Use of glycolysis-inhibiting compounds to boost neural stem cell function in the brain
A CRISPR-Cas9 screening platform identifies gene knockouts that enhance neural stem cell activation by inhibiting glucose metabolism, addressing aging-related neural stem cell decline and boosting new neuron production for brain injury and disease treatment.
Patent Information
- Application Number
- PCT/US2025/039498
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-29
- Filing Date
- 2025-07-28
- Publication Date
- 2026-02-05
AI Technical Summary
Aging impairs the ability of neural stem cells to transition from quiescence to activation, leading to decreased production of new neurons and defective regeneration in the adult mammalian brain, which is exacerbated in conditions like Alzheimer's disease, and current genetic interventions are limited in throughput and systematic understanding.
A high-throughput CRISPR-Cas9 screening platform is used to identify gene knockouts that enhance neural stem cell activation, employing agents that inhibit the glucose metabolic pathway, such as oxythiamine chloride, 2-Deoxy-d-glucose, and 3-bromopyruvate, to increase the number of newborn neurons and quiescent neural stem cells.
The approach significantly boosts neural stem cell activation, increasing the production of new neurons by at least 1.25-fold, offering potential treatments for brain injuries and neurodegenerative diseases like stroke and Alzheimer's disease.
Smart Images

Figure 00000068_0000 
Figure 00000069_0000 
Figure 00000070_0000
Abstract
Description
USE OF GLYCOLYSIS-INHIBITING COMPOUNDS TO BOOST NEURAL STEM CELL FUNCTION IN THE BRAINGOVERNMENT SUPPORT
[0001] This invention was made with Government support under contract AG036695 awarded by the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND
[0002] Aging impairs the ability of neural stem cells to transition from quiescence to activation (proliferation) in the adult mammalian brain. Neural stem cell (NSC) functional decline results in decreased production of new neurons and defective regeneration upon injury during aging; for example this is exacerbated in Alzheimer’s disease. Many genes are upregulated with age in NSCs, and the knockout of some of these boosts old NSC activation and rejuvenates aspects of old brain function. But systematic functional testing of genes in old NSCs, and more generally in old cells, has not been done. This has been a major limiting factor in identifying the most promising rejuvenation interventions.
[0003] The adult mammalian brain contains several neural stem cell (NSC) regions that give rise to newborn neurons and can repair tissue damaged by stroke or brain injuries. The most active NSC niche is located in the subventricular zone (SVZ) lining the lateral ventricles of the brain. NSCs from the SVZ region can generate thousands of newborn neurons each day in a young adult mouse. The SVZ region comprises a pool of quiescent NSCs that can give rise to activated (proliferating) NSCs, which in turn generate more committed progenitors that migrate out of the niche and differentiate into neurons. The ability of NSCs to activate and form newborn neurons is severely impaired in the aging brain, and this can contribute to deficits in sensory and cognitive function.
[0004] Identifying genes that impact NSC activation could lead to interventions that counter brain defects during aging. Several genetic interventions have been found to improve old NSC activation, including signaling pathways and transcriptional regulators. However, such studies have been limited in their throughput as they focused on one or a few genes at a time. Thus, we are still missing a systematic understanding of the genes and pathways that functionally affect old NSCs.
[0005] More generally, a major challenge in identifying genetic interventions that improve old cells is the establishment of scalable genetic screens in mammals. Aging occurs at both the cell and organismal level, and it is therefore important to develop screens in vitro in cells from old organisms and in vivo in old tissues. However, genetic screens for regulators of aging in normal old cells have not yet been performed. In addition, in vivo genetic screens are challenging in mammals. Thus, developing screening platforms for old mammalian cells and organisms has thepotential to identify previously unknown gene manipulations that could restore tissue function in older individuals. In the brain, such screens could help identify strategies to counter regenerative and cognitive decline with aging.
[0006] Methods of enhancing activation of aged neural stem cells are provided herein.SUMMARY
[0007] Compositions and methods are provided for enhancing neural stem cell function in a mammalian brain, including an aging mammalian brain. A high throughput in vitro and in vivo CRISPR-Cas9 screening platforms was used to systematically uncover gene knockouts that boost NSC activation in aging brains. The administration of small molecules that inhibit the glucose metabolic pathway are shown to enhance the activation of aged NSC neural stem cell function.
[0008] Compositions and methods are provided for enhancing NSC activation in aged cells. In some embodiments, a population of aged NSC are contacted with an effective dose of an agent that inhibits the glucose metabolic pathway.
[0009] In some embodiments the contacting is performed ex vivo, e.g. to activate cells prior to transplantation. In some embodiments the contacting is performed in vivo, e.g. in the treatment of conditions adversely affected by decreased NSC activation. In some embodiments the agent is delivered systemically. In some embodiments the agent is administered locally.
[0010] In some embodiments the agent that inhibits the glucose metabolic pathway is one or more of oxythiamine chloride, 2-Deoxy-d-glucose, and 3-bromopyruvate, or a derivative thereof that maintains the inhibitory activity. In some embodiments the agent is oxythiamine chloride. In some embodiments the agent is 2-Deoxy-d-glucose. In some embodiments the agent is 3- bromopyruvate. In some embodiments the agent is administered in a dose effective to increase the number of newborn neurons in a brain region of interest. In some embodiments the agent is administered in a dose effective to increase the number of quiescent NSCs in a brain region of interest. The increase in newborn neurons or NSC may be at least about 1 .25-fold, at least about 1 .5-fold, at least about 1 .75-fold, at least about 2-fold, or more.
[0011] In some embodiments an effective dose of an agent that inhibits the glucose metabolic pathway, for example one or more of oxythiamine chloride, 2-Deoxy-d-glucose, or 3- bromopyruvate, is administered to an individual for treatment of brain injury or neurodegenerative diseases. In an embodiment, the individual is treated for stroke. In an embodiment the individual is treated for a neurologic condition selected from ischemic stroke, chronic hemorrhagic stroke, subacute ischemic and hemorrhagic stroke patients, patients with traumatic brain injury, spinal cord injury, Parkinson's Disease, ALS (Lou Gehrig’s Disease), and Alzheimer's Disease.
[0012] Agents that inhibit the glucose metabolic pathway can be administered systemically, or by direct administration into the central nervous system. In some embodiments administration isdirectly into the lateral ventricle. In some embodiments administration is at or near the cerebral cortex of the patient, wherein the cerebral cortex of the subject may include any of lateral ventricle, prefrontal cortex, motor association cortex, primary motor cortex or primary somatosensory cortex. Such administration may be, for example, cortical or sub-cortical, where a subcortical area of the brain may be any of the hippocampus, amygdala, extended amygdala, claustrum, basal ganglia, or basal forebrain. Such local administration may be in the form of a sustained release device or implant.
[0013] In some embodiments a formulation comprising one or agents that inhibit the glucose metabolic pathway, and a pharmaceutically acceptable excipient. In some embodiments the formulation is provided in a unit dosage. The excipient may be selected to be suitable for administration to a region of the brain.
[0014] In some embodiments a cell culture is provided, wherein the culture comprises a population of mammalian neural cells, including neural stem cells, in a medium comprising an effective dose of an agent that inhibits the glucose metabolic pathway. The neural cells may be human cells. The cells may be obtained from an aged human. An effective dose of the activated cells, following treatment in culture, may be administered to an individual in need thereof. In some embodiments the cells are obtained from the individual. In other embodiments allogeneic cells are administered.
[0015] In certain embodiments the subject being treated is an aged, or elderly, mammal. The rate of aging is species specific, where a human may be aged at about 50 years; and a rodent at about 2 years. In general terms, a natural progressive decline in body systems starts in early adulthood, but it becomes most evident several decades later. One arbitrary way to define elderly more precisely in humans is to say that it begins at conventional retirement age, around about 60, around about 65 years of age. Another definition sets parameters for aging coincident with the loss of reproductive ability, which is around about age 45, more usually around about 50 in humans, but will, however, vary with the individual.BRIEF DESCRIPTION OF THE DRAWINGS
[0016] FIGS. 1 A-1 M. A genome-wide screen identified 300 gene knockouts that boost old neural stem cell activation, a, Screen design. Three independent genome-wide screens using primary NSC cultures from a pool of 6 young (3-4 months old) or 6 old (18-21 months old) Cas9 mice (3 males and 3 females). Quiescent NSCs are infected with a lentiviral library of single guide RNAs (sgRNAs) targeting 23,000 genes (10 sgRNAs per gene) and 15,000 control sgRNAs. Quiescent NSCs (qNSCs) are transitioned to activation, and activated NSCs (aNSCs) are collected after 4 days (Day 4) by intracellular FACS with a proliferation marker (Ki67) or expanded for 14 days (Day 14). Enrichment or depletion of sgRNAs is determined by genomic sequencing, b, Example of Ki67 FACS on NSCs from young (3-4 months, blue) and old (18-21 months, red) Cas9 mice.aNSCs (top), qNSCs (middle), or qNSCs that transitioned to activation (Day 4) (bottom), c, Quantification of NSC activation efficiency at Day 4 by FACS. Mean + / - SEM of the proportion of cells expressing Ki67, normalized to young for each experiment. Each dot represents an independent primary NSC culture derived from a pool of six young (3-4 months) (3 males and 3 females) or ten old (18-21 months) (5 males and 5 females) Cas9 mice. P-values: two-tailed Mann-Whitney test, d, Principal Component Analysis (PCA) on gene scores of each screen at Day 14: Young (blue) and Old (red), e, Quantification of NSC activation efficiency (Mean + / - SEM) at Day 4 by FACS. qNSCs were infected with lentivirus targeting 100 control sgRNAs or a pool of sgRNAs targeting the top 10 genes (5 sgRNAs per gene) from screens 1 and 2 (Day 4 or 14, FDR <0.1 in both screens). Each dot represents an independent primary culture of NSCs derived from a pool of four young (3-4 months) or old (18-21 months) Cas9 mice (2 males and 2 females). P-values: two tailed Mann-Whitney test, f, g, Example screen results (screen 2) at Day 4 for young (f) or old NSCs (g), showing gene scores as a function of effect size. Each dot represents one gene. Labelled dots are top ranking genes (FDR<0.1 in at least 2 of the 3 independent screens, across Day 4 or Day 14, whose knockouts boost (purple) or impede (green) NSC activation in an age-dependent manner or whose knockouts boost activation regardless of age (grey) h, Heatmap showing gene scores for the top 10 gene knockouts that boost young or old activation, Slc2a4 (GLUT4), Slc2a12 (GLUT12), Snail, Cdkn2a, and Lrigl. i, Venn diagram of gene knockouts that boost NSC activation in at least 2 of 3 screens (FDR<0.1 ) in young (blue) or old NSCs (red), j, FACS quantification of NSC activation efficiency at Day 4. Old qNSCs were either uninfected or infected with lentivirus expressing sgRNAs targeting GFP (control) or individual genes (5 sgRNAs per gene). Cells were placed in activation media for 4 days and activation was assessed by Ki67 FACS. Mean + / - SEM of percentage of cells expressing Ki67, normalized to control for each experiment (2 independent experiments, each with 4 NSC cultures derived from a pool of 2 mice). Each dot represents an independent primary culture of old NSCs from a pool of 2 old (18-21 months) Cas9 mice (1 male and 1 female). P-values: Wilcoxon signed rank test, k-m, Selected Gene Ontology (GO) terms associated with genes knockouts that boost young (k), young and old (I) or old (m) NSC activation (FDR<0.1 in at least 2 of 3 screens), assessed using EnrichR. P-values: Fisher’s exact test.
[0017] FIGS. 2A-2G. In vivo screening platform for rapid testing of gene knockout effects on neural stem cell activation, a, In vivo screen platform in old mice. Old (20-22 months) Cas9 mice (females) are injected with lentivirus expressing sgRNAs directly into the lateral ventricles (in close proximity to the SVZ niche). Each sgRNA library targets 10 genes of interest (5 sgRNAs per gene) along with 100 control sgRNAs (Methods). 5 weeks after injection, genomic DNA is harvested from the olfactory bulb and sgRNAs are sequenced to determine enrichment or depletion, b, Immunofluorescence images of sections of the subventricular zone (SVZ) NSC niche of old (21 -months) Cas9 mouse brain, 48 hours after stereotactic injection of lentivirusesexpressing mCherry and 100 control sgRNAs. Markers: mCherry (lentivirus-infected cells, red), GFAP (NSCs and astrocytes, magenta), Ki67 (proliferative cells, green), and DAPI (nuclei, blue). Right panels: high magnification images of SVZ niche infected with virus, c-d, Normalized sgRNA counts of the Top 10 gene pool (50 sgRNAs) and control (100 sgRNAs) libraries in various brain regions, either 1 day (c) or 5 weeks (d) post virus injection. The Top 10 gene pool corresponds to genes that when knocked-out boosted old NSC activation in our in vitro screens (screens 1 and 2). All sgRNA counts are normalized to total counts between brain regions to account for variance in sequencing depth, e, CasTLE gene scores for 50 gene knockouts tested in groups of 10 in old (19-22 months) female Cas9 mice olfactory bulbs. Each sgRNA library of 10 genes was injected into 4 old Cas9 mice, one mouse for the 1 day post-injection SVZ sequencing of starting sgRNA pool, and 3 mice for the 5 week post-injection sequencing of olfactory bulb sgRNAs. Olfactory bulb sgRNA enrichment was computed with CasTLE by comparison to the 24-hour SVZ sequenced sample. Mean + / - SEM of CasTLE score in 3 independent mice. Each dot represents gene score from one mouse. *: gene hits with a 95% confidence interval that did not contain 0 as computed by CasTLE analysis. Color indicates screen number, f, g, Relative enrichment and frequency of each sgRNA targeting Slc2a4 (GLUT4, purple) or Vmn1r107 (green) or the control (grey) sgRNA pool. Hashed line: CasTLE-computed relative enrichment effect size for sgRNAs of interest relative to control sgRNA pool. Vertical dashes: relative enrichment of the 5 sgRNAs targeting Slc2a4 (GLUT4) or Vmn1r107.
[0018] FIGS. 3A-3K. Slc2a4 (GLUT4) knockout in the SVZ neural stem cell niche boosts neurogenesis in old mice, a, Immunofluorescence images of subventricular zone (SVZ) sections from old (21 months) female Cas9 mice, 5 weeks after injection of lentivirus expressing sgRNAs targeting Scl2a4 (GLUT4) into the lateral ventricles. Mice were injected with EdU once per week for 4 weeks, starting one week after virus injection. Markers: mCherry reporter (lentivirus-infected cells, red), GLUT4 (green), GFAP (astrocytes and qNSCs, magenta). LV: lateral ventricle. Dashed white rectangles: examples of cells with mCherry infection. Insets: zoomed-in images, b, Immunofluorescence images of olfactory bulb sections from old (22 months) male Cas9 mice, 5 weeks after injection of lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Markers: mCherry (lentivirus-infected cells, red), GLUT4 (green), and DAPI (nuclei, blue). Dashed white squares: examples of cells with mCherry infection, c, Quantification of GLUT4 mean fluorescent intensity in non-infected (mCherry ) and infected (mCherry+) GFAP+cells in the SVZ, 5 weeks after injection of lentivirus to express sgRNA targeting Slc2a4 (GLUT4) into the lateral ventricle. Mean + / -SEM of GLUT4 fluorescence intensity in GFAP+cells. Each dot represents a cell’s GLUT4 mean fluorescent intensity. P-value: two-tailed Mann-Whitney test, d, QuPath image quantification of GLUT4 mean fluorescence, comparing infected (mCherry+) and uninfected (mCherry cells. Mean + / - SEM of all detected cells GLUT4 mean fluorescence. Each dot represents a cell quantified in a Slc2a4 (GLUT4) sgRNA treated mouse. P-value: two-tailedMann-Whitney test, e, Z-stack confocal images of olfactory bulb sections from old (20 months) male Cas9 mice, 5 weeks after injection of lentivirus expressing control or Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Markers: NeuN (mature neurons, green), mCherry (lentivirus-infected cells, red), GFAP (astrocytes, Blue), and Dex (neuroblasts, magenta). White arrows: NeuN+cells infected with lentivirus (expressing one of the sgRNAs targeting control or GLUT4). Z-stack positions are labelled at the bottom right, f, Immunofluorescence images of olfactory bulb sections from old (20 months) male Cas9 mouse, 5 weeks after injection of lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Markers: EdU (newborn cells, green), mCherry (lentivirus-infected cells, magenta), NeuN (mature neurons, red), and DAPI (nuclei, blue). White arrows: NeuN+cells that are infected with lentivirus (expressing one of the sgRNAs targeting GLUT4). Right panels: zoomed-in images, g, Quantification of the number of newborn neurons (NeuN+mCherry+EdU+) over total number EdU+in the olfactory bulb. Mean + / - SEM over 3 independent experiments for a total of n = 3-6 mice (all males). Each dot represents the average number of cell counts for one mouse, from 3 serial sections taken at 100 pm intervals across the olfactory bulb pair, with the treated conditions normalized to average of control. P-values: two-tailed Mann-Whitney test, h, Immunofluorescence images of coronal sections of the SVZ niche from old (21 months) male Cas9 mice, 5 weeks after injection of lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Markers: Ki67 (proliferative cells, green), GFAP (NSCs and astrocytes, magenta), S100a6 (NSCs, red) and DAPI (nuclei, blue). Cell types: qNSC (GFAP+S100a6+Ki67 ), aNSC (GFAP+S00a6+Ki67+), Neuroblast (GFAP Ki67+) and astrocytes; GFAP+S100a6 ). i, Quantification of the number of qNSCs, aNSCs, neuroblasts, and astrocytes in the SVZ. Mean + / - SEM over 3 independent experiments for a total of n = 8 mice. Each dot represents the average number of cell counts for one mouse, from -8 serial sections at 100 pm intervals across the SVZ. P-values: two-tailed Mann-Whitney test, j, Immunofluorescence images of coronal sections of the SVZ niche from young (3-4 months) and old (18-21 months) male Cas9 mice. Markers: GLUT4 (red), Ki67 (proliferative cells, green), GFAP (NSCs and astrocytes, magenta), and DAPI (nuclei, blue). Cell types: qNSC / astrocyte (GFAP+Ki67 ), aNSC (GFAP+Ki67+), Neuroblast (GFAP Ki67+) and other cells (ependymal, microglia; GFAP Ki67 ). Right panels: zoomed-in images, k, QuPath image quantification of GLUT4 mean fluorescence intensity in neural stem cell niche cells from 7 young (3-4 months) and 7 old (18-21 months) male Cas9 mice. Cell types identified as in e. Mean + / - SEM from 2 independent experiments each with 3-4 mice, for a total of n = 7 mice. Each dot represents GLUT4 mean fluorescent intensity average of cells from one mouse. P-values: two tailed Mann-Whitney test.
[0019] FIGS. 4A-4J. Old NSCs exhibit high glucose uptake which can be targeted to ameliorate activation, a, Glucose uptake pathway, b, Heatmap plotting the glucose and insulin pathwaymedian gene scores (CasTLE) from genome-wide in vitro screens (Day 4). Gene knockouts that boost (green) or impede (red) activation, c-e, Immunofluorescence image for GLUT4 staining (c) and quantification of primary NSC cultures from young (3-4 months) or old (18-21 months) Cas9 mice (mixed sex) in quiescence media for 7 days (qNSCs) or in activation media for 2 days (aNSCs). Markers: GLUT4 (c, d, red), STX4A (e, green) and DAPI (nuclei, blue). QuPath image quantification of GLUT4 (d) or STX4A (e) mean fluorescence. Mean + / - SEM from 3-4 independent NSC cultures from a pool of 6 mixed-sex mice. Each dot represents an independent NSC culture. P-values: two-tailed Mann-Whitney test, f, Bioluminescent glucose uptake assay (Promega Glucose Uptake-Gio kit) on primary qNSCs or aNSCs from young (3-4 months) or old (18-21 months) mice. Mean + / - SEM from 6-8 independent NSC cultures, each from a pool of 6 mice, 3 males and 3 females. Each dot represents an independent NSC culture. P-values: two- tailed Mann-Whitney test, g, Extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) in young and old qNSCs. qNSCs from young (3-4 months) or old (18-21 months) mice were infected with lentiviruses expressing control sgRNAs or sgRNAs targeting Slc2a4 (GLUT4) and metabolic assay experiments were performed two days later. Mean + / - SD of results from 2 independent experiments of 6-8 independent NSC cultures, each from a pool of 2 mice, 1 male and 1 female. Each dot represents results from one independent NSC culture. P-values: Wilcoxon signed rank test (comparisons within samples) or one-tailed Mann-Whitney test (comparison across different aged samples), h, Bioluminescent glucose uptake assay (Promega Glucose Uptake-Gio kit) on primary qNSC cultures from old (18-21 months old) mice treated with lentivirus expressing Slc2a4 (GLUT4) or control (unannotated genomic regions) targeting sgRNAs, or uninfected. NSCs were plated in NSC quiescence media 6 days prior to lentiviral infection and assessed for glucose uptake at Day 4 or Day 8. Mean + / - SD from 3-4 independent NSC cultures, each from a pool of 6 mice (3 males and 3 females). Each dot represents an independent NSC culture. P-values: two-tailed Mann-Whitney test, i, Percentage of qNSCs from mixed sex young (3-4 months old) or old (18-21 months old) that successfully activated (% Ki67+) 4 days after transition to aNSC media assessed by FACS. NSCs were placed in quiescence media for 4 days, exposed to lentivirus to express sgRNAs targeting Slc2a4 (GLUT4) or unannotated genomic regions (control); 6 days later, the media was replaced with quiescence media with (grey) or without (pink) glucose; 48 hours later, the media was replaced with activation media with glucose for 4 days. FACS analysis for Ki67. Mean + / - SD from 6 independent NSC cultures, each from a pool of 6 mice, 3 males and 3 females. Each dot represents an independent NSC culture. P-values: two-tailed Mann-Whitney test, j, Summary of gene knockouts, and associated cellular processes, that boost old NSC activation. Bold: gene knockouts that boosted old NSC activation in both in vitro and in vivo screens.
[0020] FIG. 5 is a dot plot showing mean + / - SEM of the percentage of cells expressing Ki67, normalized to the control for each independent experiment. Each dot represents an independentprimary culture of NSCs derived from a pool of 4 young (2-3 months old) or old (18-20 months old) mice (50:50 mix of male and female). P-value determined by two-tailed Mann-Whitney test.
[0021] FIG. 6A-6N. Genome-wide screen quality control, a, b, Normalized count matrices of all sgRNA counts across samples at Day 4 (a) or Day 14 (b). c, Growth curves with number of cells at each passage (p3-p12) for primary cultures of NSCs from young (3-4 months) and old (18-21 months) mice used for the genome-wide screens. Dots represent cell counts for the sample at each passage (x106). Dotted line at 1 .4x109represents the required number of cells for each biological replicate, d-f, Pairwise comparison of casTLE scores across young screen samples at Day 14. Correlation plots between Screen 1 and Screen 2, Screen 2 and Screen 3; Screen 1 and Screen 3. Spearman p is indicated, g-i, Principal Component Analysis (PCA) performed on all gene scores of the three independent screens at Day 4 (g,h) and Day 14 (i): Young 1 , 2, 3 (blue) and Old 1 , 2, 3 (red), with Principal Components 1 vs. 2 (g) and Principal Components 3 vs. 4 (h,i). j,k, Volcano plots of example screen results (screen 1 ) at Day 14 for young (j) or old NSCs (k), showing gene scores (y-axis) in relation to effect size (x-axis). Each dot represents one gene. Labelled dots are top ranking gene knockouts (FDR<0.1 in at least 2 of the 3 independent screens. Selecting genes that intersect screen 1 (day 4 or 14) with screen 2 (day 4 or 14)) that boost NSC activation (purple, corresponding to enriched sgRNAs) or impede NSC activation (green, corresponding to depleted sgRNAs) in an age-dependent manner or gene knockouts that boost activation regardless of age (grey, corresponding to enriched sgRNAs). I, Comparison of significantly depleted genes (FDR < 0.1 ) in genome-wide screen (Day 14) and essential genes identified from Online GEne Essentiality database (OGEE), m, Comparison of significantly depleted genes (FDR < 0.1 ) in genome-wide screen (Day 14) and essential genes identified from Core Essential Genes 2 (CEG2). n, Validation of gene knockout efficiency at the genomic level. qNSCs were infected with lentivirus expressing sgRNAs targeting individual genes (5 sgRNAs per gene) and genomic DNA was extracted. Top: Experiment 1. Bottom: Experiment 2. Percentage of knockout was quantified by sequencing PCR products followed by DECODRv3.0. Each dot represents the percentage knockout for one sgRNA. #: knockout detected by DECODRv3.0, but with low confidence (r2< 0.6). No data point: knockout not detected by DECODRv3.0. Dotted red line: sum of knockout percentages for high confidence and detected knockouts. See Fig. 11 h-m for genomic knockout examples and knockout efficiency by western blot and FACS for Slc2a4 (GLUT4).
[0022] FIG. 7A-7G. Example top sgRNAs counts from gene knockouts enriched or depleted in genome-wide screens and Gene Ontology analysis of gene knockouts that impede activation, a- c, Histograms plotting the relative enrichment and frequency of each sgRNA targeting a gene of interest or the control sgRNA pool (control), comparing the starting sgRNA plasmid library to the screen result. Enriched sgRNAs (purple) and depleted sgRNAs (green). Hashed line indicates the CasTLE computed enrichment effect size for sgRNA targeting the gene of interest and controlsgRNA pool. Colored dashes above the x-axis represent each of the sgRNAs targeting the gene of interest and their relative enrichment, d, Venn diagram of all gene knockouts that impede NSC activation in at least 2 of the 3 independent screens (FDR<0. 1 in both screens. Selecting genes that intersect screen 1 (day 4 or 14) with screen 2 (day 4 or 14)) in young (blue) or old NSCs (red), e-g, Gene Ontology (GO) terms associated with gene knockouts that impede young (e) NSC activation, impede activation regardless of age (f), or impede activation of old (g) NSCs. Gene sets selected based on FDR<0.1 in at least 2 of the 3 independent screens. GO terms assessed using EnrichR focusing on the “cell component”, “molecular function” and “biological process” libraries. P-value calculated by EnrichR using a Fisher’s exact test.
[0023] FIG. 8A-8D. Efficiency of in vivo lentiviral injection and knockout, a, Immunofluorescence images of sections of the lateral ventricles and subventricular zones (SVZs), olfactory bulb, midbrain hippocampus and hindbrain cerebellum regions of old (22 months old) female Cas9 mice, 1 week after injection of lentivirus expressing mCherry reporter and sgRNAs. Markers: mCherry reporter (lentivirus-infected cells, red) and cell nuclei (DAPI, blue), b, Immunofluorescence images of sections of the olfactory bulb mCherry in the olfactory bulb of old (21 months old) female Cas9 mice, 5 weeks after injection of lentivirus expressing mCherry reporter and sgRNAs. Markers: mCherry reporter (lentivirus-infected cells, red) and cell nuclei (DAPI, blue), c, Zoomed-in immunofluorescence images of sections of olfactory bulb from old (22 months old) female Cas9 mice, 5 weeks after injection of lentivirus expressing sgRNA targeting the EGFP reporter present in Cas9 mice directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Markers : mCherry reporter (lentivirus-infected cells, red), EGFP reporter (present in Cas9 mice, green), EdU (newborn cells, magenta) and cell nuclei (DAPI, blue), d, Quantification of EGFP mean fluorescent intensity in non-infected (mCherry ) and infected (mCherry*) newborn cells (EdU+) in the olfactory bulb, 5 weeks after injection of lentivirus to express sgRNA targeting EGFP into the lateral ventricle. Dot plot showing mean + / -SEM of the EGFP fluorescence intensity in EdU+ cells. Each dot represents a cell’s EGFP mean fluorescent intensity. P-value determined by two-tailed Mann-Whitney test.
[0024] FIG. 9A-9I. In vivo screen quality control, WT controls, example genes, young mouse screen, a, b, Normalized count matrices of all sgRNA counts across samples at 24-hours (a) or 5 weeks (b) post virus injection, c, Olfactory bulb sgRNA enrichment CasTLE analysis results showing gene scores of the Top 10 gene pool, 5 weeks after injection of lentivirus expressing sgRNAs targeted to these genes directly into the lateral ventricles of wild-type (WT) old (20-21 months old) male mice. Gene scores were computed by comparing the olfactory bulb sgRNA counts 5-week post injection and the SVZ sgRNA counts from an independent mouse sequenced 24 hours after injection. Each dot represents gene score (mean + / - SEM) from an independent mouse. *: gene hits with a 95% confidence interval that did not contain 0 as computed by CasTLEanalysis, in at least one of the 2 independent mice, d-g, Histograms plotting the relative enrichment and frequency of each sgRNA targeting a gene of interest or the control sgRNA pool, comparing the starting sgRNA library in the SVZ at 24 hours post infection to the olfactory bulb sgRNA counts at 5 weeks post injection. Here we show top ranked genes plotted on example screens as labelled. Hashed line indicates the CasTLE computed enrichment effect size for targeted gene and control pool. Colored dashes above the x-axis represent each of the sgRNAs targeting the gene of interest and their relative enrichment, h, CasTLE gene scores for 10 gene knockouts (depleted in young / old in vitro screens) in young (3 months old) female Cas9 mice olfactory bulbs. The library of 10 genes was injected into 1 young Cas9 mouse, which was left for 5 weeks and then the olfactory bulb sgRNAs were sequenced. Olfactory bulb sgRNA enrichment was computed with CasTLE by comparison to the 24-hour SVZ sequenced sample. Dot plot showing mean of CasTLE score in 1 mouse. Each dot represents gene score from one mouse. *: gene hits with a 95% confidence interval that did not contain 0 as computed by CasTLE analysis, i, Comparison between “Published NSC regulators” hits in in vitro and in vivo screens. Gene scores for in vitro screens were plotted for Published NSC regulators. Bold: gene knockout that were similar in vitro and in vivo screens.
[0025] FIG. 10A-10N. GLUT4 knockout efficiency in vivo, proportion of newborn cells that become neurons, other cell types in the olfactory bulb, and GLUT4 expression with aging, a, Top panel: immunofluorescence images of sections of the SVZ from old (22 months old) female Cas9 mice, 5 weeks after injection with lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Markers: DAPI (nuclei, blue), GFAP (qNSCs / astrocytes, magenta), Ki67 (proliferative cells, green), S100a6 (NSCs, red), merge image. Bottom panel: immunofluorescent images of sections of the SVZ from the same mice as in top panel, with markers for DAPI (nuclei, blue), mCherry (lentivirus-infected cells, red), and GFAP (qNSCs / astrocytes, green), b, Representative immunofluorescence images of olfactory bulb sections from old (~20 months old) male Cas9 mice, 5 weeks after injection of lentivirus expressing control (unannotated genomic regions), Slc2a4 (GLUT4) or Vmnlr 107 sgRNAs directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Markers: EdU (newborn cells, green) and nuclei (DAPI, blue). Zoomed-out images with the dashed white squares representing the insets (top) and zoomed-in images as insets (bottom), c, Example image of mCherry (lentivirus-infected cells, magenta) and EdU (newborn cells, green) staining (top panel) and QuPath image quantification of the average number of EdU+and mCherry+cells in the olfactory bulbs, normalized to total EdU+cells (lower panel) in old Cas9 mice (18-23 months old). Dot plot, with each dot representing counts from one mouse, showing mean + / - SEM. Results are from 3 independent experiments for a total of n = 5-9 mice. Each dot represents the average number of cell counts for one mouse, from 3 serial sections taken at 100 pm intervals across the olfactory bulb pair, with the treated conditions normalized to average of control. P-values determined by two-tailed Mann-Whitney test, d, Immunofluorescence images of olfactory bulb sections from old (20 months) male Cas9 mouse, 5 weeks after injection of lentivirus expressing control (unannotated genomic regions) or Vmn1r107sgRN s directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Markers: EdU (newborn cells, green), mCherry (lentivirus-infected cells, magenta), NeuN (mature neurons, red), and DAPI (nuclei, blue). Dashed white squares: NeuN+cells that are infected with lentivirus (expressing one of the sgRNAs). Insets: zoomed-in images, e, QuPath image quantification of NeuN mean fluorescent intensity in infected (mCherry+) newborn cells (EdU+) in the olfactory bulb of old Cas9 mice (18-23 months old) (mix of males and females), 5 weeks after injection of lentivirus expressing control (unannotated genomic regions), Slc2a4 (GLUT4), or Vmn1r107 sgRNAs directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Dot plot showing mean + / - SEM of quantification results from 3 independent experiments, each with ~2-3 mice, for a total of n = 5-9 mice. Each lavender dot represents the average NeuN fluorescence intensity of all enumerated cells in one mouse, from 3 serial sections taken at 100 pm intervals across the olfactory bulb pair. Each grey dot represents a single cell NeuN fluorescence intensity, showing all cells across all samples for each respective treatment. Average NeuN fluorescence intensity of cells (lavender dots) of each treated mouse was statistically compared between treated and control mice. P-values determined by two tailed Mann-Whitney test, f, QuPath image quantification of the percentage of newborn cells (EdU+) that are also NeuN+, comparing cells with (mCherry+) or without (mCherry ), in control, Slc2a4, or Vmn1r107 sgRNA expression conditions. Dot plot showing mean + / - SEM of quantification results from 3 independent experiments, each with 1-3 mice, for a total of n = 5 mice. Each dot represents the average (%NeuN+) of all cell quantifications from a single mouse. P-values determined by two-tailed Mann-Whitney test, g, Representative immunofluorescence images of olfactory bulb sections from old (20 months old) male Cas9 mouse, 5 weeks after injection of lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Markers: mCherry (lentivirus- infected cells, red), Tuj1 (neuron marker, green), and DAPI (nuclei, blue). Insets and white ovals: Tuj1+cells that are infected with lentivirus (expressing one of the sgRNAs targeting Slc2a4 (GLUT4)). h, QuPath image quantification of Tuj1 mean fluorescent intensity in infected (mCherry+) newborn cells (EdU+) in the olfactory bulb of old Cas9 mice (18-21 months old) (mix of males and females), 5 weeks after injection of lentivirus expressing control (unannotated genomic regions), or Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Dot plot showing mean + / - SEM of quantification results from 2 independent experiments, each with ~2 mice, for a total of n = 4 mice. Each lavender dot represents the average Tuj 1 fluorescence intensity of all enumerated cells in one mouse, sections taken at 100 pm intervals across the olfactory bulb pair.Each grey dot represents a single cell Tuj1 fluorescence intensity, showing all cells across all samples for each respective treatment. Average Tuj1 fluorescence intensity of cells (lavender dots) of each treated mouse was statistically compared between treated and control mice. P- values determined by two tailed Mann-Whitney test, i, Representative immunofluorescence images of olfactory bulb sections from old (20 months old) male Cas9 mouse, 5 weeks after injection of lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Markers: mCherry (lentivirus-infected cells, red), Calretinin (mature neuron marker, green), and DAPI (nuclei, blue), j, Representative immunofluorescence images of olfactory bulb sections from old (20 months old) male Cas9 mouse, 5 weeks after injection of lentivirus expressing Slc2a4 (GLUT4) sgRNAs directly into the lateral ventricles. Mice were injected with EdU once per week, starting one week after virus injection, for 4 weeks. Left panels: Markers: mCherry (lentivirus- infected cells, red), GFAP (astrocytes, blue, top panels), Dex (immature neuroblast, blue, bottom panels), NeuN (neurons, green). Right panels: mCherry (lentivirus-infected cells, red), DAPI (nuclei, blue), Sox10 (oligodendrocytes, green, top panels), Olig2 (oligodendrodyctes, magenta, lower panels). Images are the exact same in the top and lower panels to show the different channels, except for the Slc2a4 (GLUT4) sgRNA condition for Dex (lower panel), as there were no Dcx+cells (which are very rare) in the same image, k, QuPath image quantification of the mean fluorescence intensity with an isotype antibody control (mouse IgG) in sections from the SVZ neural stem cell niche from 4 young (3-4 months old) and 3 old (18-21 months old) male Cas9 mice (control for Fig. 3k). Cell types were identified as follows: qNSC / astrocyte (GFAP+Ki67 ), aNSC (GFAP+Ki67+), Neuroblast (GFAP Ki67+) and other cells (ependymal, microglia; GFAP Ki67 ). Dot plot showing mean + / - SEM of quantification results from 2 independent experiments, each with 1 -3 mice, for a total of n = 2-3 (old) or 4 (young) mice. Each dot represents average fluorescent intensities of cells from one mouse. P-values determined by two tailed Mann-Whitney test. I, Violin plots comparing the log-normalized expression of Slc2a4 (GLUT4) between young (blue) and old (red) in single cell RNA-seq of qNSCs / astrocytes, aNSCs, neuroblasts, and all other cells from the neurogenic niche. P-values determined by two-sample Welch’s t-test. m, Representative immunofluorescence images of coronal sections of the SVZ neural stem cell niche from young (3-4 months old) and old (18-21 months old) male Cas9 mice. Markers: GLUT4 (red), S100a6 (NSC marker, green), GFAP (NSC and astrocyte marker, magenta), and DAPI (nuclei, blue). Dotted squares: regions with NSCs shown in the insets. Insets: zoomed-in images, n, QuPath image quantification of the mean fluorescence intensity of the GLUT4 antibody in s100a6+ / GFAP+ cells quantified from sections of the SVZ neural stem cell niche from 4 young (3-4 months old) and 4 old (18-21 months old) male Cas9 mice. Dot plot showing mean + / - SEM of quantification results from 2 independent experiments, each with 2 mice, for a total of n = 4 or4 mice. Each dot represents average fluorescent intensities of cells from one mouse. P-values determined by two tailed Mann-Whitney test.
[0026] FIG. 1 1 A-1 1 O. Glucose transporter expression during aging, STX4A immunofluorescence in vitro and in vivo, Slc2a4 (GLUT4) knockout efficiency and effects of Slc2a4 (GLUT4) knockout on qNSC activation in the context of glucose restriction, a, Bar plots showing the Iog2 fold change in average expression of the Slc2a transcripts expressed in qNSCs / astrocytes from young and old mice, where Iog2 fold changes greater than 0 indicate higher expression in cells of old animals than in young animals, b, Immunofluorescence image of STX4A in primary NSC cultures from young (3-4 months old) or old (18-21 months old) mice (quantification in Fig. 4e). NSCs were plated in quiescence NSC media (qNSCs) for 7 days prior to imaging, and NSCs were plated in activated NSC media (aNSCs) 2 days prior to imaging. Markers: STX4A (green) and DAPI (nuclei, blue), c, Representative immunofluorescence images of coronal sections from SVZ NSC niche sections from young (3-4 months old) and old (18-21 months old) Cas9 mice. Markers: Ki67 (proliferation maker, green), GFAP (NSC and astrocyte marker, magenta), DAPI (nuclei, blue), and STX4A (red). Cell types were identified as follows: qNSC / astrocytes (GFAP+Ki67 ), aNSCs (GFAP+Ki67+), Neuroblasts (GFAP Ki67+), and other cells (ependymal, microglia; GFAP Ki67 ). d, QuPath image quantification of STX4A mean fluorescence in cells of the neural stem cell niche from 3 young (~4 months-old) and 3 old (~19 months-old) male Cas9 mice. Cell types were identified as follows: qNSC / astrocyte (GFAP+Ki67 ), aNSC (GFAP+Ki67+), Neuroblast (GFAP Ki67+) and other cells (ependymal, microglia; GFAP Ki67). P-values: two tailed Mann-Whitney test, e, Expression of Scl2a4 (GLUT4) transcripts in young and qNSCs and aNSCs in culture76, f, FACS-based glucose uptake assay with 2NBDG (2-( / V-(7-Nitrobenz-2-oxa-1 ,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Sigma, 72987) on primary NSC cultures (qNSCs and aNSCs) from young (3-4-months-old) or old (18-21 -months-old) mice. Dot plot showing mean + / - SEM of results from 3-4 independent cultures, each from a pool of 6 mice, 3 males and 3 females. Each dot represents an independent NSC culture. P-values determined by two-tailed Mann-Whitney test, g, Violin plots showing the log-normalized expression of all genes in the fatty acid oxidation gene signature across young and old qNSC / astrocyte cells in the single-cell RNA-seq dataset98. P-value determined by two-sample Welch’s t-test. h, Top panel: scheme of the Slc2a4 (GLUT4) locus with the location of sgRNAs 1 -5. Bottom panel: genomic sequences for Slc2a4 (GLUT4) sgRNAs 1 -5 from DECODRv3.0 analysis tool indicating the sgRNA target and cut site and indel distribution, i, Guide sequences used for Slc2a4 (GLUT4) sgRNAs 1-5 and the DECODRv3.0 knockout percentage for each sgRNA. j, GLUT4 knockout efficiency in primary qNSC cultures by western blot. Western blot analysis of GLUT4 levels in qNSCs infected with control sgRNA (targeting unannotated regions of the genome) or sgRNA targeting Slc2a4 (GLUT4), 10 days after infection by lentivirus and 3 days of selection with puromycin. [3-actin is used as a loading control, k, Quantification of westernblot: GLUT4 intensity, normalized to p-actin intensity. I, GLUT4 knockout efficiency in primary qNSC cultures by FACS. Intracellular FACS analysis of GLUT4 levels in fixed qNSCs treated with control sgRNA or sgRNA targeting Slc2a4 (GLUT4), 10 days after lentivirus infection to express sgRNA. No antibody control panel is on the left. Plots show mCherry+gated cells, GLUT4 fluorescence, m, Quantification of FACS data, normalized to control, n, Data from Fig. 4i, presented as the boost in qNSC activation ability with Slc2a4 (GLUT4) knockout, with or without glucose starvation. Dot plot showing mean + / - SEM of activation ability of Slc2a4 (GLUT4) knockout relative to control. Each dot represents an independent NSC culture. P-values determined by two-tailed Mann-Whitney test, o, Percentage of qNSCs from mixed sex young (3- 4 months old) or old (18-21 months old) that successfully activated (% Ki67+) 4 days after transition to aNSC media, as assessed by Ki67 intracellular FACS analysis. NSCs were placed in qNSC media for 4 days. Then the cell media was replaced with qNSC media with or without 2- Deoxy-D-glucose (2-DG) (2mM) for 48 hours, at which point the media was replaced with aNSC media and the cells were allowed to activate for 4 days prior to intracellular FACS analysis with Ki67. Dot plot showing mean + / - SEM of results from 4 independent NSC cultures, each from a pool of 2 mice, 1 male and 1 female. Each dot represents an independent NSC culture. P-values determined by two-tailed Mann-Whitney test.
[0027] FIG. 12A-12E. FACS gates and western blots.DETAILED DESCRIPTION
[0028] Before embodiments of the present disclosure are further described, it is to be understood that this disclosure is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
[0029] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of embodiments of the present disclosure.
[0030] It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a compound" includes not only a single compound but also a combination of two or more compounds, reference to "a substituent" includes a single substituent as well as two or more substituents, and the like.
[0031] In describing and claiming the present invention, certain terminology will be used in accordance with the definitions set out below. It will be appreciated that the definitions providedherein are not intended to be mutually exclusive. Accordingly, some chemical moieties may fall within the definition of more than one term.
[0032] As used herein, the phrases “for example,” “for instance,” “such as,” or “including” are meant to introduce examples that further clarify more general subject matter. These examples are provided only as an aid for understanding the disclosure, and are not meant to be limiting in any fashion.
[0033] General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001 ); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as BioRad, Stratagene, Invitrogen, Sigma-Aldrich, and ClonTech.
[0034] By "proliferate" it is meant to divide by mitosis, i.e. undergo mitosis. An "expanded population" is a population of cells that has proliferated, i.e. undergone mitosis, such that the expanded population has an increase in cell number, that is, a greater number of cells, than the population at the outset.
[0035] The term "primary culture" denotes a mixed cell population of cells from an organ or tissue within an organ. The word "primary" takes its usual meaning in the art of tissue culture. Primary tissue, or primary tissue derived cells refers to cells that have not been expanded or maintained in culture.
[0036] The term "tissue" refers to a group or layer of similarly specialized cells which together perform certain special functions.
[0037] The term "organ" refers to two or more adjacent layers of tissue, which layers of tissue maintain some form of cell-cell and / or cell-matrix interaction to form a microarchitecture.
[0038] A "therapeutically effective amount" or "efficacious amount" means the amount of a compound that, when administered to a mammal or other subject for treating a disease, condition, or disorder, is sufficient to effect such treatment for the disease, condition, or disorder. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.
[0039] The term “unit dosage form,” or “unit dose” as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of a compound calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for unit dosage forms depend on the particular compound employed and the effect to be achieved, and the pharmacodynamics associated with each compound in the host.
[0040] A "pharmaceutically acceptable excipient," "pharmaceutically acceptable diluent," "pharmaceutically acceptable carrier," and "pharmaceutically acceptable adjuvant" means an excipient, diluent, carrier, and adjuvant that are useful in preparing a pharmaceutical composition that are generally safe, non-toxic and neither biologically nor otherwise undesirable, and include an excipient, diluent, carrier, and adjuvant that are acceptable for veterinary use as well as human pharmaceutical use. "A pharmaceutically acceptable excipient, diluent, carrier and adjuvant" as used in the specification and claims includes both one and more than one such excipient, diluent, carrier, and adjuvant.
[0041] As used herein, a "pharmaceutical composition" or “formulation" is meant to encompass a composition suitable for administration to a subject, such as a mammal, especially a human. In general a “pharmaceutical composition” is sterile, and preferably free of contaminants that are capable of eliciting an undesirable response within the subject (e.g., the compound(s) in the pharmaceutical composition is pharmaceutical grade). Pharmaceutical compositions can be designed for administration to subjects or patients in need thereof via a number of different routes of administration including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, intracheal, intramuscular, subcutaneous, and the like.
[0042] The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. "Treatment" as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom but has not yet been diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.
[0043] "Co-administer" means to administer in conjunction with one another, together, coordinately, including simultaneous or sequential administration of two or more agents.
[0044] "Comprising" means, without other limitation, including the referent, necessarily, without any qualification or exclusion on what else may be included. For example, "a composition comprising x and y" encompasses any composition that contains x and y, no matter what other components may be present in the composition. Likewise, "a method comprising the step of x"encompasses any method in which x is carried out, whether x is the only step in the method or it is only one of the steps, no matter how many other steps there may be and no matter how simple or complex x is in comparison to them. "Comprised of" and similar phrases using words of the root "comprise" are used herein as synonyms of "comprising" and have the same meaning. The methods of the invention also include the use of factor combinations that consist, or consist essentially of the desired factors.
[0045] "Effective amount" generally means an amount which provides the desired local or systemic effect. For example, an effective amount is an amount sufficient to effectuate a beneficial or desired clinical result. The effective amounts can be provided all at once in a single administration or in fractional amounts that provide the effective amount in several administrations. The precise determination of what would be considered an effective amount may be based on factors individual to each subject, including their size, age, injury, and / or disease or injury being treated, and amount of time since the injury occurred or the disease began. One skilled in the art will be able to determine the effective amount for a given subject based on these considerations which are routine in the art. As used herein, "effective dose" means the same as "effective amount." A unit dose may comprise an effective amount of an active agent for a single administration.
[0046] Aged. As used herein, the term aged refers to the effects or the characteristics of increasing age, particularly with respect to the bias of hematopoietic stem cells towards cells of the myeloid lineage. The rate of aging is species specific, where a human may be aged at about 50 years; and a rodent at about 2 years. In general terms, a natural progressive decline in body systems starts in early adulthood, but it becomes most evident several decades later. One arbitrary way to define old age more precisely in humans is to say that it begins at conventional retirement age, around about 60, around about 65 years of age. Another definition sets parameters for aging coincident with the loss of reproductive ability, which is around about age 45, more usually around about 50 in humans, but may, however, vary with the individual. In addition to chronologic aging, individuals may suffer from a similar phenotype due to inflammation, genetic causes, and the like.
[0047] The term “progenitor cell” as used herein refers to a cell population that generates at least one differentiated progenitor, and may give rise to multiple lineages. Progenitor cells may self-renew, i.e. when the cells undergo mitosis, they produce at least one daughter cell that is a progenitor cell, although typically the self-renewal is of limited duration relative to stem cells. The cells are not pluripotent, that is, they are not capable of giving rise to cells of other organs in vivo.
[0048] The term "pluripotent" or "pluripotency" refers to cells with the ability to give rise to progeny that can undergo differentiation, under appropriate conditions, into cell types that collectively exhibit characteristics associated with cell lineages from the three germ layers(endoderm, mesoderm, and ectoderm). A "stem cell" is a cell characterized by the ability of selfrenewal through mitotic cell division and the potential to differentiate into a tissue or an organ. Among mammalian stem cells, embryonic and somatic stem cells may be distinguished.
[0049] The term “neural stem cell” refers to self-renewing, multipotent cells that firstly generate the radial glial progenitor cells that generate the neurons and glia of the nervous system of all animals during embryonic development. Some neural progenitor stem cells persist in highly restricted regions in the adult vertebrate brain and continue to produce neurons throughout life. NSCs are commonly characterized by a combination of expression of an NSC / astrocyte marker, an NSC / IPC marker, and / or the ciliary protein promininl (CD133), as well as their radial morphology and location of the cell body in the stem cell layer of the V-SVZ or the DG.
[0050] Stem cells are characterized by their capacity to differentiate into multiple cell types. They undergo symmetric or asymmetric cell division into two daughter cells. In symmetric cell division, both daughter cells are also stem cells. In asymmetric division, a stem cell produces one stem cell and one specialized cell. NSCs primarily differentiate into neurons, astrocytes, and oligodendrocytes.
[0051] In the adult mammalian brain, the subgranular zone in the hippocampal dentate gyrus, the subventricular zone around the lateral ventricles, and the hypothalamus (precisely in the dorsal a1 , a2 region and the "hypothalamic proliferative region”, located in the adjacent median eminence) have been reported to contain neural stem cells.
[0052] NSCs are stimulated to begin differentiation via exogenous cues from the microenvironment, or stem cell niche. Some neural cells are migrated from the SVZ along the rostral migratory stream which contains a marrow-like structure with ependymal cells and astrocytes when stimulated. The ependymal cells and astrocytes form glial tubes used by migrating neuroblasts. The astrocytes in the tubes provide support for the migrating cells as well as insulation from electrical and chemical signals released from surrounding cells. The astrocytes are the primary precursors for rapid cell amplification. The neuroblasts form tight chains and migrate towards the specified site of cell damage to repair or replace neural cells. Neural stem cell proliferation declines as a consequence of aging.
[0053] The most widely accepted model of an adult NSC is a radial, glial fibrillary acidic proteinpositive cell. Quiescent stem cells are able to remain in the quiescent state due to the renewable tissue provided by the specific niches composed of blood vessels, astrocytes, microglia, ependymal cells, and extracellular matrix present within the brain. Once activated, the develop into active proliferating intermediate cells, which then divide into neuroblasts. The undifferentiated neuroblasts form chains that migrate and develop into mature neurons.
[0054] Markers expressed by neural stem cells include Nestin, an intermediate filament protein; Sox2 (Sex-determining region Y (SRY)-Box 2) transcription factor; Musashi-1 , an RNA-binding protein; Pax6 (Paired Box 6) transcription factor; notch receptors, CD133, and Olig2. See Randoet al. (2025) Cell Stem Cell 32(7):1038-1054; Sun et al. (2025) Neuron. 113(1 ):82-108; Coquand et al. (2024) Nat Cell Biol. 26(5):698-709; Negredo et al. (2020) Cell Stem Cell. 27(2):202-223; each herein specifically incorporated by reference.
[0055] Quiescence is defined as a state of reversible cell cycle arrest, usually in the GO phase of the cell cycle but also in G2 (Otsuki and Brand, 2018). Non-proliferation is also a characteristic of terminally differentiated and senescent cells, but only quiescent cells can re-enter the cell cycle under physiological conditions. The state of quiescence is considered important for long-lived proliferative cells as it protects them from exhaustion of their proliferation potential and allows them to avoid accumulation of damage to DNA, proteins, and mitochondria that might result in malignant transformation or senescence.
[0056] Most tissues in adult organisms harbor stem cells, which divide to generate differentiated progenies for tissue maintenance or repair, while also self-renewing — i.e., generating new stem cells — and / or re-entering quiescence to maintain the stem cell population over extended periods. Despite being associated with a low metabolic state, including low rates of RNA and protein synthesis, quiescence is an actively maintained process involving a molecular program that suppresses terminal differentiation, prevents senescence, and ensures reversibility of the cell cycle-arrest.
[0057] Quiescent stem cells can be identified by their reduced activity, small size, low mitochondrial content, and decreased levels of RNA and protein, as well as by their inability to incorporate or retain DNA or chromatin labels. Methods may include identifying the absence of proliferation markers (e.g., PCNA, Ki67, phospho-Histone H3), assessing RNA content, or tracking label retention to pinpoint these cells. Additionally, cell cycle phase sensors like p27, which is more highly expressed in quiescent cells, can help distinguish them from cycling cells.
[0058] The presence of newborn stem cells can be determined by, for example, methods disclosed in the Examples, such as tracking the presence of a detectable thymidine analog that incorporates into newly synthesized DNA and can be visualized by immunofluorescent assays.
[0059] A cell transplant, as used herein, is the transplantation of one or more cells into a recipient body, usually for the purpose of augmenting function of an organ or tissue in the recipient. As used herein, a recipient is an individual to whom tissue or cells from another individual (donor), commonly of the same species, has been transferred. Generally the MHC antigens, which may be Class I or Class II, will be matched, although one or more of the MHC antigens may be different in the donor as compared to the recipient. The graft recipient and donor are generally mammals, preferably human. Laboratory animals, such as rodents, e.g. mice, rats, etc. are of interest for drug screening, elucidation of developmental pathways, etc. For thepurposes of the invention, the cells may be allogeneic, autologous, or xenogeneic with respect to the recipient.
[0060] The terms "active agent," “antagonist”, "inhibitor", "drug" and "pharmacologically active agent" are used interchangeably herein to refer to a chemical material or compound which, when administered to an organism (human or animal) induces a desired pharmacologic and / or physiologic effect by local and / or systemic action.
[0061] 2-Deoxy-d-glucose is a glucose molecule which has the 2-hydroxyl group replaced by hydrogen, so that it cannot undergo further glycolysis. As such; it acts to competitively inhibit the production of glucose-6-phosphate from glucose at the phosphoglucoisomerase level (step 2 of glycolysis). 2-DG is up taken by the glucose transporters of the cell. Therefore, cells with higher glucose uptake, have also a higher uptake of 2-DG. Doses of 2-DG used clinically include, for example, 63, 90, or 126 mg / kg / day. 2-DG has been administered intravenously at 30 mg / m2for 3 of every 4 weeks in a clinical trial. The effective dose for the purposes of the disclosure may be more or less than the dose previously used in clinical trials, e.g. in cancer treatment.
[0062] Oxythiamine is a thiamine antagonist. It is converted by thiamine pyrophosphokinase to oxythiamine pyrophosphate, a transketolase inhibitor. As transketolase is a crucial enzyme of the pentose phosphate pathway, inhibition of this enzyme causes suppression of the pentose phosphate pathway and thus deprives cells of the metabolic intermediate (glyceraldehyde-3- phosphate) for ATP generation and of the substrates (NADPH, ribose-phosphate) for macromolecule synthesis. In vivo, oxythiamine has been administered at 400 and 500 mg / kg per day, and in vitro at concentrations of from about 0.5 LIM to 5 mM. The effective dose for the purposes of the disclosure may be more or less than the dose previously used in clinical trials, e.g. in cancer treatment.
[0063] Bromopyruvic acid (3-Bromopyruvic acid, 3-Bromopyruvate, Bromopyruvic acid, Hexokinase II Inhibitor II, 3-BP) is a hexokinase II inhibitor with Ki of 2.4 mM for glycolysis / hexokinase inhibition. 3-BP inhibits key glycolytic enzymes including hexokinase II, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase (LDH).
[0064] Other inhibitors of interest can be targeted to the genetic sequences identified herein as detrimental to aged NSC activation. For example, agents such as RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, antisense RNAs, ribozymes, catalytic DNA, etc. can be targeted to the specific genes identified in the Examples herein.
[0065] Determining a therapeutically or prophylactically effective amount of the inhibitor compositions can be done based on animal data using routine computational methods. The therapeutic dose may be at least about 0.01 ,ng / kg body weight, at least about 0.05 ig / kg bodyweight; at least about 0.1 iig / kg body weight, at least about 0.5 j g / kg body weight, at least about 1 ug / kg body weight, at least about 2.5 pig / kg body weight, at least about 5 ug / kg body weight, at least about 100 ,ug / kg body weight, at least about 500 ug / kg body weight, and may be not more than about 5 mg / kg body weight, not more than about 1 mg / kg body weight. It will be understood by one of skill in the art that such guidelines will be adjusted for the molecular weight of the active agent. The dosage may also be varied for localized administration, e.g. intranasal, inhalation, etc., or for systemic administration, e.g. i.m., i.p., i.v., and the like.
[0066] In certain embodiments, multiple therapeutically effective doses are administered according to a daily dosing regimen, or intermittently. For example, a therapeutically effective dose can be administered, one day a week, two days a week, three days a week, four days a week, or five days a week, and so forth. By "intermittent" administration is intended the therapeutically effective dose can be administered, for example, every other day, every two days, every three days, once a week, once every two weeks, once every three weeks, once a month, and so forth. For example, in some embodiments, an antibody is administered once every two to four weeks for an extended period of time, such as for 1 , 2, 3, 4, 5, 6, 7, 8, 10, 15, 24 months, and so forth. By "twice-weekly" or "two times per week" is intended that two therapeutically effective doses of the agent in question is administered to the subject within a 7 day period, beginning on day 1 of the first week of administration, with a minimum of 72 hours, between doses and a maximum of 96 hours between doses. By "thrice weekly" or "three times per week" is intended that three therapeutically effective doses are administered to the subject within a 7 day period, allowing for a minimum of 48 hours between doses and a maximum of 72 hours between doses. For purposes of the present invention, this type of dosing is referred to as "intermittent" therapy. In accordance with the methods of the present invention, a subject can receive intermittent therapy for one or more weekly or monthly cycles until the desired therapeutic response is achieved. The agents can be administered by any acceptable route of administration as noted herein below.
[0067] Administering the instant compositions can be effected or performed using any of the various methods and delivery systems known to those skilled in the art. The administering can be performed, for example, intravenously, intraventricularly, orally, via implant, transmucosally, transdermally, intramuscularly, intrathecally, and subcutaneously. The following delivery systems, which employ a number of routinely used pharmaceutical carriers, are only representative of the many embodiments envisioned for administering the instant compositions.
[0068] Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGA's). Implantable systems include rods and discs, and can contain excipients such as PLGA andpolycaprylactone. Nucleic acids of the invention can also be administered attached to particles using a gene gun.
[0069] Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc).
[0070] Transmucosal delivery systems include patches, tablets, suppositories, pessaries, gels and creams, and can contain excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other vehicles (e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid).
[0071] Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums, xanthans, cellulosics and sugars), humectants (e.g., sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and Jun. 2,2005 antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid), anti-caking agents, coating agents, and chelating agents (e.g., EDTA).
[0072] In some embodiments, a dose of the agent is provided in an implant, e.g. a matrix or scaffold, osmotic pump or other delivery device, etc., for localized delivery of the factor. The effective dose may be determined based on the specific tissue, rate of release from the implant, size of the implant, and the like, and may be empirically determined by one of skill in the art. The dose may provide for biological activity equivalent to 1 ,u.g, 10 ig, 100 .g, 1 mg, 5 mg, 10 mg, 25 mg, 50 mg, 75 mg, 100 mg, 250 mg, 500 mg, 750 mg, 1 g of inhibitor. The dose may be administered at a single time point, e.g. as a single implant; or may be fractionated, e.g. delivered in a microneedle configuration. The dose may be administered, once, two, three time, 4 times, 5 times, 10 times, or more as required to achieve the desired effect, and administration may be daily, every 2 days, every 3 days, every 4 days, weekly, bi-weekly, monthly, or more.
[0073] Therapeutic formulations described herein may be used to treat diseases associated with aging and NSC, particularly neurological diseases or disorders of the CNS. Subjects in need of therapy, e.g. a subject suffering from a neurological condition associated with the decreased replacement of neurons, glial cells, astrocytes, oligodendrocytes, etc. or with aberrantly functioning cells, could especially benefit from such therapies.
[0074] In some approaches, the agents are administered directly to an injured site to treat a neurological condition, see, e.g., Morizane et al., (2008), Cell Tissue Res., 331 (1 ):323-326;Coutts and Keirstead (2008), Exp. Neurol., 209(2):368- 377; Goswami and Rao (2007), Drugs, 10(10)713-719.
[0075] The agents may be administered in any physiologically acceptable medium, and may, for example, be administered in combination with ex vivo stimulated NSC, which may be provided prior to differentiation, i.e. they may be provided in an undifferentiated state and allowed to differentiate in vivo, or they may be allowed to differentiate for a period of time ex vivo and provided following differentiation. They may be provided alone or with a suitable substrate or matrix, e.g. to support their growth and / or organization in the tissue to which they are being transplanted.
[0076] The effective amount of a therapeutic composition to be given to a particular patient will depend on a variety of factors, several of which will differ from patient to patient. A competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to halt or reverse the progression the disease condition as required. Utilizing LD50 animal data, and other information available for the agent, a clinician can determine the maximum safe dose for an individual, depending on the route of administration. For instance, an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered. Similarly, compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration. Utilizing ordinary skill, the competent clinician will be able to optimize the dosage of a particular therapeutic in the course of routine clinical trials.
[0077] Subjects in need of neuron transplantation therapy or suitable for treatment with therapeutic formulations include, e.g. a subject suffering from a neurological condition associated with the loss of neurons, glial cells, astrocytes, oligodendrocytes, etc. or with aberrantly functioning cells, could especially benefit from therapies that utilize cells derived by the methods of the invention. Examples of such diseases, disorders and conditions include neurodegenerative diseases (e.g. Parkinson’s Disease, Alzheimer’s Disease, Huntington’s Disease, Amyotrophic Lateral Sclerosis (ALS), Spielmeyer-Vogt-Sjogren-Batten disease (Batten Disease), Frontotemporal Dementia with Parkinsonism, Progressive Supranuclear Palsy, Pick Disease, prion diseases (e.g. Creutzfeldt-Jakob disease), Amyloidosis, glaucoma, diabetic retinopathy, age related macular degeneration (AMD), and the like); neuropsychiatric disorders (e.g. anxiety disorders (e.g. obsessive compulsive disorder), mood disorders (e.g. depression), childhood disorders (e.g. attention deficit disorder, autistic disorders), cognitive disorders (e.g. delirium, dementia), schizophrenia, substance related disorders (e.g. addiction), eating disorders, and the like); channelopathies (e.g. epilepsy, migraine, and the like); lysosomal storage disorders (e.g. Tay-Sachs disease, Gaucher disease, Fabry disease, Pompe disease, Niemann-Pick disease, Mucopolysaccharidosis (MPS) & related diseases, and the like); autoimmune diseases of theCNS (e.g. Multiple Sclerosis, encephalomyelitis, paraneoplastic syndromes (e.g. cerebellar degeneration), autoimmune inner ear disease, opsoclonus myoclonus syndrome, and the like); cerebral infarction, stroke, spinal cord injury, optic nerve injury, etc.
[0078] Culturing. NSC cells, e.g. aged human NSC may be collected in any appropriate medium that maintains the viability of the cells and cultured in the presence of an effective dose of one or more agents that inhibit the glucose metabolic pathway. In one implementation, the medium comprises a neural cell medium as described in United States Patent Application Publication Number 20160108361 , Media Compositions for Neuronal Cell Culture by Gage and Bardy, for example, “BrainPhys” medium, as described in Table 1 , and further described in Bardy et al., 2015, A neuronal medium that supports basic synaptic functions of human neurons in vitro, PNAS 15043921 12. In one embodiment, the neuronal medium further comprises a serum replacement supplement. Various alternative media are commercially available and may be used according to the nature of the cells, including dMEM, HBSS, dPBS, RPMI, Iscoves medium, etc., frequently supplemented with non-serum supplement. The cultured cells may be expanded, cryopreserved, and utilized in various applications. NSC populations cultured using the methods disclosed herein are optionally of high purity. For instance, the NSPC populations may have a purity of 75%, 80%, 85%, 90%, 95%, or a purity of greater than 95%.
[0079] In some embodiments, NSC populations activated by the methods of the disclosure may be used in cell replacement or cell transplantation therapy to treat diseases, particularly neurological diseases or disorders of the CNS. In some embodiments, the cell transplantation therapy is a neuron transplantation therapy. In some embodiments the cell transplantation therapy is a glial cell transplantation therapy. The cells may be provided in a unit dose effective for administration to a recipient, e.g. in a transplantation, where a unit dose may comprise at least about 104, at least about 105, at least about 106, at least about 107, at least about 108cells, or more. The composition may be provided in a container, e.g. a container suitable for administration, such as a sealed vial, tube, etc.
[0080] In some approaches, NSCs are transplanted directly to an injured site to treat a neurological condition, see, e.g., Morizane et al., (2008), Cell Tissue Res., 331 (1 ):323-326; Coutts and Keirstead (2008), Exp. Neurol., 209(2):368- 377; Goswami and Rao (2007), Drugs, 10(10)713-719. For example, for the treatment of Parkinson's disease, neurons may be transplanted directly into the striate body of a subject with Parkinson's disease. As another example, for treatment of ALS, corticospinal motor neurons may be transplanted directly into the motor cortex of the subject with ALS. In other approaches, the cells derived by the methods of the invention are engineered to respond to cues that can target their migration into lesions for brain and spinal cord repair; see, e.g., Chen et al. (2007) Stem Cell Rev. 3(4):280-288.
[0081] The NSCs or therapeutic agents may be administered in any physiologically acceptable medium. NSC may be provided prior to differentiation, i.e. they may be provided in an undifferentiated state and allowed to differentiate in vivo. They may be provided alone or with a suitable substrate or matrix, e.g. to support their growth and / or organization in the tissue to which they are being transplanted. Usually, at least 1x105cells will be administered, preferably 1x106or more. The cells may be introduced to the subject via any of the following routes: parenteral, intravenous, intracranial, intraspinal, intraocular, or into spinal fluid. The cells may be introduced by injection, catheter, or the like. Examples of methods for local delivery, that is, delivery to the site of injury, include, e.g. through an Ommaya reservoir, e.g. for intrathecal delivery (see e.g. US Patent Nos. 5,222,982 and 5385582, incorporated herein by reference); by bolus injection, e.g. by a syringe, e.g. intravitreally or intracranially; by continuous infusion, e.g. by cannulation, e.g. with convection (see e.g. US Application No. 20070254842, incorporated here by reference); or by implanting a device upon which the cells have been reversibly affixed (see e.g. US Application Nos. 20080081064 and 20090196903, incorporated herein by reference).
[0082] The number of administrations of treatment to a subject may vary. Introducing the NSCs into the subject may be a one-time event; but in certain situations, such treatment may elicit improvement for a limited period of time and require an on-going series of repeated treatments. In other situations, multiple administrations of the NSCs may be required before an effect is observed. The exact protocols depend upon the disease or condition, the stage of the disease and parameters of the individual subject being treated.
[0083] For some central nervous system conditions, it may be necessary to formulate the composition comprising the NSCs isolated using the methods disclosed herein to cross the blood brain barrier (BBB). One strategy for drug delivery through the blood brain barrier (BBB) entails disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically by the use of vasoactive substances such as bradykinin. A BBB disrupting agent can be coadministered with the therapeutic compositions of the invention when the compositions are administered by intravascular injection. Alternatively, delivery of a composition behind the BBB may be by local delivery, for example by intrathecal delivery, e.g. through an Ommaya reservoir (see e.g. US Patent Nos. 5,222,982 and 5,385,582, incorporated herein by reference); by bolus injection, e.g. by a syringe, e.g. intravitreally or intracranially; by continuous infusion, e.g. by cannulation, e.g. with convection (see e.g. US Application No. 20070254842, incorporated here by reference); or by implanting a device upon which the NR pharmaceutical composition has been reversibly affixed (see e.g. US Application Nos. 20080081064 and 20090196903, incorporated herein by reference).
[0084] The calculation of the effective amount or effective dose of the composition comprising the NSCs isolated using the methods disclosed herein to be administered is within the skill of one of ordinary skill in the art, and will be routine to those persons skilled in the art. Needless to say,the final amount to be administered will be dependent upon the route of administration and upon the nature of the disorder or condition that is to be treated.
[0085] The effective amount of a therapeutic composition to be given to a particular patient will depend on a variety of factors, several of which will differ from patient to patient. A competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to halt or reverse the progression the disease condition as required. Utilizing LD50 animal data, and other information available for the agent, a clinician can determine the maximum safe dose for an individual, depending on the route of administration. For instance, an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered. Similarly, compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration. Utilizing ordinary skill, the competent clinician will be able to optimize the dosage of a particular therapeutic in the course of routine clinical trials.
[0086] In some embodiments a kit may be provided, e.g. comprising a unit dose of activated NSC or a therapeutic formulation of an agent that inhibits the glucose metabolic pathway, in a dose effective to increase activation of the NSC. The kit may comprise suitable buffers, excipients, etc. Cell culture components may be provided, e.g. flasks, medium, etc.EXPERIMENTALIn vitro and in vivo CRISPR-Cas9 screens reveal regulators of aging in neural stem cells of the brain
[0087] Aging impairs the ability of neural stem cells to transition from quiescence to activation (proliferation) in the adult mammalian brain. Neural stem cell (NSC) functional decline results in decreased production of new neurons and defective regeneration upon injury during aging, and this is exacerbated in Alzheimer’s disease. Many genes are upregulated with age in NSCs, and the knockout of some of these boosts old NSC activation and rejuvenates aspects of old brain function. But systematic functional testing of genes in old NSCs - and more generally in old cells - has not been done. This has been a major limiting factor in identifying the most promising rejuvenation interventions.
[0088] Here we develop in vitro and in vivo high-throughput CRISPR-Cas9 screening platforms to systematically uncover gene knockouts that boost NSC activation in old mice. Our genomewide screening pipeline in primary cultures of young and old NSCs identifies over 300 gene knockouts that specifically restore old NSC activation. Interestingly, the top gene knockouts are involved in glucose import, cilium organization, and ribonucleoprotein structures. To determine which gene knockouts have a rejuvenating effect for the aging brain, we establish a scalable CRISPR-Cas9 screening platform in vivo in old mice. Of the 50 gene knockouts we tested in vivo,24 boost old NSC activation and production of new neurons in old brains. Notably, the knockout of Slc2a4, which encodes for the GLUT4 glucose transporter, is a top intervention that boosts old NSC function. GLUT4 protein expression increases in the stem cell niche during aging, and old NSCs indeed uptake ~2-fold more glucose than their young counterparts. Transient glucose starvation increases the ability of old NSCs to activate, which is not further improved by knockout of S / c2a4 / GLUT4. Together, these results indicate that an increase in glucose uptake contributes to the decline in NSC activation with age, but that it can be reversed by genetic or external interventions. Importantly, our work provides scalable platforms to systematically identify genetic interventions that boost old NSC function, including in vivo in old brains, with important implications for regenerative and cognitive decline during aging.
[0089] The adult mammalian brain contains several neural stem cell (NSC) regions that give rise to newborn neurons and can repair tissue damaged by stroke or brain injuries. The most active NSC niche is located in the subventricular zone (SVZ) lining the lateral ventricles of the brain. NSCs from the SVZ region can generate thousands of newborn neurons each day in a young adult mouse. The SVZ region comprises a pool of quiescent NSCs that can give rise to activated (proliferating) NSCs, which in turn generate more committed progenitors that migrate out of the niche toward the olfactory bulb, where they differentiate into neurons. The ability of NSCs to activate and form newborn neurons is severely impaired in the aging brain, and this can contribute to deficits in sensory and cognitive function.
[0090] Identifying genes that impact NSC activation can lead to interventions that counter brain defects during aging. Several genetic interventions have been found to improve old NSC activation, including signaling pathways and transcriptional regulators. However, such studies have been limited in their throughput as they focused on one or a few genes at a time. Thus, we are still missing a systematic understanding of the genes and pathways that functionally affect old NSCs.
[0091] More generally, a major challenge in identifying genetic interventions that improve old cells is the establishment of scalable genetic screens in mammals. Aging occurs at both the cell and organismal level, and it is therefore important to develop screens in vitro in cells from old organisms and in vivo in old tissues. CRISPR-Cas9 genome-wide screens have been developed for a number of phenotypes in vitro, including with stem cell models of Werner and Hutchinson- Gilford progeria syndrome. However, genetic screens for regulators of aging in normal old cells have not yet been performed. In addition, in vivo genetic screens are challenging in mammals and have been so far limited to development, young brains, or cancer. Thus, developing CRISPR- Cas9 screening platforms for old mammalian cells and organisms has the potential to identify previously unknown gene manipulations that could restore tissue function in older individuals. Inthe brain, such screens could help identify strategies to counter regenerative and cognitive decline with aging.Results
[0092] CRISPR-Cas9 screen to boost old NSCs. To systematically identify genes that boost activation of NSCs as a function of age, we developed a genetic screening platform to conduct genome-wide CRISPR-Cas9 knockout screens in primary NSC cultures from young and old mice (Fig. 1 a) (see Fig. 2 for counterpart in vivo targeted screens). Primary NSC cultures can transition between quiescence (qNSC) and activated (aNSC) states in culture when exposed to different growth factors. Primary qNSC cultures from old mice exhibit decreased ability to activate compared to their young counterparts, recapitulating an in vivo aging phenotype. To establish a screening platform, we aged cohorts of mice that express Cas9 (and EGFP) in all cells - hereafter termed ‘Cas9 mice’ (see Methods). For each independent screen (three total), we harvested NSCs from the subventricular zone (SVZ) of six young (3-4 months) and six old (18-21 months) Cas9 mice. As expected, primary qNSC cultures from old Cas9 mice displayed an impeded ability to activate compared to young counterparts (~2-fold decline, based on proliferation marker Ki67) (Fig. 1 b,c).
[0093] We performed three independent genome-wide CRISPR-Cas9 screens for genes that impact qNSC activation as a function of age. To this end, we expanded NSCs from young and old Cas9 mice, induced quiescence, and then transduced over 400 million qNSCs with lentiviruses that express a single guide RNA (sgRNA) library targeting all -23,000 protein coding genes in the genome, with 10 unique sgRNAs per gene, as well as 15,000 control sgRNAs (-245,000 sgRNAs total) (Fig. 1 a). Five days after sgRNA library transduction, qNSCs were activated with growth factors and expanded for either 4 or 14 days and processed as independent samples for sequencing (Fig. 1 a). The day 4 time point was chosen to isolate any cell that successfully activated by fluorescence-activated cell sorting (FACS) based on the proliferation marker Ki67. The day 14 timepoint allowed for more robust enrichment of cells with knockouts that maintained self-renewal capabilities over long periods of time, outgrew other cells, and therefore did not require FACS isolation. After 4 or 14 days, we generated libraries of sgRNAs from all cells and processed them for high-throughput sequencing. The sgRNA libraries had sufficient coverage of the sgRNA pool for genome-wide screen analysis (FIG. 6a-c).
[0094] To analyze each screen sample, we assessed sgRNA enrichment / depletion by CasTLE analysis, which uses the sequencing read counts of the 10 sgRNAs targeting each gene and compares to the control sgRNA distributions to compute effect size, gene score, confidence interval, and P-value. The results of each screen were correlated with each other (though Young Day 14 was a slight outlier for screen 1 ) (FIG. 6d-f). Interestingly, principal component analysis (PCA) on CasTLE gene score values separated our three independent screens based on the ageof NSCs (Fig. 1 d and FIG. 6h), highlighting aging as a primary contributor to the screen’s outcome. We independently verified that a sub-screen of the top 10 gene knockouts that improved old NSC activation in screens 1 and 2 could boost, as a pool, old NSC activation to -70% of young NSC activation levels (Fig. 1 e).
[0095] We then directly compared young and old NSC screens to identify the gene knockouts that boost NSC activation specifically in young NSCs, specifically in old NSCs, or regardless of age (Fig. 1 f-i, FIG. 6j , k) . Overall, our genome-wide screens identified 654 and 1 ,386 genes whose knockouts boosted or impeded NSC activation respectively (FDR<0.1 in 2 or more independent screens). As expected, gene knockouts that impeded NSC activation overlapped with essential genes (FIG. 6l,m). We found 143 gene knockouts that enhanced both young and old NSC activation, 210 specific to young NSC activation, and 301 specific to old NSC activation (Fig. 1 i). We individually validated the top 10 gene knockouts that ameliorated old NSC activation in screens 1 and 2. We verified individual knockout efficiency at the genomic level (FIG. 6n, FIG. 11 h,i) and at the protein level for one of them (FIG. 11j-m). Importantly, 10 out of these 10 individual gene knockouts indeed boosted old NSC activation as assessed by Ki67+FACS analysis (Fig. 1j).
[0096] Consistent with previous findings, genes implicated in the maintenance of NSC quiescence (e.g. Snail, Smad4 (TGFB pathway), and Lrigl) as well as general cell cycle regulators (e.g. Trp53, Cdkn2a) were enriched as knockouts that increase both young and old NSC activation (Fig. 1 h,i).
[0097] Surprisingly, a large fraction of gene knockouts increased activation only in young or only in old NSCs, suggesting some NSC quiescence regulators change as a function of age. Some of the young-specific gene knockouts were previously known to regulate NSC activation, such as CREBBP. By contrast, many of the old-specific gene knockouts had not been previously implicated in NSC activation, such as the genes encoding Sptlc2, Rsph3a, Pxdcl and the glucose transporters Slc2a4 (GLUT4) and Slc2a 12 (GLUT12) (Fig. 1 f-i and FIG. 7a-c).
[0098] GO term analysis of gene knockouts that specifically boost old NSC activation revealed cilium organization, cytoplasmic ribonucleoprotein structures (P bodies, RNA binding proteins), and glucose transport (Fig. 1 m. See FIG. 7d-g for genes that impede NSC activation). Primary cilia are linked to the quiescent state of NSCs and knockout of primary cilia genes in young NSCs leads to decreased proliferation and maintenance in mice, but their role in aging NSCs is not known. The cytoplasmic ribonucleoprotein structures GO term is interesting with regard to the cytoplasmic protein aggregate structures that are observed in aging quiescent NSCs. Glucose metabolism signatures have been linked to the quiescent state of NSCs and regulation of glucose metabolism has been shown to impact young NSC self-renewal, survival, and differentiation to neurons. However, the key step of glucose transport has not been previously implicated in NSC function during aging. More generally, the role of glucose metabolism in old NSCs is not known.Together, these results provide an exhaustive dataset with gene knockouts that restore the transition from quiescence to activation, a key aspect of neural stem cell aging, and it includes many previously unknown genes and pathways.
[0099] CRISPR-Cas9 screens in old brains. Primary cultures from old mice recapitulate several aspects of in vivo aging but not all, and there are no current methods to rapidly screen multiple genes for functional impact on aging cells in vivo. To test if gene knockouts could also boost NSC function in vivo, we developed a gene knockout screening platform for the aging brain. The SVZ neurogenic region provides a good paradigm for in vivo screening. Quiescent NSCs of the SVZ normally activate and produce progeny in this niche, which then migrate out of the niche to generate new neurons at a distal location in the olfactory bulb. We leveraged the natural properties of this regenerative region to design a CRISPR-Cas9 screening platform in old mice. We performed stereotaxic brain surgery in old Cas9 mice to inject sgRNA- and mCherry- expressing lentiviruses directly into the lateral ventricles, in close proximity to NSCs from the SVZ neurogenic niche (Fig. 2a). We verified that injection led to infection of NSCs in the niche by mCherry immunofluorescence and staining for markers of quiescent NSCs (GFAP+Ki67 j and activated NSCs (GFAP+Ki67+) (Fig. 2b and FIG. 8a). After 5 weeks to allow time for both knockout to occur and NSC progeny to migrate to the olfactory bulb, we collected the entire olfactory bulb for genomic sequencing of sgRNAs (Fig. 2a, see Fig. 3 and FIG. 10 for analysis of brain sections by immunostaining). We verified that mCherry-positive cells (cells infected by the virus) were indeed found in the olfactory bulb after 5 weeks (FIG. 8b). We validated that injecting sgRNAs targeting EGFP in the SVZ niche of old Cas9 mice (which also express an EGFP reporter) led to decreased EGFP staining in the olfactory bulb after 5 weeks (FIG. 8c, d). Importantly, we also confirmed that sgRNAs targeting a specific gene (Slc2a4 (GLUT4)) led to decreased GLUT4 staining both in the SVZ and olfactory bulb after 5 weeks (Fig. 3a-d). Thus, stereotactic injection of lentiviruses with sgRNAs in lateral ventricle in vivo leads to efficient gene knockout in the SVZ niche and, after 5 weeks, results in lentivirus-infected cells with knockout in the olfactory bulb.
[0100] We verified coverage and diversity of sgRNAs in vivo by injecting old Cas9 mice with lentivirus expressing 50 sgRNAs targeting the top 10 genes (‘Top 10’ library) that specifically boosted old NSC activation from our first two in vitro screens (each gene targeted by 5 unique sgRNAs), and 100 negative control sgRNAs targeting unannotated regions of the genome (150 sgRNAs total). One day after injection, we extracted and sequenced genomic DNA from the SVZ niche and 3 distant brain regions: the olfactory bulb (where NSC progeny eventually migrate) as well as the outer cortex and the cerebellum as negative controls (regions where NSC progeny do not migrate) (Fig. 2c). At the day one time point, 150 sgRNAs were detected in the SVZ niche and only a fraction of sgRNAs at 100-1000 fold fewer sequencing reads were detected in the olfactory bulb, cerebellum, and outer cortex at this early time point (Fig. 2c and FIG. 9a). Five weeks after injection (in a different old Cas9 mouse), we also collected the same brain regions(Fig. 2d). At the week five time point, 150 sgRNAs were again detected in the SVZ niche, but now the majority were also detected in the olfactory bulb, suggesting NSCs containing sgRNAs had migrated out of the SVZ niche and allowed distal neurogenesis in the olfactory bulb (Fig. 2d and FIG. 9b). The 50 sgRNAs targeting the Top 10 gene pool were strongly enriched over the 100 control sgRNAs in the olfactory bulb, and to a lesser extent in the SVZ niche (Fig. 2c, d). The sgRNA abundance in the olfactory bulb (OB) is unlikely to be explained by expansion of cells infected in the olfactory bulb itself given the lack of sgRNA diversity in the olfactory bulb at one day post-infection (Fig. 2c and FIG. 9a). Importantly, we also did not observe Top 10 sgRNA pool enrichment over control in the cerebellum or cortex (negative control regions, Fig. 2d) or in wildtype mice that do not express Cas9 (FIG. 9c). Hence, our in vivo platform leverages the natural properties of the NSC niche and the production of neurons in a distal region, which allows efficient targeted CRISPR-Cas9 screening in vivo.
[0101] Using this platform, we performed 3 independent targeted screens in old Cas9 mice, each assessing 5 libraries of 10 genes for their ability to boost NSC activation and migration to the olfactory bulb. In addition to the Top 10 gene library, we selected 4 other sets of 10 genes based on our genome-wide screens in cultured NSCs. The 5 libraries were: i) ‘Top 10’ library, with genes that when knocked-out boosted old NSC activation in our in vitro screens (screens 1 and 2) (e.g. Rsph3a), ii) ‘Glucose uptake / human disease' library, with genes that when knocked- out also boosted activation of old NSCs in our in vitro screens (e.g. Slc2a4 (GLUT4), Slc2a12 (GLUT12), Sorll), iii) ‘Cytoplasmic ribonucleoprotein structures’ library, with genes that belong to the P bodies and cytoplasmic ribonucleoprotein / stress granule GO terms, some of which boosted old NSC activation in our in vitro screen (e.g. Dis3l2, Mbnll, Edc3), iv) ‘Depleted (Young / Old)’ library, with genes that when knocked-out blocked young or old NSC activation in our in vitro screens (screens 1 and 2), and v) ‘Published NSC regulators’ library, with genes that have previously been implicated in NSC function in the literature (Fig. 2e). We injected old Cas9 mice with virus to express one of the 5 libraries along with the 100 control sgRNA library, waited five weeks, and then sequenced sgRNAs in the olfactory bulbs and performed CasTLE analysis (Fig. 2e). Of the 50 gene knockouts tested, we identified 24 gene knockouts that were significantly enriched in the olfactory bulb in one of the in vivo screens, with 7 higher-confidence knockouts significantly enriched in at least 2 out of 3 screens. These data suggest that these knockouts boost old NSC activation (and / or migration and differentiation) (e.g., Rsph3a, Sorll, Slc2a4) (Fig. 2e,f, FIG. 9d,e,g, see Fig. 3 for independent validation of Slc2a4). Of the 10 gene knockouts predicted to impede NSCs activation, the 4 predicted to specifically block old NSC activation were slightly depleted in the olfactory bulb but did not reach significance (Fig. 2e,g and FIG. 9f). The lack of sensitivity in detecting gene knockouts that are depleted in the olfactory bulb may be due to the low levels of neurogenesis in old mice, and indeed significant depletion of some of these gene knockouts could be observed in young mice (FIG. 9h). Of the 9 published NSC regulatorsthat had a significant effect in in vivo screens, 3 had the same effect in in vitro screens (FIG. 9i), suggesting that in vivo screens can identify some genes that are missed in vitro - perhaps due to differences in cell cycle status as well as cell-cell or cell-matrix interactions. Interestingly, of the activating gene knockouts tested based on our in vitro screens, some of the most abundant and enriched sgRNAs targeted genes associated with cilia (Rsph3a), glucose uptake (Slc2a4, Slc45a4), and Alzheimer’s disease (Sorll) (Fig. 2e). The ‘Glucose uptake / human disease’ library was most strongly enriched, with 9 of the 10 gene knockouts reaching significance in at least one in vivo screen (Fig. 2e). Overall, these data establish a scalable platform to genetically screen in vivo for genes that impact old NSC function and highlight the importance of cilia, glucose metabolism, and ribonucleoprotein structures for aging NSCs.
[0102] Knocking-out GLUT4 boosts neurogenesis. One of the most consistent gene knockouts that boost old NSC function both in vitro and in vivo is Slc2a4 (GLUT4) knockout. GLUT4 is an insulin-dependent glucose transporter. Glucose metabolism has been previously implicated in young NSC self-renewal, survival, and differentiation. But the importance of the key step of glucose import in NSC function is unclear. More generally, the regulation and role of glucose metabolism in old NSCs are not known. We asked if reducing GLUT4 in the SVZ niche is sufficient to boost the ability of NSCs to generate newborn neurons in the olfactory bulb (neurogenesis) in old individuals. To this end, we stereotactically injected sgRNAs targeting Slc2a4 (GLUT4) into the ventricles of old Cas9 mice. As two types of negative controls, we used sgRNAs to unannotated regions of the genome (control) or sgRNAs to Vmn1r107- a gene that was depleted in in vitro screens (see FIG. 7d) and did not have a significant effect in in vivo screens (see Fig. 2e). We verified that sgRNAs targeting Slc2a4 (GLUT4) successfully reduced GLUT4 staining in the subventricular zone (SVZ) (Fig. 3a, c) and olfactory bulb (OB) (Fig. 3b, d), five weeks after injection of lentivirus in the SVZ NSC niche. To track newborn cells arriving in the olfactory bulb, we injected mice weekly starting 7 days post virus injection with EdU (5-ethynyl-2’-deoxyuridine), a thymidine analog that incorporates into newly synthesized DNA and can be visualized by immunofluorescent assays (Fig. 3e-g, FIG. 10b-d). We first quantified the number of newborn cells in the olfactory bulb five weeks after virus injection by co-staining for EdU (newborn cells) and mCherry (sgRNA lentivirus reporter) (FIG. 10b-d). Slc2a4 (GLUT4) knockout resulted in over 2-fold increase in the proportion of newborn cells that were mCherry+relative to control treatment in the olfactory bulb (FIG. 10b-d). We then assessed how well cells with GLUT4 knockout differentiated into neurons by staining for neuronal markers (Tuj1 and NeuN). The vast majority of cells targeted by the Slc2a4 (GLUT4) sgRNA (mCherry+) were positive for the neuronal nuclei marker (NeuN) in the olfactory bulb (Fig. 3e-g, FIG. 10e,f). Importantly, Slc2a4 (GLUT4) knockout in the SVZ resulted in a significant increase in the number of newborn neurons (NeuN+EdU+cells) in the olfactory bulb (Fig. 3g). Cells with Slc2a4 (GLUT4) knockout were also positive for another neuronal marker Tuj1 (and a few cells were positive for the mature neuron marker Calretinin)(FIG. 10g-i). In contrast, cells with Slc2a4 (GLUT4) knockout did not co-stain with markers of neuroblasts (Dex), astrocytes (GFAP), or oligodendrocytes (Olig2, Sox10) in the olfactory bulb (FIG. 10j). These results suggest that Slc2a4 (GLUT4) knockout in the SVZ niche improves neurogenesis.
[0103] We next tested whether the enhanced neurogenesis observed in Slc2a4 (GLUT4) knockout was accompanied by increased NSC number in the SVZ niche. By performing immunofluorescence with markers of NSCs in the niche, we found that Slc2a4 (GLUT4) knockout led to an increased number of quiescent NSCs (GFAP+S100a6+Ki67 ), activated NSCs (GFAP+S100a6+Ki67+), and neuroblasts (GFAP Ki67+) (Fig. 3h,i). The higher number of quiescent NSCs in Slc2a4 (GLUT4) knockout brains could be due to enhanced self-renewal or return to quiescence following activation. There was no NSC exhaustion in the niche upon Slc2a4 knockout at least at this 5 week time point. Collectively, these observations are consistent with the notion that the increased neurogenesis upon Slc2a4 (GLUT4) knockout is due to an increase in NSC activation in vivo.
[0104] Given the beneficial effect of GLUT4 knockout in old NSCs in vivo, we asked whether GLUT4 protein expression itself changes in the SVZ neurogenic niche with age. We performed immunofluorescence staining of GLUT4 in SVZ sections from young and old mice followed by quantification using an automated pipeline (see Methods). These experiments revealed that GLUT4 protein increased in astrocytes / quiescent NSCs (GFAP+Ki67 ) (and in activated NSCs / NPCs (GFAP+Ki67+)) in the old brain (Fig. 3j,k and FIG. 10k). Immunofluorescence staining and quantification using S100a6, a marker that is relatively specific to NSCs, corroborated the increase in GLUT4 in old NSCs (FIG. 10m, n). In contrast, GLUT4 protein expression did not change with age in other cell types (ependymal, microglia; GFAP Ki67 ) (Fig. 3j,k and FIG. 10k). Analysis of single cell RNA-seq data confirmed that Slc2a4 (GLUT4) transcript increased with age in quiescent NSCs / astrocytes, but not in other cell types (FIG. 101), which may underlie the changes in GLUT4 protein with age. Thus, the glucose transporter GLUT4 increases in expression during aging in NSCs in vivo, and knockout of this transporter boosts NSC number and neurogenesis in old mice. These data suggest that the increase in GLUT4 could be detrimental for NSC function and neurogenesis in old brains.
[0105] Old NSCs exhibit high glucose uptake. GLUT4 ISIc2a4 is a transporter that increases glucose uptake in an insulin-dependent manner in cells (Fig. 4a). We therefore assessed components of the glucose uptake pathway (insulin-dependent or independent) in the context of NSC aging by mining our genome-wide in vitro screen results. Among the 12 known glucose transporters in mice, only Slc2a4 (GLUT4) and Slc2a12 (GLUT12), when knocked out, significantly boosted old NSC activation in vitro (Fig. 4a, b). In vivo, Slc2a4 (GLUT4) knockout (but not Scl2a12 (GLUT12) knockout) boosted neurogenesis in old mice (see Fig. 2, 3). Consistently, using our single cell RNA-seq data, we found that among the 12 glucosetransporters, only Slc2a4 (GLUT4) was significantly upregulated in quiescent NSCs during aging (FIG. 11 a). Immunofluorescence staining of GLUT4 in NSC cultures from young and old mice, followed by automated quantification, showed that GLUT4 protein levels increased in old quiescent NSCs (Fig. 4c, d), consistent with our in vivo observations (Fig. 3j,k). In activated NSCs, age-dependent GLUT4 protein levels were not consistent in vitro and in vivo, perhaps due to cell cycle heterogeneity or cell-cell, or cell-matrix interactions (Fig. 3j,k, Fig. 4c, d). These data highlight GLUT4, among other glucose transporters, as an important regulator of quiescent NSC function during aging.
[0106] Within the glucose uptake pathway, knockout of Stx4a, which encodes a protein that facilitates the fusion of GLUT4 storage vesicles with the plasma membrane (among other functions), boosted old NSC activation in one of the screens (Fig. 4b). Immunofluorescence staining, followed by unbiased quantification, indicated that STX4A protein was also increased in old quiescent NSCs in vitro and in vivo (Fig. 4e, FIG. 1 1 b-d). By contrast, proteins in the glycolysis, insulin and associated downstream pathways (e.g. hexokinase enzymes HK1 -3, mTOR, GSK3B and FOXO) were not enriched in the genome-wide screens in old NSCs, and some insulin pathway genes were even depleted (Fig. 4a, b). Collectively, these observations suggest that glucose transporter activity is a key step in regulating old NSC activation.
[0107] We next asked if glucose uptake changes with age in NSCs. Using two independent glucose uptake assays, we found that old quiescent and activated NSCs in culture uptake ~2- fold more glucose than their young counterparts (Fig. 4f [colorimetric glucose uptake assay] and FIG. 1 1 f [FACS-based glucose uptake assay]). This increase in glucose uptake in old quiescent NSCs is in line with the age-dependent increase in GLUT4 protein levels observed by immunofluorescence staining both in vitro and in vivo, and in the rest of our study we therefore focused on quiescent NSCs.
[0108] To determine whether the age-dependent increase in glucose uptake affects downstream metabolic pathways in quiescent NSCs, we measured extracellular acidification rate (ECAR), which mostly reflects glycolysis, as well as oxygen consumption rate (OCR), which reflects mitochondrial respiration. Old quiescent NSCs had a significantly higher ECAR and lower OCR compared to young counterparts (Fig. 4g), suggesting that old quiescent NSCs have higher glycolysis and decreased respiration. Moreover, we observed that a gene signature for fatty acid oxidation (FAO), which is normally high in young quiescent NSCs, decreases with age (FIG. 1 1g). Thus, old quiescent NSCs may increase their usage of glucose (compared to other sources) for energy metabolism. Slc2a4 (GLUT4) knockout significantly decreased both ECAR and OCR in young qNSCs (Fig. 4g). By contrast, Slc2a4 (GLUT4) knockout decreased only ECAR (and not OCR) in old quiescent NSCs (Fig. 4g). These results raise the possibility that GLUT4 knockout boosts old NSC activation in part by reducing glycolysis.
[0109] We then determined if restricting glucose uptake, either genetically or by depleting glucose in the media, benefits the activation of old NSCs. We verified that the individual Slc2a4 (GLUT4) knockout was efficient in qNSCs both at the genomic and protein level (FIG. 1 1 h-m) and that it significantly reduced glucose uptake compared to control in old quiescent NSCs (Fig. 4h). We then tested the effect of Slc2a4 (GLUT4) on the ability of quiescent NSCs to activate. In line with our screen results, individual Slc2a4 (GLUT4) knockout improved the ability of old quiescent NSCs to transition from quiescence to activation (Fig. 4i, FIG. 11 n). Interestingly, a brief 48-hour pulse of glucose starvation in quiescent NSCs improved their ability to activate out of quiescence (Fig. 4i and FIG. 11 n). GLUT4 knockout did not further increase old qNSC activation in the context of a pulse of glucose starvation (Fig. 4i and FIG. 11 n), suggesting that one mechanism by which GLUT4 reduction improves old NSC activation is by lowering glucose. Consistently, treatment with 2-Deoxy-D-glucose (2-DG) - a glucose analog that cannot undergo glycolysis - boosted old (but not young) qNSC activation out of quiescence (FIG. 1 1 o). Hence, old quiescent NSCs are in a state of high glucose uptake likely due to increased GLUT4 expression during aging, but this can be reversed through genetic or glucose restriction perturbations to ameliorate old qNSC activation. These results highlight the use of genetic screens in old cells to uncover genetic pathways (e.g. glucose metabolism, primary cilia, ribonucleoprotein structures) and interventions to boost NSC function during aging (Fig. 4j).
[0110] This study is the first genome-wide knockout screen to identify genes that impact aging in a regenerative neurogenic niche. It also shows the development of a new CRISPR-Cas9 targeted screening platform to study functional regulators of cellular aging in vivo. The power of knockout screens is their ability to uncover new biology. Here we identify over 300 genes that when knocked out in the context of genome-wide screen boost the activation of old NSCs in vitro, and 10 out of 10 of the top genes individually validate. The genes uncovered by the screen include glucose metabolism, ribonucleoprotein structures, and primary cilia associated genes as well as many other genes. These candidates can contribute to the mechanisms allowing NSCs to transition out of quiescence into activation - a step that is defective in aging. Most of these genes had not previously been identified to regulate NSCs, especially in old cells, and they represent a resource for functional regulators of NSC aging and rejuvenation. Given the spatial heterogeneity of NSCs in the SVZ niche, assessing how gene knockouts affect NSCs in a spatially-restricted manner could reveal interactions between genetic factors and spatial location.
[0111] The knockout of insulin-sensitive glucose transporter GLUT4 was consistently a top hit for both in vitro and in vivo screens, leading to a relative 2-fold increase in neurogenesis in old mice in vivo. Old quiescent NSCs exhibit an increase in glucose uptake, with 2 times more glucose uptake than their young counterparts. Reversing this increase, either genetically or by glucose starvation, boosted the ability of old NSCs to activate. In contrast to GLUT4, manipulatingother glucose transporters did not have a strong effect on NSC activation. The importance of GLUT4, among other glucose transporters, in regulating NSC aging could be due to the increase in Scl2a4 (GLUT4) with age or the fact that GLUT4 is an insulin-dependent glucose transporter. Changes in other substrates that quiescent NSCs could use (e.g. fatty acids) with aging is also of interest. Other stem cells, including hematopoietic stem cells and muscle stem cells, display greater glucose usage and higher levels of glycolysis with age in mice and humans. These observations suggest that increased glucose in cells may be a general feature of stem cell aging. This is interesting in light of the fact that glucose restriction extends lifespan in yeast and worms, whereas high glucose shortens worm lifespan. The way in which increased glucose impedes NSC could involve metabolic regulation downstream of glycolysis, for example mitochondrial metabolism or other metabolic pathways and processes that use glucose. Importantly, dysregulated insulin-glucose signaling has also been linked to neuronal dysfunction and human brain aging and Alzheimer’s disease. Thus, our discovery that the increased glucose uptake in old cells can be targeted with GLUT4 knockout or glucose restriction demonstrates that such mechanism could be targeted more broadly to counter aging.
[0112] Systemic gene therapy interventions can rejuvenate aspects of aging in progeria or even physiologically old mice. A major challenge has been to rapidly identify new genetic interventions to counter aging in vivo. Our establishment of an in vivo screening platform shows a relatively high-throughput and rapid method of testing genetic interventions in the context of a regenerative stem cell niche in vivo. This type of screen is scalable, versatile to use with other CRISPR-Cas9 techniques (e.g. gene activation / inhibition), and applicable to other cell types (e.g. other stem cells) in old mice. Genetic interventions that impact old tissues have the potential to identify new strategies - genetic or environmental - to delay or reverse features of aging. In the brain, such interventions can be particularly important to counter cognitive and regenerative decline during aging and neurodegenerative diseases.Example 2
[0113] For testing the ability of small molecules to boost NSC activation, we performed qNSC reactivation experiments in 24-well format. We seeded 2x105cells in 24 well, after 4 days in quiescence media (with qNSC media changes every 2 days), compounds were then added to the media for a 48-hour treatment, with one exchange at the 24-hour time point. After 48-hour treatment, the cells were washed 1 x in PBS and then transitioned to aNSC media for activation. aNSC media was exchanged once after 48 hours and then Ki67 intracellular FACS was performed at day 4 post treatment to assess NSC activation efficiency. The relative boost to activation efficiency was calculated by dividing the percent activation in treatment versus buffer only control. FIG. 5 is a dot plot showing mean + / - SEM of the percentage of cells expressing Ki67, normalized to the control for each independent experiment. Each dot represents anindependent primary culture of NSCs derived from a pool of 4 young (2-3 months old) or old (18- 20 months old) mice (50:50 mix of male and female). P-value determined by two-tailed Mann- Whitney test.
[0114] 2DG, imatinib, oxythiamine chloride and bromopyruvic acid were found to significantly enhance the activation of aged neural stem cells.Methods
[0115] Laboratory animals. Cas9-expressing mice (Cas9 mice) were obtained from Jax. These mice (background C57BL / 6N) constitutively express the Cas9 endonuclease and an EGFP reporter under the control of a CAG promoter knocked into the Rosa26 locus. All screens in this study were performed with the Cas9 mice, including all NSC primary cultures and all in vivo work. We maintained a colony of Cas9 mice ranging in ages up to 28 months at the Stanford Comparative Medicine Building and the Neuroscience-ChemH building vivarium. As a negative control for the in vivo screens, male C57BL / 6 mice obtained from the National Institute on Aging (NIA) Aged Rodent colony were used at 18-21 months old. NIA mice were habituated in the Stanford facility for at least 2 weeks prior to initiation of experiments. Mice were maintained under the care of the Veterinary Service Center at Stanford University under IACUC protocols 8661 .
[0116] Primary cultures of NSCs from young and old brains and activation experiments. For all experiments involving primary culture of NSCs, we pooled subventricular zones (SVZs) from pairs of male and female Cas9 mice, either 3-4 month-old mice (young) or 18-21 month-old mice (old). To generate primary cultures of NSCs from young and old mice, we micro-dissected SVZs into a small drop of PIPES buffer (pH 7.4), minced them in a 10 cm tissue culture dish with -100 chops of a scalpel blade, and suspended the tissue in PIPES buffer prior to centrifugation for 5 min at 300g, at which point the excess PIPES buffer was poured out. The pellet of minced SVZs was then enzymatically dissociated (in 5 mL per 2 SVZs) with a mixture of HBSS (Corning, 21 - 021 -CVR) with 1% penicillin-streptomycin-glutamine (Gibco, 10378-016), 1 U / mL Dispase II (STEMCELL Technologies, 07913), 2.5 U / mL Papain (Worthington Biochemical, LS003126), and 250 U / mL DNAse I (D4527, Sigma-Aldrich), vortexed briefly, and incubated at 37°C for 40 min on a rotator. The samples were then centrifuged at 300g for 5 min at room temperature and resuspended in NeuroBasal-A medium (Gibco, 10888-022) with 1 % penicillin-streptomycin- glutamine (Gibco, 10378-016) and 2% B27 minus vitamin A (Gibco, 12587-010) and triturated -20 times, centrifuged and resuspended in complete 'aNSC media’ Neurobasal-A (Gibco, 10888- 022) supplemented with 2% B27 minus vitamin A (Gibco, 12587-010), 1 % penicillinstreptomycin— glutamine (Gibco, 10378-016), 20 ng / mL of EGF (Peprotech, AF-100-15), and 20 ng / mL of bFGF (Peprotech, 100-18B), placed in a humidified incubator, 37°C, 5% CO2. After 3-4 days, neurospheres emerged in the media and were passaged by dissociation with 1 mL Accutase (STEMCELL Technologies, 07920) for 5 min at 37°C, washed once with PBS, andresuspended in aNSC media. Neurosphere cultures were maintained with passaging every 2-3 days, and all experiments were performed in cultures of less than 10 passages. Details on passage numbers are provided in experimental sections below. For cultures of quiescent NSCs (qNSCs), the aNSC culture media was changed to remove EGF and add BMP4 (50 ng / mL) (Peprotech, 315-27). The Complete ‘qNSC media’ is: Neurobasal-A (Gibco, 10888-022) supplemented with 2% B27 minus vitamin A (Gibco, 12587-010), 1 x penicillin-streptomycin- glutamine (Gibco, 10378-016), 50 ng / mL of BMP4 (Biolegend, 94073), and 20 ng / mL of bFGF (Peprotech, 100-18B). To induce quiescence, tissue culture plates were pre-treated with PBS (Fisher Scientific, #MT21040cv) containing 50 ng / mL Poly-D-Lysine (Sigma-Aldrich, P6407) for 1 hour, and then washed 3 times with PBS prior to cell plating cells on plates in qNSC media. The density of cells plated is important for induction of quiescence and ability of qNSCs to reactivate, especially in the context of lentiviral infection. In optimizing qNSC activation protocol, we observed that qNSCs seeded at the following densities were best for quiescence / activation experiments: 2x107cells per 15 cm plate, 1 x106cells per well of a 6-well plate, 2x105cells per well of a 24-well plate, and 1 x105cells per well of a 96-well plate. For activation of qNSC cultures, cells were washed once with PBS, and then aNSC media was added to the plate, and refreshed every 2 days. For plating, cells were counted manually with a hemocytometer or using the Countess II FL Automated Cell Counter (Life Technologies, AMQAF1000).
[0117] Tissue culture plastics. \Ne found that primary cultures of NSCs were sensitive to the tissue culture plastic products used. Specifically, passaging NSCs in conical tubes manufactured by Genesee (15 mL conical tubes, Cat#28-103) resulted in death of the NSC cultures within 1 week of brief exposure to the plastic during passaging. Plastics from the following manufacturers were assessed to be suitable for NSC growth both in detached and adherent conditions: Thermo fisher 15 / 50 mL Falcon tubes (14-959-53A / 14-432-22), 15 cm / 10 cm / 6-well / 12-well / 24-well / 96- well Falcon® Tissue Culture Dishes (353025 / 08772E / 08-772-1 B / 08-772-29 / 08-772-1 / 087722c).
[0118] Lentivirus production. Genome-wide virus library preparation: For lentiviral production, human embryonic kidney 293T cells were seeded in DMEM + 10% fetal bovine serum (FBS, Gibco 10099141 ) + 1 x penicillin- streptomycin-glutamine (Gibco, 10378-016) at a density of 2x107cells in 15 cm plates. One day later, 293T media was replaced with 18 mL fresh media and the cells were transfected using the polyethylenimine (PEI) (1 mg / mL, Polysciences #23966-2) transfection method, mixing plasmids as follows: 2.27 pg each of 3rdgeneration lentivirus packaging vectors pMDLg, pRSV, and pVSVG (obtained from Mike Bassik lab), along with 45 pg of the pooled single guide RNA (sgRNA) genome wide plasmid library. The sgRNA library targets all -23,000 protein coding genes in the genome, with 10 unique sgRNAs per gene, as well as 15,000 control sgRNAs (-245,000 sgRNAs total). The sgRNA plasmid library, consisting of 20 sub-libraries, was mixed proportionally to the number of sgRNAs in each library. One day after PEI transfection, the medium was changed to 18 mL of NeuroBasal-A + 1x penicillin-streptomycin-glutamine (Gibco, 10378-016). After one day, the viral containing supernatant was collected on ice and stored at 4°C. Fresh medium was added to the 293T cells and collected again after 24 hours and again at 48 hours (a total of 3 collections of 18 mL of virus supernatant). All three supernatants were combined, filtered through a 0.45 pm filter (Stericup, EMD Millipore, #S2HVU02RE), and frozen at -80°C in 10 mL aliquots in 15 mL conical tubes. For plasmid library reamplifications, we electroporated 1 pL of 25 ng / pL of each library into 50 pL bacteria (Lucigen, 60242-2), with: 1 .8 kV, 600 ohms, 10 pF in 0.1 cm cuvette (Gene Pulser Xcell, Bio Rad, 1652662). After electroporation, we allowed bacteria to recover in Lucigen recovery media for 2 hours in 15 mL conical tube shaking at 37°C. We plated 1 pL of the transformation onto an LB + carbenicillin (100 pg / mL, Sigma-Aldrich, #C9231 -1 G) agar plate to confirm transformation efficiency and the rest of recovery suspension was placed into 0.5 L LB + carbenicillin (100 pg / mL) liquid media in a 2L flask for 16 hr shaking at 37°C, and DNA was purified by Maxiprep (Thermo Fisher Scientific, FERK0492) according to the manufacturer’s protocol.
[0119] sgRNA sub-library design: We designed 5 sub-libraries of sgRNAs to test gene hits from the in vitro screens in the brain in vivo (Fig. 1 and Fig. 2). Our selection criteria were as follows. For the Top10 gene list, we selected all significantly enriched genes (FDR<0.1 ) from the first 2 in vitro genome wide screens, selecting any gene that was significant in both screen 1 and 2, at any time point, day 4 or day 14 (for example, a Screen 1 day 4 hit and an overlapping Screen 2 day 14 hit would be added to the list). With that list, we ranked the genes based on the CasTLE gene score average from both screens and both time points (i.e. average of all: screenl day 4 or day 14, screen 2 day 4 or day 14). This library was selected based on the first 2 in vitro genome-wide screens only, because at the time of library design, only the first 2 in vitro screens had been completed. Similarly, the Depleted gene list was also selected based on the first 2 screens. We selected all significantly depleted genes (FDR<0.1 ) from the first 2 in vitro genome-wide screens, selecting any gene that was significant in both screen 1 and 2, at any time point, day 4 or day 14 (for example, a Screen 1 day 4 hit and an overlapping Screen 2 day 14 hit would be added to the list). With that list, we then removed any gene that was significantly (FDR<0.1 ) depleted in qNSCs of screen 1 or 2 of any age. The final list was then selected by removing unannotated genes (e.g. GM3264, GM3164) and focusing on genes with associated publications. For the Glucose uptake and Human disease list, we selected genes that significantly (FDR<0.1 ) enriched in 2 of 3 in vitro genome-wide screens, at day 4 or day 14 (for example, a Screen 1 day 4 hit and an overlapping Screen 2 day 14 hit would be added to the list). The list of enriched genes was analyzed by GO term analysis (see section “Computational, analysis of CRISPR screens”). From the GO “Molecular Function (2018)” database, “D-glucose transmembrane transporter activity (G0:0055056)” and “sugarproton symporter activity (G0:0005351 )” terms were both in the top 10, with genes Slc2a4, Slc2a12and Slc45a4. The other genes in the Glucose uptake and Human disease list were selected based on one of 2 criteria: (1 ) genes implicated in human disease:Snrpb2 (Alzheimer’s), Sorll (Alzheimer’s disease), C1qtnf5 (Human aging), or (2) genes that are significantly (p<0.05) upregulated in qNSCs in old mice: Slit2, Ier2, Cdknla, Ecscr. For the Cytoplasmic ribonucleoprotein granules library, in the GO term analysis of gene knockouts that boosted old NSC activation, the terms “P-body (G0:0000932)”, “cytoplasmic ribonucleoprotein granule (G0:0036464)”, ribonucleoprotein granule (G0:0035770)”, “cytoplasmic stress granule (G0:0010494)” all came up in the list, although most were not significant. From this, we hypothesized that cytoplasmic granule structures could impede old NSC activation. We took the entire GO term “cytoplasmic ribonucleoprotein granule (G0:0036464)” and selected gene knockouts that had the greatest difference in effect between young and old NSC screens. Many of these genes did not demonstrate any significant effect in our in vitro screens, other than Dis3l2, Edc3 and Mbnll, which all significantly boosted old NSC activation in at least 2 of 3 screens. The final list of genes was the “Published NSC regulators” list, which we chose based on searching the literature for genes that had previously been implicated in regulation of NSC function and behavior. We did not select based on functional effect prediction.
[0120] sgRNA plasmid sub-library cloning for in vivo screens: The sgRNA expressing plasmid MCB320 was digested with the Blpl and BstXI restriction enzymes, the band was gel-extracted and purified, and used for a pooled ligation reaction. We selected 5 sgRNAs from each gene of interest, based on the 5 out of 10 sgRNAs most enriched or depleted in our genome-wide in vitro screen. For the forward oligo of each sgRNA sequence, we added sequences: 5’-ttgg and 3’- gtttaagagc. For the reverse complement oligo of each sgRNA squence, we took the reverse complement of the sgRNA sequence and added 5’-ttagctcttaaac and 3’ -ccaacaag. To clone a pool of 10 genes, we selected the 50 sgRNAs pairs targeting the 10 genes and annealed the sgRNA pairs in separate annealing reactions, in a 100 pL of IDT duplex buffer (#1 1 -05-01 -12) with 1 pM forward and reverse oligos. We incubated the oligo pairs at 95°C for 5 min, and then allowed the oligos to gradually anneal at room temperature. We mixed all 50 annealed oligo pairs into one pool, diluted it 1 :20 in IDT duplex buffer, and then used 1 pL of annealed oligo pool in a ligation reaction with 500 ng of digested MCB320 backbone. We used 1.5 pL of the ligation mix and electroporated 30 pL competent bacteria (Lucigen, 60242-2) with: 1.8 kV, 600 ohms, 10 pF in 0.1 cm cuvette (Gene Pulser Xcell, Bio Rad, 1652662). We plated the entire recovered transformed bacteria on a 10 cm LB + Ampicillin (100 pg / mL, Sigma-Aldrich, #A9518-100G) plate, allowed overnight recovery, and the next day added 5 mL LB to the bacterial lawn and scraped it with a sterile silicon scraper. The resuspended bacterial mix was transferred to a clean collection tube, plate was again rinsed with additional 5 mL LB and transferred to same tube for overnight growth in 500 mL LB + Ampicillin (100 pg / mL) for Maxiprep (Thermo Fisher Scientific, FERK0492) according to manufacturer's protocol. For library reamplification, we performed the same transformation and amplification procedure.
[0121] Concentration of virus for in vivo and in vitro sub-screens: For in vivo and in vitro subscreens, we generated virus the same way as our genome-wide virus libraries, with modifications as follows. We plated four 15 cm plates of 293T cells for a total of 200 mL of collected virus after 3 days of collecting at 4°C, but rather than directly freezing the virus, we performed ultracentrifugation to concentrate the virus. For ultracentrifugation, we sterilized 30 mL ultraclear tubes (Beckman coulter 344058) under UV (TC room biosafety cabinet) for 15 min. We then put the tubes on ice, allowed 15 min to cool, and then added 30 mL of virus and centrifuged at 16,500 RPM for 1 hour at 4°C. We carefully decanted the supernatant using serological pipets, leaving 1 mL media in bottom of tube, adding 30 mL more virus-containing media and centrifuging again. We repeated the decanting, refilling and centrifugation of the same tube, concentrating a total of 180 mL of virus supernatant into a single tube. After the last ultracentrifugation, we removed most of the supernatant with a serological pipet, and the last 1 mL with a P1000 pipet tip from the side of the tilted tube, so as not to disturb the viral pellet. The viral pellet was usually visible in center of all of the tubes. We resuspend in 60 pL ice-cold PBS (1 / 3000thoriginal volume) by pipetting up and down ~60 times, being careful not to produce air bubbles. The concentrated resuspended virus was then aliquoted into PCR strip tubes in 5 pL aliquots and placed onto dry ice. After 15 min, the virus was transferred to -80°C for storage. For experiments, virus was thawed on ice and injected into the brain or added to cell culture within 30 min of thaw. We assessed virus infectivity of each batch by performing serial dilution (3 pL, 1 pL, 0.5 pL) infections of 2x105293T cells in 24-well culture plates for 16 hour infection, and then performing fluorescence-activated cell sorting (FACS) analysis 48-hours later to detect the percent of cells expressing mCherry reporter. For each experiment we normalized virus infectivity (viral titer) across treatments by adjusting the concentrations of virus added in PBS.
[0122] Genome-wide knockout screens in primary cultures of NSCs. For each genome-wide screen, primary cultures of NSCs derived from a pool of 3 male and 3 female Cas9 mice were used for each independent biological replicate. In total, 3 independent genome-wide screens, each performed with independent young and old NSC pooled from 6 mice, were conducted. For each independent screen, young and old NSC cultures were processed in parallel at each stage of sample processing. The young and old NSC culture passage numbers were kept the same and at the start of screen were as follows: Screen 1 , passage 8; Screen 2, passage 7; Screen 3, passage 12. To measure the growth rate between young and old cells at each passage, we counted cells using the Countess 3 cell counter (ThermoFisher, A50298). The young and old cells showed comparable growth rates (FIG. 6c). To expand the NSCs up to the 1.4x109cells (the equivalent of 140 15 cm plates) required for each biological replicate, 1 x107NSCs were passaged and expanded into 15 cm plates every 2-3 days, with feedings every 2 days (alternating between doubling the media (with 2x growth factor aNSC media) or complete media exchange). For each screen, 70 plates of 2x107qNSCs were seeded at day 0 (see below for library coveragecalculations). After 4 days in qNSC media, the cells were incubated with the genome-wide sgRNA lentivirus library (see above). For this, sgRNA lentivirus library was freshly thawed at room temperature and diluted 1 :5 in Neurobasal media and then B27 and growth factors were added to make it qNSC media, and 18 mL of this mix was added to plates for 16-hour overnight infection. The virus dilution added was based on viral titering experiments determined to achieve -30% culture infection of cells to ensure each cell only received a single sgRNA. Therefore, infecting the starting 1 .4x109cells at 30% infection would result in 4.2x108infected cells, giving us a coverage of -1 ,700 cells per sgRNA (-243,000 total sgRNAs). Note that these numbers represent the starting library coverage, but the cells do expand over the course of activation, and therefore the final cell numbers at end of experiment are orders of magnitude larger. The infected cells were then left in qNSC media for an additional 5 days prior to transition to aNSC media for activation. After 4 days of activation, the cells were dissociated using Accutase (Stem Cell Technologies, 07920) for 15-30 min at 37°C (until most cells rounded up) and gently scrapped with silicone cell scrapers (Fisher Scientific, 07-200-364) and split into 2 groups: 55 plates of NSCs were processed for the Day 4 Ki67 FACS sorting (see below), and the other 15 plates of cells were placed into aNSC culture for 10 days of further expansion as neurospheres (Day 14 time point). The day 4 FACS-sorted young and old cells were sorted to have equal numbers of Ki67+cells from both ages for each screen for downstream analysis. See “Intracellular FACS” section below for Day 4 FACS protocol. The final number of sorted cells for each age in each screen was as follows: Screen 1 had 2.2x107sorted Ki67+cells, Screen 2 had 1 .41 x107Ki67+cells, Screen 3 had 1 x108Ki67+cells. After sorting, the methanol fixed cells were centrifuged at 700g for 5 min, the supernatant FACS buffer was decanted, and the cell pellets were frozen at - 80°C until the genomic DNA extraction. To extract genomic DNA of sorted and methanol fixed cells, the cell pellets were defrosted at room temperature and then processed by resuspension in 5 mL of TE 1 % SDS (Thermo Fisher Scientific, 15525017) and incubated at 65°C for 16 hours. The cell suspension was then treated with 50 pL proteinase K (Fisher Scientific, 25-530-049) (20 mg / mL) for 2 hours at 37°C. Samples were processed for genomic DNA extraction using Zymo Research ChIP DNA clean and concentrator (Zymo, D5205) according to manufacturer protocol. The day 14 expanding neurospheres were immediately centrifuged at 300g for 5 min and then processed for genomic DNA extraction with Qiagen QiaAmp DNA Blood Maxi Kit (51194), adding 5x107cells per column and according to the manufacturer’s protocol.
[0123] sgRNA PCR amplification and sequencing. After genomic DNA isolation, sgRNA was amplified from the genome in 2 successive, nested PCR reactions. For the nested PCR reactions, we used either Herculase II Fusion Polymerase (Agilent, 600679) for screen 1 , or Q5 DNA polymerase (Fisher Scientific, M0491 L) for screens 2 and 3, and Q5 DNA polymerase for in vivo screens, according to manufacturer’s protocol. In optimizing this PCR reaction, we found that Herculase II Polymerase was outperformed by Q5 polymerase, Q5 polymerase requiring fewerPCR cycles to get more amplicon product, which is why we switched to Q5 DNA polymerase. We used 5 pg genomic DNA in 50 pL reactions to run on thermocycler. For the first PCR, we used primers MCB1562 (aggcttggatttctataacttcgtatagcatacattatac) and MCB1563 (acatgcatggcggtaatacggttatc) (1 pM final concentration), with PCR cycles as follows: 98°C for 2 min, 19 cycles of [98°C / 30s, 59.1 °C / 30s, 72°C / 45s], followed by 72°C for 3 min. We pooled all the PCR#1 cycle products and then used 5 pL of the pool in a second PCR reaction (PCR#2) with the same conditions but using different primers; MCB1439 (caagcagaagacggcatacgagatgcacaaaaggaaactcaccct) and a barcoded primer (aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXX CGACTCGGTGCCACTTTTTC, where XXXXXX is the 6-digit barcode for high throughput sequencing sample identification). The second PCR reaction was run for either 30 cycles ( / n vitro screen 1 and in vivo screens), or 18 cycles (in vitro screens 2 and 3). The resulting PCR products were all resolved on a 1 .5% DNA agarose gel, the 272bp band was extracted (Qiaquick Gel extractions kit, #28706), eluted in 10 pL ultra-pure water (Invitrogen, 10977023), and assessed on a bioanalyzer (Agilent, Bioanalyzer 2100). Final libraries were combined into a pool at equal concentrations for sequencing on an Illumina Novaseq S4 system (with Novogene, for genome wide in vitro screen) , or on an Illumina MiSeq system (with Stanford Genomics facility, for in vivo screens), sequencing to a depth of ~1 x107or ~5x105reads per sample for in vitro and in vivo screens, respectively.
[0124] Computational analysis of CRISPR-Cas9 screens. For both the in vitro and in vivo screens, our analyses were performed using CasTLE pipeline. Briefly, for each screen, the raw screen fastq files were aligned to the sgRNA library sequence (“mm-Cas9-10”, or one of custom 10 gene library + control sgRNAs) to make count files using the “makeCounts” script. The count files were then analyzed using the “analyzeCounts” CasTLE script, comparing each screen timepoint to the starting plasmid sgRNA library count file (in vitro screens) or the sequenced 24- hour SVZ count file (in vivo screens), which we sequenced in parallel with screen libraries. We then calculated P-values for all genes in each screen by running 100,000 (in vitro screens) or 10,000 (in vivo screens) permutations with the “addPermutations” CasTLE script. For each genome-wide screen, we corrected for multiple hypotheses on the -23,000 gene associated P- values using the Python Statsmodel module, with Benjamini / Hochberg method, and classified genes as significant using an FDR<0.1 cutoff. For the in vivo screens, we classified genes as hits if their CasTLE computed 95% confidence interval did not contain 0. The library diversity of each sample was displayed using the “plotDist” CasTLE script. The screen results and individual gene sgRNA enrichment plots were visualized using the “plotVolcano” and “plotGene” scripts, respectively. We note that in in vivo screens, there was bimodal distribution of control sgRNAs, which is most likely due to the fact that a control sgRNA infected an NSC that was, at the time, highly actively proliferating, and that will naturally enrich in the olfactory bulb.
[0125] Generation of gene lists for the genome-wide screens. To generate the final gene lists for the genome-wide screens, we used all genes that were significant (FDR<0.1 ) in 2 or more independent screens (Screen 1 and 2, 2 and 3, or 1 and 3), at any time point (Day 4 or Day 14. For example- a Screen 1 Day 4 hit and an overlapping Screen 2 Day 14 hit, would be added to the list). For principal component analysis (PCA), we used the Python sklearn. decomposition. PCA module with CasTLE computed gene scores as input (Fig. 1d, Extended Fig. 1 g-i). We performed gene set enrichment analysis by inputting gene lists into the EnrichR online portal, and then focusing on the “Ontologies” tab with GO Biological Process(2018) / Molecular functioned 8) / Cellular(2018) components, sorting the terms based on P-value, which is computed by EnrichR using the Fisher exact test.
[0126] Assessment of potential outliers in the genome-wide screens. To test for potential outliers, we compared casTLE scores for all genes in the genome-wide screen between each replicate at Day 14 for the young NSC screens (FIG. 6d-f). Correlations between replicates were calculated by Spearman’s correlation test. We also examined the PC loadings of Day 14 young and old in vitro genome-wide screens of PC1 and PC2 and Day 4 young and old in vitro genomewide screens of PC3 and PC4. PC loadings were extracted using the Python sklearn. decomposition. PCA module. We performed gene set enrichment analysis by inputting the top 50 gene knockouts contributing to the PC into EnrichR online portal, and then focusing on the “Ontologies” tab with GO Biological Process(2018) / Molecular function(2018) / Cellular(2018) components, sorting the terms based on P-value, which is computed by EnrichR using the Fisher exact test. The GO terms of the genes that contribute to the replicate Young 1 at Day 14 not clustering with the other young replicates are enriched for Cytosolic Proteasome Complex (G0:0031597) as well as Proteasome-Activating ATPase Activity (G0:0036402). As mentioned above in Generation of gene lists for the genome-wide screens, we chose hits from the screen that were significant in 2 or 3 replicates to avoid having one of the screens skew the data. We have also investigated the loading of all PCs for both Day 4 and Day 14 and performed GO term analysis on the genes underlying all PCs (Supplementary Table 5). Genes and GO terms underlying the technical variance for Day 4 samples (PC1 , 2, 4) are involved in cell division, proteostasis, and transcription / translation. Thus, one possible source of variance in this in vitro NSC system could be due to lentiviral infection (impacting cell survival / cell proliferation) or bottlenecking during passaging.
[0127] Comparison with published screens / databases. Ne tested whether the genes significantly depleted at the Day 14 timepoint overlapped with list of common essential genes. We generated a list of Day 14 significantly (FDR<0.1 ) depleted genes in both the young and old screens. We identified the overlap between significantly depleted genes in the NSC screens with Core Essential Genes 2 (CEG2) database and the Online GEne Essentiality database (OGEE) (FIG. 6l,m). P-values were calculated using a Fisher’s exact test. There was a small butstatistically significant overlap between known essential gene lists and the significantly depleted NSC gene list. Thus, these in vitro genome-wide screens captured essential genes that are shared with published datasets, but also captured unique genes whose knockout affect cell survival or activation in neural stem cells.
[0128] Intracellular fluorescence activated cell sorting (FACS) for Ki67. For the genome-wide screen and for other qNSC activation experiments, we FACS-isolated proliferative cells (Ki67+) as follows. Cells were dissociated with Accutase (Stemcell Technologies, 07920) for 5 min, collected into conical tubes, and centrifuged at 300g for 5 min. Cells were resuspended in PBS at 5x107cells in 1 mL (or 1 x105cell in 100 pL), and then 9 mL (or 900 pL) ice-cold 100% methanol was added and cells were agitated for 15 min at 4°C. Cells were then centrifuged at 500g for 5 min and resuspended for a wash in 3 mL PBS and centrifuged again at 500g for 5 min. Cells were then resuspended in 3.5 mL staining solution: Ki67-APC (eBioscience, 17-5698-82) 1 :300 in PBS, 2% fetal bovine serum (FBS) (Gibco, 10099141 ) at 4°C. Samples were agitated for 30 min at room temperature in the dark, and then 10 mL PBS was added prior to centrifugation at 700g for 5 min. Samples were then resuspended (25 mL per 5x107cells) in FACS buffer: PBS, 2% FBS, DAPI (Fisher Scientific, 62248, 1 mg / mL) 1 :5000. Each sample was filtered with FACS- strainer cap tubes (Fisher, 08-771 -23), just prior to FACS sorting. Cells were sorted on an Aria BD FACS Aria with a 100 pm nozzle at 13 psi and Flowjo (v10) software was used for data analysis.
[0129] Assessment of NSC activation for in vitro sub-screen and glucose intervention. For testing the Top 10 gene library (in vitro sub-screen) (Fig. 1 e) and glucose intervention (Fig. 4i), we performed qNSC activation experiments in 24-well or 96-well format. We seeded 2x105cells in 24 well, or 1 x105cells in 96 well format. After 4 days in qNSC media, with media changes every 2 days, concentrated virus was then added to the cells. We added 3 pL equal titer virus (see “Concentration of virus for in vivo and in vitro sub screens” section) to each 24-well containing 500 pL qNSC media, or 0.1 pL virus to 100 pL in each 96-well experiment. We left the virus in media with cells for 16 hours, and then refreshed the media. 5-6 days after infection, the cells were washed 1 x in PBS and then either transitioned to aNSC media for activation (Fig. 1 e) or incubated with qNSC media with or without glucose for 2 days and then transitioned to aNSC media for activation (Fig. 4i). aNSC media was exchanged once after 48 hours and Ki67 intracellular FACS was performed at day 4 post infection (see intracellular FACS section above). Even though overall activation was decreased in lentivi rally-infected cells compared to noninfected cells, the difference in activation between old and young NSCs was preserved.
[0130] Assessment of the impact of individual gene knockout on NSC activation. To test the impact of individual gene knockouts on NSC activation (Fig. 1 j), we used 8 independent NSC cultures from old (18-21 months old) mice, each culture being a mix of 1 male and 1 female mouse. We infected these NSC cultures with purified lentiviruses expressing 5 sgRNAs per gene.We evaluated the top 10 genes (Screen 1 and Screen 2). To assess the effect of each individual gene knockout on NSC activation, we seeded 3x105NSCs in 24 well format. After 4 days in qNSC media, with media changes every 2 days, qNSCs were incubated with fresh lentiviruses with equal titer. Lenviruses were generated as described in the “Lentivirus production” section using 293T cells. For these experiments, lentiviruses expressing sgRNAs to individual genes were collected by incubating 293T cells directly in qNSC media. The supernatants were collected and their titers were tested, using serial dilutions, to achieve a similar 50-70% range of infection of 293T cells. Supernatants were added to the qNSC wells for 16 hours, and then the media was changed to qNSC media. Six days after infection, the cells were washed 1 x in PBS and then transitioned to aNSC media for activation. aNSC media was exchanged once after 48 hours and then Ki67 intracellular FACS was performed at day 3 post infection (see Intracellular FACS section above).
[0131] Validation of individual knockout efficiency. We validated the knockout efficiency for 7 individual genes in qNSCs cultures in two independent experiments:
[0132] For Experiment 1 , young and old NSCs were seeded in a 24-well PDL pre-coated plate at a density of 2-3x105cells per well and incubated in qNSC media. After 4 days with media changes every 2 days, qNSCs were infected with lentiviruses expressing sgRNAs targeting each gene (5 sgRNAs per gene) as described in “Assessment of the impact of individual gene knockout on NSC activation”. Six days after infection, cells were washed with PBS then lysed directly with DirectPCR Lysis Reagent (Viagen Biotech, 102-T) with 1 % Proteinase K (Fisher Scientific, 25- 530-049) for 10 min at room temperature. The supernatant was pipetted repeatedly, then transferred to PCR strip tubes and incubated at 65°C for 25 min, and then 95°C for 15 min in a thermocycler. We amplified genomic DNA with primer pairs surrounding the sgRNA-editing sites, using Q5 polymerase (Fisher Scientific, M0491 L) and the following program: 30s of annealing step at 55°C and 1 min of extending step at 72°C for 40 cycles total.
[0133] For Experiment 2, we cloned 5sgRNAs for each individual gene, using the same methodology as described in “sgRNA plasmid sub-library cloning for in vivo screens" above. For lentiviral production, 293T cells were seeded in DMEM + 10% fetal bovine serum (FBS, Gibco 10099141 ) + 1 x penicillin- streptomycin-glutamine (Gibco, 10378-016) at a density of 13x106cells in 15 cm plates. One day later, 293T media was replaced with 18 mL fresh media and the cells were transfected using the polyethylenimine (PEI) (1 mg / mL, Polysciences #23966-2) transfection method. The individual gene library (25.5 pg) was transfected together with the lentiviral packaging plasmids psPAX2 (32.12 pg), and pCMV-VSV-G (9.44 pg) per 15 cm plate. psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260; RRID:Addgene_12260). pCMV- VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454; RRID:Addgene_8454). One day (20-24 hours) after transfection, the media was changed to NeuroBasal-A with penicillin- streptomycin-glutamine. After another 20-24 hours, lentivirus-containing supernatant wascollected and stored at 4°C and fresh media was added to the 293T cells for another collection after 24 hours. Both supernatants were then combined, filtered through a 0.45 pm polyvinylidene fluoride (PVDF) filter (Millipore Sigma, SE1 M003M00), and frozen at -80°C in 5 mL aliquots. For lentiviral transduction, young qNSCs were plated onto 6 well PDL pre-coated plates at the density of 1 .75x106cells per well (for control lentivirus), 10 cm PDL pre-coated plates at the density of 1.0x107cells / plate (for Slc2a4 (GLUT4) targeting lentivirus) or 12 well PDL pre-coated plates at a density of 4.ox105cells (for Npb and B3galnt2 targeting lentivirus). NSCs were kept in qNSC media for 4 days (with media changes every other day) before transduction. After removing media, viral supernatants (2 mL for 6 well plates, 10 mL for 10 cm plates and 1 mL for 12 well plates) were thawed at room temperature and mixed with 8% of B27 minus vitamin A, bFGF (80 ng / mL) and BMP4 (200 ng / mL). qNSCs were incubated with lentiviral media for 24 hours. After removing lentiviral media after 24 hours, a second lentiviral transduction was repeated the next day. After two consecutive transductions, qNSCs were washed once with NeuroBasal-A media and then cells were kept in qNSC media for 7 days to allow recovery and CRISPR editing. To select for a population of cells that was infected by the lentivirus, 1 .0 pg / mL of puromycin (Sigma- Aldrich, P8833) was added to the cultures for 3 days, with media changes every day. To assess knockout efficiency, we isolated genomic DNA as described above for Experiment 1. We amplified genomic DNA with primer pairs roughly 150-250bp upstream and 300-450bp downstream of sgRNA editing site (See Supplementary Table 4 for a complete list of primers), using GoTaq Green Master Mix (Promega, M7123) and the following amplification program: 30s of annealing step at 55°C and 1 min of extending step at 72°C for 40 cycles total.
[0134] In both Experiment 1 and Experiment 2, PCR amplicons were Sanger-sequenced using the respective forward primers. We then analyzed knockout efficiency using the DECODRv3.0 online tool. Each sgRNA was analyzed separately. Individual sgRNAs that had an editing efficiency with an r2value less than 0.6 from DECODRv3.0 are marked with a # in FIG. 6n. Individual sgRNAs that were not detected by DECODRv3.0 in the Sanger sequencing trace were indicated as not detected (ND) and not included as data points in FIG. 6n. Finally, we note that the percentage of knockout per gene is likely also underestimated due to the fact that larger indels that span sgRNA cutting sites are not taken into account by DECODR.
[0135] In vivo gene knockout experiments. Stereotaxic surgeries were performed to inject virus into the lateral ventricle of mice. For these experiments, old Cas9 mice were used, except for one experiment where old WT mice were used (see “Laboratory animals” section). Surgeries were performed on heating pads with isoflurane induced anesthesia, with a Kopf (Model 940) stereotaxic frame, World Precision Instruments (UMP3T-1 ) UltraMicroPump3, Hamilton 1710RN 100 pL syringe with 30g Small Hub RN needle with point 2 beveled end. Injections were made at the following coordinates, relative to bregma: lateral 1 mm, anterior 0.3 mm, ventral depth 3 mm from skull surface. After drilling skull and inserting the needle into position, we waited 5 min priorto injecting virus. We injected 3 pL of equal titer virus at a rate of 10 nL / s. We waited 7 min after injection, before removing the needle and suturing the skin. Animals were administered a single dose of Buprenorphine SR (0.5 mg / kg) for postoperative pain management and monitored for 1 - week post-surgery until full recovery. For labelling of proliferating NSC progeny, we injected animals intraperitoneally weekly with EdU (Thermo Fisher Scientific, A10044, 50 mg / kg, dissolved in sterile PBS), starting 1 week after surgery. We used both male and female mice for in vivo testing, always making note of sex for each experiment. We did not observe major differences in results between sexes, and plots include data from both sexes.
[0136] Influence of the anesthetic: In our pilot experiments, we performed some surgeries with Ketamine / Xylazine anesthesia instead of Isofluorane, for the relative ease of use, which we believe resulted in striking impairment of neurogenesis in both young and old animals when assessed in downstream screen analyses. Briefly, we performed our in vivo screening as outlined above, but we could only detect very few sgRNAs in the olfactory 5 weeks after injection when the mice had been anesthetized with Ketamine / Xylazine. We interpreted the lack of sgRNA detection in the olfactory bulb as an indication that not many NSCs were able to activate and migrate to the ofactory bulb in those conditions. We repeated the experiments with Ketamine / Xylazine 2 times, in close to 20 animals, always observing an impairment in sgRNA detection in the olfactory bulb after 5 weeks. When the same virus was injected into same age / background mice under isoflurane anesthesia, we could detect a far greater diversity and abundance of sgRNAs in the olfactory bulb 5 weeks later. We therefore did not perform any surgeries presented in this manuscript with Ketamine / Xylazine anesthesia, but used Isoflurane instead.
[0137] At the end point of in vivo experiments, mice were either sacrificed for sequencing of sgRNAs in the brain (in vivo sub-screens), or for immunofluorescence imaging (see In vivo immunofluorescence experiments section) of the olfactory bulb and other brain regions (single gene knockout experiments). For sequencing sgRNAs in the brain, mice were sacrificed either 1 - 2 days after injection or 5 weeks after injection and their brains were immediately removed and sub-dissected for genomic DNA extraction. We used a scalpel to cut off the olfactory bulbs and to cut a ~1 mm thin slice of the outer cortex as well as the outer cerebellum. We then subdissected out the SVZ niche. We took each tissue and minced it with -100 cuts of a scalpel and proceeded to extract genomic DNA according to manufacturer’s protocol (Qiagen QIAamp DNA micro kit, 56304). The genomic DNA was then processed for sgRNA amplification and sequencing as outlined in the sgRNA PCR amplification and sequencing section.
[0138] Immunofluorescence staining of brain sections, image analysis, and quantification.
[0139] Brain sections in the olfactory bulb and subventricular zone: For immunofluorescence straining of brain sections, young and old anesthetized mice were first subjected to intracardiac perfusion with 4 ml_ of heparin (Sigma Aldrich, H3149-50KU) and then 25 ml_ 4%paraformaldehyde (PFA) (Electron Microscopy Science, 15714) in PBS. Brains were then removed and further fixed for 16 hours by submerging in 4% PFA, at 4°C. Brains were then washed 3 times in PBS and placed in a conical tube with a 30% sucrose (Sigma-Aldrich, S3929- 1 KG) in PBS solution for 2-3 days until sinking to bottom of conical tube. The brains were then embedded in optimal cutting temperature (O.C.T.) compound (Electron Microscopy Sciences, 62550-12) for cryo-sectioning. Brain coronal sections were taken at 20 pm thickness (Leica, CM3050S). For assessing neurogenesis in the olfactory bulb, every 10thsection was used. Thus, imaging was performed every 200 pm across the entire olfactory bulb. For assessing different cell types in the subventricular zone (SVZ), we began taking sections at the most anterior part of the lateral ventricle, and every 10thsection was used. Thus, imaging was performed every 200 pm across the SVZ.
[0140] Immunofluorescence staining: For immunofluorescence staining, sections were brought to room temperature and then washed 1 time with PBS and then permeabilized with ice-cold methanol and 0.1 % Triton X-100 (Fisher Scientific, BP151 ) for 15 min. All samples were stained at the same time. Slides were washed 3 times with PBS, and then treated with Clicklt reagents (for Edll) or put straight into antibody blocking solution. For Click-lt EdU staining (Thermo Fisher Scientific, C10337 / C10639 / C10634), we placed 50-70 pL of reaction cocktail from this kit onto the tissue and incubated in humidified chamber at room temperature for 30 min. Slides were then washed 3 times in PBS prior to blocking for antibodies. Slides were treated with 50-70 pL blocking solution (5% normal donkey serum [NDS, ImmunoReagents, SP-072-VX10], 1 % Bovine Serum Albumin (BSA, Sigma-Aldrich, A1595-50ML), 8.5 mL PBS) in a humidified chamber at room temperature for 30 min. Blocking solution was replaced with antibody solution consisting of blocking solution with antibodies as follows: mCherry (Invitrogen, M1 1217) 1 :500, GFAP (Abeam, 53554) 1 :500, GFP (Abeam, 13970) 1 :500, GLUT4 (for in vivo staining R&D, MAB1262) 1 :500, Ki67 (Invitrogen, 14-5698-082) 1 :500, STX4A (Santa Cruz Biotechnology, sc-101301 ) 1 :500, GFP (Abeam, 13970) 1 :500, mouse IgG (Santa Cruz SC-3877, Lot: L1916) 1 :500, NeuN (Millipore, MAB377) 1 :500, S100a6 (Abeam, ab181975) 1 :500, Tuj1 (Biolegend, 802001 ) 1 :500, Olig2 (R&D Systems, AF2418) 1 :100, Sox10 (Abeam, Ab180862) 1 :100, Calretinin (Abeam, Ab244299) 1 :500, Dex (Cell Signaling Technology, 4604) 1 :500. We tested two mCherry antibodies (Abeam, ab21351 1 ; Invitrogen, M1 1217) and we found that Invitrogen, M1 1217 was better for immunostaining for brain sections. After primary staining in dark for 2 hours in humidified chamber at room temperature or 16 hours at 4°C, slides were washed 3 times in PBS prior to staining with secondary antibodies. Secondary antibodies were diluted in blocking solution and consisted of Alexa 488 / 594 / 647 conjugated antibodies (Fisher Scientific, A21202, A21206, A21209, A21447, A31571 , A31573) 1 :500, and DAPI (1 mg / mL, Fisher Scientific 62248) 1 :5000. We added 50-70 pL of secondary antibody mix to cover the section, and incubated in dark for 2 hours in humidified chamber at room temperature or 16 hours at 4°C. Slides were thenwashed 3 times with PBS 0.2% tween for 10 min, washed 3 times with PBS for 5 min, and then mounted using ProLong Gold (20-40 pL, Thermo fisher Scientific, P36931 ), dried for 2 hours and sealed with nail polish.
[0141] Confocal imaging: Images were captured using a Zeiss LSM 900 confocal microscope with a 10 / 20 / 63X objective. The exposure and gain settings for each channel / antibody were set at the beginning of each imaging session and remained the same for all animals and treatments. We randomized the order in which we imaged the slides, and we ensured that different treatments and age groups were all imaged in the same session on the same day. The imaging was not performed in a blinded manner. We did not select areas to image. We imaged and quantified serial sections. Confocal imaging was done every 200 pm across the entire olfactory bulb or SVZ region.
[0142] Image analysis and quantification: For image analysis, we used the open-source software QuPath. This approach allowed us to set the thresholds and quantification parameters on training images, and then run the same analysis across all sections, samples and treatments in an automated manner.
[0143] For quantifying GLUT4 knockout efficiency in the SVZ niche, we first annotated a polygon line around the SVZ NSC niche, creating an analysis region about 5-20 cells deep from the ventricle wall. We then performed the “analyze->cell detection” function, detecting cells in the image based on DAPI staining, using the program default settings, expanding the cell nuclei 5 pm in the “cell parameters” section. We then trained 2 independent object classifications: for GFAP+and mCherry+cells, adjusting the thresholds to detect positive cells that were apparent by eye. We combined the GFAP+and mCherry+objects into a single composite classifier and run it on all annotated images and treatments. The results were output as annotation detections. The annotation detections were used to display the GLUT4 channel “cell mean” fluorescent intensity for GFAP+mCherry+as compared to GFAPTnCherry populations in the different treatments.
[0144] For quantification of newborn neurons in the olfactory bulb, we first annotated a polygon line just beneath the olfactory bulb mitral cell layer, to focus the analysis within the inner layers of the olfactory bulb, where newborn neurons arrive. We then performed the “analyzer-cell detection” function, detecting cells in the image based on DAPI staining, using the program default settings, expanding the cell nuclei 5 pm in the “cell parameters” section. We then trained 3 independent object classifications: for mCherry+, Edll+, and NeuN+cells adjusting the thresholds to detect positive cells that were apparent by eye. We combined the mCherry, EdU and NeuN objects into a single composite classifier and run it on all annotated images and treatments. The results were output as annotation measurements and annotation detections. The annotation measurements were used for graphs depicting the number of NeuN+mCherry+EdU+ / Total EdU+cell numbers for each treatment, and the annotation detectionswere used to display the NeuN channel “cell mean” fluorescent intensity for EdU+mCherry+populations in the different treatments.
[0145] For quantifying different cell numbers in the SVZ niche with GLUT4 {Slc2a4) sgRNA treatment compared to control, we first annotated a polygon line around the SVZ NSC niche, creating an analysis region about 5-20 cells deep from the ventricle wall. We then performed the “analyze-»cell detection” function, detecting cells in the image based on DARI staining, using the program default settings, expanding the cell nuclei 5 pm in the “cell parameters” section. We then trained 3 independent object classifications: for GFAP+, Ki67+, and S100a6+cells adjusting the thresholds to detect positive cells that were apparent by eye. We combined the GFAP+, Ki67+, and s100a6+objects into a single composite classifier and run it on all annotated images and treatments. The results were output as annotation measurements. The annotation measurements were used for graphs depicting the sgRNA treatment and impact on number of each cell type: qNSCs (GFAP+S100a6+Ki67 ), aNSCs (GFAP+S100a6+Ki67+), Neuroblasts (GFAP Ki67+), and Astrocytes (GFAP+S100a6 ) for each condition.
[0146] For quantification of GLUT4 fluorescent intensity in different cell types of young and old mice in vivo, we first annotated a polygon line around the SVZ NSC niche, creating an analysis region about 5-20 cells deep from the ventricle wall. We then performed the “analyze->cell detection” function, detecting cells in the image based on DAPI staining, using the program default settings, expanding the cell nuclei 5pm in the “cell parameters” section. We then trained two independent object classifications: one for Ki67+(or S100a6+, for NSC specific labelling experiments) cells, and the other for GFAP+cells, adjusting the thresholds to detect positive cells that were apparent by eye. We combined the Ki67 (or S100a6) and GFAP objects into a single composite classifier and run it on all annotated images and treatments. The results were output as annotation detections. The annotation detections were used to display the GLUT4 channel “cell mean” fluorescent intensity for GFAP+Ki67+(aNSCs), GFAP+Ki67 (qNSCs / astrocytes), GFAP Ki67+(Neuroblasts), GFAP Ki67 (Other cells, including ependymal and microglia), or GFAP+S100a6+(NSCs) populations across different aged mice.
[0147] For all experiments, the output numbers displayed on the graphs were derived from the average of all serial section images across a biological replicate (1 mouse), biological sample values were then analyzed for significance by two-tailed Mann-Whitney test.
[0148] Immunofluorescence staining of primary cell cultures of NSCs and quantification. Immunofluorescence staining: For immunofluorescence staining of primary cell cultures of NSCs, we seeded 2.5 x 105aNSCs or 2x105qNSCs onto Poly-D-Lysine (50 ng / mL, Sigma-Aldrich, P6407) pre-treated (30 min, followed by 3x PBS wash) coverslips in each well of a 24-well plate. The qNSCs were plated 7 days prior to fixation, the aNSCs were plated 24 hours prior to fixation. For fixation, cells were washed 1 time with PBS, and then 500 pL of 4% PFA (Electron Microscopy Science, 15714) was added for 30-min incubation at room temperature. Cells were washed 3times with PBS and then permeabilized with 0.1% Triton X-100 (Fisher Scientific, BP151 ) in PBS for 15 min shaking at room temperature. Coverslips were washed twice with PBS and then processed for antibody staining. Coverslips were placed on a 45 pL drop of primary antibody solution consisting of 1% BSA in PBS with primary antibodies as follows: GLUT4 (Abeam, 33780) 1 :500, Ki67 (Invitrogen, 14-5698-082) 1 :500, STX4A (Santa Cruz Biotechnology, QQ-17) 1 :500. After 1 -hour incubation in dark at room temperature, slides were washed 3 times in PBS shaking for 5 min at room temperature. Slides were then placed on 45 pL drop of secondary antibodies in 1 % BSA in PBS consisting of Alexa 488 / 594 / 647 conjugated antibodies, (Fisher Scientific, A21206, A21209, A31571 ) 1 :500, and DAPI (1 mg / mL, Fisher Scientific 62248) 1 :5000. After 1- hour incubation at room temperature in the dark, slides were washed 3 times with PBS, prior to mounting with ProLong Gold, dried for 2 hours and sealed with nail polish.
[0149] Confocal imaging: Images were captured using a Zeiss LSM 900 confocal microscope with a 10 / 20 / 63X objective. The exposure and gain settings for each channel / antibody were set at the beginning of each imaging session and remained the same for all samples and treatments. We randomized the order in which we imaged the slides, and we ensured that different treatments and age groups were all imaged in the same session on the same day. The imaging was not done in a blinded manner. We did not select areas to image. We randomly selected 10 areas of each coverslip to image. For image analysis, see Immunofluorescence image analysis section below.
[0150] Image analysis and quantification: For image analysis, we used the open-source software QuPath. This approach allowed us to set the thresholds and quantification parameters on training images, and then run the same analysis across all sections, samples and treatments in an automated manner. For the in vitro GLUT4 and STX4A quantifications, we selected the entire image as the analysis annotation. We then performed the “analyze-»cell detection” function, detecting cells in the image based on DAPI staining, using the program default settings, expanding the cell nuclei 5 pm in the “cell parameters” section. The results were output as annotation detections. The annotation detections were used to display the GLUT4 and STX4A “cell mean” fluorescent intensity for each protein’s channel in each cell-culture type and age group. For all experiments, the output numbers from different images were averaged across a biological replicate (1 NSC culture), biological sample values were then analyzed for significance by two-tailed Mann-Whitney test. Note that we did not detect significant changes in Slc2a4 (GLUT4) by RT-qPCR and western blot in young vs. old qNSCs, likely because of detection and sensitivity issues.
[0151] Expression of glucose transporter genes and fatty acid oxidation gene signature in single cell RNA-seq. To test the expression of Slc2a4 (GLUT4) and other glucose transporter genes, we retrieved the raw counts from our most recent single-cell RNA-seq dataset from the SVZ neurogenic niche from young and old mice, and used a subset of the data containing only thecontrol (sedentary) animals across young and old ages (i.e. “O_Control” and “Y_Control” in the “AgeCond” metadata column). We normalized the counts data by dividing each cell by its total expression, scaling up to 105total counts per cell, and then taking the log-transform of the normalized counts with an added pseudocount. For comparisons across cell types, we used the pre-existing cell type annotations: “Astrocyte_qNSC”, “aNSC_NPC”, and “Neuroblast”. For comparisons across age, we compared old (“O_Control”) and young (“Y_Control”) animals using the pre-existing age annotations in the dataset72. For statistical comparisons of the mean expression across conditions, we used the two-sample Welch’s t-test from stat_compare_means(). Welch's t-test is designed for unequal population variances. To compute the log-fold change, we divided the average expression in the old cells by the average expression in young cells and then took the Iog2-transform of the resulting ratio. To compute the fatty acid oxidation gene signature, we summed the expression of the 19 genes from the fatty acid oxidation signature published in for each cell in the published single-cell RNA-seq dataset from SVZ neurogenic niches of young and old mice. We then compared the fatty acid oxidation gene signature levels across old and young qNSCs / astrocytes using the two-sample Welch’s t-test, which is designed for unequal population variances.
[0152] Expression of Slc2a4 RNA in bulk RNA-seq (in vitro). To test the expression of Slc2a4 (GLUT4) in vitro, we retrieved the RNA-seq normalized counts from in vitro qNSCs and aNSCs from a published dataset. To calculate statistical significance between qNSCS and aNSCs, we used a two-sided Mann-Whitney test.
[0153] Glucose uptake assays. For qNSCs, we seeded 40,000 cells per well and for aNSCs we seeded 10,000 cells per well (aNSCs do not stick to plate as well and will double every -16-24 hours, so we seed less to achieve similar density to qNSCs at time of analysis) on Poly-D-Lysine (PDL) (Sigma-Aldrich, P6407) pre-coated 96-well plates, performing the assay 3 days after seeding. Duplicate wells were seeded and used for cell count normalization at time of glucose uptake assay. For knockout experiments, 1 x105qNSCs were plated per well on PDL pre-coated 96-well plates in qNSC media 6 days prior to infection with lentivirus to express sgRNA, where 1 pL of concentrated virus was added to the culture media for 16-hours to achieve -100% infection of the cells. We then assessed glucose uptake either 4 days or 8 days after infection using two different types of assays (see below).
[0154] Colorimetric glucose uptake assay: For the colorimetric glucose uptake assay (Glucose Uptake-Gio Assay [Promega, J1342], Fig. 4f,h), experiments were performed according to the manufacturer’s protocol, with the following details. Cells were pre-treated for 1 hour of qNSC / aNSC culture media without glucose. Culture media was then replaced with 50 pL of qNSC / aNSC media containing 1 mM 2-DG (2-Deoxy-D-glucose, provided in Glucose Uptake-Gio kit from Promega (J1342)) reagent for 10 min in incubator (humidified, 37°C, 5% CO2). The 2-DG media was then removed and 50 pL of PBS was added prior to carrying out the remainder of theassay according to the manufacturer’s protocol. All media treatments and reagent exchanges were pre-aliquoted into an empty 96 well plate, such that we could add the treatment to entire rows of cells at once using a multi-channel pipet, to ensure the duration of treatment was equivalent across different cell types and ages. The luminescence of the cells was measured with 0.5 second readings using a Varioskan LUX multimode plate reader. Due to different treatments having effects on cell numbers, plate readings in some cases (mentioned in figure legends) required normalization to the cell counts (Countess II cell counter, Thermo Fisher Scientific) based off duplicate wells. We performed glucose uptake experiments on different numbers of NSCs and observed a linear correlation between relative light units (RLU) and cells plated.
[0155] Fluorescent glucose uptake assay: For the fluorescent 2-NBDG glucose uptake assay (fluorescent 2-NBDG [2-(A / -(7-Nitrobenz-2-oxa-1 ,3-diazol-4-yl)Amino)-2-Deoxyglucose] [Fisher, N13195], FIG. 11f), cells were placed in glucose free media for 1 hour and then treated with 200pM 2-NBDG for 30 min at 37°C, and then analyzed by flow cytometry at excitation / emission maxima of -465 / 540 nm, with DAPI in the media to eliminate dead cells.
[0156] Assessing GLUT4 knockout efficiency at the protein level in vitro . Western blot to assess GLUT4 knockout efficiency at the protein level. Young aNSCs were seeded onto PDL-coated 10 cm plates at a density of 1x107cells per plate and transferred into qNSC media. Media was changed every 2 days. After 4 or 5 days in qNSC media, qNSC cultures were infected with lentivirus expressing control sgRNAs or Slc2a4 (GLUT4) sgRNAs (5 sgRNAs). Seven days after infection, 1 .0 pg / mL of puromycin (Sigma-Aldrich, P8833) was added to the cultures for 3 days, with media changes every day, to select for infected cells. Then, the cells were washed with PBS and incubated on ice with ice-cold 1x lysis buffer (50 mM Tris-HCI, pH 8, 150 mM NaCI, 0.5% sodium deoxycholate, and 0.5% Triton-X 100) and 1x protease inhibitor (Thermo Fisher Scientific, 87786) for 10 min and cells were scraped off of the plate. Lysates were centrifuged at 10,000 g for 10 min at 4°C. The supernatant was removed and preserved, then the protein concentration was quantified using the BCA assay (Thermo Fisher Scientific 23225). To load the samples, 4x LDS buffer (Invitrogen NP007) with 1 mM DTT (Sigma-Aldrich 10197777001 ) was added to lysates with equal concentrations of protein and the mix was incubated at 95°C for 7 min; 25 pg of protein was added to each lane. Proteins were separated by SDS-PAGE in MOPS buffer (Invitrogen NP0001 ) on precast 4-12% Bis-Tris polyacrylamide gels (lnvitrogenNP0323BOX). Proteins were transferred onto nitrocellulose membranes. Membranes were incubated for 30 min at room temperature in blocking buffer (PBS + 3% w / v non-fat dry milk + 0.2% Tween-20). Given that GLUT4 and the loading control (P-actin) have a very similar molecular weight, we performed western blot in a sequential manner (first GLUT4 and then fS- actin). Primary antibodies to GLUT4 (1 :500, Invitrogen PA1-1065) were diluted in blocking buffer and incubated overnight at 4°C. After three washes in PBS + 0.2% Tween-20, goat anti-rabbit800CW (1 :10000, Li-Cor 925-3221 1 ) in blocking buffer were incubated for 1 hour at room temperature and washed three times in PBS + 0.2% Tween-20. Detection was performed on the LI-COR Odyssey FC imaging system with the 800 channel for 10 min. Then, primary antibodies to p-actin (1 :40000, Abeam ab6276) as a loading control were added for 1 hour at room temperature and washed 3 times in PBS + 0.2% Tween-20. Goat anti-mouse 680CW (1 : 10000, Li-Cor 925-68070) in blocking buffer were incubated for 1 hour at room temperature and washed three times in PBS + 0.2% Tween-20. Detection was performed on the LI-COR Odyssey FC imaging system with the 700 channel for 30 sec. We used Imaged to quantify the intensity of the GLUT4 and p-actin bands, and the intensity of the GLUT4 band was divided by the intensity of the corresponding p-actin band for each sample.
[0157] FACS to assess GLUT knockout efficiency at the protein level. \Ne plated NSCs on PDL- coated 24-well plates at the density of 3x105cells per well and added qNSC media for 4 days. After 4 days in quiescence, lentivirus expressing control sgRNAs or sgRNAs to Slc2a4 (GLUT4) (5 sgRNAs) was added to qNSCs for overnight infection, and the cells were kept in qNSC media for another 6 days. After 6 days (to leave time for infection and knockout to occur), the cells were dissociated with accutase, and placed in 500 LLL of media in 24-well format. FACS was performed by mixing the primary GLUT4 antibody (R&D Systems, MAB1262) at a 5:1 ratio with secondary anti-IgG AlexaFluor647 for 10 min on ice, in the dark. The antibody mix was added to live cells in culture at a dilution factor of 200X (502.5 iiL total volume), and incubated in cell culture incubator (37°C, 5% CO2) for 30 min. The cells were then fixed by adding 500 jiL of PBS + 1 % PFA to each well, without shaking the cells. Cells were incubated at room temperature for 20 min in the dark, and then analyzed by FACS (BD, LSRFortessa). FACS quantification was done by gating first on mCherry positive cells (infected cells).
[0158] Extracellular Acidification Rate (ECAR) and Oxygen Consumption Rate (OCR). To measure extracellular acidification rate (ECAR) and oxygen consumption rate (OCR), we seeded 80,000 NSCs into qNSC media in a PDL pre-treated well of a 96-well plate. The cells were maintained in quiescence for 4 days with media exchanges at 24 and 72-hour post seeding. The cells were then treated with unconcentrated equal titer lentivirus (with control sgRNAs or sgRNAs to Scl2a4 (GLUT4)) for 16-hour overnight infection. The cells were placed back into qNSC media for 48 hours prior to running the metabolic assay. For ECAR, assays were run according to manufacturer’s protocol (Glycolysis assay, Abeam #Ab197244), with the following parameters. The cells were placed in a CC free incubator, at 37°C, for 3 hours prior to running the assay. Fluorescence was measured using a Tecan Spark plate reader with the following settings: instrument was pre-warmed to 37°C 1 -hour prior to run, run mode: kinetic, kinetic duration 1 hr:30min, Interval time 1 min:30sec, Excitation wavelength 380, Excitation bandwidth 20, Emission wavelength 615, Emission bandwidth 10. The slope of the fluorescence detected over the period of linear increase was calculated for each sample. For OCR, assays were runaccording to the manufacturer’s protocol (Extracellular Oxygen Consumption Assay, Abeam catalog #Ab197243), with the following parameters. The extracellular O2 consumption reagent was used at 1 / 15 dilution (10 pL added to 150 pL of sample in a 96-well plate). High sensitivity mineral oil was pre-warmed to 37°C 30 min prior to use, and 2 drops were used for each well prior to running assay on plate reader. Fluorescence was measured using the Tecan spark plate reader with following measurements: Excitation 380 + / -20 nm, Emission 650 + / -20 nm, kinetic duration 1 hr:30min, Interval time 1 min:30sec. The slope of the fluorescence detected over the period of linear increase was calculated for each sample.
[0159] Transient glucose starvation. NSCs were placed in qNSC media for 4 days, exposed to lentivirus to express sgRNAs targeting Slc2a4 (GLUT4) or unannotated genomic regions (control). Then 6 days after infection, the cell media was replaced with standard complete qNSC media with glucose or modified to have no glucose (Neurobasal A media Thermo Scientific, A2477501 , no D-glucose, no sodium pyruvate, supplemented with 1 x sodium pyruvate, Fisher Scientific, 1 1 -360-070) for 48 hours, at which point the media was replaced with standard complete aNSC media (with normal glucose concentration (4500 mg / L) in Neurobasal A media Thermo Fisher 10888-022) and the cells were allowed to activate for 4 days prior to intracellular FACS analysis with Ki67.
[0160] Effect of 2-DG on young and old NSC activation. To test the effect of 2- Deoxy- D-glucose(2-DG) on young and old NSC activation, we performed qNSC activation experiments in 24-well plate format. Primary cultures of NSCs were derived from a pool of 2 young (3-4 months old) or old (18-21 months old) mice (1 :1 mix of male and female). We seeded 2x105NSCs in each well of a 24-well plate. After 4 days in qNSC media (with qNSC media changes every 2 days), 2-DG (2mM final concentration, Sigma, D8375) was added to the media for a 36-hour treatment, with one exchange at the 24-hour time point. After 36-hour treatment, the cells were washed 1 x in PBS and then transitioned to aNSC media for activation. aNSC media was exchanged once after 48 hours and then Ki67 intracellular FACS was performed at day 4 post treatment to assess NSC activation efficiency as described above. P-value were determined by two-tailed Mann-Whitney test.
[0161] Statistical analyses. For all experiments, young and old conditions were processed in an alternate manner rather than in two large groups, to minimize the group effect. We did not perform power analyses, though we did take into account previous experiments to determine the number of animals needed. To calculate statistical significance for experiments, all tests were two-sided Mann-Whitney tests, unless otherwise indicated.References1 Aimone, J. B. et al. Regulation and function of adult neurogenesis: from genes to cognition. Physiol Rev94, 991 -1026, doi:10.1152 / physrev.00004.2014 (2014).2 Gage, F. H. & Temple, S. Neural stem cells: generating and regenerating the brain. Neuron 80, 588-601 , doi:10.1016 / j.neuron.2013.10.037 (2013).3 Kalamakis, G. et al. Quiescence Modulates Stem Cell Maintenance and Regenerative Capacity in the Aging Brain. Ce / / 176, 1407-1419 e1414, doi:10.1016 / j.celL2019.01 .040 (2019).4 Knoth, R. et al. Murine features of neurogenesis in the human hippocampus across the lifespan from O to 100 years. PLoS One 5, e8809, doi :10.1371 / journal. pone.0008809 (2010).5 Silva-Vargas, V., Crouch, E. E. & Doetsch, F. Adult neural stem cells and their niche: a dynamic duo during homeostasis, regeneration, and aging. Curr Opin Neurobiol 23, 935-942, doi : 10.1016 / j.conb.2013.09.004 (2013).6 Navarro Negredo, P., Yeo, R. W. & Brunet, A. Aging and Rejuvenation of Neural Stem Cells and Their Niches. Cell Stem Cell 27, 202-223, doi:10.1016 / j.stem.2020.07.002 (2020).7 Silva-Vargas, V., Maldonado-Soto, A. R., Mizrak, D., Codega, P. & Doetsch, F. Age- Dependent Niche Signals from the Choroid Plexus Regulate Adult Neural Stem Cells. Cell Stem Cell 19, 643-652, doi:10.1016 / j.stem.2016.06.013 (2016).8 Villeda, S. A. et al. The ageing systemic milieu negatively regulates neurogenesis and cognitive function. Nature 477, 90-94, doi:10.1038 / nature10357 (2011 ).9 Bond, A. M., Ming, G. L. & Song, H. Adult Mammalian Neural Stem Cells and Neurogenesis: Five Decades Later. Cell Stem Cell17, 385-395, doi:10.1016 / j. stem.2015.09.003 (2015).10 Moreno-Jimenez, E. P. et al. Adult hippocampal neurogenesis is abundant in neurologically healthy subjects and drops sharply in patients with Alzheimer's disease. Nat Med 25, 554-560, doi:10.1038 / s41591 -019-0375-9 (2019).11 Dulken, B. W. etal. Single-cell analysis reveals T cell infiltration in old neurogenic niches. Nature 571 , 205-210, doi:10.1038 / s41586-019-1362-5 (2019).12 Ibrayeva, A. et al. Early stem cell aging in the mature brain. Cell Stem Cell 28, 955-966 e957, doi:10.1016 / j. stem.2021 .03.018 (2021 ).13 Artegiani, B. ef al. A Single-Cell RNA Sequencing Study Reveals Cellular and Molecular Dynamics of the Hippocampal Neurogenic Niche. Cell Rep 21 , 3271-3284, doi : 10.1016 / j.celrep.2O17.11 .050 (2017).14 Yousef, H. ef al. Age-Associated Increase in BMP Signaling Inhibits Hippocampal Neurogenesis. Stem Cells 33, 1577-1588, doi:10.1002 / stem.1943 (2015).15 Chaker, Z., Aid, S., Berry, H. & Holzenberger, M. Suppression of IGF-I signals in neural stem cells enhances neurogenesis and olfactory function during aging. Aging Cell 14, 847-856, doi:10.1111 / aceL 12365 (2015).16 Molofsky, A. V. et al. Increasing p16INK4a expression decreases forebrain progenitors and neurogenesis during ageing. Nature 443, 448-452, doi:10.1038 / nature05091 (2006).17 Zhang, R. et al. Id4 Downstream of Notch2 Maintains Neural Stem Cell Quiescence in the Adult Hippocampus. Cell Rep 28, 1485-1498 e1486, doi:10.1016 / j.celrep.2O19.07.014 (2019).18 Bedrosian, T. A. et al. Lamin B1 decline underlies age-related loss of adult hippocampal neurogenesis. EMBOJW, e105819, doi:10.15252 / embj.2020105819 (2021 ).19 Arvidsson, A., Collin, T., Kirik, D., Kokaia, Z. & Lindvall, O. Neuronal replacement from endogenous precursors in the adult brain after stroke. Nat Med 8, 963-970, doi:10.1038 / nm747 (2002).20 Doetsch, F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M. & Alvarez-Buylla, A. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97, 703- 716, doi:10.1016 / s0092-8674(00)80783-7 (1999).21 Kaplan, M. S. & Hinds, J. W. Neurogenesis in Olfactory-Bulb and Dentate Gyrus of Adult Rat - Electron-Microscopic Analysis of Light Autoradiographs. Anat Rec 187 , 620-620 (1977).22 Zheng, W. M. et al. Neurogenesis in Adult Human Brain after Traumatic Brain Injury. J Neurotraum 30, 1872-1880, doi:10.1089 / neu.2010.1579 (2013).23 Llorens-Bobadilla, E. et al. Single-Cell Transcriptomics Reveals a Population of Dormant Neural Stem Cells that Become Activated upon Brain Injury. Cell Stem Cell 17, 329-340, doi : 10.1016 / j. stem.2015.07.002 (2015).24 Jin, K. et al. Evidence for stroke-induced neurogenesis in the human brain. Proc Natl Acad Sci U S A 103, 13198-13202, doi : 10.1073 / pnas.0603512103 (2006).25 Kernie, S. G. & Parent, J. M. Forebrain neurogenesis after focal Ischemic and traumatic brain injury. Neurobiol Dis 37 , 267-274, doi:10.1016 / j.nbd.2009.11.002 (2010).26 Obernier, K. et al. Adult Neurogenesis Is Sustained by Symmetric Self-Renewal and Differentiation. Cell Stem Cell22, 221-234 e228, doi:10.1016 / j.stem.2018.01 .003 (2018).27 Obernier, K. & Alvarez-Buylla, A. Neural stem cells: origin, heterogeneity and regulation in the adult mammalian brain. Development 146, doi:10.1242 / dev.156059 (2019).28 Shin, J. etal. Single-Cell RNA-Seq with Waterfall Reveals Molecular Cascades underlying Adult Neurogenesis. Cell Stem Cell 7, 360-372, doi :10.1016 / j. stem.2015.07.013 (2015).29 Urban, N. et al. Return to quiescence of mouse neural stem cells by degradation of a proactivation protein. Science 353, 292-295, doi:10.1126 / science.aaf4802 (2016).30 Luo, J., Daniels, S. B., Lennington, J. B., Notti, R. Q. & Conover, J. C. The aging neurogenic subventricular zone. Aging Cell 5, 139-152, doi:10.1111 / j.1474-9726.2006.00197.x (2006).31 Platel, J. C. etal. Neuronal integration in the adult mouse olfactory bulb is a non-selective addition process. Elite 8, doi:10.7554 / eLife.44830 (2019).32 Wang, C. et al. Identification and characterization of neuroblasts in the subventricular zone and rostral migratory stream of the adult human brain. Cell Res 21 , 1534-1550, doi:10.1038 / cr.2011.83 (2011 ).33 Lois, C. & Alvarez-Buylla, A. Long-distance neuronal migration in the adult mammalian brain. Science 264, 1145-1148, doi :10.1126 / science.8178174 (1994).34 Mirzadeh, Z., Merkle, F. T., Soriano-Navarro, M., Garcia-Verdugo, J. M. & Alvarez-Buylla, A. Neural stem cells confer unique pinwheel architecture to the ventricular surface in neurogenic regions of the adult brain. Cell Stem Cell 3, 265-278, doi :10.1016 / j. stem.2008.07.004 (2008).35 Shen, Q. ef al. Adult SVZ stem cells lie in a vascular niche: a quantitative analysis of niche cell-cell interactions. Cell Stem Cell 3, 289-300, doi:10.1016 / j. stem.2008.07.026 (2008).36 Tavazoie, M. et al. A specialized vascular niche for adult neural stem cells. Cell Stem Cell 3, 279-288, doi:10.1016 / j.stem.2008.07.025 (2008).37 Enwere, E. et al. Aging results in reduced epidermal growth factor receptor signaling, diminished olfactory neurogenesis, and deficits in fine olfactory discrimination. J Neurosci 24, 8354-8365, doi:10.1523 / JNEUROSCI.2751-04.2004 (2004).38 Tropepe, V., Craig, C. G., Morshead, C. M. & van der Kooy, D. Transforming growth factor-alpha null and senescent mice show decreased neural progenitor cell proliferation in the forebrain subependyma. J Neurosci 17 , 7850-7859 (1997).39 Bondolfi, L., Ermini, F., Long, J. M., Ingram, D. K. & Jucker, M. Impact of age and caloric restriction on neurogenesis in the dentate gyrus of C57BL / 6 mice. Neurobiol Aging 25, 333-340, doi : 10.1016 / S0197-4580(03)00083-6 (2004).40 Alonso, M. et al. Activation of adult-born neurons facilitates learning and memory. Nat Neurosci 15, 897-904, doi:10.1038 / nn.3108 (2012).41 Gheusi, G. & Lledo, P. M. Adult neurogenesis in the olfactory system shapes odor memory and perception. Prog Brain Res 208, 157-175, doi :10.1016 / B978-0-444-63350-7.00006- 1 (2014).42 Gontier, G. et al. Tet2 Rescues Age-Related Regenerative Decline and EnhancesCognitive Function in the Adult Mouse Brain. Cell Rep 22, 1974-1981 , doi : 10.1016 / j.celrep.2O18.02.001 (2018).43 Leeman, D. S. et al. Lysosome activation clears aggregates and enhances quiescent neural stem cell activation during aging. Science 359, 1277-1283, doi:10.1126 / science.aag3048 (2018).44 Yadirgi, G. et al. Conditional activation of Bmi1 expression regulates self-renewal, apoptosis, and differentiation of neural stem / progenitor cells in vitro and in vivo. Stem Cells 29, 700-712, doi:10.1002 / stem.614 (2011).45 Horowitz, A. M. et al. Blood factors transfer beneficial effects of exercise on neurogenesis and cognition to the aged brain. Science 369, 167-173, doi:10.1126 / science.aaw2622 (2020).46 McAvoy, K. M. etal. Modulating Neuronal Competition Dynamics in the Dentate Gyrus to Rejuvenate Aging Memory Circuits. Neuron 91 , 1356-1373, doi :10.1016 / j. neuron.2016.08.009 (2016).47 Morgens, D. W., Deans, R. M., Li, A. & Bassik, M. C. Systematic comparison of CRISPR / Cas9 and RNAi screens for essential genes. Nat Biotechnol 34, 634-636, doi:10.1038 / nbt.3567 (2016).48 Morgens, D. W. et al. Genome-scale measurement of off-target activity using Cas9 toxicity in high-throughput screens. Nat Commun S, 15178, doi:10.1038 / ncomms15178 (2017).49 Wang, T., Wei, J. J., Sabatini, D. M. & Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84, doi:10.1126 / science.1246981 (2014).50 Lytle, N. K. etal. A Multiscale Map of the Stem Cell State in Pancreatic Adenocarcinoma. Cell 177, 572-586 e522, doi : 10.1016Zj.cell.2019.03.010 (2019).51 Wang, T. et al. Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Ce / / 168, 890-903 e815, doi:10.1016 / j. cell.2017.01.013 (2017).52 Yau, E. H. et al. Genome-Wide CRISPR Screen for Essential Cell Growth Mediators in Mutant KRAS Colorectal Cancers. Cancer Res 77, 6330-6339, doi:10.1158 / 0008-5472. CAN-17- 2043 (2017).53 Kramer, N. J. et al. CRISPR-Cas9 screens in human cells and primary neurons identify modifiers of C9ORF72 dipeptide-repeat-protein toxicity. Nat Genet 50, 603-612, doi : 10.1038 / S41588-018-0070-7 (2018).54 Tian, R. et al. Genome-wide CRISPRi / a screens in human neurons link lysosomal failure to ferroptosis. Nat Neurosci 24, 1020-1034, doi:10.1038 / s41593-021 -00862-0 (2021).55 Tian, R. et al. CRISPR Interference-Based Platform for Multimodal Genetic Screens in Human iPSC-Derived Neurons. Neuron 104, 239-255 e212, doi:10.1016 / j. neuron.2019.07.014 (2019).56 Shifrut, E. et al. Genome-wide CRISPR Screens in Primary Human T Cells Reveal Key Regulators of Immune Function. Cell 175, 1958-1971 e1915, doi:10.1016 / j. cell.2018.10.024 (2018).57 Pluvinage, J. V. et al. CD22 blockade restores homeostatic microglial phagocytosis in ageing brains. Nature 568, 187-192, doi:10.1038 / S41586-019-1088-4 (2019).58 Kamber, R. A. et al. Inter-cellular CRISPR screens reveal regulators of cancer cell phagocytosis. Nature 597, 549-554, doi:10.1038 / S41586-021 -03879-4 (2021 ).59 Wang, W. ef al. A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence. Sci Transl Med 3, doi:10.1126 / scitranslmed.abd2655 (2021 ).60 Jin, X. et al. In vivo Perturb-Seq reveals neuronal and glial abnormalities associated with autism risk genes. Science 370, doi :10.1126 / science. aaz6063 (2020).61 Kalebic, N. et al. CRISPR / Cas9-induced disruption of gene expression in mouse embryonic brain and single neural stem cells in vivo. EMBO Rep 17, 338-348, doi : 10.15252 / embr.2O1541715 (2016).62 Beronja, S. & Fuchs, E. RNAi-mediated gene function analysis in skin. Methods Mol Biol 961 , 351-361 , doi :10.1007 / 978-1 -62703-227-8_23 (2013).63 Wertz, M. H. et al. Genome-wide In Vivo CNS Screening Identifies Genes that ModifyCNS Neuronal Survival and mHTT Toxicity. Neuron 106, 76-89 e78, doi:10.1016 / j. neuron.2020.01.004 (2020).64 Ramani, B. et al. Scalable, cell type-selective, AAV-based in vivo CRISPR screening in the mouse brain. bioRxiv, (2023).65 Bajaj, J. etal. An in vivo genome-wide CRISPR screen identifies the RNA-binding protein Staufen2 as a key regulator of myeloid leukemia. Nat Cancer 1 , 410-422, doi:10.1038 / s43018- 020-0054-2 (2020).66 Chow, R. D. & Chen, S. Cancer CRISPR Screens In Vivo. Trends Cancer 4, 349-358, doi:10.1016 / j.trecan.2018.03.002 (2018).67 Rogers, Z. N. et al. Mapping the in vivo fitness landscape of lung adenocarcinoma tumor suppression in mice. Nat Genet 50, 483-486, doi:10.1038 / s41588-018-0083-2 (2018).68 Rogers, Z. N. et al. A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods 14, 737-742, doi:10.1038 / nmeth.4297 (2017).69 Yamauchi, T. et al. Genome-wide CRISPR-Cas9 Screen Identifies Leukemia-Specific Dependence on a Pre-mRNA Metabolic Pathway Regulated by DCPS. Cancer Cell 33, 386-400 e385, doi:10.1016 / j.ccell.2O18.01 .012 (2018).70 Chow, R. D. et al. AAV-mediated direct in vivo CRISPR screen identifies functional suppressors in glioblastoma. Nat Neurosci 20, 1329-1341 , doi:10.1038 / nn.4620 (2017).71 Dong, M. B. et al. Systematic Immunotherapy Target Discovery Using Genome-Scale In Vivo CRISPR Screens in CD8 T Cells. Cell 178, 1189-1204 e1123, doi : 10.1016Zj.cell.2019.07.044 (2019).72 Wang, G. etal. Mapping a functional cancer genome atlas of tumor suppressors in mouse liver using AAV-CRISPR-mediated direct in vivo screening. Sci Adv 4, eaao5508, doi : 10.1126 / sciadv.aao5508 (2018).73 Martynoga, B. et al. Epigenomic enhancer annotation reveals a key role for NFIX in neural stem cell quiescence. Genes Dev27, 1769-1786, doi :10.1101 / gad.216804.113 (2013).74 Platt, R. J. et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell 159, 440-455, doi:10.1016Zj.cell.2014.09.014 (2014).75 Mira, H. et al. Signaling through BMPR-IA regulates quiescence and long-term activity of neural stem cells in the adult hippocampus. Cell Stem Cell 7, 78-89, doi : 10.1016 / j. stem.2010.04.016 (2010).76 Marques-Torrejon, M. A. et al. LRIG1 is a gatekeeper to exit from quiescence in adult neural stem cells. Nat Common 12, 2594, doi:10.1038 / s41467-021-22813-w (2021 ).77 Pineda, J. R. et al. Vascular-derived TGF-beta increases in the stem cell niche and perturbs neurogenesis during aging and following irradiation in the adult mouse brain. EMBO Mol Med5, 548-562, doi:10.1002 / emmm.201202197 (2013).78 Satyanarayana, A. & Kaldis, P. Mammalian cell-cycle regulation: several Cdks, numerous cyclins and diverse compensatory mechanisms. Oncogene 28, 2925-2939, doi:10.1038 / onc.2009.170 (2009).79 Hafner, A., Bulyk, M. L., Jambhekar, A. & Lahav, G. The multiple mechanisms that regulate p53 activity and cell fate. Nat Rev Mol Cell Biol 20, 199-210, doi:10.1038 / s41580-019- 0110-x (2019).80 Schoof, M. et al. The transcriptional coactivator and histone acetyltransferase CBP regulates neural precursor cell development and migration. Acta Neuropathol Common 7, 199, doi : 10.1186 / S40478-019-0849-5 (2019).81 O'Connor, S. A. et al. Neural GO: a quiescent-like state found in neuroepithelial-derived cells and glioma. Mol Syst Biol 17, e9522, doi:10.15252 / msb.20209522 (2021 ).82 Khatri, P. etal. Proliferation and cilia dynamics in neural stem cells prospectively isolated from the SEZ. Sci Rep 4, 3803, doi:10.1038 / srep03803 (2014).83 Alvarez-Satta, M., Moreno-Cugnon, L. & Matheu, A. Primary cilium and brain aging: role in neural stem cells, neurodegenerative diseases and glioblastoma. Ageing Res Rev 52, 53-63, doi : 10.1016 / j . arr.2019.04.004 (2019).84 Amador-Arjona, A. et al. Primary cilia regulate proliferation of amplifying progenitors in adult hippocampus: implications for learning and memory. J Neurosci 31 , 9933-9944, doi :10.1523 / JNEUROSCI.1062-11 .2011 (2011 ).85 Tong, C. K. et al. Primary cilia are required in a unique subpopulation of neural progenitors. Proc Natl Acad Sci USA 111 , 12438-12443, doi:10.1073 / pnas.1321425111 (2014).86 Breunig, J. J. et al. Primary cilia regulate hippocampal neurogenesis by mediating sonic hedgehog signaling. Proc Natl Acad Sci U S A 105, 13127-13132, doi:10.1073 / pnas.0804558105 (2008).87 Han, Y. G. et al. Hedgehog signaling and primary cilia are required for the formation of adult neural stem cells. Nat Neurosci 11 , 277-284, doi:10.1038 / nn2059 (2008).88 Knobloch, M. & Jessberger, S. Metabolism and neurogenesis. Curr Opin Neurobiol 42, 45-52, doi:10.1016 / j.conb.2016.11.006 (2017).89 Lange, C. et al. Relief of hypoxia by angiogenesis promotes neural stem cell differentiation by targeting glycolysis. EMBO J 35, 924-941 , doi:10.15252 / embj.201592372 (2016).90 Fusco, S. et al. A CREB-Sirt1 -Hes1 Circuitry Mediates Neural Stem Cell Response to Glucose Availability. Cell Rep 14, 1195-1205, doi : 10.1016 / j . celrep.2015.12.092 (2016).91 Candelario, K. M., Shuttleworth, C. W. & Cunningham, L. A. Neural stem / progenitor cells display a low requirement for oxidative metabolism independent of hypoxia inducible factor- 1 alpha expression. J Neurochem 125, 420-429, doi:10.1111 / jnc.122O4 (2013).92 Chen, X. et al. High Glucose Inhibits Neural Stem Cell Differentiation Through Oxidative Stress and Endoplasmic Reticulum Stress. Stem Cells Dev 27, 745-755, doi : 10.1089 / scd.2017.0203 (2018).93 Zhou, W. et al. TIGAR promotes neural stem cell differentiation through acetyl-CoA- mediated histone acetylation. Cell Death Dis 10, 198, doi:10.1038 / s41419-019-1434-3 (2019).94 Leto, D. & Saltiel, A. R. Regulation of glucose transport by insulin: traffic control of GLUT4. Nat Rev Mol Cell Biol 13, 383-396, doi:10.1038 / nrm3351 (2012).95 Gusel'nikova, V. V. & Korzhevskiy, D. E. NeuN As a Neuronal Nuclear Antigen and Neuron Differentiation Marker. Acta Naturae 7, 42-47, doi:Doi 10.32607 / 20758251-2015-7-2-42- 47 (2015).96 Jiang, Y. Q. & Oblinger, M. M. Differential regulation of beta III and other tubulin genes during peripheral and central neuron development. J Cell Sci 103 ( Pt 3), 643-651 , doi:10.1242 / jcs.103.3.643 (1992).97 Mullen, R. J., Buck, C. R. & Smith, A. M. NeuN, a neuronal specific nuclear protein in vertebrates. Development 16, 201 -211 , doi:10.1242 / dev.116.1 .201 (1992).98 Liu, L. et al. Exercise reprograms the inflammatory landscape of multiple stem cell compartments during mammalian aging. Cell Stem Cell 30, 689-705 e684, doi : 10.1016 / j. stem.2023.03.016 (2023).99 Schmidt, C. A., Fisher-Wellman, K. H. & Neufer, P. D. From OCR and ECAR to energy: Perspectives on the design and interpretation of bioenergetics studies. J Biol Chem 297, 101140, doi : 10.1016 / j . jbc.2021 .101140 (2021 ).100 Knobloch, M. et al. A Fatty Acid Oxidation-Dependent Metabolic Shift Regulates Adult Neural Stem Cell Activity. Cell Rep 20, 2144-2155, doi:10.1016 / j.celrep.2O17.08.029 (2017).101 Delgado, A. C. et al. Release of stem cells from quiescence reveals gliogenic domains in the adult mouse brain. Science 372, 1205-1209, doi:10.1126 / science.abg8467 (2021).102 Cebrian-Silla, A. et al. Single-cell analysis of the ventricular-subventricular zone reveals signatures of dorsal and ventral adult neurogenesis. Elite 10, doi:10.7554 / eLife.67436 (2021 ).103 Mizrak, D. et al. Single-Cell Analysis of Regional Differences in Adult V-SVZ Neural Stem Cell Lineages. Cell Rep 26, 394-406 e395, doi:10.1016 / j.celrep.2018.12.044 (2019).104 Poisa-Beiro, L. et al. Glycogen accumulation, central carbon metabolism, and aging of hematopoietic stem and progenitor cells. Sci Rep 10, 11597, doi :10.1038 / s41598-020-68396-2 (2020).105 Paia, F. et al. Distinct metabolic states govern skeletal muscle stem cell fates during prenatal and postnatal myogenesis. J Cell Sci 131 , doi:10.1242 / jcs.212977 (2018).106 Hennrich, M. L. et al. Cell-specific proteome analyses of human bone marrow reveal molecular features of age-dependent functional decline. Nat Commun 9, 4004, doi :10.1038 / S41467-018-06353-4 (2018).107 Zou, K. et al. Life span extension by glucose restriction is abrogated by methionine supplementation: Cross-talk between glucose and methionine and implication of methionine as a key regulator of life span. Sci Adv 6, eaba1306, doi:10.1126 / sciadv.aba1306 (2020).108 Lin, S. J. et al. Calorie restriction extends Saccharomyces cerevisiae lifespan by increasing respiration. Nature 418, 344-348, doi:10.1038 / nature00829 (2002).109 Marcellino, B. K., Ekasumara, N. & Mobbs, C. V. Dietary Restriction and Glycolytic Inhibition Reduce Proteotoxicity and Extend Lifespan via NHR-49. Curr Neurobiol 9, 1-7 (2018).110 Schulz, T. J. et al. Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell Metab 6, 280-293, doi : 10.1016 / j.cmet.2007.08.011 (2007).111 Choi, S. S. High glucose diets shorten lifespan of Caenorhabditis elegans via ectopic apoptosis induction. Nutr Res Pract5, 214-218, doi:10.4162 / nrp.2011.5.3.214 (2011).112 Lee, S. J., Murphy, C. T. & Kenyon, C. Glucose shortens the life span of C. elegans by downregulating DAF-16 / FOXO activity and aquaporin gene expression. Cell Metab 10, 379-391 , doi : 10.1016 / j.cmet.2009.10.003 (2009).113 Schlotterer, A. et al. C. elegans as model for the study of high glucose- mediated life span reduction. Diabetes 58, 2450-2456, doi:10.2337 / db09-0567 (2009).114 Petrelli, F. et al. Mitochondrial pyruvate metabolism regulates the activation of quiescent adult neural stem cells. Sci Adv 9, eadd5220, doi:10.1126 / sciadv.add5220 (2023).115 Frazier, H. N. et al. Broadening the definition of brain insulin resistance in aging and Alzheimer's disease. Exp Neurol 313, 79-87, doi:10.1016 / j.expneurol.2018.12.007 (2019).116 Frolich, L. et al. Brain insulin and insulin receptors in aging and sporadic Alzheimer's disease. J Neural Transm (Vienna) 105, 423-438, doi:10.1007 / s007020050068 (1998).117 Davidsohn, N. et al. A single combination gene therapy treats multiple age-related diseases. Proc Natl Acad Sci U S A 116, 23505-23511 , doi:10.1073 / pnas.1910073116 (2019).118 Bernardes de Jesus, B. etal. Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer. EMBO Mol Med 4, 691 -704, doi : 10.1002 / emmm.201200245 (2012).
[0162] The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and theconcepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims.
Claims
What is claimed is:
1. A method of enhancing neural stem cell (NSC) activation in an aged individual, the method comprising: contacting NSC from the individual with an effective dose of an agent that inhibits glucose metabolic pathway, in a dose effective to increase activation of the NSC.
2. The method of claim 1 , wherein the contacting is performed ex vivo.
3. The method of claim 1 , wherein the contacting is performed in vivo.
4. The method of any of the previous claims, wherein the agent is delivered systemically.
5. The method of any of the previous claims, wherein the agent is delivered locally.
6. The method of any of the previous claims, wherein the agent is oxythiamine chloride or a derivative thereof that maintains inhibition of the glucose metabolic pathway.
7. The method of any of the previous claims, wherein the agent is 2-Deoxy-d-glucose or a derivative thereof that maintains inhibition of the glucose metabolic pathway.
8. The method of any of the previous claims, wherein the agent is 3-bromopyruvate or a derivative thereof that maintains inhibition of the glucose metabolic pathway.
9. The method of any of the previous claims, wherein the agent is administered in a dose effective to increase the number of newborn neurons in a brain region of interest.
10. The method of any of the previous claims, wherein the agent is administered in a dose effective to increase the number of quiescent NSCs in a brain region of interest.11 . The method of any of the previous claims wherein the individual is treated for brain injury or neurodegenerative disease.
12. The method of any of the previous claims wherein the individual is treated for a neurologic condition selected from ischemic stroke, chronic hemorrhagic stroke, subacute ischemic and hemorrhagic stroke patients, patients with traumatic brain injury, spinal cord injury, Parkinson's Disease, ALS (Lou Gehrig’s Disease), and Alzheimer's Disease.
13. A formulation for use in the method of any of claims 1 -12, comprising an effective unit dose of an agent that inhibits the glucose metabolic pathway and a pharmaceutically acceptable excipient suitable for administration to a region of the brain.
14. The formulation of claim 13, wherein the agent is selected from oxythiamine chloride or a derivative thereof, 2-Deoxy-d-glucose or a derivative thereof, and 3-bromopyruvate or a derivative thereof.
15. A cell culture comprising a population of aged mammalian neural stem cells in a medium comprising an effective dose of an agent that inhibits the glucose metabolic pathway.