Fibroblast growth factor 21 (FGF21) gene therapy

The use of a rAAV vector encoding FGF21 addresses the limitations of traditional FGF21 treatments by reducing kidney inflammation and fibrosis, offering sustained therapeutic benefits for AKI and CKD through targeted gene delivery.

WO2026028137A1PCT designated stage Publication Date: 2026-02-05UNIVERSITAT AUTONOMA DE BARCELONA

Patent Information

Application Number
PCT/IB2025/057770
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-24
Filing Date
2025-07-31
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Current treatments for kidney diseases such as acute kidney injury (AKI), chronic kidney disease (CKD), and renal fibrosis face challenges due to the poor pharmacokinetic properties of Fibroblast growth factor 21 (FGF21) and the need for multiple administrations, which can lead to immunogenicity and patient burden, while existing therapies do not effectively address inflammation, oxidative stress, and fibrosis in the kidneys.

Method used

Administration of a recombinant adeno-associated virus (rAAV) vector encoding FGF21 or a functional fragment, utilizing AAV capsids and promoters to target kidney or liver-specific expression, reducing the need for frequent dosing and minimizing immunogenicity.

Benefits of technology

The rAAV vector effectively reduces kidney inflammation, oxidative stress, and fibrosis, providing sustained therapeutic benefits for AKI and CKD without the drawbacks of traditional FGF21 formulations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000021_0001
    Figure IMGF000021_0001
  • Figure IMGF000056_0001
    Figure IMGF000056_0001
  • Figure IMGF000057_0001
    Figure IMGF000057_0001
Patent Text Reader

Abstract

According to various aspects of this disclosure, the present disclosure relates to methods for reducing kidney inflammation, reducing kidney fibrosis, reducing oxidative stress in the kidney, preventing or reducing the likelihood of chronic kidney disease (CKD), treating or preventing acute kidney injury (AKI) or treating a kidney disease in a subject in need thereof comprising administering, e.g., intramuscularly, to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof and an AAV capsid (e.g., AAV1 serotype), optionally, wherein the subject does not suffer from diabetes.
Need to check novelty before this filing date? Find Prior Art

Description

FIBROBLAST GROWTH FACTOR 21 (FGF21) GENE THERAPYCROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the priority benefit of U.S. Provisional Application No. 63 / 677,897, filed July 31, 2024; and U.S. Provisional Application No. 63 / 749,358, filed January 24, 2025; each of which is hereby incorporated by reference in its entirety.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0002] The content of the electronically submitted sequence listing (Name: 5344_008PC02_SequenceListing_ST26.xml; Size: 83,113 bytes; and Date of Creation: July 30, 2025), filed with the application, is incorporated herein by reference in its entirety.FIELD OF THE DISCLOSURE

[0003] The present disclosure relates to the medical field, including nucleic acid therapies for treating and preventing kidney diseases.BACKGROUND OF THE DISCLOSURE

[0004] Acute kidney injury (AKI), the sudden (e.g., within less than seven days) failure of the kidney to filter waste products from the blood as normal, and Chronic Kidney Disease (CKD), the gradual loss of kidney function over time (e.g., greater than three months), are highly prevalent conditions that cause significant levels of morbidity and mortality. Andrade-Oliveira V, et al., 2019. Front Pharmacol. 10: 1192. As of 2017, approximately 30 million Americans have CDK, and approximately 60% of intensive care unit patients are affected by AKI. CKD can lead to high blood pressure, heart disease, stroke, and early death. AKI is associated with a cascade response of inflammatory pathways in the kidney, involving cytokine and chemokine secretion and tissue repair.

[0005] Furthermore, among issues caused by aging, renal aging is becoming nonnegligible. See Liu, F., et al., 2022. Genes (Basel) 13(5):796. According to WorldHealth Organization (WHO) statistics, it is estimated that there will be approximately two billion people over 60 years old worldwide by 2050, and the incidence of deaths due to renal dysfunction is increasing globally in parallel with the aging population. Id.Although the aging process is not known to directly cause kidney disease, aging kidneys are more susceptible to various adverse factors such as high blood pressure, diabetes, obesity, or primary renal disorders, which may contribute to the development of renal pathologies. Id. Aging thus is associated with a time-dependent decline in kidney function. Id.

[0006] The main pathological characteristics of the aged kidney include arteriosclerosis, glomerulosclerosis, tubular atrophy, and interstitial fibrosis. Id. Specifically, numerous studies have indicated that aging is recognized as a major contributor to the increased incidence of acute kidney injury (AKI) and chronic kidney disease (CKD) in the overall population. Id. Thus, reducing the inflammatory response leading to AKI, fibrosis, and CKD represents an urgent need in the management and prevention of kidney diseases.

[0007] Fibroblast growth factor 21 (FGF21), a growth factor predominantly secreted by the liver, but also by adipose tissue and pancreas (Muise, E. S. et al., 2008. Mol.Pharmacol. 74:403-412), has been shown to increase brown adipose tissue (BAT) growth and expression of thermogenic genes in BAT and white adipose tissue (WAT), stimulating energy expenditure (Coskun, T. et al., 2008. Endocrinology 149:6018-6027; Fisher, F. M. et al., 2012. Genes Dev. 26:271-281; Kharitonenkov, A. et al., 2005. J. Clin. Invest 115: 1627-1635; Konishi, M. et al., 2000. J. Biol. Chem. 275: 12119-12122;Tomlinson, E. et al., 2002. Endocrinology 143: 1741-1747; Xu, J. et al., 2009. Diabetes 58:250-259). Overexpression of FGF21 in transgenic mice protected them from diet- induced obesity (Kharitonenkov, A. et al., 2005. J Clin. Invest 115:1627-1635) and the administration of FGF21 protein to ob / ob, db / db or high fat diet (HFD)-fed mice or to obese ZDF rats promoted a robust reduction in adiposity, significantly lowered blood glucose and triglycerides, decreased fasting insulin levels and improved insulin sensitivity (Coskun, T. et al., 2008. Endocrinology 149:6018-6027; Kharitonenkov, A. et al., 2005. J Clin. Invest 115: 1627-1635; Xu, J. et al., 2009. Diabetes 58:250-259; Adams, A. C. et al., 2012. PLoS. One. 7:e38438; Berglund, E. D. et al., 2009. Endocrinology 150:4084-4093). Moreover, the administration of FGF21 to obese diabetic rhesus monkeys dramatically reduced fasting plasma glucose, fructosamine, triglyceride, insulin, and glucagon levelsand induced a small but significant weight loss (Kharitonenkov, A. et al., 2007. Endocrinology 148:774-781).

[0008] Native FGF21 protein exhibits poor pharmacokinetic characteristics for a pharmaceutical. For example, it has a short half-life, and it is susceptible to in vivo proteolytic degradation and aggregation in pharmaceutical formulations (Huang, J. et al., 2013. J Pharmacol Exp Ther. 346(2):270-80; So, W. Y. and Leung, P. S. 2016. Med Res Rev. 36(4):672-704; Zhang, J. and Li, Y. 2015. Front Endocrinol (Lausanne). 6: 168). Various engineering approaches have been developed to extend the half-life and to improve the stability and solubility of FGF21. For example, pegbelfermin (PGBF, also BMS-986036) is a polyethylene glycol-modified (PEGylated) recombinant human FGF21 analogue and pegozafermin (PGZ, also BIO89 100 or TEV-47948) is a glycoPEGylated version of human FGF21 (Verzijl 2020 DOI: 10.1080 / 13543784.2020.1708898; bailey 2023). PEGylation of FGF21 increases the size and solubility and decreases proteolytic degradation of the molecule and glomerular filtration in the kidney, resulting in a prolonged half-life and duration of action (So & Leung, 2016). Nevertheless, those FGF21 mimetics require multiple administrations, which poses a significant burden to the patients. Moreover, engineered FGF21 mimetics / analogs may exhibit a higher risk of immunogenicity than native FGF21, e.g., patients treated with the PEGylated FGF-21 mimetic LY2405319 developed injection site reactions, anti-drug antibodies, and a serious hypersensitivity reaction (Gaich, G. et al., 2013. Cell Metab. 18(3):333-40).BRIEF SUMMARY

[0009] Certain aspects of the present disclosure provide a method for treating or reducing kidney inflammation in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viralexpression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a liver specific promoter. In some aspects, the kidney inflammation is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0010] Certain aspects of the present disclosure provide a method for treating or reducing oxidative stress in a kidney of a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a liver specific promoter. In some aspects, the oxidative stress in the kidney is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0011] Certain aspects of the present disclosure provide a method for treating, preventing, or reducing kidney fibrosis in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a liver specific promoter. In some aspects, the kidney fibrosis is not associated with diabetes. In some aspects, the subject does not suffer from diabetes. In some aspects, the method reduces inflammation and oxidative stress in the kidney and prevents or reduces kidney fibrosis.

[0012] Certain aspects of the present disclosure provide a method for treating or preventing acute kidney injury (AKI) in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a liver specific promoter. In some aspects, the AKI is not associated with diabetes. In some aspects, the subject does not suffer from diabetes. In some aspects, the method reduces inflammation and oxidative stress in the kidney and prevents or treats AKI.

[0013] Certain aspects of the present disclosure provide a method for treating, preventing or reducing the likelihood of chronic kidney disease (CKD)-related fibrosis in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a liver specific promoter. In some aspects, the CKD and / or kidney fibrosis is / are not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0014] Certain aspects of the present disclosure provide a method for treatment and / or prevention of a kidney disease in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vectorcomprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof, wherein the kidney disease is selected from the group consisting of age-related kidney disease, uremia, acute renal insufficiency, chronic pyelonephritis, acute pyelonephritis, chronic glomerulonephritis, acute progressive nephritis syndrome, nephrotic syndrome, nephrosclerosis, interstitial nephritis, focal glomerulosclerosis, membranous nephropathy, multiple purulent renal syndrome, renal vascular hypertension, hypertensive kidney disease, secondary nephropathy, hyperphosphatemia, hyperkalemia, hyperuricemia, hypernatremia, chronic myeloid leukemia (CML), lupus nephritis, or kidney disease secondary to Alzheimer’s disease. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a liver specific promoter. In some aspects, the kidney disease is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0015] In some aspects, the kidney disease is an age-related kidney disease.

[0016] In some aspects, the kidney disease is uremia.

[0017] In some aspects, the kidney disease is acute renal insufficiency.

[0018] In some aspects, the kidney disease is chronic pyelonephritis.

[0019] In some aspects, the kidney disease is acute pyelonephritis.

[0020] In some aspects, the kidney disease is chronic glomerulonephritis.

[0021] In some aspects, the kidney disease is acute progressive nephritis syndrome.

[0022] In some aspects, the kidney disease is nephrotic syndrome.

[0023] In some aspects, the kidney disease is nephrosclerosis.

[0024] In some aspects, the kidney disease is interstitial nephritis.

[0025] In some aspects, the kidney disease is focal glomerulosclerosis.

[0026] In some aspects, the kidney disease is membranous nephropathy.

[0027] In some aspects, the kidney disease is multiple purulent renal syndrome.

[0028] In some aspects, the kidney disease is renal vascular hypertension.

[0029] In some aspects, the kidney disease is hypertensive kidney disease.

[0030] In some aspects, the kidney disease is secondary nephropathy.

[0031] In some aspects, the kidney disease is hyperphophatemia.

[0032] In some aspects, the kidney disease is hyperkalemia.

[0033] In some aspects, the kidney disease is hyperuricemia.

[0034] In some aspects, the kidney disease is hypernatremia.

[0035] In some aspects, the kidney disease is chronic myeloid leukemia (CML).

[0036] In some aspects, the kidney disease is lupus nephritis.

[0037] In some aspects, the kidney disease is secondary to Alzheimer's disease.

[0038] In some aspects, the subject suffers from chronic kidney disease (CKD).

[0039] In some aspects, the subject suffers from CKD-related fibrosis.

[0040] In some aspects, the kidney inflammation, the kidney oxidative stress, the kidney fibrosis, the AKI, and / or the CKD is not associated with diabetes.

[0041] In some aspects, the subject does not suffer from diabetes.

[0042] In some aspects, the ubiquitous promoter comprises a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter, a eukaryotic translation elongation factor 1 a (EFla) promoter, a simian virus 40 (SV40) promoter, a cytomegalovirus (CMV) promoter or a CAG promoter.

[0043] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter.

[0044] In some aspects, the ubiquitous promoter comprises a CAG promoter.

[0045] In some aspects, the promoter is a liver specific promoter.

[0046] In some aspects, the liver specific promoter comprises a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, an apolipoprotein E promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter.

[0047] In some aspects, the viral expression construct further comprises one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

[0048] In some aspects, the polyadenylation signal is a SV40 polyA or a rabbit betaglobin polyA.

[0049] In some aspects, the AAV ITRs (e.g., a 5’ ITR and a 3’ ITR) are AAV2 serotype.

[0050] In some aspects, the rAAV vector is injected into a muscle selected from the group consisting of quadriceps, gastrocnemius, tibialis, and any combination thereof.

[0051] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and / or a latissimus dorsi (lat). In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and / or a hamstring. In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a hamstring, or any combination thereof.

[0052] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and a latissimus dorsi (lat).

[0053] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and a hamstring.

[0054] In some aspects, the rAAV vector is administered as a single dose.

[0055] In some aspects, the rAAV vector is administered over multiple doses.

[0056] In some aspects, the multiple doses are administered to the same muscle. In some aspects, the multiple doses are administered to different muscles.

[0057] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence encoding an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1.

[0058] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 4, 5, 6, or 7.

[0059] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 4.

[0060] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 5.

[0061] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 6.

[0062] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 7.

[0063] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof encodes the amino acid sequence of SEQ ID NO: 1.

[0064] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 4.

[0065] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 5.

[0066] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 6.

[0067] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 7.

[0068] In some aspects, the rAAV comprises a polynucleotide having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 14.

[0069] In some aspects, administration of the rAAV reduces kidney inflammation, reduces kidney damage, reduces oxidative stress in a kidney, reduces or prevents kidney fibrosis, and / or treats or prevents AKI.

[0070] In some aspects, administration of the rAAV reduces kidney inflammation in the subject.

[0071] In some aspects, administration of the rAAV reduces kidney damage in the subject.

[0072] In some aspects, administration of the rAAV reduces or prevents kidney fibrosis in the subject.

[0073] In some aspects, administration of the rAAV treats or prevents AKI in the subject.

[0074] In some aspects, after administration, the subject has a 0.1-6 fold reduction in a relative expression of an inflammatory gene marker selected from the group consisting of Cd68, F4 / 80, Ccl2, Ccl3, Ccl5, Tufa, or any combination thereof, optionally wherein the relative expression is measured by qRT-PCR.

[0075] In some aspects, after administration, the subject has a 0.1-6 fold reduction in a relative expression of a cytokine, a chemokine, a cell adhesion molecule (CAM), or any combinations thereof, optionally wherein the relative expression is measured by qRT- PCR.

[0076] In some aspects, the cytokine is an interleukin (IL), a tumor necrosis factor (TNF), an interferon (IFN), a transforming growth factor (TGF), or any combination thereof.

[0077] In some aspects, the CAM is an IgSF, a cadherin, a selectin, an integrin, or any combination thereof.

[0078] In some aspects, the chemokine is a CXC chemokine, a CX3C chemokine, a CC chemokine, or any combination thereof.

[0079] In some aspects, after administration, the subject has a 0.1-6 fold reduction in a relative expression of an oxidative stress gene marker selected from the group consisting of Nox2, Nox4, iNos, or any combination thereof and / or wherein the subject has a 0.1-6 fold increase in a relative expression of an antioxidant gene marker selected from the group consisting of Gsr, Gpxl, Cat, Sodl, or any combination thereof, optionally wherein the relative expression is measured by qRT-PCR.

[0080] In some aspects, after administration, the subject has a 0.1-6 fold reduction in a relative expression of a fibrosis gene marker selected from the group consisting of Tgflb, Collal, Col3al, Col4al, Ctgf, Fn, aSMA, Col5al, Col6al, vimentin, E-cadherin, PIIINP, TGFb, MCP-1, hepcidin, LFABP, RBP, VCAM-1, CTGF, PAI-1, MMP-2, TIMP-1, MBL, SGK-1, CD30, or any combination thereof, optionally, wherein the relative expression is measured by qRT-PCR.

[0081] In some aspects, after administration, the subject has a 0.1-6 fold reduction in a kidney injury gene marker selected from the group consisting of Kimi, Lnc2, or anycombination thereof, optionally, wherein the relative expression is measured by qRT- PCR.

[0082] Certain aspects are directed method for treatment or prevention of a Metabolic dysfunction-associated steatotic liver disease (MASLD), e.g., metabolic dysfunction- associated steatohepatitis (MASH), in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter.

[0083] In some aspects, the subject is Human Immunodeficiency Virus (HIV) positive. In some aspects, the subject is being treated or has been treated with an antiretroviral therapy (ART). In some aspects, the MASLD (e.g., MASH) is associated with HIV infection and / or ART toxicity. In some aspects, the ART is a nucleoside reverse transcriptase inhibitor (NRTI), a nucleotide reverse transcriptase inhibitor (NtRTI), a nonnucleoside reverse transcriptase inhibitor (NNRTI), a protease inhibitor (PI), an integrase inhibitor (INSTI), a fusion inhibitor (FI), a chemokine receptor antagonist (e.g., a CCR5 antagonist), an entry inhibitor (e.g., a CD4-directed post-attachment inhibitor), or any combination thereof.

[0084] In some aspects, the subject further suffers from viral hepatitis, preferably chronic viral hepatitis.

[0085] In some aspects, the rAAV vector is administered in a total dose of about 1 x 1011vg / kg to about 1 x 1015vg / kg (e.g., a total dose of about 1 x 1012vg / kg to about 1 x 1014vg / kg, about 3 x 1012vg / kg to about 3 x 1013vg / kg, about 1 x 1012vg / kg to about 1 x 1013vg / kg, about 1 x 1012vg / kg to about 1 x 1014vg / kg, or about 3 x 1012vg / kg to about 4 x 1012vg / kg).

[0086] In some aspects, the rAAV vector is administered in a total dose of about 1 x 1013vg to about 1 x 1017vg (e.g., a total dose of about 9.6 x 1013vg, about 3.0 x 1014vg, about 5.6 x 1014vg, about 9.6 x 1014vg, or about 2.0 x 1015vg).DESCRIPTION OF FIGURES

[0087] FIGs. 1A-1K show results of AAV1-FGF21 intramuscular administration in 21 month old healthy male mice compared to sham treated 21 month old healthy male mice and untreated 7 month old male mice. FIG. 1A provides kidney weight at 7, 21, or 26 months of age (n=5 / group). In kidney samples from 7, 21, or 26-months-old mice (n=5- 8 / group), quantification by qRT-PCR of the expression of key genes was performed. FIG. IB and FIG. 1C provide expression levels of kidney damage gene markers: Kidney Injury Molecule 1 (Kimi) (FIG. IB) and Lipocalin 2 (Lnc2) (FIG. 1C). FIG. 1D-1G provide expression levels of inflammatory gene markers: F4 / 80 (FIG. ID), Monocyte chemotactic protein 1 (Mcpl) (FIG. IE), Tumor necrotic factor alpha (Tnfla) (FIG. IF), and Transforming growth factor beta-1 (Tgfb) (FIG. 1G). FIG. 1H- IK provide expression levels of fibrosis markers: fibronectin (Fn) (FIG. 1H), Collagen type I alpha (Collal) (FIG. II), Collagen type III alpha (Col3al) (FIG. 1 J), and Collagen type IV alpha (Col4al) (FIG. IK). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***p<0 001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. FC, Fold change.

[0088] FIGs. 2A-2I show effects on kidney disease of AAV1-FGF21 intramuscular administration in HFD-fed female mice. FIG. 2A provides kidney weight at 50 weeks of age (n=6-9 / group). In kidney samples from 50-week-old mice (n=6-9 / group), quantification by qRT-PCR of the expression of key genes was performed. FIGs. 2B-2C provide expression levels of kidney damage gene markers: Kidney Injury Molecule 1 (Kimi) (FIG. 2B) and Lipocalin 2 (Lnc2) (FIG. 2C). FIGs. 2D-2F provide expression levels of inflammatory gene markers: F4 / 80 (FIG. 2D), Monocyte chemotactic protein 1 (Mcpl) (FIG. 2E) and Tumor necrotic factor alpha (Tnfla) (FIG. 2F). FIGs. 2G-2I provide expression levels of fibrosis gene markers: Collagen type I alpha (Collal) (FIG. 2G), Collagen type III alpha (Col3al) (FIG. 2H) and Fibronectin (Fn) (FIG. 21). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. FC, Fold change.

[0089] FIGs. 3A-3F show effects on kidney disease of AAV1-FGF21 intramuscular administration in HFD-fed male mice. FIG. 3A provides kidney weight at 50 weeks of age (n=9-10 / group). In kidney samples from 50-week-old mice (n=7-8 / group), quantification by qRT-PCR of the expression of key genes was performed. FIGs. 3B-3Cprovide expression level of inflammatory gene markers: Monocyte chemotactic protein 1 (Mcpl) (FIG. 3B) and Tumor necrotic factor alpha (Tnfla) (FIG. 3C). FIGs. 3D-3F provide expression levels of fibrosis gene markers: Collagen type I alpha (Collal) (FIG. 3D), Collagen type III alpha (Col3al) (FIG. 3E) and Fibronectin (Fn) (FIG. 3F). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 by Student's two-tailed t test. FC, Fold change.

[0090] FIGs. 4A-4K show the effects of intramuscular administration of AAV1-FGF21 in kidney inflammation and fibrosis of db / db male mice. FIGs. 4A-4B provide expression levels of kidney damage gene markers: Kidney Injury Molecule 1 (Kimi) (FIG. 4A) and Lipocalin 2 (Lnc2) (FIG. 4B). FIGs. 4C-4E provide expression levels of inflammatory gene markers: F4 / 80 (FIG. 4C), Mcpl (FIG. 4D) and Tnfla (FIG. 4E). FIGs. 4F-4K provide expression levels of fibrosis gene markers: Transforming growth factor betal (Tgflb) (FIG. 4F), Collagen type I alpha (Collal) (FIG. 4G), Collagen type III alpha (Col3al) (FIG. 4H), Collagen type IV alpha (Col4al) (FIG. 41), Fibronectin (Fn) (FIG. 4 J) and Connective tissue growth Factor (Ctgf) (FIG. 4K). Data are presented as mean ± SEM. *P<0.05, ***P<0.001 by Student's two-tailed t test. FC, Fold change.

[0091] FIGS. 5A-5G show the effects of intramuscular administration of AAV1-FGF21 in kidney oxidative stress of db / db male mice. FIGs. 5A-5C provide expression levels of oxidative stress gene markers: NADPH oxidase 2 (Nox2) (FIG. 5A), NADPH Oxidase 4 (Nox4) (FIG. 5B) and inducible nitric oxide synthase (iNos) (FIG. 5C). FIGs. 5D-5G provide expression levels of antioxidant gene markers: Glutathione-Disulfide Reductase (Gsr) (FIG. 5D), Glutathione Peroxidase 1 (Gpxl) (FIG. 5E), Catalase (Cat) (FIG. 5F) and Superoxide Dismutase 1 (Sodl) (FIG. 5G). Data are presented as mean ± SEM. *P<0.05, **P<0.01, by Student's two-tailed t test. FC, Fold change.

[0092] FIGS. 6A-6J show HFD induces liver steatosis, inflammation, and fibrosis. Eight- week-old male mice were fed a HFD for 12, 18 or 29 weeks. FIGS. 6A-6B provide body (FIG. 6A) and liver weight (FIG. 6B) after 12 or 29 weeks on HFD (w=8-l 1 / group). FIGS. 6C-6D provide liver triglyceride (FIG. 6C) and cholesterol content (FIG. 6D) in 20-week-old male mice fed a chow or HFD for 12 weeks («=8-l 1 / group). FIG. 6E provides representative images of liver sections from mice fed a chow diet for 12 weeks of a HFD for 12, 18 or 29 weeks stained with hematoxylin-eosin (upper panel; scale bars, 100 pm), immunostained against the macrophage cell marker MAC2 (middle panel; scale bars, 100 pm) or stained with PicroSirius Red (lower panel; scale bars, 50 pm). Arrowsindicate MAC2+cells. FIGS. 6F-6J provide hepatic expression levels of the inflammatory markers Cd68 (FIG. 6F) and F4 / 80 (FIG. 6G), the fibrosis markers Col lai (FIG. 6H) and Col3al (FIG. 61) and of the marker of activation of hepatic stellate cells a-Sma (FIG. 6J) (w=7 / group). Data are presented as mean ± SEM. * <0.05, *** <0.001 by one-way analysis of variance (ANOVA) with Dunnett' s multiple comparison test (FIGS. 6A, 6B, 6F-6J) or Student's two-tailed t test (FIGS. 6C, 6D). w, weeks.

[0093] FIGS. 7A-7L show AAV-mediated skeletal muscle gene transfer of FGF21 reverses hepatic steatosis. Eight-week-old male mice were fed a HFD. Twenty weeks later, mice were treated intramuscularly with AAV-FGF21 vectors and remained in HFD feeding for all experimental period. Non-injected chow and HFD-fed mice were used as controls. FIGS. 7A-7H provide body weight follow-up ( / / =9- l 0 / group) (FIG. 7A), body weight gain in HFD-fed groups from week 28 to 70 of age ( / / =4- l 0 / group) (FIG. 7B), serum FGF21 levels at different time points (w=5-l 1 / group) (FIG. 7C), quantitative PCR analysis of murine optimized Fgf21 (moFgf21 expression in the three injected skeletal muscles and in the liver in 70-week-old male mice (w=5-7 / group) (FIG. 7D), hepatic expression of Klb ( =5-l 0 / group) (FIG. 7E), representative macroscopic images of the liver from control HFD-fed (left) and AAV-FGF21-treated (right) male mice at 50 weeks of age (FIG. 7F), representative images of hematoxylin-eosin staining of liver sections at 50 and 70 weeks of age (FIG. 7G), (scale bars, 100 pm), and liver weight at different time points (w=5-l 1 / group) (FIG. 7H). FIGS. 71 and 7J provide liver triglyceride (FIG. 71) and cholesterol (FIG. 7 J) content ( / / =5- l l / group). FIGS. 7K and 7L provide serum ALT (FIG. 7K) and AST levels (FIG. 7L) (n=5-9 / group). Data are presented as mean ± SEM; ** <0.01, *** <0.001 by one-way analysis of variance (ANOVA) with Bonferroni multiple comparison test. AU, arbitrary units. ND, non-detected. FC, Fold change, w, weeks. 1, death due to natural causes.

[0094] FIGS. 8A-8G show treatment with AAV-FGF21 vectors reverts hepatic inflammation. FIG. 8A provides representative images of liver sections immunostained against the macrophage marker MAC2. Red arrows indicate MAC2+cells. Scale bars, 100 pm. FIGS. 8B-8G provide expression levels of the hepatic inflammatory markers Cd68 (FIG. 8B), F4 / 80 (FIG. 8C), Ccl2 (FIG. 8D), Ccl3 (FIG. 8E), Ccl5 (FIG. 8F) and Tnfa (FIG. 8G) («=5-l 0 / group). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 by one-way analysis of variance (ANOVA) with Bonferroni multiple comparison test. FC, Fold change, w, weeks.

[0095] FIGS. 9A-9P show muscle-derived FGF21 counteracts hepatic fibrosis and halts development of liver tumors. FIG. 9A provides representative images of PicroSirius Red (PSR) staining of liver sections showing liver fibrosis in red. Scale bars, 50 pm. FIG. 9B provides histomorphometric quantitative assessment of liver fibrosis (PSR) (w=2- 4 / group). FIGS. 9C-9D provide expression levels of the liver fibrosis markers Collal (FIG. 9C) and Col3al (FIG. 9D) (w=5-l 0 / group). FIGS. 9E-9G provide expression levels of the genes involved in extracellular matrix deposition Mmpl2 (FIG. 9E), Mmpl3 (FIG. 9F) and Timpl (FIG. 9G) (w=5-l 0 / group). FIGS. 9H-9K provide expression levels of the marker of activated hepatic stellate cells (HSCs) a-Sma (FIG. 9H) and key cytokines involved in HSCs activation Tfgb (FIG. 91), Pdgfa (FIG. 9J) and Pdgfb (FIG. 9K) (w=5-l 0 / group). FIG. 9L-9P provide expression levels of the hepato-cellular carcinoma markers AJp (FIG. 9L), Ly6d (FIG. 9M), Krtl9 (FIG. 9N), Gohnl (FIG. 90) and Cd44 (FIG. 9P), in non-tumoral liver parenchyma ( / / =5- l 0 / group). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 by one-way analysis of variance (ANOVA) with Bonferroni multiple comparison test. FC, Fold change, w, weeks.

[0096] FIGS. 10A-10G show AAV-FGF21 gene therapy reverses obesity and NASH in HFD-fed female mice. Eight-week-old female mice were fed a HFD. At 20 weeks of age, they were administered intramuscularly with AAV-FGF21 vectors. Mice remained in HFD feeding up to 50 weeks of age. FIGS. 10A-10E provide body weight follow-up ( / / = l 0 / group) (FIG. 10A), serum levels of FGF21 ( / / =6- l 0 / group) (FIG. 10B), quantitative PCR analysis of moFgf21 expression in the three skeletal muscles injected and in the liver (w=4-5 / group) (FIG. 10C), liver weight at 50 weeks of age (w=6-8 / group) (FIG. 10D), and representative images of liver sections stained with hematoxylin-eosin and PicroSirius Red and immunostained against MAC2 (FIG. 10E), scale bars: 100, 50 and 100 pm, respectively). Arrows indicate MAC2+cells. FIGS. 10F and 10G provide hepatic expression of the inflammatory marker F4 / 80 (FIG. 10F) and fibrosis marker Collal (FIG. 10G) in 50-week-old mice (w=6-8 / group). Data are presented as mean ± SEM. * <0.05, ** <0.01, *** <0.001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. ND, non-detected. FC, Fold change. AU, arbitrary units.

[0097] FIGS. 11A-11M show AAV-FGF21 gene therapy reverses NASH in ob / ob mice. Nine-week-old male and female ob / ob mice were administered intramuscularly withAAV-FGF21 vectors and followed-up to 41 weeks of age. FIG. 11A shows body weight follow-up in male ob / ob mice (w=6 / group). FIG. 11B shows serum levels of FGF21 in male ob / ob mice (w=6 / group). FIG. 11C shows liver weight of male ob / ob mice at sacrifice (w=6 / group). FIGs. 11D-11E show liver triglyceride (FIG. 11D) and cholesterol (FIG. HE) content in male ob / ob mice (w=6 / group). FIG. HF shows body weight follow-up in female ob / ob mice (w=5 / group). FIG. 11G shows serum levels of FGF21 in female ob / ob mice ( / / =2-4 / group). FIG. 11H shows liver weight of female ob / ob mice at sacrifice (w=2-5 / group). FIGs. 11I-11J shows liver triglyceride (FIG. HI) and cholesterol (FIG. 11 J) content in female ob / ob mice ( / / =2-5 / group). FIG. HK shows representative images of liver sections of male and female ob / ob mice stained with hematoxylin-eosin and PicroSirius Red. Scale bars: 100 and 50 pm, respectively. FIGs. 11L-11M show hepatic expression of the inflammatory markers F4 / 80 and Cd68 and the fibrosis marker Collal in male (FIG. 11L) and female (FIG. 11M) ob / ob mice (n=2- 6 / group). Data are presented as mean ± SEM. *P<0.05, **P<0.01, *** <0.001 by Student's two-tailed t test. FC, Fold change.

[0098] FIGs. 12A-12J show treatment with AAV-FGF21 reverts adiposity in HFD-fed male mice. Eight-week-old male mice were fed a chow or a HFD for 12 weeks. FIG. 12A shows representative images of eWAT sections immunostained against MAC2 (upper panel) and iWAT and iBAT sections stained of with hematoxylin-eosin (middle and lower panels) of 8-week-old male mice were fed a chow or a HFD for 12 weeks. Red arrows indicate crown-like structures. Scale bars, 100 pm (eWAT, iWAT) and 50 pm (iBAT). FIGs. 12B-12D show weight of eWAT (FIG. 12B), iWAT (FIG. 12C) and iBAT (FIG. 12D) depots of 8-week-old male mice were fed a chow or a HFD for 12 weeks. (w=8-l 1 / group). FIG. 12E-12F show expression levels of the inflammatory markers Cd68 (FIG. 12E) and F4 / 80 (FIG. 12F) in eWAT in the same cohorts of mice as in (a) (w=7 / group). FIG. 12G show serum leptin levels (w=8-9 / group) in the same cohorts of mice as in (FIG. 12A). FIGs. 12H-12I show weight of mW AT (FIG. 12H) and rWAT (FIG. 121) depots of AAV-treated HFD-fed male mice (w=8-10 / group). FIG. 12J shows representative images of the hematoxylin-eosin staining of iWAT sections of the same mice as in (FIGs. 12H-12I) Scale bars, 100 pm. Data are presented as mean ± SEM. * <0.05, **P<0.01, *** <0.001 by Student's two-tailed t test (b-g) or by one-way analysis of variance (ANOVA) with Bonferroni (FIGs. 12H-12I). FC, Fold change.

[0099] FIGs. 13A-13I show reversal of WAT hypertrophy and inflammation by AAV1- FGF21 treatment. FIG. 13A shows immunohistochemical analysis of MAC2 in eWAT sections. Red arrows indicate crown-like structures. Scale bars, 100 pm. FIG. 13B shows morphometric analysis of the mean adipocyte area in eWAT (w=4 / group). FIGs 13C-13D show weight of eWAT (FIG. 13C) and iWAT (FIG. 13D) depots ( / / =5- l 0 / group). FIGs. 13E-13F show serum leptin (FIG. 13E) and adiponectin (FIG. 13F) levels (n=5- 10 / group). FIGS. 13G-13I Expression levels of the inflammatory markers Cd68 (FIG. 13G), F4 / 80 (FIG. 13H) and Tnfa (FIG. 131) in eWAT (w=5-10 / group). Data are presented as mean ± SEM; *P<0.05, **P<0.01, *** <0.001 by one-way analysis of variance (ANOVA) with Bonferroni multiple comparison test. FC, Fold change, w, weeks.

[0100] FIGs. 14A-14O show AAV1-FGF21 treatment reverses adiposity and enhances energy expenditure in HFD-fed female mice. FIG. 14A shows weight of the peri-ovarian WAT (poWAT), parametrial (pmWAT), retroperitoneal (rWAT), mesenteric (mW AT) and inguinal white adipose tissue (iWAT) depots obtained from AAV-FGF21 -treated female mice at 50 weeks of age (w=6-9 / group). FIG. 14B shows representative images of pmWAT sections immunostained against MAC2 and iWAT sections stained with hematoxylin-eosin. Scale bars, 100 pm. FIG. 14C-14D show expression levels of the inflammatory markers Cd68 (FIG. 14C) and FF (FIG. 14D) in pmWAT (n=6- 9 / group). FIG. 14E shows food intake of AAV-FGF21 -treated female mice fed a HFD (n=2 cages / group). FIG. 14F shows energy expenditure of female mice was measured 10 weeks after AAV administration with an indirect open circuit calorimeter (w=3-5 / group). FIG. 14G shows iBAT weight of HFD-fed female mice (w=6-9 / group). FIG. 14H shows expression of the thermogenic marker Ucpl in iBAT (w=6-9 / group). FIG. 141 shows representative images of iBAT sections stained with hematoxylin-eosin from AAV- FGF21-treated female mice at 50 weeks of age. Scale bars: 100 pm. FIGs. 14J-14O shows assessment of the locomotor activity of female mice in the open-field test (n=6- 9 / group) for distance traveled (cm) (FIG. 14J), moving time (%) (FIG. 14K), maximum velocity (cm / sec) (FIG. 14L), resting time (%) (FIG. 14M), fast time (%) (FIG. 14N), and slow time (%) (FIG. 140). Data are presented as mean ± SEM. *F<0.05, **F<0.01, ***F<0.001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. FC, Fold change.

[0101] FIGs. 15A-15P show AAV1-FGF21 treatment increases energy expenditure.FIG. 15A shows food intake of male mice fed a HFD and treated with AAV1-FGF21 (w=2-3 cages / group). FIG. 15B shows energy expenditure was measured with an indirect open circuit calorimeter at different time points, during light and dark cycles (n=6- 10 / group). FIG. 15C shows iBAT weight of AAV-FGF21 -treated male mice at different ages (w=5-10 / group). FIG. 15D shows representative images of hematoxylin-eosin staining of iBAT sections. Scale bars, 100 pm. FIGs. 15E-15G show quantification of the expression of the non-shivering thermogenesis markers Ucpl (FIG. 15E), Cidea (FIG. 15F) and E / ov / J (FIG. 15G) in iBAT at 70 weeks of age (w=5-10 / group). FIG. 15H shows representative tracks during the open field test of male mice at 8 and 70 weeks of age. FIGs. 15I-15P shows assessment of locomotor activity (FIGs. 15I-15N) and anxiety parameters (FIGs. 15O-15P) through the open-field test ( / / =5- l 5 / group) for distance traveled (cm) (FIG. 151), moving time (%) (FIG. 15J), maximum velocity (cm / sec) (FIG. 15K), resting time (%) (FIG. 15L), fast time (%) (FIG. 15M), slow time (%) (FIG. 15N), time in center (sec) (FIG. 150), and first entry to center (sec) (FIG. 15P). Data are presented as mean ± SEM. * <0.05, ** <0.01, *** <0.001 by one-way analysis of variance (ANOVA) with Tukey's (FIGs. 15A, 15E-15G and 15I-15P) or Bonferroni (FIGs. 15B-15C) multiple comparison test. FC, Fold change, w, weeks.

[0102] FIGs. 16A-16I show effects of AAV-FGF21 treatment in muscle integrity and insulin sensitivity in HFD-fed mice. FIG. 16A shows weight of skeletal muscles of 70- week-old male mice (w=5-10 / group). FIG. 16B shows representative images of quadriceps sections stained with hematoxylin-eosin from 70-week-old AAV-FGF21- treated animals. Scale bars, 50 pm. FIG. 16C shows weight of skeletal muscles of 50- week-old female mice ( / / =6-9 / group). FIG. 16D shows representative images of hematoxylin-eosin staining of quadriceps sections of 50-week-old female mice. Scale bars, 50 pm. FIG. 16E-16F shows fasted insulin (FIG. 16E) and glucose (FIG. 16F) levels in male mice fed a chow or HFD for 12 weeks (w=8 / group). FIGs. 16G-16H show serum insulin (FIG. 16G) and glucose (FIG. 16H) levels in HFD-fed female mice, in fed and fasted conditions, at 53 and 36 weeks of age, respectively (w=5-9 / group). FIG. 161 shows insulin tolerance test was performed in female mice 14 weeks post- AAV administration (0.75 units insulin / kg BW). Results were calculated as percentage of initial blood glucose levels (w=9-10 / group). Data are presented as mean ± SEM. * <0.05, ** <0.01, *** <0.001 by one-way analysis of variance (ANOVA) with Tukey's multiplecomparison test (FIGs. 16A, 16C, 16G, 16H) or by Student's two-tailed t test (FIGs. 16E-16F). In FIG. 161, # <0.05, ##P<Q.Q1 versus chow-fed control group and $P<0.05, $$$P<0.001 versus HFD-fed control group by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test.

[0103] FIGs. 17A-17J show AAV1-FGF21 improves insulin sensitivity. FIG. 17A shows fed and fasted serum insulin in male mice at 70 and 38 weeks of age, respectively (w=5-9 / group). FIG. 17B shows fed and fasted blood glucose in male mice at 48 and 38 weeks of age, respectively (w=8-10 / group). FIG. 17C shows insulin sensitivity was determined after an intraperitoneal insulin injection (0.75 units / kg) at 59 weeks of age in male mice. Results were calculated as percentage of initial blood glucose levels (n=9- 10 / group). FIG. 17D shows representative images of insulin immunostaining in pancreas sections from AAV-FGF21 -treated male mice. Scale bars, 500 pm. Inset scale bars, 100 pm. FIG. 17E shows quantification of [3-cell mass in male mice at 70 weeks of age (w=5 / group). FIG. 17F shows fasted glucagon levels in male mice, 12 weeks post-AAV administration (w=9-10 / group). FIG. 17G shows forelimb grip strength in female mice (w=6-9 / group). FIG. 17H shows time before falling during the rotarod test performed in female mice (w=6-9 / group). FIGs. 17I-17J shows discrimination index (FIG. 171) and exploration time (FIG. 17J) during novel object recognition (NOR) test performed in female mice (w=6 / group). Data are presented as mean ± SEM. *P<0.05, **P<0.01, *** <0.001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test (FIGs. 17A-17B, 17E, 17G-17I) or Student's two-tailed t test (FIGs. 17F, 17 J). In FIG. 17C, # <0.05, ## <0.01, ###P<Q.QQ1 versus chow-fed control group and $$P<0.01, $$$P<0.001 versus HFD-fed control group by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. BW, body weight. N, newtons.

[0104] FIGs. 18A-18M show AAV1-FGF21 biodistribution and biological activity in dogs. Healthy Beagle dogs (Dog-1 and Dog-2) were treated with 7xl012vg / kg of AAV1- canine optimized FGF21 and followed up for four months. FIG. 18A shows vector genome copy number (left panel, blue) and canine optimize FGF21 (coFGF21) expression (right panel, orange) were analyzed in tissue punches from multiple regions of the skeletal muscle and the liver obtained during necropsy of dogs. FIG. 18B shows schematic representation indicating the mean coFGF21 expression in hindlimb skeletal muscles. Image courtesy of IMAIOS © "Micheau A, Hoa D, e- Anatomy,www.imaios.com, DOI: 10.37019 / e-anatomy". FIG. 18C shows levels of biologically active FGF21 in fasted conditions measured using a cell-based reporter gene assay (iLite®). FIG. 18D shows hepatic expression levels of KLB (w=2-3 / group). FIG. 18E shows serum triglyceride levels pre-AAV and 4 months post-AAV. FIG. 18F-18G shows hepatic expression levels of ACADM (FIG. 18F) and ACADL (FIG. 18G) ( / / =2-3 / group). FIG. 18H shows serum adiponectin levels pre-AAV and 4 months post-AAV (n=2- 3 / group). FIGs. 18I-18L show quantification oiADIPOQ (FIG. 181), UCP1 (FIG. 18J), EL0VL3 (FIG. 18K) and PPARGC1A (FIG. 18L) expression in perirenal (prWAT) and gluteal WAT (gWAT) (w=2-3 / group). FIG. 18M shows representative images of the hematoxylin-eosin staining of prWAT sections. Insets show multilocular adipocytes in prWAT of AAV-FGF21 -treated dogs. Scale bars, 100 pm. Inset scale bars, 25pm. Data are presented as mean ± SEM. * <0.05, ** <0.01, *** <0.001 by Student's two-tailed t test. coFGF21, canine optimized FGF21. ND, non-detected. vg / dg, vector genomes / diploid genome. AU, arbitrary units. FC, Fold change. G, Gluteus. T, Tensor. Q, Quadriceps. V, Vastus. LLL, left lateral lobe. LML, left medial lobe. RML, right medial lobe.

[0105] FIGs. 19A-19F show safety and biological activity of AAV1-FGF21 treatment in dogs. FIGs. 19A-19B show expression levels of CPT2 in the liver (FIG. 19A), and perirenal (prWAT) and gluteal WAT (gWAT) (FIG. 19B) (w=2-3 / group). FIGs. 19C- 19D show expression levels of(FIG. 19C) and ACADL (FIG. 19D) in prWAT and gWAT (w=2-3 / group). FIG. 19E-19F show representative images of the hematoxylin-eosin staining (FIG. 19E) and immunostaining against laminin (FIG. 19F) of biceps femoris sections from Dog-2. Scale bars, 100 pm. Data are presented as mean ± SEM. * <0.05 by Student's two-tailed t test. FC, Fold change.

[0106] FIGs. 20A-20B show FGF21 circulating levels in human patients. FIGs. 20A- 20B show serum FGF21 levels were measured in a cohort of 46 lean and 12 overweight individuals and in a cohort of approximately 500 highly obese and insulin resistant patients, grouped by body mass index (BMI) (FIG. 20A) and in a cohort of 20 biopsy- proven MASH patients and grouped by fibrosis stage (FIG. 20B). Grey bar indicates FGF21 circulating levels corresponding to 90% of healthy individuals (0-0.26 ng / ml). The 2-fold limit of the normal range displayed by lean individuals (0.53 ng / ml) is indicated with the dashed line, / / , number of individuals.

[0107] FIGs. 21A-21C show in vitro comparative analysis of AAV1 vectors encoding human, canine and murine optimized FGF21. 2v6.11 cells were infected with AAV1 vectors encoding murine, canine, or human optimized FGF21 under the control of the CMV promoter (AAVl-moFGF21, AAVl-coFGF21 and AAVl-hsoFGF21, respectively) at MOIs of 500, 1000, and 2000 vg / cell. Forty-eight hours post-infection, FGF21 mRNA expression, FGF21 protein concentration and FGF21 activity in cell media were evaluated. FIG. 21 A shows quantification of FGF21 mRNA expression levels. The levels of murine, canine, or human optimized FGF21 mediated by all vectors were similar and proportional to the vector dose. A primer-probe mix targeting the SV40 polyA signal, sequence common to all three FGF21 mRNAs, was used. FIG. 21B shows Human FGF21 concentration in cell media was measured using the Human FGF21 ELISA Kit (R&D Systems). Canine and mouse FGF21 in cell media were measured using the same ELISA kit to check if they cross-react with the human FGF21 antibody of the kit. The kit was unable to detect canine FGF21 secreted in the media. The levels of mouse FGF21 in the medium detected with the hFGF21 ELISA kit were similar to those of human FGF21, suggesting that human antibodies in the Kit are equally effective at detecting mice FGF21 as they are for human FGF21. FIG. 21C shows the biological activity of human FGF21 produced and secreted into cell media by the infected cells was measured using the cellbased reporter gene assay iLite FGF21 Assay Ready Cells (Svar Life Science). Canine and mouse FGF21 activity in cell media were measured using the same assay to assess a possible cross-reactivity with the human receptor chain FGFRlc and the human FGF21 co-receptor P-Klotho used in the assay. The levels of canine FGF21 activity detected in cell media were similar to those of human FGF21. However, the iLite FGF21 Ready Cells assay could barely detect murine FGF21 activity at the highest MOI. Data are presented as mean ± SEM. NI, non-infected. AU, arbitrary units. ND, non-detected. MOI, multiplicity of infection.

[0108] FIGs. 22A-22B show muscle-derived FGF21 counteracts glomerulus expansion. A dose of 3xl0nvg / mouse of AAV1-FGF21 was administered into skeletal muscle of thirteen-months-old C57BL / 6J male mice, which were followed for up to 21- or 26- months of age. Two littermate-control groups were administered the same dose of AAV1- null intramuscularly at thirteen months of age and followed up to 21- or 26-months. Another cohort of 7-months-old mice were used as young controls. FIG. 22A shows glomerulus area (n=4-5 / group). FIG. 22B shows representative images of Picrosirius Redstaining of kidney sections showing kidney fibrosis in red. Data are presented as mean ± SEM. *P<0.05, **P<0.01 by one-way analysis of variance (ANOVA) with Dunnet’s multiple comparison test.

[0109] FIGs. 23A-23B show muscle-derived FGF21 counteracts kidney fibrosis and glomerulus hypertrophy in db / db mice. Nine-week-old db / db male mice were administered intramuscularly with a dose of 3x1011 viral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFgf21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs, and followed-up to 35 weeks of age. Non-injected db / db littermate mice were used as controls. FIG. 23A shows representative images of Picrosirius Red staining of kidney sections showing kidney fibrosis in red. FIG. 23B shows glomerulus area (n=4-6 / group). Data are presented as mean ± SEM. ***P<0.001 by Student’ s two-tailed t test.

[0110] FIG. 24 is a schematic depicting AAV1 -mediated skeletal muscle gene transfer of FGF21 in 3xTg-AD female mice.

[0111] FIGs. 25A-25B show the effects of intramuscular administration of AAV1- FGF21 in the expression of kidney damage markers (Kimi and Lnc2) in 3xTg-AD female mice. FIG. 25A shows quantification by qRT-PCR of the expression in the kidney of 17- month-old mice (n=12-15 / group) of Kimi, and FIG. 25B shows quantification by qRT- PCR of the expression in the kidney of 17-month-old mice (n=12-15 / group) of Lnc2. Data are presented as mean ± SEM. Student’s two-tailed t test. FC, Fold change.

[0112] FIGs. 26A-D show the effects of intramuscular administration of AAV1-FGF21 in the expression of kidney inflammation markers (F4 / 80, Tnfa, Mcpl, and Tgfb) in 3xTg-AD female mice. FIG. 26A shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12-15 / group) of F4 / 80. FIG. 26B shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12- 15 / group) of Tnfa. FIG. 26C shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12-15 / group) of Mcpl. FIG. 26D shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12-15 / group) of Tgfb. Data are presented as mean ± SEM. Student’s two-tailed t test. FC, Fold change.

[0113] FIGs. 27A-27D show the effects of intramuscular administration of AAV1- FGF21 in the expression of kidney fibrosis markers (Collal, Col3al, Fn, and Col4al) in 3xTg-AD female mice. FIG. 27A shows quantification by qRT-PCR of the expression inthe kidney of 17-month-old mice (n=12-15 / group) of Collal. FIG. 27B shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12- 15 / group) of Col3al. FIG. 27C shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12-15 / group) of Fn. FIG. 27D shows quantification by qRT-PCR of the expression in the kidney of 17-month-old mice (n=12-15 / group) of Col4al. Data are presented as mean ± SEM. Student’s two-tailed t test. FC, Fold change.

[0114] FIGs. 28A-B show muscle-derived FGF21 reduced kidney glomerulus hypertrophy in 3xTg female mice. FIG. 28A shows representative images of hematoxylin / eosin staining of kidney sections, and FIG. 28B shows glomerulus area (n=6-8 / group). Data are presented as mean ± SEM. **P<0.01 by Student’s two-tailed t test.DETAILED DESCRIPTION

[0115] Certain aspects of the disclosure are directed to a method for treating or reducing kidney inflammation and / or kidney oxidative stress in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or functional fragment thereof operably linked to promoter (e.g., a ubiquitous promoter).

[0116] Certain aspects of the disclosure are directed to a method for treating, preventing or reducing the likelihood of kidney fibrosis in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter).

[0117] Certain aspects of the disclosure are directed to a method for treating, preventing, or reducing the likelihood of acute kidney injury (AKI) in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associatedvirus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter).

[0118] Certain aspects of the disclosure are directed to a method for treatment or prevention of kidney disease in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter), wherein the kidney disease is selected from the group consisting of age-related kidney disease, uremia, acute renal insufficiency, chronic pyelonephritis, acute pyelonephritis, chronic glomerulonephritis, acute progressive nephritis syndrome, nephrotic syndrome, nephrosclerosis, interstitial nephritis, focal glomerulosclerosis, membranous nephropathy, multiple purulent renal syndrome, renal vascular hypertension, hypertensive kidney disease, secondary nephropathy, hyperphosphatemia, hyperkalemia, hyperuricemia, hypernatremia, chronic myeloid leukemia (CML) lupus nephritis, or kidney disease secondary to Alzheimer’s disease

[0119] Certain aspects of the disclosure are directed method for treatment or prevention of a Metabolic dysfunction-associated steatotic liver disease (MASLD) e.g., metabolic dysfunction-associated steatohepatitis (MASH), in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter.

[0120] In some aspects, the subject suffers from chronic kidney disease (CKD).

[0121] In some aspects, the subject suffers from CKD-related fibrosis.

[0122] In some aspects, the kidney inflammation, the kidney oxidative stress, the kidney fibrosis, the AKI, and / or the CKD is not associated with diabetes.

[0123] In some aspects, the subject does not suffer from diabetes.

[0124] In some aspects, the subject suffers from a Human Immunodeficiency Virus(HIV) infection. In some aspects, the subject suffers from chronic inflammation derived from the HIV infection. In some aspects, the subject is being treated or has been treated with an antiretroviral therapy (ART). In some aspects, the MASLD (e.g., MASH) is associated with HIV infection and / or ART toxicity.I. Definitions

[0125] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In case of conflict, the present application including the definitions will control. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. All publications, patents and other references mentioned herein are incorporated by reference in their entireties for all purposes as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

[0126] Although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods and examples are illustrative only and are not intended to be limiting. Other features and advantages of the disclosure will be apparent from the detailed description and from the claims.

[0127] In order to further define this disclosure, the following terms and definitions are provided.

[0128] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more," and "at least one" can be used interchangeably herein. In certain aspects, the term "a" or "an" means "single." In other aspects, the term "a" or "an" includes "two or more" or "multiple."

[0129] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical valuesset forth. In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 10 percent, up or down (higher or lower).

[0130] The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21- nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range. "At least" is also not limited to integers (e.g., "at least 5%" includes 5.0%, 5.1%, 5.18% without consideration of the number of significant figures).

[0131] Throughout this disclosure, various aspects are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Numeric ranges recited are inclusive of the numbers defining the range and include each integer within the defined range.

[0132] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the disclosure. Thus, ranges recited herein are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints. For example, a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0133] Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of a disclosure is disclosed as having a plurality of alternatives, examples of that disclosure in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of a disclosure can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.

[0134] The term "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0135] It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of and / or "consisting essentially of' are also provided.

[0136] The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions, formulations, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0137] The term "excipient" refers to any substance, not itself a therapeutic agent, which may be used in a composition for delivery of an active therapeutic agent to a subject or combined with an active therapeutic agent (e.g., to create a pharmaceutical composition) to improve its handling or storage properties or to permit or facilitate formation of a dose unit of the composition. Excipients include, but are not limited to, solvents, penetration enhancers, wetting agents, antioxidants, lubricants, emollients, substances added to improve appearance or texture of the composition and substances used to form hydrogels. Any such excipients can be used in any dosage forms according to the present disclosure.The foregoing classes of excipients are not meant to be exhaustive but merely illustrative as a person of ordinary skill in the art would recognize that additional types and combinations of excipients could be used to achieve the desired goals for delivery of a drug. The excipient can be an inert substance, an inactive substance, and / or a not medicinally active substance. The excipient can serve various purposes. A person skilled in the art can select one or more excipients with respect to the particular desired properties by routine experimentation and without any undue burden. The amount of each excipient used can vary within ranges conventional in the art. Techniques and excipients which can be used to formulate dosage forms are described in Handbook of Pharmaceutical Excipients, 6th edition, Rowe et al., Eds., American Pharmaceuticals Association and the Pharmaceutical Press, publications department of the Royal Pharmaceutical Society of Great Britain (2009); and Remington: the Science and Practice of Pharmacy, 21st edition, Gennaro, Ed., Lippincott Williams & Wilkins (2005).

[0138] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.

[0139] A "coding sequence" or a sequence "encoding" a particular molecule (e.g., a therapeutic molecule) is a nucleic acid that is transcribed (in the case of DNA) or translated (in the case of mRNA) into polypeptide, in vitro or in vivo, when operably linked to an appropriate regulatory sequence, such as a promoter. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

[0140] As used herein, the term "synthetic" means designed, produced, prepared, and / or manufactured by the hand of man. Synthesis of polynucleotides or polypeptides or other molecules of the present disclosure can be chemical or enzymatic.

[0141] "Nucleic acid," "polynucleotide," and "oligonucleotide," are used interchangeably in the present application. These terms refer to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. The terms "nucleic acid," "polynucleotide," and "oligonucleotide," as used herein, are defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides can also be referred to as nucleic acid molecules or oligomers.Polynucleotides can be made, e.g., recombinantly, enzymatically, or synthetically, e.g., by solid-phase chemical synthesis followed by purification. When referring to a sequence of the polynucleotide or nucleic acid, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The disclosure of a polynucleotide or nucleic acid sequence can be understood to disclose the complementary sequences as well.

[0142] A kilobase (abbreviated: Kb) is a unit of length of DNA that is equal to 1,000 nucleotide bases (also referred to herein as nucleotides or bases).

[0143] The term "mRNA," as used herein, refers to a single stranded messenger RNA that encodes the amino acid sequence of one or more polypeptide chains.

[0144] Introns" are noncoding sections of an RNA transcript, or the DNA encoding it, that are spliced out before the RNA molecule is translated into a protein.

[0145] The term "promoter" as used herein refers to a DNA sequence recognized by the machinery of the cell, or introduced synthetic machinery, required to initiate the transcription of a gene or coding sequence. The term "promoter" is also meant to encompass those nucleic acid elements sufficient for promoter-dependent gene or coding sequence expression controllable for cell-type specific, tissue-specific or inducible by external signals or agents; such elements can be located in the 5' or 3' regions of the gene. In some aspects, the promoter is a constitutively active promoter, a cell-type specific promoter, or an inducible promoter.

[0146] As used herein, "CAG promoter" refers to a synthetic promoter for driving gene expression which is constructed from a CMV early enhancer element; a promoter, firstexon, and first intron of chicken beta-actin gene; and a splice acceptor of the rabbit betaglobin gene.

[0147] The terms "operatively linked," "operatively inserted," "operatively positioned," "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene or coding sequence. In some aspects, the term "operably linked" means that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene or coding sequence expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s). In some aspects, the term "operably inserted" means that the DNA of interest introduced into the cell is positioned adjacent a DNA sequence which directs transcription and translation of the introduced DNA (i.e., facilitates the production of, e.g., a FGF21 protein encoded by a DNA of interest).

[0148] The term "expression vector", "expression construct" or "expression cassette" means any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid encoding sequence is capable of being transcribed. Typically, an expression cassette comprises a promoter operably linked to a nucleic acid (e.g., a gene of interest).

[0149] The term "adeno-associated virus vector" or "AAV vector" as used herein refers to any vector that comprises or derives from components of an adeno-associated virus. The term AAV vector can be used to designate a vector comprising an AAV genome sequence (e.g., an AAV ITR) and a payload. In some aspects, the AAV vector is suitable to infect mammalian cells, preferably human cells. The term AAV vector can be used to designate an AAV-type viral particle or virion comprising a payload. The AAV vector can be derived from various serotypes, including combinations of serotypes (i.e., "pseudotyped" AAV) or from various genomes (e.g., single stranded or self-complementary). In addition, the AAV vector can be replication defective and / or targeted. As used herein, the term "adeno-associated virus" (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh8, AAVrhlO, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), and any other AAV now known or later discovered. See, e.g., FIELDS et al.VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). In some aspects, an "AAV vector" includes a derivative of a known AAV vector. In some aspects, an "AAV vector" includes a modified or an artificial AAV vector. The terms "AAV capsid" and "AAV particle" can be used interchangeably. In some aspects, the AAV vector is modified or mutated relative to the wild-type AAV serotype sequence. In some aspects, the AAV particle that can comprise an AAV vector comprising at least one payload region (e.g., a polynucleotide encoding a gene of interest) and at least one AAV inverted terminal repeat (ITR) region, which is suitable to infect mammalian cells, preferably human cells.

[0150] As used herein, recombinant AAV vectors or rAAV vectors refer to AAV particles lacking viral genes and packaged with payload DNA encoding heterologous genes of interest. In some aspects, the rAAV vectors of the disclosure comprise a polynucleotide encoding a gene of interest flanked by ITRs, which is encapsulated in an AAV particle.

[0151] scAAV" or "self-complementary adeno-associated virus" refers to an adeno- associated viral vector that comprises duplex nucleic acid sequence that are complementary to one another. The two complementary sequences will associate to form one double stranded DNA unit for replication and transcription.

[0152] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide or nucleoside sequence in relation to a second nucleotide or nucleoside sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide or nucleoside sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C, or 70 °C, for 12-16 hours followed by washing (see, e.g., "Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can be used. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides or nucleosides.

[0153] Complementary sequences can include, or be formed entirely from, non-Watson- Crick base pairs and / or base pairs formed from non-natural and alternative nucleotides or nucleosides, as far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing. Complementary sequences within a dsRNA, or between an oligonucleotide and a target sequence as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide or nucleoside sequence to an oligonucleotide or polynucleotide comprising a second nucleotide or nucleoside sequence over the entire length of one or both nucleotide or nucleoside sequences. Such sequences can be referred to as "fully complementary" or "100% complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., reduction of expression via a RISC pathway. "Substantially complementary" can refer to a polynucleotide that is substantially complementary to a contiguous portion of the nucleic acid of interest (e.g., a DNA or an mRNA encoding a FGF21 protein). For example, a polynucleotide is complementary to at least a part of a nucleic acid molecule if the sequence is substantially complementary to a non- interrupted portion of a nucleic acid molecule encoding a therapeutic molecule. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a shRNA comprising one oligonucleotide of 21 linked nucleosides in length and another oligonucleotide of 23 nucleosides in length, wherein the longer oligonucleotide comprises a sequence of 21 linked nucleosides that is fully complementary to the shorter oligonucleotide, can be referred to as "fully complementary" for the purposes described herein.

[0154] Inverted terminal repeat" (abbreviated: ITR) refers to a single stranded sequence of nucleotides, typically, followed downstream by its reverse complement sequence or a sequence similar to the reverse complement. Naturally occurring ITR sequences are approximately 145 bases each (AAV-1 has ITRs of 143 nucleotides), and AAV plasmids typically include two ITR sequences. The DNA sequence between the ITRs is packagedinto the AAV molecule. The intervening sequence of nucleotides between the initial sequence and the reverse complement (or a sequence similar to the reverse complement) can be any length. ITRs can adopt orientations at the ends of the AAV genome that are described, e.g., as FLIP / FLOP, FLOP / FLIP, FLIP / FLIP, or FLOP / FLOP.

[0155] "Flanking" or "flanked by" as used herein in the context of the relationship or location of sequences relative to one another, refers to one or more sequences (e.g., ITRs) being on each or on one side of another sequence (e.g., an expression cassette). In some aspects, a sequence can flank another sequence that is immediately beside the sequence. In some aspects, a sequence can flank another sequence where there is an intervening sequence between the sequences.

[0156] The phrase "contacting a cell" (e.g., contacting a cell with the AAV vectors, the AAV capsids, or the pharmaceutical compositions of the disclosure) as used herein, includes contacting a cell directly or indirectly. In some aspects, contacting a cell with the expression vector, the rAAV vector, or the pharmaceutical composition includes contacting a cell in vitro with the expression vector, the rAAV vector, or the pharmaceutical composition, or contacting a cell in vivo with the expression vector, the rAAV vector, or the pharmaceutical composition. Thus, for example, the expression vector, the rAAV vector, or the pharmaceutical composition can be put into physical contact with the cell by the individual performing the method, or alternatively, the expression vector, the rAAV vector, or the pharmaceutical composition can be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0157] In some aspects, contacting a cell in vitro can be done, for example, by incubating the cell with the expression vector, the rAAV vector, or the pharmaceutical composition. In some aspects, contacting a cell in vivo can be done, for example, by injecting the expression vector, the rAAV vector, or the pharmaceutical composition of the disclosure into or near the tissue where the cell is located (e.g., the skeletal muscle), or by injecting the expression vector, the rAAV vector, or the pharmaceutical composition into another area, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the expression vector can be encapsulated by an AAV capsid that directs the AAV vector to a site of interest. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell can be contacted in vitro with the expression vector, the rAAV vector, or the pharmaceutical composition and subsequently transplanted into a subject.

[0158] In some aspects, contacting a cell with the expression vector, the rAAV vector, or the pharmaceutical composition of the present disclosure includes "introducing" or "delivering" (directly or indirectly) the expression vector, the rAAV vector, or the pharmaceutical composition into the cell by facilitating or effecting uptake or absorption into the cell. Introducing the expression vector, the rAAV vector, or the pharmaceutical composition into a cell can be in vitro and / or in vivo. For example, for in vivo introduction the expression vector, the rAAV vector, or the pharmaceutical composition can be injected into a specific tissue site (e.g., the locus where a therapeutic effect is desired) or administered systemically (e.g., administering an AAV vector targeted to a locus where a therapeutic effect is desired). In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection.

[0159] As used herein, the terms "effective amount," "therapeutically effective amount," and a "sufficient amount" of, e.g., expression vector, the rAAV vector, or the pharmaceutical composition disclosed herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an "effective amount" or synonym thereto depends on the context in which it is being applied. In some aspects, a therapeutically effective amount of an agent (e.g., expression vector, the rAAV vector, or the pharmaceutical composition disclosed herein) is an amount that results in a beneficial or desired result in a subject as compared to a control.

[0160] The amount of a given agent (e.g., the expression vector, the rAAV vector, or the pharmaceutical composition disclosed herein) will correspond to such an amount will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight) or host being treated, and the like.

[0161] The term "prophylactically effective amount," as used herein, includes the amount of an agent, (e.g., the expression vector, the rAAV vector, or the pharmaceutical composition disclosed herein) that, when administered to a subject having or predisposed to have a disease or disorder (e.g., a kidney disease or disorder), is sufficient to prevent, reduce the risk of, reduce the symptoms of, or ameliorate the disease or disorder or one or more symptoms of the disease or disorder. Ameliorating the disease or disorder includes slowing the course of the disease or disorder or reducing the severity of later-developing disease or disorder. The "prophylactically effective amount" can vary depending on thecharacteristics of the agent, e.g., the expression vector, the rAAV vector, or the pharmaceutical composition, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

[0162] As used herein, the term "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0163] As used herein, the term "in vivo" refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

[0164] As used herein, the term "transfection" refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures. The list of agents that can be transfected into a cell is large and includes, e.g., mRNA, siRNA, shRNA, sense and / or anti-sense sequences, DNA encoding one or more genes or coding sequences including those organized into an expression plasmid, e.g., a vector.

[0165] "Percent (%) sequence identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values can be generated using the sequence comparison computer program BLAST.

[0166] The terms "administer," "administering," "administration," and the like, as used herein, refer to methods that may be used to enable delivery of a drug, e.g., the expression vector, the rAAV vector, or the pharmaceutical composition disclosed herein, to the desired site of biological action. Administration techniques that can be employed with the agents and methods described herein are found in e.g., Goodman and Gilman, ThePharmacological Basis of Therapeutics, current edition, Pergamon; and Remington's, Pharmaceutical Sciences, current edition, Mack Publishing Co., Easton, Pa.

[0167] The terms "treat," "treatment," or "treating," as used herein refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition; the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition. The term also includes prophylaxis or prevention of a disease or condition or its symptoms thereof, unless indicated otherwise.

[0168] The terms "subject," "patient," "individual," and "host," and variants thereof are used interchangeably herein and refer to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans. The methods described herein are applicable to both human therapy and veterinary applications. As used herein, the phrase "subject in need thereof' includes subjects, such as mammalian subjects, that would benefit from administration of a therapeutic agent, e.g., the expression vector, the rAAV vector, or the pharmaceutical composition disclosed herein.

[0169] As used herein, the terms "derived from" or "derivative" refer to a component that is isolated from or made using a specified molecule, or information (e.g., a nucleic acid sequence) from the specified molecule. For example, a polynucleotide sequence that is derived from another polynucleotide sequence can include a polynucleotide sequence that is identical or substantially similar to the polynucleotide sequence it derives from. In the case of polynucleotides, the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis, or artificial random mutagenesis. The mutagenesis used to derive polynucleotides can be intentionally directed or intentionally random, or a mixture of each. The mutagenesis of a polynucleotide to create a different polynucleotide derived from the first polynucleotide can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived polynucleotide can be made by appropriate screening methods known in the art. In some aspects, a polynucleotide sequence that is derived from a first polynucleotide sequence has a sequence identity of at least about 85%, at least about 86%, at least about 87%, at leastabout 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to the first polynucleotide sequence, respectively, wherein the derived polynucleotide sequence retains the biological activity of the original polynucleotide.

[0170] As used herein, the term "functional fragment thereof' refers to a fragment or portion of a protein that is still capable of one or more functions associated with the full protein (e.g., stimulating, modulating, regulating, or modifying). In some aspects, a functional fragment can comprise a truncated protein.

[0171] As used herein, "truncated" refers to a molecule or sequence (e.g., protein, polypeptide, nucleic acid, etc.) that is shortened by removing one or more amino acids or portions therein. The truncation(s) can be in any portion(s) throughout the molecule, e.g., not limited to the N or C terminal portions.

[0172] As used herein, the term "delivery vector" or "vector" refers to any vehicle for the cloning of and / or transfer of a nucleic acid into a host cell, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc. A vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A "replicon" refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control. The term "delivery vector" or "vector" includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo. A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. Insertion of a polynucleotide into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini. Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and / or selection of host cells that incorporate and express other coding regions contained on the vector. Examples of reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), P-galactosidase (LacZ), P-glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. In some aspects, the delivery vector is selected from the group consisting ofa viral vector (e.g., a recombinant AAV vector), a plasmid, a lipid, a protein particle, a bacterial vector, and a lysosome.

[0173] Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. In some aspects, treatment includes eliciting a clinically significant response without excessive levels of side effects. In some aspects, treatment includes prolonging survival as compared to expected survival if not receiving treatment. As used herein, the term "amelioration" or "ameliorating" refers to a lessening of severity of at least one indicator of a condition or disease. In some aspects, "preventing" or "prevention" includes delaying or forestalling the onset, development or progression of a condition or disease for a period of time, including weeks, months, or years.

[0174] "Disorder" is used interchangeably herein with "disease", "condition", and similar words to refer to any impairment of health or state of abnormal functioning of an organism, e.g., any state in which medical and / or surgical management is indicated or for which a subject appropriately seeks medical and / or surgical attention. It should also be understood that the listing of a particular disorder within a particular category is for convenience and is not intended to limit the invention. It will be understood that certain disorders could appropriately be listed in multiple categories.

[0175] As used herein, "skeletal muscle" refers to the tissue composed of muscle fibers. A muscle fiber, also known as a myofiber, is a single multinucleated or syncitial cell that results from the fusion of many hundreds of myoblasts, some of which remain in the mature muscle as undifferentiated cells known as satellite cells. Individual muscle fibers are surrounded by a connective tissue called endomysium. Around 10 to 100 muscle fibers form fascicles, or bundles, which are themselves surrounded by another connective tissue layer called the perimysium. Finally, the skeletal muscle is formed by groups of fascicles that are surrounded also by another connective tissue layer called the epimysium. In addition to muscle fibers, skeletal muscle is also composed of numerous blood vessels and nerves. The ends of muscles converge in dense connective tissuestructures, the tendons and aponeuroses that mediate attachment of muscles to the periosteum of bones or to the connective tissue of other muscles.

[0176] As used herein, the term "kidney inflammation" refers to a condition in which the tissues in the kidney become inflamed and may have a reduced capacity to filter waste from the blood. In some aspects, the kidney inflammation can be caused by infection, inflammatory conditions, genetic conditions, medications, or being exposed to certain chemicals. In some aspects, without treatment and / or control, kidney inflammation can lead to kidney damage, kidney fibrosis, and / or kidney failure. In some aspects, gene markers associated with kidney inflammation can include one or more of the following: F4 / 80, Monocyte chemotactic protein 1 (Mcpl), CD68, and Tumor necrotic factor alpha (Tnfla).

[0177] As used herein, the phrases "oxidative stress in a kidney" or "kidney oxidative stress" or "renal oxidative stress" refer to disturbances in the pro- / anti oxidant balance in the kidney due to both antioxidant depletions and increased reactive oxygen species (ROS) and reactive nitrogen species (RNS) production. In some aspects, gene markers associated with oxidative stress in a kidney can include one or more of the following: NADPH oxidase 2 (Nox2), NADPH Oxidase 4 (Nox4) and inducible nitric oxide synthase (iNos). In some aspects, antioxidant gene markers in the kidney can include one or more of Glutathione-Disulfide Reductase (Gsr), Glutathione Peroxidase 1 (Gpxl), Catalase (Cat), and Superoxide Dismutase 1 (Sodl).

[0178] As used herein, "kidney fibrosis" or "renal fibrosis" refers to the overgrowth, hardening, and / or scarring of kidney tissues related to excess deposition of extracellular matrix components. In some aspects, gene markers associated with kidney fibrosis can include one or more of the following: Collagen type I alpha (Collal), Collagen type III alpha (Col3al), Collagen type IV alpha (Col4al), fibronectin (Fn), and Transforming growth factor betal (Tgflb).

[0179] As used herein, "chronic kidney disease" or "CKD" refer to the presence of kidney damage, which is typically assessed by an estimated glomerular filtration rate (eGFR) less than 90 ml / min per 1.73 square meters, persisting for 3 months or more. Chronic kidney disease is a state of progressive loss of kidney function or kidney failure, which if untreated can ultimately result in the need for dialysis or transplantation. Chronic kidney disease can be associated with inflammation and fibrosis. In some aspects, Stage 2 CKD is associated with eGFR of 60-89; Stage 3a CKD is associated with eGFR of 45-59; Stage3b is associated with eGFR of 30-44; Stage 4 is associated with eGFR of 15-29; and Stage 5 is associated with eGFR of less than 15. In some aspects, gene markers of kidney damage can include one or more of the following: Kidney Injury Molecule 1 (Kimi) and Lipocalin 2 (Lnc2).II. Fibroblast growth factor 21 (FGF21)

[0180] In some aspects, the Fibroblast growth factor 21 (FGF21) amino acid or nucleic acid sequence provided herein is a human FGF21 sequence or a functional fragment thereof. In some aspects, the Fibroblast growth factor 21 (FGF21) amino acid or nucleic acid sequence is a human FGF21 sequence. In some aspects, the FGF21 amino acid or nucleic acid sequence is a full length human FGF21 sequence. In some aspects, the FGF21 amino acid or nucleic acid sequence is a functional fragment of a full length human FGF21 sequence.

[0181] In some aspects, the FGF21 or a functional fragment thereof comprises an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 1

[0182] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 4, 5, 6, or 7.

[0183] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 4.

[0184] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 5.

[0185] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 6.

[0186] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 7.III. Expression Constructs

[0187] In some aspects, the expression constructs provided herein comprise a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or functional fragment thereof operably linked to a promoter. In some aspects, the FGF21 nucleic acid sequence is operably linked to a ubiquitous promoter. In some aspects, the ubiquitous promoter is a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter (e.g., SEQ ID NO: 25), a eukaryotic translation elongation factor 1 a (EFla) promoter (e.g., SEQ ID NO: 24), a simian virus 40 (SV40) promoter (e.g., SEQ ID NO: 26), a cytomegalovirus (CMV) promoter (e.g., SEQ ID NO: 17) or a CAG promoter (e.g., SEQ ID NO: 16).

[0188] In some aspects, the ubiquitous promoter comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 17.

[0189] In some aspects, the ubiquitous promoter comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 16.

[0190] In some aspects, the ubiquitous promoter comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 24.

[0191] In some aspects, the ubiquitous promoter comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 25.

[0192] In some aspects, the ubiquitous promoter comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 26.

[0193] In some aspects, the expression construct comprises the nucleotide sequence encoding the FGF21 or a functional fragment thereof having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 1.

[0194] In some aspects, the expression construct comprises the nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 4, 5, 6, or 7.

[0195] In some aspects, the expression construct comprises the nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 4.

[0196] In some aspects, the expression construct comprises the nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 5.

[0197] In some aspects, the expression construct comprises the nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 6.

[0198] In some aspects, the expression construct comprises the nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO 7.

[0199] In some aspects, the expression construct comprises a FGF21 nucleic acid sequence which is operably linked to a small chicken beta-actinpromoter / cytomegalovirus enhancer (smCBA) promoter (e.g., SEQ ID NO: 25), a eukaryotic translation elongation factor 1 a (EFla) promoter (e.g., SEQ ID NO: 24), a simian virus 40 (SV40) promoter (e.g., SEQ ID NO: 26), a cytomegalovirus (CMV) promoter (e.g., SEQ ID NO: 17) or a CAG promoter (e.g., SEQ ID NO: 16).

[0200] In some aspects, the expression construct comprises a FGF21 nucleic acid sequence which is operably linked to a cytomegalovirus (CMV) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 17.

[0201] In some aspects, the expression construct comprises a FGF21 nucleic acid sequence which is operably linked to a CAG promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 16.

[0202] In some aspects, the expression construct comprises a FGF21 nucleic acid sequence which is operably linked to a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 25.

[0203] In some aspects, the expression construct comprises a FGF21 nucleic acid sequence which is operably linked to a eukaryotic translation elongation factor 1 a (EFla) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 24.

[0204] In some aspects, the expression construct comprises a FGF21 nucleic acid sequence which is operably linked to a simian virus 40 (SV40) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 26.

[0205] In some aspects, the viral expression construct further comprises one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

[0206] In some aspects, the polyadenylation signal is a SV40 polyA or a rabbit betaglobin polyA.

[0207] In some aspects, the polyadenylation signal is a SV40 polyA. In some aspects, the polyadenylation signal comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21.

[0208] In some aspects, the polyadenylation signal is a rabbit beta-globin polyA. In some aspects, the polyadenylation signal comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 22.

[0209] In some aspects, the viral expression construct comprises a chimeric intron, a CMV enhancer, and / or a CMV promoter / enhancer sequence.

[0210] In some aspect, the chimeric intron comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 15.

[0211] In some aspect, the CMV enhancer comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 18.

[0212] In some aspect, the CMV promoter / enhancer comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 23.IV. Adeno-Associated Virus (AAV) Vectors and Capsids

[0213] Adeno-Associated Virus (AAV), a parvovirus belonging to the genus Dependovirus, has several attractive features not found in other viruses. For example, AAV can infect a wide range of host cells, including non-dividing cells. Furthermore, AAV can infect cells from different species. Importantly, AAV has not been associated with any human or animal disease, and does not appear to alter the physiological properties of the host cell upon integration. Finally, AAV is stable at a wide range of physical and chemical conditions, which lends itself to production, storage, and transportation requirements.

[0214] The AAV genome, a linear, single-stranded DNA molecule containing approximately 4700 nucleotides (the AAV-2 genome consists of 4681 nucleotides), generally comprises an internal non-repeating segment flanked on each end by inverted terminal repeats (ITRs). The ITRs are approximately 145 nucleotides in length (AAV-1 has ITRs of 143 nucleotides) and have multiple functions, including serving as origins of replication, and as packaging signals for the viral genome.

[0215] The internal non-repeated portion of the genome includes two large open reading frames (ORFs), known as the AAV replication (rep) and capsid (cap) regions. These ORFs encode replication and capsid gene products, respectively: replication and capsid gene products (i.e., proteins) allow for the replication, assembly, and packaging of a complete AAV virion. More specifically, a family of at least four viral proteins are expressed from the AAV rep region: Rep 78, Rep 68, Rep 52, and Rep 40, all of which are named for their apparent molecular weights. The AAV cap region encodes at least three proteins: VP1, VP2, and VP3.

[0216] AAV is a helper-dependent virus, requiring co-infection with a helper virus (e.g., adenovirus, herpesvirus, or vaccinia virus) in order to form functionally complete AAV virions. In the absence of co-infection with a helper virus, AAV establishes a latent state in which the viral genome inserts into a host cell chromosome or exists in an episomal form, but infectious virions are not produced. Subsequent infection by a helper virus "rescues" the integrated genome, allowing it to be replicated and packaged into viral capsids, thereby reconstituting the infectious virion. While AAV can infect cells from different species, the helper virus must be of the same species as the host cell. Thus, for example, human AAV will replicate in canine cells that have been co-infected with a canine adenovirus.

[0217] In some aspects, AAV vectors of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype. According to the present disclosure, the AAV serotype can be, but is not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, and AAV12, and variants thereof.

[0218] In some aspects, the AAV is a self-complementary adeno-associated virus (sc AAV).

[0219] In some aspects, the viral expression construct, vector genome, or the AAV vector disclosed herein comprises a promoter. In some aspects, the promoter is a constitutively active promoter, a cell-type specific promoter, or an inducible promoter.

[0220] Promoters can be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters and mammalian promoters. In some aspects, the promoters can be human promoters. In some aspects, the promoter can be truncated. In some aspects, the promoter comprises a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter, a simian virus 40 (SV40) promoter, a eukaryotic translation elongation factor 1 a (EFla, also referred to as EFl alpha or EFla) promoter, cytomegalovirus (CMV) immediate-early enhancer and / or promoter, chicken P-actin (CBA) and its derivative CAG, P glucuronidase (GUSB), or ubiquitin C (UBC). In some aspects, the promoter is a CBA promoter, a CMV promoter, an EF-la (Elongation Factor la) promoter, aRSV (Rous Sarcoma Virus) promoter, an Ubiquitin (UbC) promoter, or any combination thereof. In some aspects, tissue-specific expression elements can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, liver promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, or oligodendrocytes.

[0221] In some aspects, the promoter comprises a CBA promoter, a CMV promoter, an EF-la (Elongation Factor la) promoter, a RSV (Rous Sarcoma Virus) promoter, an Ubiquitin (UbC) promoter, a CAG promoter, a smCBA promoter or any combination thereof.

[0222] In some aspects, the promoter is a liver specific promoter. In some aspects the liver specific promoter comprises a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, an apolipoprotein E promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter.

[0223] In some aspects, the promoter is a hAAT promoter. In some aspects, the promoter is a TBG promoter. In some aspects, the promoter comprises a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or100% identity to SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 31.

[0224] In some aspects, the promoter can be less than 1 kb. In some aspects, the promoter can have a length between about 15-20, about 10-50, about 20-30, about 30-40, about 40- 50, about 50-60, about 50-100, about 60-70, about 70-80, about 80-90, about 90-100, about 100-110, about 100-150, about 110-120, about 120-130, about 130-140, about 140-150, about 150-160, about 150-200, about 160-170, about 170-180, about 180-190, about 190- 200, about 200-210, about 200-250, about 210-220, about 220-230, about 230-240, about 240-250, about 250-260, about 250-300, about 260-270, about 270-280, about 280-290, about 290-300, about 200-300, about 200-400, about 200-500, about 200-600, about 200- 700, about 200-800, about 300-400, about 300-500, about 300-600, about 300-700, about 300-800, about 400-500, about 400-600, about 400-700, about 400-800, about 500-600, about 500-700, about 500-800, about 600-700, about 600-800 or about 700-800 nucleotides.

[0225] In some aspects, the promoter is a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include, e.g., CMV, CBA (including derivatives CAG, CBh, etc.), smCBA, EFla, SV40, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1- CBX3).

[0226] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter or a CAG promoter.

[0227] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter.

[0228] In some aspects, the ubiquitous promoter comprises a CAG promoter.

[0229] In some aspects, the promoter is not cell specific. In some aspects, the promoter is an ubiquitin c (UBC) promoter. The UBC promoter can have a size of 300-350 nucleotides. In some aspects, the UBC promoter is 332 nucleotides. In some aspects, the promoter is a P- glucuronidase (GUSB) promoter. The GUSB promoter can have a size of 350-400 nucleotides. In some aspects, the GUSB promoter is 378 nucleotides. In some aspects, the promoter is a neurofilament light (NFL) promoter. The NFL promoter can have a size of 600-700 nucleotides. In some aspects, the NFL promoter is 650 nucleotides. In some aspects, the construct can be AAV-promoter-CMV / globin intron-modulatory polynucleotide-RBG, where the AAV can be self-complementary and the AAV can be the DJ serotype.

[0230] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises a Kozak sequence. Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5' UTRs. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another G.

[0231] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

[0232] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises an enhancer sequence.

[0233] In some aspects, the enhancer is a CMV enhancer sequence (SEQ ID NO: 18).

[0234] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises an intron sequence.

[0235] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises an intron sequence, e.g., a SV40 intron sequence or a CAG intron sequence.

[0236] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises an Internal Ribosome Entry Site (IRES).

[0237] In some aspects, the viral expression construct, vector genome, or the AAV vector comprises further comprises a poly(A) sequence. In some aspects, the polyadenylation sequence or "polyA sequence" can range from 50 to about 500 nucleotides in length.

[0238] In some aspects, the polyadenylation sequence is about 50-100, about 50-150, about 50-160, about 50-200, about 60-100, about 60-150, about 60-160, about 60-200, about 70- 100, about 70-150, about 70-160, about 70-200, about 80-100, about 80-150, about 80-160, about 80-200, about 90-100, about 90-150, about 90-160, or about 90-200 nucleotides in length.

[0239] In some aspects, the polyadenylation sequence is a rabbit globin polyadenylation (poly A) signal sequence. In some aspects, the polyadenylation sequence is a human growth hormone polyadenylation (poly A) signal sequence. In some aspects, the polyadenylation sequence is a bovine growth hormone polyadenylation (poly A) signal sequence. In some aspects, the polyadenylation sequence is a synthetic polyadenylation (poly A) signal sequence. In some aspects, the polyadenylation sequence is a SV40 polyA signal sequence.

[0240] In some aspects, the poly(A) sequence comprises a SV40 polyadenylation signal or a Rabbit beta-globin polyadenylation signal.

[0241] In some aspects, the poly(A) sequence is a SV40 poly(A) signal sequence.

[0242] In some aspects, the poly (A) sequence is a SV40 poly (A) signal sequence comprises a nucleic acid sequence corresponding to SEQ ID NO: 21.

[0243] In some aspects, the poly(A) sequence is a Rabbit beta-globin polyadenylation signal sequence.

[0244] In some aspects, the Rabbit beta-globin polyadenylation signal sequence comprises a nucleic acid sequence corresponding to SEQ ID NO: 22.

[0245] In some aspects, the viral expression construct, vector genome, or the AAV vector further comprises two inverted terminal repeat (ITR) sequences.

[0246] In some aspects, the pair of ITR sequences are derived from an AAV serotype selected from AAV1, AAV2, AAV3a, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or variants thereof. In some aspects, the pair of ITR sequences are derived from an AAV serotype AAV2.

[0247] In some aspects, the viral expression construct, vector genome, or the AAV vector comprises at least one ITR region and a payload region, e.g., a polynucleotide or expression cassette for expression of the FGF21 protein. In some aspects, the AAV vector comprises two ITRs. In some aspects, these two ITRs flank the payload region at the 5' and 3' ends. The ITRs can function as origins of replication comprising recognition sites for replication. In some aspects, the ITRs comprise sequence regions that can be complementary and symmetrically arranged. In some aspects, the ITRs incorporated into the AAV vector of the present disclosure can be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences.

[0248] The ITRs can be derived from the same serotype as the desired capsid, selected from any of the serotypes disclosed herein, or a derivative thereof. The ITR can be of a different serotype from the desired capsid. In some aspects, the ITRs are of the same serotype as one another. In some aspects, the ITRs are of different serotypes. Nonlimiting examples include zero, one or both of the ITRs having the same serotype as the desired capsid.

[0249] Independently, each ITR can be about 75 to about 175 nucleotides in length. In some aspects, the ITR can be about 100-150 nucleotides in length, about 140-150 nucleotides in length or about 140-155 nucleotides in length. Non-limiting examples ofITR length are about 140, about 141, about 142, about 145 nucleotides in length, and those having at least 95% identity thereto.

[0250] In some aspects, the viral expression construct, vector genome, or the AAV vector comprises at least one inverted terminal repeat having a length of about 75-80, about 75- 85, about 75-100, about 80- 85, about 80-90, about 80-105, about 85-90, about 85-95, about 85-110, about 90-95, about 90-100, about 90-115, about 95-100, about 95-105, about 95-120, about 100-105, about 100-110, about 100-125, about 105-110, about 105- 115, about 105-130, about 110-115, about 110-120, about 110-135, about 115-120, about 115-125, about 115-140, about 120-125, about 120-130, about 120-145, about 125-130, about 125-135, about 125-150, about 130-135, about 130-140, about 130-155, about 135- 140, about 135-145, about 135-160, about 140-145, about 140-150, about 140-165, about 145-150, about 145-155, about 145-170, about 150-155, about 150-160, about 150-175, about 155-160, about 155-165, about 160-165, about 160-170, about 165-170, about 165- 175, or about 170-175 nucleotides.

[0251] In some aspects, the length of a first and / or a second ITR region for AAV vector can be about 75-80, about 75-85, about 75-100, about 80-85, about 80-90, about 80-105, about 85-90, about 85-95, about 85-110, about 90-95, about 90-100, about 90-115, about 95-100, about 95-105, about 95-120, about 100-105, about 100-110, about 100-125, about 105-110, about 105-115, about 105-130, about 110-115, about 110-120, about 110-135, about 115-120, about 115-125, about 115-140, about 120-125, about 120-130, about 120- 145, about 125-130, about 125-135, about 125-150, about 130-135, about 130-140, about 130-155, about 135-140, about 135-145, about 135-160, about 140-145, about 140-150, about 140-165, about 145-150, about 145-155, about 145-170, about 150-155, about 150- 160, about 150-175, about 155-160, about 155-165, about 160-165, about 160-170, about 165-170, about 165-175, or about 170-175 nucleotides.

[0252] In some aspects, the nucleic acid of interest is located near the 5' end of the flip ITR in the vector. In some aspects, the nucleic acid of interest is located near the 3' end of the flip ITR in the vector. In some aspects, the nucleic acid of interest is located near the 5' end of the flop ITR in the vector. In some aspects, the nucleic acid of interest is located near the 3' end of the flop ITR in the vector. In some aspects, the nucleic acid of interest is located between the 5' end of the flip ITR and the 3' end of the flop ITR in the vector. In some aspects, the nucleic acid of interest is located between (e.g., half-way betweenthe 5' end of the flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR and the 5' end of the flip ITR), the 3' end of the flip ITR and the 5' end of the flip ITR in the vector.

[0253] In some aspects, the nucleic acid of interest is located within about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more than about 30 nucleotides downstream or upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

[0254] As another non-limiting example, the nucleic acid of interest is located within about 1-5, about 1- 10, about 1-15, about 1-20, about 1-25, about 1-30, about 5-10, about 5-15, about 5-20, about 5-25, about 5-30, about 10-15, about 10-20, about 10-25, about 10-30, about 15-20, about 15-25, about 15-30, about 20-25, about 20-30 or about 25-30 nucleotides downstream or upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

[0255] In some aspects, the nucleic acid of interest is located within the first about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25% or more than about 25% of the nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

[0256] As another non-limiting example, the nucleic acid of interest is located with the first about 1-5%, about 1-10%, about 1-15%, about 1-20%, about 1-25%, about 5-10%, about 5-15%, about 5-20%, about 5-25%, about 10-15%, about 10-20%, about 10-25%, about 15- 20%, about 15-25%, or about 20-25% downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

[0257] In some aspects, the ITRs comprise a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any of SEQ ID NOs: 19, 20, or combinations thereof.

[0258] In some aspects, the ITRs comprise a 5’ ITR comprising a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 19, and a 3’ ITR comprising a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to SEQ ID NO: 20.

[0259] In some aspects, the AAV comprises an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, and AAV12.

[0260] In some aspects, the viral expression construct, vector genome, or the AAV vector comprises ITRs having an AAV2 serotype.

[0261] In some aspects, the nucleic acid sequence has been modified to reduce the number of CpG sites.

[0262] Certain aspects of the disclosure are directed to an adeno-associated virus (AAV) vector comprising a polynucleotide (e.g., expression construct disclosed herein) comprising a promoter (e.g., ubiquitous promoter) operably linked to a nucleic acid sequence encoding a FGF21 protein or functional fragment thereof flanked by AAV inverted terminal repeats (ITRs). In some aspects, the AAV vector is encapsidated by an AAV capsid (e.g., AAV1 serotype).

[0263] In some aspects, provided herein is an adeno-associated virus (AAV) vector comprises an expression cassette comprising a promoter operably linked to a nucleic acid encoding a FGF21 protein or functional fragment thereof where the expression cassette is flanked by ITRs, wherein the nucleic acid sequence encoding a FGF21 protein or functional fragment thereof comprises a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any of SEQ ID NOs: 4, 5, 6, or 7.

[0264] In some aspects, the AAV vector comprises an expression construct comprising a nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4.

[0265] In some aspects, the AAV vector comprises an expression construct comprising a nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5.

[0266] In some aspects, the AAV vector comprises an expression construct comprising a nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6.

[0267] In some aspects, the AAV vector comprises an expression construct comprising a nucleotide sequence encoding the FGF21 or a functional fragment thereof which comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7.

[0268] In some aspects, the AAV vector comprises an expression construct comprising a FGF21 nucleic acid sequence which is operably linked to a cytomegalovirus (CMV) promoter (e.g., SEQ ID NO: 17) or a CAG promoter (e.g., SEQ ID NO: 16).

[0269] In some aspects, the AAV vector comprises an expression construct comprising a FGF21 nucleic acid sequence which is operably linked to a cytomegalovirus (CMV) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 17.

[0270] In some aspects, the AAV vector comprises an expression construct comprising a FGF21 nucleic acid sequence which is operably linked to a CAG promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 16.

[0271] In some aspects, the AAV vector comprises an expression construct comprising a FGF21 nucleic acid sequence which is operably linked to a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 25.

[0272] In some aspects, the AAV vector comprises an expression construct comprising a FGF21 nucleic acid sequence which is operably linked to a eukaryotic translation elongation factor 1 a (EFla) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 24.

[0273] In some aspects, the AAV vector comprises an expression construct comprising a FGF21 nucleic acid sequence which is operably linked to a simian virus 40 (SV40) promoter having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 26.

[0274] In some aspects, the AAV vector comprises an expression construct further comprising one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

[0275] In some aspects, the polyadenylation signal is a SV40 polyA or a rabbit betaglobin polyA.

[0276] In some aspects, the polyadenylation signal is a SV40 polyA. In some aspects, the polyadenylation signal comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21.

[0277] In some aspects, the polyadenylation signal is a rabbit beta-globin polyA. In some aspects, the polyadenylation signal comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 22.

[0278] In some aspects, the AAV vector comprises an expression construct comprising a chimeric intron, a CMV enhancer, and / or a CMV promoter / enhancer sequence.

[0279] In some aspect, the chimeric intron comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 15.

[0280] In some aspect, the CMV enhancer comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 18.

[0281] In some aspect, the CMV promoter / enhancer comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 23.

[0282] In some aspects, the AAV vector comprises an expression construct flanked by AAV ITRs, wherein the AAV ITRs are AAV2 serotype.

[0283] In some aspects, the AAV ITRs comprise a 5’ ITR and a 3’ ITR. In some aspects, the 5’ ITR comprises a sequence having at least 85%, at least 90%, at least 91%, at least92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 19. In some aspects, the 3’ ITR comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 20.

[0284] In some aspects, the AAV vector comprises a sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14.

[0285] In some aspects, the AAV vector comprises a nucleic acid sequence comprising any of the nucleotide sequences of the SEQ ID NOs disclosed in Table 1, or any combinations thereof.Table 1 - Exemplary AAV construct sequences

[0286] In some aspects, the viral expression construct, vector genome, or the AAV vector disclosed herein is encapsidated in an adeno-associated (AAV) capsid. In some aspects, provided herein is a recombinant adeno-associated (rAAV) vector comprising a capsidand any of the viral expression construct, vector genome, or the AAV vector disclosed herein.

[0287] In some aspects, the AAV capsid serotype is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, and AAV12. In some aspects, the AAV capsid serotype is AAV1.

[0288] In some aspects, the disclosure is directed to an isolated rAAV particle comprising the vector genome of any of the AAV vectors described herein. In some aspects, the rAAV particle is produced by any of the methods of packaging described herein or known in the art.

[0289] In some aspects, the disclosure is directed to a plurality of rAAV particles. In some aspects, the rAAV particles are isolated or purified.

[0290] The present disclosure also provides for cells containing the viral expression construct, vector genome, or the AAV vector disclosed herein. In some aspect, the cell comprises mammalian cells. In some aspects, the cell provides helper functions that package the viral expression construct, vector genome, or the AAV vector into a viral particle. In some aspects, the cell provides AAV helper functions. In some aspects, the cell provides AAV Rep and / or Cap proteins. In some aspects, the cell is stably or transiently transfected with polynucleotide(s) encoding Rep and / or Cap protein sequence(s). In some aspects, the cell provides Rep78 or / and Rep68 proteins. In some aspects, the cell is stably or transiently transfected with Rep78 and Rep68 proteins polynucleotide encoding sequence(s).

[0291] In some aspects, the present disclosure provides for a method for packaging a nucleic acid of interest in an AAV capsid. In some aspects, the method comprises transfecting a cell in vitro with any viral expression construct, vector genome, or the AAV vector described herein and one or more plasmids comprising Rep / Cap genes and adenovirus genes. In some aspects, the nucleic acid of interest is packaged into the AAV capsid.

[0292] In some aspects, a rAAV particle is produced by a method comprising:(1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and / or AAV payload construct vector, (2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfecting viral replication cells, (3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payloadconstruct expression vector, (4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, and (5) harvesting and purifying the viral particle comprising a parvoviral genome.

[0293] In some aspects, the present disclosure provides a method for producing an rAAV particle comprising the steps of (1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with: (i) AAV vector of the disclosure comprising a payload region (e.g., polynucleotide encoding a FGF21 protein), (ii) a construct expressing rep and cap genes and (iii) a helper construct, and (2) harvesting and purifying the rAAV particle comprising a viral genome.

[0294] In some aspects, the rAAV particles can be produced in a viral replication cell that comprises an insect cell. Growing conditions for insect cells in culture, and production of heterologous products in insect cells in culture are well known in the art, see, e.g., U.S. Patent No. 6,204,059.

[0295] The viral replication cell can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Viral replication cells can comprise mammalian cells such as A549, WEH1, 3T3, 10T1 / 2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals. Viral replication cells comprise cells derived from mammalian species including, but not limited to, human, monkey, mouse, rat, rabbit, and hamster or cell type, including but not limited to fibroblast, hepatocyte, tumor cell, cell line transformed cell, etc.

[0296] Viral production disclosed herein describes processes and methods for producing rAAV particles that contact a target cell to deliver a payload, e.g., a recombinant viral construct, which comprises a polynucleotide or expression construct disclosed herein.

[0297] In some aspects, the rAAV particles can be produced in a viral replication cell that comprises a mammalian cell. Viral replication cells commonly used for production of recombinant AAV particles include, but are not limited to 293 cells, COS cells, HeLa cells, and KB cells.

[0298] In some aspects, rAAV particles are produced in mammalian cells wherein all three VP proteins are expressed at a stoichiometry approaching 1 : 1 : 10 (VP1 :VP2:VP3). In some aspects, the VP proteins are expressed at a stoichiometry such that VP3 is higherthan VP1 and VP2. In some aspects, the VP proteins are expressed at a stoichiometry such that VP1 and VP2 are at approximately the same level. The regulatory mechanisms that allow this controlled level of expression include the production of two mRNAs, one for VP1, and the other for VP2 and VP3, produced by differential splicing.

[0299] In some aspects, rAAV particles are produced in mammalian cells using a triple transfection method wherein a payload construct (e.g., an AAV vector disclosed herein), parvoviral Rep and parvoviral Cap and a helper construct are comprised within three different constructs. The triple transfection method of the three components of AAV particle production can be utilized to produce small lots of virus for assays including transduction efficiency, target tissue (tropism) evaluation, and stability.

[0300] In some aspects, the viral expression construct, vector genome, or the AAV vector can be each incorporated by a transposon donor / acceptor system into a bacmid, also known as a baculovirus plasmid, by standard molecular biology techniques known and performed by a person skilled in the art. Transfection of separate viral replication cell populations produces two baculoviruses, one that comprises the viral construct expression vector, and another that comprises the AAV payload construct expression vector. The two baculoviruses can be used to infect a single viral replication cell population for production of AAV particles.

[0301] Baculovirus expression vectors for producing viral particles in insect cells, including but not limited to Spodoptera frugiperda (Sf9) cells, provide high titers of viral particle product. Recombinant baculovirus encoding the viral construct expression vector and AAV vector initiates a productive infection of viral replicating cells. Infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection, see, e.g., Urabe, M. et al., J Virol. 2006 Feb; 80 (4): 1874-85, the contents of which are herein incorporated by reference in their entirety.

[0302] Production of rAAV particles with baculovirus in an insect cell system can address known baculovirus genetic and physical instability. Baculovirus-infected viral producing cells are harvested into aliquots that can be cryopreserved in liquid nitrogen; the aliquots retain viability and infectivity for infection of large-scale viral producing cell culture (Wasilko DJ et al., Protein Expr Purif. 2009 Jun; 65(2): 122-32).

[0303] In some aspects, stable viral replication cells permissive for baculovirus infection are engineered with at least one stable integrated copy of any of the elements necessary for AAV replication and viral particle production including, but not limited to, the entire AAV genome, Rep and Cap genes, Rep genes, Cap genes, each Rep protein as a separate transcription cassette, each VP protein as a separate transcription cassette, the AAP (assembly activation protein), or at least one of the baculovirus helper genes with native or non-native promoters.

[0304] In some aspects, rAAV particle production can be modified to increase the scale of production. Transfection of replication cells in large-scale culture formats can be carried out according to any methods known in the art.

[0305] In some aspects, cell culture bioreactors can be used for large scale viral production. In some cases, bioreactors comprise stirred tank reactors.

[0306] Cells of the disclosure, including, but not limited to viral production cells, can be subjected to cell lysis according to any methods known in the art. In some aspects, the cells of the disclosure are not subjected to cell lysis. Cell lysis can be carried out to obtain one or more agents (e.g., viral particles) present within any cells of the disclosure.

[0307] In some aspects, a method for harvesting rAAV particles without lysis can be used for efficient and scalable AAV particle production. In a non-limiting example, AAV particles can be produced by culturing an AAV particle lacking a heparin binding site, thereby allowing the AAV particle to pass into the supernatant, in a cell culture, collecting supernatant from the culture; and isolating the AAV particle from the supernatant, as described in U.S. Patent Application 2009 / 0275107.

[0308] Cell lysates comprising viral particles can be subjected to clarification. Clarification refers to initial steps taken in purification of viral particles from cell lysates. Clarification serves to prepare lysates for further purification by removing larger, insoluble debris. Clarification steps can include, but are not limited to centrifugation and filtration.

[0309] In some aspects, rAAV particles can be purified from clarified cell lysates by one or more methods of chromatography.V. Pharmaceutical Compositions

[0310] In some aspects, provided herein is a pharmaceutical composition comprising any of the viral expression construct, vector genome, the AAV vector, or rAAV vectors disclosed herein.

[0311] In some aspects, the pharmaceutical composition is in a form suitable for administration to a subject in need thereof. In some aspects, the pharmaceutical composition is in a form suitable for intramuscular administration to a subject in need thereof.

[0312] In some aspects, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient or carrier.

[0313] In some aspects, pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.

[0314] Also provided herein are pharmaceutical compositions comprising rAAV vectors disclosed herein having the desired degree of purity, and a pharmaceutically acceptable carrier or excipient, in a form suitable for administration to a subject. Pharmaceutically acceptable excipients or carriers can be determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising a plurality of vectors, e.g., AAV vectors described herein. (See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 21st ed. (2005)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.

[0315] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed.

[0316] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Except insofar as any conventional media or compound is incompatible with the rAAV vectors disclosed herein, use thereof in the compositions is contemplated. In some aspects, a pharmaceutical composition is formulated to be compatible with its intended route of administration.

[0317] The rAAV vectors disclosed herein can be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.VI. Kits

[0318] The present disclosure also provides kits, or products of manufacture, comprising (i) any of the AAV vectors, the rAAV vectors, or the pharmaceutical compositions disclosed herein, and (ii) optionally instructions for use (e.g., a package insert with instructions to perform any of the methods described herein).

[0319] In some aspects, the kit or product of manufacture comprises (i) viral expression construct, vector genome, or the AAV vector disclosed herein disclosed herein (ii) optionally, an additional agent (e.g., rep / cap plasmid and / or helper plasmid), and (iii) optionally, instructions for use (e.g., a package insert with instructions to perform any of the methods described herein are also contemplated).

[0320] One skilled in the art will readily recognize that the AAV vectors, the rAAV vectors, or the pharmaceutical compositions of the present disclosure, can be readily incorporated into one of the established kit formats which are well known in the art.VII. Administration

[0321] The AAV vectors, rAAV vectors, or pharmaceutical compositions disclosed herein can be administered by any route which results in a therapeutically effective outcome. In some aspects, the methods disclosed herein can comprise intramuscularly administering an AAV vector, rAAV vector, or pharmaceutical composition of the present disclosure to a subject disclosed herein.

[0322] In some aspects, the methods disclosed herein comprise administering any of the vectors, rAAV vectors, or pharmaceutical compositions disclosed herein to a subject, e.g., a subject suffering from Chronic kidney disease (CKD).

[0323] The AAV vector, rAAV vector, or pharmaceutical composition disclosed herein can be formulated to be suitable for administration to a cell, tissue and / or an organ in vivo of individuals affected by or at risk of developing a kidney disease or disorder disclosed herein, and may be administered in vivo, ex vivo or in vitro.

[0324] In some aspects, the AAV vector, rAAV vector, or pharmaceutical composition disclosed herein is administered to a human skeletal muscle.

[0325] In some aspects, the AAV vector, rAAV vector, or pharmaceutical composition disclosed herein is injected into a muscle selected from the group consisting of quadriceps, gastrocnemius, tibialis, and any combination thereof.

[0326] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and / or a latissimus dorsi (lat). In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and / or a hamstring. In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a hamstring, or any combination thereof.

[0327] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and a latissimus dorsi (lat).

[0328] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and a hamstring.

[0329] The AAV vector, rAAV vector, or pharmaceutical composition disclosed herein can be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.

[0330] The optimal effective amount of the AAV vector, rAAV vector, or pharmaceutical composition disclosed herein can be determined empirically and will depend on the type and severity of the disease, route of administration, disease progression and health, mass and body area of the individual.

[0331] The AAV vector, rAAV vector, or pharmaceutical composition disclosed herein may be administered in a single dose, or in multiple doses. The AAV vector, rAAV vector, or pharmaceutical composition disclosed herein may be administered by injection in various locations in the skeletal muscle, such as quadriceps, gastrocnemius, tibialis, and any combination thereof.

[0332] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralismajor), and / or a latissimus dorsi (lat). In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and / or a hamstring. In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a hamstring, or any combination thereof.

[0333] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and a latissimus dorsi (lat).

[0334] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and a hamstring.

[0335] In some aspects, the rAAV vector is administered as a single dose.

[0336] In some aspects, the rAAV vector is administered over multiple doses.

[0337] In some aspects, the rAAV vector is administered to the same skeletal muscle(e.g., the left quadriceps, left gastrocnemius, the left tibialis, the right quadriceps, right gastrocnemius, or the right tibialis). In some aspects, the rAAV vector is administered to different skeletal muscles (e.g., one dose is given to the left quadriceps and the left gastrocnemius, one dose is given to the left quadriceps and the right quadriceps, etc.).

[0338] In some aspects, the rAAV vector is administered in a total dose of about 1 x 1011vg / kg to about 1 x 1015vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1014vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 3 x 1012vg / kg to about 3 x 1013vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1013vg / kg. In some aspects the rAAV vector is administered in a total dose of about 3 x 1012vg / kg, about 4 x 1012vg / kg, about 5 x 1012vg / kg, about 6 x 1012vg / kg, about 7 x1012vg / kg, about 8 x 1012vg / kg, about 9 x 1012vg / kg, about 1 x 1013vg / kg, about 1.5 x1013vg / kg, about 2 x 1013vg / kg, about 2.5 x 1013vg / kg, about 3 x 1013vg / kg, about 3.5 x1013vg / kg, about 4 x 1013vg / kg, about 4.5 x 1013vg / kg, or about 5 x 1013vg / kg. In some aspects the rAAV vector is administered in a total dose of about 1.2 x 1012vg / kg, about 3.8 x 1012vg / kg, about 1.2 x 1013vg / kg, or about 2.5 x 1013vg / kg.

[0339] In some aspects, the rAAV vector is administered in a total dose of about 1 x 1013vg to about 1 x 1017vg. In some aspects, the rAAV vector is administered in a total doseof about 1 x 1014vg to about 1 x 1016vg. In some aspects, the rAAV vector is administered in a total dose of about 2 x 1014vg to about 3 x 1015vg. In some aspects, the rAAV vector is administered in a total dose of about 9.6 x 1013vg, about 3.0 x 1014vg, about 5.6 x 1014vg, about 9.6 x 1014vg, about 2.0 x 1015vg.VIII. Methods of Treatment for Renal Inflammation, Renal Oxidative Stress, and Renal Fibrosis

[0340] Kidney inflammation can be characterized by the recruitment and activation of neutrophils and macrophages by cytokine release in damaged tissue. Neutrophils express pro-inflammatory cytokines and enzymes for degrading extracellular matrix, which is then cleared by macrophages. Black LM, et al. J Histochem Cytochem. 2019 Sep;67(9):663-681. Inflammatory responses also involve recruitment of infiltrating leukocytes, which in turn activate pro-fibrotic cells to seal the sites of injury. Wynn TA. J Pathol. 2008;214(2): 199-210. These cells work in tandem with epithelial and endothelial cells to regenerate damaged tissue. However, if an inflammatory response continues in an unregulated manner, scar tissue can form in the kidney, leading to fibrosis and renal dysfunction. Dysregulation of ROS exacerbates both renal inflammation and fibrosis by causing oxidative stress-induced injury. Sedeek M, Nasrallah R, Touyz RM, Hebert RL. J Am Soc Nephrol. 2013;24(10): 1512-8.

[0341] Certain aspects of the present disclosure provide a method for reducing kidney inflammation in a subject comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector for expression of a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises an inverted terminal repeat (ITR) and a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter). In some aspects, the kidney inflammation is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0342] In some aspects, the administration increases the circulating levels of FGF21.

[0343] In some aspects, the kidney inflammation is detected by quantification of the relative expression of inflammatory gene markers Cd68, F4 / 80, Ccl2, Ccl3, Ccl5, Mcpl, Tgfb, and / or Tnfa by qRT-PCR In some aspects, the method reduces the relativeexpression levels of one or more inflammatory gene markers selected from Cd68, F4 / 80, Ccl2, Ccl3, Ccl5, Mcpl, Tgfb, and / or Tufa after administration of the rAAV vector. In some aspects, the subject has a 0.1-6 fold reduction in relative expression of one or more inflammatory gene markers. In some aspects, the subject has at least a 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5, 3.75, 4, 4.25, 4.5, 4.75, 5, 5.25, 5.5, 5.75, or 6 fold reduction in relative expression of one or more inflammatory gene markers.

[0344] In some aspects, after administration, the subject has a 0.1-6 fold reduction in a relative expression of a cytokine, a chemokine, a cell adhesion molecule (CAM), or any combinations thereof. In some aspects, the relative expression is measured by qRT-PCR.

[0345] In some aspects, the cytokine is an interleukin (IL), a tumor necrosis factor (TNF), an interferon (IFN), a transforming growth factor (TGF), or any combination thereof.

[0346] In some aspects, the CAM is an IgSF, a cadherin, a selectin, or an integrin.

[0347] In some aspects, the chemokine is a member of the CXC family, a member of theCX3C family, or a member of the CC family.

[0348] Certain aspects of the present disclosure provide a method for reducing oxidative stress in a kidney of a subject comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises an inverted terminal repeat (ITR) and a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter. In some aspects, the oxidative stress in the kidney is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0349] In some aspects, the oxidative stress in a kidney is detected by the quantification of the relative expression of oxidative stress gene markers Nox2, Nox4, and / or iNos and / or antioxidant gene markers Gsr, Gpxl, Cat, and Sodl by qRT-PCR. In some aspects, the method reduces the relative expression levels of one or more oxidative stress gene markers and / or increased relative expression levels of one or more antioxidant gene markers after administration of the rAAV vector. In some aspects, the subject has a 0.1-6 fold reduction in the relative expression of one or more oxidative stress gene markers. In some aspects, the subject has at least a 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5, 3.75, 4, 4.25, 4.5, 4.75, 5, 5.25, 5.5, 5.75, or 6 fold reduction in relative expression of one or more oxidative stress gene markers. In some aspects, the subject hasa 0.1-4 fold increase in the relative expression of one or more antioxidant gene markers. In some aspects, the subject has at least a 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5, 3.75, 4, 4.25, 4.5, 4.75, 5, 5.25, 5.5, 5.75, or 6 fold increase in relative expression of one or more antioxidant gene markers.

[0350] Certain aspects of the present disclosure provide a method for reducing kidney fibrosis in a subject comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises an inverted terminal repeat (ITR) and a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) operably linked to a promoter (e.g., a ubiquitous promoter). In some aspects, the kidney fibrosis is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0351] In some aspects, the kidney fibrosis is detected by quantification of the relative expression of fibrosis markers Tgflb, Collal, Col3al, Col4al, Ctgf, Fn, aSMA, Col5al, Col6al, vimentin, E-cadherin, PIIINP, TGFb, MCP-1, hepcidin, LFABP, RBP, VCAM-1, CTGF, PAI-1, MMP-2, TIMP-1, MBL, SGK-1, and / or CD30 by qRT-PCR. In some aspects, the method decreases relative expression levels of one or more fibrosis markers after administration of the rAAV vector. In some aspects, the subject has a 0.1-6 fold reduction in the relative expression of one or more fibrosis gene markers. In some aspects, the subject has at least a 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5, 3.75, 4, 4.25, 4.5, 4.75, 5, 5.25, 5.5, 5.75, or 6 fold reduction in relative expression of one or more fibrosis gene markers.

[0352] Certain aspects of the present disclosure provide a method for treating or preventing chronic kidney disease (CKD) in a subject comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector for expression of a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises an inverted terminal repeat (ITR) and a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter). In some aspects, the CKD is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0353] In some aspects, the CKD is associated with kidney damage assessed by an estimated glomerular filtration rate (eGFR) less than 90 ml / min per 1.73 square meters, persisting for 3 months or more. In some aspects, the subject suffers from Stage 2 CKD (e.g., having an eGFR of 60-89). In some aspects, the subject suffers from Stage 3a CKD(e.g., having an eGFR of 45-59). In some aspects, the subject suffers from Stage 3b CKD(e.g., having an eGFR of 30-44). In some aspects, the subject suffers from Stage 4 CKD(e.g., having an eGFR of 15-29). In some aspects, the subject suffers from Stage 5 CKD(e.g., having an eGFR of less than 15). In some aspects, the CKD is detected by quantification of the relative expression of kidney damage markers Kimi and Lnc2 by qRT-PCR. In some aspects, the subject has decreased relative expression levels of one or more kidney damage markers after administration of the rAAV vector. In some aspects, the subject has a 0.1-6 fold reduction in the relative expression of one or more kidney damage markers. In some aspects, the subject has at least a 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5, 3.75, 4, 4.25, 4.5, 4.75, 5, 5.25, 5.5, 5.75, or 6 fold reduction in relative expression of one or more kidney damage markers.

[0354] Certain aspects of the present disclosure provide a method for treating or reducing kidney inflammation in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter), wherein the kidney inflammation is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0355] Certain aspects of the present disclosure provide a method for treating or reducing oxidative stress in a kidney of a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression constructcomprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter), wherein the oxidative stress in the kidney is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0356] Certain aspects of the present disclosure provide a method for treating, preventing, or reducing kidney fibrosis in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter), wherein the kidney fibrosis is not associated with diabetes. In some aspects, the subject does not suffer from diabetes. In some aspects, the method reduces inflammation and oxidative stress in the kidney and prevents or reduces kidney fibrosis.

[0357] Certain aspects of the present disclosure provide a method for treating or preventing acute kidney injury (AKI) in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., ubiquitous promoter), wherein the AKI is not associated with diabetes. In some aspects, the subject does not suffer from diabetes. In some aspects, the method reduces inflammation and oxidative stress in the kidney and prevents or treats AKI.

[0358] Certain aspects of the present disclosure provide a method for treating, preventing or reducing the likelihood of chronic kidney disease (CKD)-related fibrosis in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. Insome aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises AAV inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., ubiquitous promoter), wherein the CKD and / or kidney fibrosis is / are not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0359] Certain aspects of the present disclosure provide a method for treatment and / or prevention of a kidney disease that is secondary to Alzheimer's Disease in a subject in need thereof comprising administering intramuscularly to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., ubiquitous promoter), wherein the kidney disease is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0360] Certain aspects of the present disclosure provide a method for treatment and / or prevention of a kidney disease in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof, wherein the kidney disease is selected from the group consisting of age-related kidney disease, uremia, acute renal insufficiency, chronic pyelonephritis, acute pyelonephritis, chronic glomerulonephritis, acute progressive nephritis syndrome, nephrotic syndrome, nephrosclerosis, interstitial nephritis, focal glomerulosclerosis, membranous nephropathy, multiple purulent renal syndrome, renal vascular hypertension, hypertensive kidney disease, secondary nephropathy, hyperphosphatemia, hyperkalemia, hyperuricemia, hypernatremia, chronic myeloid leukemia (CML), lupus nephritis, or kidney disease secondary to Alzheimer’s disease. In some aspects, the rAAV vector comprises a vector genome and an AAV capsid (e.g., AAV1 serotype). In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising the nucleotide sequence encodinga Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter), wherein the kidney disease is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0361] In some aspects, the kidney disease is an age-related kidney disease.

[0362] In some aspects, the kidney disease is uremia.

[0363] In some aspects, the kidney disease is acute renal insufficiency.

[0364] In some aspects, the kidney disease is chronic pyelonephritis.

[0365] In some aspects, the kidney disease is acute pyelonephritis.

[0366] In some aspects, the kidney disease is chronic glomerulonephritis.

[0367] In some aspects, the kidney disease is acute progressive nephritis syndrome.

[0368] In some aspects, the kidney disease is nephrotic syndrome.

[0369] In some aspects, the kidney disease is nephrosclerosis.

[0370] In some aspects, the kidney disease is interstitial nephritis.

[0371] In some aspects, the kidney disease is focal glomerulosclerosis.

[0372] In some aspects, the kidney disease is membranous nephropathy.

[0373] In some aspects, the kidney disease is multiple purulent renal syndrome.

[0374] In some aspects, the kidney disease is renal vascular hypertension.

[0375] In some aspects, the kidney disease is hypertensive kidney disease.

[0376] In some aspects, the kidney disease is secondary nephropathy.

[0377] In some aspects, the kidney disease is hyperphophatemia.

[0378] In some aspects, the kidney disease is hyperkalemia.

[0379] In some aspects, the kidney disease is hyperuricemia.

[0380] In some aspects, the kidney disease is hypernatremia.

[0381] In some aspects, the kidney disease is chronic myeloid leukemia (CML).

[0382] In some aspects, the kidney disease is lupus nephritis.

[0383] In some aspects, the kidney disease is secondary to Alzheimer's disease (see, e.g., Fraile-Ramos, J., et al., International Journal of Molecular Sciences 25(11):6112 (June 2024)).

[0384] In some aspects, administration of the rAAV reduces kidney inflammation, reduces oxidative stress in a kidney, reduces or prevents kidney fibrosis, and treats or prevents AKI.

[0385] In some aspects, the subject suffers from chronic kidney disease (CKD).

[0386] In some aspects, the subject suffers from CKD-related fibrosis.

[0387] In some aspects, the kidney inflammation, the kidney oxidative stress, the kidney fibrosis, the AKI, and / or the CKD is not associated with diabetes, optionally, the subject does not suffer from diabetes.

[0388] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter or a CAG promoter.

[0389] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter.

[0390] In some aspects, the ubiquitous promoter comprises a CAG promoter.

[0391] In some aspects, the promoter is a liver specific promoter. In some aspects the liver specific promoter comprises a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, an apolipoprotein E promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter.

[0392] In some aspects, the viral expression construct further comprises one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

[0393] In some aspects, the polyadenylation signal is a SV40 polyA or a rabbit betaglobin polyA.

[0394] In some aspects, the AAV ITRs (e.g., a 5’ ITR and a 3’ ITR) are AAV2 serotype.

[0395] In some aspects, the administration is intramuscular.

[0396] In some aspects, the rAAV vector is injected into a muscle selected from the group consisting of quadriceps, gastrocnemius, tibialis, and any combination thereof.

[0397] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and / or a latissimus dorsi (lat). In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and / or a hamstring. In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a hamstring, or any combination thereof.

[0398] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis,a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and a latissimus dorsi (lat).

[0399] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and a hamstring.

[0400] In some aspects, the rAAV vector is administered as a single dose.

[0401] In some aspects, the rAAV vector is administered over multiple doses.

[0402] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence encoding an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1.

[0403] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, 5, 6, or 7.

[0404] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4.

[0405] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5.

[0406] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6.

[0407] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7.

[0408] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof encodes the amino acid sequence of SEQ ID NO: 1.

[0409] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 4.

[0410] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 5.

[0411] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 6.

[0412] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 7.

[0413] In some aspects, the rAAV comprises a polynucleotide having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14.

[0414] In some aspects, the methods disclosed herein comprise administering the rAAV vector in a total dose of about 1 x 1011vg / kg to about 1 x 1015vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1014vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 3 x 1012vg / kg to about 3 x 1013vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1013vg / kg. In some aspects the rAAV vector is administered in a total dose of about 3 x 1012vg / kg, about 4 x 1012vg / kg, about 5 x 1012vg / kg, about 6 x 1012vg / kg, about 7 x 1012vg / kg, about 8 x 1012vg / kg, about 9 x 1012vg / kg, about 1 x 1013vg / kg, about 1.5 x 1013vg / kg, about 2 x 1013vg / kg, about 2.5 x 1013vg / kg, about 3 x 1013vg / kg, about 3.5 x 1013vg / kg, about 4 x 1013vg / kg, about 4.5 x 1013vg / kg, or about 5 x 1013vg / kg. In some aspects the rAAV vector is administered in a total dose of about 1.2 x 1012vg / kg, about 3.8 x 1012vg / kg, about 1.2 x 1013vg / kg, or about 2.5 x 1013vg / kg.

[0415] In some aspects, the methods disclosed herein comprise administering the rAAV vector in a total dose of about 1 x 1013vg to about 1 x 1017vg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1014vg to about 1 x 1016vg. In some aspects, the rAAV vector is administered in a total dose of about 2 x 1014vg to about 3 x 1015vg. In some aspects, the rAAV vector is administered in a total dose of about 9.6 x 1013vg, about 3.0 x 1014vg, about 5.6 x 1014vg, about 9.6 x 1014vg, about 2.0 x 1015vg.IX. Methods of Treatment for Liver Diseases and MASH

[0416] Diabetic kidney disease is initiated by diabetes-related disturbances in glucose metabolism, which then trigger other metabolic, hemodynamic, inflammatory, and fibrotic processes that contribute to disease progression. Tuttle, K., et al., Kidney International 102:248-260 (2022). Diabetic kidney disease has a high global disease burden and substantially increases the risk of kidney failure and cardiovascular events. Id. Despite treatment, there is substantial residual risk of disease progression with existing therapies. Id.

[0417] Metabolic dysfunction-associated steatotic liver disease (MASLD) is the most common chronic hepatic disorder worldwide, reaching epidemic proportions with a prevalence of 11-37% among adult population. MASLD initiates as excessive accumulation of lipids in the liver that progresses towards severe metabolic dysfunction- associated steatohepatitis (MASH, formerly known as nonalcoholic steatohepatitis or NASH)), characterized by >5% hepatic steatosis with inflammation, hepatocyte injury, and fibrosis. In advanced stages, MASH is associated with severe liver disease, such as cirrhosis, hepatocellular carcinoma (HCC), and end-stage liver disease, and with increased mortality rate. The global epidemics of both obesity and type 2 diabetes (T2D) are important risk factors for MASH. In the United States and European Union, about 40 million people are afflicted by MASH.

[0418] People living with HIV (PLHIV) are particularly susceptible to developing MASLD, and it has become one of the leading causes of liver disease among this population. Pericas, J., et al., Lancet HIV 11 :e561-566 (2024); Van Eekeren, L., et al., eBioMedicine 109:105407-105422 (2024). Several factors contribute to the susceptibility of PLHIV developing MASLD, including, for example, chronic systemic inflammation and metabolic abnormalities derived from HIV infection, increased risk of liver steatosis and metabolic changes associated with some antiretroviral therapy (ART) drugs (e.g., lipodystrophy, changes in weight, and changes in lipid metabolism), and high incidence of viral hepatitis. These factors also may cause MASLD to progress to MASH at a higher rate in PLHIV than in the general population. Nonetheless, the mechanisms driving MASLD and MASH in PLHIV remain poorly understood, as PLHIV often are excluded from clinical research. Despite the increasing prevalence of MASH, until very recently no pharmacotherapies were available and was considered an unmet medical need. In March2024, the FDA approved resmetirom (Rezdiffra®), an oral thyroid hormone receptor agonist, under the accelerated approval pathway, for adults with MASH with moderate to advanced fibrosis. Nevertheless, in the phase 3 MAESTRO-NASH trial, the placebo- adjusted response rate for either primary endpoint at 52 weeks elicited by resmetirom was modest. Moreover, the molecular mechanisms underpinning improvement of MASH by resmetirom remain unclear and the safety of long-term use of resmetirom has not yet been assessed. Therefore, because of the heterogeneous nature of the disease and its high prevalence, more effective, and safe treatment modalities are needed for MASH.

[0419] Gene therapy may deliver transformative benefits for MASH patients. Adeno- associated viral (AAV) vector-based gene therapy has extensively proved to provide full therapeutic efficacy for rare monogenic diseases in the clinical setting. AAV vectors, derived from non-pathogenic viruses, are predominantly non-integrative and able to mediate multi-year production of therapeutic proteins after a single administration. The breakthroughs in genetic medicine for rare diseases have laid the groundwork for the development of AAV-based treatments for complex, polygenic, and highly prevalent metabolic diseases. In this case, gene therapy faces a new paradigm due to the challenge posed by the identification of potentially therapeutic genes.

[0420] Fibroblast growth factor 21 (FGF21) may be a promising candidate gene to revert MASH since it regulates energy homeostasis and exerts anti-inflammatory and anti- fibrotic effects in multiple tissues, including the liver. Moreover, liver or adipose tissue- directed AAV-FGF21 gene therapy enables a long-lasting increase in native FGF21 levels in circulation, resulting in sustained counteraction of obesity and insulin resistance in mice. However, in the clinical setting, mild to severe renal, liver and dorsal root ganglia toxicities, thrombotic microangiopathies, and heart and lung failure, leading in some cases to fatalities, have recently been documented following systemic administration of high doses of AAV vectors. In small and large animals, systemic AAV delivery has also raised concerns about the oncogenic potential of these vectors due to insertional mutagenesis in the liver. This is of particular importance in diseases such as MASLD and MASH, where there is already an increased risk for HCC. In marked contrast, animal and human data show that genetic engineering of skeletal muscle by intramuscular (IM) administration of AAV vectors of serotype 1 is safe, well tolerated, and leads to minimal systemic biodistribution. Skeletal muscle has additional advantages as a target tissue for AAV-mediated gene transfer since it is easily accessible by noninvasive procedures andenables efficient and long-term sustained expression of therapeutic proteins because of the low replication rate of myofibers. Up to date, durability in large animals and humans has been documented for 8 and 10 years, respectively. Moreover, gene delivery to muscle is not limited by the presence of preexisting neutralizing antibodies against AAV, a key aspect given the relatively high prevalence of anti-AAV antibodies in the general population.

[0421] Certain aspects of the present disclosure provide a method for treatment and / or prevention of diabetic kidney disease in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector for expression of a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter), wherein subject suffers from diabetes.

[0422] Certain aspects of the disclosure are directed to a method of treatment and / or prevention of a Metabolic dysfunction-associated steatotic liver disease (MASLD) in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector for expression of a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter). In some aspects, the MASLD is not associated with diabetes. In some aspects, the subject does not suffer from diabetes.

[0423] In some aspects, the subject is positive for a Human Immunodeficiency Virus (HIV) infection. In some aspects, the subject has chronic systemic inflammation and / or metabolic abnormalities derived from the HIV infection. In some aspects, the subject is being treated or has been treated with an antiretroviral therapy (ART). In some aspects, the MASLD (e.g., MASH) is associated with HIV infection and / or ART toxicity. In some aspects, the subject further suffers from viral hepatitis (e.g., chronic viral hepatitis).

[0424] In some aspects, the subject is HIV positive and suffers from MASLD (e.g., MASH). In some aspects, the MASLD (e.g., MASH) is associated with or secondary to a HIV infection. In some aspects, the MASLD (e.g., MASH) is associated with or secondary to treatment with one or more antiretroviral therapy (ART) drugs.

[0425] Metabolic dysfunction-associated steatotic liver disease (MASLD) is also known in the art as nonalcoholic fatty liver disease or NAFLD.

[0426] In some aspects, the MASLD is metabolic dysfunction-associated steatohepatitis (MASH). Metabolic dysfunction-associated steatohepatitis (MASH) is also known as Non-alcoholic steatohepatitis (NASH).

[0427] In some aspects, the subject is suffering from hepatic steatosis.

[0428] In some aspects, the subject is suffering from liver inflammation, hepatocyte injury, and liver fibrosis.

[0429] In some aspects, the subject is Human Immunodeficiency Virus (HIV) positive. In some aspects, the subject is suffering from an HIV infection. In some aspects, the MASLD, e.g., MASH, is associated with or secondary to the HIV infection.

[0430] In some aspects, the subject is being treated with or has been treated with an antiretroviral therapy (ART) drugs, e.g., for an HIV infection. In some aspects, the antiretroviral drug is a nucleoside reverse transcriptase inhibitor (NRTI), a nucleotide reverse transcriptase inhibitor (NtRTI), a non-nucleoside reverse transcriptase inhibitor (NNRTI), a protease inhibitor (PI), an integrase inhibitor (INSTI), a fusion inhibitor (FI), a chemokine receptor antagonist (e.g., a CCR5 antagonist), an entry inhibitor (e.g., a CD4-directed post-attachment inhibitor), or any combination thereof.

[0431] In some aspects, the MASH is associated with severe liver disease, cirrhosis, hepatocellular carcinoma (HCC), or end-stage liver disease.

[0432] In some aspects, the subject has diabetes.

[0433] In some aspects, the subject has increased expression levels of the macrophagespecific markers, such as MAC2, CD68 antigen (Cd68), and / or adhesion G protein- coupled receptor El (Adgrel, also known as F4 / 80).

[0434] In some aspects, the subject has increased expression levels of cytokines involved in Hepatic stellate cell activation, such as alpha-smooth muscle actin (a-Sma), transforming growth factor beta 1 (Tgfb platelet derived growth factor alpha (Pdgfd), and platelet derived growth factor beta (Pt / g / Z>).

[0435] In some aspects, the subject has increased expression levels of pro-inflammatory cytokines, such as chemokine (C-C motif) ligand 2, 3 and 5 (Ccl2, Ccl3, Ccl5) and tumor necrosis factor alpha (Tnfd).

[0436] In some aspects, the subject has increased expression levels of collagen fibers involved in fibrosis, such as Collal and Col3al.

[0437] In some aspects, the subject has increased expression levels of genes involved in extracellular matrix deposition, such as matrix metalloproteinases 12 and 13 (Mmpl2 and 13) and tissue inhibitor of metalloproteinases 1 (Timpl).

[0438] In some aspects, the subject has increased expression of HCC markers such as alpha fetoprotein (Afp lymphocyte antigen 6 complex locus D U.y6d).jkeratin 19 (Krtl9 golgi membrane protein 1 (Golml') and Cd44.

[0439] In some aspects, the increased expression levels are relative to individuals who do not have a MASH or a MASLD.

[0440] In some aspects, the subject has a loss of insulin sensitivity.

[0441] In some aspects, the subject is obese.

[0442] In some aspects, the subjects were grouped by their body mass index (BMI, kg / m2) in class I (BMI, 30-34.9), class II (BMI, 35-39.9) and class III (BMI, >40), according to the World Health Organization classification.

[0443] In some aspects, the subject has a BMI between 30-34.9.

[0444] In some aspects, the subject has a BMI between 35-39.9.

[0445] In some aspects, the subject has a BMI above 40.

[0446] In some aspects, the FGF21 levels of the subject show are increased less than 2- fold relative to a lean individual.

[0447] In some aspects, after treatment with the rAAV vector of the present disclosure, the subject has increased expression of the thermogenic markers uncoupling protein 1 (Ucpl), cell death-inducing DNA fragmentation factor, alpha subunit-like effector A (Cidea) and elongation of very long chain fatty acids (FEN1 / Elo2, SUR4 / Elo3, yeast)- like 3 (Elovl3).

[0448] Certain aspects of the present disclosure provide a method for reducing liver inflammation in a subject in need thereof comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector for expression of a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. Insome aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter).

[0449] Certain aspects of the present disclosure provide a method for reducing liver fibrosis in a subject comprising administering (e.g., intramuscularly) to the subject a recombinant adeno-associated virus (rAAV) vector for expression of a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof. In some aspects, the rAAV vector comprises a vector genome and a capsid having an AAV1 serotype. In some aspects, the vector genome comprises inverted terminal repeats (ITRs) flanking a viral expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a promoter (e.g., a ubiquitous promoter).

[0450] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter or a CAG promoter.

[0451] In some aspects, the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter.

[0452] In some aspects, the ubiquitous promoter comprises a CAG promoter.

[0453] In some aspects, the promoter is a liver specific promoter. In some aspects the liver specific promoter comprises a hAAT promoter, a human thyroxine binding globulin (TBG) promoter, an apolipoprotein E / human alpha-antitrypsin (ApoE / hAAT) promoter, an apolipoprotein E promoter, a hepatic locus control region- 1 (HCR) promoter, or DC 172 promoter.

[0454] In some aspects, the viral expression construct further comprises one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

[0455] In some aspects, the polyadenylation signal is a SV40 polyA or a rabbit betaglobin polyA.

[0456] In some aspects, the AAV ITRs (e.g., a 5’ ITR and a 3’ ITR) are AAV2 serotype.

[0457] In some aspects, the administration is intramuscular.

[0458] In some aspects, the rAAV vector is injected into a muscle selected from the group consisting of quadriceps, gastrocnemius, tibialis, and any combination thereof.

[0459] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and / or a latissimus dorsi (lat). In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and / or a hamstring. In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a hamstring, or any combination thereof.

[0460] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a tricep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, a hamstring, a deltoid, a trapezius, a pectoral muscle (e.g., pectoralis major), and a latissimus dorsi (lat).

[0461] In some aspects, the muscle is selected from the group consisting of a quadricep, a bicep, a gastrocnemius (e.g., a calf muscle), a gluteus maximus, a vastus lateralis, a vastus medialis, and a hamstring.

[0462] In some aspects, the rAAV vector is administered as a single dose.

[0463] In some aspects, the rAAV vector is administered over multiple doses.

[0464] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence encoding an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1.

[0465] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4, 5, 6, or 7.

[0466] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4.

[0467] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5.

[0468] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6.

[0469] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7.

[0470] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof encodes the amino acid sequence of SEQ ID NO: 1.

[0471] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 4.

[0472] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 5.

[0473] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 6.

[0474] In some aspects, the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises the sequence of SEQ ID NO: 7.

[0475] In some aspects, the rAAV comprises a polynucleotide having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 14.

[0476] In some aspects, the methods disclosed herein comprise administering the rAAV vector in a total dose of about 1 x 1011vg / kg to about 1 x 1015vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1014vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 3 x 1012vg / kg to about 3 x 1013vg / kg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1013vg / kg. In some aspects the rAAV vector is administered in a total dose of about 3 x 1012vg / kg, about 4 x 1012vg / kg, about 5 x 1012vg / kg, about 6 x 1012vg / kg, about 7 x 1012vg / kg, about 8 x 1012vg / kg, about 9 x 1012vg / kg, about 1 x 1013vg / kg, about 1.5 x 1013vg / kg, about 2 x 1013vg / kg, about 2.5 x 1013vg / kg, about 3 x 1013vg / kg, about 3.5 x 1013vg / kg, about 4 x 1013vg / kg, about 4.5 x 1013vg / kg, or about 5 x 1013vg / kg. In some aspects the rAAV vector is administered in a total dose of about 1.2 x 1012vg / kg, about 3.8 x 1012vg / kg, about 1.2 x 1013vg / kg, or about 2.5 x 1013vg / kg.

[0477] In some aspects, the methods disclosed herein comprise administering the rAAV vector in a total dose of about 1 x 1013vg to about 1 x 1017vg. In some aspects, the rAAV vector is administered in a total dose of about 1 x 1014vg to about 1 x 1016vg. In some aspects, the rAAV vector is administered in a total dose of about 2 x 1014vg to about 3 x 1015vg. In some aspects, the rAAV vector is administered in a total dose of about 9.6 x 1013vg, about 3.0 x 1014vg, about 5.6 x 1014vg, about 9.6 x 1014vg, about 2.0 x 1015vg.

[0478] The following examples are illustrative and are not intended to limit the full scope of the claimed aspects.EXAMPLESExample 1. AAV1-CMV-FGF21 constructRecombinant AAV vectors.

[0479] AAV expression cassettes were obtained by cloning, between the ITRs of AAV2, the murine, canine or human optimized FGF21 coding sequences (e.g., SEQ ID NOs: 4- 11) under the control of the cytomegalovirus (CMV) promoter. Single-stranded AAV1 vectors were produced by triple transfection in HEK293 cells and purified using an optimized CsCl gradient-based purification protocol that renders vector preps of high purity with negligible amounts of empty capsids. Viral genome titers were determined by PicoGreen, using phage lambda DNA to generate the standard curve.Example 2. Effects of intramuscular AAV1-FGF21 on kidney damage and kidney inflammation in aged healthy male mice.

[0480] A dose of 3xl0nviral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFgf21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) was administered into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs of thirteen-months-old C57BL / 6J male mice, which were followed up to 21 months of age. A littermate control group were administered the same dose of null vectors (AAVl-null) intramuscularly at thirteenmonths of age and followed up to 21 months. Another cohort of seven-months-old C57BL / 6J male mice were used as young controls.

[0481] FIG. 1A provides kidney weight of mice at 7, 21, or 26 months of age (n=5- 8 / group). In kidney samples from 7, 21, or 26-months-old mice (n=5-8 / group), quantification by qRT-PCR of the expression of key genes was performed. FIG. IB and FIG. 1C provide expression levels of kidney damage gene markers: Kidney Injury Molecule 1 (Kimi) (FIG. IB) and Lipocalin 2 (Lnc2) (FIG. 1C). FIG. 1D-1G provide expression levels of inflammatory gene markers: F4 / 80 (FIG. ID), Monocyte chemotactic protein 1 (Mcpl) (FIG. IE), Tumor necrotic factor alpha (Tnfla) (FIG. IF), and Transforming growth factor beta-1 (Tgfb) (FIG. 1G). FIG. 1H- IK provide expression levels of fibrosis markers: fibronectin (Fn) (FIG. 1H), Collagen type I alpha (Collal) (FIG. II), Collagen type III alpha (Col3al) (FIG. 1 J), and Collagen type IV alpha (Col4al) (FIG. IK). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***p<0 001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. FC, Fold change, thirteen-months-old.

[0482] Additionally, FIGs. 22A-22B show muscle-derived FGF21 counteracts glomerulus expansion in treated mice. Thirteen-months-old C57BL / 6J male mice were administered into skeletal muscle with a dose of 3xl0nvg / mouse of AAV1-FGF21 and followed up to 21- or 26-months of age. Two littermate control groups were administered intramuscularly at thirteen months of age with the same dose of AAVl-null and followed up to 21- or 26-months. Another cohort of 7-months-old mice were used as young controls. FIG. 22A shows glomerulus area (n=4-5 / group). FIG. 22B shows representative images of Picrosirius Red staining of kidney sections showing kidney fibrosis in red. Data are presented as mean ± SEM. *P<0.05, **P<0.01 by one-way analysis of variance (ANOVA) with Dunnet’s multiple comparison test.

[0483] The data shows that aged healthy mice treated with an intramuscular injection of AAV1-FGF21 show decreased levels of kidney damage gene markers and inflammatory gene markers. Furthermore, the data shows that glomerulus expansion is counteracted in AAV1-FGF21 mice relative to control and AAVl-null treated mice at both 21 and 26 months.Example 3. Effects on kidney damage and fibrosis of AAV1-FGF21 intramuscular administration in HFD-fed female mice.

[0484] Eight-week-old C57BL / 6J female mice were fed ad libitum with a HFD. At 20 weeks of age, a dose of 3xl0nviral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFgf21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) were administered into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs. Mice remained in HFD feeding up to 50 weeks of age. Non-injected littermate mice were fed ad libitum with chow or HFD to be used as controls.

[0485] FIG. 2A provides kidney weight at 50 weeks of age (n=6-9 / group). In kidney samples from 50-week-old mice (n=6-9 / group), quantification by qRT-PCR of the expression of key genes was performed. FIGs. 2B-2C provide expression levels of kidney damage gene markers: Kidney Injury Molecule 1 (Kimi) (FIG. 2B) and Lipocalin 2 (Lnc2) (FIG. 2C). FIGs. 2D-2F provide expression levels of inflammatory gene markers: F4 / 80 (FIG. 2D), Monocyte chemotactic protein 1 (Mcpl) (FIG. 2E) and Tumor necrotic factor alpha (Tnfla) (FIG. 2F). FIGs. 2G-2I provide expression levels of fibrosis gene markers: Collagen type I alpha (Collal) (FIG. 2G), Collagen type III alpha (Col3al) (FIG. 2H) and Fibronectin (Fn) (FIG. 21). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 by one-way analysis of variance (ANOVA) with Tukey's multiple comparison test. FC, Fold change.

[0486] The data shows that HFD-fed female mice treated with an intramuscular injection of AAV1-FGF21 show decreased levels of kidney damage gene markers and fibrosis gene markers compared to untreated mice of the same age, fed the same diet.Example 4. Effects on kidney inflammation and fibrosis of AAV1-FGF21 intramuscular administration in HFD-fed male mice.

[0487] Eight-week-old C57BL / 6J male mice were fed ad libitum with a HFD. At 28 weeks of age, a dose of 3xl0nviral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFgf21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) were administered into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs. Mice remained in HFD feeding up to 50 weeks of age. Non-injected ad libitum HFD-fed littermate mice were used as controls.

[0488] FIG. 3A provides kidney weight at 50 weeks of age (n=9-10 / group). In kidney samples from 50-week-old mice (n=7-8 / group), quantification by qRT-PCR of the expression of key genes was performed. FIGs. 3B-3C provide expression level of inflammatory gene markers: Monocyte chemotactic protein 1 (Mcpl) (FIG. 3B) and Tumor necrotic factor alpha (Tnfla) (FIG. 3C). FIGs. 3D-3F provide expression levels of fibrosis gene markers: Collagen type I alpha (Collal) (FIG. 3D), Collagen type III alpha (Col3al) (FIG. 3E) and Fibronectin (Fn) (FIG. 3F). Data are presented as mean ± SEM. *P<0.05, **P<0.01, ***P<0.001 by Student's two-tailed t test. FC, Fold change.

[0489] The data shows that HFD-fed male mice treated with an intramuscular injection of AAV1-FGF21 show decreased levels of inflammatory gene markers and fibrosis gene markers compared to untreated mice of the same age, fed the same diet.Example 5. Effects of intramuscular administration of AAV1-FGF21 in kidney inflammation and fibrosis of db / db male mice.

[0490] Nine-week-old db / db male mice were administered intramuscularly with a dose of 3xl0nviral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFgf21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs, and followed up to 35 weeks of age. Non-injected db / db littermate mice were used as controls. In kidney samples from 35-week-old mice (n=7-8 / group), quantification by qRT-PCR of the expression of key genes was performed.

[0491] FIGs. 4A-4B provide expression levels of kidney damage gene markers: Kidney Injury Molecule 1 (Kimi) (FIG. 4A) and Lipocalin 2 (Lnc2) (FIG. 4B). FIGs. 4C-4E provide expression levels of inflammatory gene markers: F4 / 80 (FIG. 4C), Mcpl (FIG. 4D) and Tnfla (FIG. 4E). FIGs. 4F-4K provide expression levels of fibrosis gene markers: Transforming growth factor betal (Tgflb) (FIG. 4F), Collagen type I alpha (Collal) (FIG. 4G), Collagen type III alpha (Col3al) (FIG. 4H), Collagen type IV alpha (Col4al) (FIG. 41), Fibronectin (Fn) (FIG. 4 J) and Connective tissue growth Factor (Ctgf) (FIG. 4K). Data are presented as mean ± SEM. *P<0.05, ***P<0.001 by Student's two-tailed t test. FC, Fold change.

[0492] The data shows that db / db male mice treated with an intramuscular injection of AAV1-FGF21 show improved levels of inflammatory gene markers and fibrosis gene markers compared to untreated mice of the same age, fed the same diet.

[0493] FIGs. 23A-23B show muscle-derived FGF21 counteracted kidney fibrosis and glomerulus hypertrophy in db / db mice. FIG. 23A shows representative images of Picrosirius Red staining of kidney sections showing kidney fibrosis in red. FIG. 23B shows glomerulus area (n=4-6 / group). Data are presented as mean ± SEM. ***P<0.001 by Student’s two-tailed t test. Taken together, FIGs. 23A-23B show that glomeruli size was reduced in AAV-FGF21 treated mice, which suggests reduced fibrosis in the kidney.Example 6. Effects of intramuscular administration of AAV1-FGF21 in kidney oxidative stress of db / db male mice.

[0494] Nine-week-old db / db male mice were administered intramuscularly with a dose of 3xl0nviral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFgf21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs, and followed-up to 35 weeks of age. Non-injected db / db littermate mice were used as controls. In kidney samples from 35-week-old mice (n=7-8 / group), quantification by qRT-PCR of the expression of key genes was performed.

[0495] FIGs. 5A-5C provide expression levels of oxidative stress gene markers: NADPH oxidase 2 (Nox2) (FIG. 5A), NADPH Oxidase 4 (Nox4) (FIG. 5B) and inducible nitric oxide synthase (iNos) (FIG. 5C). FIGs. 5D-5G provide expression levels of antioxidant gene markers: Glutathione-Disulfide Reductase (Gsr) (FIG. 5D), Glutathione Peroxidase 1 (Gpxl) (FIG. 5E), Catalase (Cat) (FIG. 5F) and Superoxide Dismutase 1 (Sodl) (FIG. 5G). Data are presented as mean ± SEM. *P<0.05, **P<0.01, by Student's two-tailed t test. FC, Fold change.

[0496] The data shows that db / db male mice treated with an intramuscular injection of AAV1-FGF21 show decreased levels of oxidative stress gene markers and increased levels of antioxidant gene markers.Example 7. High fat diet feeding induces MASH in mice

[0497] The following methods were used for the mouse studies in Examples 7-13.Animals.

[0498] C57Bl / 6J01aHsd and B6.V-Lepob / OlaHsd (ob / ob) male and female mice were used. Mice were kept in a specific pathogen-free facility and maintained under a light—dark cycle of 12 h at 22°C. Mice were fed ad libitum with a standard diet (2018S Teklad Global Diets®, Envigo) or a high-fat diet (TD.88137 Teklad, Envigo). When stated, mice were fasted for 16 h. For tissue sampling, mice were anesthetized with inhalational anesthetic isoflurane and decapitated. Tissues of interest were excised and kept at -80°C or in formalin until analysis. Male Beagle dogs were fed once daily at 9:00 AM with dry food (Elite Nutrition, Nestle). Dogs' health was monitored through clinical, hematological, and biochemical examination and sacrificed by administration of a lethal dose of pentobarbital.AAV-FGF21 intramuscular administration.

[0499] Mice were anesthetized with an intraperitoneal injection of ketamine (100 mg / kg) and xylazine (10 mg / kg). Hindlimbs were shaved, and AAV vectors were intramuscularly administered in a volume of 180 pl divided into six injection sites distributed between quadriceps, gastrocnemius and tibialis cranialis of each hindlimb. AAV delivery in dogs was performed as previously described. Briefly, animals were anesthetized and AAV vectors were delivered to a total of 33-40 sites (IxlO12vg per site) in each hindlimb, distributed on the lateral aspect of the thigh (isquiotibialis muscles) (with a five-prong needle syringe (Meso-relle, Biotekne SRL)) and the tibialis anterior muscle (single point injections). Throughout the procedure, temperature, cardiac and respiratory frequency, arterial pressure, pulse, and electrocardiography were monitored using a multifunctional patient Vet Care monitor (B. Braun Medical).Insulin tolerance test.

[0500] For insulin tolerance test (ITT), insulin (Humulin Regular; Eli Lilly) was injected intraperitoneally to fed mice at a dose of 0.75 lU / kg body weight. Glycemia was measured in tail vein blood samples at the indicated time points.Indirect calorimetry.

[0501] An indirect open circuit calorimeter (Oxylet, Panlab) was used to monitor O2 consumption and CO2 production. Mice were individualized and acclimated to the metabolic chambers for 24 h, and data were collected in each cage for 5 min, every 45 min, for 24 h, during the light and dark cycles and adjusted by body weight.Open-field test.

[0502] The open-field test was performed between 9:00 am and 1 :00 pm as previously reported (Haurigot et al, 2013). Briefly, animals were placed in a corner of a square area surrounded by high white walls (45x45x40 cm) and motor and exploratory activities were evaluated during the first 6 minutes using a video tracking system (SMART Junior; Panlab).Grip Strength Test.

[0503] A grip strength test meter (Panlab) was used to assess forelimb grip strength. The grip strength meter was positioned horizontally, and mice were held by the tail and lowered towards the apparatus. Animals were allowed to grasp the metal bar with their front paws and were then pulled backwards in the horizontal plane. The force applied to the bar just before it lost grip was recorded as the peak tension. The average of 3 trials was analyzed.Rotarod test.

[0504] Mice were placed on a rotating rod (Panlab), spinning at 4 RPM. Lane width, 50 mm; rod diameter, 30 mm. Once stabilized, mice were subjected to an incrementally increasing speed from 4 to 40 RPM in 5 minutes. The first day of the experiment was used to train the animals in the use of the device. Each animal underwent 3 trials. The length of time that the mice managed to remain on the rod was recorded. Then, animals underwent 1 day resting and the third day, mice took 3 more trials on the rod. The average of 3 trials was analyzed.Novel Object Recognition Test.

[0505] The novel object recognition tests were conducted in the open field box. Open- field test was used to acclimatize the mice to the box. The next day, to conduct the first trial, two identical objects (A and B) were placed in the upper right and upper left quadrants of the box, and then mice were placed backwards to both objects. After 10 minutes of exploration, mice were removed from the box, and allowed for 10 minutes break. In the second trial, one of the identical objects (A and B) was replaced with object C (new object). Mice were then put back into the box for a further 10 minutes of exploration. The amount of time animals spent exploring the novel object was recordedand evaluated using a video tracking system (SMART Junior; Panlab). The evaluation of novel object recognition test memory was expressed as a percentage of the discrimination ratio calculated according to the following formula: Discrimination ratio (%) = (N- F) / (N+F)xlOO%, where N represents the time spent in exploring the new object and F represents the time spent in exploring the same object.Hormone and metabolite assays.

[0506] Hepatic triglyceride and cholesterol content were determined by chloroform: methanol (2: 1 vol / vol) extraction of total lipids. Triglycerides, cholesterol and ALT were quantified spectrophotometrically using an enzymatic assay (Horiba-ABX) in a Pentra 400 Analyzer (Horiba-ABX). Glycemia was determined using a Glucometer EliteTM (Bayer). Serum insulin, glucagon, FGF21, adiponectin and leptin levels in mice were determined using Rat Insulin ELISA kit (90010, Crystal Chem), Mouse Glucagon ELISA (81518, Crystal Chem), Mouse / Rat FGF-21 ELISA kit (MF2100, R&D Systems), Mouse Adiponectin ELISA kit (80569, Crystal Chem) and Mouse Leptin ELISA kit (90030, Crystal Chem), respectively. Serum insulin and FGF21 levels in human samples were determined by Human insulin ELISA kit (90095, Crystal Chem) and Human FGF-21 ELISA kit (DF2100, R&D Systems). Canine adiponectin in serum was measured with the Human adiponectin ELISA High sensitivity kit (RD191023100, BioVendor Group), which has been previously validated for reliably measurement of canine adiponectin. Serum FGF21 levels in dogs remained undetectable when measured with four different canine FGF21 ELISAs (E08F0016, Blue Gene; MBS028669, MyBiosource; ABIN1053687, Antibodies-online; KT-100218, Kamiya Biomedical Company). Experiments performed in vitro demonstrated that canine FGF21 activity in the cell media could be identified in a manner similar to that of human FGF21 using the cell-based reporter gene assay iLite® FGF21 assay ready cells (BM3071, Svar Life Science) (FIG. 21). Therefore, biologically active canine FGF21 in circulation was evaluated using this assay.Histology and immunohistochemistry.

[0507] Tissues were fixed for 12-24 h in 10% formalin, embedded in paraffin and sectioned. Sections were incubated overnight at 4°C with rat anti-MAC2 (1 :50; CL8942AP; Cedarlane), guinea pig anti-insulin (1 : 100; 1-8510; Sigma-Aldrich) or rabbitanti-laminin (1 :200; Abl l575; Abeam). Biotinylated rabbit anti-rat (1 :300; E0467;Dako), rabbit anti-guinea pig coupled to peroxidase (1 :300; P0141; Dako) or goat antirabbit (Alexa Fluor 488-conjugated) (1 : 100; Al 1008; Molecular probes), were used as secondary antibodies. The ABC peroxidase kit (Pierce) was used for immunodetection, and sections were counterstained in Mayer's hematoxylin. Hoechst (B2261; Sigma- Aldrich) was used for nuclear counterstaining of fluorescent specimens. Hepatic fibrosis was assessed by the percentage of the PicroSirius Red-positive area quantified in 10 randomly selected lOO fields per liver section. Morphometric analysis of adipocyte size was performed in eWAT sections stained with hematoxylin-eosin. P-cell mass was determined in insulin-stained pancreas sections as previously described.RNA analysis.

[0508] Total RNA was obtained from different tissues using isolation reagent (Tripure, Roche and QIAzol, Qiagen co.) and a RNeasy Minikit (Qiagen) and treated with DNase I (Qiagen). For gene expression quantification, one microgram of RNA was reverse- transcribed using the Transcriptor First Strand cDNA Synthesis kit (Roche). Real-time quantitative PCR was performed in a Lightcycler (Roche) using the Lightcycler 480 SyBr Green I Master Mix (Roche) and primers or Taqman Probes Master (Roche) and the primers and probes. Data were normalized to RplpO expression.Statistical analysis.

[0509] Statistics were calculated using GraphPad Prism. Statistical significance was calculated using a one-way analysis of variance (ANOVA) with Tukey's, Dunnett's or Bonferroni multiple comparison test and Student's two-tailed t test. For comparisons involving several time points, ANOVA Bonferroni test was used to compare the different groups. Differences were considered significant when E < 0.05.Results.

[0510] Eight-week-old wild-type male mice were fed a high fat diet (HFD) for 12, 18, or 29 weeks to determine MASH development. Already after 12 weeks on HFD, mice became highly obese, showed enlarged liver, and severe hepatic steatosis with markedly increased hepatic triglycerides and cholesterol content (FIG. 6A-6E). Moreover, as soon as 12 weeks after HFD feeding, immunostaining of liver sections with the macrophage-specific marker MAC2 showed marked macrophage infiltration and, in agreement, the hepatic expression levels of the macrophage cell markers CD68 antigen (Cd68) and adhesion G protein-coupled receptor El (Adgrel, also known as F4 / 80) were also highly increased (FIG. 6E-6G). Consistent with development of severe inflammation, marked hepatic fibrosis by PicroSirius Red staining and also increased expression of the fibrosis markers collagen-type 1 alpha and -type 3 alpha (Collal and Coldal) were observed in the liver already after 12 weeks on HFD (FIG. 6E, 6H, 61, respectively). Hepatic stellate cells (HSCs) are the primary fibrogenic cells involved in the progression of liver fibrosis in MASLD. During this process, HSCs become activated and acquire a myofibroblastlike phenotype characterized by expression of alpha-smooth muscle actin (a-Sma). HFD- fed mice also showed markedly increased expression of a-Sma in the liver (FIG. 6J). All these results demonstrated severe hepatic steatosis, inflammation, and fibrosis in HFD-fed mice, consistent with MASH development.Example 8. Reversal of hepatic steatosis in HFD-fed mice treated with AAV-FGF21 vectors

[0511] Male mice were fed a HFD for 20 weeks to induce MASH (FIG. 7A). Twenty- eight-week-old obese animals were then treated IM (quadriceps, gastrocnemius, and tibialis muscles of both hindlimbs) with a dose of 3xl0nviral genomes (vg) / mouse of AAV vectors of serotype 1 encoding a murine optimized Fgf21 coding sequence (moFGF21) under the control of the cytomegalovirus (CMV) promoter (AAV-FGF21) (FIG. 7A). To assess therapeutic efficacy, two cohorts of AAV-FGF21 treated mice were maintained on HFD up to either 50 or 70 weeks of age. As controls, untreated chow- and HFD-fed mice were used. Mice treated with AAV-FGF21 showed a progressive reduction of body weight up to 40 weeks of age, remaining indistinguishable from chow-fed mice thereafter, consistent with complete reversal of obesity (FIG. 7A). From week 28 to 50 and 70 of age, body weight of HFD-fed non-treated mice increased 18% and 30%, respectively, while that of animals treated with AAV-FGF21 decreased about 30% (FIG. 7B).

[0512] Although HFD-fed untreated mice showed increased FGF21 serum levels compared to chow-fed mice (FIG. 7C), this increase was not able to decrease their body weight gain (FIG. 7A, 7B). Normalization of the obese phenotype resulted from about 10-fold increased circulating FGF21 levels achieved after treatment of HFD-fed micewith AAV-FGF21 (FIG. 7C). Serum FGF21 was derived from specific expression of moFGF21 in the genetically engineered skeletal muscles (FIG. 7D). As a result of the IM administration of AAV1 vectors, moFGF21 expression was not detected in other tissues, such as the liver (FIG. 7D), as previously observed for other transgenes. In agreement with increased serum FGF21, expression of the FGF21 co-receptor P-klotho (Klb), which is essential for FGF21 signaling, was markedly increased in the liver of AAV-FGF21- treated mice (FIG. 7E).

[0513] Hepatomegaly was also normalized in HFD-fed AAV-FGF21 -treated animals (FIG. 7F-7H). Consistent with this, histological analysis of liver sections of HFD-fed mice revealed marked hepatic steatosis, that was fully reverted after treatment with AAV- FGF21 (FIG. 7G). This was parallel to a reduction in the liver triglyceride and cholesterol content (FIG. 71, 7 J). In agreement with reversal of hepatic steatosis, the activity levels of the hepatic injury markers alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were normalized in AAV-FGF21-treated mice (FIG. 7K, 7L). All these results demonstrated that IM treatment with 3xl0nvg of AAV-FGF21 vectors mediated full therapeutic benefit against fatty liver disease. Similarly, a marked reduction in body and liver weights and counteraction of hepatic steatosis were observed in HFD- fed female mice and also in ob / ob male and female mice treated with the same dose of AAV-FGF21 vectors (FIG. 10A-10E and FIG. 11A-11K).Example 9. Treatment with AAV-FGF21 reverts hepatic inflammation and fibrosis and halts development of liver tumors

[0514] Immunostaining of liver sections of untreated HFD-fed male mice with MAC2 showed marked macrophage infiltration, which was not detected in HFD-fed AAV- FGF21-treated animals (FIG. 8A). The lack of hepatic inflammation in these mice was parallel to normalization of expression levels of the macrophage markers Cd68 and F4 / 80, and of pro-inflammatory cytokines, such as chemokine (C-C motif) ligand 2, 3 and 5 (Ccl2, Ccl3, Ccl5) and tumor necrosis factor alpha (Tnfd) (FIG. 8B-8G). Moreover, AAV-mediated FGF21 gene therapy fully reverted hepatic fibrosis. Collagen fibers were highly abundant in the liver of old HFD-fed mice because of the very advanced fatty liver disease (FIG. 9A, 9B) In agreement, expression levels of Collal and Col3al were highly increased in non-treated HFD-fed mice and normalized in AAV-FGF21-treated mice (FIG. 9C, 9D) Likewise, HFD-fed female mice and ob / ob male and female micetreated IM with AAV-FGF21 vectors also showed counteraction of liver inflammation and fibrosis (FIG. 10E-10G and FIG. 11K-11M).

[0515] In agreement with reversal of fibrosis, AAV-FGF21 -treated male mice normalized the expression of genes involved in extracellular matrix deposition, including matrix metalloproteinases 12 and 13 (Mmpl2 and 13) and tissue inhibitor of metalloproteinases 1 (Timpl) (FIG. 9E-9G). Moreover, expression of the activated HSC marker a-Sma and of key cytokines involved in HSCs activation, such as transforming growth factor beta 1 (Tgfb) and platelet derived growth factor alpha and beta (Pdgfa and Pdgfb), was similar to those of old healthy chow-fed mice (FIG. 9H-9K). Altogether these findings indicated that the serum increase of muscle-derived FGF21 levels mediated MASH resolution.

[0516] Long-term feeding with HFD has also been associated with late-stage progression of MASH and increased incidence of liver tumors in C57BL / 6J mice. While all the control HFD-fed mice developed liver tumors by 70 weeks of age (5 / 5), animals treated with AAV-FGF21 vectors were protected from HFD-induced development of liver neoplasms (0 / 9). None of the chow-fed mice developed tumors during the follow-up period. Consistent with these results, HFD feeding induced a progressive expression of HCC markers, such as alpha fetoprotein (Ajp), lymphocyte antigen 6 complex locus D (I.y6d . keratin 19 (Krtl9 golgi membrane protein 1 (Golml') and Cd4440, in non- tumoral liver parenchyma, that was completely normalized in HFD-fed mice treated with AAV-FGF21 vectors (FIG. 9L-9P). All these results confirmed that treatment with AAV-FGF21 precluded progression from MASH to cirrhosis and HCC.Example 10. AAV-FGF21 treatment mediates reversal of WAT hypertrophy and inflammation

[0517] As observed with MASH development, by 12 weeks after feeding with HFD, increased fat accumulation in visceral and subcutaneous white adipose tissue (WAT) and brown adipose tissue (BAT), and the weight of the main WAT and BAT depots were observed (FIG. 12A-12D) As expected, this paralleled the severe macrophage inflammation of WAT and the markedly increased circulating levels of leptin, a key adipokine positively correlating with the amount of body fat that also exerts profibrogenic effects in the liver (FIG. 12E-12G). Therefore, by the time of treatment with AAV- FGF21 vectors at 28 weeks of age, HFD-fed animals had already developed severe adipose tissue alterations.

[0518] AAV-FGF21 gene therapy normalized the size of white adipocytes and weight of the epidydimal, inguinal, mesenteric and retroperitoneal WAT depots (FIG. 13A-13D and FIG. 12H-12J). Moreover, in contrast to untreated HFD-fed mice, AAV-FGF21- treated animals also normalized serum leptin and showed a marked increase in levels of circulating adiponectin (FIG. 13E, 13F). Adiponectin is known to exert antiinflammatory, anti-steatotic, anti-fibrotic, and insulin-sensitizing effects that will further contribute to FGF21 therapeutic benefits.

[0519] Adipocyte hypertrophy in non-treated HFD-fed mice resulted in severe macrophage inflammation of epidydimal WAT (eWAT) evidenced by increased presence of "crown-like" structures, which were absent in mice treated with AAV-FGF21 vectors (FIG. 13A) Moreover, the expression of the inflammatory markers Cd68, F4 / 80 and Tnfa was normalized (FIG. 13G-13I). Similar observations were made in HFD-fed female mice treated with AAV-FGF21 vectors (FIG. 14A-14D) Therefore, all these results demonstrated that IM AAV-FGF21 gene therapy was able to revert WAT hypertrophy and inflammation.Example 11. AAV-FGF21 gene therapy increases energy expenditure

[0520] Despite a slight increase in food intake (FIG. 15A), normalization of body weight in AAV-FGF21 -treated HFD-fed mice agreed with increased energy expenditure (FIG. 15B), which likely resulted from both enhanced non-shivering thermogenesis and increased locomotor activity. Non-treated HFD-fed mice showed increased fat accumulation and weight of interscapular BAT (iBAT), normalized in HFD-fed mice treated with AAV-FGF21 vectors (FIG. 15C, 15D). Moreover, markedly increased expression of the thermogenic markers uncoupling protein 1 (Ucpl cell death-inducing DNA fragmentation factor, alpha subunit-like effector A (Cided) and elongation of very long chain fatty acids (FEN1 / Elo2, SUR4 / Elo3, yeast)-like 3 (Elovl3) was also observed in the AAV-FGF21 -treated mice (FIG. 15E-15G), consistent with enhancement of nonshivering thermogenesis. Similar results were obtained in HFD-fed female mice treated with FGF21 -encoding vectors (FIG. 14E-14I).

[0521] The degree of spontaneous locomotor activity of 70-week-old HFD-fed mice treated with AAV-FGF21 was higher than that of age-matched control HFD- and chow- fed counterparts in the open-field test. These mice travelled more distance, moved more time and at higher velocity, rested less time and spent more time doing fast and slowmovements than untreated controls (FIG. 15H-15N). Moreover, locomotor activity of AAV-FGF21 -treated animals resembled that of non-treated young chow-fed animals (8 weeks of age) (FIG. 15H-15N). This test also revealed that treatment with AAV-FGF21 reverted the anxiety observed in HFD-fed obese mice. Compared with their age-matched chow-fed counterparts, the time in the central zone was increased and the first entry in the center decreased in AAV-FGF21 treated mice, which performed similarly to young lean animals (FIG. 15O-15P). Normal skeletal muscle weight and morphology and no signs of muscle pathology or inflammation were documented in AAV-treated animals (FIG. 16A, 16B) Similar results were also obtained in AAV-FGF21 -treated HFD-fed female mice (FIG. 14J-14O and FIG. 16C, 16D)

[0522] Altogether, these results proved the pivotal role of AAV-derived increased circulating FGF21 levels to induce energy expenditure in obesogenic conditions.Example 12. Improved insulin sensitivity by AAV-FGF21 gene therapy

[0523] MASH and obesity are tightly associated with insulin resistance. Hyperinsulinemia and mild hyperglycemia of non-treated HFD-fed male mice were normalized in AAV-FGF21 -treated mice (FIG. 17A, 17B and FIG. 16E, 16F). To confirm the increased insulin sensitivity of FGF21 -treated animals, an intraperitoneal insulin tolerance test (ITT) was performed. As expected, HFD-fed mice showed loss of insulin sensitivity whereas animals treated with AAV-FGF21 showed greater insulin sensitivity than chow-fed controls (FIG. 17C). Similarly, treatment of HFD-fed female mice with AAV-FGF21 also resulted in improved insulin sensitivity (FIG. 16G-16I). Moreover, treatment with AAV-FGF21 counteracted the islet hyperplasia induced in insulin resistance conditions and decreased circulating levels of glucagon compared with HFD-fed control mice (FIG. 17D-17F).Example 13. AAV-FGF21 treatment improves neuromuscular performance and cognition in HFD-fed mice

[0524] Obesity and insulin resistance are associated with impaired neuromuscular function, locomotor activity and coordination, anxiety-like behavior, and deficits in cognitive function in animal models and also in humans. MASLD is also associated with cognitive impairment, worsening in patients with higher risk of liver fibrosis. In this regard, treatment of HFD-fed obese mice with AAV-FGF21 vectors counteractedneuromuscular and cognitive decline (FIG. 17G-17J). These mice displayed increased muscle strength and were able to stay longer on the accelerating rotarod than untreated HFD-fed counterparts, demonstrating improved coordination and balance (FIG. 17G, 17H). Moreover, treated mice outperformed untreated HFD-fed mice in the novel object recognition test, these mice showed increased exploration time for the new object compared to HFD-fed non-treated mice and had a discrimination index equivalent to that of control chow-fed animals (FIG. 171, 17J), indicating prevention of memory loss. All these therapeutic benefits may result from direct FGF21 effects on the brain, since native FGF21 can cross the blood-brain barrier, and also from AAV-FGF21-mediated normalization of obesity, liver and adipose tissue inflammation, circulating leptin levels and insulin resistance, whose alterations trigger detrimental effects on brain function.Example 14. Treatment of Beagle dogs with AAV-FGF21 vectorsClinical laboratory and hematological parameters in dogs.

[0525] General lab parameters were measured by spectrophotometry with a Cobas Mira Analyzer (Roche). Hematological parameters were determined using a SCIL VetABC haematology analyzer.Vector genome copy number.

[0526] Dog skeletal muscle and liver samples were digested overnight (ON) at 56°C in 300 pL of Tissue Lysis Solution with Proteinase K (0.2 mg / mL). Total DNA was isolated from supernatants with MasterPure DNA Purification Kit (Lucigen). DNA was extracted following manufacturer's instructions and resuspended in distilled water and quantified with NanoDrop ND- 1000 spectrophotometer (Thermo Fisher). Vector genome copy number in 40 ng of total DNA was determined by quantitative PCR using LightCycler 480 Probes Master (Roche) and primers and probes specific for canine optimized FGF21 coding sequence. A reference standard curve was built from serial dilutions of linearized plasmid bearing the CMV promoter and optimized canine FGF21 cDNA spiked into 20 ng / pL of non-transduced dog genomic DNA.Results.

[0527] Towards the translation to the clinic of the AAV-FGF21 -mediated gene therapy, healthy Beagle dogs (Dog-1 and Dog-2) were treated IM with 7xl012vg / kg of AAV1vectors encoding codon-optimized canine FGF21 (AAV-coFGF21), that corresponded to the dose mediating full therapeutic efficacy in HFD-fed mice (3xlOnvg). Three untreated dogs were used as controls. Four months post-AAV administration, biodistribution analysis indicated widespread coFGF21 expression and vector genome copy numbers in hindlimb skeletal muscles (FIG. 18A, 18B). No transgene expression was observed in untreated skeletal muscles or liver (FIG. 18A). Circulating biologically active FGF21 levels rose above baseline as soon as 2 weeks after vector administration and remained high thereafter (FIG. 18C). In agreement with increased biologically active AAV-derived FGF21 in bloodstream, levels of P-klotho increased in the liver (FIG.18D). Dog-1 and Dog-2 showed decreased serum triglycerides, and enhanced hepatic expression of key markers of P-oxidation, such as acyl-CoA dehydrogenase medium (ACADM) and long (ACADL) channel, and carnitine palmitoyl transferase 2 (CPT2) (FIG. 18E-18G and FIG. 19A). Moreover, increased serum adiponectin levels and adiponectin expression in WAT were observed in the treated dogs (FIG. 18H, 181). WAT of these animals also showed presence of multilocular adipocytes and increased expression of thermogenic and P-oxidation markers (FIG. 18J-18M and FIG. 19B-19D).

[0528] Histological evaluation of genetically modified skeletal muscles revealed unaltered morphology, normal fiber size and lack of inflammation (FIG. 19E, 19F). To further assess the safety of the approach and potential toxicities, animal health was periodically monitored through clinical, hematological and biochemical examination. No clinically relevant deviations were observed in different parameters obtained throughout the 4-month follow-up, in agreement with the general health status of the animals (Tables 2 and 3). All these results highlighted that treatment with AAV-coFGF21 was safe and able to improve key metabolic parameters in large animals.Table 2. Clinical chemistry parameters in Beagle dogs treated with AAV1-FGF21Table 3. Hematological parameters in Beagle dogs treated with AAV1-FGF21Example 15. Analysis of circulating FGF21 levels in obese, T2D, and MASH patients Human Samples.

[0529] Human samples were analysed to determine FGF21 and insulin levels. Blood samples were collected after overnight fasting. All samples were centrifuged, fractionated and serum stored at -80°C until further analysis. Patients' clinical data and biochemical parameters were provided by the hospital.

[0530] Circulating FGF21 levels were measured in approximately 500 highly obese, insulin resistant and T2D male and female patients. Two additional cohorts of 12overweight and 46 lean subjects were analyzed as controls. Patient characteristics are provided in Table 4. Obese individuals were grouped by their body mass index (BMI, kg / m2) in class I (BMI, 30-34.9), class II (BMI, 35-39.9) and class III (BMI, >40), according to the World Health Organization classification. From class I to III patients, a progressive increase in glycemic control markers, such as fasting glucose, HbAlc, insulin and HOMA-IR, in circulating triglycerides and in liver fibrosis markers (FLI, HIS and TyG) was observed, consistent with MASH development (Table 4).

[0531] FGF21 circulating levels corresponding to 90% of healthy individuals ranged 0- 0.26 ng / ml (0-260 pg / ml) (FIG. 20A). A very significant percentage (about 50-80%) of T2D / obese class I to III patients also showed FGF21 levels in bloodstream comprised in this range (FIG. 20A). Most of the remaining class II and III obese patients did not exceed the 2-fold limit of the normal range displayed by lean individuals (0.53 ng / ml) (FIG. 20A). Similar observations were made in chow-fed mice compared with HFD-fed obese and insulin resistant mice, which showed a 2-fold increase in FGF21 circulating levels (FIG. 7C) and were highly responsive to the AAV-FGF21-mediated gene therapy. From the cohort of 500 obese patients analyzed, only a limited number of subjects remained out of this range (FIG. 20A). In addition, circulating FGF21 levels were also examined in a cohort of 20 biopsy-proven MASH patients (Table 5). Similar to the results obtained in obese / T2D patients and independently of the liver fibrosis stage and BMI, most MASH patients had FGF21 levels within the 2-fold limit of the normal range of lean individuals (FIG. 20B). Altogether, these results suggest that most obese, T2D, and MASH patients would be eligible for the AAV-FGF21 gene therapy.Table 4. Characteristics of insulin resistance, type 2 diabetic and obese patients.Table 5. Characteristics of patients with biopsy proven MASH.Example 16. Isolation of Kidneys from 3xTG-AD mice treated with AAV1-CMV- moFGF21 via Intramuscular administration

[0532] The 3xTg-AD (B6; 129Tg(APPSwe,tauP301L)lLfa PsenltolMPm) mouse model is a widely used mouse model of Alzheimer's disease, homozygous for all three mutant alleles, homozygous for the Psenl mutation and homozygous for the co-injected APPSwe and tauP301 L transgenes (Belfiore, R., Aging Cell. 2019, 18(l):el2873).

[0533] 10-month old 3xTg-AD mice were administered intramuscularly with 3xl0uvg / mouse of AAVl-CMV-moFGF21 vectors. As control, non-treated 3xTg-AD animals were used. The animals were sacrificed by 17 months of age. At sacrifice, serum and tissue samples were stored for later analysis.Example 17. Analysis of FGF21 levels in the Kidneys of 3xTG-AD mice treated with AAVl-CMV-moFGF21 via Intramuscular administration

[0534] The 3xTg-AD (B6; 129Tg(APPSwe,tauP301L)lLfa PsenltolMpm) mouse model was used to evaluate therapeutic potential of the AAV-mediated genetic engineering of the skeletal muscle with FGF21 on Kidney disease secondary to Alzheimer's disease. In particular, this study evaluated the inflammation and fibrosis levels in the kidney of 3xtg- AD transgenic female mice treated intramuscularly with AAV-FGF21 vectors.

[0535] Ten-month-old female 3xTg-AD mice were administered intramuscularly (IM) with 3x l0nviral genomes (vg) / mouse of AAV vectors of serotype 1 (AAV1) carrying a murine optimized FGF21 coding sequence (moFfg21) under the control of the cytomegalovirus (CMV) promoter (AAV1-FGF21) into quadriceps, gastrocnemius and tibialis muscles of both hindlimbs and followed-up to 17 months of age. Age matched untreated female 3xTg-AD mice were used as controls. A schematic of the general study design is shown in FIG. 24.

[0536] Analysis of the tissue samples from Example 16 included studies on kidney inflammation, kidney fibrosis, kidney damage, and associated biomarkers. Kidney damage, inflammation and fibrosis were evaluated by quantification of expression of key genes by qPCR. The glomerulus area was evaluated by morphometric analysis in kidney sections. Kidney damage gene markers included Kidney Injury Molecule 1 (Kimi) and Lipocalin 2 (Lnc2). Kidney inflammation markers included Monocyte chemotactic protein 1 (Mcpl), F4 / 80, and Tumor necrotic factor alpha (Tnfla). Kidney fibrosis gene markers included Transforming growth factor betal (Tgflb), Collagen type I alpha (Collal), Collagen type III alpha (Col3al), Collagen type IV alpha (Col4al), and Fibronectin (Fn).

[0537] The following methods were used for the mouse studies in Example 17.Animals.

[0538] Ten-month-old female B6; 129-Tg(APPSwe,tauP301L)lLfa PsenltmlMpm / Mmjaxmice (3xtg-AD) mice were used. Animals were kept under Pathogen Free conditions at the animal facility. Mice were fed ad libitum with chow diet (2018S Teklad Global Diets®, Envigo) and maintained under a light-dark cycle of 12 h.Sample Collection.

[0539] At the time of euthanasia, mice were anesthetised by means of inhalational of the anaesthetics Isoflurano (IsoFlo®, Abbott Animal Health, Illinois, USA) and decapitated. Tissues of interest were excised and kept at -80°C or with formalin, until analysis.Immunohistochemical and Morphometric Analysis.

[0540] Tissues were fixed for 12-24 h in 10% formalin, embedded in paraffin and sectioned. Morphometric analysis of glomerulus area was performed in kidney sections stained with hematoxylin and eosin. Six to eight animals per group were used and at least 30 glomerulus / kidney were analyzed. Images were obtained with a Nikon Eclipse 90i microscopy (Nikon).RNA Analysis.

[0541] Total RNA was obtained from kidney using isolation reagent (Tripure, Roche) and RNeasy Minikit (Qiagen) and treated with DNAsel (Qiagen). One microgram of RNAwas reverse transcribed using the PrimeScript™ RT Reagent Kit (Perfect Real Time) (Takara). Real-time quantitative PCR (qRT-PCR) was performed in a QuantStudio™ 5 Real-Time PCR System (Takara) using the TB Green Premix Ex Taq (Takara) and the primers listed in the Table 6 below. Data was normalized to RplpO expression.Table 6. Primers Used in qRT-PCR.Gen Primer Forward ( 5 ’ - 3 ’) Primer Reverse ( 5 ’ ~ 3 ’)TCCCACCTTGTCTCCAG TCT ACTGGTCTAGGACCCGAGAAGRplpO(SEQ ID NO: 32) (SEQ ID NO: 33)AAGCCGCAGAAAAACCTAC AACCACGCTTAGAGATGCTGKimi(SEQ ID NO: 34) (SEQ ID NO: 35)CAGAAGGCAGCTTTACGA TG CCTGGAGCTTGGAACAAATGLnc2(SEQ ID NO: 36) (SEQ ID NO: 37)CTTTGGATGGGCTTCCAGTC GCAAGGAGGACAGAGTTTATC1-480(SEQ ID NO: 38) (SEQ ID NO: 39)AACTGCATCTGCCCTAAGGTC AAGTGCTTGAGGTGGTTGTGMcpl(SEQ ID NO: 40) (SEQ ID NO: 41)CTGTAGCCCACGTCGTAGC TTGAGATCCATGCCGTTGTnfa(SEQ ID NO: 42) (SEQ ID NO: 43)GACTGGAAGAGCGGAGAGTA CCTTGATGGCGTCCAGGTTCollal(SEQ ID NO: 44) (SEQ ID NO: 45)AGGATCTGTCCTTTGCGATG TCTCCAAATGGGATCTCTGGCol3al(SEQ ID NO: 46) (SEQ ID NO: 47)AAGATTGGCGACAAGTGGAG TAGGTTTGCAGGTCCATTCCFnl(SEQ ID NO: 48) (SEQ ID NO: 49)ATGCTAAAGAGGTCACCCGC TGCTTCCCGAATGTCTGACGTgfb(SEQ ID NO: 50) (SEQ ID NO: 51)AAAGGGAGAAAGAGGCTT GC AGCATCACCCTTTTGTCCTGCol4al(SEQ ID NO: 52) (SEQ ID NO: 53)- I l l -Statistical Analysis.

[0542] Data was analyzed by an unpaired Student’s t-test. Differences were considered significant when P < 0.05.Results.

[0543] Gene expression is presented in arbitrary units with the mean expression level of each gene in the control group assigned a value of 1.00.Kidney Damage.

[0544] Expression of key markers of kidney damage, such as Kidney Injury Molecule 1 (Kimi) and Lipocalin 2 (Lnc2), was decreased in 3xTg-AD aged female mice treated intramuscularly (IM) with AAV1-FGF21 vectors showed decreased expression of Kimi and Lnc2 (FIG. 25A and FIG. 25B; Tables 7 and 8, below).

[0545] Kidney Inflammation.

[0546] Treatment with AAV1-FGF21 vectors decreased the expression of the macrophage marker F4 / 80, of the pro-inflammatory cytokines Mcpl and Tnfla, and of Tgfb, a multifunctional protein that regulates immune function as well as fibrosis, in the kidney of 3xTg-AD aged female mice (FIGs. 26A-26D; Tables 9 and 10, below).Kidney Fibrosis.

[0547] Similarly, expression levels of the fibrosis markers fibronectin 1 (Fn), collagen type I alpha 1 chain (Collal) and collagen type III alpha 1 chain (Col3al) were reduced in the kidney of 3xTg-AD aged female mice treated with AAV1-FGF21 vectors (FIGs. 27A-27C; Tables 11 and 12, below). A slight but not significant decrease in the expression of Col4al were observed (FIG. 27D; Tables 11 and 12, below). Moreover, treated mice also showed decreased glomerulus area, a marker of age-related kidney disease (FIGs. 28A-28B and Tables 13 and 14, below).

[0548] Muscle-directed AAV-FGF21 gene therapy in 3xTg-AD aged female mice decreased expression levels of key kidney damage, inflammation, and fibrosis markers and reduced the glomerulus area.Table 7. Lcn2 and Kimi Expression in Treated 3xTg-AD Aged Female MiceTable 8. Lcn2 and Kimi Expression in Untreated (Control) 3xTg-AD Aged Female MiceTable 9. F4 / 80, Tnfla, Mcpl, and Tgfb Expression in Treated 3xTg-AD Aged Female MiceTable 10. F4 / 80, Tnfla, Mcpl, and Tgfb Expression in Untreated (Control) 3xTg-AD Aged Female MiceTable 11. Collal, Col3al, and Fn Expression in Treated 3xTg-AD Aged Female MiceTable 12. Collal, Col3al, and Fn Expression in Untreated (Control) 3xTg-AD Aged Female MiceTable 13. Glomerulus Area in Treated 3xTg-AD Aged Female MiceTable 14. Glomerulus Area in Untreated (Control) 3xTg-AD Aged Female MiceExample 18. Isolation of Kidneys from SAMP8 mice treated with AAV1-CMV- moFGFll via Intramuscular administration

[0549] Eight-week-old male SAMP8 mice were administered intramuscularly with 3xl0uvg / mouse of AAVl-CMV-moFGF21 vectors. As control, non-treated SAMP8 and SAMR1 animals were used. The animals were sacrificed at 42 weeks of age. At sacrifice, serum and tissue samples were stored for later analysis.Example 19. Analysis of FGF21 levels in the Kidneys of SAMP8 mice treated with AAVl-CMV-moFGF21 via Intramuscular administration (Prophetic)

[0550] The expression levels of AAVl-CMV-moFGF21 treated SAMP8 mice are measured for both tissue specific (e.g., kidney) and circulating levels of FGF21.

[0551] Analysis of the serum and tissue samples from Example 18 include studies on kidney inflammation, kidney fibrosis, kidney damage, oxidative stress, and associated biomarkers. Inflammatory gene markers include Monocyte chemotactic protein 1 (Mcpl), F4 / 80, and Tumor necrotic factor alpha (Tnfla). Fibrosis gene markers include Transforming growth factor betal (Tgflb), Collagen type I alpha (Collal), Collagen type III alpha (Col3al), Collagen type IV alpha (Col4al), Connective tissue growth factor (Ctgf), and Fibronectin (Fn). Kidney damage gene markers include Kidney Injury Molecule 1 (Kimi) and Lipocalin 2 (Lnc2). Oxidative stress gene markers include NADPH oxidase 2 (Nox2), NADPH Oxidase 4 (Nox4), and inducible nitric oxide synthase (iNos). Antioxidant gene markers include Glutathione-Disulfide Reductase (Gsr), Glutathione Peroxidase 1 (Gpxl), Catalase (Cat), and Superoxide Dismutase 1 (Sodl).* * *

[0552] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature.

[0553] All of the references cited above, as well as all references cited herein, are incorporated herein by reference in their entireties.Table 15: Additional Sequences

Claims

WHAT IS CLAIMED IS:

1. A method for treating or reducing kidney inflammation and / or kidney oxidative stress in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or functional fragment thereof operably linked to a ubiquitous promoter.

2. A method for treating, preventing or reducing the likelihood of kidney fibrosis in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter.

3. A method for treating, preventing, or reducing the likelihood of acute kidney injury (AKI) in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter.

4. A method for treatment or prevention of kidney disease in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequence encoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter, wherein the kidney disease is selectedfrom the group consisting of age-related kidney disease, uremia, acute renal insufficiency, chronic pyelonephritis, acute pyelonephritis, chronic glomerulonephritis, acute progressive nephritis syndrome, nephrotic syndrome, nephrosclerosis, interstitial nephritis, focal glomerulosclerosis, membranous nephropathy, multiple purulent renal syndrome, renal vascular hypertension, hypertensive kidney disease, secondary nephropathy, hyperphosphatemia, hyperkalemia, hyperuricemia or hypernatremia.

5. The method of any one of claims 1-4, wherein the subject suffers from chronic kidney disease (CKD).

6. The method of any one of claims 1-5, wherein the subject suffers from CKD-related fibrosis.

7. The method of any one of the claims 1-6, wherein the kidney inflammation, the kidney oxidative stress, the kidney fibrosis, the AKI, and / or the CKD is not associated with diabetes.

8. The method of any one of the claims 1-7, wherein the subject does not suffer from diabetes.

9. The method of any one of the claims 1-8, wherein the ubiquitous promoter comprises a small chicken beta-actin promoter / cytomegalovirus enhancer (smCBA) promoter, a eukaryotic translation elongation factor 1 a (EFla) promoter, a simian virus 40 (SV40) promoter, a cytomegalovirus (CMV) promoter or a CAG promoter.

10. The method of claim any one of claims 1-9, wherein the ubiquitous promoter comprises a cytomegalovirus (CMV) promoter.

11. The method of claim any one of claims 1-10, wherein the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence encoding an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1.

12. The method of claim any one of claims 1-11, wherein the nucleotide sequence encoding the FGF21 or a functional fragment thereof comprises a nucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 4, 5, 6, or 7.

13. The method of claim any one of claims 1-12, wherein the rAAV comprises a polynucleotide having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 14.

14. The method of any one of the claims 1-13, wherein the expression construct further comprises one or more of a polyadenylation signal, at least one target sequence of a microRNA, and / or an enhancer sequence.

15. The method of any one of the claims 1-14, wherein the rAAV vector is administered as a single dose.

16. The method of any one of the claims 1-14, wherein the rAAV vector is administered over multiple doses.

17. The method of any one of claims 1-16, wherein the subject has a 0.1-6 fold reduction in a relative expression of an inflammatory gene marker selected from the group consisting of a cytokine, a chemokine, a cell adhesion molecule (CAM), or any combination thereof, optionally wherein the relative expression is measured by qRT-PCR.

18. The method of claim 17, wherein the cytokine is an interleukin (IL), a tumor necrosis factor (TNF), an interferon (IFN), a transforming growth factor (TGF), or any combination thereof.

19. The method of claim 17, wherein the CAM is an IgSF, a cadherin, a selectin, an integrin, or any combination thereof.

20. The method of claim 17, wherein the chemokine is a member of the CXC family, a member of the CX3C family, or a member of the CC family.

21. The method of any one of claims 1-16, wherein the subject has a 0.1-6 fold reduction in a relative expression of an inflammatory gene marker selected from the group consisting of Cd68, F4 / 80, Ccl2, Ccl3, Ccl5, Tufa, or any combination thereof, optionally wherein the relative expression is measured by qRT-PCR.

22. The method of any one of claims 1-21, wherein the subject has a 0.1-6 fold reduction in a relative expression of an oxidative stress gene marker selected from the group consisting of Nox2, Nox4, iNos, or any combination thereof and / or wherein the subject has a 0.1-6 fold increase in a relative expression of an antioxidant gene marker selected from the group consisting of Gsr, Gpxl, Cat, Sodl, or any combination thereof, optionally wherein the relative expression is measured by qRT-PCR.

23. The method of any one of claims 1-22, wherein the subject has a 0.1-6 fold reduction in a relative expression of a fibrosis gene marker selected from the group consisting of Tgflb, Collal, Col3al, Col4al, Ctgf, Fn, aSMA, Col5al, Col6al, vimentin, E-cadherin, PIIINP, TGFb, MCP-1, hepcidin, LFABP, RBP, VCAM-1, CTGF, PAI-1, MMP-2, TIMP-1, MBL, SGK-1, CD30, or any combination thereof, optionally, wherein the relative expression is measured by qRT-PCR.

24. The method of any one of claims 1-23, wherein the subject has a 0.1-6 fold reduction in a kidney injury gene marker selected from the group consisting of Kimi, Lnc2, or any combination thereof, optionally, wherein the relative expression is measured by qRT- PCR.

25. A method for treatment or prevention of a Metabolic dysfunction-associated steatotic liver disease (MASLD) in a subject in need thereof comprising intramuscularly administering to the subject a recombinant adeno-associated virus (rAAV) vector, wherein the rAAV vector comprises a vector genome and an AAV capsid, optionally having an AAV1 serotype, wherein the vector genome comprises AAV inverted terminal repeats (ITRs) flanking an expression construct comprising a nucleotide sequenceencoding a Fibroblast growth factor 21 (FGF21) or a functional fragment thereof operably linked to a ubiquitous promoter.

26. The method of claim 25, wherein the MASLD is metabolic dysfunction-associated steatohepatitis (MASH).

27. The method of claim 25 or 26, wherein the subject is Human Immunodeficiency Virus (HIV) positive.

28. The method of any one of claims 25-27, wherein the subject is being or has been treated with an antiretroviral therapy (ART).

29. The method of claim 28, wherein the ART is a nucleoside reverse transcriptase inhibitor (NRTI), a nucleotide reverse transcriptase inhibitor (NtRTI), a non-nucleoside reverse transcriptase inhibitor (NNRTI), a protease inhibitor (PI), an integrase inhibitor (INSTI), a fusion inhibitor (FI), a chemokine receptor antagonist (e.g., a CCR5 antagonist), an entry inhibitor (e.g., a CD4-directed post-attachment inhibitor), or any combination thereof.

30. The method of any one of claims 25-29, wherein the subject further suffers from viral hepatitis, preferably chronic viral hepatitis.

31. The method of any one of claims 1-30, wherein the rAAV vector is administered in a total dose of about 1 x 1011vg / kg to about 1 x 1015vg / kg, optionally wherein the rAAV vector is administered in a total dose of about 1 x 1012vg / kg to about 1 x 1014vg / kg, about 3 x 1012vg / kg to about 3 x 1013vg / kg, about 1 x 1012vg / kg to about 1 x 1013vg / kg, about 1 x 1012vg / kg to about 1 x 1014vg / kg, or about 3 x 1012vg / kg to about 4 x 1012vg / kg.

32. The method of any one of claims 1-31, wherein the rAAV vector is administered in a total dose of about 1 x 1013vg to about 1 x 1017vg, optionally about 9.6 x 1013vg, about 3.0 x 1014vg, about 5.6 x 1014vg, about 9.6 x 1014vg, or about 2.0 x 1015vg.

Citation Information

Patent Citations

  • Scalable Production Method for AAV

    US20090275107A1

  • AAV capsid vehicles for molecular transfer

    US6204059B1

  • Application of fibroblast growth factor-21 in treatment of renal fibrosis

    CN105597085A

  • Gene therapy composition for use in diabetes treatment

    WO2012007458A1

  • Methods of treating FGF21-associated disorders

    WO2017021893A1

Cited By

  • AAV vectors for delivery of nucleic acids encoding FGF21 and methods of treating lung diseases using the same

    WO2026133103A1