Methods of altering mitochondrial function and uses thereof in therapy

Abstract

A method of altering mitochondrial function in a cell is provided. The method comprises administering to the cell an agent which modulates expression or activity of NDUFV2P1, thereby altering the mitochondrial activity in the cell. Also provided are methods of treating diseases-associated with an aberrant mitochondrial function, such as mental diseases and disorders.

Description

[0001] METHODS OF ALTERING MITOCHONDRIAL FUNCTION

[0002] AND USES THEREOF IN THERAPY

[0003] RELATED APPLICATION / S

[0004] This application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 677,462 filed on 31 July, 2024, the contents of which are incorporated herein by reference in their entirety.

[0005] SEQUENCE LISTING STATEMENT

[0006] The XML file, entitled 104027. xml, created on 30 July 2025, comprising 3,605 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

[0007] FIELD AND BACKGROUND OF THE INVENTION

[0008] The present invention, in some embodiments thereof, relates to methods of altering mitochondrial function and uses thereof in therapy.

[0009] Schizophrenia (SZ) is a severe incurable chronic mental disorder with an onset in adolescence and a worldwide prevalence of ~1 %. It has a major negative impact on the lives of those afflicted by the disorder and on their families. Patients exhibit progressive disturbances in main human capabilities, perception, emotion, cognition and occupational and social functioning. SZ is mainly treated by pharmacotherapy by antipsychotic drugs, yet the response and compliance of patients to these medications is relatively low and they induce severe side effects.

[0010] Biological brain and peripheral abnormalities have been reported for this disorder leading to the conceptualization of schizophrenia as a neurodevelopmental disorder with impaired neuronal activity and brain circuitry. Mitochondria, are key players in neuronal activity, as neurons are heavy consumers of energy and highly dependent on Ca2+homeostasis, both core functions of the mitochondria. Mitochondrial dysfunction has been implicated in numerous general and neuropsychiatric disorders including diabetes and cancer as well as schizophrenia (SZ), bipolar disorder, major depression, Alzheimer’s disease (AD), Parkinson’s disease and autism1. Their involvement in such a variety of diseases stems from being an important cellular hub and from playing a key role in the quality control mechanisms of cells. In addition to providing cells’ energy demands and buffering of intracellular Ca2+concentrations, mitochondria provide various metabolites serving as building blocks for multiple macromolecules and synthesizing heme and steroids. They are also involved in, generation of reactive oxygen species (ROS) and apoptosis, all essential signalling for cell survival or death. In the CNS, impaired mitochondria can lead to deficits in neuronal development, firing and synaptic plasticity2to oxidative stress and inflammation, and ultimately to abnormal behavior3-5.

[0011] In SZ and in SZ-associated 3q29 and 22ql l.2 deletion syndromes, mitochondrial dysregulations have been repeatedly observed both in the periphery and in brain. Previously, mitochondria were found dysfunctional in mental disorders in general and in SZ in particular, which has now become an accepted pathology of these disorders. The critical role of mitochondria in SZ was demonstrated by transplanting healthy mitochondria into SZ patients-derived iPSCs and into the brains of a rat model of SZ (maternal immune activation by Poly EC). It was shown that healthy mitochondria restored mitochondrial functions, neuronal sprouting and activity and even SZ-related behavioural deficits in SZ-like rats3,4This phenomenon advocates for a direct link between mitochondria and SZ-related neuronal and behavioural pathologies. Unfortunately, mitochondrial transplantation is not realistic in patients due to their toxic potential and their foreign mtDNA due to the need of allogeneic mitochondria from a healthy subject.

[0012] Recent studies showed that impairments in the first complex of the mitochondrial respiratory chain (Col) and specifically its NDUFV2 subunits are a major cause of mitochondria malfunction in SZ. NDUFV2 subunit is essential for Col activity, ATP production, neuronal plasticity and survival and has been suggested as a risk gene in SZ6-8. It was further shown that NDUFV2 pseudogene (NDUFV2P1) is increased in SZ patients -derived from various cell types and brain samples. In addition, decreased levels of NDUFV2 were highly correlated with increased levels of its pseudogene NDUFV2P1 in SZ patients’ lymphocytes, brain specimens, and their EBV-transformed lymphocytes (LCLs). NDUFV2P1 showed also a similar inverse correlation with mitochondrial respiration9. NDUFV2P1 is transcribed into mRNA, which is not translated into a protein. Notably, an increasing number of reports show the involvement of pseudogenes including PTENP1, BRAFP1, HMGA1 and 5-HTR7P in cellular regulatory mechanisms and development10,11

[0013] SUMMARY OF THE INVENTION

[0014] According to an aspect of some embodiments of the present invention there is provided a method of altering mitochondrial function in a cell, the method comprising administering to the cell an agent which modulates expression or activity of NDUFV2P1, thereby altering the mitochondrial activity in the cell.

[0015] According to an aspect of some embodiments of the present invention there is provided a method of treating a disease-associated with an aberrant mitochondrial function, the method comprising administering to the subject a therapeutically effective amount of an agent which modulates expression or activity of NDUFV2P1, thereby treating the disease-associated with an aberrant mitochondrial function.

[0016] According to an aspect of some embodiments of the present invention there is provided an agent which modulates expression or activity of NDUFV2P1 for use in treating a disease- associated with an aberrant mitochondrial function.

[0017] According to some embodiments of the invention, the disease is selected from the group consisting of a mental disease (e.g., schizophrenia), a neurodegenerative disease (e.g., Alzheimer’s disease, Parkinson’s disease), cancer and cardiomyopathy.

[0018] According to an aspect of some embodiments of the present invention there is provided a method of treating a mental disease (e.g., schizophrenia, autism, major depression) or a neurodegenerative disease (e.g., Alzheimer’s disease or Parkinson’s disease) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent which down-regulates activity or expression of NDUFV2P1, thereby treating the mental disease or a neurodegenerative disease.

[0019] According to an aspect of some embodiments of the present invention there is provided an agent which down-regulates activity or expression of NDUFV2P1 for use in treating a mental disease (e.g., schizophrenia, autism, major depression) or a neurodegenerative disease (e.g., Alzheimer’s disease or Parkinson’s disease) in a subject in need thereof.

[0020] According to an aspect of some embodiments of the present invention there is provided a method of treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent which up-regulates activity or expression of NDUFV2P1, thereby treating cancer.

[0021] According to an aspect of some embodiments of the present invention there is provided an agent which up-regulates activity or expression of NDUFV2P1, for use in treating cancer in a cancer in need thereof.

[0022] According to some embodiments of the invention, the cancer is associated with an aberrant mitochondrial activity as compared to a non-cancerous cell of the cancer tissue.

[0023] According to some embodiments of the invention, the method further comprises determining mitochondria activity in the cell prior to and / or following the administering.

[0024] According to some embodiments of the invention, the method is effected in-vivo.

[0025] According to some embodiments of the invention, the method is effected ex-vivo.

[0026] According to some embodiments of the invention, the agent up-regulates activity or expression of NDUFV2P1. According to some embodiments of the invention, the agent down-regulates activity or expression of NDUFV2P1.

[0027] According to some embodiments of the invention, the agent which down-regulates activity of expression of NDUFV2P1 is a genome editing agent.

[0028] According to some embodiments of the invention, the agent which down-regulates activity of expression of NDUFV2P1 is an RNA silencing agent [e.g., RNAi siRNA, antisense oligo (ASO)].

[0029] According to some embodiments of the invention, the mental disease is selected from the group consisting of schizophrenia, bipolar disorder, depression and autism.

[0030] According to some embodiments of the invention, the agent is formulated for administration to the central nervous system (CNS) or the administering is to the CNS (e.g., nasal).

[0031] According to some embodiments of the invention, the agent is formulated for targeted delivery.

[0032] According to some embodiments of the invention, the targeted delivery is to a cancer cell.

[0033] According to some embodiments of the invention, the targeted delivery is to a neuron, e.g., cortical neuron.

[0034] According to some embodiments of the invention, the targeted delivery is to a cardiomyocyte or a cancer cell.

[0035] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0036] BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

[0037] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

[0038] In the drawings: FIGs. 1A-R: NDUFV2P1 (PG) affects its parent gene NDUFV2 transcript and protein levels. Naive SZ-derived LCLs showed a significant decrease (P=0.018) in NDUFV2 (A), while an increase (P=0.002) in PG mRNA levels as compared to naive healthy subjects -derived LCLs (B). Overexpression of PG (OE PG) in healthy subject-derived LCLs caused a significant decrease (P=0.002) in NDUFV2 (C) and a significant increase in PG (P=0.004) transcript levels as compared to the same LCLs infected with an empty virus (Empty) (D). Downregulation of PG (shPG) in SZ- derived LCLs, caused a significant increase (P=0.03) in NDUFV2 mRNA levels (E) and a significant decrease (P=0.04) in PG as compared to the cells infected with scramble virus (F). Representative gels and quantification of the results demonstrated a significant reduction (P=0.01) in NDUFV2 protein levels in naive SZ-derived LCLs as compared to healthy subjects -derived LCLs (G, J). OE PG in healthy subjects-derived LCLs initiated a significant decrease (P=0.03) in NDUFV2 protein levels (H, K), while shPG treatment in SZ-derived LCLs, caused a significant increase (P=0.014) in NDUFV2 protein levels as compared to the cells infected with scramble virus (I, L). Overexpression (M-N, Q) or downregulation (O-P, R) of PG in healthy and SZ- derived LCLs, respectively, had no effect on protein levels of NDUFV1 and NDUFS1, two additional proteins of the N functional subunit of Col. Values are expressed as mean ± SEM normalized to P- actin. Data were obtained from 2-5 LCLs / group for mRNA and from n=2-3 LCLs / group for proteins from two independent experiments.

[0039] FIGs. 2A-R: Alterations in NDFV2P1 (PG) transcript levels impacts mitochondrial functions. Representative images of MitoTracker Orange fluorescence concentrated in mitochondria depending on their membrane potential (Aym) within naive healthy and SZ-derived LCLs and with or without PG OE and downregulation, respectively (A, G, N). Quantifications of A\| / m in naive SZ and healthy control LCLs (B); following PG overexpression (OE PG) and its Empty control virus (Empty) in healthy-derived LCLs (H); and following PG downregulation (shPG) and its scramble control virus (scramble) in SZ-derived LCLs (N). A\| / m is significantly decreased (P<0.0001) in naive SZ cells and in healthy-derived LCLs following OE PG (P=0.01), while no change was observed in A\| / m following shPG in SZ-derived LCLs, compared to their relevant controls. A\| / m was assessed in n=2 LCLs / group, 6-13 cells / line in two independent experiments. Quantifications of Oxygen consumption rates (OCR) in naive SZ and healthy control LCLs (C-F); following OE PG and its Empty control in healthy-derived LCLs (LL); and following shPG and its scramble control in SZ-derived LCLs (O-R). Naive SZ cells exhibited significantly reduced levels of all tested respiratory parameters including the basal, ATP-linked and maximal OCR as compared to healthy LCLs (P=0.01, P=0.02 and P=0.05, respectively) (C-E). As a result of OE PG in healthy LCLs, a significant decrease was observed in basal and maximal OCR (P<0.002 and P=0.001, respectively) (I, K), while a decrease that did not reach significance was observed in ATP-linked OCR (J). Following shPG in SZ-derived LCLs, a significant increase in basal, ATP-linked, and maximal OCR was observed (P=0.05, P=0.004 and P=0.02, respectively) (O-Q). OCR profiles following the addition of oligomycin, FCCP and Rot / AA with and without manipulation of PG expression (F, L, R). OCR measurements were done in 8-12 replications of n= 3-5 LCLs / group in two independent experiments. All values are expressed as mean ± SEM.

[0040] FIGs. 3A-T: Alterations in NDUFV2P1 transcript levels affects mitochondrial network connectivity and distribution and fission / fusion protein levels. Representative images of mitochondria stained with Orange MitoTracker before and after focused laser beam-induced dissipation of A\| / m. The square marks the area treated with the focused laser beam. The dashed circle (ROI) marks the area within and beneath which the 3D intensity of the fluorescence before and after laser beam application was quantified in naive SZ and healthy control LCLs (A); following OE PG and its Empty control in healthy -derived LCLs (E); and following shPG and its scramble control in SZ-derived LCLs (I). Mitochondria network connectivity was significantly reduced in naive SZ-derived LCLs compared to healthy subjects (P=0.04, n=2 LCLs / group, 16-18 cells / group) (B). Similar to the appearance in naive SZ, OE PG in healthy-derived LCLs caused a significant reduction in mitochondria network connectivity as compared to Empty infected cells (P=0.02, n=2 LCLs / group, 9-18 cells / group) (F), Conversely, a significant intensification of mitochondrial connectivity was observed following shPG treatment in SZ-derived LCLs as compared to scramble infected cells (P=0.01, n=2 LCLs / group, 8-13 cells / line) (J). Representative 3D images obtained by IMARIS software, of MitoTracker Orange stained mitochondria in naive SZ and healthy LCLs, and in OE PG and shPG treated healthy and SZ derived cells, respectively (C, G, K). Mitochondrial distribution within the cell borders was determined by coefficient of variation between the grid intensity of the pixels. The coefficient of variation was elevated in naive SZ-derived LCLs compared to healthy subjects (P=0.006) (D), while no change was observed in OE PG healthy-derived LCLs (H). shPG in SZ-derived LCLs caused a significant decrease in the coefficient of variation (P=0.02) (L)Following OE PG infection in healthy-derived LCLs, levels of the fission / fusion proteins MFN2, 0PA1, and Drpl were significantly decreased (P=0.04, P=0.003, and P=0.02, respectively) (M-O). Conversely, their levels were significantly increased (P=0.04, P=0.04, and P=0.01, respectively) following shPG infection of SZ-derived LCLs (Q-S). Representative SDS-PAGE gels of fission / fusion protein following PG OE and shPG (P, T). Values are expressed as mean ± SEM following normalization to P-actin of n=3-7 LCLs / group of two independent experiments. FIGs. 4A-N: Overexpression of human NDUFV2P1 (OE PG) in primary rat cortical neuronal cultures impacts its parent gene, NDUFV2, and mitochondrial functions. Quantification of both hPG and rat NDUFV2 transcript levels exhibited a significant increase following OE PG (P=0.01 and P=0.0005, respectively) (A-B) while, a significant decrease (P=0.0003) was observed in protein levels of NDUFV2 with no changes in NDUFV1 and NDUFS1, as represented by SDS- PAGE gels and their quantifications (C-F). Representative images of MitoTracker Orange fluorescence, representing Aym within infected primary cortical neurons marked with GFP (green) acquired using Zeiss LSM 900 Laser Scanning Confocal System (G). Quantification of A\| / m in the selected ROI (indicated by the dashed line) revealed a significant decrease (P=0.02) following OE PG compared to Empty infected cells (H). The distribution, determined by coefficient of variation between the grid intensity of the pixels within the ROI, was significantly elevated (P=0.0007) following OE PG (I). No change was observed in mitochondria network connectivity (J). OCR profiles following OE PG, Empty infected and non-infected (no Inf) cells in the presence and absence of oligomycin, FCCP, and Rot / AA are presented in (K). OE PG caused a significant impairment in all analyzed cellular respiration parameters compared to both Empty infected and no Inf cells, in basal, ATP-linked and Maximal OCR (P<0.0001, P<0.0001 and P<0.0004, respectively) (L-N). Values are expressed as mean ± SEM of 8-16 replications / group in 2 independent experiments. For analysis of P-actin normalized transcript and protein, values are expressed as mean ± SEM of n=3 or 6 / group, performed in 2 independent experiments. For imaging analysis values are expressed as mean ± SEM of 12-13 cells / group, performed in 2 independent experiments.

[0041] FIGs. 5A-L: Overexpression of hPG in primary rat cortical neuron cultures impairs neuronal sprouting, synapse formation, and basal firing activity. Representative binary images of neurons following Empty and OE PG infection (A). The qualifications of images reveals a significant decrease (P=0.003) in both the number of branches and junctions (B-C) while no change was observed in the average length of the neuronal branches (D). Results were obtained from 11 fields per group across four independent experiments, and analyzed using 2D / 3D Skeleton analysis in ImageJ software. Representative Confocal images of the pre-synaptic marker S YN 1 (blue) and post-synaptic marker PSD-95 (red) and their merged image following OE PG and Empty infection of 14 DIV primary cortical neuron cultures. The images on the right are a magnified view of the area outlined by the dashed white line in the adjacent image. Each arrow indicates co-localization of the two markers S YN 1 and PSD95 (E). Quantification of S YN 1 and PSD95 puncta densities revealed a significant reduction following OE PG infection (P=0.02 and P=0.0005, respectively), and a marked decrease in their co-localized puncta density (P<0.0001) (F-H). A representative image of Pearson product- moment correlation coefficient (PCC) demonstrates a marked reduction in signal overlap between S YN 1 and PSD95 following OE PG treatment compared to the Empty control (r = 0.0305 vs. r = 0.659) (I). Values are expressed as mean ± SEM of 11-18 cells / group and performed in 2 independent experiments. Recordings of the spontaneous activity of neurons were collected using the sofware MC_Rack. A significant decrease in spikes (J) and bursts (K) frequencies were observed (P=0.0075 and P=0.0007, respectively) after treatment with OE PG compared to Empty control. Representative image of neuronal network in the Microelectrode Array (MEA) plate is presented (L). Values are expressed as mean ± SEM of 3-4 plates / group, performed in 2 independent experiments.

[0042] FIGs. 6A-D: NDUFV2P1 characteristics in CTL and SZ derived LCLs. Both in SZ and CTL-LCLs (4 LCLs / group) full length transcript of NDUFV2P1 (lOlObp) is observed in the nuclear fraction (A) while its spliced variant (~521bp) is observed in the cytosol (B), unlike its parent gene NDUFV2, which full length sequence is observed both in the nuclear and cytosol fraction (C). In-vitro transcription translation of RT-PCR and a pGEM-T products of NDUFV2 and NDUFV2P1 full length transcripts from 4LCLs / group resulted in a35S -methionine-labeled NDUFV2 protein, while NDUFV2P1 transcripts were unable to produce a protein both in CTL and SZ samples (D).

[0043] FIGs. 7A-R: NDUFV2 and NDUFV2P1 cellular distribution are differentially altered in SZ derived LCLs. NDUFV2 transcript levels are significantly reduced while those of NDUFV2P1 are significantly increased (P<0.001, P<0.014 respectively), in SZ-LCLs as compared to CTL- LCLs cell lysates (A). Protein levels of NDUFV2 are also significantly reduced (P<0.028) in SZ- LCLs cell lysate as presented by a representative PAGE gel and quantification of 5LCLs lines / group (B,C). NDUFV2P1 involvement in NDUFV2 decrease in SZ-LCLs was studied by overexpressing NDUFV2P1 in CTL-LCLs (n=5) thereby mimicking its state in SZ cells. Five days after infection, one way ANOVA showed a significant change between non-infected CTL-LCLs, those infected with empty virus and those overexpressing NDUFV2P1 in NDUFV2P1 transcripts levels (#; F245 = 18.94, P<0.0002) and NDUFV2 mRNA and protein levels (#; F2J5 = 7.20, P< 0.008; F2J5 =10.92, P<0.002, respectively) the significant increase in NDUFV2P1 mRNA levels in cell lysates (*P< 0.019) was associated with a significant decrease in NDUFV2mRNA and protein levels (*P< 0.010 and *P<0.03, respectively) as compared to empty virus -infected cells and (**P< 0.008 and **P< 0.004, respectively) as compared to non-infected CTL cells. Infection with empty virus caused no significant change in NDUFV2 mRNA, while NDUFV2 protein levels were significantly reduced (**P<0.022) and NDUFV2P1 mRNA levels were significantly increased by empty virus infection (**P<0.015) as compared to non-infected CTL-LCLs. Quantification of data and representative gels are depicted in (D-H). Subcellular distribution of NDUFV2 and its pseudogene was assessed in SZ- and CTL- derived LCLs (n=4-5 LCLs / group). In the nuclear fraction NDUFV2 mRNA and protein levels in SZ were similar to those in CTL cells, while those of NDUFV2P1 were significantly increased (P<0.004) in SZ cells (I, M, N). In the cytosolic fraction of SZ cells NDUFV2 mRNA and protein levels were significantly lower (P<0.002; P<0.008, respectively), while NDUFV2P1 transcripts were higher than in the controls (P<0.0006) (J, M, O). In the cytosolic ribosomal fractions, no change was observed between both cohorts in both NDUFV2 and NDUFV2P1 (K, M, P). However, in the mitochondria-bound ribosomal fraction, the primary site for NDUFV2 translationCL or t p here to enter tex; , both transcripts were significantly lower in the SZ cohort as compared to the control (P<0.02, P<0.0007, respectively) (L). NDUFV2 protein in isolated mitochondria was also significantly reduced (P<0.006) in SZ cells, leading to complex I activity deficits (M. Q). No change was observed in (T1 / 2) and Kdecay, of NDUFV2P1 and GAPDH, while NDUFV2 transcripts showed a significantly reduced degradation rate (P<0.03) in SZ- LCLs as compared to CTL-LCLs (n=5LCLs / group) (R) indicating that the changes in NDUFV2 and NDUFV2P1 transcripts in SZ cells was not due to their stability.

[0044] FIGs. 8 A- J: NDUFV2P1 transcript interferes with the nuclear export of NDUFV2 in SZ- LCLs: A significant inverse correlation between nuclear NDUFV2P1 and cytosolic NDUFV2 mRNA levels is depicted in (A), (n=4 LCLs / group for each transcript). Out of three main TREX complex RBPs, NXF1, CHTOP and ALYREF, only NXF1, which facilitates the last step in mRNA nuclear export, shows a significant and high inverse correlation between its binding to NDUFV2 and to NDUFV2P1 mRNAs (n=2LCLs / group for each transcript) (B-D). mRNA levels of NDUFV2 and GAPDH are similar in SZ and CTL nuclear fraction (n=4 CLCs / group) while that of NDUFV2P1 is significantly increased (P<0.0001) in SZ following cross-linking of mRNAs and proteins (E). Following the cross -linking, immunoprecipitation with anti-NXFl revealed a significant decrease in the NXFl-bound NDUFV2 (*P<0.05) while an increase in NXFl-bound NDUFV2P1 (*P<0.03) in SZ cells with no change in GAPDH binding as compared to CTL (n=4 LCLs / group) (F). Following overexpression of NDUFV2P1 in CTL-LCLs, nuclear fraction level of NDUFV2P1 mRNA showed a 1.8-fold increase in 5 polled CTL-LCLs as compared to CTL samples infected with empty virus or non-infected cells (n=5 LCLs / group) with no change in NDUFV2 mRNA levels (G). NXFl-bound NDUFV2 decreased by 50% and those of NDUFV2P1 increased three times following overexpression of NDUGV2P1 in the 5 polled CTL-LCLs as compared to those infected with empty virus (H). Similar data were observed in 5 LCLs / group pooled naive SZ and CTL LCLs . In the nuclear fraction NDUFV2 mRNA showed almost no change (27% decrease) while that of NDUFV2P1 showed a 4.3-fold increase (I). NXFl-bound NDUFV2 showed a 16-fold decrease, while NXFl-bound NDUFV2P1 showed a 3 -fold increase in 5 pooled LCLs / group SZ samples as compared to the CTL sample (J).

[0045] FIGs. 9A-F: The interactome pattern of NDUFV2 and NDUFV2P1 mRNAs is oppositely altered in SZ. Unsupervised hierarchical clustering of the abundance of RNA binding proteins (RBPs) to NDUFV2 (A) and NDUFV2P1 (B) mRNAs transcribed from CTL-LCLs (n=2 LCLs / group) and SZ-LCLs (n=2-3 LCLs / group) of significantly expressed 197 RBPs bound to NDUFV2 and 945 RBPs bound to NDUFV2P1 showed an overall lower abundance of RBPs bound to SZ-NDUFV2 mRNA, yet higher abundance of RBPs bound to SZ-NDUFV2P1. The RBPs bound to the hSNRNP70-positive control (I.C.) is depicted. The RBPs segregated into three clusters (A-C) for both mRNAs. For NDUFV2, cluster A is enriched for Aminoacyl-t-RNA biosynthesis and branched-chain amino acids degradation, cluster B for ribosome and RNA binding and cluster C for Ribosome and RNA transport. For NDUFV2P1, cluster A is enriched for Ribosome and spliceosome, cluster B for spliceosome, RNA surveillance and RNA transport and cluster C for nuclear RNA transport. Distance estimation between samples’ proteins, assessed by Euclidean distances, as well as PC A (C) distinguished between CTL and SZ samples for both mRNAs. ORA analysis of significant RBPs followed by KEGG pathway enrichment analysis identified three main pathways for NDUFV2-bound RBPs, Ribosome (FDR=2.005e-2; P=1.366e- 4); Spliceosome (FDR=2.005e-2; P=1.845e-4) and RNA transport (FDR=2.005e-2; P=7.538e-5) pathways (D). For NDUFV2P1- bound RBPs four top pathways were identified, including Spliceosome (FDR=2.2e-16; P=2.2e-16), Ribosome (FDR=2.2e-16; P=2.2e-16), mRNA surveillance (FDR=3.619e-13; P=3.3307e-15) and RNA transport (FDR=3.619e-13; P=3.331e- 15) pathways (E). Pathway enrichment analysis of the RBPs that did not bind to CTL NDUFV2P1 mRNA yet bound with high abundance to mRNAs of SZ NDUFV2P1 as well as to NDUFV2 from both cohorts, identified two pathways RNA polymerase (FDR=4.7163e-2; P=2.228e-4) and RNA transport (FDR=4.2432e-3; P=6.9e-6) (F).

[0046] FIG. 10: A graphical summary of NDUFV2 and NDUFV2P1 state and interaction in SZ patients as compared to healthy CTL derived cells. Nuclear NDUFV2 mRNA levels are similar in SZ and CTL cells however NDUFV2P1 mRNA levels are significantly increased in SZ nucleus (A). NDUFV2 mRNA binding to NXF1, which facilitates the final step of mRNA transport process from the nucleus to the cytoplasm through a direct interaction with the nuclear pore complex, is hindered by NDUFV2P1 in SZ-LCLs. Hence, NDUFV2 mRNA binding to NXF1 is decreased, while NDUFV2P1 binding is increased in SZ cells (B). The altered binding to NXF1 underlies the cytosolic reduction of NDUFV2 and the increase of NDUFV2P1 mRNAs levels in SZ cells as compared to CTL-LCLs (C). NDUFV2 mRNA transport by RBPs through the cytosol to the ribosomes is probably also hindered as higher levels of RBPs bind NDUFV2P1 mRNA, while lower levels bind to NDUFV2 mRNA in SZ as compared to CTL (D). In mitochondrial bound ribosome, the main site of NDUFV2 mRNA translation, reduced level of NDUFV2 mRNA is observed, which leads to reduced levels of NDUFV2 protein observed in mitochondria (E). NDUFV2P1 transcript levels at the mitochondrial-bound ribosomes are higher in CTL than in SZ (E), suggesting that at this site NDUFV2P1 is bound to translate inhibitory RBP, such as FMRP1, thereby reducing the inhibitory effect in CTL, yet less so in SZ, which contributes to the decrease in NDUFV2 protein levels in SZ. Reduced levels of intra-mitochondrial NDUFV2 protein leads to deficits in complex I activity and finally to mitochondrial dysfunction in the disease.

[0047] FIGs. 11A-F are graphs illustrating that overexpression of hNDUFV2Pl in neonatal brain causes reversible spontaneous activity impairment in the open field test. Figure 11A-C show the mean speed curve of spontaneous activity changes over time in one, two and four months old hNDUFV2Pl infected mice; one-month old (Figure 11A) two-month-old hNDUFV2Pl (Figure 1 IB) infected mice show hyperactivity as compared to naive and empty virus infected mice, which was restored to normal by four-month of age (Figure 11C). Total distance travelled by hNDUFV2Pl infected mice in the open field test was elevated at one-month (Figure 11 D), was restored at two-month and (Figure 11F) and four-month-old hNDUFV2Pl infected mice as compared to naive and empty virus infected mice. Values are means ± SEM of 10 mice from two experiments. *P<0.05, ** P<0.001. PG OE - hNDUFV2Pl infected mice, CTR VEH - empty virus infected mice.

[0048] FIGs. 12A-D are graphs illustrating that overexpression of hNDUFV2Pl in neonatal brain causes long lasting impairments in social novelty test but reversible impairments in sociability. In two months old hNDUFV2Pl infected mice, sociability test parameters were impaired as compared to naive and empty virus infected mice (data not shown). At four months old hNDUFV2Pl infected mice did not show preference between the animal and object in day 1 (Figure 12A), calculated as interaction time and time index (percentage of time spent with mouse divided by object) and in day 2- (Figure 12B) of the test paradigm. However, the preference between novel and familiar animal was impaired. All parameters of social novelty were abnormal as compared to naive and empty virus injected mice: time spent with novel mouse, time index (percentage of time spent with novel mouse divided by total time), percentage of time in the novel chamber, time spent with familiar mouse and in familiar mouse’s chamber (Figure 12C). A graphical illustration of sociability and social novelty tests are illustrated in figure 12D. Values are means ± SEM of 10 mice from two experiments. *P<0.05, ** P< 0.01,*** P<0.00. PG OE - hNDUFV2Pl infected mice, CTR VEH - empty virus infected mice.

[0049] Figs. 13A-H are graphs illustrating that overexpression of hNDUFV2Pl in neonatal brain causes long lasting impairments spatial learning and memory tested in a Barnes maze as compared to naive and empty virus injected mice. The abnormality was manifested by longer learning curve measured by the latency time to reach the target (Figure 13 A) by the longer path length, (Figure 13B) and by the reference memory error on 1-5 days training days (Figure 13C). Memory probed on day 6 was also impaired as depicted by percentage of time spent at target quadrant (Figure 13D), time at target hole (Figure 13E), distance at target hole (Figure 13F), number of entries made at target hole (Figure 13G) and latency to reach target hole (Figure 13H). Time spent and distance covering at the target showed no significant differences between the three groups. Values are means ± SEM of 10 mice from two experiments. *P<0.05, ** P< 0.0, *** P<0.001. PG OE - hNDUFV2Pl infected mice, CTR VEH - empty virus infected mice.

[0050] FIGs. 14A-B demonstrate the significant decrease in the parent gene NDUFV2 within neurons of mPFC of four- month-old mice infected with hNDUFV2Pl. Representative triplestained images of mPFC show reduced levels of NDUFV2 (green) within the soma of neuron marked by NeuN (red) and DAPI (blue) in hNDUFV2Pl as compared to empty virus infected mice. Quantification of the mean intensity of NDUFV2 within soma of the neurons shows a significant reduction of NDUFV2 in hNDUFV2Pl infected mice as compared to those infected with empty virus. Scale bar = 20 pm. Magnification 60x. Values are means ± SEM of 6 mice from two experiments and 5-6 fields for each. *P<0.001. PG OE - hNDUFV2Pl infected mice, CTR VEH - empty virus infected mice.

[0051] DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

[0052] The present invention, in some embodiments thereof, relates to methods of altering mitochondrial function and uses thereof in therapy.

[0053] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0054] The present findings demonstrate that NDUFV2P1 affects various functions of the mitochondria. Hence, NDUFV2P1 over- or down-regulation oppositely affected NDUFV2 protein levels, mitochondrial respiration and their network dynamics in healthy subjects- and SZ- LCLs (Lymphocyte cell lines derived from patients and healthy subjects), respectively. In primary rat cortical neuron cultures, NDUFV2P1 overexpression induced deficits in mitochondrial function, which was associated with reduced neuronal branching, neurite sprouting and neuronal activity. In addition, the present inventors have shown that its over-expression in healthy subjects-derived cells induces mitochondrial dysfunction with a similar pattern to SZ cells and that its downregulation in SZ patients-derived cells restores mitochondrial functions.

[0055] The present inventors provide evidence that NDUFV2P1 mRNA interferes with NDUFV2 mRNA leading to the production of a malfunctioning NDUFV2 protein. Hence, suggested is a method for down-regulation of mRNA levels or activity of NDUFV2P1 by e.g., RNA interference technology (RNAi) such as shRNA, siRNA etc. or by antisense oligos (ASOs), which is delivered to patients with SZ. As the downregulation of NDUFV2P1 enhances mitochondrial respiration it could be effective also in other disorders with mitochondrial respiration deficiencies. Conversely, upregulating NDUFV2P1 by overexpressing its cytosolic sequence and thereby causing deficits in mitochondrial function and increasing ROS formation can be effective in treating tumors.

[0056] As shown in the Examples section which follows, uninfected SZ-LCLs showed higher transcript levels of NDUFV2P1, while lower transcript and protein levels of NDUFV2 (Figure 1A, B and G), dissipation of A\| / m (Figures 2A, B); impaired mitochondrial network dynamics [uneven mitochondrial cellular distribution (and reduced network connectivity (Figure 3A-D)]; and reduced mitochondrial respiration (Figures 2C-F) as compared to Cont-LCLs. Overexpression of NDUFV2P1 in Cont-LCLs by the infection with pLenti CMV containing NDUFV2P1- GFP+construct (OE PG) or a control vector (empty), caused an increase in NDUFV2P1 levels associated with reduced NDUFV2 transcripts and protein levels (Figure 1C, ID and 1H), impaired mitochondrial A\| / m (Figures 2G, H), network dynamics (Figure 3E), mitochondrial respiration (Figures 21- L), mimicking the mitochondrial state of uninfected SZ-LCLs. Down-regulation of NDUFV2P1 by the infection of SZ-derived LCLs with pLenti CMV containing hsRNA-GFP+ of NDUFV2P1 or an empty control virus caused opposite effects on all studied parameters (Figures IE, IF, 1I,1O-P, Figures 2 M-R and Figures 3LL and Figures 3Q-T) except for A\| / m which was not affected.

[0057] Taken together, these data substantiate a role for NDUFV2P1 in the regulation of mitochondrial function in LCLs. In rat cortical neuron primary cultures over expression of hNDUFV2Pl resulted in reduced mitochondrial respiration, dissipated A\| / m and an uneven distribution of the mitochondria in the neurons (Figure 4A-N) with no change in their connectivity. Mitochondrial dysfunction in neurons over-expressing hNDUFV2Pl was associated with aberrations in neuronal neurite number (end points) and branching (triple points), with no change in the average branch length as well as impairment in neuronal activity (Figures 5A-L). Whilst further reducing the present invention to practice, the present inventors have identified a potential mechanism by which NDUFV2P1 negatively controls NDUFV2 transcripts.

[0058] In SZ subjects-derived lymphocyte cell lines (LCLs), NDUFV2P1 transcript levels were increased in all subcellular fractions studied, while NDUFV2 transcript levels were reduced, except for in the nucleus compared to healthy subjects’ cells (CTL), suggesting its intact transcription, yet impaired nuclear export (Figures 7A-R). RNA immunoprecipitation with NXF1, a key player in transporting mRNA from the nucleus to the cytosol, revealed an increase of NDUFV2P1 yet a decrease of NDUFV2 binding to NXF1 (Figure 8A-F). The interactome of both mRNAs (RNA binding proteins - RBPs profile ) showed opposite binding capacity to almost all RBPs, lower for NDUFV2 transcripts and higher for NDUFV2P1 in SZ compared to CTL samples, and pinpoint additional RBPs differentiating between SZ and CTL including ribosomal and RNA transport-related RBPs (Figures 9A-F). Overexpression of NDUFV2P1 in CTL cells caused a reduction in NDUFV2 levels and in its binding efficiency to NXF1, mimicking SZ state thereby verifying NDUV2P1 role in NDUFV2 deficits in the disease (Figures 7D-F and 8E-H).

[0059] Overexpression of hNDUFV2Pl in neonatal mice brain induced mitochondrial, and behavioral impairment most likely due to reducing the complex I subunit NDUFV2 protein levels (Figures 11A-F, Figures 12A-D, Figures 13A-D and Figures 14A-B).

[0060] Thus, according to a first aspect of the invention, there is provided a method of altering mitochondrial function in a cell, the method comprising administering to the cell an agent which modulates expression or activity of NDUFV2P1.

[0061] As used herein “NDUFV2” is the Ubiquinone Oxidoreductase Core Subunit V2, which is a Protein Coding gene.

[0062] As used herein, “NDUFV2P1” NDUFV2P1 (NADH: Ubiquinone Oxidoreductase Core Subunit V2 Pseudogene 1) is a Pseudogene having mRNA but no protein product (Figure 6D).

[0063] Additional gene information for NDUFV2P1 Gene: HGNC (7718); NCBI Gene (4730); and / or Ensembl (ENSG00000267809).

[0064] As used herein “mitochondrial function” relates to the production of ATP (i.e. mitochondrial respiration), buffering of intracellular Ca2+concentrations, provision of metabolites serving as building blocks for multiple macromolecules and synthesizing heme and steroids, generation of reactive oxygen species (ROS) or apoptosis. In the CNS, impaired mitochondria can lead to deficits in neuronal development, firing and synaptic plasticity to oxidative stress and inflammation, and ultimately to abnormal behaviour.

[0065] As used herein “altering” refers to increasing or decreasing mitochondrial function as manifested by at least one parameter of functionaility relative to a control e.g., cell being treated under the same conditions as the method described herein albeit in the absence of the agent.

[0066] Altering is by at least about 10 %, 20 %, 30 %, 40 %m 50 %, 60 %, 70 %, 80 %, 90 % or more or say at least about 2 folds, 3 folds, 5 folds, 10 folds or higher.

[0067] In one embodiment, the altering is increasing at least one mitochondrial function. This can be carried out by decreasing an activity and / or amount of NDUFV2P1.

[0068] According to specific embodiments the downregulating agent is an RNA silencing agent or a genome editing agent.

[0069] As used herein, the phrase "RNA silencing" refers to a group of regulatory mechanisms [e.g. RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression] mediated by RNA molecules which result in the inhibition or "silencing" of the expression of a corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

[0070] As used herein, the term "RNA silencing agent" refers to an RNA which is capable of specifically inhibiting or "silencing" the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g, the full translation and / or expression) of an mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small non-coding RNAs can be generated. Exemplary RNA silencing agents include dsRNAs such as siRNAs, miRNAs and shRNAs.

[0071] In one embodiment, the RNA silencing agent is capable of inducing RNA interference.

[0072] In another embodiment, the RNA silencing agent is capable of mediating translational repression.

[0073] According to an embodiment of the invention, the RNA silencing agent is specific to the target RNA (e.g., NDUFV2P1) and does not cross inhibit or silence other targets or a splice variant which exhibits 99% or less global homology to the target gene, e.g., less than 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% global homology to the target gene; as determined by PCR, Western blot, Immunohistochemistry and / or flow cytometry.

[0074] For downregulation of NDUFV2P1 by silencing, a location non-homologous to NDUFV2 is preferably used. An exemplary shRNA sequence is provided in the Examples section which follows. Contemplated herein are the human or non-human homologs for targeting the gene by genome editing or silencing dependent on the selected cell (for instance, the silencing molecule for use in human will be effective on the human sequence).

[0075] RNA interference refers to the process of sequence- specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs).

[0076] Following is a detailed description on RNA silencing agents that can be used according to specific embodiments of the present invention.

[0077] DsRNA, siRNA and shRNA - The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex.

[0078] Accordingly, some embodiments of the invention contemplate use of dsRNA to downregulate protein expression from mRNA.

[0079] According to one embodiment dsRNA longer than 30 bp are used. Various studies demonstrate that long dsRNAs can be used to silence gene expression without inducing the stress response or causing significant off-target effects - see for example [Strat et al., Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004;13: 115- 125; Diallo M., et al., Oligonucleotides. 2003;13:381-392; Paddison P.J., et al., Proc. Natl Acad. Sci. USA. 2002;99: 1443-1448; Tran N., et al., FEBS Lett. 2004;573: 127-134],

[0080] According to some embodiments of the invention, dsRNA is provided in cells where the interferon pathway is not activated, see for example Billy et al., PNAS 2001, Vol 98, pages 14428- 14433. and Diallo et al, Oligonucleotides, October 1, 2003, 13(5): 381-392. doi: 10.1089 / 154545703322617069.

[0081] According to an embodiment of the invention, the long dsRNA are specifically designed not to induce the interferon and PKR pathways for down-regulating gene expression. For example, Shinagwa and Ishii [Genes & Dev. 17 (11): 1340-1345, 2003] have developed a vector, named pDECAP, to express long double-strand RNA from an RNA polymerase II (Pol II) promoter. Because the transcripts from pDECAP lack both the 5'-cap structure and the 3'-poly(A) tail that facilitate ds-RNA export to the cytoplasm, long ds-RNA from pDECAP does not induce the interferon response. Another method of evading the interferon and PKR pathways in mammalian systems is by introduction of small inhibitory RNAs (siRNAs) either via transfection or endogenous expression.

[0082] The term "siRNA" refers to small inhibitory RNA duplexes (generally between 18-30 base pairs) that induce the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19 bp duplex region and symmetric 2-base 3'-overhangs on the termini, although it has been recently described that chemically synthesized RNA duplexes of 25-30 base length can have as much as a 100-fold increase in potency compared with 21mers at the same location. The observed increased potency obtained using longer RNAs in triggering RNAi is suggested to result from providing Dicer with a substrate (27mer) instead of a product (21mer) and that this improves the rate or efficiency of entry of the siRNA duplex into RISC.

[0083] It has been found that position of the 3'-overhang influences potency of an siRNA and asymmetric duplexes having a 3 '-overhang on the antisense strand are generally more potent than those with the 3'-overhang on the sense strand (Rose et al., 2005). This can be attributed to asymmetrical strand loading into RISC, as the opposite efficacy patterns are observed when targeting the antisense transcript.

[0084] The strands of a double- stranded interfering RNA (e.g., an siRNA) may be connected to form a hairpin or stem-loop structure (e.g., an shRNA). Thus, as mentioned, the RNA silencing agent of some embodiments of the invention may also be a short hairpin RNA (shRNA).

[0085] The term "shRNA", as used herein, refers to an RNA agent having a stem- loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between and including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11. Some of the nucleotides in the loop can be involved in base-pair interactions with other nucleotides in the loop. Examples of oligonucleotide sequences that can be used to form the loop include 5'-CAAGAGA-3' and 5’-UUACAA-3’ (International Patent Application Nos. WO2013126963 and WO2014107763). It will be recognized by one of skill in the art that the resulting single chain oligonucleotide forms a stem- loop or hairpin structure comprising a doublestranded region capable of interacting with the RNAi machinery.

[0086] Synthesis of RNA silencing agents suitable for use with some embodiments of the invention can be effected as follows. First, the NDUFV2P1 mRNA sequence is scanned downstream of the AUG start codon for AA dinucleotide sequences. Occurrence of each AA and the 3’ adjacent 19 nucleotides is recorded as potential siRNA target sites. Preferably, siRNA target sites are selected from the open reading frame, as untranslated regions (UTRs) are richer in regulatory protein binding sites. UTR-binding proteins and / or translation initiation complexes may interfere with binding of the siRNA endonuclease complex [Tuschl ChemBiochem. 2:239- 245]. It will be appreciated though, that siRNAs directed at untranslated regions may also be effective, as demonstrated for GAPDH wherein siRNA directed at the 5’ UTR mediated about 90 % decrease in cellular GAPDH mRNA and completely abolished protein level (www.ambion.com / techlib / tn / 91 / 912.html).

[0087] Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih.gov / BLAST / ). Putative target sites which exhibit significant homology to other coding sequences are filtered out.

[0088] Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G / C content as these have proven to be more effective in mediating gene silencing as compared to those with G / C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.

[0089] It will be appreciated that, and as mentioned herein above, the RNA silencing agent of some embodiments of the invention need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides. miRNA and miRNA mimics - According to another embodiment the RNA silencing agent may be a miRNA.

[0090] The term "microRNA", "miRNA", and "miR" are synonymous and refer to a collection of non-coding single-stranded RNA molecules of about 19-28 nucleotides in length, which regulate gene expression. miRNAs are found in a wide range of organisms (viruses.fwdarw.humans) and have been shown to play a role in development, homeostasis, and disease etiology.

[0091] Below is a brief description of the mechanism of miRNA activity.

[0092] Genes coding for miRNAs are transcribed leading to production of an miRNA precursor known as the pri-miRNA. The pri-miRNA is typically part of a polycistronic RNA comprising multiple pri-miRNAs. The pri-miRNA may form a hairpin with a stem and loop. The stem may comprise mismatched bases. The hairpin structure of the pri-miRNA is recognized by Drosha, which is an RNase III endonuclease. Drosha typically recognizes terminal loops in the pri-miRNA and cleaves approximately two helical turns into the stem to produce a 60-70 nucleotide precursor known as the pre-miRNA. Drosha cleaves the pri-miRNA with a staggered cut typical of RNase III endonucleases yielding a pre-miRNA stem loop with a 5' phosphate and ~2 nucleotide 3' overhang. It is estimated that approximately one helical turn of stem (~10 nucleotides) extending beyond the Drosha cleavage site is essential for efficient processing. The pre-miRNA is then actively transported from the nucleus to the cytoplasm by Ran-GTP and the export receptor Ex-portin-5.

[0093] The double-stranded stem of the pre-miRNA is then recognized by Dicer, which is also an RNase III endonuclease. Dicer may also recognize the 5' phosphate and 3' overhang at the base of the stem loop. Dicer then cleaves off the terminal loop two helical turns away from the base of the stem loop leaving an additional 5' phosphate and ~2 nucleotide 3' overhang. The resulting siRNA-like duplex, which may comprise mismatches, comprises the mature miRNA and a similarsized fragment known as the miRNA*. The miRNA and miRNA* may be derived from opposing arms of the pri-miRNA and pre-miRNA*. miRNA* sequences may be found in libraries of cloned miRNAs but typically at lower frequency than the miRNAs.

[0094] Although initially present as a double- stranded species with miRNA*, the miRNA eventually becomes incorporated as a single-stranded RNA into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can lead to variability in specificity for miRNA / miRNA* duplexes, binding site of the target gene, activity of miRNA (repress or activate), and which strand of the miRNA / miRNA* duplex is loaded in to the RISC.

[0095] When the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* is removed and degraded. The strand of the miRNA:miRNA* duplex that is loaded into the RISC is the strand whose 5' end is less tightly paired. In cases where both ends of the miRNA:miRNA* have roughly equivalent 5' pairing, both miRNA and miRNA* may have gene silencing activity.

[0096] The RISC identifies target nucleic acids based on high levels of complementarity between the miRNA and the mRNA, especially by nucleotides 2-7 of the miRNA.

[0097] A number of studies have looked at the base-pairing requirement between miRNA and its mRNA target for achieving efficient inhibition of translation (reviewed by Bartel 2004, Cell 116- 281). In mammalian cells, the first 8 nucleotides of the miRNA may be important (Doench & Sharp 2004 GenesDev 2004-504). However, other parts of the miRNA may also participate in mRNA binding. Moreover, sufficient base pairing at the 3’ can compensate for insufficient pairing at the 5’ (Brennecke et al, 2005 PLoS 3-e85). Computation studies, analyzing miRNA binding on whole genomes have suggested a specific role for bases 2-7 at the 5’ of the miRNA in target binding but the role of the first nucleotide, found usually to be “A” was also recognized (Lewis et at 2005 Cell 120-15). Similarly, nucleotides 1-7 or 2-8 were used to identify and validate targets by Krek et al. (2005, Nat Genet 37-495).

[0098] The target sites in the mRNA may be in the 5' UTR, the 3' UTR or in the coding region. Interestingly, multiple miRNAs may regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA binding sites in most genetically identified targets may indicate that the cooperative action of multiple RISCs provides the most efficient translational inhibition. miRNAs may direct the RISC to downregulate gene expression by either of two mechanisms: mRNA cleavage or translational repression. The miRNA may specify cleavage of the mRNA if the mRNA has a certain degree of complementarity to the miRNA. When a miRNA guides cleavage, the cut is typically between the nucleotides pairing to residues 10 and 11 of the miRNA. Alternatively, the miRNA may repress translation if the miRNA does not have the requisite degree of complementarity to the miRNA. Translational repression may be more prevalent in animals since animals may have a lower degree of complementarity between the miRNA and binding site.

[0099] It should be noted that there may be variability in the 5’ and 3’ ends of any pair of miRNA and miRNA*. This variability may be due to variability in the enzymatic processing of Drosha and Dicer with respect to the site of cleavage. Variability at the 5’ and 3’ ends of miRNA and miRNA* may also be due to mismatches in the stem structures of the pri-miRNA and pre-miRNA. The mismatches of the stem strands may lead to a population of different hairpin structures. Variability in the stem structures may also lead to variability in the products of cleavage by Drosha and Dicer.

[0100] The term "microRNA mimic" or “miRNA mimic” refers to synthetic non-coding RNAs that are capable of entering the RNAi pathway and regulating gene expression. miRNA mimics imitate the function of endogenous miRNAs and can be designed as mature, double stranded molecules or mimic precursors (e.g., or pre-miRNAs). miRNA mimics can be comprised of modified or unmodified RNA, DNA, RNA-DNA hybrids, or alternative nucleic acid chemistries (e.g., LNAs or 2'-O,4'-C-ethylene-bridged nucleic acids (ENA)). For mature, double stranded miRNA mimics, the length of the duplex region can vary between 13-33, 18-24 or 21-23 nucleotides. The miRNA may also comprise a total of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides. The sequence of the miRNA may be the first 13-33 nucleotides of the pre-miRNA. The sequence of the miRNA may also be the last 13-33 nucleotides of the pre-miRNA.

[0101] Preparation of miRNAs mimics can be affected by any method known in the art such as chemical synthesis or recombinant methods.

[0102] It will be appreciated from the description provided herein above that contacting cells with a miRNA may be affected by transfecting the cells with e.g. the mature double stranded miRNA, the pre-miRNA or the pri-miRNA.

[0103] The pre-miRNA sequence may comprise from 45-90, 60-80 or 60-70 nucleotides.

[0104] The pri-miRNA sequence may comprise from 45-30,000, 50-25,000, 100-20,000, 1,000- 1,500 or 80-100 nucleotides.

[0105] Antisense - Antisense is a single stranded RNA designed to prevent or inhibit expression of a gene by specifically hybridizing to its mRNA. Downregulation of a mRNA can be affected using an antisense polynucleotide capable of specifically hybridizing with an mRNA transcript encoding NDUFV2P1.

[0106] Design of antisense molecules which can be used to efficiently downregulate a NDUFV2P1 must be affected while considering two aspects important to the antisense approach. The first aspect is delivery of the oligonucleotide into the cytoplasm of the appropriate cells, while the second aspect is design of an oligonucleotide which specifically binds the designated mRNA within cells in a way which inhibits translation thereof.

[0107] Another agent capable of downregulating a NDUFV2P1 is a ribozyme molecule capable of specifically cleaving an mRNA transcript encoding a NDUFV2P1. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest [Welch et al., Curr Opin Biotechnol. 9:486-96 (1998)]. The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders [Welch et al., Clin Diagn Virol. 10: 163-71 (1998)]. Most notably, several ribozyme gene therapy protocols for HIV patients are already in Phase 1 trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials.

[0108] An additional method of regulating the expression of an NDUFV2P1 gene in cells is via triplex forming oligonuclotides (TFOs). Recent studies have shown that TFOs can be designed which can recognize and bind to polypurine / polypirimidine regions in double- stranded helical DNA in a sequence-specific manner. These recognition rules are outlined by Maher III, L. J., et al., Science, 1989;245:725-730; Moser, H. E„ et al., Science, 1987;238:645-630; Beal, P. A., et al, Science, 1992;251: 1360-1363; Cooney, M., et al., Science, 1988;241:456-459; and Hogan, M. E., et al., EP Publication 375408. Modification of the oligonuclotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, J Clin Invest 2003;l 12:487- 94).

[0109] In general, the triplex-forming oligonucleotide has the sequence correspondence: oligo 3'— A G G T duplex 5'— A G C T duplex 3'— T C G A

[0110] However, it has been shown that the A-AT and G-GC triplets have the greatest triple helical stability (Reither and Jeltsch, BMC Biochem, 2002, Septl2, Epub). The same authors have demonstrated that TFOs designed according to the A-AT and G-GC rule do not form non-specific triplexes, indicating that the triplex formation is indeed sequence specific.

[0111] Thus for any given sequence in the NDUFV2P1 regulatory region a triplex forming sequence may be devised. Triplex-forming oligonucleotides preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.

[0112] Transfection of cells (for example, via cationic liposomes) with TFOs, and formation of the triple helical structure with the target DNA induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and resulting in the specific downregulation of gene expression. Examples of such suppression of gene expression in cells treated with TFOs include knockout of episomal supFGl and endogenous HPRT genes in mammalian cells (Vasquez et al., Nucl Acids Res. 1999;27: 1176-81, and Puri, et al, J Biol Chem, 2001;276:28991-98), and the sequence- and target specific downregulation of expression of the Ets2 transcription factor, important in prostate cancer etiology (Carbone, et al, Nucl Acid Res. 2003 ;31:833-43), and the pro-inflammatory ICAM-1 gene (Besch et al, J Biol Chem, 2002;277:32473-79). In addition, Vuyisich and Beal have recently shown that sequence specific TFOs can bind to dsRNA, inhibiting activity of dsRNA-dependent enzymes such as RNA-dependent kinases (Vuyisich and Beal, Nuc. Acids Res 2000;28:2369-74).

[0113] Additionally, TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both downregulation and upregulation of expression of endogenous genes (Seidman and Glazer, J Clin Invest 2003; 112:487- 94). Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003 017068 and 2003 0096980 to Froehler et al, and 2002 0128218 and 2002 0123476 to Emanuele et al, and U.S. Pat. No. 5,721,138 to Lawn.

[0114] The prior art teaches of a number of delivery strategies which can be used to efficiently deliver oligonucleotides into a wide variety of cell types [see, for example, Jaaskelainen et al. Cell Mol Biol Lett. (2002) 7(2):236-7; Gait, Cell Mol Life Sci. (2003) 60(5):844-53; Martino et al. J Biomed Biotechnol. (2009) 2009:410260; Grijalvo et al. Expert Opin Ther Pat. (2014) 24(7):801- 19; Falzarano et al, Nucleic Acid Ther. (2014) 24(l):87-100; Shilakari et al. Biomed Res Int. (2014) 2014: 526391; Prakash et al. Nucleic Acids Res. (2014) 42(13):8796-807 and Asseline et al. J Gene Med. (2014) 16(7-8): 157-65]

[0115] In addition, algorithms for identifying those sequences with the highest predicted binding affinity for their target mRNA based on a thermodynamic cycle that accounts for the energetics of structural alterations in both the target mRNA and the oligonucleotide are also available [see, for example, Walton et al. Biotechnol Bioeng 65: 1-9 (1999)]. Such algorithms have been successfully used to implement an antisense approach in cells.

[0116] In addition, several approaches for designing and predicting efficiency of specific oligonucleotides using an in vitro system were also published (Matveeva et al., Nature Biotechnology 16: 1374 - 1375 (1998)].

[0117] Thus, the generation of highly accurate antisense design algorithms and a wide variety of oligonucleotide delivery systems, enable an ordinarily skilled artisan to design and implement antisense approaches suitable for downregulating expression of known sequences without having to resort to undue trial and error experimentation.

[0118] Nucleic acid agents can also operate at the DNA level as summarized infra.

[0119] Downregulation of NDUFV2P1 can also be achieved by inactivating the gene via introducing targeted mutations involving loss-of function alterations (e.g. point mutations, deletions and insertions) in the gene structure.

[0120] Methods of introducing nucleic acid alterations to a gene of interest are well known in the art [see for example Menke D. Genesis (2013) 51: - 618; Capecchi, Science (1989) 244: 1288- 1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; US Patent Nos. 8771945, 8586526, 6774279 and UP Patent Application Publication Nos. 20030232410, 20050026157, US20060014264; the contents of which are incorporated by reference in their entireties] and include targeted homologous recombination, site specific recombinases, PB transposases and genome editing by engineered nucleases. Agents for introducing nucleic acid alterations to a gene of interest can be designed using publically available sources or obtained commercially from Transposagen, Addgene and Sangamo Biosciences.

[0121] Following is a description of various exemplary methods used to introduce nucleic acid alterations to a gene of interest and agents for implementing same that can be used according to specific embodiments of the present invention.

[0122] Genome Editing using engineered endonucleases - this approach refers to a reverse genetics method using artificially engineered nucleases to cut and create specific double- stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homology directed repair (HDR) and non-homologous end-joining (NFfEJ). NFfEJ directly joins the DNA ends in a double- stranded break, while HDR utilizes a homologous sequence as a template for regenerating the missing DNA sequence at the break point. In order to introduce specific nucleotide modifications to the genomic DNA, a DNA repair template containing the desired sequence must be present during HDR. Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and the probability is very high that the recognized base pair combination will be found in many locations across the genome resulting in multiple cuts not limited to a desired location. To overcome this challenge and create site-specific single- or doublestranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TAEENs) and CRISPR / Cas system.

[0123] Meganucleases - Meganucleases are commonly grouped into four families: the LAGEIDADG family, the GIY-YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the LAGEIDADG family are characterized by having either one or two copies of the conserved EAGLIDADG motif. The four families of meganucleases are widely separated from one another with respect to conserved structural elements and, consequently, DNA recognition sequence specificity and catalytic activity. Meganucleases are found commonly in microbial species and have the unique property of having very long recognition sequences (>14bp) thus making them naturally very specific for cutting at a desired location. This can be exploited to make site-specific double-stranded breaks in genome editing. One of skill in the art can use these naturally occurring meganucleases, however the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. For example, various meganucleases have been fused to create hybrid enzymes that recognize a new sequence. Alternatively, DNA interacting amino acids of the meganuclease can be altered to design sequence specific meganucleases (see e.g., US Patent 8,021,867). Meganucleases can be designed using the methods described in e.g., Certo, MT et al. Nature Methods (2012) 9:073-975; U.S. Patent Nos. 8,304,222; 8,021,867; 8, 119,381; 8, 124,369; 8, 129,134; 8,133,697; 8,143,015; 8,143,016; 8, 148,098; or 8, 163,514, the contents of each are incorporated herein by reference in their entirety. Alternatively, meganucleases with site specific cutting characteristics can be obtained using commercially available technologies e.g., Precision Biosciences' Directed Nuclease Editor™ genome editing technology.

[0124] ZFNs and TALENs - Two distinct classes of engineered nucleases, zinc-finger nucleases (ZFNs) and transcription activator- like effector nucleases (TALENs), have both proven to be effective at producing targeted double- stranded breaks (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).

[0125] Basically, ZFNs and TALENs restriction endonuclease technology utilizes a non-specific DNA cutting enzyme which is linked to a specific DNA binding domain (either a series of zinc finger domains or TALE repeats, respectively). Typically a restriction enzyme whose DNA recognition site and cleaving site are separate from each other is selected. The cleaving portion is separated and then linked to a DNA binding domain, thereby yielding an endonuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with such properties is Fokl. Additionally Fokl has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, Fokl nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The heterodimer functioning nucleases avoid the possibility of unwanted homodimer activity and thus increase specificity of the doublestranded break.

[0126] Thus, for example to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind adjacent sequences at the targeted site. Upon transient expression in cells, the nucleases bind to their target sites and the Fokl domains heterodimerize to create a double-stranded break. Repair of these double- stranded breaks through the nonhomologous end-joining (NHEJ) pathway most often results in small deletions or small sequence insertions. Since each repair made by NHEJ is unique, the use of a single nuclease pair can produce an allelic series with a range of different deletions at the target site. The deletions typically range anywhere from a few base pairs to a few hundred base pairs in length, but larger deletions have successfully been generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a fragment of DNA with homology to the targeted region is introduced in conjunction with the nuclease pair, the doublestranded break can be repaired via homology directed repair to generate specific modifications (Li et al., 2011; Miller et al., 2010; Umov et al., 2005).

[0127] Although the nuclease portions of both ZFNs and TALENs have similar properties, the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs rely on Cys2- His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers typically found in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs happen in repeated patterns, different combinations can be tried to create a wide variety of sequence specificities. Approaches for making site-specific zinc finger endonucleases include, e.g., modular assembly (where Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence), OPEN (low- stringency selection of peptide domains vs. triplet nucleotides followed by high-stringency selections of peptide combination vs. the final target in bacterial systems), and bacterial one-hybrid screening of zinc finger libraries, among others. ZFNs can also be designed and obtained commercially from e.g., Sangamo Biosciences™ (Richmond, CA).

[0128] Method for designing and obtaining TALENs are described in e.g. Reyon et al. Nature Biotechnology 2012 May;30(5):460-5; Miller et al. Nat Biotechnol. (2011) 29: 143-148; Cermak et al. Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al. Nature Biotechnology (2011) 29 (2): 149-53. A recently developed web-based program named Mojo Hand was introduced by Mayo Clinic for designing TAL and TALEN constructs for genome editing applications (can be accessed through www(dot)talendesign(dot)org). TALEN can also be designed and obtained commercially from e.g., Sangamo Biosciences™ (Richmond, CA).

[0129] CRISPR-Cas system - Many bacteria and archea contain endogenous RNA-based adaptive immune systems that can degrade nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) genes that produce RNA components and CRISPR associated (Cas) genes that encode protein components. The CRISPR RNAs (crRNAs) contain short stretches of homology to specific viruses and plasmids and act as guides to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogen. Studies of the type II CRISPR / Cas system of Streptococcus pyogenes have shown that three components form an RNA / protein complex and together are sufficient for sequence- specific nuclease activity: the Cas9 nuclease, a crRNA containing 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337: 816-821.). It was further demonstrated that a synthetic chimeric guide RNA (gRNA) composed of a fusion between crRNA and tracrRNA could direct Cas9 to cleave DNA targets that are complementary to the crRNA in vitro. It was also demonstrated that transient expression of Cas9 in conjunction with synthetic gRNAs can be used to produce targeted double- stranded brakes in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a, b; Jinek et al., 2013; Mali et al., 2013).

[0130] The CRIPSR / Cas system for genome editing contains two distinct components: a gRNA and an endonuclease e.g. Cas9.

[0131] The gRNA is typically a 20 nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA / Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA / Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break. Just as with ZFNs and TALENs, the double-stranded brakes produced by CRISPR / Cas can undergo homologous recombination or NHEJ.

[0132] The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double strand breaks in the genomic DNA.

[0133] A significant advantage of CRISPR / Cas is that the high efficiency of this system coupled with the ability to easily create synthetic gRNAs enables multiple genes to be targeted simultaneously. In addition, the majority of cells carrying the mutation present biallelic mutations in the targeted genes.

[0134] However, apparent flexibility in the base-pairing interactions between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cut by Cas9.

[0135] Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH-, are called ‘nickases’. With only one active nuclease domain, the Cas9 nickase cuts only one strand of the target DNA, creating a single-strand break or 'nick'. A single-strand break, or nick, is normally quickly repaired through the HDR pathway, using the intact complementary DNA strand as the template. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are treated as a double-strand break, in what is often referred to as a 'double nick' CRISPR system. A double-nick can be repaired by either NHEJ or HDR depending on the desired effect on the gene target. Thus, if specificity and reduced off-target effects are crucial, using the Cas9 nickase to create a double-nick by designing two gRNAs with target sequences in close proximity and on opposite strands of the genomic DNA would decrease off- target effect as either gRNA alone will result in nicks that will not change the genomic DNA.

[0136] Modified versions of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9, or dCas9) have no nuclease activity while still able to bind to DNA based on gRNA specificity. The dCas9 can be utilized as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.

[0137] There are a number of publicly available tools available to help choose and / or design target sequences as well as lists of bioinformatically determined unique gRNAs for different genes in different species such as the Feng Zhang lab's Target Finder, the Michael Boutros lab's Target Finder (E-CRISP), the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes and the CRISPR Optimal Target Finder.

[0138] Non-limiting examples of a gRNA that can be used in the present invention include target sequences to the non-homologous sequence of NDUFV2 in exon 1 of NDUFV2P1 gene.

[0139] In order to use the CRISPR system, both gRNA and Cas9 should be expressed in a target cell. The insertion vector can contain both cassettes on a single plasmid or the cassettes are expressed from two separate plasmids. CRISPR plasmids are commercially available such as the px33O plasmid from Addgene.

[0140] Upregulation of NDUFV2P1 can be affected at the genomic level (z.e., activation of transcription via promoters, enhancers, regulatory elements), at the transcript level (z.e., correct splicing, polyadenylation, activation of translation).

[0141] Following is a list of agents capable of upregulating the expression level and / or activity of NDUFV2P1.

[0142] For up-regulation of NDUFV 2P 1 , contemplated herein are the natural or synthetic versions of NDUFV2P1 (e.g., at least 80 %, 85 %, 901 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 % or 100 % identity to the human gene).

[0143] According to a specific embodiment, a cDNA sequence of NDUFV2P1 is used for upregulation. An agent capable of upregulating expression of a NDUFV2P1 may be an exogenous polynucleotide sequence designed and constructed to express at least a functional portion of the NDUFV2P1. Accordingly, the exogenous polynucleotide sequence may be a DNA or RNA sequence encoding a NDUFV2P1 molecule, capable of interfering with the amount / activity of NDUFV2.

[0144] To express exogenous NDUFV2P1 in mammalian cells, a polynucleotide sequence encoding a NDUFV2P1 is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.

[0145] It will be appreciated that the nucleic acid construct of some embodiments of the invention can also utilize NDUFV2P1 homologues which exhibit the desired activity. Such homologues can be, for example, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85

[0146] %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92

[0147] %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99

[0148] % or 100 % identical to SEQ ID NO: 1, as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10 and average mismatch equals -9.

[0149] According to a specific embodiment, the genes or mRNAs are human. According to a specific embodiment, the genes or mRNAs are non-human orthologs (e.g., same function and level of identity above 80 % to the human gene).

[0150] Constitutive promoters suitable for use with some embodiments of the invention are promoter sequences which are active under most environmental conditions and most types of cells such as the cytomegalovirus (CMV) and Rous sarcoma virus (RSV).

[0151] To express exogenous NDUFV2P1 in mammalian cells, the NDUFV2P1 polynucleotide sequence is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.

[0152] The nucleic acid construct (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a poly adenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof. The nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.

[0153] Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.

[0154] Preferably, the promoter utilized by the nucleic acid construct of some embodiments of the invention is active in the specific cell population transformed. Examples of cell type-specific and / or tissue-specific promoters include promoters such as albumin that is liver specific [Pinkert et al., (1987) Genes Dev. 1:268-277], lymphoid specific promoters [Calame et al., (1988) Adv. Immunol. 43:235-275]; in particular promoters of T-cell receptors [Winoto et al., (1989) EMBO J. 8:729-733] and immunoglobulins; [Banerji et al. (1983) Cell 33729-740], neuron- specific promoters such as the neurofilament promoter [Byrne et al. (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477], pancreas-specific promoters [Edlunch et al. (1985) Science 230:912-916] or mammary gland- specific promoters such as the milk whey promoter (U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166).

[0155] Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer / promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long-term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.

[0156] In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

[0157] Poly adenylation sequences can also be added to the expression vector in order to increase the efficiency of NDUFV2P1 mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11- 30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.

[0158] In addition to the elements already described, the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.

[0159] The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.

[0160] It will be appreciated that the individual elements comprised in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding a NDUFV2P1 can be arranged in a "head- to-tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.

[0161] Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, pZeoSV2(+ / -), pSecTag2, pDisplay, pEF / myc / cyto, pCMV / myc / cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.

[0162] Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p2O5. Other exemplary vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.

[0163] As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein. For example, bone marrow cells can be targeted using the human T cell leukemia virus type I (HTLV-I) and kidney cells may be targeted using the heterologous promoter present in the baculovirus Autographa californica nucleopolyhedro virus (AcMNPV) as described in Liang CY et al., 2004 (Arch Virol. 149: 51-60).

[0164] Recombinant viral vectors are useful for in vivo expression of NDUFV2P1 since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.

[0165] Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.

[0166] Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non- viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems. Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)]. The most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses. A viral construct such as a retroviral construct includes at least one transcriptional promoter / enhancer or locus -defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. In addition, such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention. Optionally, the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof. Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.

[0167] The agent capable of upregulating NDUFV2P1 may be the mRNA molecule.

[0168] Methods of stabilizing mRNA are known in the art and include modulation of the length of the polyadenine tail found at the 3” end of the mRNA transcript. Alternativley, or additionally, the mRNA cap found at the molecule’s 5’ end can be modified. The naturally occurring cap structure typical in mammalian cells has a tendency to be improperly incorporated into mRNAs synthesized in vitro, rendering them less effective. Synthetic “anti-reverse cap analogs” (e.g. those commercially available at Thermo Fisher Scientific) can prevent this misincorporation, which results in more stable mRNA with improved translational efficiency. In order to reduce immunogenicity, substitution of particular nucleotides can be exchanged with chemically modified alternatives such as 5-methylcytosine or pseudoruidine. Such substiutions can mute the immune response whilst also bolstering the stability of the mRNA and efficiency of translation. In certain cases, particular nucleotides can be incorporated into the mRNA to increase immunogenicity. This may be particularly relevant for vaccine therapy.

[0169] Alternatively, or additionally, the mRNA may be encapsulated in lipid-based particles to enhance fusion with the lipid cell membrane.

[0170] Thus, it is suggesed that modulation of mitochondrial activity as described and claimed herein can be useful in the treatment of a variety of medical coditions.

[0171] In mental diseases, mitochondrial function is disrupted. In order to alleviate these conditions, it is suggested to down-regulate NDUFV2P1.

[0172] Exemplary mental diseases which may be treated according to embodiments of the present invention include schizophrenia, bipolar, autism and depression.

[0173] The present inventors also contemplate increasing mitochondrial function (i.e. downregulation of NDUFV2P1) as a therapeutic for treating neurodegenerative diseases.

[0174] Exemplary neurodegenerative diseases which may be treated according to embodiments of the present invention include, but are not limited to, Alexander disease, Alper's disease, Alzheimer's disease, Amyotrophic lateral sclerosis, Ataxia telangiectasia, Batten disease (also known as Spielmeyer- Vogt-Sjogren-Batten disease), Bovine spongiform encephalopathy (BSE), Canavan disease, Cockayne syndrome, Corticobasal degeneration, Creutzfeldt- Jakob disease, Huntington disease, HIV-associated dementia, Kennedy's disease, Krabbe disease, Lewy body dementia, Machado-Joseph disease (Spinocerebellar ataxia type 3), Multiple sclerosis, Multiple System Atrophy, Neuroborreliosis, Parkinson disease, Pelizaeus-Merzbacher Disease, Pick's disease, Primary lateral sclerosis, Prion diseases, Refsum's disease, Sandhoff disease, Schilder's disease, Sub-Acute Combined Degeneration of the Cord Secondary to Pernicious Anaemia, Schizophrenia, Spielmeyer-Vogt-Sjogren-Batten disease (also known as Batten disease), Spinocerebellar ataxia (multiple types with varying characteristics), Spinal muscular atrophy, Steele-Richardson-Olszewski disease and Tabes dorsalis.

[0175] In cancer, oxidative phosphorylation is essential to sustain cancer cell growth and can also increase sensitivity to Gold standard treatments, e.g., chemotherapy, as first or second line of treatment.

[0176] Up-regulation of NDUFV2P1 would cause an aberrant mitochondrial function rendering cancer cells, which are dependent on mitochondrial function suscpetible to cell killing and / or would induce oxidative stress by formation of targeted ROS that would induce cell death.

[0177] Exemplary cancers which can be treated by up-regulation of NDUFV2P1 include adrenocortical carcinoma, hereditary; bladder cancer; breast cancer; breast cancer, ductal; breast cancer, invasive intraductal; breast cancer, sporadic; breast cancer, susceptibility to; breast cancer, type 4; breast cancer, type 4; breast cancer- 1; breast cancer-3; breast-ovarian cancer; Burkitt’s lymphoma; cervical carcinoma; colorectal adenoma; colorectal cancer; colorectal cancer, hereditary nonpolyposis, type 1; colorectal cancer, hereditary nonpolyposis, type 2; colorectal cancer, hereditary nonpolyposis, type 3; colorectal cancer, hereditary nonpolyposis, type 6; colorectal cancer, hereditary nonpolyposis, type 7; dermatofibrosarcoma protuberans; endometrial carcinoma; esophageal cancer; gastric cancer, fibrosarcoma, glioblastoma multiforme; glomus tumors, multiple; hepatoblastoma; hepatocellular cancer; hepatocellular carcinoma; leukemia, acute lymphoblastic; leukemia, acute myeloid; leukemia, acute myeloid, with eosinophilia; leukemia, acute nonlymphocytic; leukemia, chronic myeloid; Li-Fraumeni syndrome; liposarcoma, lung cancer; lung cancer, small cell; lymphoma, non-Hodgkin’s; lynch cancer family syndrome II; male germ cell tumor; mast cell leukemia; medullary thyroid; medulloblastoma; melanoma, meningioma; multiple endocrine neoplasia; myeloid malignancy, predisposition to; myxosarcoma, neuroblastoma; osteosarcoma; ovarian cancer; ovarian cancer, serous; ovarian carcinoma; ovarian sex cord tumors; pancreatic cancer; pancreatic endocrine tumors; paraganglioma, familial nonchromaffin; pilomatricoma; pituitary tumor, invasive; prostate adenocarcinoma; prostate cancer; renal cell carcinoma, papillary, familial and sporadic; retinoblastoma; rhabdoid predisposition syndrome, familial; rhabdoid tumors; rhabdomyosarcoma; small-cell cancer of lung; soft tissue sarcoma, squamous cell carcinoma, head and neck; T-cell acute lymphoblastic leukemia; Turcot syndrome with glioblastoma; tylosis with esophageal cancer; uterine cervix carcinoma, Wilms’ tumor, type 2; and Wilms’ tumor, type 1, etc.

[0178] Alternatively, in Diabetes type II, the activity of mitochondira, e.g., oxidative phosphorylation (OXPHOS) is either increased or not changed depending on the tissue.

[0179] It is suggested that that up-regulation of NDUFV2P1 in specific organs would cause inhibition of mitochondrial Complex I leading to decreased ATP production, which in turn would reduce glucose production in the liver, thereby helping to control blood sugar levels in people with diabetes.

[0180] In cardoimiopeties, depression in mitochondrial OXPHOS activity plays an important role in the development of heart failure doi: 10.3390 / antioxl2111941(dot) doi: 10.1038 / s41598-019- 43761-y. 10.1038 / s41598-019-40419-7. It is suggested that the design of therapeutic strategies targeting mitochondrial dysfunction holds promise for the prevention and treatment of heart failure doi(dot)org / 10.3389 / fcvm.2022.945142. Hence, it is suggested that down-regulation of NDUFV2P1 would be beneficial in the treatment of cardiac conditions such as cardiomyopathies.

[0181] The down-regulating or up-regulating agents of some embodiments of the invention can be administered to an organism per se, or in a pharmaceutical composition where it is mixed with suitable carriers or excipients.

[0182] As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0183] Herein the term "active ingredient" refers to the NDUFV2P1 down- or up-regulating agent accountable for the biological effect.

[0184] Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases. Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

[0185] Techniques for formulation and administration of drugs may be found in “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, PA, latest edition, which is incorporated herein by reference.

[0186] Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intracardiac, into the common coronary artery, intravenous, intraperitoneal, intranasal, or intraocular injections.

[0187] According to a particular embodiment, the delivery is intranasal, as further described herein below.

[0188] Conventional approaches for drug delivery to the central nervous system (CNS) include: neurosurgical strategies (e.g., intracerebral injection or intracerebroventricular infusion); molecular manipulation of the agent (e.g., production of a chimeric fusion protein that comprises a transport peptide that has an affinity for an endothelial cell surface molecule in combination with an agent that is itself incapable of crossing the BBB) in an attempt to exploit one of the endogenous transport pathways of the BBB; pharmacological strategies designed to increase the lipid solubility of an agent (e.g., conjugation of water-soluble agents to lipid or cholesterol carriers); and the transitory disruption of the integrity of the BBB by hyperosmotic disruption (resulting from the infusion of a mannitol solution into the carotid artery or the use of a biologically active agent such as an angiotensin peptide). However, each of these strategies has limitations, such as the inherent risks associated with an invasive surgical procedure, a size limitation imposed by a limitation inherent in the endogenous transport systems, potentially undesirable biological side effects associated with the systemic administration of a chimeric molecule comprised of a carrier motif that could be active outside of the CNS, and the possible risk of brain damage within regions of the brain where the BBB is disrupted, which renders it a suboptimal delivery method.

[0189] Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient. Pharmaceutical compositions of some embodiments of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0190] Pharmaceutical compositions for use in accordance with some embodiments of the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

[0191] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

[0192] For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and / or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

[0193] Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

[0194] Pharmaceutical compositions which can be used orally, include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.

[0195] For buccal administration, the compositions may take the form of tablets or lozenges formulated in a conventional manner.

[0196] For administration by nasal inhalation, the active ingredients for use according to some embodiments of the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

[0197] The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0198] Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water-based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

[0199] Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water-based solution, before use. The pharmaceutical composition of some embodiments of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.

[0200] Pharmaceutical compositions suitable for use in context of some embodiments of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (e.g. NDUFV2P1 down-regulating agent) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., schizophrenia) or prolong the survival of the subject being treated.

[0201] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0202] For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0203] Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 P-l).

[0204] Dosage amount and interval may be adjusted individually to provide blood levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0205] Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.

[0206] The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. Compositions of some embodiments of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as is further detailed above.

[0207] The term “treating” refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and / or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.

[0208] As used herein, the term “preventing” refers to keeping a disease, disorder or condition from occurring in a subject who may be at risk for the disease, but has not yet been diagnosed as having the disease.

[0209] As used herein, the term “subject” includes mammals, preferably human beings at any age which suffer from the pathology. Preferably, this term encompasses individuals who are at risk to develop the pathology.

[0210] As used herein the term “about” refers to ± 10 %.

[0211] The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".

[0212] The term “consisting of’ means “including and limited to”.

[0213] The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and / or parts, but only if the additional ingredients, steps and / or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

[0214] As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0215] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals there between.

[0216] As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

[0217] As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.

[0218] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.

[0219] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format.

[0220] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0221] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

[0222] EXAMPLES

[0223] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.

[0224] General experimental procedures for examples 1-7

[0225] Cell growth and maintenance: LCLs were previously established, from control healthy subjects and DSM-IV diagnosed SZ patients Cells were grown as previously described (Ifhar et al., 2019, I. Eur Neuropsychopharmacol 29: 577-589). Primary cortical neurons were isolated and grown as previously described (Berlin S. et al, 2018, Biochem approaches glutamatergic neurotransmission 293-325). Glia cells proliferation was restrained by 4p.M Arabinofurano syl Cytidine (ARA-c, Sigma- Aldrich).

[0226] Protein Extraction and Immunoblotting: Protein extraction and assessment by Western blotting

[0227] RNA isolation and quantification: Total RNA was isolated using TRI-Reagent (Sigma- Aldrich) and quantified. Total RNA was reverse transcribed into cDNA using the VERSO™ cDNA kit (Thermo Scientific). The cDNA was amplified by PCR with either ReddyMix PCR Master Mix (PCR BIOSYSTENS) or FastStart Taq Polymerase kit (Sigma-Aldrich). PCR products were separated on agarose gels and quantified using the ImageQuant LAS 4000 system (GE Healthcare Life Sciences), and / or analyzed by qRT-PCR using Fast SYBR™ Green Master Mix (Thermo Scientific). All procedures followed the manufacturers’ protocols. Gene-specific primers were designed according to sequences obtained from Gene-Bank.

[0228] Plasmid Construction, Lentivirus production and cell infection: Human NDUFV2P1 (PG) whole transcript (NG_001161.4) was amplified from cDNA of LCLs and cloned into pEF- ENTR-A vector (Invitrogen) containing GFP. Commercially built-up shRNA plasmids (TRC2- pLKO-puro-CMV-tGFP, Sigma- Aldrich) recognizing three different sequences of PG (pLenti- shPGl / shPG2 / shPG3; Table SI) were used for constructing three different PG shRNA plasmids. All generated plasmids were verified by Sanger sequencing. Using a 3rd generation packaging system (pCMV-delta-R8.2 and pCMV-VSVG plasmids), concentrated lentivirus containing each one of the above constructs was produced. The control lentivirus for OE PG, was obtained from the same plasmid lacking the PG insert (Empty), and for shPG lentiviruses a scramble sequence (Scramble). Virus titration was performed utilizing the Lenti-X GoStix Plus quantitative lentiviral titer test kit (Takara Bio), according to the manufacturer's instructions. LCLs were infected with >lxl05IFU / ml lentivirus in the presence of Polybrene (Sigma- Aldrich) and primary cortical neurons were infected at 7 DIV with >lxlO9IFU / ml lentivirus.

[0229] Immunofluorescence staining: Fixed and permeabilized cortical neuron cells were blocked and incubated with primary and secondary antibodies and then mounted with DAPI (Vectashield). Slides were viewed using Zeiss ESM 900 META Easer Scanning Inverted Confocal system (Carl Zeiss) with a x63 Plan- Apochromat oil objective. Analysis of 11-25 fields per group, obtained from 2-4 independent experiments, was performed using ImageJ software (v.1.46, Wayne Rasband). Co-localization between two fluorescent signals was defined by their spatial overlap. Pearson product-moment correlation coefficient (PCC) was assessed by the Scatterplot of colocalization analysis using ImageJ software. Branch analysis of infected neurons, identified by GFP fluorescence, was conducted using 2D / 3D Skeleton analysis in ImageJ software (vl.46; Wayne Rasband), with 11 fields per group analyzed across four independent experiments.

[0230] Oxygen consumption rates: Cellular respiration was quantified using the Seahorse Extracellular Flux Analyzer XF-96 (Seahorse Biosciences). Oxygen consumption rates (OCR) were measured before and after the addition of various inhibitors to determine key parameters of mitochondrial respiration. Optimized concentrations of respiration inhibitors were: 4 pM oligomycin, 1 pM FCCP and 3 pM Rot / AA for LCLs and 2 pM oligomycin, 1 pM FCCP and 3 pM Rot / AA for primary cortical neurons. Measurements were done in 8-12 replications of n= 3-5 LCLs / group in two independent experiments. Data were normalized to cells’ protein levels.

[0231] Mitochondrial imaging: Mitochondrial membrane potential (A\| / m), distribution and network connectivity analyses were performed using MITOTRACKER™ Orange CMTMRos mitochondrion-selective probes (Invitrogen). Images were acquired using Zeiss LSM-700 or LSM- 900 Laser Scanning Confocal System (Carl Zeiss MicroImaging) with a x63 Plan- Apochromat oil objective and analyzed by in-house Python scripts. 3D visualization and data analysis were also performed using IMARIS software. Data were obtained from 8-18 cells / group in n=2 LCLs / group in at least two independent experiments. Microelectrode array (MEA): For network activity recording, 5xl05cells were seeded on Laminin / poly-D-lysine (Sigma-Aldrich) covered thin glass multielectrode array (MEA) dishes, grown and infected at 7 DIV. Standard MEA dishes containing 60 electrodes (30 pm titanium nitride electrode diameter) in an 8 by 8 grid arrangement spaced 200 pm apart with a small glass ring, were used. Three to four cultures plates / group obtained from 2 independent experiments were recorded at 15-22 DIV, minimum 8 days after infection. Recording of the spontaneous activity was performed for 10 min with a sampling frequency of 20 kHz. Data of individual electrodes were collected using the sofware MC_Rack (version 1.21 by Multi Channel Systems MCS GmbH). Field potentials of raw data were corrected with a high pass filter of a frequency of 200Hz. The spontaneous activity was detected by a spike detector algorithm consisting a hard threshold crossing, computed using four times the standard deviation of the raw signal. The bursts were defined as sequences of three spikes occurring in less than 100 msec. Electrophysiological data were imported to MATLAB software (MathWorks) and analyzed using an in-house script.

[0232] Statistical analysis: Results are expressed as mean ± SEM. Data were analyzed for normal distribution by Kolmogorov-Smirnov test. Normally distributed data were analyzed by unpaired or paired Student T-test. Differences in means between groups were considered significant if p<0.05. Samples distant in at least ±2 SD from group average were excluded from the analysis. Statistical analyses were performed using GraphPad Prism 9.1.1.

[0233] EXAMPLE 1

[0234] Transcript levels of NDUFV2 and NDUFV2P1 (PG) as well as protein levels of NDUFV2

[0235] Transcript levels of NDUFV2 and NDUFV2P1 (PG) as well as protein levels of NDUFV2 were assessed by qPCR and Western blotting in lymphocyte cell lines (LCLs) derived from schizophrenia patients and healthy control subjects.

[0236] To examine the relationship between the changes in NDUFV2 and PG expression levels, PG was overexpressed (OE PG) in healthy cells to mimic its state in naive SZ cells and downregulated (shPG) in SZ-LCLs, in an attempt to normalize their mitochondrial related deficits. First, the present inventors verified that the selected LCL cohorts showed a significant decrease in the mRNA and protein expression of NDUFV2 and an increase in mRNA expression of PG in SZ- derived LCLs compared to healthy LCLs (P=0.018, P=0.01 and P=0.002, respectively; Figure 1A, B, G, J). This pattern of change is probably not due to typical (haloperidol) or atypical (clozapine and risperidone) antipsychotic drug treatment, as two weeks of in-vitro exposure of LCLs to these drugs did not affect the transcript levels of either the pseudogene or NDUFV2. Infection efficiency was > 85% as determined by GFP fluorescence intensity. OE PG in healthy-derived LCLs resulted in a significant reduction of NDUFV2 mRNA and protein levels (P=0.002 and P=0.03, respectively; Figure 1C, H, K) in line with the findings in naive SZ-derived LCLs. These reductions were associated with a significant increase in PG transcript levels following OE PG- Lenti treatment compared to cells infected with Empty virus (P= 0.004; Figure ID). However, shPG treatment in SZ-derived LCLs resulted in a significant increase in NDUFV2 mRNA and protein levels (P=0.03 and P=0.014, respectively; Figure IE, I, L), associated with a significant reduction in PG transcript levels (P=0.04; Figure IF). The present inventors then studied whether PG affects additional subunits of Col, NDUFV1 and NDUFS1 that together with NDUFV2 form the functional N subunit of Col and have been reported to be altered in SZ. Both OE PG and shPG had no effect on NDUFS1 and NDUFV1 subunits’ protein levels (Figure 1M-R).

[0237] For upregulation or down-regulation the NDUFV2P1 construct (Ensembl: ENSG00000267809, SEQ ID NO: 1) or the shRNA

[0238] CCGGCTTACCGCCCACTGGGTAAGGAGCTCGAGCTCCTTACCCAGTGGGCGGTAAGT TTTTG (SEQ ID NO: 2), were used respectively.

[0239] EXAMPLE 2

[0240] Alterations in NDFV2P1 (PG) transcript levels impacts mitochondrial functions

[0241] Naive SZ-derived LCLs demonstrated deficits in mitochondrial function. Hence, a significant decrease in the mitochondrial membrane potential (A\| / m) (P<0.0001; Figure 2A, B) and reduced basal-, ATP-linked and maximal cellular oxygen consumption rates (OCR) as compared to healthy LCLs (P=0.01, P=0.02 and P=0.05, respectively; Figure 2C-E) was observed. Therefore, the present inventors investigated whether NDUFV2 alterations are due to PG and project on mitochondrial function. Indeed, OE PG caused a significant decrease in A\| / m (P=0.01; Figure 2G, H) as well as in basal and maximal OCR (P=0.002 and P=0.001, respectively; Figure 21, K) in healthy-derived LCLs as compared to Empty infected cells. No significant change was observed in ATP-Linked OCR (Figure 2J). The functional link between PG and mitochondrial activity was further supported by shPG treatment in SZ-derived LCLs. While A\| / m remained unchanged following shPG treatment (Figure 2M, N), a significant increase was observed in basal, ATP-linked, and maximal OCR (P=0.05; P=0.004 and P=0.02, respectively; Figure 2O-Q). Figure 2F, L, R represents the OCR profile following the addition of oligomycin, FCCP and Rot / AA with and without manipulation of PG expression. EXAMPLE 3

[0242] The effect of modulating NDUFV2P1 on mitochondrial membrane potential and network dynamics

[0243] Mitochondrial membrane potential (Am) and network dynamics were assessed by confocal microscopy in SZ- and Con- derived LCLs labeled with mitotracker orange, a cationic dye, which enters the mitochondria depending on the magnitude of the A ,,,. A m was assessed as the integrated intensity of the dye / cell area. Mitochondrial distribution was calculated as the coefficient of variation between pick cells intensity / average intensity of a cell. Network connectivity assessment is based on the ability of a focused laser beam to dissipate A m and on the fact that the extent of the dissipation spreading is directly proportional to the connectivity of the mitochondrial network in a given ROI. The ratio of dye intensity before and after the application of the focused laser beam in a given ROI is used for the assessment of mitochondrial network connectivity. 3D analysis of the mitotracker intensity was assessed using in-house Python scripts. In naive SZ LCLs mitochondria network connectivity was significantly decreased (P=0.04; Figure 3A, B) and the mitochondria were unevenly distributed throughout the cells, indicated by higher coefficient of variation (P=0.006; Figure 3C, D), as compared to healthy-derived LCLs. OE PG in healthy cells caused a similar phenomenon in network connectivity (P=0.02; Figure 3E, F) but had no effect on mitochondrial cellular distribution (Figure 3G, H). In shPG infected SZ LCLs however, we observed a significant increase in the mitochondrial network connectivity (P=0.01; Figure 31, J) as well as improvement in cellular mitochondrial distribution as indicated by a decrease in the coefficient of variation, (P=0.02; Figure 3K, L) as compared to SZ-LCLs infected with the control vector. Consistent with the network connectivity data, MFN2, OPA1 and DRP1, three key players in mitochondrial fusion and fission, were significantly reduced following overexpression of PG in healthy LCLs (P=0.04, P=0.003 and P=0.02, respectively; Figure 3M-P), while significantly increased upon downregulation of PG in SZ LCLs (P=0.04, P=0.04 and P=0.01, respectively; Figure 3Q-T) .

[0244] EXAMPLE 4

[0245] The effect of modulating NDUFV2P1 on respiration rate

[0246] O2 consumption rates (OCR) in LCLs were measured by the Seahorse apparatus.

[0247] To assess the effects of PG in neurons, the present inventors overexpressed the human PG (hPG) in primary rat cortical neurons. In-silico analysis revealed that NDUFV2 has no pseudogene in rats. Following hPG overexpression (OE PG) (P=0.01; Figure 4A), a significant reduction in the NDUFV2 protein levels (P=0.003) and no alteration in the protein levels of the two additional subunits of Col, NDUFS1 and NDUFV1 were observed, similar to our finding in LCLs. The transcript level of NDUFV2 was significantly increased (P=0.0005), which most likely stems from compensatory mechanisms addressing neuronal cells’ high energy demands (52,53); (Figure 4B- F). Concomitant with these findings in LCLs, OE PG caused alterations in mitochondrial function. Hence, A\| / m was significantly decreased and the mitochondria were unevenly distributed as indicated by the increase in the coefficient of variation (P=0.02 and P=0.0007, respectively; Figure 4G-I). No change was observed in mitochondria network connectivity in cells’ soma following OE PG (Figure 4J), similar to our previous finding in SZ-iPSCs- derived glutamatergic neurons. Basal, ATP-linked and maximal OCR were also significantly reduced (P<0.0001, P<0.0001 and P<0.0004, respectively; Figure 4K-N). Notably, the effects of OE PG did not involve ROS formation, as the addition of NAC prior to OCR assessment did not change the basal OCR levels in OE PG, unlike the reduction observed upon culture treatment with H2O2.

[0248] EXAMPLE 5

[0249] The effect of modulating NDUFV2P1 on mitochondrial function and neuronal sprouting in rat primary cortical neurons

[0250] NDUFV2P1 affects mitochondrial function and more upstream neuronal morphology. The effects of NDUFV2P1 on neuronal cultures were studied by expressing the human NDUFV2P1 construct described above in rat primary cortical neuron cultures. NDUFV2P1 is a human pseudogene and having quite a low similarity with the rat’s NDUFV2 (31.8%). However there is no report on a pseudogene for NDUFV2 in rats or mice. The present inventors further studied whether OE PG-induced mitochondrial dysfunction leads to neuronal aberrations. OE PG in rat primary cortical neuronal cultures caused structural changes in neurons as represented by the binary images of neurons, and by the significant decrease in both neuronal number of branches and junctions (P=0.003; Figure 5A-C), with no change in the average length of the branches (Figure 5D). Moreover, quantification of the presynaptic and postsynaptic markers, SYN1 and PSD95 respectively, showed a significant decrease expressed by puncta density (P=0.02 and P=0.0005, respectively; Figure 5E-G) of both markers. The co-localization of the pre- and postsynaptic markers, indicating synaptic contacts, was significantly reduced (P<0.0001; Figure 5H). A representative image of Pearson product- moment correlation coefficient (PCC) showed a clear difference in signal overlap between Empty and OE PG neurons, with corresponding r values indicating reduced co-localization upon OE PG treatment (r=0.0305 in OE PG versus r=0.659 in Empty; Figure 51). Finally, these neuronal changes were complemented by a significant decrease in neuronal basal firing rates, manifested by the reduced spike and burst frequencies following treatment with OE PG (P=0.0075 and P=0.0007, respectively; Figure 5J- L).

[0251] In all, the presented data show that NDUFV2P1 has an upstream effect starting with impairing its parent gene NDUFV2, which leads to mitochondrial dysfunctions and ultimately to neuronal structure and function aberrations. These data suggest NDUFV2P1 manipulation as a potential tool to increase or decrease mitochondrial activity, which is suggested as an important pathology in numerous general and CNS disorders.

[0252] EXAMPLE 6

[0253] Determining the effect of NDUFV2P1 overexpression in mice on behavior, neuronal morphology, reactive oxygen species production, (ROS) and immune activation by immunofluorescence

[0254] Characterization of the in-vivo role of NDUFV2P1 in the modulation of brain mitochondrial, neuronal, and immune system function and its connection to the behavioral aberrations are assessed by in vivo expressing NDUFV2P1 in the mouse brain.

[0255] Experimental Procedures

[0256] Neonate mice (1-2 days old) receive a single intracerebroventricular injection of adeno- associated virus (AAV) containing the NDUFV2P1 (Ensembl: ENSG00000267809) cherry labelled construct. The control group receives the same construct-containing virus without the NDUFV2P1 (Empty). First, virus incorporation into different brain areas is assessed at 2 and 4 weeks by the cherry labeling and into the various cell types by labelling them with cell-type specific fluorescent antibodies using various microscopy techniques. Next, one, twoand three months old mice are assessed by various behavioral tests relevant for mental diseases including, spontaneous induced locomotion in an open field, elevated plus maze for anxiety, new object recognition, Barn maze for working memory and social recognition. In addition, at 2 weeks (infection was done on day 1 or 2 after birth), one month old and three months old mice are sacrificed and their brains divided into two parts along the midsagittal axis. One part is fixed, sectioned and used for microscopy analyses such as neuronal morphology, reactive oxygen species production, (ROS) and immune activation by immunofluorescence. The other part of the brain is used for the assessments of various parameters in brain areas relevant to the behavioral changes including: NDUFV2P1 and its parent gene NDUFV2 transcripts by qPCR and NDUFV2 protein levels by Western blotting; mitochondrial various function (see below in hiPSCs experiments); transcriptomics, proteomics and metabolomics to identify impaired molecular pathways; neuronal activity by calcium imaging and neurotransmitters’ turnover rates by HPLC. Immuno-reactivity is assessed by pro and anti-inflammatory cytokine levels.

[0257] EXAMPLE 7 hiPSCs-derived cortical neurons from control and schizophrenic subjects as an in vitro model and manipulation of NDUFV2P1 therein

[0258] NDUFV2P1 is observed only in the human genome. Therefore, to study the effects of NDUFV2P1 modulation on mitochondrial and neuronal functions in a predictive model of human brain, hiPSCs derived from schizophrenia and healthy control subjects are used and subjected to a differentiation protocol for differentiation to cortical neurons.

[0259] Experimental Procedures hiPSCs are reprogrammed from fibroblasts / keratinocytes / lymphocytes of schizophrenia patients and healthy subject (at least n=3 / group) are differentiated into neuronal progenitors and cryopreserved according to Gantner et al. Stem Cell Reports . 2021 May 11;16(5): 1262-1275. Neuronal progenitors are further differentiated into mature cortical neurons using notch signaling inhibition protocol based on the protocol reported in STAR Protoc. 2023 Jun 9;4(2): : 102325.

[0260] During the differentiation process into neuronal progenitors according to Gantner et al. Stem Cell Reports . 2021 May 11 ; 16(5) : 1262-1275 protocol. hiPSCs are infected with lentiviruses containing either NDUFV2P1 construct (Ensembl: ENSG00000267809, SEQ ID NO: 1) or the shRNA [for example

[0261] CCGGCTTACCGCCCACTGGGTAAGGAGCTCGAGCTCCTTACCCAGTGGGCGGTAAGT TTTTG (SEQ ID NO: 2) inserted into TRC2-pLKO-puro CMV-tGFP plasmid for lentivirus], designed for a specific region of the pseudogene, for up or down regulation of NDUFV2P1, respectively. For the controls, the matching empty virus are used. To ensure NDUFV2P1 down- or up- regulation, its transcript levels are assessed by qPCR. To study the effect of manipulated NDUFV2P1 on its parent gene protein and mRNA levels of NDUFV2 are assessed. The effects of NDUFV2P1 manipulation on various mitochondrial functions including oxygen consumption and extracellular acidification rate (ECAR) for oxidative phosphorylation and glycolysis are studied, respectively, by Seahorse apparatus; mitochondrial membrane potential ('Anij and mitochondria network dynamics by confocal microscopy using one of the cationic mitotrackers; the activity of respiratory chain complexes and ATP production by commercial kits. In addition, neuronal differentiation efficiency is determined by the fluorescence intensity of cortical neuron developmental markers. Neuronal structure is assessed by neurite length, density and sprouting. Neuronal activity is followed by firing frequency using a multielectrode array (MEA) system and by calcium imaging using Fura-2 or patch-clamp. Transcriptomic, proteomics and metabolomics are assessed in all experimental groups.

[0262] It is expected that overexpression of NDUFV2P1 in healthy hiPSCs shows similar characteristics to those observed in hiPSCs derived from schizophrenia patients and its downregulation in schizophrenia derived hiPSCs restores their dysfunction.

[0263] EXAMPLE 8

[0264] Mode of interference of NDUFV2P1 with its parent gene

[0265] Experimental procedures:

[0266] EBV-transformed human lymphocyte cell lines (LCLs): LCLs derived from DSM-IV diagnosed SZ patients (6 males, 4 females, average age 45.4+8.1 years old, range 31-60 years) and healthy control subjects with no prior history of psychiatric illness (7 males, 3 females, average age 45.9+7.8 years old, range 33-60 years). The average Positive and Negative Syndrome Scale (PANSS) scores of patients were: Negative scores 31.8+4.9, Positive scores 22.1+7.4, Global scores 54.4+14.5.

[0267] RT-PCR: RNA was extracted from LCL lysates or their subcellular fractions by TRI- Reagent™ and treated with DNAse. Reverse transcription was followed by polymerase chain reaction (PCR) using the FastStart High Fidelity PCR System (Cat#04710436001 Roche Diagnostics, Mannheim, Germany) or by quantitative polymerase chain reaction (q-PCR). For each gene, 3 different cDNA concentrations were assessed. cDNA samples were analyzed by Sanger sequencing.

[0268] Immunoblotting: Protein was extracted from LCL lysates or the subcellular fractions using a radio-immunoprecipitation assay buffer (RIPA) containing protease-phosphatase inhibitor cocktails, assessed for its concentration, separated on SDS-PAGE, and exposed to the relevant antibodies. Band optical density was assessed by TotalLab Quant software.

[0269] Subcellular fractionation: Mitochondria were isolated from LCLs (l-1.5xl07cells / line) and purified on a Percoll gradient as previously described. Ribosomes were isolated by sucrose cushion centrifugation. LCLs (l-2xl07cells / line) were incubated in the presence of lOOpg / ml cyclohexamide (CHX) for 10 min 37 °C. Cells were centrifuged 500g, 5 min 4 °C, and the pellet was washed twice with ice-cold PBS-CHX. The pellet was lyzed with 100-300pl fresh lysis buffer (20mM HEPES-KOH pH 7.4, 5mM MgCL2, lOOmM KC1, 200 pg / ml heparine, 1% TRITONX™ x 100, 2mM DTT and lOOpg / ml CHX. For RNA isolation, RNASe inhibitor lOOOU / ml, and for protein isolation anti-proteases cocktail were added. Lysates were incubated for 10-15 min on ice and centrifuged 12,000xg for 10 min. The supernatant 250-350pl was placed on a similar volume of cushion buffer (4% sucrose, 20mM HEPES-KOH pH 7.4, 150mM KC1 5mM MgCL2) and was centrifuged for 60-70 min at 535,000xg (Sorval Micro-Ultracentrifuge RC-M150). The supernatant was stored at -80 °C. For RNA or protein isolation the ribosomal pellet was homogenized in glass / glass homogenizer in Tri-reagent or protein lysis buffer, respectively.

[0270] Mitochondria-bound ribosomes were isolated as described in Matsumoto S, Mitochondrion. 2012;12:391-8. LCLs (5xl07cells / line) were incubated in the presence of lOOpg / ml CHX for 10 min. Cell were centrifuged at 500g, 5 min 40 °C and washed twice with ice- cold PBS-CHX. Cells were re-suspended in the homogenization buffer (lOmM Hepes-KOH pH 7.4, 0.25M sucrose, ImM EDTA-KOH, lOOpg / ml CHX), homogenized in conic glass / glass Patter Elvejen homogenizer and centrifuged at 1600xg for 10 min at 40 °C. The supernatant was centrifuged at 22,000xg for 15 min at 40 °C and the obtained pellet was re-suspended with homogenization buffer and centrifuged at 1600xg for 5 min at 40 °C. The final supernatant containing the mitochondria was centrifuged at 22,000xg for 15 min at 40 °C and the mitochondria- bound ribosomal fraction was isolated by sucrose cushion centrifugation as described above.

[0271] Nuclear and cytosolic fractions were isolated as previously described [Senichkin V V. et al., Cells. 2021;10:852]. LCLs (5-10xl06cells / line) were washed twice with cold PBS with or without EDTA lOmM for protein or RNA extraction, respectively. The pellet was re-suspended in 350 pl hypotonic buffer (lOmM Tris -HC1 pH 7.4, lOmM Na Cl, 3mM, MgCLi), with 0.5% NP40 (with anti-proteases and anti-phosphatases cocktails for protein extraction) incubated 30 min in ice and centrifuged for 10 min at 720xg. The cytosolic supernatant was re-centrifuged at 15,000xg for 5min at 40 °C and the resulting cytosolic supernatant was stored at -80 °C until use. The nuclear pellet was suspended in complete cell extraction buffer (lOmM Tris-HCl pH 7.4, lOOmM NaCl, 1% TRITONX™100, 10% glycerol, 0.1% SDS, 0.5% deoxycholate with ImM EDTA). Antiproteases and anti-phosphatases cocktails or lOOOu / ml RNAase inhibitor were added for protein or RNA extraction, respectively. The nuclear pellet was incubated on ice for 30 min with intermittent vortex, centrifuged for 30 min at 14,000xg at 4 °C and the pellet containing the nuclear fraction was stored at -80 °C until use. The purity of the subcellular fractions was verified by immunoblotting with sub-fraction specific antibodies.

[0272] In-vitro transcription / translation: 35S -methionine labeled proteins were obtained using a T7 transcription / translation systems kit (Cat# LI 170 Promega, USA) in the presence of 35s- methionine-cysteine (>1000 Ci / mmol, Cat# NEG009T PerkinElmer, NEN Radiochemicals, MA). Linearized pGEM-T vector containing NDUFV2 or NDUFV2P1 sequences or the T7-promoter containing RT-PCR products of both transcripts obtained from four LCLs / group were used as templates. The reaction was performed according to the manufacturer instructions. RNA pulldown: mRNAs were synthesized in-vitro from the T7-promoter RT-PCR products, obtained from equal amount of total RNA of 2-3 LCLs / group, of full length NDUFV2 and the short cytosolic spliced variant of NDUFV2P1 using a T7 Transcription Kit (Cat# K0441 ThermoFisher Scientific) according to the manufacturer instruction. Sanger sequencing showed no difference in the sequences of the RT-PCR products from controls and SZ. The obtained mRNAs were extracted and purified using an RNA Purification Kit (Cat# K0731 ThermoFisher Scientific). The Biotin RNA Labeling Mix (cat# 11685597910 Sigma- Aldrich) was used to incorporate Biotin- 16-UTP to approximately every 20-25 nucleotides of the transcripts for the detection of RNA-binding proteins (RBPs) of mRNAs and long noncoding RNAs. Labeling efficiency in each sample was estimated using the Biotin Chromogenic Detection Kit (Cat# K061 ThermoFisher Scientific). Equal levels of biotin labeled NDUFV2 or NDUFV2P1 mRNAs from SZ and controls were used for pull-down experiments. Finally, to enrich for RBPs a magnetic RNA-Protein pull-down kit (Cat# 20164 ThermoFisher Scientific) was used according to the manufacturer instructions. The RNA-bound beads were equilibrated in protein RNA binding buffer and then incubated with 100 pg cell lysate protein / lOOpl reaction buffer for 60 min at 4 °C. The extracted RBPs were assessed by Liquid Chromatography and Mass Spectrometry (LC- MS / MS). Based on previous multiple testing corrections methods in proteomic, the criteria for significantly altered proteins were effect size cut-off of log2-ratio>|0.32|, p<0.05 values to assess the differentially expressed RBPs for NDUFV2, while q<0.05 values for NDUFV2P1, as the overall significant difference between groups was lower for NDUFV2 (n=2 LCLs / group) than for NDUFV2P1. (n=2 CTL-LCLs and 2-3 SZ-LCLs), and false discovery rate <0.05. The differentially expressed proteins, their biological functions and interactions were analyzed using Webgestalt, String and Preseus softwares.

[0273] RNA immunoprecipitation (RIP): RIP was performed using Magna RIP kit (Cat#17-701 Millipore) according to the manufacturer instructions. In short, 5xl07cells, n=4-5 LCLs / group were used. Reverse crosslinking was performed following cell washing with PBS by 1% formaldehyde (F-8775 Molecular Biology). Slow cell shaking was performed at RT for 15 min. Crosslinking was stopped by the addition of 0.2M glycine for 5 min. Samples were centrifuged 2500xg for 5 min at 4 °C. The pellet was washed twice with cold PBS. Nuclear fraction was purified as described above. RNA immunoprecipitation was performed according to the manufacturer instructions using 5pg of antibody of NXF1 (anti- TAP (NXF1) (Invitrogen Cat. # MAI-5882), anti-IgG-negative control and anti-hSNRNP70 positive control, both provided in the Magna RIP kit). In short, RNA beads were prepared and antibodies bound. Nuclear lysates were thawed and centrifuged at 17000xg for 10 min at 4 °C, resuspended in RIP IP buffer, added to the antibody bound beads and rotated overnight at 4 °C. 10 l of the nuclear lysates were kept for assessing total mRNA input for each sample and 10 pl for assessing protein levels of mRNA bound NXF1 by western blotting. Each immunoprecipitated was washed thoroughly, then treated with RIP wash buffer containing proteinase K and 10% SDS to digest the proteins. RNA was purified from the beads’ supernatant and the input samples according to the manufacturer instructions and specific bound transcripts were assessed by qRT-PCR. Relative expression of NDUFV2 and NDUFV2P1 was normalized to NXF1 bound GAPDH, 18S or input levels (nuclear mRNA) of the respective transcripts.

[0274] RNA stability: ECE cells (3x107) from five ICLs / group were grown and split to 5xl06 / time point (0, 30, 60, 120, 240 and 360 min). Actinomycine D (Sigma-Akdrich A9415) 5pg / ml was added to each well at time 0. RNA was extracted at each time point and I g RNA was taken for qRT-PCR. RNA stability was assessed for each of the following mRNAs: P-actin, GAPDH, 18sRNA, NDUFV2 and NDUFV2P1. T1 / 2 and kdecay (K) were calculated using the one phase decay analysis in GraphPad Prism as previously described [Ratnadiwakara M, Bio Protoc. 2018;8: e3072].

[0275] Plasmid construction and cell infection: For pNDUFV2Pl Lentivirus, the entire transcript sequence (NG_001161.4) was cloned into the pGEM-T vector (Promega, WI, USA), and its sequence confirmed by Sanger sequencing. Next, the NDUFV2P1 fragment was cut by appropriate enzymes (BamHI and EcoRI) purified, ligated into pEF-ENTR A vector (Invitrogen, CA, USA), to generate the pEF-ENTR A-NDUFV2P1 expressing vector. pEF-ENTR A-NDUFV2P1 was used to construct the final pLenti-CMV-GFP-DEST-NDUFV2Pl plasmid employing the GATEWAY™ cloning technique with GFP and NDUFV2P1 having different promoters. The final plasmid was packed with a 3rd generation Lentivirus packaging system. The same plasmid lacking NDUFV2P1 serve as a control (empty vector). LCLs were infected in the presence of 1:20 (w:v) polybrene (10 mg / ml, Sigma- Aldrich TR-1003) for 3h, washed and analyzed 5 days after infection. For RIP experiments the nuclear fraction was isolated from each of the five LCLs / group after crosslinking and then pooled into one sample / group for IP experiment with anti-NXFl antibody.

[0276] Statistics: Results were analyzed for normal distribution by Kolmogorov- Smirnov test. The data showed normal distribution and were therefore compared by Student’s or Welch's T-tests if two groups were compared and ANOVA if more groups were involved. Pearson’s correlation, r > |0.7 I, P < 0.05 was considered significant. Results are expressed as mean ± SEM. P < 0.05 was considered statistically significant. GraphPad Prism 9.1.1 and IBM SPSS statistics 24 software were used. RESULTS

[0277] NDUFV2P1 characteristics in SZ and CTL LCLs

[0278] NDUFV2P1 transcript is lOlObp long and has an identical sequence in both SZ and healthy (CTL) subjects ’-derived LCLs. NDUFV2P1 is unique to humans, as neither NCBI genome browser nor nucleotide sequence alignment detected its entire mRNA sequence in other organisms. The entire NDUFV2P1 transcript showed 71.86% similarity with its parent gene NDUFV2. Downstream of its first 314bp, NDUFV2P1 is almost identical to NDUFV2 sequence (98% similarity) starting at 50bp downstream to the ATG of NDUFV2. Similar to other IncRNAs, NDUFV2P1 is spliced. Its full-length transcript is observed in the nuclear fraction but not in the cytosolic fraction (Figure 6A,B). Stepwise RT-PCR, using the same forward prime (F-PG5) and different reverse primers revealed that a spliced variant of ~521bp is expressed in the cytosolic fraction, its 260bp 5’ end showing 99% homology with NDUFV2. To verify that NDUFV2P1 cannot produce protein in SZ cells, in-vitro transcription / translation of linearized pGEM-T containing full-length NDUFV2P1 and NDUFV2 sequences, and of their T7-RT-PCR full length products was performed. Unlike NDUFV2, NDUFV2P1 from both SZ and CTL LCLs (n=4 / group) and their plasmids, failed to produce 35S -methionine labeled protein (Figure 6C).

[0279] The subcellular distribution of NDUFV2 and NDUFV2P1 transcript levels and their decay rates are altered in SZ:

[0280] As described above, in one cohort, lower transcript and protein levels of NDUFV2, while higher levels of NDUFV2P1 transcripts were found in SZ brain specimens and different cell types as compared to controls. In addition, a high and significant inverse correlation was shown to between NDUFV2P1 transcripts and NDUFV2 protein level and mitochondrial respiration in LCLs and human brain prefrontal specimens (Bergman et al., Mol Psychiatry. 2018;25: 805-20). In this example LCLs from a different cohort was used. Similar differences in NDUFV2 and its pseudogenes were observed. Thus, NDUFV2 transcripts and protein levels were significantly reduced (P<0.001, P<0.028, respectively), while transcripts of NDUFV2P1 were increased (P<0.014) in SZ as compared to CTL-derived LCLs (Figures 7A-C). A significant decrease in NDUFV2 protein levels was also observed in isolated SZ-derived mitochondria (P<0.006), which, as previously reported, lead to complex I deficits (Figure 7M). Based on the hitherto findings, we hypothesized that the deficits observed in NDUFV2 protein and mitochondrial function stems from NDUFV2P1 interference with its parent gene. To verify this hypothesis, NDUFV2P1 was overexpressed in CTL-LCLs (n=5LCLs / group) and five days later increased levels of NDUFV2P1 (P<0.019) were observed associated with a significant reduction in NDUFV2 transcript and protein levels (P<0.01 and P< 0.03, respectively) as compared to empty virus infected cells, mimicking the findings in SZ-LCLs and suggesting that the pseudogene plays a role in the regulation of its parent gene mRNA and protein expression (Figures 7D-H).

[0281] To investigate potential intracellular sites where NDUFV2 and NDUFV2P1 interact, subcellular distribution in SZ- and CTL- derived LCLs was assessed (n=4-5 LCLs / group). In the nuclear fraction, NADUFV2 transcript levels were similar in both cohorts, suggesting an intact transcription process of NDUFV2 in SZ. NDUFV2P1 transcript levels, however, were significantly higher (P<0.004) in SZ-LCLs as compared to the controls. In the cytosolic fraction, however, NDUFV2 mRNA and protein levels were significantly lowered (P<0.002; P<0.008, respectively) and NDUFV2P1 transcript levels remained higher than in the controls (P<0.0006). In the cytosolic ribosomal fractions, no change was observed between both cohorts in both NDUFV2 and NDUFV2P1. However, in the mitochondria-bound ribosomal fraction, the primary site for NDUFV2 translation, both transcripts were significantly lower in the SZ cohort as compared to the control (P<0.02, P<0.0007, respectively) (Figures 7LQ), suggesting that NDUFV2P1 transport to the mitochondria-bound ribosome is hindered in SZ-LCLs. The observed reduction in NDUFV2 and the increase in NDUFV2P1 mRNAs levels in total cell lysates are not due to parallel differences in their mRNA stability. Hence, no significant change was observed in the half-life time (T1 / 2) and Kdecay(K) of NDUFV2P1 and GAPDH, yet NDUFV2 transcripts showed a significantly reduced degradation rate in SZ-LCLs as compared to CTL-LCLs (TI / 2= 116.74+35.42 vs. 24.57+4.19, P<0.03; KDecay=0.009+0.002 vs. 0.031+0.005, P<0.01; n=5LCLs / group) (Figure 7R and Table 1). The latter is in line with previous findings of reduced degradation rates of NDUFV2 protein in the cytosolic and mitochondrial fractions in SZ, which probably contributed to the defective functioning of NDUFV2. Taken together, these data point at abnormal nuclear / cytosolic export process of NDUFV2 mRNA in SZ, which can be one possible spot of interference between both transcripts.

[0282] Table 1: Half-life and Kdecay of mRNA in SZ and healthy subjects (con) derived LCLs.

[0283] Non-linear regression curve fitting of the relative abundance of mRNA assessed by qRT-PCR at each time point relative to t = 0 was analyzed by GraphPad Prism to obtain Kdecay and half-life for each mRNA. Data are means + SEM of 5 LCLs / group. *P<0.01 and ** P< 0.03. NDUFV2P1 transcript interferes with NDUFV2 binding to Nuclear RNA Export Factor 1 (NXF1) in SZ.

[0284] Given the subcellular fractionation findings, the present inventors next studied whether NDUFV2 and NDUFV2P1 mRNAs interact at the nuclear export machinery. A high and significant inverse correlation between the mRNA levels of nuclear NDUFV2P1 and cytosolic NDUFV2 (r=0.839, P=0.009) was found, as well as between the levels of NDUFV2- and NDUFV2P1- bound NXF1 (r=0.986, P=0.014). No other TREX complex-related RBPs (e.g. CHTOP ALYREF, THOC2 / 3 / 5 and DDX39) showed a significant high inverse correlation (Figures 8A-D). NXF1 coordinates transcriptional dynamics, 3' end processing, and nuclear export of mRNAs and IncRNAs. NXF1-NXT1 dimer facilitates the last step in mRNA nuclear transport to the cytoplasm through direct interaction with the nuclear pore complex. The present inventors therefore performed nuclear RNA immunoprecipitation to explore the efficiency of binding of NDUFV2 entire transcript and 512bp long NDUFV2P1 mRNA to NXF1. First, the nuclear levels (input) of NDUFV2, NDUFV2P1 and GAPDH mRNAs was assessed following the crosslinking procedure (n=4LCLs / group). Similar to the finding in the subcellular fractionation experiment, there was a significant increase in NDUFV2P1 (P<0.0001) while no change in NDUFV2 and GAPDH transcripts’ levels in SZ as compared to CTL samples (n=4LCLs / group). NXF1 -bound NDUFV2 transcript levels were significantly lower in SZ samples as compared to controls (3.10+0.86 vs. 28.67+11.1; P<0.05), while that of NDUFV2P1 were increased (11.59+5.79 vs. 2.35+0.29; P<0.03) Figures 8E, F). To investigate whether these alterations in NDUFV2 binding to NXF1 in SZ samples are due, at least in part, to NDUFV2P1 interference with NDUFV2 nuclear export, the present inventors overexpressed NDUFV2P1 or its empty vector in CTL-LCLs (N=5 LCLcs / group). After isolation of the nuclear fraction, they pooled together all five samples / group into one sample / group to receive a measurable amount of NXFl-bound mRNA in the infected cells and to increase reliability. The NXFl-bound mRNA levels of NDUFV2 and NDUFV2P1 in CTL-LCLs overexpressing NDUFV2P1 were compared to CTL-LCLs treated with empty virus and with those of pooled naive SZ-LCLs and CTL-LCLs (n=5LCLs / group). Overexpression of NDUFV2P1 in CTL-LCLs resulted in its increased mRNA levels by 180% in the nuclear fraction (input), with no change in NDUFV2 transcript levels as compared to empty virus infected cells. Following its overexpression in CTL-LCLs, NXFl-bound NDUFV2P1 mRNA levels increased by 300%, while those of NDUFV2 were reduced to half of Bound NDUFV2 mRNA in cells infected with empty CTL virus (Figures 8G-H). Comparing naive SZ-LCLs to CTL-LCLs, revealed a similar pattern of change both in the nuclear fraction and in the NXFl-bound mRNAs for both genes (Figures 81, J). These data strongly support NDUF2P1 interference with its parent gene on NXF1 -mediated nuclear export.

[0285] The interactome pattern of NDUFV2 and NDUFV2P1 mRNAs is oppositely altered in SZ:

[0286] Finally, to elucidate additional intracellular sites of interaction between NDUFV2 mRNA and its pseudogene, the present inventors assessed their interactomes. In-vitro synthesized biotinylated mRNAs from T7-RT-PCR products of SZ and healthy subjects’ LCLs (2-3 LCLs / group) were incubated with their matched protein lysates, mimicking the in-vivo conditions. Levels of the RNA bound proteins (RBPs) were assessed by LC-MS / MS and analyzed. Sanger sequencing of the SZ and healthy control T7-RT-PCR products of both genes show no sequence difference. A total of 1848 RBPs (FDR < 0.01), which bind NDUFV2 and / or NDUFV2P1 were identified. Unsupervised hierarchical clustering of the significantly different NDUFV2-RBPs (n=197; p<0.05) and NDUFV2Pl-RBPs (n=945; q<0.05) and principal component analysis (PCA) distinguished between SZ and healthy subjects for both mRNAs. Overall, the bound RBPs to SZ- derived NDUFV2 transcript showed lower levels than those bound to healthy control derived mRNA, while an opposite phenomenon was observed for those bound to SZ-derived NDUFV2P1, which showed increased levels as compared to healthy controls (Figures 9A,B), further supporting the interference potential of NDUFV2P1 of its parent gene binding by specific RBPs. Overrepresentation analysis (ORA) of significant RBPs followed by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis identified three main pathways for NDUFV2- bound RBPs, Ribosome (FDR=2.005e-2; P=1.366e-4); Spliceosome (FDR=2.005e-2; P=1.845e- 4) and RNA transport (FDR=2.005e-2; P=7.538e-5) pathways (Figures 9D). For NDUFV2P1- bound RBPs four top pathways were identified, including Spliceosome (FDR=2.2e-16; P=2.2e- 16), Ribosome (FDR=2.2e-16; P=2.2e-16), mRNA surveillance (FDR=3.619e-13; P=3.3307e-15) and RNA transport (FDR=3.619e-13; P=3.331e-15) pathways (Figure 9E). Interestingly, 109 RBPs did not bind to CTL NDUFV2P1 mRNA yet bound with high abundance to mRNAs of SZ NDUFV2P1 as well as to NDUFV2 from both cohorts. Pathway enrichment analysis of these RBPs identified two pathways RNA polymerase (FDR=4.7163e-2; P=2.228e-4) and RNA transport (FDR=4.2432e-3; P=6.9e-6) further emphasizing RNA transport machinery as a site of interaction between the pseudogene and its parent gene (Figure 9F). In contrast, only four RBPs bound equally to CTL and SZ NDUFV2 mRNA and to CTL NDUFV2P1 but not SZ NDUFV2P1 mRNA. One of the five RBPs is the complement Clq binding protein (C1QBP). This protein is highly expressed in the mitochondria but is also present in extramitochondrial locations including cell surface, cytosol, and nucleus. C1QBP is involved in mRNA remodeling and stabilization, which may explain the higher expression of NDUFV2P1 in the mitochondria-bound ribosomal fraction in CTL. Despite the inherent limitations of an in-vitro assessment of mRNA interactome, the similar pathways obtained for both transcripts and the decreased RBPs binding to NDUFV2 transcripts, while increased binding to NDUFV2P1 in SZ samples, suggest that NDUFV2P1 is a trans-acting factor interfering with NDUFV2 mRNA processing, its transport from the nucleus to the ribosome and translation.

[0287] EXAMPLE 9

[0288] Overexpression of NDUFV2P1 in neonatal mice

[0289] Experimental procedures:

[0290] Injection age: Pl

[0291] Area of injection: lateral ventricle

[0292] Amount of injection: 1 pl (50 nL / sec)

[0293] Figures 11A-F illustrate overexpression of hNDUFV2Pl in neonatal brain causes behavioral impairment. The impairments observed up to two months old PG mice in the open field test parameters, were abolished at four months old mice.

[0294] Sociability was also restored in 4 month old PG mice. However, social novelty, which majorly depends on mPFC functioning was significantly impaired as illustrated in Figures 12A-C.

[0295] The Barns maze was used to study the integrity of spatial learning and memory, which depend on hippocampal and mPFC functioning. Both spatial learning and memory (Figurel3) were significantly impaired in PG mice.

[0296] Immunostaining of mPFC sections with NeuN for neuronal soma (red) and anti NDUFV2 (green) showed that NDUFV2 protein levels are significantly reduced within neurons of mice that overexpressed PG. The filamentous structures (in green) are blood vessels epithelial cells expressing NDUFV2 (Figures 14).

[0297] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

[0298] It is the intent of the Applicant(s) that all publications, patents and patent applications referred to in this specification are to be incorporated in their entirety by reference into the specification, as if each individual publication, patent or patent application was specifically and individually noted when referenced that it is to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is / are hereby incorporated herein by reference in its / their entirety.

[0299] REFERENCES

[0300] (additional references may be found throughout the document) NunnarilJ, Suomalainen A. Mitochondria: in sickness and in health. Cell 2012. 6;148: 1145-1159. doi: 10.1016 / j.cell.2012.02.035. Annesley SJ, Fisher PR. Mitochondria in Health and Disease Cells 2019. 8: 680 doi: 10.3390 / cells8070680. Ene HM. Karry R, Farfara D, Ben-Shachar D. Mitochondria play an essential role in the trajectory of adolescent neurodevelopment and behavior in adulthood: evidence from a schizophrenia rat model 2023. 28: 1170-1181 doi: 10.1038 / s41380-022-01865-4 Robicsek O. et al. Isolated Mitochondria Transfer Improves Neuronal Differentiation of Schizophrenia-Derived Induced Pluripotent Stem Cells and Rescues Deficits in a Rat Model of the Disorder. 2018. Sch Bull. 44,432-442 doi: 10.1093 / schbul / sbx077. Santos-Silva T. et al. Transcriptomic analysis reveals mitochondrial pathways associated with distinct adolescent behavioral phenotypes and stress response. 2023. Transl. Psychiatry 13: 351-363. doi: 10.1038 / s41398-023-02648-3. Helper L, Ben-Shachar D, Mann JJ. Multivariate meta-analyses of mitochondrial complex I and IV in major depressive disorder, bipolar disorder, schizophrenia, Alzheimer disease, and Parkinson disease. 2019. Neuropsychopharmacol. 44:837-849. doi: 10.1038 / s41386- 018-0090-0 Bergman O, Ben-Shachar D. Mitochondrial Oxidative Phosphorylation System (OXPHOS) Deficits in Schizophrenia: Possible Interactions with Cellular Processes. 2016. Can J Psychiatry. 61:457-69 doi: 10.1177 / 0706743716648290 Washizuka s. et al. Association of mitochondrial complex I subunit gene NDUFV2 at 18p 11 with schizophrenia in the Japanese population. 2016. Neuropsychiatric Genetics. 141B, 301-304. doi: 10.1002 / ajmg.b.30285. Bergman O, Karry R, Milhem J, Ben-Shachar D. NDUFV2 pseudogene (NDUFV2P1) contributes to mitochondrial complex I deficits in schizophrenia. 2020. Molecular Psychiatry. 25:805-820. doi: 10.1038 / s41380-018-0309-9 Poliseno E, et al. A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. 2010. Nature. 465: 1033-1038. doi: 10.1038 / nature09144 Chiefari E, et al. Pseudogene-mediated posttranscriptional silencing of HMGA1 can result in insulin resistance and type 2 diabetes. 2010. Nature Commun. 1:40: doi: 10.1038 / ncomms 10400.

Claims

WHAT IS CLAIMED IS:

1. A method of altering mitochondrial function in a cell, the method comprising administering to the cell an agent which modulates expression or activity of NDUFV2P1, thereby altering the mitochondrial activity in the cell.

2. A method of treating a disease-associated with an aberrant mitochondrial function, the method comprising administering to the subject a therapeutically effective amount of an agent which modulates expression or activity of NDUFV2P1, thereby treating the disease-associated with an aberrant mitochondrial function.

3. An agent which modulates expression or activity of NDUFV2P1 for use in treating a disease-associated with an aberrant mitochondrial function.

4. The method or agent of claim 2 or 3, wherein said disease is selected from the group consisting of a mental disease, a neurodegenerative disease, cancer and cardiomyopathy.

5. A method of treating a mental disease or a neurodegenerative disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent which down-regulates activity or expression of NDUFV2P1, thereby treating the mental disease or a neurodegenerative disease.

6. An agent which down-regulates activity or expression of NDUFV2P1 for use in treating a mental disease or a neurodegenerative disease in a subject in need thereof.

7. The method or agent of any one of claims 4-6, wherein said neurodegenerative disease is Alzheimer’s disease or Parkinson’s disease.

8. A method of treating cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an agent which up-regulates activity or expression of NDUFV2P1, thereby treating cancer.

9. An agent which up-regulates activity or expression of NDUFV2P1, for use in treating cancer in a cancer in need thereof.

10. The method or agent of any one of claims 8 or 9, wherein said cancer is associated with an aberrant mitochondrial activity as compared to a non-cancerous cell of the cancer tissue.

11. The method of claim 1, further comprising determining mitochondria activity in the cell prior to and / or following said administering.

12. The method of claim 1, being affected in-vivo.

13. The method of claim 1, being affected ex-vivo.

14. The method or agent for use of any one of claim 1-3, wherein said agent up-regulates activity or expression of NDUFV2P1.

15. The method or agent for use of any one of claim 1-3, wherein said agent down- regulates activity or expression of NDUFV2P1.

16. The method or agent for use of any one of claims 5, 6, 12-13 and 15, wherein said agent which down-regulates activity of expression of NDUFV2P1 is a genome editing agent.

17. The method or agent for use of any one of claims 5, 6, 12-13 and 15-16, wherein said agent which down-regulates activity of expression of NDUFV2P1 is an RNA silencing agent.

18. The method or agent of claim 17, wherein said RNA silencing agent is a miRNA, siRNA or an antisense oligonucleotide.

19. The method or agent for use of any one of claims 4, 5, 6, 12, 13, 15-16 and 17, wherein said mental disease is selected from the group consisting of schizophrenia, bipolar disorder, depression and autism.

20. The method or agent for use of any one of claims 1-19, wherein said agent is formulated for administration to the central nervous system (CNS) or said administering is to the CNS.

21. The method or agent of claim 20, wherein said agent is formulated for nasal administration.

22. The method or agent for use of any one of claims 1-20, wherein said agent is formulated for targeted delivery.

23. The method or agent for use of claim 22, wherein said targeted delivery is to a cancer cell.

24. The method or agent for use of claim 22, wherein said targeted delivery is to a neuron.

25. The method or agent for use of claim 22, wherein said targeted delivery is to a cardiomyocyte or a cancer cell.

Images