-b y617M1, hM-by618M1, hM-by689M1, hM-by692M1, hM-by693M1, hM-by700M1, hM-by704M1, hM-by705M1, hM- by707M1, hM-by708M1, hM-by709M1, hM-by710M1, hM-by711M1, hM-by740M1, hM-by745M1, hM-by746M1, h M-by747M1, hM-by748M1, hM-by749M1, hM-by751M1, hM-by752M1, hM-by753M1, hM-by754M1 or hM-by755M1.

9. The siRNA according to any one of claims 1 to 8, characterized in that, The siRNA contains a sense strand and an antisense strand as shown below: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.132; Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm(SEQ ID NO.131); Antonym chain: AmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm(SEQ ID NO.132); (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.134; Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm(SEQ ID NO.133); Antonym chain: UmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.134); (3) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.136; Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm(SEQ ID NO.135) Antonym chain: UmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.136) or (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.138; Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm(SEQ ID NO.137) Antonym chain: UmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.138). (5) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.151; Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm(SEQ ID NO.131); Antisense strand: VPAmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm (SEQ ID NO. 151); (6) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.152; Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm(SEQ ID NO.133); Antonym chain: VPUmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.152); (7) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.153; Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm(SEQ ID NO.135) Antonym chain: VPUmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.153) or (8) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.154; Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm(SEQ ID NO.137) Antonym chain: VPUmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.154).

10. The siRNA according to any one of claims 1 to 9, characterized in that, A ligand is attached to the 3'-end or 5'-end of the positive strand of the siRNA or to any nucleotide in the positive strand.

11. The siRNA according to claim 10, characterized in that, The ligand comprises N-acetylgalactosamine (GalNAc) or a derivative thereof.

12. The siRNA according to any one of claims 10 to 11, characterized in that, The ligand is L96 as shown in the following formula:

13. The siRNA according to any one of claims 1 to 12, characterized in that, The first nucleotide at the 5' end of the antisense strand of the siRNA is a nucleotide modified with 5'(E)-VP as shown in the following formula:

14. The siRNA according to any one of claims 1 to 13, characterized in that, The siRNA contains a sense strand and an antisense strand as shown below: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.132; Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm-L96 (SEQ ID NO.131); Antonym chain: AmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm(SEQ ID NO.132); (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO.131 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.151; Chain of Justice: CmsUmsAmCmGmAmCfUfUfUmCmUmCmAmAmGmAmUmUm-L96 (SEQ ID NO.131); Antisense strand: VPAmsAfsUmCmUmUfGmAmGmAmAmAmGmUfCmGfUmAmGmsGmsGm (SEQ ID NO. 151); (3) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.134; Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm-L96 (SEQ ID NO.133); Antonym chain: UmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.134); (4) The sense strand contains the nucleotide sequence shown in SEQ ID NO.133 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.152; Chain of Justice: AmsCmsGmAmCmUmUfUfCfUmCmAmAmGmAmUmUmCmAm-L96 (SEQ ID NO.133); Antonym chain: VPUmsGfsAmAmUmCfUmUmGmAmGmAmAmAfGmUfCmGmUmsAmsGm (SEQ ID NO.152); (5) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.136; Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm-L96 (SEQ ID NO.135) Antonym chain: UmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.136) (6) The sense strand contains the nucleotide sequence shown in SEQ ID NO.135 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.153; Chain of Justice: CmsGmsAmCmUmUmUfCfUfCmAmAmGmAmUmUmCmAmAm-L96 (SEQ ID NO.135) Antonym chain: VPUmsUfsGmAmAmUfCmUmUmGmAmGmAmAfAmGfUmCmGmsUmsAm(SEQ ID NO.153) (7) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.138; Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm-L96 (SEQ ID NO.137) Antonym chain: UmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.138); or (8) The sense strand contains the nucleotide sequence shown in SEQ ID NO.137 and is coupled with L96 at the 3' end, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.154; Chain of Justice: GmsAmsCmUmUmUmCfUfCfAmAmGmAmUmUmCmAmAmAm-L96 (SEQ ID NO.137) Antonym chain: VPUmsUfsUmGmAmAfUmCmUmUmGmAmGmAfAmAfGmUmCmsGmsUm(SEQ ID NO.154).

15. A composition comprising the siRNA according to any one of claims 1 to 4.

16. Use of the siRNA of any one of claims 1 to 14 or the composition of claim 15 in the preparation of a medicament for treating diseases caused by abnormal MASP2 expression.

17. A method for treating a disease caused by abnormal MASP2 expression, the method comprising administering to a subject in need the siRNA of any one of claims 1 to 14 or the composition of claim 15.

18. The use of claim 16 or the method of claim 17, wherein the disease caused by abnormal MASP2 expression can be a disease caused by upregulation of MASP2 expression; further, the disease caused by abnormal MASP2 expression includes autoimmune diseases, rare diseases, or a variety of common diseases, specifically including but not limited to age-related macular degeneration (AMD), kidney diseases (such as IgA nephropathy, lupus nephritis, glomerulonephritis, nephrotic syndrome, diabetic nephropathy, membranous nephropathy), ischemia-reperfusion injury (such as renal ischemia-reperfusion, myocardial ischemia-reperfusion, ischemic stroke), paroxysmal nocturnal hemoglobinuria, hemolytic uremic syndrome, rheumatoid arthritis, multiple sclerosis, moderate to severe active systemic lupus erythematosus, and nervous system diseases. Systemic immune disorders, optic neuritis, thrombocytopenia, relapsed / refractory multiple sclerosis, IgG4-related diseases, glomerulonephritis, myasthenia gravis, non-Hodgkin's lymphoma, autoantibody-positive systemic lupus erythematosus, relapsed / refractory multiple myeloma, generalized myasthenia gravis, neuromyelitis optica, mantle cell lymphoma, myeloma, neuromyelitis optica spectrum disorders, steroid-resistant nephrotic syndrome, ANCA-associated vasculitis, scleroderma, Sjögren's syndrome, connective tissue disease-related thrombocytopenia, kidney transplant rejection, hereditary angioedema, thrombotic microangiopathy (such as atypical hemolytic uremic syndrome), geographic atrophy, diabetic retinopathy, retinitis pigmentosa, macular edema, Parkinson's disease, etc.

19. A method for inhibiting MASP2 expression in cells, the method comprising contacting the cells with any one of 1 to 14 siRNA or the composition of claim 15.

Citation Information

Patent Citations

  • Nucleic acid capable of inhibiting expression of MASP2

    CN110506116A

  • Double-stranded siRNA analogue for inhibiting MASP2 expression as well as preparation method and application of double-stranded siRNA analogue

    CN120118899A

  • Methods for reducing proteinuria in a human subject suffering from immunoglobulin a nephropathy

    WO2018071701A1

  • Mannan binding lectin serine peptidase 2 (MASP2) IRNA compositions and methods of use thereof

    WO2021168148A1

  • Nucleic acids for inhibiting expression of MASP-2 in a cell

    WO2023152286A1