Therapy and drug screening for cardiomyocyte injury-related diseases

Abstract

Provided is a use of a reagent capable of regulating the expression of the Ncbp2 gene or regulating the activity of an expression product of the Ncbp2 gene in the preparation of a drug for preventing and / or treating diseases or conditions related to cardiomyocyte injury in a subject.

Description

Treatment of myocardial cell injury related diseases and drug screening

[0001] Cross-reference to Related Applications

[0002] This application claims priority to Chinese Patent Application No. 202411025426.2, filed July 29, 2024, the entire contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0003] The present application relates to the field of biological medicine, and relates to the use of an agent capable of regulating the expression of an Ncbp2 gene or the activity of an expression product of the Ncbp2 gene in the preparation of a medicament for preventing and / or treating a disease or disorder related to myocardial cell injury in a subject. BACKGROUND

[0004] Cardiovascular disease represents one of the medical challenges and is the leading cause of morbidity and mortality in many developed countries. Although various methods have been developed in the past two decades to repair or replace damaged myocardium, so far, it is still difficult to find suitable myocardial cells to replace the necrotic myocardium of patients in the medical research progress, therefore, the loss of myocardium and its final replacement is an important goal of heart research. This needs to be tackled from multiple aspects, including understanding how myocardial cells develop and mature, how cardiovascular disease develops, what are the important regulatory patterns, how to repair the heart based on these regulatory patterns, etc.

[0005] Alternative splicing (AS) is a ubiquitous mechanism of gene expression regulation. Genome-wide surveys have shown that approximately 90-95% of human genes undergo alternative splicing, leading to the complexity of the proteome to serve complex biological functions. Many studies have reported that alternative splicing plays an important role in the development of mammals, cell and organ functional specialization, and disease progression. In the heart, AS is increasingly recognized as an important role related to heart development, homeostasis and disease. Previous studies on the role of AS in heart development were based on the organ level, but due to the high heterogeneity of myocardial cells in the heart, resolving the AS of different cells in the heart at the single cell resolution helps to understand the process of heart development and maturation. Therefore, it is particularly important to find more accurate splicing regulators based on single cell resolution from a more precise perspective.

[0006] NCBP2 (Nuclear cap-binding protein subunit 2) is a subunit of the heterodimeric cap-binding complex, which is known to directly bind to the RNA cap, facilitate RNA processing, and is an RNA binding protein (RBP). RBP can regulate AS through cooperation and antagonism, and the role of NCBP2 in AS regulation and heart maturation is unclear, and there is no report of its use in myocardial cell repair. SUMMARY

[0007] The inventors of the present application have surprisingly found that activating the expression of Ncbp2 can promote the proliferation of myocardial cells and repair myocardial injury, and thus obtained the use of an activator of Ncbp2 in the preparation of a medicament for preventing and / or treating a disease or disorder related to myocardial cell injury, thereby completing the present application.

[0008] Pharmaceutical use

[0009] In one aspect, the present application provides the use of an agent capable of modulating the expression of a Ncbp2 gene or modulating the activity of an expression product of a Ncbp2 gene in the preparation of a medicament for preventing and / or treating a disease or disorder related to myocardial cell injury in a subject.

[0010] In certain embodiments, the agent is an activator capable of activating or up-regulating the expression of the Ncbp2 gene and / or activating or enhancing the activity of an expression product of the Ncbp2 gene.

[0011] In certain embodiments, the agent can exert its activating effect through any mechanism, for example, by activating the expression of a gene at the RNA or protein level (e.g., enhancing the transcription of a gene, and / or, enhancing the translation of the mRNA product of the gene).

[0012] In certain embodiments, the agent enhances the biological function of the gene by activating the expression level of the gene. In such embodiments, the determination of the expression level can be carried out at the nucleic acid level or the protein level. Methods for determining expression at the nucleic acid level include, but are not limited to, Northern blotting, PCR, RT-PCR, or real time RT-PCR. Methods for determining expression at the protein level include, but are not limited to, Western blotting or polyacrylamide gel electrophoresis combined with protein staining techniques such as Coomassie blue or silver staining, mass spectrometry, ELISA, etc.

[0013] In certain embodiments, the agent is selected from an expression product of the Ncbp2 gene or an active fragment thereof, a nucleic acid molecule encoding the expression product or the active fragment thereof, an antibody or an antigen-binding fragment thereof, a low-molecular-weight chemical compound.

[0014] In the present disclosure, the expression "low molecular weight chemical compound" refers to an organic non-protein compound. In some embodiments, the low molecular weight chemical compound has a molecular weight of no more than 1500 Da. The low molecular weight chemical compound is capable of binding to and enhancing the function of the above-mentioned gene or its expression product. The low molecular weight chemical compound can be obtained by screening existing low molecular weight chemical compound libraries (e.g., Chem Bridge, Chem Div, Inter Bio Screen, Life Chemicals, Specs, or Vitas-m) and determining the activation activity of the compound on the expression level of the above-mentioned gene using the method as described above.

[0015] In some embodiments, the expression product of the Ncbp2 gene is selected from mRNA or protein.

[0016] In some embodiments, the agent is an Ncbp2 mRNA or a nucleic acid molecule comprising an Ncbp2 mRNA.

[0017] In some embodiments, the nucleic acid molecule comprises a Cap1 structure, a 5' UTR at its 5' end, a 3' UTR and a PolyA tail at its 3' end.

[0018] In some embodiments, the nucleic acid molecule comprises, in order from 5' end to 3' end: a Cap1 structure, a 5' UTR, an mRNA of Ncbp2, a self-cleaving peptide (such as T2A), a reporter gene (such as a fluorescent protein, e.g., eGFP), a 3' UTR and a PolyA tail.

[0019] In some embodiments, the Ncbp2 mRNA encodes a human NCBP2 protein (such as shown in SEQ ID NO: 17).

[0020] In some embodiments, the agent is an Ncbp2 mRNA or a nucleic acid molecule comprising an Ncbp2 mRNA.

[0021] In some embodiments, the nucleic acid molecule comprises a Cap1 structure, a 5' UTR at its 5' end, a 3' UTR and a PolyA tail at its 3' end.

[0022] In some embodiments, the nucleic acid molecule comprises, in order from 5' end to 3' end: a Cap1 structure, a 5' UTR, an mRNA of Ncbp2, a self-cleaving peptide (such as T2A), a reporter gene (such as a fluorescent protein, e.g., eGFP), a 3' UTR and a PolyA tail.

[0023] In some embodiments, the agent comprises a sequence as shown in SEQ ID NO: 10.

[0024] In certain embodiments, the agent is an NCBP2 protein or a polypeptide comprising an NCBP2 protein.

[0025] In certain embodiments, the polypeptide further comprises a CPP and / or a NLS.

[0026] In certain embodiments, the polypeptide comprises, in order from N-terminus to C- terminus, a CPP, a NLS, and an NCBP2 protein.

[0027] In certain embodiments, the polypeptide comprises a protein tag at its N-terminus or C- terminus. In certain embodiments, the protein tag is a purification tag (e.g., His tag).

[0028] In certain embodiments, each domain of the polypeptide is optionally connected by a peptide linker.

[0029] In certain embodiments, the NCBP2 protein is of human origin, e.g., comprising the sequence set forth in SEQ ID NO: 17.

[0030] In certain embodiments, the agent comprises a sequence as set forth in SEQ ID NO: 12 or 14.

[0031] In certain embodiments, the agent is an expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof. In certain embodiments, the nucleic acid molecule is operably linked to an expression regulatory element (e.g., a promoter).

[0032] In certain embodiments, the agent is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0033] In certain embodiments, the agent is a viral vector (e.g., AAV, HIV) comprising a nucleic acid molecule encoding a human NCBP2 protein (as set forth in SEQ ID NO: 17).

[0034] In certain embodiments, the agent is an expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof. In certain embodiments, the nucleic acid molecule is operably linked to an expression regulatory element (e.g., a promoter).

[0035] In certain embodiments, the agent is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0036] In certain embodiments, the agent is a viral vector (e.g., AAV, HIV) comprising an Ncbp2 coding sequence as set forth in SEQ ID NO: 1.

[0037] In certain embodiments, the agent comprises a sequence as set forth in SEQ ID NO: 15 or 18.

[0038] In certain embodiments, the agent is an expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof. In certain embodiments, the nucleic acid molecule is operably linked to an expression regulatory element (e.g., a promoter). In certain embodiments, the agent further comprises a regulatory vector that regulates expression of the expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof.

[0039] In certain embodiments, the regulatory vector comprises a nucleic acid molecule encoding a regulatory element, and the expression vector comprises a response element. In certain embodiments, the regulatory element encoded by the regulatory vector is rtTA, and the response element comprised by the expression vector is TRE. In certain embodiments, in the expression vector, the nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof is located 3’ downstream of the response element.

[0040] In certain embodiments, the expression vector or regulatory vector is a viral vector, such as a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0041] In certain embodiments, the expression vector is a viral vector (such as AAV) comprising the Ncbp2 coding sequence set forth in SEQ ID NO: 1.

[0042] In certain embodiments, the regulatory vector comprises a sequence as set forth in SEQ ID NO: 19.

[0043] In certain embodiments, the expression vector comprises a sequence as set forth in SEQ ID NO: 20.

[0044] In certain embodiments, the subject is a mammal, such as a human.

[0045] In certain embodiments, the disease or condition associated with damage to cardiomyocytes is selected from cardiovascular diseases.

[0046] In certain embodiments, the cardiovascular disease causes one or more conditions selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring.

[0047] In certain embodiments, the cardiovascular disease is selected from the group consisting of myocardial infarction, heart failure, arrhythmia, cardiomyopathy, coronary heart disease, hypertensive heart disease, congenital heart disease, hypertension, myocarditis, pericarditis, atherosclerosis, rheumatic heart disease, pericardial tumour, cor pulmonale, valvular heart disease, senile valvular heart disease, cardiac amyloidosis, pericardial effusion.

[0048] In certain embodiments, the disease or disorder associated with myocardial cell damage is selected from the group consisting of myocardial infarction, heart failure, arrhythmia, myocardial scarring, cardiomyopathy, coronary heart disease, hypertensive heart disease.

[0049] In certain embodiments, the medicament is for preventing and / or treating heart failure, which can be caused by any disease or disorder, such as any cardiovascular disease, for example myocardial infarction, arrhythmia, cardiomyopathy, coronary heart disease, hypertensive heart disease, congenital heart disease, hypertension, myocarditis, pericarditis, atherosclerosis, rheumatic heart disease, pericardial tumour, cor pulmonale, valvular heart disease, senile valvular heart disease, cardiac amyloidosis, pericardial effusion, etc.

[0050] In certain embodiments, the medicament is capable of improving cardiac contractile function and / or reducing fibrosis.

[0051] Methods of preventing and / or treating a disease or disorder associated with myocardial cell damage

[0052] In another aspect, the present application also provides a method for preventing and / or treating a disease or disorder associated with myocardial cell damage in a subject, comprising: administering to a subject in need thereof an effective amount of an agent capable of modulating the expression of the Ncbp2 gene or modulating the activity of the expression product of the Ncbp2 gene.

[0053] In certain embodiments, the agent is an activator capable of activating or up-regulating the expression of the Ncbp2 gene and / or activating or enhancing the activity of the expression product of the Ncbp2 gene.

[0054] In certain embodiments, the agent can exert its activating effect through any mechanism, for example by activating the expression of the gene at the RNA or protein level (e.g. enhancing the transcription of the gene, and / or, enhancing the translation of the mRNA product of the gene).

[0055] In certain embodiments, the agent enhances the biological function of the gene by activating the expression level of the gene. In such embodiments, the determination of the expression level can be carried out at the nucleic acid level or the protein level. Methods for determining expression at the nucleic acid level include, but are not limited to, Northern blot, PCR, RT-PCR, or real time RT-PCR. Methods for determining expression at the protein level include, but are not limited to, Western blot or polyacrylamide gel electrophoresis combined with protein staining techniques such as Coomassie blue or silver staining, mass spectrometry, ELISA, etc.

[0056] In certain embodiments, the agent is selected from the expression product of the Ncbp2 gene or an active fragment thereof, a nucleic acid molecule encoding the expression product or an active fragment thereof, an antibody or an antigen-binding fragment thereof, a low molecular weight chemical compound.

[0057] In this context, the expression "low molecular weight chemical compound" refers to an organic non-protein compound. In certain embodiments, the low molecular weight chemical compound has a molecular weight of no more than 1500 Da. The low molecular weight chemical compound is capable of binding to and enhancing the function of the above-mentioned gene or its expression product. The low molecular weight chemical compound can be obtained by screening existing low molecular weight chemical compound libraries (e.g., Chem Bridge, Chem Div, Inter Bio Screen, Life Chemicals, Specs, or Vitas-m) and determining the activating activity of the compounds on the expression level of the above-mentioned gene using the methods as described above.

[0058] In certain embodiments, the expression product of the Ncbp2 gene is selected from mRNA or protein.

[0059] In certain embodiments, the agent is Ncbp2 mRNA or a nucleic acid molecule comprising Ncbp2 mRNA.

[0060] In certain embodiments, the nucleic acid molecule comprises a Cap1 structure, a 5'UTR at its 5' end, a 3'UTR and a PolyA tail at its 3' end.

[0061] In certain embodiments, the nucleic acid molecule comprises, in order from 5' end to 3' end: a Cap1 structure, a 5'UTR, mRNA of Ncbp2, a self-cleaving peptide (such as T2A), a reporter gene (such as a fluorescent protein, e.g., eGFP), a 3'UTR, and a PolyA tail.

[0062] In certain embodiments, the Ncbp2 mRNA encodes a human NCBP2 protein (such as shown in SEQ ID NO: 17).

[0063] In certain embodiments, the agent is an Ncbp2 mRNA or a nucleic acid molecule comprising an Ncbp2 mRNA.

[0064] In certain embodiments, the nucleic acid molecule comprises a Cap1 structure, a 5’ UTR at its 5’ end, a 3’ UTR and a PolyA tail at its 3’ end.

[0065] In certain embodiments, the nucleic acid molecule comprises, in order from 5’ end to 3’ end: a Cap1 structure, a 5’ UTR, an mRNA of Ncbp2, a self-cleaving peptide (such as T2A), a reporter gene (such as a fluorescent protein, e.g., eGFP), a 3’ UTR and a PolyA tail.

[0066] In certain embodiments, the agent comprises a sequence as set forth in SEQ ID NO: 10.

[0067] In certain embodiments, the agent is an NCBP2 protein or a polypeptide comprising an NCBP2 protein.

[0068] In certain embodiments, the polypeptide further comprises a CPP and / or a NLS.

[0069] In certain embodiments, the polypeptide comprises, in order from N-terminus to C-terminus: a CPP, a NLS and an NCBP2 protein.

[0070] In certain embodiments, the polypeptide comprises a protein tag at its N-terminus or C-terminus. In certain embodiments, the protein tag is a purification tag (e.g., His tag).

[0071] In certain embodiments, the various domains of the polypeptide are optionally connected by a peptide linker.

[0072] In certain embodiments, the NCBP2 protein is of human origin, e.g., comprises a sequence as set forth in SEQ ID NO: 17.

[0073] In certain embodiments, the agent comprises a sequence as set forth in SEQ ID NO: 12 or 14.

[0074] In certain embodiments, the agent is an expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof. In certain embodiments, the nucleic acid molecule is operably linked to an expression regulatory element (e.g., a promoter).

[0075] In certain embodiments, the agent is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a retroviral vector.

[0076] In certain embodiments, the agent is a viral vector (e.g., AAV, HIV) comprising a nucleic acid molecule encoding a human NCBP2 protein (e.g., as set forth in SEQ ID NO: 17).

[0077] In certain embodiments, the agent is an expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof. In certain embodiments, the nucleic acid molecule is operably linked to an expression regulatory element (e.g., a promoter).

[0078] In certain embodiments, the agent is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0079] In certain embodiments, the agent is a viral vector (e.g., AAV, HIV) comprising a Ncbp2 coding sequence as set forth in SEQ ID NO: 1.

[0080] In certain embodiments, the agent comprises a sequence as set forth in SEQ ID NO: 15 or 18.

[0081] In certain embodiments, the agent is an expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof. In certain embodiments, the nucleic acid molecule is operably linked to an expression regulatory element (e.g., a promoter). In certain embodiments, the agent further comprises a regulatory vector that regulates expression of the expression vector comprising a nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof.

[0082] In certain embodiments, the regulatory vector comprises a nucleic acid molecule encoding a regulatory element, and the expression vector comprises a response element. In certain embodiments, the regulatory element encoded by the regulatory vector is rtTA, and the response element comprised by the expression vector is TRE. In certain embodiments, in the expression vector, the nucleic acid molecule encoding an expression product of the Ncbp2 gene or an active fragment thereof is located 3' downstream of the response element.

[0083] In certain embodiments, the expression vector or regulatory vector is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0084] In certain embodiments, the expression vector is a viral vector (e.g., AAV) comprising a Ncbp2 coding sequence as set forth in SEQ ID NO: 1.

[0085] In certain embodiments, the regulatory vector comprises a sequence as set forth in SEQ ID NO: 19.

[0086] In certain embodiments, the expression vector comprises a sequence as set forth in SEQ ID NO: 20. In certain embodiments, the subject is a mammal, e.g., a human.

[0087] In certain embodiments, the disease or condition associated with damage to cardiomyocytes is selected from cardiovascular diseases.

[0088] In certain embodiments, the cardiovascular disease causes one or more conditions selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring.

[0089] In certain embodiments, the cardiovascular disease is selected from heart attack, heart failure, arrhythmia, cardiomyopathy, coronary heart disease, hypertensive heart disease, congenital heart disease, hypertension, myocarditis, pericarditis, atherosclerotic disease, rheumatic heart disease, pericardial tumors, cor pulmonale, valvular heart disease, senile valvular heart disease, myocardial amyloidosis, pericardial effusion.

[0090] In certain embodiments, the disease or condition associated with damage to cardiomyocytes is selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring, cardiomyopathy, coronary heart disease, hypertensive heart disease.

[0091] In certain embodiments, the method is used to prevent and / or treat heart failure, which can be caused by any disease or condition, e.g., any cardiovascular disease, e.g., heart attack, arrhythmia, cardiomyopathy, coronary heart disease, hypertensive heart disease, congenital heart disease, hypertension, myocarditis, pericarditis, atherosclerotic disease, rheumatic heart disease, pericardial tumors, cor pulmonale, valvular heart disease, senile valvular heart disease, myocardial amyloidosis, pericardial effusion, etc.

[0092] In certain embodiments, the method is capable of improving cardiac contractile function and / or reducing fibrosis.

[0093] In certain embodiments, the agent can be formulated into any dosage form known in the medical arts, e.g., tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injectable solutions, sterile powders for injection, and concentrated solutions for injection), inhalants, sprays, and the like. The preferred dosage form will depend on the intended mode of administration and therapeutic use. The agent should be sterile and stable under the conditions of manufacture and storage. A preferred dosage form is an injection. Such injections can be sterile injection solutions. For example, sterile injection solutions can be prepared by incorporating the agent in the required amount in an appropriate solvent with one or more of the other ingredients enumerated above, as desired. The preparation can also be enclosed in an ampule in unit dosage form. A preferred method of preparation is to incorporate the agent in the required amount in an appropriate solvent with one or more of the other ingredients enumerated above, as desired, followed by sterilization by filtration. Alternatively, sterile solid compositions can be prepared by vacuum or freeze drying techniques. In addition, sterile solutions can be prepared by incorporating the agent in the required amount in an appropriate solvent with one or more of the other ingredients enumerated above, as desired, followed by filtered sterilization. Furthermore, sterile solutions can be prepared as sterile powders (e.g., by vacuum drying or freeze-drying) for reconstitution with a suitable solvent medium prior to use. Such powders can be reconstituted with, for example, water for injection (WFI), bacteriostatic water for injection (BWFI), sodium chloride solution (e.g., 0.9% (w / v) NaCl), dextrose solution (e.g., 5% dextrose), surfactant-containing solutions (e.g., 0.01% polysorbate 20), pH-buffered solutions (e.g., phosphate-buffered saline), Ringer's solution, and any combination thereof.

[0094] The agent can be administered by any suitable method known in the art, including, but not limited to, oral, buccal, sublingual, ocular, topical, parenteral, rectal, intraleaflet, intracisternal, inguinal, intravesical, local (e.g., powder, salve, or drops), or nasal routes. However, for many therapeutic uses, the preferred route of administration / mode of administration is parenteral administration (e.g., intravenous injection or bolus, subcutaneous injection, intraperitoneal injection, intramuscular injection). The skilled artisan will appreciate that the route of administration / mode of administration will vary depending on the intended purpose. In certain embodiments, the agent is administered by intravenous injection or bolus.

[0095] Methods of screening for drugs

[0096] In another aspect, the present application also provides a method of screening for a drug for preventing and / or treating a disease or disorder associated with myocardial cell damage in a subject, comprising the step of screening for an agent capable of modulating the expression of the Ncbp2 gene or modulating the activity of the expression product of the Ncbp2 gene.

[0097] In certain embodiments, the agent is an activator capable of activating or upregulating the expression of the Ncbp2 gene and / or activating or enhancing the activity of the expression product of the Ncbp2 gene.

[0098] In certain embodiments, the subject is a mammal, e.g., a human.

[0099] In certain embodiments, the disease or disorder associated with myocardial cell damage is selected from cardiovascular diseases.

[0100] In certain embodiments, the cardiovascular disease causes one or more of the conditions selected from the group consisting of myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring.

[0101] In certain embodiments, the cardiovascular disease is selected from the group consisting of heart attack, heart failure, arrhythmia, cardiomyopathy, coronary heart disease, hypertensive heart disease, congenital heart disease, hypertension, myocarditis, pericarditis, atherosclerosis, rheumatic heart disease, pericardial tumors, cor pulmonale, valvular heart disease, senile valvular heart disease, myocardial amyloidosis, pericardial effusion.

[0102] In certain embodiments, the disease or disorder associated with myocardial cell damage is selected from the group consisting of myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring, cardiomyopathy, coronary heart disease, hypertensive heart disease.

[0103] In certain embodiments, the medicament is used for preventing and / or treating heart failure, which can be caused by any disease or disorder, e.g., any cardiovascular disease, e.g., heart attack, arrhythmia, cardiomyopathy, coronary heart disease, hypertensive heart disease, congenital heart disease, hypertension, myocarditis, pericarditis, atherosclerosis, rheumatic heart disease, pericardial tumors, cor pulmonale, valvular heart disease, senile valvular heart disease, myocardial amyloidosis, pericardial effusion, etc.

[0104] In certain embodiments, the medicament is capable of improving cardiac contractile function and / or reducing fibrosis.

[0105] In certain embodiments, the method comprises: (1) contacting a test agent with a cell capable of expressing a Ncbp2 gene; (2) determining the expression level of the Ncbp2 gene or the activity of NCBP2 protein; (3) comparing the determination result of step (2) with that in the absence of the test agent; (4) selecting a test agent having the ability to activate or upregulate the expression of the gene or the activity of the protein as a candidate drug.

[0106] Definitions of terms

[0107] In the present application, the scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art, unless otherwise indicated. Also, the cell culture, molecular biology, biochemistry, nucleic acid chemistry, immunology, and other biological procedures described herein are in accordance with conventional techniques of the respective fields. In addition, the following terms are defined and explained as follows in order to better understand the present application.

[0108] When the terms "for example," "for instance," "such as," "including," "containing," or "comprising" are used in the detailed description and / or the appended claims, these terms are not to be interpreted in an excluding sense, but are to be interpreted in a non-limiting sense.

[0109] The terms "a" and "an" and "the" and similar referents in the context of describing the application (especially in the context of the following claims) are to be interpreted in an inclusive rather than an exclusive sense unless otherwise noted or clearly contradicted by context.

[0110] As used herein, the term "NCBP2 (nuclear cap-binding protein subunit 2)" refers to one subunit of a heterodimeric cap-binding complex that can directly bind to the RNA cap, facilitating RNA processing, and is a RNA-binding protein (RBP). The sequence of Ncbp2 is well known to those skilled in the art (see, e.g., NCBI GENBANK database accession number: NM_026554.4).

[0111] As used herein, the term "gene" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term includes double- and single-stranded DNA and RNA. It also includes known types of modifications, for example, methylation, "capping," substitution of one or more of the naturally occurring nucleotides with an analog. Preferably, a gene contains coding sequences encoding a polypeptide. A "coding sequence" is a nucleotide sequence, transcribed and translated into a polypeptide in vivo, when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A coding sequence can include, but is not limited to, mRNA, cDNA, recombinant nucleic acid sequences or genomic DNA, and in some instances introns.

[0112] As used herein, the term "gene expression" refers to the process by which information contained in a gene is converted into a gene product. The gene product can be the direct transcriptional product (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA, shRNA, RNAi, miRNA, or any other type of RNA) or a protein produced by translation from mRNA of a gene. Gene product also includes modified RNA and modified protein, RNA modification processes such as capping, polyadenylation, methylation, and editing, and protein modification processes such as methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristilation, and glycosylation. "Modulation" of gene expression refers to a change in the activity of a gene, and modulation of expression can include, but is not limited to, gene activation and gene repression.

[0113] As used herein, the term "nucleic acid" can be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to, modified or unmodified DNA, RNA, which is not limited in length. For nucleic acids used in the construction of recombinant constructs, it is preferred that the nucleic acid is DNA, as DNA is more stable and easier to manipulate than RNA.

[0114] As used herein, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When the vector is capable of directing the expression of a polynucleotide inserted into it, the vector is referred to as an expression vector. A vector can be introduced into a host cell by transformation, transduction or transfection, and directs the expression of elements of the genetic material it carries in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1 -derived artificial chromosomes (PAC); bacteriophages, such as lambda phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papova viruses (such as SV40). A vector can contain a variety of elements that control expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, a vector can contain a replication origin.

[0115] As used herein, the term "viral vector" is used broadly to refer to a nucleic acid molecule (e.g., transfer plasmid) that includes a virus-derived nucleic acid element that typically facilitates transfer or integration of a nucleic acid molecule into the genome of a cell, or a viral particle that mediates nucleic acid transfer. In addition to the nucleic acid, a viral particle will typically include various viral components and sometimes host cell components. The term "viral vector" can refer to a virus or viral particle that is capable of transferring a nucleic acid into a cell, or to the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are derived primarily from a virus.

[0116] As used herein, the term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof derived primarily from a retrovirus.

[0117] As used herein, the term "lentiviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof (including LTRs) derived primarily from a lentivirus. In certain embodiments, the terms "lentiviral vector," "lentiviral expression vector" can be used to refer to a lentiviral transfer plasmid and / or an infectious lentiviral particle. Where elements (e.g., cloning sites, promoters, regulatory elements, heterologous nucleic acids, etc.) are mentioned herein, it is understood that the sequences of these elements exist in the lentiviral particles of the application in RNA form and in the DNA plasmids of the application in DNA form.

[0118] As used herein, the term "adeno-associated viral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements or portions thereof derived primarily from an adeno-associated virus (AAV). AAV is a single-stranded, nonenveloped DNA virus that does not cause disease and elicits only a very mild immune response. An AAV vector can be replicated and packaged into an infectious viral particle that includes at least one AAV capsid protein and an encapsidated polynucleotide AAV vector, and can also include a heterologous nucleic acid, which is commonly referred to as an "AAV viral particle" or "AAV vector particle."

[0119] As used herein, the term "antibody" in its broadest sense refers to molecules that specifically bind to an antigenic determinant, and can include various antibody structures as long as they exhibit the desired antigen-binding activity. Typically, an antibody can be an immunoglobulin molecule comprised of two pairs of polypeptide chains (each pair having one light (LC) and one heavy (HC) chain). Antibody light chains can be assigned to a kind of kappa (kappa) and lambda (lambda) light chain. Heavy chains can be assigned to a kind of mu, delta, gamma, alpha, or epsilon, and define a class of the antibody as IgM, IgD, IgG, IgA, and IgE, respectively. Within the light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, and the heavy chain further comprises a "D" region of about 3 or more amino acids. Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region is comprised of one domain, CL. The constant domains are not directly involved in binding of an antibody to an antigen, but exhibit various effector functions, such as mediating the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of each heavy / light chain pair (VH and VL) form the antigen binding site. Assignment of amino acids to each region or domain can follow the definition of Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia & Lesk (1987) J. Mol. Biol. 196:901-917; Chothia et al. (1989) Nature 342:878-883.

[0120] As used herein, the term "operably linked" refers to a functional linkage between a promoter or other regulatory element and a transcribed DNA sequence or coding sequence of a gene (or transgene) such that the promoter, etc. exerts its action or function to initiate, assist, influence, cause, and / or promote transcription and expression of the associated transcribed DNA sequence or coding sequence, at least in some cell, tissue, developmental stage, and / or condition. Two transcribed DNA sequences can also be "operably linked" to each other if their transcription is controlled by a common promoter or other regulatory element.

[0121] As used herein, the term "promoter" refers to a nucleic acid sequence that exerts its function to direct transcription of a downstream coding sequence.

[0122] The writing of the twenty conventional amino acids referred to herein follows conventional usage. See, e.g., Immunology - A Synthesis (2nd Edition, E. S. Golub and D. R. Gren, Eds., Sinauer Associates, Sunderland, Mass. (1991)), which is incorporated herein by reference. In the present application, the terms "polypeptide" and "protein" have the same meaning and are used interchangeably. Also in the present application, amino acids are generally represented by the single and three letter abbreviations well known in the art. For example, alanine can be represented by A or Ala.

[0123] As used herein, the term "prevention" refers to a method undertaken to prevent or delay the onset of a disease or disorder or symptoms (e.g., a disease associated with cardiomyocyte injury) in a subject. As used herein, the term "treatment" refers to a method undertaken to obtain a beneficial or desired clinical result. For the purposes of this application, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilization (i.e., not worsening) of the state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Moreover, "treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.

[0124] As used herein, the term "subject" refers to a mammal, such as a primate, e.g., a human. In certain embodiments, the subject (e.g., human) has a disease associated with cardiomyocyte injury.

[0125] As used herein, the term "effective amount" means an amount that is sufficient to achieve or at least partially achieve a desired effect. For example, an effective amount for preventing a disease (e.g., a disease associated with myocardial cell damage) means an amount that is sufficient to prevent, arrest, or delay the onset of the disease; an effective amount for treating a disease means an amount that is sufficient to cure or at least partially arrest the disease and its complications in a patient already having the disease. Determining such effective amounts is well within the capabilities of those skilled in the art. For example, an amount effective for therapeutic purposes will depend on the severity of the disease to be treated, the general state of the patient's own immune system, the general condition of the patient such as age, weight, and gender, the mode of administration of the drug, and other therapies that the patient may be receiving, and the like.

[0126] Advantages of the Invention

[0127] The inventors of the present application first discovered that NCBP2 plays an important role in AS regulation and heart maturation, and that activating NCBP2 expression can promote myocardial cell proliferation, repair myocardial damage, and has a repairing effect on cardiovascular diseases such as myocardial infarction, and has important clinical value for the treatment of cardiovascular diseases. BRIEF DESCRIPTION OF DRAWINGS

[0128] FIG. 1: Ncbp2-modRNA structure schematic diagram.

[0129] FIGS. 2A-2F: Plasmid maps. Among them, FIG. 2A is pCDH-CMV-EF1a-Puro; FIG. 2B is pCDH-CMV-NCBP2-EF1a-Puro; FIG. 2C is pAAV--IRES-ZsGreen1; FIG. 2D is pAAV-mNCBP2-IRES-ZsGreen1; FIG. 2E is pAAV-UbC-rtTA; FIG. 2F is pAAV-TRE-PminCMV-3xFlag-Ncbp2-ZsGreen1.

[0130] FIG. 3A-3B: Immunofluorescence staining to detect NCBP2 expression after Ncbp2-modRNA transfection of NMCM, wherein FIG. 3A is immunofluorescence staining of NCBP2, a-Actinin, DAPI, Merge of myocardial cells in different groups of myocardial cells transfected with Ncbp2-modRNA for different times (24h and 120h), observed under 40x objective, scale = 50pm, FIG. 3B is the determination of Ncbp2-modRNA gene transfection efficiency by immunofluorescence staining, the "Relative NCBP2 fluorescence intensity (IntDen / Area)" index is used to evaluate the relative intensity of the fluorescence signal of Ncbp2 in cells or tissues, the "Relative NCBP2 fluorescence intensity (IntDen / Cell number)" index is used to evaluate the relative intensity of the fluorescence signal of Ncbp2 in cells, the experimental results of each group are shown on the left side as PBS and on the right side as Ncbp2-mRNA.

[0131] FIG. 4A-4B: Changes in Ncbp2 mRNA and NCBP2 protein expression over time after Ncbp2-modRNA transfection of NMCM, wherein FIG. 4A is real-time fluorescent quantitative PCR to detect changes in Ncbp2 mRNA expression over time after Ncbp2-modRNA transfection of NMCM, the experimental results of each group are shown on the left side as PBS and on the right side as Ncbp2-mRNA. FIG. 4B is Western blotting to detect NCBP2 protein expression, wherein the Western blotting bands from left to right are as follows: NMCM transfected with GFP-modRNA for 24h, 48h, 96h and Ncbp2-modRNA for 24h, 48h, 96h, and GAPDH as an internal reference gene.

[0132] FIG. 5: Western blotting to detect the expression level of NCBP2 protein in different tissue organs of myocardial infarction mice 24 hours after transfection with Ncbp2-modRNA, and the gray value of the bands was quantitatively analyzed using Image J software. The left side is the original WB banding chart, and the right side is the corresponding quantitative statistical chart. FIG. 5A to 5D correspond to the marginal area of myocardial infarction, the distal myocardial area, the spleen and the kidney, respectively. n = 2 for the GFP-modRNA transfection group and n = 4 for the Ncbp2-modRNA transfection group.

[0133] Figure 6: NCBP2 expression analysis after recombinant protein 1 transfection of neonatal rat cardiomyocytes. Western blotting was used to detect the NCBP2 protein expression level after 24 hours and 48 hours of transfection of recombinant protein 1 in neonatal rat cardiomyocytes, and the band gray value was quantitatively analyzed using Image J software. Figure 6A is the WB original banding chart after 24 hours of transfection, and β-TUBULIN is used as an internal reference; Figure 6B is the gray value normalization statistical chart corresponding to Figure 6A; Figure 6C is the WB original banding chart after 48 hours of transfection, and β-TUBULIN is also used as an internal reference; Figure 6D is the gray value normalization statistical chart corresponding to Figure 6C.

[0134] Figure 7: NCBP2 expression analysis after recombinant protein 2 transfection of neonatal rat cardiomyocytes. Western blotting was used to detect the NCBP2 protein expression level after 24 hours and 48 hours of transfection of recombinant protein 2 in neonatal rat cardiomyocytes, and the band gray value was quantitatively analyzed using Image J software. Figure 7A is the WB original banding chart after 24 hours of transfection, and GAPDH is used as an internal reference; Figure 7C is the gray value normalization statistical chart corresponding to Figure 7A; Figure 7B is the WB original banding chart after 48 hours of transfection, and β-TUBULIN is also used as an internal reference; Figure 7D is the gray value normalization statistical chart corresponding to Figure 7B.

[0135] Figure 8: Western blotting was used to detect the expression level of NCBP2 protein in the left ventricular anterior wall tissue of adult mice infected with Tet-On AAV system and continuously induced by doxycycline (DOX) for 7 days. The left side is the DOX induction group, and the right side is the control group without DOX.

[0136] Figure 9: AAV-Ncbp2-OE promotes the regeneration repair of mouse heart after myocardial infarction. Figure 9A is a schematic diagram of AAV-Ncbp2-OE treatment of adult C57BL / 6J mice myocardial infarction, Figure 9B is echocardiography detection of the heart of adult C57BL / 6J mice treated with myocardial infarction (AAV-GFP-OE group: n = 10; AAV-Ncbp2-OE group: n = 12; ns P>0.05, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, data expressed as Mean ± SEM, statistical analysis using Two-way ANOVA analysis), Figure 9C is a schematic diagram of neonatal P5.5 C57BL / 6J mice myocardial infarction treatment, Figure 9D is echocardiography detection of the heart of neonatal P5.5 C57BL / 6J mice treated with myocardial infarction (AAV-GFP-OE group: n = 20; AAV-Ncbp2-OE group: n = 22; data expressed as Mean ± SEM, statistical analysis using Two-way ANOVA analysis, ns P>0.05, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0137] Figures 10A-10C: Evaluation of the therapeutic effect of Ncbp2 overexpression lentivirus in a mouse myocardial infarction model. Figure 10A is a schematic diagram of the experimental procedure: GFP overexpression lentivirus (control group) or Ncbp2 overexpression lentivirus was injected directly into the anterior wall of the myocardium of P1 mice, and cardiac function was evaluated by echocardiography at 2 days, 14 days and 28 days after surgery, and tissue samples from the infarct area and its surrounding area were collected for RT-PCR and immunofluorescence analysis. Figure 10B shows that in mice with myocardial infarction, 2 weeks after injection of GFP lentivirus, immunostaining of heart tissue showed GFP expression. Figure 10C is the result of real-time fluorescence quantitative PCR, showing the expression level of Ncbp2 in the infarct and surrounding tissues 2 weeks after injection. Both the GFP group and the Ncbp2 group were n = 3, data expressed as Mean ± SEM, statistical analysis using Two-way ANOVA analysis, ns P>0.05, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0138] Figure 11: Changes in left ventricular ejection fraction (LVEF) at different time points after lentivirus injection measured by echocardiography. n = 25 in GFP, n = 22 in Ncbp2 at 2 days; n = 18 in GFP, n = 22 in Ncbp2 at 14 days; n = 9 in GFP, n = 12 in Ncbp2 at 28 days. Data are presented as Mean ± SEM, statistical analysis by Two-way ANOVA, ns P>0.05, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0139] Figure 12: Masson's trichrome staining to evaluate the effect of GFP (control) or Ncbp2 lentivirus injection on the degree of cardiac fibrosis in the myocardial infarction model at 28 days. Scale bar = 1000 μm in the figure; the right side is the quantitative statistics of fibrosis area, n = 9 in GFP group, n = 10 in Ncbp2 group (2-3 regions per section from 4 mice), data are presented as Mean ± SEM, statistical analysis by Student's t test, p<0.05.

[0140] Figure 13: Real-time fluorescent quantitative PCR results of the expression of fibrosis genes, inflammation genes, cardiac and heart failure genes in mouse hearts overexpressing GFP and Ncbp2. n = 3 for GFP, n = 4 for Ncbp2, Mean ± SEM, *p<0.05, ***p<0.001, ****p<0.0001 (two-way ANOVA).

[0141] Figure 14: Changes in left ventricular ejection fraction (LVEF) at different time points in the myocardial infarction model in mice overexpressing NCBP2 systemically and in cardiomyocyte-specifically were evaluated by echocardiography. The number of mice in each group is as follows: Ncbp2fl / +; αMHC-MCM group n = 7, αMHC-MCM group n = 8, Ncbp2fl / +; UBC-Cre-ERT2 group n = 11, UBC-Cre-ERT2 group n = 5. Data are presented as Mean ± SEM, statistical analysis by Two-way ANOVA, ns P>0.05, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0142] Sequence information

[0143] The information of the sequences involved in the present application is described in the following table:

[0144] Table 1: Sequence description DETAILED DESCRIPTION

[0145] The present application will now be described in the following non-limiting examples.

[0146] Those skilled in the art will appreciate that the examples describe the application in terms of preferred embodiments, and that the application is not intended to be limited to the preferred embodiments. The experimental methods in the examples are routine methods unless otherwise specified. When specific conditions are not specified in the examples, the routine conditions or the conditions recommended by the manufacturer are used. When the manufacturers of the reagents or instruments are not specified, they are all routine products that can be obtained commercially.

[0147] Example 1: Construction of NCBP2 overexpression vector

[0148] 1.1 Construction of Ncbp2-modRNA

[0149] The coding nucleotide sequence SEQ ID NO: 1 of NCBP2 (NCBI Reference Sequence: NM_026554.4) was obtained by NCBI search, and the following sequences were added at the 5' end:

[0150] 5' UTR sequence (AGGAGAACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCTCTAGAGCCACC, SEQ ID NO: 3);

[0151] The following sequences were added at the 3' end in order:

[0152] T2A sequence (GGCAGCGGCGAGGGCAGGGGCAGCCTGCTGACCTGCGGCGACGTGGAGGAGAACCCCGGCCCC, SEQ ID NO: 3);

[0153] eGFP coding sequence (ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG, SEQ ID NO: 5);

[0154] 3’ UTR sequence (GGATCCGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAGCTAGC, SEQ ID NO: 8);

[0155] Poly(A) sequence (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID NO: 9).

[0156] The above sequence was synthesized, modified by N1-Me-Pseudo UTP, capped at the 5' end, and formed Cap1 structure to obtain the modified Ncbp2-modRNA sequence (SEQ ID NO: 10) finally, and the structure is shown in FIG. 1.

[0157] 1.2 Construction of NCBP2 recombinant protein

[0158] Two NCBP2 recombinant proteins were constructed according to the following two schemes:

[0159] (1) A CPP sequence, an NLS sequence, and a linker were sequentially added to the 5' end of the NCBP2 coding sequence (SEQ ID NO: 17), and a 6*His sequence was added to the 3' end of the NCBP2 sequence to construct NCBP2 recombinant protein 1, and the amino acid sequence is shown in SEQ ID NO: 12;

[0160] (2) A 6*His sequence was added to the 3' end of the NCBP2 coding sequence (SEQ ID NO: 17) to construct NCBP2 recombinant protein 2, and the amino acid sequence is shown in SEQ ID NO: 14.

[0161] 1.3 Construction of NCBP2 overexpression plasmid

[0162] The lentivirus overexpression vector pCDH-CMV-MCS-EF1a-Puro plasmid (System Biosciences, CD510B-1) was selected, as shown in FIG. 2A, and the coding sequence of NCBP2 (SEQ ID NO: 1) was linked to the plasmid to construct the NCBP2 lentivirus overexpression plasmid (the sequence is shown in SEQ ID NO: 18), and the plasmid map is shown in FIG. 2B.

[0163] The AAV overexpression vector pAAV-IRES-Zsgreen1 plasmid (Miaoling Biological, P0726) was selected, as shown in FIG. 2C, and the coding sequence of NCBP2 (SEQ ID NO: 1) was linked to the plasmid to construct the NCBP2 overexpression plasmid (the sequence is shown in SEQ ID NO: 15), and the plasmid map is shown in FIG. 2D.

[0164] For the construction of Tet-On AAV overexpression plasmid, AAV dual plasmid expression system based on Tet-On system was constructed, rtTA expression vector and TRE response vector were packaged respectively, and Dox-induced expression of target gene was achieved by mixing virus infection. Vector modification: pAAV-IRES-ZsGreenl was double digested by MluI+BglII, the CMV promoter and IRES-ZsGreenl fragment were removed, and the vector backbone was reserved;

[0165] pAAV-IRES-ZsGreenl was double digested by MluI+EcoRI, and TRE vector construction was prepared. Key element amplification: UbC-rtTA-WPRE: PCR amplification from Fuw-M2rtTA (Addgene#20342), homologous arms were introduced at both ends; TRE-miniCMV: PCR amplification from TetO-FUW-OSKM (Addgene#20321), homologous arms were introduced at both ends; PCR obtained 3xFlag-NCBP2 fragment. Ligation and cloning construction: insert UbC-rtTA-WPRE into MluI / BglII linearized pAAV backbone to obtain rtTA expression vector pAAV-UbC-rtTA (sequence as SEQ ID NO: 19), and its plasmid map is shown in Figure 2E. Insert TRE-miniCMV into MluI / EcoRI linearized pAAV backbone, and connect target gene 3xFlag-NCBP2 to obtain TRE response vector pAAV-TRE-PminCMV-3xFlag-NCBP2-Zsgreenl (sequence as SEQ ID NO: 20), and its plasmid map is shown in Figure 2F.

[0166] Example 2: Culture, passage, freezing and virus packaging of 293T cells

[0167] 2.1 Thawing of 293T cells

[0168] (1) Prepare complete culture medium according to the formula shown in Table 2, and preheat the complete culture medium and PBS (Zhijia Gold Bridge, ZLI-9062) at 37°C water bath;

[0169] Table 2: Configuration formula of complete culture medium (50 mL)

[0170] (2) Take 293T cells (Chinese Academy of Sciences, GNHu44) from liquid nitrogen quickly, and quickly put into a 37°C water bath to quickly shake, so that it can be quickly melted in a short time, then transfer into a 15 mL sterile centrifuge tube, add preheated complete medium, then centrifuge at 1000 rpm for 3 min to remove the injury. The cell pellet is resuspended with 2 mL of complete medium, and the resuspension is transferred into a 10 cm petri dish containing 8 mL of complete medium for culture. Then put the petri dish into a cell incubator under the condition of 5% CO2, 95% humidity, 37°C, shake crossly, continue to culture, and complete cell recovery.

[0171] 2.2 Recovery of 293T cells

[0172] (1) Take 293T cells (Chinese Academy of Sciences, GNHu44) from liquid nitrogen quickly, and quickly put into a 37°C water bath to quickly shake, so that it can be quickly melted in a short time, then transfer into a 15 mL sterile centrifuge tube, add preheated complete medium, then centrifuge at 1000 rpm for 3 min to remove the injury. The cell pellet is resuspended with 2 mL of complete medium, and the resuspension is transferred into a 10 cm petri dish containing 8 mL of complete medium for culture. Then put the petri dish into a cell incubator under the condition of 5% CO2, 95% humidity, 37°C, shake crossly, continue to culture, and complete cell recovery.

[0173] (2) Add 1 mL of preheated PBS, 45° gently tilt the petri dish back and forth, so that the PBS covers all the cells, wash away the dead cells and impurities, and use the suction filter pump to remove the PBS;

[0174] (3) Add 1 mL of 0.25% trypsin (Gibco, 25200056), 45° gently tilt the petri dish back and forth, so that the trypsin covers all the cells, and the cells are digested. When the cells fall off, immediately use the suction filter pump to remove the trypsin;

[0175] (4) Add 2 mL of preheated complete medium for neutralization, 45° gently tilt the petri dish back and forth, so that the medium covers all the cells, and gently blow the 293T cells with a pipette gun to form a single cell suspension;

[0176] (5) Place the 293T cell suspension in a 15 mL centrifuge tube for centrifugal treatment, 1000 rpm, 3 min, room temperature, discard the supernatant;

[0177] (6) Add 2 mL of preheated complete medium to resuspend the cell pellet, take one-third of the cells to replate a new cell culture dish, add 7 mL of complete medium to shake thoroughly, and culture in a cell incubator under the condition of 5% CO2, 95% humidity, 37°C.

[0178] 2.3 Cryopreservation of 293T cells

[0179] (1) Preheat the complete medium and PBS in a 37°C water bath;

[0180] (2) Take 293T cells (Chinese Academy of Sciences, GNHu44) from liquid nitrogen quickly, and quickly put into a 37°C water bath to quickly shake, so that it can be quickly melted in a short time, then transfer into a 15 mL sterile centrifuge tube, add preheated complete medium, then centrifuge at 1000 rpm for 3 min to remove the injury. The cell pellet is resuspended with 2 mL of complete medium, and the resuspension is transferred into a 10 cm petri dish containing 8 mL of complete medium for culture. Then put the petri dish into a cell incubator under the condition of 5% CO2, 95% humidity, 37°C, shake crossly, continue to culture, and complete cell recovery.

[0181] (3) Add 1 mL of preheated PBS, gently tilt the dish back and forth at 45°, so that the PBS covers all the cells, wash away dead cells and impurities, and use a suction pump to remove the PBS;

[0182] (4) Add 1 mL of 0.25% trypsin, gently tilt the dish back and forth at 45°, so that the trypsin covers all the cells, and digest the cells. As soon as cell shedding occurs, use a suction pump to remove the trypsin;

[0183] (5) Add 2 mL of preheated complete medium for neutralization, gently tilt the dish back and forth at 45°, so that the medium covers all the cells, and gently blow the 293T cells with a pipette gun to form a single-cell suspension;

[0184] (6) Place the 293T cell suspension in a 15 mL centrifuge tube and centrifuge at 1000 rpm for 3 min at room temperature, and discard the supernatant;

[0185] (7) Add 2 mL of cryopreservation solution to resuspend the cell pellet, take 1 mL of cell suspension and distribute it into cryopreservation tubes, and store the cryopreservation tubes in a cryopreservation box at -80°C for slow cooling;

[0186] (8) The next day, transfer the cryopreservation tubes to a -196°C liquid nitrogen tank for long-term storage.

[0187] 2.4 AAV packaging

[0188] (1) Use 293T cell culture medium to seed 15 cm cell culture dishes with 293T cells, and incubate in a cell incubator at 5% CO2, 95% humidity, and 37°C.

[0189] (2) One day in advance, perform a 2:3 passage;

[0190] (3) Two hours before transfection, replace the medium with 18 mL of low serum and double-antibody-free medium (prepared according to the formula shown in Table 3) per dish, and incubate in a cell incubator at 5% CO2, 95% humidity, and 37°C. When the cell density reaches 80%-90%, proceed with AAV packaging (when observing the cell density, pay attention to the difference in density between the center and the edge to make the judgment);

[0191] Table 3: Configuration formula of low serum and double-antibody-free medium (50 mL)

[0192] (4) Prepare AAV packaging system (ready-to-use): pAAV-GOI, pAAV-2 / 9n (Miaoling Bio, P12267), pAdDeltaF6 (Miaoling Bio, P10945) in a molar ratio of 1:1:1. According to the molar ratio, 80 μg of total plasmid was added to 3 mL of Opti-MEM (Gibco, 31985070) and mixed gently by tilting the test tube at 45° back and forth. Let stand for 5 min;

[0193] (5) Prepare transfection reagent according to PEI 3 times the amount of DNA. 240 μL PEI (Polysciences, 24765-1) was added to 3 mL Opti-MEM, and the test tube was tilted at 45° back and forth. Mix gently and let stand for 5 min;

[0194] (6) Slowly add the plasmid mixture to the PEI liposome mixture, mix well after inversion, and let stand for 15 min (Note: Do not blow or shake, PEI is a liposome, and vigorous shaking can easily cause structural damage. Mix gently by tilting the test tube at 45° back and forth). Get the plasmid PEI mixture;

[0195] (7) Use a suction filter pump to remove the excess secondary antibody-free culture medium in the 293T cell culture dish, leaving about 14 mL / dish. Add about 6 mL of plasmid PEI mixture along the side wall of the cell culture dish, and mix gently by tilting the culture dish. The total volume is about 20 mL / dish. Incubate in a cell incubator at 5% CO2, 95% humidity, and 37°C. After 24 h of plasmid transfection, discard the culture medium and replace it with 20 mL of secondary antibody-free culture medium. Incubate in a cell incubator at 5% CO2, 95% humidity, and 37°C;

[0196] (8) Continue to culture for 48-72 h after medium replacement, observe the cytopathic effect, and collect 293T cells with a pipette gun. Collect the culture medium and cell precipitate in a 50 mL centrifuge tube. Centrifuge at 2000 rpm, 10 min, 4°C, and discard the supernatant. Freeze the cell precipitate at -80°C for AAV lysis and extraction.

[0197] 2.5 AAV extraction

[0198] (1) Take out the frozen AAV packaged 293T cell precipitate from the -80°C freezer and resuspend with 9 mL of PBS (high pressure);

[0199] (2) Add 1 mL of Lysis Buffer (0.5% Sodium deoxycholate + 0.1% SDS + 1% Triton TMX-100) and 0.001% of PF68 (MP Biomedicals, 092750016) at final concentration, mixed well and incubated at 37°C water bath for 15 min (Sodium deoxycholate (Sigma-Aldrich, D6750-25G); SDS (VWR, 0227-1KG); Triton X-100 (Sigma-Aldrich, T8787-100ML)); TM X-100 (Sigma-Aldrich, T8787-100ML));

[0200] (3) The cell suspension was repeatedly frozen and thawed to lyse using liquid nitrogen at -196°C and 37°C water bath, and the freezing and thawing was repeated four times;

[0201] (4) High-salt resistant all-competent nuclease (Yeasen, 20159ES25) was added at a final concentration of 50 U / mL, and MgCl2 was added to a final concentration of 2 mM, and incubated at 37°C water bath for 45 min to make the nucleic acid fragments disappear;

[0202] (5) 4 mL of 5M NaCl was added, and shaken for 30 s to prevent loss of AAV;

[0203] (6) The AAV solution was centrifuged at 4000 rpm for 10 min at 4°C. The supernatant was collected in a new centrifuge tube and centrifuged again at 4000 rpm for 10 min at 4°C. The supernatant was collected in a new centrifuge tube and stored in a 4°C refrigerator for preservation, and was subjected to density gradient centrifugation. The centrifugation was repeated several times until the supernatant was almost free of precipitate;

[0204] (7) Density gradient centrifugation in a biological safety cabinet (Thermo): 10 mL of syringe (1 mL syringe needle) was used to sequentially add iodixanol (Sigma, D1556-250ML) gradient solution (the formula is shown in Table 4) to a 39 mL ultracentrifuge tube. 5.4 mL of 60% solution (can be added slightly faster), 6.5 mL of 40% solution, 6.5 mL of 25% solution, 8 mL of 15% solution (when adding iodixanol of different concentrations, the centrifuge tube should be tilted and slowly pushed in to avoid layering, especially when adding 15% layer, since the density difference between 15% and 25% iodixanol is small, the 15% layer is easy to mix with the 25% layer). Finally, 12 mL of virus supernatant was added, and the remaining volume was filled with PBS (during injection, air bubbles should be prevented, for example, 7 mL of solution should be drawn when 6.5 mL of solution is injected, to prevent disturbance and air bubbles remaining in the centrifuge tube, and there should be no liquid in the neck of the ultracentrifuge tube);

[0205] Table 4: Configuration formula of iodixanol gradient solution (50 mL)

[0206] Wherein, 10x Gradient Buffer is configured according to the formula shown in Table 5.

[0207] Table 5: Configuration formula of 10x Gradient Buffer (100 mL)

[0208] (8) High-temperature sealing of the ultracentrifuge tube, centrifugation using an ultracentrifuge, 300000g, 2.5h, 10°C;

[0209] (9) The ultracentrifuge tube is taken out and fixed on an iron stand, and a 10mL syringe needle is used to insert the upper part of the centrifuge tube at an angle of 45 degrees to guide the gas;

[0210] (10) A 1mL syringe needle is used to configure a 10mL needle tube to vertically insert the side of the centrifuge tube at the junction of 40% gradient solution and 60% gradient solution, and the AAV salt solution in the 40% gradient solution is extracted and collected in the centrifuge tube, and stored in a 4°C refrigerator.

[0211] 2.6 Desalination and purification of AAV

[0212] (1) Add 5mL of PBS containing 1% PF68 to the ultrafiltration centrifuge tube for column equilibration, centrifuge after 3min, 3000g, 3min, discard the waste liquid;

[0213] (2) Add 5mL of PBS containing 0.1% PF68 to the ultrafiltration centrifuge tube for column equilibration, centrifuge after 3min, 3000g, 3min, discard the waste liquid;

[0214] (3) Add 5mL of PBS containing 0.01% PF68 to the ultrafiltration centrifuge tube for column equilibration, centrifuge after 3min, 3000g, 3min, discard the waste liquid;

[0215] (4) Add four times the volume of 0.001% PF68 PBS to the AAV salt solution containing iodixanol to reduce the viscosity of the solution, mix well and then add to the ultrafiltration centrifuge tube for centrifugal desalination, 3000g, 10min, 4°C, multiple centrifugation until 1mL of salt solution remains;

[0216] (5) Continue to add four times the volume of 0.001% PF68 PBS to the AAV salt solution containing iodixanol for centrifugal desalination, 3000g, 20min-30min, 4°C, until 250μL of AAV solution remains (observe the content of the concentrated solution every 5min);

[0217] (6) Add 250 μL (if virus is less, can be 100 μL) of 0.001% PF68 PBS (autoclaved) to rinse the filter membrane of the ultrafiltration centrifuge tube, and use a PCR tube to dispense the AAV solution, 50 μL / tube, and freeze at -80°C.

[0218] 2.7 Titration of AAV

[0219] (1) Removal of free DNA molecules in AAV samples

[0220] Take 1 μL of AAV in 9 μL of PBS buffer, and dilute the sample by 10 times. Further gradient dilute the sample by 10 times, 10 times, 10 times, and 10 times using PBS buffer, and prepare the reaction system according to the following Table 6. 2 3 4 5

[0221] Table 6: Reaction system

[0222] Use a PCR reaction instrument to incubate the prepared reaction system at 37°C for 30 min to degrade free DNA, and incubate at 95°C for 5 min to inactivate the DNA enzyme.

[0223] (2) Removal of capsid proteins of AAV

[0224] Add 1 μL of proteinase K (Solebo, P9460) (5 μg / μL) to each of the above reaction systems, and incubate at 37°C for 30 min to completely remove the capsid proteins of AAV.

[0225] Add 30 μL of ddH2O to each of the above reaction systems for dilution, and incubate at 95°C for 5 min to inactivate the proteinase K.

[0226] (3) Dilution of adenovirus titer determination standard

[0227] Gradient dilute the AAV titer determination standard into 10 7 vg / mL, 10 6 vg / mL, 10 5 vg / mL, 10 4 vg / mL, 10 3 vg / mL, 10 2 vg / mL, 10 vg / mL dilutions.

[0228] (4) Real-time PCR reaction

[0229] ​​​​The AAV nucleic acid sample in the above reaction system and the standard sample after gradient dilution were taken, and the reaction system shown in Table 7 was prepared for Real-time PCR detection.

[0230] Table 7: Real-time PCR reaction system

[0231] The reaction was performed using a fluorescent quantitative PCR instrument ABI Quant Studio 6 according to the procedure shown in Table 8.

[0232] Table 8: PCR reaction procedure

[0233] The NCBP2 overexpression AAV vector rAAV2 / 9-CMV-NCBP2 obtained by the above method had a titer of 8.63E+12 vg / mL; the eGFP overexpression AAV vector rAAV2 / 9-CMV-GFP had a titer of 6.83E+12 vg / mL.

[0234] 2.8 Lentivirus packaging

[0235] The day before plasmid transfection, the long 293T cells were digested and passaged, and 600-1000K cells were inoculated into the culture plate per hole (six-hole plate), or 8M-10M cells were inoculated into a 10cm culture dish, and the cross was gently shaken to ensure uniform cell growth. The culture was placed in a 37℃, 5% CO2 incubator for culture, and after 16h-24h, when the cell density grew to 60% to 70%, the culture medium was replaced with complete culture medium without double antibodies. If it was a six-hole plate, 1.5mL of culture medium was added per hole, and if it was a 10cm dish, 7mL of culture medium was added. After 6h, plasmid transfection was started. Taking a six-hole plate as an example, 250μL of opti-MEM was added to a clean 1.5mL EPPENDORF TMIn the tube, add 10 μL lippo2000, invert and mix (can be marked as tube A), stand for 5 min, in another clean 1.5 mL EP tube, add DM2G:PAX2 at a ratio of 1:2, total mass of 2 μg of packaging plasmid, total mass of 2 μg of target plasmid, finally add 250 μL opti-MEM, invert and mix (can be marked as tube B), stand for 5 min, slowly add the DNA mixture in tube B drop by drop to tube A, gently mix with a pipette, stand for 30 min, then add the mixture drop by drop evenly to the cell culture plate, gently mix, and continue to culture in a 37°C, 5% CO2 incubator. Because lippo2000 is toxic to cells, the culture medium is discarded after 8 h of culture, and 2 mL of fresh complete medium is used to replace the culture medium. The virus titer peaks at 24-48 h after transfection, so the virus supernatant is collected after 48 h, centrifuged at high speed for 5 min, the cell debris is discarded, and the virus is aliquoted according to the amount of virus used each time and stored at -80°C for later use.

[0236] 2.9 Lentivirus purification

[0237] The virus demand for animal experiments is relatively large, and generally needs to be purified before use in animal experiments. Specifically, the collected virus supernatant is filtered through a 0.45 μm filter, then placed in an ultracentrifuge tube, and centrifuged in an ultracentrifuge at 20000 rpm, 4°C, 2 h, to obtain the precipitate, which is the virus particles. The supernatant is as clean as possible, the virus particles are resuspended with sterile PBS, and aliquoted according to the experimental amount, and stored at -80°C for later use.

[0238] Example 3: Overexpression of Ncbp2 in neonatal mouse myocardial cells and mice in vivo

[0239] 3.1 Isolation and culture of neonatal mouse myocardial cells (NMCM)

[0240] Experimental animals: C57BL / 6J wild-type mice (1 day old, SPF level), purchased from Huafukang Biotechnology Co., Ltd.

[0241] The following experiments were all performed in a biological safety cabinet.

[0242] (1) According to the instructions of the primary neonatal rat myocardial cell separation kit (Thermo #, 88281), prepare the neonatal rat myocardial cell separation enzyme solution, and store it in the 4°C refrigerator for later use.

[0243] (2) Matrigel matrix plating: freeze-stored Matrigel matrix glue (Corning, 354277) is placed in a 4°C refrigerator overnight in advance, and the matrix is thawed. After the Matrigel matrix glue body is thawed, the Matrigel matrix is diluted to 5 mg / mL with pre-cooled DMEM / F-12. Immediately cover the culture dish with the diluted Matrigel matrix solution, and evenly spread the Matrigel solution on the surface of the 6-well plate. After incubation at room temperature for 1 h, store it in a 37°C incubator with 5% CO2, 95% humidity.

[0244] (3) Clean the surface of the suckling mouse with 75% alcohol, and wipe the alcohol on the front chest of the suckling mouse on paper. Hold the back skin of the suckling mouse with the left hand to expose the chest cavity. Cut the skin and left sternum in the middle of the chest between the two hands on the left side to expose the heart, and gently squeeze the heart with the left hand. Use tweezers to clamp the ventricular part.

[0245] (4) Use 1% heparin sodium solution and 1% P / S-containing Hanks balanced salt solution (Thermo, 88284) to rinse the blood in a 10 cm culture dish, repeat 2 times.

[0246] (5) 10 hearts / 1.5 mL EPPENDORF TM tube, cut 1 mm 3 size with scissors.

[0247] (6) Then add Hanks balanced salt solution to rinse the blood in the tissue block, 500 μL tube, gently blow it up, and then let it hang for about 1 min, and then let it naturally precipitate, discard the supernatant, repeat 3 times.

[0248] (7) Use a 25°C centrifuge at 300g for 2 min to remove the supernatant.

[0249] (8) Add 10 μL of prepared suckling mouse myocardial cell separation enzyme solution per suckling mouse heart, and use a 200 μL gun tip to stir evenly (do not blow it up), and digest in a 37°C water bath for 25 min (resuspend once every 10 min).

[0250] (9) Add 1 mL of complete culture medium to terminate the digestion reaction, blow the tissue block into single cells with 1 mL of pipette gun for 20-30 times, and collect it in a 15 mL centrifuge tube after filtering with a 100 μm filter.

[0251] (10) Use a 25°C centrifuge at 300g for 2 min to remove the supernatant.

[0252] (11) After resuspending the cells with complete medium, the total volume of the medium in the 10 cm cell culture dish was supplemented to 8 mL. After shaking evenly, the cells were placed in a cell incubator at 5% CO2, 95% humidity, and 37°C for 40 min of differential adhesion (to remove fibroblasts, which adhere faster than cardiomyocytes). The adhesion was repeated twice.

[0253] (12) The cell culture dish coated with Matrigel was taken out of the incubator, and the excess Matrigel solution was aspirated and reserved.

[0254] (13) The supernatant of the medium in the 10 cm culture dish after differential adhesion was collected in a 15 mL centrifuge tube and centrifuged.

[0255] (14) The supernatant was removed by centrifugation at 300 g for 5 min using a 25°C centrifuge.

[0256] (15) After resuspending the cells with the primary neonatal rat cardiomyocyte medium, the cardiomyocytes were plated in a cell culture dish and cultured in a cell incubator at 5% CO2, 95% humidity, and 37°C.

[0257] (16) For example, in a six-well plate, 1.5 mL of medium was used to resuspend 2 neonatal rat cardiomyocytes per well, about 80w of cardiomyocytes; for example, in a twelve-well plate, 1 mL of medium was used to resuspend 1 neonatal rat cardiomyocyte per well, about 40w of cardiomyocytes; for example, in a confocal dish, 200 μL of medium was used to resuspend 1 neonatal rat cardiomyocyte per dish (only plated in the middle groove), about 20w of cardiomyocytes.

[0258] 3.2 modRNA transfection of NMCM

[0259] (1) For in vitro transfection, the RNAiMAX transfection reagent (Life Technologies) recommended by the manufacturer (Thermo Scientific, 13778075) was used.

[0260] (2) The neonatal rat cardiomyocytes were isolated and cultured for 24 h according to the above procedure, and the primary neonatal rat cardiomyocyte medium was replaced with a double-antibody-free medium, DMEM+2% FBS, 2 hours before transfection.

[0261] (3) For example, in a confocal dish modRNA transfection, 2 μL of RNAiMax was mixed with 30 μL of Opti-MEM in an EPPENDORF TM tube, and vortexing was not allowed. In another EPPENDORF TMIn a separate EPPENDORF tube, mix 4 μg modRNA with 60 μL Opti-MEM. Do not vortex. Add the liquid from the tube containing the modRNA mixture to the tube containing the RNAiMAX mixture. Let the combined mixture sit at room temperature for 5 minutes. Add 120 μL of the mixture to one well of a twelve-well cell culture plate.

[0262] (4) Using the twelve-well plate modRNA transfection as an example: Mix 4 μL RNAiMax with 60 μL Opti-MEM in an EPPENDORF TM tube. Do not vortex. In a separate EPPENDORF TM tube, mix 4 μg modRNA with 60 μL Opti-MEM. Do not vortex. Add the liquid from the tube containing the modRNA mixture to the tube containing the RNAiMAX mixture. Let the combined mixture sit at room temperature for 5 minutes. Add 120 μL of the mixture to one well of a twelve-well cell culture plate.

[0263] (5) Using the six-well plate modRNA transfection as an example: Mix 9 μL RNAiMax with 150 μL Opti-MEM in an EPPENDORF TM tube. Do not vortex. In a separate EPPENDORF TM tube, mix 8 μg modRNA with 150 μL Opti-MEM. Do not vortex. Add the liquid from the tube containing the modRNA mixture to the tube containing the RNAiMAX mixture. Let the combined mixture sit at room temperature for 5 minutes. Add 300 μL of the mixture to one well of a six-well cell culture plate.

[0264] 3.3 Transfecting Ncbp2-mRNA in a mouse model of myocardial infarction

[0265] Mix 40 μL Lipofectamine MessengerMAX mRNA transfection reagent (Thermo, LMRNA008) with 10 μL OptiMEM in an EPPENDORF TM tube and vortex. Let the MessengerMAX mixture sit at room temperature for 10 minutes. In a separate EPPENDORF TMIn a tube, 40 μg of modRNA was combined with 10 μL of OptiMEM. The tube was rotated to remove liquid from the sides. After the modRNA mixture stood at room temperature for 10 minutes, the liquid from the tube containing the modRNA mixture was added to the tube containing the MessengerMAX mixture. The combined mixture was then allowed to stand at room temperature for 15 minutes. Adult mice were anesthetized by intraperitoneal injection of 0.2 mL / 10 g of 2% tribromoethanol. The left anterior descending coronary artery was ligated via thoracotomy. The ligation was performed on the left anterior descending coronary artery. The ligation was aspirated and injected into the mouse myocardium using a microsyringe. After 24 hours, proteins were collected from the infarcted area, the periphery of the infarct, the distal area, the liver, and the kidney to detect overexpression efficiency.

[0266] 3.4 Recombinant protein transfection with NMCM

[0267] Recombinant NCBP2 protein 1 was added directly to the culture medium, and the final concentration was adjusted to 2 μg / mL and 5 μg / mL.

[0268] Using the protein transfection reagent Pierce TM Transfection of recombinant NCBP2 protein 2 was performed using Protein Transfection Reagent (Thermo Scientific, Cat. #89850). Add 250 μL of methanol or chloroform to a reagent tube (89850A), vortex for 10-20 seconds to dissolve, aliquot, and store at -20°C. Transfer 20 μL of the solution to the bottom of a centrifuge tube and dry in a fume hood for 2-3 hours to ensure complete solvent evaporation. Mix 4 μg and 10 μg of recombinant NCBP2 protein 2 with the drying reagent, gently pipetting and aspirating 3-5 times, and incubate for 5 minutes to form a complex. Dilute the complex with 1 mL of serum-free DMEM medium and add to cells at 50-70% confluence, incubating at 37°C for 4 hours (the first 4 hours require a serum-free environment). After 4 hours, add equal volumes of complete culture medium to final concentrations of 2 μg / mL and 5 μg / mL.

[0269] Cells were collected after 24 hours and 48 hours in both treatment groups, and total protein was extracted for subsequent analysis.

[0270] 3.5 Tet-On AAV infection of adult mice

[0271] The separately packaged rtTA virus and TRE virus were mixed in a specific ratio to obtain a final viral titer of 1×10⁻⁶. 12 A mixed viral solution of vg / mL was administered. Adult mice were anesthetized by intraperitoneal injection of 0.2 mL / 10 g of 2% tribromoethanol. After thoracotomy, 50 μL of the viral mixture was injected intramyocardially into the anterior wall of the left ventricle. Starting on the 5th day after viral injection, NCBP2 expression was activated by intraperitoneal injection of 10 mg / mL Dox (MCE, HY-N056B) for 7 consecutive days.

[0272] 3.6 Expression efficiency evaluation based on modRNA, recombinant protein and Tet-On AAV system

[0273] To determine the optimal modRNA transfection concentration, 1 pg modRNA / 10 5 Primary neonatal mouse cardiomyocytes (NMCMs) were transfected, and NCBP2 protein was semi-quantitatively analyzed by fluorescence microscopy imaging and immunofluorescence staining, and the expression level of in vitro synthesized Ncbp2-modRNA was detected by qPCR.

[0274] In the recombinant protein transfection experiment, NMCMs were transfected with different concentrations of recombinant protein, and cell proteins were extracted 24 hours after transfection, and the transfection efficiency was detected by Western blot.

[0275] In the in vivo experiment, after the Ncbp2-modRNA transfected myocardial infarction mice for 24 hours, the marginal zone, distal zone, spleen and kidney tissues were collected respectively, and the overexpression efficiency of NCBP2 was detected by extracting the protein. For the Tet-On AAV system, after inducing expression by continuous intraperitoneal injection of doxycycline (DOX) for 7 days, the left ventricular anterior wall tissue of the mouse was collected, and the protein was extracted to evaluate the induced expression efficiency of NCBP2.

[0276] (1) Immunofluorescence staining:

[0277] 1) Take the cells 24h and 120h after transfection, discard the culture solution, and wash the cells in the confocal cell culture dish with 1 mL of 37°C preheated PBS buffer, wash away dead cells and impurities, and repeat the washing 3 times.

[0278] 2) Add 1 mL of 4% paraformaldehyde (PFA) (Regen Bio, DF0135) to fix the cells at room temperature for 10-15 min.

[0279] 3) Wash the cells with 1 mL of PBS buffer to wash away the residual paraformaldehyde solution, and repeat the washing 3 times, each time waiting for 5 min.

[0280] 4) Add 1 mL of blocking goat serum containing 3% BSA and 0.3% Triton TM X-100 to the confocal cell culture dish to block the fixed cells, and incubate at room temperature for 1 h.

[0281] 5) Wash the cells with 1 mL of PBS buffer to wash away the residual blocking goat serum, and repeat the washing 3 times, each time waiting for 5 min.

[0282] 6) Primary antibody incubation: Wash 3 times with PBS, wait for 5 min each time. Add primary antibody (diluted 1:200 with antibody diluent) NCBP2 (Proteintech, 11950-1-AP) and ACTN2 (Abeam, Ab9465) respectively, incubate at 4°C overnight.

[0283] 7) Remove primary antibody, wash the cells with 1 mL of PBS buffer, wash away the residual primary antibody, repeat the washing 3 times, wait for 5 min each time.

[0284] 8) Dilute the secondary antibody with antibody diluent (1:200 dilution), add to the confocal cell culture dish, 200 μL / dish, pay attention to avoid light, incubate at room temperature for 1 h. Among them, for NCBP2 protein, use secondary antibody Alexa Fluor 594 labeled anti-rabbit IgG (Zhongshanjingqiao, ZF-0516), for ACTN2, use secondary antibody Alexa Fluor 647 labeled goat anti-mouse IgG (H+L) (Yixingshengwu, 33213ES60).

[0285] 9) Remove secondary antibody, wash the cells with 1 mL of PBS buffer, wash away the residual secondary antibody, repeat the washing 3 times, wait for 5 min each time.

[0286] 10) Add DAPI ready-to-use staining solution (Solebao, C0065) to the confocal cell culture dish, 200 μL / dish, incubate at room temperature for 10 min.

[0287] 11) Remove the added DAPI ready-to-use staining solution, wash the cells with 1 mL of PBS buffer, wash away the residual secondary antibody, repeat the washing 3 times, wait for 5 min each time.

[0288] 12) Take pictures using a confocal microscope.

[0289] The results are shown in Figures 3A-3B, and it is detected that NCBP2 is highly expressed after 24 h of transfection.

[0290] (2) Real-time fluorescent quantitative PCR detection (qPCR)

[0291] 1) Primer design

[0292] qPCR primer design used NCBI website to select gene transcript to "pick primers", modified design parameters: "PCR product size" set at 70-200bp; "Exon junction span" selected to exclude genomic contamination interference; "Database" option, select Refseq RNA; finally, "Get primers", select primers with moderate length, good specificity, less self-complementarity, less TM value difference, and best performance for experiments. The primer sequences used in this experiment are shown in Table 9 below.

[0293] Table 9: qPCR primer table

[0294] 2) Extract RNA

[0295] ① Take the cells after transfection for 24h, 48h, and 120h, add 1mL Trizol (Invitrogen, 15596018) solution to the cell culture dish for cell lysis, and gently blow.

[0296] ② Transfer the lysed liquid to a 1.5mL EPPENDORF TM tube, and place it on ice.

[0297] ③ Add 200μL chloroform (the volume of chloroform added is 1 / 5 of the volume of Trizol), shake vigorously for 30s, and stand on ice for 2min.

[0298] ④ 4℃, 14000rpm, 15min centrifugation.

[0299] ⑤ After centrifugation, divide into three layers, the lower pink layer is the organic layer, and the middle white layer is protein and DNA. Absorbing both layers will affect the concentration result. Carefully and slowly absorb about 500μL of the upper aqueous phase into another clean EP tube.

[0300] ⑥ Add an equal volume (500μL) of isopropanol, mix well by inverting, and stand on ice for 2min.

[0301] ⑦ 4℃, 14000rpm, 15min centrifugation, discard the supernatant (as much as possible to absorb all the isopropanol).

[0302] ⑧ Add 1mL of 75% ethanol to each tube, gently invert, and centrifuge at 4℃, 14000rpm for 15min.

[0303] ⑨ As cleanly as possible, discard the supernatant, and open the lid to dry for 5min.

[0304] 10. Add 20 μL of nuclease-free water to dissolve, measure the concentration, and store at -80°C.

[0305] Conduct concentration determination of RNA samples using NanoDrop2000, select RNA option, use nuclease-free water for zero setting, and the values of A260 / A280 and A260 / A230 should be between 1.8-2, indicating good quality of RNA samples.

[0306] 3) Reverse transcription polymerase chain reaction

[0307] Conduct RNA reverse transcription according to the instructions of reverse transcription kit iScript cDNA Synthesis Kit (BIO-RAD, 1708891).

[0308] Prepare the reaction system in an RNase-free centrifuge tube, mix gently with a pipette, and collect at the bottom of the tube after short centrifugation. Conduct reverse transcription reaction on a PCR instrument, and the reverse transcription product can be immediately used for qPCR reaction, or stored at -20°C. The cDNA should avoid repeated freezing and thawing.

[0309] Prepare the reverse transcription reaction system as shown in Table 10, with a total of 10 μL system.

[0310] Table 10: Reverse transcription reaction system

[0311] Conduct reverse transcription reaction according to the reaction procedure shown in Table 11.

[0312] Table 11: Reverse transcription PCR reaction procedure

[0313] 4) Real-time PCR detection

[0314] Dilute the cDNA after reverse transcription of RNA (200 ng) 10 times with nuclease-free water, and conduct Real-time PCR detection. The reaction system is shown in Table 12, the procedure is shown in Table 13, and the reaction is conducted using fluorescent quantitative PCR instrument ABI Quant Studio6 (note: use 384-well plate for sample addition, first add 3 μL small volume, then add 7 μL mixture (can find whether the sample is added accurately in time)).

[0315] Table 12: Real-time PCR reaction system

[0316] Table 13: Real-time PCR reaction procedure

[0317] The results are shown in Figures 4A-4B, and the NCBP2 expression was the highest after 24 hours of transfection.

[0318] (3) Western blotting for detecting protein expression

[0319] 1) Protein extraction

[0320] All the following operations are performed on ice to avoid affecting the quality of protein extraction.

[0321] ①Pre-cool PBS and thaw RIPA lysis buffer. Add 100x cOmplete Protease Inhibitor Cocktail (Roche, 04693132001) and 1000x BeyoZonase TM Super Nuclease (Beyotime, D7121) to the RIPA lysis buffer within a few minutes before use. TM

[0322] ②Take the cells transfected for 24h, 48h and 96h as an example. Remove the culture medium and add 1mL pre-cooled PBS (phosphate buffer) to each well of the six-well plate. Gently shake the six-well plate to wash the cells thoroughly, and discard the PBS. Repeat this operation three times. Suck the residual PBS buffer to avoid dilution of the protein lysis buffer. Add 50-150μL lysis buffer to each well of the six-well plate, and use a gun to blow a few times to ensure that the lysis buffer and cells are in contact. Use a cell scraper to scrape the cells evenly, and make sure that each corner is scraped. Use an enzyme-free sterile gun tip to transfer all the protein lysis buffer to a 1.5ml enzyme-free EP tube, and try to transfer as much protein lysis buffer as possible. Lyse on ice for 30min, and vortex every 10min. If the experiment is not needed temporarily, store the protein tube in a -80℃ refrigerator.

[0323] As an example of extracting tissue protein, after 24h of transfection, use 2% trichloroethanol 0.2ml / 10g intraperitoneal injection for anesthesia, open the chest to cut the heart infarction edge area and distal area, and open the abdomen to cut 10mg of spleen and kidney tissue into a homogenate tube. Add 200μL RIPA lysis buffer, 100x Deacetylase Inhibitor Cocktail (MCE, HY-K0030) and 1000x BeyoZonase TM Super Nuclease (Beyotime, D7121). Put the tissue into a 4℃ tissue grinder for 120s homogenization. Lyse on ice for 30min, and vortex every 10min. If the experiment is not needed temporarily, store the protein tube in a -80℃ refrigerator.

[0324] ⑦Adjust the centrifuge to 4℃ pre-cooling, 12000rpm, and centrifuge for 30min. ​

[0325] 8. Gently remove the EP tube from the centrifuge. The protein lysate supernatant and the bottom precipitate can be seen. Transfer all of the supernatant to a new protein tube. Estimate the volume of the protein supernatant and be careful not to aspirate the cell debris precipitate at the bottom of the tube.

[0326] 9. Mix the protein lysate and 5x SDS-PAGE loading buffer (Genstar, E151) at a ratio of 4:1. Shake and centrifuge the solution before loading to ensure that the reagent is well mixed.

[0327] 10. Denature the protein sample in a metal bath at 100°C for 10 minutes.

[0328] If the experiment is not needed immediately, store the protein tube at -80°C.

[0329] 2. Protein concentration determination

[0330] 1. Prepare the BCA working solution according to the instructions (Thermo, 23227).

[0331] 2. Mix the A solution and the B solution at a ratio of 50:1. Add 200 μL of the working solution to each well. Calculate the total volume.

[0332] 3. Take 5 μL of the protein stock solution and dilute it to 25 μL with RIPA.

[0333] 4. Dilute the bovine serum albumin (BSA) standard solution in a gradient. Take 30 μL of the 2 mg / mL BSA standard solution and add 30 μL of PBS to obtain a 1 mg / mL BSA standard solution. Dilute the solution in a gradient to obtain 1000, 500, 250, 125, 62.5, and 31.25 μg / mL BSA standard solutions, each in 30 μL.

[0334] Mix 25 μL of the standard solution with the sample to be tested and 200 μL of the working solution. The final reaction volume is 225 μL.

[0335] 5. Incubate at 37°C for 30 minutes.

[0336] 6. Measure the optical density (OD value) at 562 nm using a microplate reader.

[0337] Draw the standard curve. The X-axis represents the OD562 values of the standard tubes, and the Y-axis represents the BSA standard protein concentrations. Use Excel to fit the curve and calculate the protein concentration of the sample to be tested.

[0338] ​⑦Use 1x SDS-PAGE loading buffer to prepare the sample to be tested into a protein solution of equal concentration, metal bath 100℃ for 5mins, -80℃ storage, or immediately proceed to Western blotting.

[0339] 3) Western blotting

[0340] SDS-PAGE electrophoresis: gel preparation-loading-transferring-membrane blocking-primary antibody incubation-secondary antibody incubation-washing membrane development

[0341] ①Prepare fresh SDS-PAGE gel according to the 12.5% fast gel preparation kit (Yazyme, PG213);

[0342] ②Prepare fresh 1x electrophoresis buffer according to the PluriJET 10x electrophoresis buffer Tris-Gly (PluriJET, B1005); Add the above denatured protein samples one by one to the comb holes, this process should be slow and careful, and the pipette should be squeezed with uniform force to avoid sample overflow of the holes. Add about 5-10μL of protein Marker as a molecular marker;

[0343] ③After the sample is added, the electrophoresis process is carried out. Concentrated gel electrophoresis conditions: 60V, 30min; Separation gel electrophoresis conditions: 80V, 100min, current control at about 500mA. The whole running gel process takes about 2h. The end of electrophoresis is determined by the position of bromophenol blue, if the bromophenol blue reaches the bottom of the gel, the electrophoresis can be ended and the next step can be carried out;

[0344] ④Prepare fresh 1x transferring solution according to PluriJET 10x transferring solution (PluriJET, B1006);

[0345] ⑤Carefully take out the gel, cut off the concentrated gel and the separation gel below the bromophenol blue with a blade. According to the size of the treated gel, cut a piece of 9cm x 6cm PVDF membrane;

[0346] ⑥Soak the cut PVDF membrane in methanol for 1min;

[0347] ⑦Rinse the membrane and two pieces of filter paper and a sponge piece together in the transferring solution for standby;

[0348] ⑧Assemble the transferring plate: according to the order of "sponge-filter paper-PVDF membrane-filter paper-sponge", place the "black gel white membrane" with plastic plate to dry and remove the air bubbles between the layers;

[0349] ⑨Assemble the transferring device, fill the transferring box with transferring solution and place it in an ice box, corresponding to the red and black jacks and wires, transfer for 100min at 200mA;

[0350] ⑩ Dissolve 2.5g of skim milk powder in 50mL of TBST (Purilai, B1009-TBST) to prepare a 5% milk sealing solution;

[0351] Once the transfer is complete, remove the sponge, filter paper, and adhesive. Take out the PVDF membrane, keeping the front side up, and place it in freshly prepared milk sealing solution. Seal at room temperature for 60 minutes.

[0352] Dilute the antibody with TBST according to the dilution ratio provided in the antibody instructions, and add primary antibody (1:500 dilution) NCBP2 (Proteintech, 11950-1-AP) and internal control GAPDH (Proteintech, 6004-1-Ig) or Beta Tubulin (Proteintech, 66240-1-Ig) antibody respectively.

[0353] Place the membrane in diluted antibody and incubate overnight at 4°C on a shaker for 12-16 hours.

[0354] Rinse the membrane three times with an appropriate amount of TBST (the volume of TBST should be enough to completely cover the membrane), 10 minutes each time, always keeping the front side of the membrane facing upwards, to remove residual primary antibody on the membrane and avoid excessive background during exposure.

[0355] Use QuickBlock at the dilution ratio provided in the antibody instructions. TM The secondary antibody was diluted with Western blot buffer, and the corresponding species of secondary antibody (1:5000) was added to both anti-rabbit IgG, HRP-linked Antibody (Cell Signaling, 7074) and anti-mouse IgG, HRP-linked Antibody (Cell Signaling, 7076). The washed membrane was then incubated with the secondary antibody on a shaker at room temperature for 2 hours.

[0356] Rinse the membrane five times with an appropriate amount of TBST solution, each time for 10 minutes;

[0357] According to the instructions of Prilele ECL luminescent solution (Prilele, P1020), take 1 mL of solution A and solution B respectively, mix them, and drop them evenly onto the PVDF membrane. Incubate in the dark for 2 min.

[0358] Quantitative analysis (using GAPDH as an internal reference, the gray value of the target protein band was quantitatively analyzed using ImageJ software).

[0359] Results are as follows: as shown in FIGS. 4A and 4B, the expression level of NCBP2 can be significantly increased by Ncbp2-modRNA after transfection of neonatal rat cardiomyocytes for 24 hours; in a myocardial infarction mouse, overexpression of NCBP2 can be detected in the marginal zone of myocardial infarction after transfection for 24 hours (FIG. 5). As shown in FIGS. 6-7, NCBP2 recombinant protein also exhibits good transfection efficiency in vitro. The Tet-On AAV system has significant induced expression ability after in vivo induction by doxycycline, and the background expression is extremely low, almost no leakage phenomenon (FIG. 8). In summary, the three strategies based on Ncbp2 overexpression all exhibit good performance, providing strong support for subsequent clinical translation applications.

[0360] Example 4: Role of Ncbp2 in cardiac repair

[0361] 4.1 Construction of animal models

[0362] Experimental animals: C57BL / 6J wild-type mice (5.5 days old, SPF level), adult C57BL / 6J wild-type mice (8 weeks old, SPF level), purchased from Huafukang Biotechnology Co., Ltd.

[0363] Breeding of Ncbp2 cardiomyocyte-specific overexpression mice: Ncbp2 fl / + Mice were crossed with aMHC-MerCreMer (MCM) mouse strain carrying CRE enzyme to obtain Ncbp2 fl / + ; aMHC-MCM mouse strain, after induction by intraperitoneal injection of Tamoxifen at a dose of 30 mg / kg for three days, PCR experiments were used to verify whether Ncbp2 cardiomyocyte-specific overexpression was successful.

[0364] Breeding of Ncbp2 systemic overexpression mice: Ncbp2 fl / + Mice were crossed with a UBC-Cre-ERT2 mouse strain carrying CRE enzyme to obtain Ncbp2 fl / + ; UBC-Cre-ERT2 mouse strain, after induction by intraperitoneal injection of Tamoxifen at a dose for three days, PCR and qPCR experiments were used to verify whether Ncbp2 systemic overexpression was successful.

[0365] 4.2 Construction of mouse myocardial infarction model

[0366] (1) For P5.5-day-old mice, ice anesthesia was performed for 2-4 min; for adult mice, 2% tri- bromoethanol 0.2 ml / 10 g was intraperitoneally injected for anesthesia.

[0367] (2) Open the chest and perform left anterior descending coronary artery ligation operation to establish a myocardial infarction model.

[0368] 4.3 Ncbp2 overexpression adeno-associated virus injection

[0369] (1) The purified adeno-associated virus rAAV2 / 9-CMV-GFP or rAAV2 / 9-CMV-GFP obtained in Example 2 was administered to the heart in situ at a dose of 1 x 10 11 vg / g.

[0370] (2) The injected mice were placed on a heating pad and returned to their original cage after they woke up.

[0371] (3) For adult mice, cardiac ultrasound was performed on day 14, 28, and 84 to detect the recovery of cardiac function. For P5.5-day-old mice, cardiac ultrasound was performed on day 1 and 28 after surgery to detect changes in cardiac function.

[0372] As shown in Figure 9, the results of cardiac ultrasound showed that in adult mice, the ejection fraction (EF) and left ventricular fractional shortening (FS) of the myocardial infarction model group receiving AAV-Ncbp2-OE treatment increased significantly from day 14 after surgery; in P5.5-day-old mice, AAV-Ncbp2-OE treatment also significantly improved the EF and FS levels on day 21 after surgery. The above results suggest that Ncbp2 overexpression can improve cardiac contractile function to some extent and has the potential to promote the recovery of cardiac function after myocardial infarction.

[0373] 4.4 Ncbp2 overexpression lentivirus injection

[0374] The overexpression plasmid of Ncbp2 was packaged into lentivirus, and the overexpression efficiency was verified in vitro. Then the virus was purified, and the mice were subjected to myocardial infarction operation, and GFP (as a control) and purified virus were injected into the infarct area. Ultrasound was detected 2 days after surgery as a baseline, and ultrasound was detected 14 and 28 days after surgery to confirm the repair of the mouse heart (Figure 10A). Two weeks later, GFP immunofluorescence staining was performed on mice treated with GFP lentivirus, and GFP was observed to be expressed in heart tissue sections, indicating that the virus carrying GFP successfully infected the heart tissue (Figure 10B). Then, the RNA of the two-week-old anterior wall of the heart was extracted, and quantitative PCR was performed, and the data showed that the target Ncbp2 was successfully overexpressed (Figure 10C).

[0375] Further, echocardiography showed that the ejection fraction of the heart of the mouse with myocardial infarction overexpressing Ncbp2 was significantly higher than that of the control group GFP, which proved that the overexpression of Ncbp2 had a certain repair effect on myocardial infarction (Figure 11). In addition, Masson staining of the mouse heart to evaluate the degree of fibrosis also showed that the degree of fibrosis in the overexpression group of Ncbp2 was lower than that in the control group (Figure 12), and the expression of some fibrosis genes and inflammatory genes also showed that the overexpression group of Ncbp2 was lower than the control group (Figure 13), which also proved the effect of Ncbp2 on heart repair.

[0376] 4.5 Ncbp2 overexpression mice

[0377] 8-week-old Ncbp2 fl / + ; UBC-Cre-ERT2 and UBC-Cre-ERT2 (as a control) mice were injected intraperitoneally with Tamoxifen for 3 consecutive days, and the injection dose was 30 mg / kg. After 7 days, a left anterior descending coronary artery ligation operation was performed to establish a myocardial infarction model. Ultrasound was detected 1-2 days after the operation as the baseline, and ultrasound was detected 2 weeks and 6 weeks after the operation to confirm the repair of the mouse heart.

[0378] Ncbp2 fl / + ; ɑMHC-MCM and ɑMHC-MCM (as a control) mice were injected intraperitoneally with Tamoxifen for 3 consecutive days, and the injection dose was 30 mg / kg. After 7 days, a left anterior descending coronary artery ligation operation was performed to establish a myocardial infarction model. Ultrasound was detected 1-2 days after the operation as the baseline, and ultrasound was detected 1 week, 2 weeks, 3 weeks, 4 weeks and 6 weeks after the operation to confirm the repair of the mouse heart.

[0379] As shown in Figure 14, echocardiography results showed that whether it was myocardial cell-specific or whole-body overexpression of Ncbp2, the heart contractile function could be improved to a certain extent after two weeks of overexpression.

[0380] Although the specific embodiments of the present application have been described in detail, those skilled in the art will understand that various modifications and changes can be made to the details in accordance with all the teachings disclosed herein, and these changes are within the scope of protection of the present application. The entire scope of the present application is given by the appended claims and any equivalents thereof.

Claims

1. Use of an agent capable of modulating the expression of the Ncbp2 gene or modulating the activity of the expression product of the Ncbp2 gene for the manufacture of a medicament for preventing and / or treating a disease or condition associated with cardiomyocyte injury in a subject.

2. The use of claim 1, wherein, The agent is an activator capable of activating or upregulating the expression of the Ncbp2 gene and / or of activating or enhancing the activity of the expression product of the Ncbp2 gene.

3. The use of claim 1 or 2, wherein, The agent is selected from the expression product of the Ncbp2 gene or an active fragment thereof, a nucleic acid molecule encoding the expression product or an active fragment thereof, an antibody or an antigen-binding fragment thereof, a low-molecular-weight chemical compound.

4. The use of claim 3, wherein, The expression product of the Ncbp2 gene is selected from an mRNA or a protein.

5. The use of claim 3, wherein, The agent is an Ncbp2 mRNA or a nucleic acid molecule comprising an Ncbp2 mRNA; Preferably, the nucleic acid molecule comprises a Cap1 structure, a 5’UTR at its 5’ end, a 3’UTR and a PolyA tail at its 3’ end; Preferably, the nucleic acid molecule comprises, in order from 5’ end to 3’ end: a Cap1 structure, a 5’UTR, an mRNA of Ncbp2, a self-cleaving peptide (such as T2A), a reporter gene (such as a fluorescent protein, e.g. eGFP), a 3’UTR and a PolyA tail; Preferably, the Ncbp2 mRNA encodes a human NCBP2 protein (such as set forth in SEQ ID NO: 17).

6. The use of claim 3, wherein, The agent is an NCBP2 protein or a polypeptide comprising an NCBP2 protein; Preferably, the polypeptide further comprises a CPP and / or a NLS; Preferably, the polypeptide comprises, in order from N-terminus to C-terminus: a CPP, a NLS and an NCBP2 protein; Preferably, the polypeptide comprises a protein tag at its N-terminus or C-terminus; preferably, the protein tag is a purification tag (e.g. His tag); Preferably, the various domains of the polypeptide are optionally linked by a peptide linker; Preferably, the NCBP2 protein is of human origin, e.g. comprises the sequence set forth in SEQ ID NO: 17; Preferably, the agent comprises a sequence as set forth in SEQ ID NO: 12 or 14.

7. The use of claim 3, wherein, The agent is an expression vector comprising a nucleic acid molecule encoding the expression product of the Ncbp2 gene or an active fragment thereof; Preferably, the agent is a viral vector, e.g. a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a retroviral vector; Preferably, the agent is a viral vector (such as AAV) comprising a nucleic acid molecule encoding a human NCBP2 protein (such as set forth in SEQ ID NO: 17).

8. The use of claim 1, wherein, The subject is a mammal, e.g. a human.

9. The use of claim 1, wherein, The disease or condition associated with cardiomyocyte injury is selected from a cardiovascular disease; Preferably, the cardiovascular disease causes one or more of the conditions selected from the group consisting of myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring; Preferably, the disease or condition associated with cardiomyocyte injury is selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring, cardiomyopathy, coronary heart disease, hypertensive heart disease.

10. A method for preventing and / or treating a disease or disorder associated with myocardial cell damage in a subject, comprising: administering to a subject in need thereof an effective amount of an agent capable of modulating the expression of the Ncbp2 gene or the activity of the expression product of the Ncbp2 gene.

11. The method of claim 10, wherein, The agent is an activating agent capable of activating or upregulating the expression of the Ncbp2 gene and / or activating or enhancing the activity of the expression product of the Ncbp2 gene.

12. The method of claim 10 or 11, wherein, The agent is selected from the expression product of the Ncbp2 gene or an active fragment thereof, a nucleic acid molecule encoding the expression product or an active fragment thereof, an antibody or an antigen-binding fragment thereof, a low-molecular-weight chemical compound.

13. The method of claim 12, wherein, The expression product of the Ncbp2 gene is selected from mRNA or protein.

14. The method of claim 12, wherein, The agent is Ncbp2 mRNA or a nucleic acid molecule comprising Ncbp2 mRNA; Preferably, the nucleic acid molecule comprises a Cap1 structure, a 5’UTR at its 5’ end, a 3’UTR and a PolyA tail at its 3’ end; Preferably, the nucleic acid molecule comprises, in order from 5’ end to 3’ end: a Cap1 structure, a 5’UTR, mRNA of Ncbp2, a self-cleaving peptide (such as T2A), a reporter gene (such as a fluorescent protein, e.g., eGFP), a 3’UTR and a PolyA tail; Preferably, the Ncbp2 mRNA encodes a human NCBP2 protein (such as set forth in SEQ ID NO: 17).

15. The method of claim 12, wherein, The agent is NCBP2 protein or a polypeptide comprising NCBP2 protein; Preferably, the polypeptide further comprises a CPP and / or a NLS; Preferably, the polypeptide comprises, in order from N-terminus to C-terminus: a CPP, a NLS and a NCBP2 protein; Preferably, the polypeptide comprises a protein tag at its N-terminus or C-terminus; preferably, the protein tag is a purification tag (e.g., His tag); Preferably, the domains of the polypeptide are optionally connected by a peptide linker; Preferably, the NCBP2 protein is of human origin, e.g., comprising the sequence set forth in SEQ ID NO: 17; Preferably, the agent comprises a sequence as set forth in SEQ ID NO: 12 or 14.

16. The method of claim 12, wherein, The agent is an expression vector comprising a nucleic acid molecule encoding the expression product of the Ncbp2 gene or an active fragment thereof; Preferably, the agent is a viral vector, e.g., a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a retroviral vector; Preferably, the agent is a viral vector (such as AAV) comprising a nucleic acid molecule encoding a human NCBP2 protein (such as set forth in SEQ ID NO: 17).

17. The method of claim 10, wherein, The subject is a mammal, e.g., a human.

18. The method of claim 10, wherein, The disease or condition associated with damage to cardiomyocytes is selected from cardiovascular diseases; Preferably, the cardiovascular disease causes one or more of the conditions selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring; Preferably, the disease or condition associated with damage to cardiomyocytes is selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scarring, cardiomyopathy, coronary heart disease, hypertensive heart disease.

19. A method of screening for a drug for preventing and / or treating a disease or disorder associated with myocardial cell damage in a subject, comprising a step of screening for an agent capable of modulating the expression of the Ncbp2 gene or modulating the activity of the expression product of the Ncbp2 gene; Preferably, the agent is an activator capable of activating or up-regulating the expression of the Ncbp2 gene and / or activating or enhancing the activity of the expression product of the Ncbp2 gene; Preferably, the subject is a mammal, such as a human; Preferably, the disease or disorder associated with myocardial cell damage is selected from cardiovascular diseases; Preferably, the cardiovascular disease causes one or more of the conditions selected from the group consisting of myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scar; Preferably, the disease or disorder associated with myocardial cell damage is selected from myocardial infarction (heart attack), heart failure (heart failure), arrhythmia, myocardial scar, cardiomyopathy, coronary heart disease, hypertensive heart disease; Preferably, the method comprises: (1) contacting a test agent with a cell capable of expressing the Ncbp2 gene; (2) determining the expression level of the Ncbp2 gene or the activity of the NCBP2 protein; (3) comparing the results of step (2) with the results in the absence of the test agent; (4) selecting the test agent having the ability to activate or up-regulate the expression of the gene or the activity of the protein as a candidate drug.

Images