Adeno-associated virus compositions for the treatment of limb girdle muscular dystrophy 2a

Abstract

The present invention provides novel gene therapy compositions for use in treatment of limb girdle muscular dystrophy 2A (LGMD2A).

Description

[0001] Attorney Docket No.: PAT059898-WO-PCT / KATE-037 ADENO-ASSOCIATED VIRUS COMPOSITIONS FOR THE TREATMENT OF LIMB GIRDLE MUSCULAR DYSTROPHY 2A CLAIM OF PRIORITY This application claims the benefit of U.S. Provisional Patent Application No. 63 / 677,141, filed July 30, 2024; and U.S. Provisional Patent Application No.63 / 687,987, filed August 28, 2024; each of which is incorporated by reference herein in its entirety. SEQUENCE LISTING The instant application contains a Sequence Listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on June 25, 2025, is named PAT059898-WO-PCT_SL.xml and is 2,181,371 bytes in size. FIELD OF DISCLOSURE This disclosure relates to compositions for the treatment of limb girdle muscular dystrophy 2A (LGMD2A). BACKGROUND Calpainopathy, also known as limb girdle muscular dystrophy 2A (LGMD2A), is a form of muscular dystrophy and the most common type of autosomal recessive limb-girdle muscular dystrophy. Calpainopathy is characterized by symmetric and progressive weakness of proximal limb-girdle muscles, resulting in a tendency to walk on tiptoe, difficulty in running, scapular winging, waddling gait, laxity of the abdominal muscles, Achilles tendon shortening, and scoliosis. The age of onset of muscle weakness is extremely variable; the most common being between eight and 15 years, although it can range between two and 50 years. LGMD2A is a rare disease, estimated to affects 1 in every 43,000 people. LGMD2A is caused by mutations in the calpain 3 (CAPN3) gene, which encodes the calpain-3 protein involved in the maintenance of muscle integrity and function. More than 480 CAPN3 mutations have been reported, some of which can be associated with severe or benign disease course. To date there are no specific treatments for LGMD2A, with only symptomatic management available. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 SUMMARY The present disclosure is directed to compositions (e.g., adeno-associated viral (AAV) compositions) and methods for treating limb girdle muscular dystrophy 2A (LGMD2A). For example, aspects of the invention provide a formulation comprising an AAV particle comprising (e.g., encapsidating) a nucleic acid comprising a promoter and a sequence encoding the calpain 3 gene (CAPN3). Aspects of the invention provide a composition comprising an adeno-associated virus (AAV) particle comprising an engineered capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2421). The capsid protein encapsidates a nucleic acid molecule (e.g., a cargo) comprising a promoter and a sequence encoding a CAPN3 transgene. The nucleic acid may further comprise a heart de-targeting miRNA binding site. The nucleic acid may further comprise a dorsal root ganglia (DRG) de-targeting miRNA binding site. In aspects of the invention, the nucleic acid molecule may comprise a sequence having the having at least 95% sequence identity with a sequence selected from SEQ ID NO: 2408, that encodes a CAPN3 transgene. The DRG de-targeting miRNA binding site may comprise a sequence selected from among SEQ ID NOs: 2399-2401. The heart de-targeting miRNA binding site may comprise a sequence selected from among SEQ ID NO: 2402 and SEQ ID NO: 2403. The promoter may be a novel promoter that exhibits specificity (e.g. high expression in) for muscle cells, for example myocytes. The promoter may exhibit decreased or limited specificity (e.g. low expression in) for heart / cardiac cells. The promoter may comprise a sequence having at least 95% sequence identity with a sequence selected from among SEQ ID NO: 2404-SEQ ID NO: 2407. For example, the nucleic acid molecule (e.g. cargo) may comprise in order: a first inverted terminal repeat (ITR) region; a promoter; a first heart de-targeting miRNA binding site; an intron; the sequence a sequence encoding a CAPN3 transgene; a second heart de-targeting miRNA binding site; a third heart de-targeting miRNA binding site; a first DRG de-targeting miRNA binding site; a fourth heart de-targeting miRNA binding site; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second DRG de-targeting miRNA binding site; a polyadenylation signal; a second ITR region. The ITR regions may be AAV2 ITR regions derived from an AAV2. For example, the full nucleic acid molecule may comprise a sequence selected from among SEQ ID NO: 2413-2420. Advantageously, when administered to a subject with LGMD2A, the composition is effective at restoring a healthy phenotype. The engineered capsid protein may advantageously exhibit decreased liver tropism and / or increased muscle tropism. For example, the capsid protein may comprise an amino acid sequence selected from Tables 1a in hypervariable region IV (HVR IV) relative to wild-type AAV-9. The capsid protein may comprise substitutions at amino acids 451-455 relative to a wild-type AAV-9 vector capsid selected from column 1 of Table 1b and a 7-mer insert selected from column 2 of Table 1b inserted after amino acid 455 relative to a wild-type AAV-9 vector. The capsid protein may further comprise a deletion of G267 relative to wild-type AAV-9 capsid or equivalent position in another AAV capsid. Accordingly, aspects of the invention further provide methods and uses of the compositions of the invention (for example in the preparation of a medicament) for treating a subject suffering from LGMD2A. The methods and uses may comprise providing to a subject a composition of the invention as described above. Accordingly, aspects of the disclosure provide a recombinant nucleic acid comprising a muscle specific promoter; a sequence encoding calpain 3 (CAPN3) or biologically active fragment thereof; at least one heart de-targeting miRNA binding site; and at least one dorsal root ganglia (DRG) de-targeting miRNA binding site. In some embodiments, the muscle specific promoter comprises a CK8 promoter, a desmin promoter, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, or a TTNI2 promoter. In some embodiments, the muscle specific promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In some embodiments, the muscle specific promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In Attorney Docket No.: PAT059898-WO-PCT / KATE-037 some embodiments, the muscle specific promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404. In some embodiments, the sequence encoding CAPN3 is a sequence encoding human CAPN3. In some embodiments, the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the at least one heart de-targeting miRNA binding site comprises a binding site for miR-221 or miR-499. In some embodiments, the at least one heart de-targeting miRNA binding site comprises a binding site for miR-221-3p or miR-499- 5p. In some embodiments, the at least one heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. In some embodiments, the at least one heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. In some embodiments, the at least one heart de- targeting miRNA binding site comprises a first, a second, a third, and a fourth heart de- targeting miRNA binding site. In some embodiments, each of the first, the second, the third, and the fourth heart de-targeting miRNA binding sites comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. In some embodiments, each of the first, the second, the third, and the fourth heart de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338, miR-138, or miR-9. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338-3p, miR- 138-5p, or miR-9-5p. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least Attorney Docket No.: PAT059898-WO-PCT / KATE-037 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, the at least one DRG de-targeting miRNA binding site comprises a first and a second DRG de- targeting miRNA binding site. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, the recombinant nucleic acid further comprises an intron. In some embodiments, the intron comprises a simian virus 40 (SV40) intron sequence, a minute virus of mice (MVM) intron, a RK intron, a β-globin intron, and / or a chicken β-actin (CBA) intron, including functional variants or fragments thereof. In some embodiments, the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410. In some embodiments, the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410. In some embodiments, the recombinant nucleic acid further comprises a polyadenylation (PolyA) signal. In some embodiments, the PolyA signal comprises a bovine growth hormone polyadenylation (bgh-PolyA) signal, a synthetic PolyA signal, or an SV40 PolyA signal. In some embodiments, the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the recombinant nucleic acid further comprises a 5′ inverted terminal repeat (ITR) and a 3′ ITR. In some embodiments, the 5′ ITR and / or the 3′ ITR is an adeno-associated virus 2 (AAV2) ITR, or a variant or fragment thereof. In some Attorney Docket No.: PAT059898-WO-PCT / KATE-037 embodiments, the 5′ ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the 5′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the 3′ ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412. In some embodiments, the 3′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2412. In some embodiments, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR; a promoter; a first heart de-targeting miRNA binding site; an intron; a sequence encoding CAPN3; a second heart de-targeting miRNA binding site; a third heart de-targeting miRNA binding site; a first DRG de-targeting miRNA binding site; a fourth heart de-targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a PolyA signal; and a 3′ ITR. In some embodiments, the recombinant nucleic acid comprises: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412. Aspects of the present disclosure provide: a) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; b) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; c) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least Attorney Docket No.: PAT059898-WO-PCT / KATE-037 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; d) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; e) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; f) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; g) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; and h) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 In some embodiments, the 5′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; the first heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410; the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408; the second heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the third heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the first DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the fourth heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the second DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411; and the 3′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2412. Aspects of the present disclosure provide: a) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; b) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; c) a recombinant nucleic acid comprising: Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; d) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; e) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; f) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; g) a recombinant nucleic acid comprising: Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; and h) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In some embodiments, the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2413-2420. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2413-2420. Aspects of the present disclosure provide a recombinant nucleic acid comprising a promoter, wherein the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In some embodiments, the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In some embodiments, the recombinant nucleic acid further comprises a sequence encoding CAPN3, optionally wherein the sequence encodes human CAPN3. In some embodiments, the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least Attorney Docket No.: PAT059898-WO-PCT / KATE-037 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the recombinant nucleic acid comprising the promoter exhibits enhanced expression in skeletal muscle cells compared to non-skeletal muscle cells and / or cardiac muscle cells. Aspects of the present disclosure provide a recombinant nucleic acid comprising a promoter, wherein the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2442-2451. In some embodiments, the recombinant nucleic acid further comprises an enhancer comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2433-2441. In some embodiments, the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2423-2432. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2423-2432. In some embodiments, the recombinant nucleic acid further comprises a sequence encoding CAPN3, optionally wherein the sequence encodes human CAPN3. In some embodiments, the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408. In some embodiments, the recombinant nucleic acid further comprises at least one heart de-targeting miRNA binding site. In some embodiments, the at least one heart de- targeting miRNA binding site comprises a binding site for miR-221-3p or miR-499-5p. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 In some embodiments, the recombinant nucleic acid comprising the promoter exhibits enhanced expression in skeletal muscle cells compared to non-skeletal muscle cells and / or cardiac muscle cells. Aspects of the present disclosure provide an adeno-associated virus (AAV) particle comprising any of the recombinant nucleic acids described herein and a capsid protein. In some embodiments, the capsid protein is derived from a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh, AAVrh10, AAVrh74, AAV-DJ, AAV-DJ / 8, Anc80, and AAV7m8, or a derivative, hybrid or chimeric serotype thereof. In some embodiments, the AAV particle has increased muscle tropism compared to a wild type AAV9 particle. In some embodiments, the AAV particle has reduced liver tropism compared to a wild type AAV9 particle. In some embodiments, the capsid protein comprises an amino acid sequence of formula (I): (I) X1NX2X3X4RGDRX5X6L (SEQ ID NO: 1), wherein each of X1-X6 is any amino acid. In some embodiments, the amino acid sequence of formula (I) is in a hypervariable region IV (HVR IV) relative to a wild type AAV9 capsid. In some embodiments, relative to a wild type AAV9 capsid, X1is a substitution at amino acid 451, X2 is a substitution at amino acid 453, X3 is a substitution at amino acid 454, X4is a substitution at amino acid 455, and RGDRX5X6L (SEQ ID NO: 2422) is inserted after amino acid 455. In some embodiments, X1is A, I, F, G, H, L, M, Q, S, T, or V; X2is A, G, S, T, or Y; X3 is S, N, G, or P; X4 is A, G, H, I, M, S, T, or V; X5 is A, G, or Q; and X6 is A, I, L, M, N, S, or Y. In some embodiments, the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 801-1599. In some embodiments, the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 1600-2398. In some embodiments, the amino acid sequence of formula (I) comprises or consists of any one of SEQ ID NOs: 2-800. In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NOs: 191, 198, 199, 215, 256, 379, 544, 550, or 748. In some embodiments, the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 In some embodiments, the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 215 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector. Aspects of the present disclosure provide a pharmaceutical composition comprising any of the recombinant nucleic acids described herein, any of the adeno-associated virus (AAV) particles described herein, and a pharmaceutically acceptable carrier. Aspects of the present disclosure provide a method of treating limb girdle muscular dystrophy 2A (LGMD2A) in a subject in need thereof, the method comprising administering to the subject an effective amount of any of the recombinant nucleic acids described herein, any of the adeno-associated virus (AAV) particles described herein, or any of the pharmaceutical compositions described herein. In some embodiments, the subject is a human subject. In some embodiments, the subject has at least one mutation in the calpain 3 (CAPN3) gene. In some embodiments, the administering comprises intramuscular administration, subcutaneous injection, intravenous injection, or intravenous (IV) administration. Aspects of the present disclosure provide use of the recombinant nucleic acid of any of the recombinant nucleic acids described herein, any of the adeno-associated virus (AAV) particles described herein, or any of the pharmaceutical compositions described herein for the manufacture of a medicament for treating limb girdle muscular dystrophy 2A (LGMD2A). Aspects of the present disclosure provide any of the recombinant nucleic acids described herein, any of the adeno-associated virus (AAV) particles described herein, or any of the pharmaceutical compositions described herein for use in treating limb girdle muscular dystrophy 2A (LGMD2A). Aspects of the present disclosure provide a kit comprising any of the recombinant nucleic acid described herein, any of the adeno-associated virus (AAV) particles described herein, or any of the pharmaceutical compositions described herein. In some embodiments, the kit further comprises instructions for use in treating limb girdle muscular dystrophy 2A (LGMD2A) in a subject in need thereof. Aspects of the nucleic acid molecules (e.g., cargo) and capsid proteins are described in further detail below. For sequences disclosed throughout this application, it is understood that nucleic acid molecules and peptides may comprise one or more substitutions, for example conservative substitutions, that allow sequences to continue to function. Accordingly, sequences may have Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the sequence disclosed. A conservative substitution refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain. For example, conservative substitutions may include a substitution found in one of the following groups: Group 1: Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3: Asparagine (Asn or N), Glutamine (Gln or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (Ile or I), Leucine (Leu or L), Methionine (Met or M), Valine (Val or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W). Additionally, or alternatively, amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur- containing). For example, an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Val, Leu, and Ile. Other conservative substitutions groups include sulfur- containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gln; small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gln; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, Ile, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. DRG De-targeting miRNAs The present invention provides recombinant nucleic acids and recombinant expression vectors (e.g., AAV vectors) that encode a transgene and the binding site(s) for specific micro RNAs (miRs) that direct the miRs to selectively inhibit expression of the same transgene. By the present invention, it was discovered that miR-338-3p, miR-138-5p, and miR-9-5p are highly expressed in dorsal root ganglial (DRG) cells and not expressed, or expressed at substantially low levels, in muscle cells (including skeletal and heart muscle cells). Accordingly, aspects of the invention provide a recombinant nucleic acid and an engineered vector comprising a first nucleic acid sequence encoding a transgene and a second nucleic acid sequence encoding for the binding site(s) of one or more miRs selected from among miR-338-3p, miR-138-5p, or miR-9-5p. In such instances, the second nucleic acid sequence can be referred to as DRG de-targeting miRNA binding site. Thus, as used herein, Attorney Docket No.: PAT059898-WO-PCT / KATE-037 the term “DRG de-targeting binding site” refers to a nucleic acid sequence encoding for a binding site of a miR (e.g., miR-338-3p, miR-138-5p, and miR-9-5p) that is highly expressed in DRG cells but not expressed, or expressed at significantly lower levels, in muscle cells. The nucleic acid sequence encoding a binding site of a miR is sufficiently complementary with the nucleic acid sequence encoding the miR to effect base pairing (binding) between the DRG de-targeting binding site and the miR. Advantageously, the second nucleic acid sequence directs the miR, when present, to repress expression of the transgene. As a result, the selected miRs (miR-338-3p, miR-138-5p, miR-9-5p) in cells transduced by the vectors of the invention will be directed to inhibit expression of the transgene. For example, the transgene (e.g., hCAPN3) may provide a therapeutic effect when expressed in skeletal and / or heart muscle but provide a toxic effect when expressed in DRG cells. Without being bound to a mechanism of action, transduction of both muscle cells and DRG cells by vectors of the invention results in transcription of both transgene mRNA and the binding site(s) of the select miR. In DRG cells with substantial endogenous expression of miR-338-3p, miR-138-5p, and miR-9-5p, transgene expression will be substantially repressed. In muscle cells with limited to no expression of miR-338-3p, miR-138-5p, miR-9- 5p, transgene expression will not be substantially repressed. As a result, the therapeutic effect of the transgene will continue in muscle cells and the toxic effect in DRG cells will be abated. In aspects of the invention, the second nucleic acid sequence may be operably linked to the first nucleic acid sequence, for example the second nucleic acid sequence may be operably linked to the 3′ or 5′ end of the first nucleic acid sequence. Advantageously, this may result in increased transcription of both nucleic acid sequences. The engineered vector may be a viral vector. For example, the vector may be an adeno-associated viral (AAV) vector. Further advantageously, the engineered vector may comprise a capsid protein with modified tropism for skeletal and / or heart muscle in comparison with the wild-type AAV vector. For example, transduction and expression of the transgene may be increased in muscle tissue while limited expression of the transgene in off- target tissue types, for example DRG may be observed. The first nucleic acid sequence and second nucleic acid sequence may also be operably linked to tissue specific promoters. Advantageously, the first nucleic acid sequence may be operably linked to a muscle specific promoter. In aspects of the invention, the second nucleic acid is 3′ or 5′ of the first nucleic acid. For example, the second nucleic acid may be incorporated into a 3′ or 5′ untranslated region (UTR) of the transgene mRNA when transcribed. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 In muscle tissue, where miR-338-3p, miR-138-5p, miR-9-5p expression is limited, the muscle specific promoter promotes transcription of the transgene and the miR binding site has limited to no effect due to the absence of the requisite miR. In cells expressing miR-338- 3p, miR-138-5p, miR-9-5p, for example DRG, the muscle specific promoter limits transcription of the transgene while the miR binding site is still present in the transcript, inhibiting translation of any transgene mRNA transcribed. Aspects of the invention also provide methods and uses of the recombinant nucleic acids and the recombinant expression vectors of the invention, for example in therapeutic compositions. Accordingly, aspects of the invention provide a method or use of a recombinant nucleic acid or a recombinant expression vector, the method or use comprising providing to a subject a recombinant nucleic acid or a recombinant expression vector (e.g., an engineered vector) comprising a first nucleic acid sequence encoding a transgene and a second nucleic acid sequence expressing the binding site of a miR selected from among miR- 338-3p, miR-138-5p, or miR-9-5p. The second nucleic acid sequence thereby directs the miR, when present (for example endogenously), to repress expression of the transgene. The transgene may be expressed in heart and / or skeletal muscle, thereby providing a therapeutic effect. The second nucleic acid sequence may be expressed in dorsal root ganglia cells and direct endogenous miR-338-3p, miR-138-5p, and / or miR-9-5p to repress expression of the transgene in dorsal root ganglia cells. For example, the transgene may provide a therapeutic effect when expressed in skeletal and / or heart muscle but provide a toxic effect when expressed in DRG cells. Accordingly, in aspects of the invention, the DRG de-targeting miRNA may comprise a sequence have at least 90% or at least 95% of the sequence identity of one or more of: CAACAAAATCACTGATGCTGGA (SEQ ID NO: 2399; miR-338-3p); CGGCCTGATTCACAACACCAGCT (SEQ ID NO: 2400; mir-138-5p), or TCATACAGCTAGATAACCAAAGA (SEQ ID NO: 2401; miR-9-5p). Heart De-targeting miRNAs The present invention provides recombinant nucleic acids and AAV vectors that encode a transgene and the binding site(s) for specific micro RNAs (miRs) that direct the miRs to selectively inhibit expression of the same transgene. miR-221, for example miR-221- 3p, and miR-499, for example miR-499a, may be highly expressed in cardiac / heart cells and not expressed, or expressed at substantially low levels, in skeletal muscle cells. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Accordingly, aspects of the invention provide a recombinant nucleic acid and an engineered AAV vector comprising a first nucleic acid sequence encoding a transgene and a second nucleic acid sequence encoding for the binding site(s) of miR-221 or miR-499. In such instances, the second nucleic acid sequence can be referred to as heart de-targeting miRNA binding site. Thus, as used herein, the term “heart de-targeting binding site” refers to a nucleic acid sequence encoding for a binding site of a miR (e.g., miR-221-3p and miR-499 miR-499a) that is highly expressed in heart cells but not expressed, or expressed at significantly lower levels, in skeletal muscle cells. The nucleic acid sequence encoding a binding site of a miR is sufficiently complementary with the nucleic acid sequence encoding the miR to effect base pairing (binding) between the heart de-targeting binding site and the miR. Advantageously, the second nucleic acid sequence directs the miR, when present, to repress expression of the transgene. As a result, miR-221 or miR-499 in cells transduced by the vectors of the invention will be directed to inhibit expression of the transgene. For example, the transgene may provide a therapeutic effect when expressed in skeletal muscle but provide a toxic effect when expressed in heart cells. Without being bound to a mechanism of action, transduction of both skeletal muscle cells and heart cells by recombinant nucleic acids or vectors of the invention results in transcription of both transgene mRNA and the binding site(s) of the select miR. In heart cells with substantial endogenous expression of miR-221-3p and miR-499, transgene expression will be substantially repressed. In skeletal muscle cells with low expression of miR-221-3p and miR- 499, transgene expression will not be substantially repressed. As a result, the therapeutic effect of the transgene will continue in muscle cells and the toxic effect in heart cells will be abated. In aspects of the invention, the second nucleic acid sequence may be operably linked to the first nucleic acid sequence, for example the second nucleic acid sequence may be operably linked to the 3′ or 5′ end of the first nucleic acid sequence. Advantageously, this may result in increased transcription of both nucleic acid sequences. Accordingly, in aspects of the invention, the heart de-targeting miRNA may comprise the sequence: GAAACCCAGCAGACAATGTAGCT (SEQ ID NO: 2402; miR-221-3p) or AAACATCACTGCAAGTCTTAA (SEQ ID NO: 2403; miR-499a). Novel Promoters The present invention provides novel promoters, that may be linked to the nucleic acid sequence so that the transcription preferably occurs within myocytes. Promoter regions Attorney Docket No.: PAT059898-WO-PCT / KATE-037 enable the host cells to replicate the AAV delivered nucleic acid only in those cell types and tissues or organs in which the desired protein should be created. Here, the muscle specific promoter is included because it is principally desired that the proteins only be translated in myocytes. Specificity of the cell type into which the nucleic acid is delivered and thus the proteins translated is desired because of the adverse effects that may ensue from delivering the nucleic acid and having it translated in cells in which that nucleic acid and thus protein is not needed. Accordingly, aspects of the present invention may provide a promoter / enhancer having a sequence having at least 95% percent sequence identity with a sequence selected from SEQ ID NOs: 2404-2407. Promoter 1 TTTAAAATAAGCTGCATACATCCACTTATTCAGAATGATAGCTTTTTATTTCAGGTCAAGAGGGACAGC CCAGAGTCTAAGAGGATCATATTCAGCTCACAGCTGCAGTTCTCAAATTACACTGATCAGGCAGATTCTGACAAA TCCAACACTCTTGGTGCCTGCCTGCCCCTACACCTTTAAAACCCTTAAAGCAGTAAGCCACTACGGGTCTAGGCT GCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCC CCCCCCCCAACACCTGCTGCCTGCTAAAAATAACCCTGTCCCTGGTGGATATCAAGGCTGTGGGGGACTGAGGGC AGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGG CGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGG CAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAG CTGAAAGCTCATCTACTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCT CTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCC AGCCAGC (SEQ ID NO: 2404) Promoter 2 GTAGCTTTAGCCGGCTTGCTTGCTTTTGGAGTCTGCCCCTCGTATGTACAGATCGGGGTCAGCCTGAGA CGTGGGCGGGTTCCTTCCCAGGCGTTGCAGCTCTCTTTCCTCCCTCACTCTCCAGTTCCTCTGGCTCAGTGAGGG ATTTGGGATTTCTGTGTGTGGGGCATGGACAGATACTACTCTTAGTGAAAAGCTGGACAAGGTGGAGTAGAGCAT CAAGGGTGAGTGCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGT TATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGCTAAAAATAACCCTGTCCCTGG TGGATATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGAC TCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTT AGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGT CCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTACTCTCAGGGGCCCCTCCCTGGGGACAGCCC CTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCAC CTCCACAGCACAGACAGACACTCAGGAGCCAGCCAGC (SEQ ID NO: 2405) Promoter 3 CCCCTGACCTTTGCGGTGGAAATCCTGAGCCCAGGCTGAGATGAGCTCAGCTGATCCTTCTCTCAGAGA CAGCTGGAGTACAGTGCTGCTCAGCCCCCAGCTCCTGAGTGTCTGGAGCAAACAGCTGGGAGAGAGGTAGAATTC ACTCCTGGATTAGAGCCAAAAACTGCCTGGCAGAAACCCCCAGGATCCTGTTTCTCCTGAGGGAGGAGCGGGGGA GCCCGGGGGCGAGAAACCCACAGCACAGGGAAGGGAAGGGCAGCCTTGAAACTGCAAGTTGGGAGATCACGGTTT CCTCACGTGGCCACCATGAGGGCTGAGGCTGTAGGCTGGCCGCTCCTGCCCCTCCCGACCACCCCCTCAGGCTTC CAGCCTCCTTGCTCAGCCACCTAGGCTGGGCTTTCAGGTTCACAGGCAGCCGGCCCTACAACATGGAGGCCCAGG CTGGGCTTTCTTCAGGAGTGGCATCTAAACTTAGGAGAGGGGAACACGTTTCACCCGAATCTGGGCTAGCAGTGT GTTGGTTAAATGGCCCCTGAGTAGGTGTGGGGCATGGCAGAGGTGCAGGAGTGGGTGTCCGAGGATGCAGCCAAC TCATCTCCAAACAGCTCCTTTTCTTTTCCCCAGTGGGCTGCATTCCCAGACTGGTATTTTAGTTGGTGTGACAGA Attorney Docket No.: PAT059898-WO-PCT / KATE-037 GTCCCAGAGTCATCTGGCCCAGGGGCTTGCACCTGCGCCAGTCCTTCCCTGTCCACCCCTGCCCGTCTCCAGGCG CTCCTATAAAGGGCTGAGCAGTTCAGCTCTTCTCACTGGGGGGTGTGAGGAACAGG (SEQ ID NO: 2406) Promoter 4 TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATA ACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCC CATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGT ACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGC CCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGACAAG GTGGAGTAGAGCATCAAGGGTGAGTTGCCTAGGCCATCAGAGTAGTTTTGGGAAAACCACTGAGAGTGAGGCAAG CCACGCTGGAAGGTGAAAACTGACAGGTAGGGAGATGGAGGGGCTAAGGCCTGTTTCACCACAGCACGGTGGACC TGTGCTTCTGCAGATGTGGAGGGGGTGGCCGCCCCTCACTTTCCAGGAGGTAGAGAGCAAAAGCCCTTCCAATGA CCTTGGTACCTACTGTGCCCTTGATCTCGCGTTCCTAGCTATCTCATGGGTTCTGCACCGGTGCCTCCTCCTGCC CTCGGTAAGGCACCTTCTAGGTCCAGCTGTGGGGCAGGGAGCGACAGGCAGGAATGATCTGACCCCTTTGGCCGG GCACGGTGACAGATGGGCTGAAAGATGAGTCACTAAACATGATCTGGGGTGCGGGGCGGGGGTGCAGCTCAGTTT CAGCCCCTCGCGCCGGGGAGGATGACCGTGCAGCTTTATATAGCCCCTGAGCCCTATATAAGCAAGTCAGAGGCC GGGGCTCGTCCGACAGGAGCCCTCAAGCTGATCTGGTCGGGACCGGATACATTATTAACCCCAGTGCAGTAGGGT CCCCAGGGGCAACCTGCCCCACAGC (SEQ ID NO: 2407) In some embodiments, the recombinant nucleic acid comprises a muscle specific promoter. Non-limiting examples of muscle specific promoters include a CK8 promoter, a desmin promotor, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, and a TTNI2 promoter. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404- 2407. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2402-2404. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2403. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any Attorney Docket No.: PAT059898-WO-PCT / KATE-037 one of SEQ ID NOs: 2442-2451. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2442-2451. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2442. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2443. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2444. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2445. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2446. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2447. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2448. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2449. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2450. In some embodiments, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of SEQ ID NO: 2451. Recombinant nucleic acid described herein can include a promoter in combination with an enhancer. For example, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2423-2432. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of any one of SEQ ID NOs: 2423- 2432. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2423. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2424. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer- promoter sequence of SEQ ID NO: 2425. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2426. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2427. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2428. In some Attorney Docket No.: PAT059898-WO-PCT / KATE-037 embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2429. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2430. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2431. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer-promoter sequence of SEQ ID NO: 2432. Recombinant nucleic acid described herein can include an enhancer. For example, the recombinant nucleic acid comprises or consists of an enhancer sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2433-2441. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of any one of SEQ ID NOs: 2433-2441. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2433. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2434. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2435. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2436. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2437. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2438. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2439. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2440. In some embodiments, the recombinant nucleic acid comprises or consists of an enhancer sequence of SEQ ID NO: 2441. Engineered Capsid Proteins The present invention also provides novel capsid protein variants for viral vectors that de-target liver tissue and target skeletal muscle at the same time. Aspects of the present invention provide adeno-associated virus (AAV) vectors comprising a capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2421). In the capsid protein, RGDR (SEQ ID NO: 2421) may be inserted after amino acid 455 in reference to an AAV9 capsid or equivalent position in another AAV capsid. AAV capsid proteins may comprise the Attorney Docket No.: PAT059898-WO-PCT / KATE-037 amino acid sequence X1NX2X3X4RGDRX5X6L (SEQ ID NO: 1), wherein X1, X2, X3, X4, X5, and X6may be any amino acid. In aspects of the invention, X1 may be an amino acid selected from the group consisting of: A, I, F, G, H, L, M, Q, S, T, and V. In preferred aspects of the invention, X1may be an amino acid selected from the group consisting of: A, I, L, M, S, and V. In aspects of the invention, X2may be an amino acid selected from the group consisting of A, G, S, T, and Y. In aspects of the invention, X3may be an amino acid selected from the group consisting of S, N, G, and P. In preferred aspects of the invention, X3 may be S. In aspects of the invention, X4may be an amino acid selected from the group consisting of A, G, H, I, M, S, T, and V. In aspects of the invention, X5may be an amino acid selected from the group consisting of A, G, and Q. In aspects of the invention, X6may be an amino acid selected from the group consisting of A, I, L, M, N, and Y. In preferred aspects of the invention, X6 may be selected from the group consisting of A, S, and Y. X1 may is located at amino acid 451, X2 located at amino acid 453, X3 located at amino acid 454, X4 is located amino acid 455, and RGDRX5X6L (SEQ ID NO: 2422) inserted after amino acid 455 in reference to an AAV9 capsid or equivalent position in another AAV capsid. In aspects of the invention, two amino acids from X1, X2, X3, and X4are wild type amino acids in reference to an AAV9 capsid or equivalent position in another AAV capsid and two amino acids from X1, X2, X3, and X4are not wild type amino acids. For example, capsid proteins variants of the invention may comprise a sequence as set forth in Table 1a. Notably, capsid protein variants on the invention comprise deletions, substitutions, and / or insertions relative to wild-type viral vector capsids. In aspects of the invention, the capsid protein comprises an amino acid sequence selected from Table 1a and the amino acid sequence is in hypervariable region IV (HVR IV) relative to wild-type AAV-9. The capsid protein variant may comprise substitutions at amino acids 451-455 relative to a wild-type AAV9 vector capsid. For example, the substitutions at amino acids 451-455 relative to a wild-type AAV9 vector capsid may be an amino acid sequence selected from column 1 of Table 1b. In aspects of the invention, the capsid protein variant may further comprise an insert. For example, the capsid protein may comprise a 7- Attorney Docket No.: PAT059898-WO-PCT / KATE-037 mer insert selected from column 2 of Table 1b. The insert may be in the location after amino acid 455 relative to a wild-type AAV9 vector. Advantageously, viral vectors comprising an amino acid sequence of the invention exhibit increased muscle tropism and / or reduced liver tropism as compared to a wild-type AAV vector (e.g., wild-type AAV9 vector). In aspects of the invention, the capsid protein further comprises a deletion of G267 in reference to a wild-type AAV9 capsid or equivalent position in another AAV capsid. Advantageously, the vector may exhibit reduced liver tropism and / or increased muscle tropism as compared to a wild-type AAV vector (e.g., wild-type AAV-9 vector). As described, for the HVR IV variants, the 5 amino acids upstream of the “RGDR” (SEQ ID NO: 2421) are at positions 451-455 relative to a wild-type AAV9 capsid. The 5 amino acids upstream of the “RGDR” are shown in column 1 of Table 1b. The 7-mer insert for HVR IV variants starts with “RGDR” (SEQ ID NO: 2421) and is inserted after amino acid 455 relative to a wild-type AAV9 capsid. The 7-mer insert for HVR IV variants are shown in column 2 of Table 1b. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNASI (SEQ ID NO: 990) at positions 451-455, the amino acid sequence of RGDRQLL (SEQ ID NO: 1789) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNASM (SEQ ID NO: 997) at positions 451-455, the amino acid sequence of RGDRQAL (SEQ ID NO: 1796) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNASM (SEQ ID NO: 998) at positions 451-455, the amino acid sequence of RGDRQSL (SEQ ID NO: 1797) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNAST (SEQ ID NO: 1014) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 1813) inserted after amino acid 455, a Attorney Docket No.: PAT059898-WO-PCT / KATE-037 deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNGST (SEQ ID NO: 1055) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 1854) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of LNYST (SEQ ID NO: 1178) at positions 451-455, the amino acid sequence of RGDRQAL (SEQ ID NO: 1977) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of SNAST (SEQ ID NO: 1343) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 2142) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of SNASV (SEQ ID NO: 1349) at positions 451-455, the amino acid sequence of RGDRQAL (SEQ ID NO: 2148) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9. In some embodiments, the capsid protein comprises, relative to the wild type AAV9 capsid protein, the amino acid sequence of VNGST (SEQ ID NO: 1547) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 2346) inserted after amino acid 455, a deletion of the amino acid G267, and the remainder of the capsid is otherwise identical to wild type AAV9.

[0002] Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Table 1a: HVR IV Capsid Variants Amino Acid SEQ SEQ Sequence ID Amino Acid ID NO: Sequence NO: Amino Acid SEQ Sequence ID NO: 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Amino Acid SEQ SEQ SEQ I Amino Acid Amino Acid Sequence D Sequenc ID ID NO: e NO: Sequence NO: 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Amino Acid SEQ SEQ SEQ I Amino Acid Amino Acid Sequence D Sequenc ID ID NO: e NO: Sequence NO: 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Amino Acid SEQ SEQ SEQ I Amino Acid Amino Acid Sequence D Sequenc ID ID NO: e NO: Sequence NO: 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Amino Acid SEQ SEQ SEQ I Amino Acid Amino Acid Sequence D Sequenc ID ID NO: e NO: Sequence NO: 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Amino Acid SEQ SEQ SEQ I Amino Acid Amino Acid Sequence D Sequenc ID ID NO: e NO: Sequence NO: 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Amino Acid SEQ Amino Acid SEQ Amino A SEQ Sequence ID ID cid ID NO: Sequence NO: Sequence NO: 9 0 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Table 1b: Split Amino Acid Sequences from Table 1a 5 aa SEQ SEQ Substitution ID 7 aa Insert ID : 5 aa SEQ SEQ stitution ID 77Sub aa Insert ID 89012345678901234567890123456789012345 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 567890123456789012345678901234567890123 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 345678901234567890123456789012345678901 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 123456789012345678901234567890123456789 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 901234567890123456789012345678901234567 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 789012345678901234567890123456789012345 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 567890123456789012345678901234567890123 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 345678901234567890123456789012345678901 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 123456789012345678901234567890123456789 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ SEQ SEQ Substitution ID 7 aa Insert ID 5 aa Substitution ID 7 aa Insert ID : 901234567890123456789012345678901234567 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 5 aa SEQ SEQ Substitution ID 7 aa Insert ID

[0003] Attorney Docket No.: PAT059898-WO-PCT / KATE-037 BRIEF DESCRIPTION OF THE DRAWINGS FIG.1 shows a plot of results from a massively parallel reporter assay (MPRA) of relative expression in NHP heart and skeletal muscle cells for enhancer-promoter combinations. FIG.2 shows a plot of the expression profile of miR-221-3p and miR-499-5p in heart, skeletal muscle, liver, and dorsal root ganglion (DRG) of mice, NHPs, and humans. FIG.3 shows a graph of results expression from promoter-enhancer combinations together with miR-221, miR-499, or no miRNA binding sites in NHP skeletal muscle or heart tissue. FIG.4A shows results from capillary electrophoresis of mouse gastrocnemius muscle to quantify 3xFLAG-hCAPN3 transgene protein expression following administration of Composition 1 of the invention. FIG.4B shows a graph of 3xFLAG-hCAPN3 expression in mice skeletal muscle following administration Composition 1 of the invention. FIG.5A shows results from capillary electrophoresis of mice hearts to quantify 3xFLAG-hCAPN3 transgene protein expression following administration of Composition 1 of the invention. FIG.5B shows a graph of 3xFLAG-hCAPN3 expression in mice hearts following administration of Composition 1 of the invention. FIG.6A shows a graph of 3xFLAG-hCAPN3 transgene expression in mouse skeletal muscle and heart after systemic administration of Composition 1. FIG.6B shows images from immunofluorescence analysis of skeletal muscle from mice administered Composition 1. Skeletal muscle was stained with anti-FLAG antibody to visualize 3xFLAG-hCAPN3, fluorescently tagged wheat germ agglutinin (WGA) to visualize the boundaries of muscle fibers by binding to glycoprotein on cell membranes, and alpha actinin to visualize the Z-lines within the sarcomeres of muscle fibers. Images show skeletal muscle magnified at 10x (top panel) and 100x (lower panel). FIG.7 shows mRNA expression in the heart and skeletal muscle of non-human primates (NHPs) following administration Composition 2. FIGs.8A-8D shows results from capillary electrophoresis and immunodetection analysis of NHP triceps, gastrocnemius, vastus lateralis, and heart to quantify 3xFLAG- hCAPN3 transgene protein expression following administration of Composition 2. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 FIGs.9A-9C show graphs quantifying 3xFLAG-hCAPN3 expression (normalized to Vinculin) in NHP triceps, gastrocnemius, and vastus lateralis following administration of Composition 2. FIG.10 shows results from capillary electrophoresis and immunodetection analysis of in vitro cleavage reactions. V5-i: intact cleavage substrate hCAPN3(C129A)-V5; V5-c: cleaved cleavage substrate hCAPN3(C129A)-V5. DETAILED DESCRIPTION The present disclosure is directed to recombinant nucleic acid compositions (e.g., adeno-associated viral (AAV) compositions) and methods for treating limb girdle muscular dystrophy 2A (LGMD2A). For example, aspects of the invention provide a formulation comprising an AAV particle comprising (e.g., encapsidating) a nucleic acid comprising a promoter and a sequence encoding the calpain 3 gene (CAPN3). Aspects of the invention provide a composition comprising an adeno-associated virus (AAV) particle comprising an engineered capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2421). The capsid protein encapsidates a nucleic acid molecule (e.g., a cargo) comprising a promoter and a sequence encoding a CAPN3 transgene. The nucleic acid may further comprise a heart de-targeting miRNA binding site. The nucleic acid may further comprise a dorsal root ganglia (DRG) de-targeting miRNA binding site. LGMD2A / Calpainopathy Limb-girdle muscular dystrophy type 2A (LGMD2A) / calpainopathy, is a progressive muscle wasting disease caused by defects in the calpain-3 (CAPN3) gene. The CAPN3 gene encodes the calpain-3 protein, which is involved in the maintenance of muscle integrity and function. The calpain-3 protein is approximately 94-kDa and 821 amino acids in length. Aspects of the invention provide a nucleic acid molecule comprising a sequence encoding a CAPN3 transgene. The sequence encoding a CAPN transgene may comprise a sequence having the sequence identity of SEQ ID NO: 2408: ATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCAGGGCCAGTT CCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGTGGCATCTATTCAGCCATCATCAGC CGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACATTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTT CTTTATGTGGACCCTGAGTTCCCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTC TGGAAGAGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAACTGACATCTGTCAA GGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTGAACCAGCACCTTCTTTTCCGAGTC ATACCCCATGATCAAAGTTTCATCGAAAACTACGCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGG Attorney Docket No.: PAT059898-WO-PCT / KATE-037 GTGGACGTGGTTATAGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAAT GAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGCTCTGAAAGGTGGGAAC ACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAGATCAGGGATGCTCCTAGTGACATG TACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCCCTCATGGGCTGCTCCATTGATGATGGCACGAACATGACC TATGGAACCTCTCCTTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTG CTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTCCGGTTCAGTATGAG ACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGGCTGGATGAGGTCCCGTTCAAAGGT GAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGG AAGGACTGGAGCTTTGTGGACAAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTGG ATGTCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCGATGCTCTGCAGTCT GACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGGGGTTGCTCTGCCGGAGGCTGCCGC AACTTCCCAGATACTTTCTGGACCAACCCTCAGTACCGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGAC TCGGAGGTGATTTGCAGCTTCCTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGT CTCTTCACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCAGCACCTGCAGAAGGAC TTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGC CTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTC TTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAA ACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAG GGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGT GAGGAACAGCAACAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTC AAGAAGGTCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGT AGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTCTGGAACAAG ATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGCACCATCAACAGCTACGAGATGCGA AATGCAGTCAACGACGCAGGATTCCACCTCAACAACCAGCTCTATGACATCATTACCATGCGGTACGCAGACAAA CACATGAACATCGACTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCA TTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCATGTATGCCTGA (SEQ ID NO: 2408) In aspects of the invention, the nucleic acid molecule may comprise a sequence having at least 85%, 86%, 87%, 88% 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sequence identity of SEQ ID NO: 2408. In some embodiments, the nucleic acid comprises SEQ ID NO: 2408. Calpain 3 is unique from other calpain proteases in that it is relatively specific to muscle tissue. The function of the calpain-3 enzyme is not well understood, however it is suggested that calpain 3 may act as both a protease and a structural protein. As a protease, it may cleaves protein of the sarcomere and cytoskeleton, designating them to be degraded by proteasomes, a part of muscle remodeling. As a structural protein, calpain-3 may play a role in stabilization of triad protein complexes which play a role in converting electrical excitation into calcium release. Typically, LGMD2A follows an autosomal recessive inheritance pattern, requiring both CAPN3 alleles to be mutated for disease to occur. In rare cases, CAPN3 mutations may also follow an autosomal dominant inheritance pattern. Three subtypes of the autosomal recessive form of LGMD2A have been described. The most frequent subtype is pelvifemoral (Leyden-Möbius) LGMD, characterized by early onset weakness in the pelvic girdle and later in the shoulder girdle. Another subtype is Attorney Docket No.: PAT059898-WO-PCT / KATE-037 scapulohumeral (Erb) LGMD, characterized by generally later onset and milder weakness of the shoulder girdle and later in the pelvic girdle. Finally, the subtype hyperCKemia is characterized by no symptoms other than elevated serum creatine kinase levels. MicroRNA MicroRNAs are small, single-stranded, non-coding RNA molecules. miRNAs base- pair to complementary sequences in mRNA molecules, thereby producing post- transcriptional regulation of gene expression. Typically, miRNA molecules silence messenger RNA (mRNA) translation by facilitating a process that leads to cleavage of mRNA strand into two pieces or destabilization of the mRNA by shortening its poly(A) tail. miRNAs are typically ~22 nt and are expressed in a cell and tissue type specific manner. miRNAs resemble small interfering RNAs (siRNAs), however miRNAs derive from regions of RNA transcripts that fold back on themselves to form short hairpins. Animal miRNAs are initially transcribed as part of one arm of an RNA stem-loop that in turn forms part of a several hundred nucleotide-long miRNA precursor termed a pri-miRNA. A single pri-miRNA may contain from one to six miRNA precursors. These hairpin loop structures are typically composed of about 70 nucleotides each. Each hairpin is flanked by sequences necessary for efficient processing. The pre-miRNA hairpin is typically cleaved by the RNase enzyme Dicer. The RNase interacts with 5' and 3' ends of the hairpin and cuts away the loop joining the 3' and 5' arms, resulting in a miRNA:miRNA duplex about 22 nucleotides in length. Overall hairpin length and loop size influence the efficiency of Dicer processing. Although either strand of the duplex may potentially act as a functional miRNA, only one strand is generally incorporated into the RNA-induced silencing complex (RISC) where the miRNA and its mRNA target interact The present invention provides miR-338-3p, miR-138-5p, and miR-9-5p functional sites that inhibit expression of a transgene to selectively inhibit expression of the transgene in the dorsal root ganglia (DRG). I. Recombinant Nucleic Acids Aspects of the present disclosure provide a recombinant nucleic acid comprising a promoter, a sequence encoding CAPN3 or biologically active fragment thereof, at least one heart de-targeting miRNA binding site, and at least one DRG de-targeting miRNA binding Attorney Docket No.: PAT059898-WO-PCT / KATE-037 site. In some embodiments, the recombinant nucleic acid can further comprise an intron and / or a PolyA signal. Alternatively, or in addition to, the recombinant nucleic acid can further comprise a 5′ inverted terminal repeat (ITR) and a 3′ ITR. Various promoters, including inducible promoters and constitutive promoters, may be used to drive expression from the recombinant nucleic acids described herein. Non-limiting examples of promoters that can be used in the recombinant nucleic acids disclosed herein include a cytomegalovirus (CMV) promoter, a chicken β-actin (CBA) promoter, an alpha-1 antitrypsin (hAAT) promoter, and any promoter derived from an immunoglobulin gene, SV40, or other tissue specific genes. In some embodiments, the promoter is tissue-specific such that, in a multi-cellular organism, the promoter drives expression only in a subset of specific cells. For example, the promoter is a muscle specific promoter. Non-limiting examples of muscle specific promoters include a CK8 promoter, a desmin promoter, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, or a TTNI2 promoter. In some embodiments, the promoter is a novel promoter described herein. For example, the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. In another example, the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407. Recombinant nucleic acids described herein comprise a sequence encoding CAPN3 or biologically active fragment thereof. Upon administration of any of the recombinant nucleic acids described herein, CAPN3 protein (e.g., full-length CAPN3 protein or biologically active fragment thereof) is expressed in muscle cells or muscle tissue to produce a therapeutic effect. In some embodiments, the sequence encoding CAPN3 or biologically active fragment thereof comprises or consists of a sequence encoding human CAPN3 or biologically active fragment thereof. For example, the sequence encoding CAPN3 or biologically active fragment thereof comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408. In another example, the sequence Attorney Docket No.: PAT059898-WO-PCT / KATE-037 encoding CAPN3 or biologically active fragment thereof comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408. Any of the sequences encoding CAPN3 or biologically active fragment thereof described herein can produce a CAPN3 protein that retains its biological activity (e.g., protease activity). For example, the sequence encoding CAPN3 or biologically active fragment thereof comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408, and CAPN3 or biologically active fragment thereof retains biological activity (e.g., protease activity). In another example, the sequence encoding CAPN3 or biologically active fragment thereof comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408, and CAPN3 or biologically active fragment thereof retains biological activity (e.g., protease activity). Recombinant nucleic acids described herein comprise at least one heart de-targeting miRNA binding site (e.g., at least one, at least two, at least three, at least four or more heart de-targeting miRNA binding sites) and at least one DRG de-targeting miRNA binding site (e.g., at least one, at least two, at least three, at least four or more DRG de-targeting miRNA binding sites). Any heart de-targeting miRNA binding site suitable for binding a heart de-targeting miRNA can be included in the recombinant nucleic acids described herein. In some embodiments, the heart de-targeting miRNA binding site can comprise or consist of a binding site for miR-221 (e.g., miR-221-3p) or miR-499 (e.g., miR-499-5p). In some embodiments, the heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. In some embodiments, the heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. In some embodiments, when the recombinant nucleic acid comprises more than one heart de-targeting miRNA binding site, the more than one heart de-targeting miRNA binding site can have the same sequence or a different sequence. For example, when the recombinant nucleic acid comprises a first, a second, a third, and a fourth heart de-targeting miRNA binding site, each of the hearth de-targeting miRNA Attorney Docket No.: PAT059898-WO-PCT / KATE-037 binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. Alternatively, one or more of the heart de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; and one or more of the heart de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403. Any DRG de-targeting miRNA binding site suitable for binding a DRG de-targeting miRNA can be included in the recombinant nucleic acids described herein. In some embodiments, the DRG de-targeting miRNA binding site can comprise or consist of a binding site for miR-338 (e.g., miR-338-3p), miR-138 (e.g., miR-138-5p), or miR-9 (e.g., miR-9-5p). In some embodiments, the DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, the DRG de- targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In some embodiments, when the recombinant nucleic acid comprises more than one DRG de-targeting miRNA binding site, the more than one DRG de-targeting miRNA binding site can have the same sequence or a different sequence. For example, when the recombinant nucleic acid comprises a first and a second DRG de-targeting miRNA binding site, each of the DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. Alternatively, the first and the Attorney Docket No.: PAT059898-WO-PCT / KATE-037 DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399 and SEQ ID NO: 2400, respectively, or vice versa; the first and the DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399 and SEQ ID NO: 2401, respectively, or vice versa; or the first and the DRG de-targeting miRNA binding sites can comprise or consist of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400 and SEQ ID NO: 2401, respectively, or vice versa. The at least one heart de-targeting miRNA binding site and the at least one DRG de- targeting miRNA binding site can be positioned in the recombinant nucleic acids described herein at any location suitable for binding a heart de-targeting miRNA or a DRG de-targeting miRNA, respectively. For example, the recombinant nucleic acid can comprise at least one heart de- targeting miRNA binding site that is upstream of a sequence encoding CAPN3 or biologically active fragment thereof, and at least one heart de-targeting miRNA binding site and at least one DRG de-targeting miRNA binding site that is downstream of the sequence encoding CAPN3 or biologically active fragment thereof. In another example, the recombinant nucleic acid can comprise at least one DRG de- targeting miRNA binding site that is upstream of a sequence encoding CAPN3 or biologically active fragment thereof, and at least one heart de-targeting miRNA binding site and at least one DRG de-targeting miRNA binding site that is downstream of the sequence encoding CAPN3 or biologically active fragment thereof. In yet another example, the recombinant nucleic acid can comprise at least one DRG de-targeting miRNA binding site and at least one heart de-targeting miRNA binding site that is upstream of a sequence encoding CAPN3 or biologically active fragment thereof. In yet another example, the recombinant nucleic acid can comprise at least one DRG de-targeting Attorney Docket No.: PAT059898-WO-PCT / KATE-037 miRNA binding site and at least one heart de-targeting miRNA binding site that is downstream of a sequence encoding CAPN3 or biologically active fragment thereof. Recombinant nucleic acids described herein can further comprise an intron to increase overall efficiency and output of gene expression. Preferably, the intron is positioned between the promoter and transgene (e.g., CAPN3 transgene) in a 5′ to 3′ orientation. Non-limiting examples of introns include a simian virus 40 (SV40) intron sequence, a minute virus of mice (MVM) intron, a RK intron, a β-globin intron, and / or a chicken β-actin (CBA) intron, including functional variants or fragments thereof. In some embodiments, the intron is a SV40 intron, including functional variants or fragments thereof. In some embodiments, the SV40 intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410. In some embodiments, the SV40 intron comprises or consists of a nucleic acid sequence comprising at least one, two, or three, but no more than four, modifications, e.g., substitutions, relative to the nucleic acid sequence of SEQ ID NO: 2410. In some embodiments, the SV40 intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410. Recombinant nucleic acids described herein can further comprise a polyadenylation (PolyA) signal sequence or functional fragment thereof, e.g., a fragment capable of measurably increasing expression as compared to expression in its absence. Non-limiting examples of PolyA signal sequences include a bovine growth hormone polyadenylation (bgh- PolyA) signal, a synthetic PolyA signal, and an SV40 PolyA signal. In some embodiments, the PolyA signal comprises a bgh-PolyA signal, and the bgh- PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411. In some embodiments, the PolyA signal comprises a bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411. Recombinant nucleic acids described herein can comprise one or more PolyA signal sequences or functional fragments thereof. In some embodiments, the recombinant nucleic Attorney Docket No.: PAT059898-WO-PCT / KATE-037 acid described herein comprises a polyA sequence between the 3′ end of a sequence encoding the CAPN3 transgene and the 5′ end of the 3′ ITR. Recombinant nucleic acids described herein can comprise one or more ITRs, e.g., two ITRs, with one upstream and the other downstream of a sequence encoding CAPN3 or biologically active fragment thereof and / or the other elements discussed above (e.g., a promoter, at least one heart de-targeting miRNA binding site, at least one DRG de-targeting miRNA binding site). An ITR sequence may be wild-type, or it may comprise one or more mutations, e.g., by the insertion, deletion, or substitution of nucleotides, as long as the sequences retain one or more function of a wild-type ITR, such as providing for functional rescue, replication and packaging. In some embodiments, a recombinant nucleic acid as described herein can comprise two ITR sequences, each of which is wild-type, variant, or modified ITR sequences. In some embodiments, a recombinant nucleic acid as described herein can comprise two ITR sequences, which are different (e.g., one wild-type ITR sequence and one variant or modified ITR sequence). For example, the “left” or 5′ ITR is a modified ITR sequence that allows for production of self-complementary genomes, and the “right” or 3′ ITR is a wild-type ITR sequence. In some embodiments, the “right” or 3′ ITR is a modified ITR sequence that allows for the production of self-complementary genomes, and the “left” or 5′ ITR is a wild-type ITR sequence. In some embodiments, a recombinant nucleic acid can comprise ITR sequences from any AAV serotype suitable for replication and packaging of the virus. Non-limiting examples AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh, AAVrh10, AAVrh74, AAV-DJ, AAV-DJ / 8, Anc80, AAV7m8, or any derivative, hybrid or chimeric serotype thereof. In some embodiments, the recombinant nucleic acid comprises one or more ITRs derived from AAV2. The nucleotides in an ITR sequence may be in a forward or reverse orientation. In some embodiments, the ITR sequences are both wild-type, variant, or modified AAV2 ITR sequences. In some embodiments, the ITR sequences are different (e.g., one ITR is a wild-type AAV2 sequence and one ITR is variant or modified AAV2 ITR sequence). In some embodiments, the “left” or 5′ ITR is a modified AAV2 ITR sequence that allows for production of self-complementary genomes, and the “right” or 3′ ITR is a wild-type AAV2 ITR sequence. In some embodiments, the “right” or 3′ ITR is a modified AAV2 ITR sequence that allows for the production of self-complementary genomes, and the “left” or 5′ Attorney Docket No.: PAT059898-WO-PCT / KATE-037 ITR is a wild-type AAV2 ITR sequence. In some embodiments, the 5′ ITR is an AAV25’ ITR as described in McCarty, D.M., et al., Gene Ther (2001), which is incorporated by reference in its entirety. In some embodiments, the 3′ ITR is an AAV23′ ITR as described in Rolling, F. & Samulski, R.J. Molecular biotechnology (1995), which is incorporated by reference in its entirety. In some embodiments, the 3' ITR may comprise a deletion of the terminal resolution site (dTR), which inhibits Rep protein nicking of the single stranded viral genome. The presence of the dTR in the 3' ITR increases self-complementary binding of the viral genome to itself, which it may do because of its small size that allows for a double- stranded viral genome to be packaged within a viral capsid. In some embodiments, the recombinant nucleic acid comprises a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the recombinant nucleic acid comprises a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409. In some embodiments, the recombinant nucleic acid comprises a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412. In some embodiments, the recombinant nucleic acid comprises a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. Example Recombinant Nucleic Acids Non-limiting examples of recombinant nucleic acids for use in methods described herein are provided below. In some examples, the recombinant nucleic acid comprises a promoter (e.g., a promoter described herein) and a sequence encoding CAPN3 (e.g., hCAPN3). For example, the recombinant nucleic acid comprises: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% , or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; and Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of SEQ ID NO: 2404 and a sequence encoding CAPN3 comprising or consisting of SEQ ID NO: 2408. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of SEQ ID NO: 2405 and a sequence encoding CAPN3 comprising or consisting of SEQ ID NO: 2408. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of SEQ ID NO: 2406 and a sequence encoding CAPN3 comprising or consisting of SEQ ID NO: 2408. In another example, the recombinant nucleic acid comprises a promoter comprising or consisting of SEQ ID NO: 2407 and a sequence encoding CAPN3 comprising or consisting of SEQ ID NO: 2408. In some examples, the recombinant nucleic acid comprises, optionally from 5′ to 3′, a promoter (e.g., a promoter described herein), a sequence encoding CAPN3 (e.g., hCAPN3), a heart de-targeting miRNA binding site, and a DRG de-targeting miRNA binding site. For example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; and Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2405; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2407; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2405; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least Attorney Docket No.: PAT059898-WO-PCT / KATE-037 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2406; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2407; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least Attorney Docket No.: PAT059898-WO-PCT / KATE-037 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; and Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; at least one heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; and at least one DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400. In some examples, the recombinant nucleic acid comprises, optionally from 5′ to 3′, a 5′ ITR; a promoter; a first heart de-targeting miRNA binding site; an intron; a sequence encoding CAPN3; a second heart de-targeting miRNA binding site; a third heart de-targeting miRNA binding site; a first DRG de-targeting miRNA binding site; a fourth heart de- targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a PolyA signal; and a 3′ ITR. For example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least Attorney Docket No.: PAT059898-WO-PCT / KATE-037 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412. In another example, the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at Attorney Docket No.: PAT059898-WO-PCT / KATE-037 least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2413-2420. In another example, the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2413-2420. II. Recombinant Expression Vectors Any of the recombinant nucleic acids described herein can be delivered to a cell (e.g., a muscle cell), a tissue (e.g., muscle tissue), or subject (e.g., human subject) without or with the use of a delivery system (e.g., recombinant expression vector (e.g., viral vector (e.g., AAV (e.g., rAAV))). (a) Recombinant Expression Vectors Any of the recombinant nucleic acids described herein can be included in a recombinant expression vector (e.g., a viral vector (e.g., an AAV vector (e.g., a rAAV vector))). Recombinant expression vectors can be delivered into a cell, a tissue, or a subject using any method known in the art or described herein. A recombinant expression vector can be an organic or inorganic molecule. A recombinant expression vector can be a small molecule (i.e., <5 kD) or a macromolecule (i.e., >5 kD). The recombinant expression vector can comprise DNA, RNA, or both DNA and RNA. The recombinant expression vector can be a DNA vector, a circular vector, or a plasmid. The recombinant expression vector can be double stranded or single stranded. In some embodiments, a recombinant expression vector (e.g., a viral vector (e.g., an AAV (e.g., a rAAV))) disclosed herein can exhibit higher expression of the recombinant nucleic acid (e.g., expression of CAPN3 or biologically active fragment thereof) in a specific tissue type as compared to the expression of the same vector in a different tissue type. For example, the recombinant expression vector can exhibit higher expression of CAPN3 or biologically active fragment thereof in a skeletal muscle tissue or cell as compared to the expression of the same vector in a non-skeletal muscle tissue (e.g., heart, liver) or cell (e.g., heart cell, liver cell). In some embodiments, the vector exhibits at least about 1.2 fold, at least about 1.5 fold, at least about 1.75 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold higher expression of the recombinant nucleic acid (e.g., expression of CAPN3 or biologically active fragment thereof) in a skeletal muscle tissue or Attorney Docket No.: PAT059898-WO-PCT / KATE-037 cell as compared to the expression of the same vector in a non-skeletal muscle tissue (e.g., heart, liver) or cell (e.g., heart cell, liver cell). In some embodiments, the recombinant expression vector is a viral vector. Non- limiting examples of viral vectors for use in compositions and methods described herein include retroviral vectors, adenoviral vectors, lentiviral vectors, adeno-associated viral (AAVs) vectors, herpes simplex viral (HSV) vectors, alphaviral vectors, pox viral vectors, murine leukemia viral vectors, and hybrid viral vectors. (b) Adeno Associated Virus Vectors AAVs are particularly appropriate viral vectors for delivery of genetic material into mammalian cells. AAVs are not known to cause disease in mammals and cause a very mild immune response. Additionally, AAVs are able to infect cells in multiple stages whether at rest or in a phase of the cell replication cycle. Advantageously, AAV DNA is not regularly inserted into the host’s genome at random sites, reducing the oncogenic properties of this vector. AAVs have been engineered to deliver a variety of treatments, especially for genetic disorders caused by single nucleotide polymorphisms (“SNP”). Genetic diseases that have been studied in conjunction with AAV vectors include Cystic fibrosis, hemophilia, arthritis, macular degeneration, muscular dystrophy, Parkinson’s disease, congestive heart failure, and Alzheimer’s disease. The AAV can be used as a vector to deliver engineered nucleic acid to a host and utilize the host’s own ribosomes to transcribe that nucleic acid into the desired proteins. See, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No.4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); and Muzyczka, J. Clin. Invest. 94:1351 (1994). AAVs have some deficiency in their replication and / or pathogenicity and thus can be safer that adenoviral vectors. In some embodiments, the AAV can integrate into a specific site on chromosome 19 of a human cell with no observable side effects. In some embodiments, the capacity of the AAV vector, system thereof, and / or AAV particles can be up to about 4.7 kb. The AAV vector or system thereof can include one or more engineered capsid polynucleotides described herein. AAVs are small, replication-defective, nonenveloped viruses that infect humans and other primate species and have a linear single-stranded DNA genome. Naturally occurring AAV serotypes exhibit liver tropism. As a result, transfection of non-liver tissue with traditional AAV vectors is impeded by the virus’s natural liver tropism. Moreover, because the liver acts to break down substances delivered to a subject, transfection of non-liver tissue Attorney Docket No.: PAT059898-WO-PCT / KATE-037 with unmodified AAV vectors requires higher dosing to provide sufficient viral load to overcome the liver and reach non-liver tissue. More than 30 naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist. AAV serotypes include, but are not limited to, AAV serotypes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13. AAVs may be engineered using conventional molecular biology techniques, making it possible to optimize these particles, for example, for cell specific delivery, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus. AAV vectors can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter, and delivery method. Previous approaches to identify AAV sequences correlated with tropism have relied upon the comparison of highly related extant serotypes with distinct characteristics, random domain swaps between unrelated serotypes, or consideration of higher-order structure, to identify motifs that define liver tropism. For example, mapping determinants of AAV tropism have been carried out by comparing highly related serotypes. One such example is the single- amino acid change (E531K) between AAV1 and AAV6 that improves murine liver transduction in AAV1. See, e.g., Wu et al. (2006) J. Virol., 80(22):11393-7, incorporated by reference herein. Another example is a reciprocal domain swap between AAV2 and AAV8 that alters tropism, but fails to define any robust specific tissue-targeting motifs. See, e.g., Raupp et al. (201) J. Virol., 86(l7):9396-408, incorporated by reference herein. Further, global consideration of structure has only highlighted gross differences between better- or worse-liver-transducers that are more observational than useful in practice. See, e.g., Nam et al (2007) J. Virol., 81(22):12260-71. AAVs exhibiting modified tissue tropism that may be used with the present invention are described in U.S. Patent No.9,695,220, U.S. Patent No.9,719,070; U.S. Patent No. 10,119,125; U.S. Patent No.10,526,584; U.S. Patent Application Publication No.2018- 0369414; U.S. Patent Application Publication No.2020-0123504; U.S. Patent Application Publication No.2020-0318082; PCT International Patent Application Publication No. WO 2015 / 054653; PCT International Patent Application Publication No. WO 2016 / 179496; PCT International Patent Application Publication No. WO 2017 / 100791; and PCT International Patent Application Publication No. WO 2019 / 217911, the entirety of the contents of each of which are incorporated by reference herein. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 The AAV vector or system thereof may include one or more regulatory molecules, such as promoters, enhancers, repressors and the like. In some embodiments, the AAV vector or system thereof can include one or more polynucleotides that can encode one or more regulatory proteins. In some embodiments, the one or more regulatory proteins can be selected from Rep78, Rep68, Rep52, Rep40, variants thereof, and combinations thereof. In some embodiments, the muscle specific promoter can drive expression of an engineered AAV capsid polynucleotide. The AAV vector or system thereof can include one or more polynucleotides that can encode one or more capsid proteins, such as the engineered AAV capsid proteins described elsewhere herein. The engineered capsid proteins can be capable of assembling into a protein shell (an engineered capsid) of the AAV virus particle. The engineered capsid can have a cell-, tissue-, and / or organ-specific tropism. The AAV vector or system thereof can be configured to produce AAV particles having a specific serotype. In some embodiments, the serotype can be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9 or any combinations thereof. In some embodiments, the AAV can be AAV1, AAV2, AAV5, AAV9 or any combination thereof. One can select the AAV of the AAV with regard to the cells to be targeted; e.g., one can select AAV serotypes 1, 2, 5, 9 or a hybrid capsid AAV1, AAV2, AAV5, AAV9 or any combination thereof for targeting brain and / or neuronal cells; and one can select AAV-4 for targeting cardiac tissue; and one can select AAV8 for delivery to the liver. Thus, in some embodiments, an AAV vector or system thereof capable of producing AAV particles capable of targeting the brain and / or neuronal cells can be configured to generate AAV particles having serotypes 1, 2, 5 or a hybrid capsid AAV1, AAV2, AAV5 or any combination thereof. In some embodiments, an AAV vector or system thereof capable of producing AAV particles capable of targeting cardiac tissue can be configured to generate an AAV particle having an AAV4 serotype. In some embodiments, an AAV vector or system thereof capable of producing AAV particles capable of targeting the liver can be configured to generate an AAV having an AAV8 serotype. See also Srivastava.2017. Curr. Opin. Virol.21:75-80. It will be appreciated that while the different serotypes can provide some level of cell, tissue, and / or organ specificity, each serotype still is multi-tropic and thus can result in tissue- toxicity if using that serotype to target a tissue that the serotype is less efficient in transducing. Thus, in addition to achieving some tissue targeting capacity via selecting an AAV of a particular serotype, it will be appreciated that the tropism of the AAV serotype can Attorney Docket No.: PAT059898-WO-PCT / KATE-037 be modified by an engineered AAV capsid described herein. As described elsewhere herein, variants of wild-type AAV of any serotype can be generated via a method described herein and determined to have a particular cell-specific tropism, which can be the same or different as that of the reference wild-type AAV serotype. In some embodiments, the cell, tissue, and / or specificity of the wild-type serotype can be enhanced (e.g., made more selective or specific for a particular cell type that the serotype is already biased towards). For example, wild-type AAV9 is biased towards muscle and brain in humans (see, e.g., Srivastava.2017. Curr. Opin. Virol.21:75-80.) By including an engineered AAV capsid and / or capsid protein variant of wild-type AAV-9 as described herein, the tropism for nervous cells might be reduced or eliminated and / or the muscle specificity increased such that the nervous specificity appears reduced in comparison, thus enhancing the specificity for muscle as compared to the wild-type AAV9. As previously mentioned, inclusion of an engineered capsid and / or capsid protein variant of a wild-type AAV serotype can have a different tropism than the wild-type reference AAV serotype. For example, an engineered AAV capsid and / or capsid protein variant of AAV9 can have specificity for a tissue other than muscle or brain in humans. In some embodiments, the AAV vector is a hybrid AAV vector or system thereof. Hybrid AAVs are AAVs that include genomes with elements from one serotype that are packaged into a capsid derived from at least one different serotype. For example, if it is the rAAV2 / 5 that is to be produced, and if the production method is based on the helper-free, transient transfection method discussed above, the 1st plasmid and the 3rd plasmid (the adeno helper plasmid) will be the same as discussed for rAAV2 production. However, the 2nd plasmid, the pRepCap will be different. In this plasmid, called pRep2 / Cap5, the Rep gene is still derived from AAV2, while the Cap gene is derived from AAV5. The production scheme is the same as the above-mentioned approach for AAV2 production. The resulting rAAV is called rAAV2 / 5, in which the genome is based on recombinant AAV2, while the capsid is based on AAV5. It is assumed the cell or tissue-tropism displayed by this AAV2 / 5 hybrid virus should be the same as that of AAV5. It will be appreciated that wild-type hybrid AAV particles suffer the same specificity issues as with the non-hybrid wild-type serotypes previously discussed. Advantages achieved by the wild-type based hybrid AAV systems can be combined with the increased and customizable cell-specificity that can be achieved with the engineered AAV capsids can be combined by generating a hybrid AAV that can include an engineered Attorney Docket No.: PAT059898-WO-PCT / KATE-037 AAV capsid described elsewhere herein. It will be appreciated that hybrid AAVs can contain an engineered AAV capsid containing a genome with elements from a different serotype than the reference wild-type serotype that the engineered AAV capsid is a variant of. For example, a hybrid AAV can be produced that includes an engineered AAV capsid that is a variant of an AAV9 serotype that is used to package a genome that contains components (e.g., rep elements) from an AAV2 serotype. As with wild-type based hybrid AAVs previously discussed, the tropism of the resulting AAV particle will be that of the engineered AAV capsid. In some embodiments, the AAV vector or system thereof is configured as a “gutless” vector, similar to that described in connection with a retroviral vector. In some embodiments, the “gutless” AAV vector or system thereof can have the cis-acting viral DNA elements involved in genome amplification and packaging in linkage with the heterologous sequences of interest (e.g., the engineered AAV capsid polynucleotide(s)). The vectors described herein can be constructed using any suitable process or technique. In some embodiments, one or more suitable recombination and / or cloning methods or techniques can be used to the vector(s) described herein. Suitable recombination and / or cloning techniques and / or methods can include, but not limited to, those described in U.S. Application publication No. US 2004-0171156 A1. Other suitable methods and techniques are described elsewhere herein. Construction of recombinant AAV vectors are described in a number of publications, including U.S. Pat. No.5,173,414; Tratschin et al., Mol. Cell. Biol.5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol.4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol.63:03822-3828 (1989). Any of the techniques and / or methods can be used and / or adapted for constructing an AAV or other vector described herein. AAV vectors are discussed elsewhere herein. In some embodiments, the vector can have one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a “cloning site”). In some embodiments, one or more insertion sites (e.g., about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and / or downstream of one or more sequence elements of one or more vectors. Delivery vehicles, vectors, particles, nanoparticles, formulations and components thereof for expression of one or more elements of an engineered AAV capsid system described herein are as used in the foregoing documents, such as International Patent Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Application Publications WO WO 2021 / 050974 and WO 2021 / 077000 and PCT International Application No. WO 2022 / 020616, the contents of which are incorporated by reference herein. Additional AAV vectors are described in International Patent Application Publication WO 2019 / 2071632, the contents of which are incorporated by reference herein. Further AAV vectors are described in International Patent Application Publications WO 2020 / 086881 and WO 2020 / 235543, the contents of each of which are incorporated by reference herein. Further AAV vectors are described in International Patent Application Publications WO 2005 / 033321; WO 2006 / 110689; WO 2007 / 127264; WO 2008 / 027084; WO 2009 / 073103; WO 2009 / 073104; WO 2009 / 105084; WO 2009 / 134681; WO 2009 / 136977; WO 2010 / 051367; WO 2010 / 138675; WO 2001 / 038187; WO 2012 / 112832; WO 2015 / 054653; WO 2016 / 179496; WO 2017 / 100791; WO 2017 / 019994; WO 2018 / 209154; WO 2019 / 067982; WO 2019 / 195701; WO 2019 / 217911; WO 2020 / 041498; WO 2020 / 210839; U.S. Patent No.7,906,111; U.S. Patent No.9,737,618; U.S. Patent No.10,265,417; U.S. Patent No.10,485,883; U.S. Patent No.10,695,441; U.S. Patent No. 10,722,598; U.S. Patent No.8,999,678; U.S. Patent No.10,301,648; U.S. Patent No. 10,626,415; U.S. Patent No.9,198,984; U.S. Patent No.10,155,931; U.S. Patent No. 8,524,219; U.S. Patent No.9,206,238; U.S. Patent No.8,685,387; U.S. Patent No.9,359,618; U.S. Patent No.8,231,880; U.S. Patent No.8,470,310; U.S. Patent No.9,597,363; U.S. Patent No.8,940,290; U.S. Patent No.9,593,346; U.S. Patent No.10,501,757; U.S. Patent No.10,786,568; U.S. Patent No.10,973,928; U.S. Patent No.10,519,198; U.S. Patent No. 8,846,031; U.S. Patent No.9,617,561; U.S. Patent No.9,884,071; U.S. Patent No. 10,406,173; U.S. Patent No.9,596,220; U.S. Patent No.9,719,010; U.S. Patent No. 10,117,125; U.S. Patent No.10,526,584; U.S. Patent No.10,881,548; U.S. Patent No. 10,738,087; U.S. Patent Publication No.2011-023353; U.S. Patent Publication No.2019- 0015527; U.S. Patent Publication No.2020-155704; U.S. Patent Publication No 2017- 0191079; U.S. Patent Publication No.2019-0218574; U.S. Patent Publication No.2020- 0208176; U.S. Patent Publication No.2020-0325491; U.S. Patent Publication No.2019- 0055523; U.S. Patent Publication No.2020-0385689; U.S. Patent Publication No.2009- 0317417; U.S. Patent Publication No.2016-0051603; U.S. Patent Publication No.2016- 00244783; U.S. Patent Publication No.2017-0183636; U.S. Patent Publication No.2020- 0263201; U.S. Patent Publication No.2020-0101099; U.S. Patent Publication No.2020- Attorney Docket No.: PAT059898-WO-PCT / KATE-037 0318082; U.S. Patent Publication No.2018-0369414; U.S. Patent Publication No.2019- 0330278; U.S. Patent Publication No.2020-0231986, the contents of each of which are incorporated by reference herein. III. Viral Particles and Capsid Proteins Any of the recombinant nucleic acids or recombinant expression vectors (e.g., recombinant expression vector (e.g., viral vector (e.g., AAV (e.g., rAAV))) described herein can be packaged or encapsulated in a viral particle (e.g., AAV particle). Viral particles for use in compositions and methods described herein can include any viral capsid protein (e.g., AAV capsid protein or variant thereof) known in the art or described herein. In some embodiments, a viral particle (e.g., an AAV particle (e.g., a rAAV particle)) disclosed herein can exhibit higher expression of the recombinant nucleic acid (e.g., expression of CAPN3 or biologically active fragment thereof) in a specific tissue type as compared to the expression of the same viral particle in a different tissue type. For example, the viral particle can exhibit higher expression of CAPN3 or biologically active fragment thereof in a skeletal muscle tissue or cell as compared to the expression of the same viral particle in a non-skeletal muscle tissue (e.g., heart, liver) or cell (e.g., heart cell, liver cell). In some embodiments, the viral particle exhibits at least about 1.2 fold, at least about 1.5 fold, at least about 1.75 fold, at least about 2 fold, at least about 2.5 fold, at least about 3 fold, at least about 4 fold higher expression of the recombinant nucleic acid (e.g., expression of CAPN3 or biologically active fragment thereof) in a skeletal muscle tissue or cell as compared to the expression of the same viral vector in a non-skeletal muscle tissue (e.g., heart, liver) or cell (e.g., heart cell, liver cell). Viral particles described herein can include any virus suitable for delivery of a transgene, e.g., retroviruses, adenovirus, lentivirus, AAV, and murine leukemia viruses. In some embodiments, the viral particle is a recombinant adenovirus comprising a recombinant nucleic acid or a recombinant expression vector described herein. In some embodiments, the viral particle is a recombinant AAV comprising a recombinant nucleic acid or a recombinant AAV vector described herein. The AAV particle can be a scAAV or a ssAVV. AAV particles described herein can include one or more AAV capsid proteins. In some embodiments, the one or more AAV capsid proteins can be from one or more AAV serotypes. Non-limiting examples of AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAVrh8, AAVfh10, Attorney Docket No.: PAT059898-WO-PCT / KATE-037 AAV-DJ, AAV-DJ / 8, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV-PHP.A, AAV- PHP.eB, AAV-PHP.S, and functional variants of any AAV serotypes. In some embodiments, the AAV particle comprises a capsid protein comprising an amino acid sequence of formula (I) X1NX2X3X4RGDRX5X6L (SEQ ID NO: 1), wherein each of X1-X6 is any amino acid. In some embodiments, X1 is A, I, F, G, H, L, M, Q, S, T, or V. In some embodiments, X2is A, G, S, T, or Y. In some embodiments, X3is S, N, G, or P. In some embodiments, X4 is A, G, H, I, M, S, T, or V. In some embodiments, X5 is A, G, or Q. In some embodiments, X6 is A, I, L, M, N, S, or Y. The amino acid sequence of formula (I) can be in a hypervariable region IV (HVR IV) relative to a wild-type AAV9 capsid. For example, relative to a wild-type AAV9 capsid, X1is a substitution at amino acid 451, X2is a substitution at amino acid 453, X3is a substitution at amino acid 454, X4 is a substitution at amino acid 455, and RGDRX5X6L (SEQ ID NO: 2422) is inserted after amino acid 455. In some embodiments, the AAV particle comprises a capsid protein comprising an amino acid sequence of any one of SEQ ID NOs: 801-1599. In some embodiments, the AAV particle comprises a capsid protein comprising an amino acid sequence of any one of SEQ ID NOs: 1600-2398. In some embodiments, the AAV particle comprises or consists of a capsid protein comprising an amino acid sequence of any one of SEQ ID NOs: 2-800. In some embodiments, the AAV particle comprises a capsid protein comprising an amino acid sequence comprising or consisting of SEQ ID NOs: 191, 198, 199, 215, 256, 379, 544, 550, or 748. Any of the capsid proteins described herein can further include a deletion. For example, the capsid protein can further comprise a deletion of amino acid G267 relative to a wild-type AAV9 vector. The capsid protein is the shell or coating of the virus that enables its delivery into the host. Without the protein, the nucleic acids would be destroyed by the host without entering into the host cells and beginning transcription and translation. The capsid protein may be in the natural conformation of a naturally occurring AAV, or it may be modified. In certain example embodiments, the AAV capsid protein is an engineered AAV capsid protein having reduced or eliminated uptake in a non-muscle cell as compared to a corresponding wild-type AAV capsid polypeptide. In some embodiments, the engineered AAV capsid encoding polynucleotide can be included in a polynucleotide that is configured to be an AAV genome donor in an AAV Attorney Docket No.: PAT059898-WO-PCT / KATE-037 vector system that can be used to generate engineered AAV particles described elsewhere herein. In some embodiments, the engineered AAV capsid encoding polynucleotide can be operably coupled to a polyadenylation tail. In some embodiments, the polyadenylation tail can be an SV40 polyadenylation tail. In some embodiments, the AAV capsid encoding polynucleotide can be operably coupled to a promoter. In some embodiments, the promoter can be a tissue specific promoter. In some embodiments, the tissue specific promoter is specific for muscle (e.g., cardiac, skeletal, and / or smooth muscle), neurons and supporting cells (e.g., astrocytes, glial cells, Schwann cells, etc.), fat, spleen, liver, kidney, immune cells, spinal fluid cells, synovial fluid cells, skin cells, cartilage, tendons, connective tissue, bone, pancreas, adrenal gland, blood cell, bone marrow cells, placenta, endothelial cells, and combinations thereof. In some embodiments, the promoter can be a constitutive promoter. Suitable tissue specific promoters and constitutive promoters are discussed elsewhere herein and are generally known in the art and can be commercially available. Suitable muscle specific promoters include, but are not limited to CK8, MHCK7, Myoglobin promoter (Mb), Desmin promoter, muscle creatine kinase promoter (MCK) and variants thereof, and SPc5-12 synthetic promoter. Described herein are various embodiments of engineered viral capsids, such as adeno- associated virus (AAV) capsids, that can be engineered to confer cell-specific tropism, such as muscle specific tropism, to an engineered viral particle. Engineered viral capsids can be lentiviral, retroviral, adenoviral, or AAV capsids. The engineered capsids can be included in an engineered virus particle (e.g., an engineered lentiviral, retroviral, adenoviral, or AAV virus particle), and can confer cell-specific tropism, reduced immunogenicity, or both to the engineered viral particle. The engineered viral capsids described herein can include one or more engineered viral capsid proteins described herein. The engineered viral capsids described herein can include one or more engineered viral capsid proteins described herein that can contain a muscle-specific targeting moiety containing or composed of an n-mer motif described elsewhere herein. The engineered viral capsid and / or capsid proteins can be encoded by one or more engineered viral capsid polynucleotides. In some embodiments, the engineered viral capsid polynucleotide is an engineered AAV capsid polynucleotide, engineered lentiviral capsid polynucleotide, engineered retroviral capsid polynucleotide, or engineered adenovirus capsid polynucleotide. In some embodiments, an engineered viral capsid polynucleotide (e.g., an engineered AAV capsid polynucleotide, engineered lentiviral capsid polynucleotide, Attorney Docket No.: PAT059898-WO-PCT / KATE-037 engineered retroviral capsid polynucleotide, or engineered adenovirus capsid polynucleotide) can include a 3’ polyadenylation signal. The polyadenylation signal can be an SV40 polyadenylation signal. The engineered viral capsids can be variants of wild-type viral capsid. For example, in some embodiments, the engineered AAV capsids can be variants of wild-type AAV capsids. In some embodiments, the wild-type AAV capsids can be composed of VP1, VP2, VP3 capsid proteins or a combination thereof. In other words, the engineered AAV capsids can include one or more variants of a wild-type VP1, wild-type VP2, and / or wild-type VP3 capsid proteins. In some embodiments, the serotype of the reference wild-type AAV capsid can be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV8, AAV9 or any combination thereof. In some embodiments, the serotype of the wild-type AAV capsid can be AAV-9. The engineered AAV capsids can have a different tropism than that of the reference wild-type AAV capsid. The engineered viral capsid can contain 1-60 engineered capsid proteins. In some embodiments, the engineered viral capsids can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 engineered capsid proteins. In some embodiments, the engineered viral capsid can contain 0- 59 wild-type viral capsid proteins. In some embodiments, the engineered viral capsid can contain 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, or 59 wild-type viral capsid proteins. In some embodiments, the engineered AAV capsid can contain 1-60 engineered capsid proteins. In some embodiments, the engineered AAV capsids can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 engineered capsid proteins. In some embodiments, the engineered AAV capsid can contain 0-59 wild-type AAV capsid proteins. In some embodiments, the engineered AAV capsid can contain 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, or 59 wild-type AAV capsid proteins. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 In some embodiments, the engineered viral capsid protein can have an n-mer amino acid motif, where n can be at least 3 amino acids. In some embodiments, n can be 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids. In some embodiments, an engineered AAV capsid can have a 6-mer or 7-mer amino acid motif. In some embodiments, the n-mer amino acid motif can be inserted between two amino acids in the wild-type viral protein (VP) (or capsid protein). In some embodiments, the n-mer motif can be inserted between two amino acids in a variable amino acid region in a viral capsid protein. In some embodiments, the n-mer motif can be inserted between two amino acids in a variable amino acid region in an AAV capsid protein. The core of each wild-type AAV viral protein contains an eight-stranded beta-barrel motif (betaB to betaI) and an alpha-helix (alphaA) that are conserved in autonomous parvovirus capsids (see, e.g., DiMattia et al.2012. J. Virol.86(12):6947-6958). Structural variable regions (VRs) occur in the surface loops that connect the beta-strands, which cluster to produce local variations in the capsid surface. AAVs have 12 variable regions (also referred to as hypervariable regions) (see, e.g., Weitzman and Linden.2011. “Adeno-Associated Virus Biology.” In Snyder, R.O., Moullier, P. (eds.) Totowa, NJ: Humana Press). In some embodiments, one or more n-mer motifs can be inserted between two amino acids in one or more of the 12 variable regions in the wild- type AVV capsid proteins. In some embodiments, the one or more n-mer motifs can be each be inserted between two amino acids in VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-III, VR-IX, VR-X, VR-XI, VR-XII, or a combination thereof. In some embodiments, the n-mer can be inserted between two amino acids in the VR-III of a capsid protein. In some embodiments, the engineered capsid can have an n-mer inserted between any two contiguous amino acids between amino acids 262 and 269, between any two contiguous amino acids between amino acids 327 and 332, between any two contiguous amino acids between amino acids 382 and 386, between any two contiguous amino acids between amino acids 452 and 460, between any two contiguous amino acids between amino acids 488 and 505, between any two contiguous amino acids between amino acids 545 and 558, between any two contiguous amino acids between amino acids 581 and 593, between any two contiguous amino acids between amino acids 704 and 714 of an AAV-9 viral protein. In some embodiments, the engineered capsid can have an n-mer inserted between amino acids 588 and 589 of an AAV-9 viral protein. In some embodiments, the engineered capsid can have a 7-mer motif inserted between amino acids 588 and 589 of an AAV-9 viral protein. In other embodiments, the motif inserted is a 10-mer motif, with replacement of amino acids 586-88 Attorney Docket No.: PAT059898-WO-PCT / KATE-037 and an insertion before 589. SEQ ID NO.4 is a reference AAV-9 capsid sequence for at least referencing the insertion sites discussed above. It will be appreciated that n-mers can be inserted in analogous positions in AAV viral proteins of other serotypes. In some embodiments as previously discussed, the n-mer(s) can be inserted between any two contiguous amino acids within the AAV viral protein and in some embodiments the insertion is made in a variable region. In some embodiments, the first 1, 2, 3, or 4 amino acids of an n-mer motif can replace 1, 2, 3, or 4 amino acids of a polypeptide into which it is inserted and preceding the insertion site. In some embodiments, the amino acids of the n-mer motif that replace 1 or more amino acids of the polypeptide into which the n-mer motif is inserted come before or immediately before an “RGDR” (SEQ ID NO: 2421) in an n-mer motif. For example, in one or more of the 10-mer inserts, the first three amino acids shown can replace 1-3 amino acids into a polypeptide to which they may be inserted. Using an AAV as another non-limiting example, one or more of the n-mer motifs can be inserted into, e.g., and AAV9 capsid prolylpeptide between amino acids 588 and 589 and the insert can replace amino acids 586, 587, and 588 such that the amino acid immediately preceding the n-mer motif after insertion is residue 585. It will be appreciated that this principle can apply in any other insertion context and is not necessarily limited to insertion between residues 588 and 589 of an AAV9 capsid or equivalent position in another AAV capsid. It will further be appreciated that in some embodiments, no amino acids in the polypeptide into which the n-mer motif is inserted are replaced by the n-mer motif. In some embodiments, the AAV capsids or other viral capsids or compositions can be muscle-specific. In some embodiments, muscle-specificity of the engineered AAV or other viral capsid or other composition is conferred by a muscle specific n-mer motif incorporated in the engineered AAV or other viral capsid or other composition described herein. While not intending to be bound by theory, it is believed that the n-mer motif confers a 3D structure to or within a domain or region of the engineered AAV capsid or other viral capsid or other composition such that the interaction of the viral particle or other composition containing the engineered AAV capsid or other viral capsid or other composition described herein has increased or improved interactions (e.g., increased affinity) with a cell surface receptor and / or other molecule on the surface of a muscle cell. In some embodiments, the cell surface receptor is AAV receptor (AAVR). In some embodiments, the cell surface receptor is a muscle cell specific AAV receptor. In some embodiments, the cell surface receptor or other Attorney Docket No.: PAT059898-WO-PCT / KATE-037 molecule is a cell surface receptor or other molecule selectively expressed on the surface of a muscle cell. In some embodiments, the cell surface receptor or molecule is an integrin or dimer thereof. In some embodiments, the cell surface receptor or molecule is an Vb6 integrin heterodimer. In some embodiments, a muscle specific engineered viral particle or other composition described herein containing the muscle-specific capsid, n-mer motif, or muscle- specific targeting moiety described herein can have an increased uptake, delivery rate, transduction rate, efficiency, amount, or a combination thereof in a muscle cell as compared to other cells types and / or other virus particles (including but not limited to AAVs) and other compositions that do not contain the muscle-specific n-mer motif of the present invention. IV. Pharmaceutical Compositions Any of the recombinant nucleic acids, the AAV vectors, or the AAV particles described herein can be included in a pharmaceutical composition comprising a pharmaceutically acceptable carrier. Some embodiments of the invention may include any acceptable form of providing the AAV vector to a subject. For example, the AAV vector may be provided to the subject in the form of a composition or formulation comprising the AAV vector. The AAV vector of this invention can be formulated and administered to treat a variety of disease states by any means that produces contact of the active ingredient with the agent's site of action in the body of the subject. The compositions, polynucleotides, polypeptides, particles, cells, vector systems and combinations thereof described herein can be contained in a formulation, such as a pharmaceutical formulation. In some embodiments, the formulations can be used to generate polypeptides and other particles that include one or more muscle-specific targeting moieties described herein. In some embodiments, the formulations can be delivered to a subject in need thereof. In some embodiments, component(s) of the engineered AAV capsid system, engineered cells, engineered AAV capsid particles, and / or combinations thereof described herein can be included in a formulation that can be delivered to a subject or a cell. In some embodiments, the formulation is a pharmaceutical formulation. One or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be provided to a subject in need thereof or a cell alone or as an active ingredient, such as in a pharmaceutical formulation. As such, also described herein are pharmaceutical formulations containing an amount of one or more of the polypeptides, polynucleotides, vectors, cells, or Attorney Docket No.: PAT059898-WO-PCT / KATE-037 combinations thereof described herein. In some embodiments, the pharmaceutical formulation can contain an effective amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The pharmaceutical formulations described herein can be administered to a subject in need thereof or a cell. In some embodiments, the amount of the one or more of the polypeptides, polynucleotides, vectors, cells, virus particles, nanoparticles, other delivery particles, and combinations thereof described herein contained in the pharmaceutical formulation can range from about 1 pg / kg to about 10 mg / kg based upon the bodyweight of the subject in need thereof or average bodyweight of the specific patient population to which the pharmaceutical formulation can be administered. The amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein in the pharmaceutical formulation can range from about 1 pg to about 10 g, from about 10 nL to about 10 ml. In embodiments where the pharmaceutical formulation contains one or more cells, the amount can range from about 1 cell to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010or more cells. In embodiments where the pharmaceutical formulation contains one or more cells, the amount can range from about 1 cell to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010or more cells per nL, μL, mL, or L. In embodiments, when engineered AAV capsid particles are included in the formulation, the formulation can contain 1 to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010, 1 x 1011, 1 x 1012, 1 x 1013, 1 x 1014, 1 x 1015, 1 x 1016, 1 x 1017, 1 x 1018, 1 x 1019, or 1 x 1020transducing units (TU) / mL of the engineered AAV capsid particles. In some embodiments, the formulation can be 0.1 to 100 mL in volume and can contain 1 to 1 x 102, 1 x 103, 1 x 104, 1 x 105, 1 x 106, 1 x 107, 1 x 108, 1 x 109, 1 x 1010, 1 x 1011, 1 x 1012, 1 x 1013, 1 x 1014, 1 x 1015, 1 x 1016, 1 x 1017, 1 x 1018, 1 x 1019, or 1 x 1020transducing units (TU) / mL of the engineered AAV capsid particles. Pharmaceutically Acceptable Carriers and Auxiliary Ingredients and Agents Any of the recombinant nucleic acids, the AAV vectors, or the AAV particles described herein can be included in a pharmaceutical composition comprising a pharmaceutically acceptable carrier. In embodiments, the pharmaceutical formulation containing an amount of one or more of the polypeptides, polynucleotides, vectors, cells, virus particles, nanoparticles, other Attorney Docket No.: PAT059898-WO-PCT / KATE-037 delivery particles, and combinations thereof described herein can further include a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxy methylcellulose, and polyvinyl pyrrolidone, which do not deleteriously react with the active composition. The pharmaceutical formulations can be sterilized, and if desired, mixed with auxiliary agents, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and / or aromatic substances, and the like which do not deleteriously react with the active composition. In some embodiments, the pharmaceutical formulations described herein may be in a dosage form. The dosage forms can be adapted for administration by any appropriate route. Appropriate routes include, but are not limited to, oral (including buccal or sublingual), rectal, epidural, intracranial, intraocular, inhaled, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, intraurethral, parenteral, intracranial, subcutaneous, intramuscular, intravenous, intraperitoneal, intradermal, intraosseous, intracardiac, intraarticular, intracavernous, intrathecal, intravitreal, intracerebral, gingival, subgingival, intracerebroventricular, and intradermal. Such formulations may be prepared by any method known in the art. Dosage forms adapted for oral administration can be discrete dosage units such as capsules, pellets or tablets, powders or granules, solutions, or suspensions in aqueous or non- aqueous liquids; edible foams or whips, or in oil-in-water liquid emulsions or water-in-oil liquid emulsions. In some embodiments, the pharmaceutical formulations adapted for oral administration also include one or more agents which flavor, preserve, color, or help disperse the pharmaceutical formulation. Dosage forms prepared for oral administration can also be in the form of a liquid solution that can be delivered as foam, spray, or liquid solution. In some embodiments, the oral dosage form can contain about 1 ng to 1000 g of a pharmaceutical formulation containing a therapeutically effective amount or an appropriate fraction thereof of the targeted effector fusion protein and / or complex thereof or composition containing the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The oral dosage form can be administered to a subject in need thereof. Where appropriate, the dosage forms described herein can be microencapsulated. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 The dosage form can also be prepared to prolong or sustain the release of any ingredient. In some embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can be the ingredient whose release is delayed. In other embodiments, the release of an optionally included auxiliary ingredient is delayed. Suitable methods for delaying the release of an ingredient include, but are not limited to, coating or embedding the ingredients in material in polymers, wax, gels, and the like. Delayed release dosage formulations can be prepared as described in standard references such as “Pharmaceutical dosage form tablets,” eds. Liberman et. al. (New York, Marcel Dekker, Inc., 1989), “Remington - The science and practice of pharmacy”, 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, and “Pharmaceutical dosage forms and drug delivery systems”, 6th Edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment, and processes for preparing tablets and capsules and delayed release dosage forms of tablets and pellets, capsules, and granules. The delayed release can be anywhere from about an hour to about 3 months or more. Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins that are commercially available under the trade name EUDRAGIT®(Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides. Coatings may be formed with a different ratio of water-soluble polymer, water insoluble polymers, and / or pH dependent polymers, with or without water insoluble / water soluble non-polymeric excipient, to produce the desired release profile. The coating is either performed on the dosage form (matrix or simple) which includes, but is not limited to, tablets (compressed with or without coated beads), capsules (with or without coated beads), beads, particle compositions, “ingredient as is” formulated as, but not limited to, suspension form or as a sprinkle dosage form. Dosage forms adapted for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some embodiments for treatments of the eye or other external tissues, for example the mouth or the skin, the pharmaceutical formulations are applied as a topical ointment or cream. When formulated in an ointment, the one or more of the polypeptides, polynucleotides, vectors, Attorney Docket No.: PAT059898-WO-PCT / KATE-037 cells, and combinations thereof described herein can be formulated with a paraffinic or water- miscible ointment base. In some embodiments, the active ingredient can be formulated in a cream with an oil-in-water cream base or a water-in-oil base. Dosage forms adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes. Dosage forms adapted for nasal or inhalation administration include aerosols, solutions, suspension drops, gels, or dry powders. In some embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein is contained in a dosage form adapted for inhalation is in a particle-size-reduced form that is obtained or obtainable by micronization. In some embodiments, the particle size of the size reduced (e.g., micronized) compound or salt or solvate thereof, is defined by a D50 value of about 0.5 to about 10 microns as measured by an appropriate method known in the art. Dosage forms adapted for administration by inhalation also include particle dusts or mists. Suitable dosage forms wherein the carrier or excipient is a liquid for administration as a nasal spray or drops include aqueous or oil solutions / suspensions of an active ingredient (e.g., the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein and / or auxiliary active agent), which may be generated by various types of metered dose pressurized aerosols, nebulizers, or insufflators. In some embodiments, the dosage forms can be aerosol formulations suitable for administration by inhalation. In some of these embodiments, the aerosol formulation can contain a solution or fine suspension of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein and a pharmaceutically acceptable aqueous or non-aqueous solvent. Aerosol formulations can be presented in single or multi- dose quantities in sterile form in a sealed container. For some of these embodiments, the sealed container is a single dose or multi-dose nasal, or an aerosol dispenser fitted with a metering valve (e.g., metered dose inhaler), which is intended for disposal once the contents of the container have been exhausted. Where the aerosol dosage form is contained in an aerosol dispenser, the dispenser contains a suitable propellant under pressure, such as compressed air, carbon dioxide, or an organic propellant, including but not limited to a hydrofluorocarbon. The aerosol formulation dosage forms in other embodiments are contained in a pump-atomizer. The pressurized aerosol formulation can also contain a solution or a suspension of one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. In further embodiments, the aerosol formulation can also contain co-solvents and / or modifiers Attorney Docket No.: PAT059898-WO-PCT / KATE-037 incorporated to improve, for example, the stability and / or taste and / or fine particle mass characteristics (amount and / or profile) of the formulation. Administration of the aerosol formulation can be once daily or several times daily, for example 2, 3, 4, or 8 times daily, in which 1, 2, or 3 doses are delivered each time. For some dosage forms suitable and / or adapted for inhaled administration, the pharmaceutical formulation is a dry powder inhalable formulation. In addition to the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein, an auxiliary active ingredient, and / or pharmaceutically acceptable salt thereof, such a dosage form can contain a powder base such as lactose, glucose, trehalose, mannitol, and / or starch. In some of these embodiments, the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein is in a particle-size reduced form. In further embodiments, a performance modifier, such as L-leucine or another amino acid, cellobiose octaacetate, and / or metals salts of stearic acid, such as magnesium or calcium stearate. In some embodiments, the aerosol dosage forms can be arranged so that each metered dose of aerosol contains a predetermined amount of an active ingredient, such as the one or more of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. Dosage forms adapted for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations. Dosage forms adapted for rectal administration include suppositories or enemas. Dosage forms adapted for parenteral administration and / or adapted for any type of injection (e.g., intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal, intraosseous, epidural, intracardiac, intraarticular, intracavernous, gingival, subgingival, intrathecal, intravitreal, intracerebral, and intracerebroventricular) can include aqueous and / or non-aqueous sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, solutes that render the composition isotonic with the blood of the subject, and aqueous and non-aqueous sterile suspensions, which can include suspending agents and thickening agents. The dosage forms adapted for parenteral administration can be presented in a single-unit dose or multi-unit dose containers, including but not limited to sealed ampoules or vials. The doses can be lyophilized and resuspended in a sterile carrier to reconstitute the dose prior to administration. Extemporaneous injection solutions and Attorney Docket No.: PAT059898-WO-PCT / KATE-037 suspensions can be prepared in some embodiments, from sterile powders, granules, and tablets. Dosage forms adapted for ocular administration can include aqueous and / or nonaqueous sterile solutions that can optionally be adapted for injection, and which can optionally contain antioxidants, buffers, bacteriostats, solutes that render the composition isotonic with the eye or fluid contained therein or around the eye of the subject, and aqueous and nonaqueous sterile suspensions, which can include suspending agents and thickening agents. For some embodiments, the dosage form contains a predetermined amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein per unit dose. In some embodiments, the predetermined amount of such unit doses may therefore be administered once or more than once a day. Such pharmaceutical formulations may be prepared by any of the methods well known in the art. V. Methods of Treatment and Use Any of the recombinant nucleic acids, the AAV vectors, or the AAV particles described herein can be included in a pharmaceutical composition comprising a pharmaceutically acceptable carrier. Some embodiments of the invention may include any acceptable form of providing the AAV vector to a subject. For example, the AAV vector may be provided to the subject in the form of a composition or formulation comprising the AAV vector. The AAV vector of this invention can be formulated and administered to treat a variety of disease states by any means that produces contact of the active ingredient with the agent's site of action in the body of the subject. The compositions, polynucleotides, polypeptides, particles, cells, vector systems and combinations thereof described herein can be contained in a formulation, such as a pharmaceutical formulation. In some embodiments, the formulations can be used to generate polypeptides and other particles that include one or more muscle-specific targeting moieties described herein. In some embodiments, the formulations can be delivered to a subject in need thereof. In some embodiments, component(s) of the engineered AAV capsid system, engineered cells, engineered AAV capsid particles, and / or combinations thereof described herein can be included in a formulation that can be delivered to a subject or a cell. In some embodiments, the formulation is a pharmaceutical formulation. One or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein can Attorney Docket No.: PAT059898-WO-PCT / KATE-037 be provided to a subject in need thereof or a cell alone or as an active ingredient, such as in a pharmaceutical formulation. As such, also described herein are pharmaceutical formulations containing an amount of one or more of the polypeptides, polynucleotides, vectors, cells, or combinations thereof described herein. In some embodiments, the pharmaceutical formulation can contain an effective amount of the one or more of the polypeptides, polynucleotides, vectors, cells, and combinations thereof described herein. The pharmaceutical formulations described herein can be administered to a subject in need thereof or a cell. Aspects of the present disclosure provide methods for treating LMGD2A in a subject in need thereof using any of the recombinant nucleic acids, the AAV vectors, the AAV particles, or pharmaceutical compositions thereof described herein. Subjects A subject can be any subject for whom diagnosis, treatment, or therapy is desired. A subject can be a human or a non-human primate. A subject can be any age. In some embodiments, the subject is a human subject that is any age (e.g., a human subject that is at least 18 years of age). A subject (e.g., human subject) to be treated by the methods described herein can be a subject having, suspected of having, or at risk for having LMGD2A. A subject (e.g., human subject) suspected of having LMGD2A might show one or more symptoms of LMGD2A, e.g., muscle weakness, muscle wasting, muscle pain, or joint contractures. A subject (e.g., human subject) at risk for LMGD2A can be a subject having one or more risk factors for LMGD2A, e.g., one or more mutations in a CAPN3 gene. A subject (e.g., human subject) who needs the treatment described herein can be identified by routine medical examination, e.g., laboratory tests (e.g., serum creatine kinase (CK) blood tests), genetic testing (e.g., testing for one or more mutations in a CAPN3 gene), or muscle biopsy. Any of the methods described herein can further comprise a step of identifying a subject (e.g., a human subject) for treatment based on identifying one or more mutations in a CAPN3 gene. In some embodiments, presence of one or more mutations in a CAPN3 gene is determined in a biological sample (e.g., a blood sample) obtained from a subject (e.g., a human subject). Administration Methods described herein encompass administering an effective amount of a recombinant nucleic acid, an AAV vector, an AAV particle, or a pharmaceutical composition Attorney Docket No.: PAT059898-WO-PCT / KATE-037 thereof to a subject, e.g., a subject in need thereof, for example, a human subject, by a variety of methods. The route of administration can be intramuscular administration, subcutaneous injection, intravenous injection, or intravenous (IV) administration. An effective amount refers to the amount of a recombinant nucleic acid, an AAV vector, an AAV particle, or a pharmaceutical composition thereof needed to prevent or alleviate at least one or more signs or symptoms of LMGD2A, and relates to a sufficient amount of a recombinant nucleic acid, an AAV vector, an AAV particle, or pharmaceutical compositions thereof that provides the desired effect, e.g., to treat a subject (e.g., human subject) having LMGD2A. An effective amount also can include an amount sufficient to prevent or delay the development of a symptom of LMGD2A, alter the course of a symptom of LMGD2A (e.g., slow the progression of a symptom of LMGD2A), or reverse a symptom of LMGD2A. Methods described herein comprise administering (e.g., intramuscularly or intravenously) to a subject (e.g., a human subject) a recombinant nucleic acid, an AAV vector, an AAV particle, or a pharmaceutical composition thereof one or more times. In some embodiments, an effective amount of a recombinant nucleic acid, an AAV vector, an AAV particle, or a pharmaceutical composition thereof is administered to a subject (e.g., a human subject) no more than once or more than once (e.g., administered twice). Any of the methods for treating LMGD2A described herein can be used in combination therapies. For example, any of the methods for treating LMGD2A described herein can be co-used with other therapeutic agents for treating LMGD2A, or for enhancing efficacy of the compositions described herein (e.g., the recombinant nucleic acids, the AAV vectors, or pharmaceutical compositions) and / or reducing side effects of the compositions described herein (e.g., the recombinant nucleic acids, the AAV vectors, or pharmaceutical compositions). Any of the recombinant nucleic acids, the AAV vectors, or pharmaceutical compositions described herein can be used as a medicament or in the manufacture of a medicament for the treatment of LMGD2A, or ameliorating one or more symptoms thereof in a subject. VI. Kits for Therapeutic Use The present disclosure provides kits for treating LMGD2A. Such kits can include any of the recombinant nucleic acids, AAV vectors, AAV particles, or pharmaceutical Attorney Docket No.: PAT059898-WO-PCT / KATE-037 compositions thereof described herein. In some embodiments, the kit can additionally comprise instructions for practicing any of the methods described herein. The instructions may include information as to dosage, dosing schedule, and route of administration. Instructions supplied in the kits of the disclosure can be written instructions on a label or a package insert. Other Embodiments Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present disclosure to its fullest extent. The specific embodiments herein are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof. In any of the aforementioned aspects and embodiments, the nucleic acid sequences contemplated can be DNA, RNA, or modified versions thereof. Modified nucleic acids can be distinguished from naturally occurring nucleic acids by modifications to the backbone of the polynucleotide chain, for example, peptide nucleic acids (PNA), morpholinos, locked nucleic acids (LNA), glycol nucleic acids (GNA) and threose nucleic acid (TNA). Modified nucleic acids can also include analogs with modifications to the four nucleobases. In some embodiments, the nucleic acids are PNAs. In some embodiments, the nucleic acids are LNAs. In some embodiments, the nucleic acids are morpholinos. In some embodiments, the nucleic acids are in a single-stranded form. In some embodiments, the nucleic acids are in double- stranded form. In some embodiments, the nucleic acids are linear. In some embodiments, the nucleic acids are circular. In some embodiments, the nucleic acids are plasmids. Embodiment 1 is a composition comprising an adeno-associated virus (AAV) particle comprising an engineered capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2421); and a nucleic acid molecule comprising a promoter; a sequence encoding a CAPN3 transgene; a heart de-targeting miRNA binding site; and a dorsal root ganglia (DRG) de-targeting miRNA binding site. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Embodiment 2 is the composition of Embodiment 1, wherein the nucleic acid molecule comprises a sequence having the at least 95% sequence identity with the sequence of SEQ ID NO: 2408. Embodiment 3 is the composition of Embodiment 2, wherein the DRG de-targeting miRNA binding site comprises a sequence selected from among SEQ ID NOs: 2399-2401. Embodiment 4 is the composition of Embodiment 3, wherein the heart de-targeting miRNA binding site comprises a sequence selected from among SEQ ID NO: 2402 and SEQ ID NO: SEQ ID NO: 2403. Embodiment 5 is the composition of Embodiment 4, wherein the promoter comprises the sequence having at least 95% sequence identity with a sequence selected from among SEQ ID NOs: 2404-2407. Embodiment 6 is the composition of Embodiment 5, wherein the nucleic acid molecule comprises in order: a first inverted terminal repeat (ITR) region; a promoter; a first heart de-targeting miRNA binding site; an intron; a sequence a sequence encoding a CAPN3 transgene; a second heart de-targeting miRNA binding site; a third heart de-targeting miRNA binding site; a first DRG de-targeting miRNA binding site; a fourth heart de-targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a polyadenylation signal; a second ITR region. Embodiment 7 is the composition of Embodiment 6, wherein the nucleic acid molecule comprises a sequence selected from among SEQ ID NOs: 2413-2420. Embodiment 8 is the composition of Embodiment 1, wherein the capsid protein comprises an amino acid sequence selected from Tables 1a in hypervariable region IV (HVR IV) relative to wild-type AAV-9, wherein the capsid protein comprises substitutions at amino acids 451-455 relative to a wild-type AAV-9 vector capsid selected from column 1 of Table 1b; and a 7-mer insert selected from column 2 of Table 1b inserted after amino acid 455 relative to a wild-type AAV-9vector. Embodiment 9 is the composition of Embodiment 8, wherein the capsid protein further comprises a deletion of G267 relative to wild-type AAV-9 capsid or equivalent position in another AAV capsid. Embodiment 10 is the composition of Embodiment 9, wherein the AAV vector exhibits reduced liver tropism and increased muscle tropism as compared to a wild type AAV vector. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Embodiment 11 is a method of treating a subject suffering from limb girdle muscular dystrophy 2A (LGMD2A), the method comprising providing to the subject a composition comprising an adeno-associated virus (AAV) particle comprising an engineered capsid protein comprising the amino acid sequence RGDR (SEQ ID NO: 2421); and a nucleic acid molecule comprising a promoter; a sequence encoding a CAPN3 transgene; a heart de- targeting miRNA binding site; and a dorsal root ganglia (DRG) de-targeting miRNA binding site. Embodiment 12 is the composition of Embodiment 11, wherein the nucleic acid molecule comprises a sequence having the at least 95% sequence identity with the sequence of SEQ ID NO: 2408. Embodiment 13 is the composition of Embodiment 12, wherein the DRG de-targeting miRNA binding site comprises a sequence selected from among SEQ ID NOs: 2399-2401. Embodiment 14 is the composition of Embodiment 13, wherein the heart de-targeting miRNA binding site comprises a sequence selected from SEQ ID NO: 2402 and SEQ ID NO: 2403. Embodiment 15 is the composition of Embodiment 14, wherein the promoter comprises the sequence having at least 95% sequence identity with a sequence selected from among SEQ ID NO: 2404-SEQ ID NO: 2407. Embodiment 16 is the composition of Embodiment 15, wherein the nucleic acid molecule comprises in order: a first inverted terminal repeat (ITR) region; a promoter; a first heart de-targeting miRNA binding site; an intron; a sequence a sequence encoding a CAPN3 transgene; a second heart de-targeting miRNA binding site; a third heart de-targeting miRNA binding site; a first DRG de-targeting miRNA binding site; a fourth heart de-targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a polyadenylation signal; and a second ITR region. Embodiment 17 is the composition of Embodiment 16, wherein the nucleic acid molecule comprises a sequence selected from among SEQ ID NOs: 2413-2420. Embodiment 18 is the composition of Embodiment 11, wherein the capsid protein comprises an amino acid sequence selected from Tables 1a in hypervariable region IV (HVR IV) relative to wild-type AAV-9, wherein the capsid protein comprises substitutions at amino acids 451-455 relative to a wild-type AAV-9 vector capsid selected from column 1 of Table 1b; and a 7-mer insert selected from column 2 of Table 1b inserted after amino acid 455 relative to a wild-type AAV-9 vector. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Embodiment 19 is the composition of Embodiment 18, wherein the capsid protein further comprises a deletion of G267 relative to wild-type AAV-9 capsid or equivalent position in another AAV capsid. Embodiment 20 is the composition of Embodiment 19, wherein the AAV vector exhibits reduced liver tropism and increased muscle tropism as compared to a wild type AAV vector. EXAMPLES In order that the invention described may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the methods and compositions provided herein and are not to be construed in any way as limiting their scope. Example 1: Exemplary Recombinant Nucleic Acids and AAV Compositions Exemplary AAV vectors of the invention were engineered comprising the capsid protein MyoAAV-LD B comprising an RGDR motif (SEQ ID NO: 2421) and a recombinant nucleic acid (also referred to as cargo) described herein. The capsid protein MyoAAV-LD B can be described relative to a wild type AAV9, specifically the capsid protein MyoAAV-LD B includes the amino acid sequence of LNAST (SEQ ID NO: 1014) at positions 451-455, the amino acid sequence of RGDRQYL (SEQ ID NO: 1813) inserted after amino acid 455, and a deletion of the amino acid G267 relative to the wild type AAV9 capsid protein, and the remainder of the capsid is otherwise identical to wild type AAV9. The capsid encapsidated a recombinant nucleic acid comprising a novel promoter comprising a sequence of any one of SEQ ID NO: 2404- 2407, a CAPN3 transgene comprising the sequence of SEQ ID NO: 2408, a first and second DRG de-targeting miRNA binding sites comprising a sequence selected from any one of SEQ ID NOs: 2399-2401, and four heart de-targeting miRNA binding sites comprising the sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403. Exemplary recombinant nucleic acids are described below: Nucleic acid 1 GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGTAGCTTTAGCCGGCTTGCTTG CTTTTGGAGTCTGCCCCTCGTATGTACAGATCGGGGTCAGCCTGAGACGTGGGCGGGTTCCTTCCCAGGCGTTGC Attorney Docket No.: PAT059898-WO-PCT / KATE-037 AGCTCTCTTTCCTCCCTCACTCTCCAGTTCCTCTGGCTCAGTGAGGGATTTGGGATTTCTGTGTGTGGGGCATGG ACAGATACTACTCTTAGTGAAAAGCTGGACAAGGTGGAGTAGAGCATCAAGGGTGAGTGCCACTACGGGTCTAGG CTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCC CCCCCCCCCCAACACCTGCTGCCTGCTAAAAATAACCCTGTCCCTGGTGGATATCAAGGCTGTGGGGGACTGAGG GCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCC GGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGG GGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACG AGCTGAAAGCTCATCTACTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTC CTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAG CCAGCCAGCAAACATCACTGCAAGTCTTAACAGCCCAGTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAA GGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACT GACATCCACTTTGCCTTTCTCTCCACAGGTGTCCAGACCGGTGCCACCATGCCGACCGTCATTAGCGCATCTGTG GCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCAGGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCT GGGGGTGGAAACCCAAGTGGCATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAG ACATTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTCCCACCGGATGAG ACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAGAGACCTCCGGAAATTTGCGAGAATCCC CGATTTATCATTGATGGAGCCAACAGAACTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCC ATTGCCTGCCTGACCCTGAACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTAC GCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTATAGATGACTGCCTGCCAACG TACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTAT GCTAAGCTCCATGGTTCCTACGAAGCTCTGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGG GTGGCAGAGTTTTTTGAGATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGC TCCCTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGG GAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCA GATGAAAGACCGACCCGGACAATCATTCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCAC GCCTACTCTGTCACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCG TGGGGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTTTGTGGACAAAGATGAGAAG GCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTGGATGTCCTATGAGGATTTCATCTACCATTTCACA AAGTTGGAGATCTGCAACCTCACGGCCGATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAAC GAGGGCCGCTGGGTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAG TACCGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTGCAGCTTCCTGGTGGCCCTG ATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTCACCATTGGCTTCGCCATCTACGAGGTT CCCAAAGAGATGCACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGC AAAACCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCC ACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTT GAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTTCGGACAGAGCA AACAGCAACAAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAG CAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAG CAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTCGTGAACAAACAC AAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCT GGAAAGCTCAACCTGCAGGAGTTCCACCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTAT GACACAGACCAGTCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAAC AACCAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGACAGTTTCATCTGC TGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTC AACGTTCTGGAGTGGCTGCAGCTCACCATGTATGCCTGATTACCGAAACCCAGCAGACAATGTAGCTAATACTCA AACATCACTGCAAGTCTTAAACAATATTCATACAGCTAGATAACCAAAGAGCTCATGAAACCCAGCAGACAATGT AGCTGACTACTCATACAGCTAGATAACCAAAGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCC AGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAAT AAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCA AGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCT CTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCA GTGAGCGAGCGAGCGCGC (SEQ ID NO: 2413) Nucleic acid Sequence 1 annotated T A Attorney Docket No.: PAT059898-WO-PCT / KATE-037 Novel GTAGCTTTAGCCGGCTTGCTTGCTTTTGGAGTCTGCCCCTCGTATGTACAGATCGGGG promoter TCAGCCTGAGACGTGGGCGGGTTCCTTCCCAGGCGTTGCAGCTCTCTTTCCTCCCTCA C C C C T C G G T T A A T C C G C T C G T G T A A A A G G G T T T C C G C C G G G A C A A G T T Attorney Docket No.: PAT059898-WO-PCT / KATE-037 TAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCC TGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGG AGTTCCACCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGA A C T G G A G A A C Nucleic acid 2 GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTAGTTATTAATAGTAATCAATT ACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGA CCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACG CCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCT ACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGACAAGGTGGAGTAGAGCATCAAGGGTGAGTTGC CTAGGCCATCAGAGTAGTTTTGGGAAAACCACTGAGAGTGAGGCAAGCCACGCTGGAAGGTGAAAACTGACAGGT AGGGAGATGGAGGGGCTAAGGCCTGTTTCACCACAGCACGGTGGACCTGTGCTTCTGCAGATGTGGAGGGGGTGG CCGCCCCTCACTTTCCAGGAGGTAGAGAGCAAAAGCCCTTCCAATGACCTTGGTACCTACTGTGCCCTTGATCTC GCGTTCCTAGCTATCTCATGGGTTCTGCACCGGTGCCTCCTCCTGCCCTCGGTAAGGCACCTTCTAGGTCCAGCT GTGGGGCAGGGAGCGACAGGCAGGAATGATCTGACCCCTTTGGCCGGGCACGGTGACAGATGGGCTGAAAGATGA GTCACTAAACATGATCTGGGGTGCGGGGCGGGGGTGCAGCTCAGTTTCAGCCCCTCGCGCCGGGGAGGATGACCG TGCAGCTTTATATAGCCCCTGAGCCCTATATAAGCAAGTCAGAGGCCGGGGCTCGTCCGACAGGAGCCCTCAAGC TGATCTGGTCGGGACCGGATACATTATTAACCCCAGTGCAGTAGGGTCCCCAGGGGCAACCTGCCCCACAGCAAA CATCACTGCAAGTCTTAACAGCCCAGTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAG AAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTT Attorney Docket No.: PAT059898-WO-PCT / KATE-037 GCCTTTCTCTCCACAGGTGTCCAGACCGGTGCCACCATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACA GCGGCTGAGCCCCGGTCCCCAGGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAAC CCAAGTGGCATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACATTCGAGCAA CTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTCCCACCGGATGAGACCTCTCTCTTT TATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAGAGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATT GATGGAGCCAACAGAACTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTG ACCCTGAACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTACGCAGGGATCTTC CACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTATAGATGACTGCCTGCCAACGTACAACAATCAA CTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCAT GGTTCCTACGAAGCTCTGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTT TTTGAGATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCCCTCATGGGC TGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGGGAGTTGATTGCA CGGATGGTAAGGAATATGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCG ACCCGGACAATCATTCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTC ACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTG GAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTTTGTGGACAAAGATGAGAAGGCCCGTCTGCAG CACCAGGTCACTGAGGATGGAGAGTTCTGGATGTCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATC TGCAACCTCACGGCCGATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGG GTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAGTACCGTCTGAAG CTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTGCAGCTTCCTGGTGGCCCTGATGCAGAAGAAC CGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTCACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATG CACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATC AACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACCTACGAGCCC CACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTTGAAAATACCATC TCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAG GAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAG CCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAGATAGCAGGA GATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAG ACACACGGGTTCACACTGGAGTCCTGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAAC CTGCAGGAGTTCCACCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAG TCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAACCAGCTCTAT GACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGACAGTTTCATCTGCTGCTTCGTTAGG CTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAG TGGCTGCAGCTCACCATGTATGCCTGATTACCGAAACCCAGCAGACAATGTAGCTAATACTCAAACATCACTGCA AGTCTTAAACAATATCGGCCTGATTCACAACACCAGCTGCTCATAAACATCACTGCAAGTCTTAAGACTACCGGC CTGATTCACAACACCAGCTCTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTT TGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATT GCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGG GAAGAGAATAGCAGGCATGCTGGGGAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTC GCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGC GCGC (SEQ ID NO: 2414) Nucleic acid Sequence 2 annotated T A C C G T T T T C T A Attorney Docket No.: PAT059898-WO-PCT / KATE-037 AGCCCTTCCAATGACCTTGGTACCTACTGTGCCCTTGATCTCGCGTTCCTAGCTATCT CATGGGTTCTGCACCGGTGCCTCCTCCTGCCCTCGGTAAGGCACCTTCTAGGTCCAGC TGTGGGGCAGGGAGCGACAGGCAGGAATGATCTGACCCCTTTGGCCGGGCACGGTGAC C G T C A T C C G C T C G T G T A A A A G G G T T T C C G C C G G G A C A A G T T C G A A C T Attorney Docket No.: PAT059898-WO-PCT / KATE-037 CAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTG GAGTGGCTGCAGCTCACCATGTATGCCTGA (SEQ ID NO: 2408) G A G A A C Nucleic acid 3 GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTCCCCTGACCTTTGCGGTGGAAA TCCTGAGCCCAGGCTGAGATGAGCTCAGCTGATCCTTCTCTCAGAGACAGCTGGAGTACAGTGCTGCTCAGCCCC CAGCTCCTGAGTGTCTGGAGCAAACAGCTGGGAGAGAGGTAGAATTCACTCCTGGATTAGAGCCAAAAACTGCCT GGCAGAAACCCCCAGGATCCTGTTTCTCCTGAGGGAGGAGCGGGGGAGCCCGGGGGCGAGAAACCCACAGCACAG GGAAGGGAAGGGCAGCCTTGAAACTGCAAGTTGGGAGATCACGGTTTCCTCACGTGGCCACCATGAGGGCTGAGG CTGTAGGCTGGCCGCTCCTGCCCCTCCCGACCACCCCCTCAGGCTTCCAGCCTCCTTGCTCAGCCACCTAGGCTG GGCTTTCAGGTTCACAGGCAGCCGGCCCTACAACATGGAGGCCCAGGCTGGGCTTTCTTCAGGAGTGGCATCTAA ACTTAGGAGAGGGGAACACGTTTCACCCGAATCTGGGCTAGCAGTGTGTTGGTTAAATGGCCCCTGAGTAGGTGT GGGGCATGGCAGAGGTGCAGGAGTGGGTGTCCGAGGATGCAGCCAACTCATCTCCAAACAGCTCCTTTTCTTTTC CCCAGTGGGCTGCATTCCCAGACTGGTATTTTAGTTGGTGTGACAGAGTCCCAGAGTCATCTGGCCCAGGGGCTT GCACCTGCGCCAGTCCTTCCCTGTCCACCCCTGCCCGTCTCCAGGCGCTCCTATAAAGGGCTGAGCAGTTCAGCT CTTCTCACTGGGGGGTGTGAGGAACAGGGAAACCCAGCAGACAATGTAGCTCAGCCCAGTGGGCAGGTAAGTATC AAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGA TAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGGTGTCCAGACCGGTGCCACCATGCCG ACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCAGGGCCAGTTCCTCACCCGGCC CAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGTGGCATCTATTCAGCCATCATCAGCCGCAATTTTCCT ATTATCGGAGTGAAAGAGAAGACATTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGAC CCTGAGTTCCCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAGAGACCT CCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAACTGACATCTGTCAAGGAGAGCTAGGG GACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTGAACCAGCACCTTCTTTTCCGAGTCATACCCCATGAT CAAAGTTTCATCGAAAACTACGCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTT ATAGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTCTGGAGT Attorney Docket No.: PAT059898-WO-PCT / KATE-037 GCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGCTCTGAAAGGTGGGAACACCACAGAGGCC ATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAGATCAGGGATGCTCCTAGTGACATGTACAAGATCATG AAGAAAGCCATCGAGAGAGGCTCCCTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCT CCTTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAGGACTCA GACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTCCGGTTCAGTATGAGACAAGAATGGCC TGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAG CTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGC TTTGTGGACAAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTGGATGTCCTATGAG GATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCGATGCTCTGCAGTCTGACAAGCTTCAG ACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGAT ACTTTCTGGACCAACCCTCAGTACCGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATT TGCAGCTTCCTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTCACCATT GGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTAC AACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGC GAGTACGTCATCGTGCCCTCCACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAG AGGAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAGCCCATC ATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAA ACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAA CAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTT AACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATGATTGCG CTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCACCTCTGGAACAAGATTAAGGCCTGG CAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAAC GACGCAGGATTCCACCTCAACAACCAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATC GACTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGACAAGGAT GGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCATGTATGCCTGATTACCGAAACCCAGC AGACAATGTAGCTAATACTCAAACATCACTGCAAGTCTTAAACAATATCAACAAAATCACTGATGCTGGAGCTCA TGAAACCCAGCAGACAATGTAGCTGACTACCAACAAAATCACTGATGCTGGACTAGAGCTCGCTGATCAGCCTCG ACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACT CCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGT GGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAAGGAACCCCTAGTGAT GGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGG CTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC (SEQ ID NO: 2415) Nucleic acid Sequence 3 annotated T T C G C G A G G T G G G T G A Attorney Docket No.: PAT059898-WO-PCT / KATE-037 miRNA binding site Intron GTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCG C C C A G C T A T A T T G C T G C G T C C G C C C G G G C C C C A A G C C C C C C T A C Attorney Docket No.: PAT059898-WO-PCT / KATE-037 First DRG de- CAACAAAATCACTGATGCTGGA (SEQ ID NO: 2399) targeting miRNA binding T T G G G A GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTTTAAAATAAGCTGCATACATC CACTTATTCAGAATGATAGCTTTTTATTTCAGGTCAAGAGGGACAGCCCAGAGTCTAAGAGGATCATATTCAGCT CACAGCTGCAGTTCTCAAATTACACTGATCAGGCAGATTCTGACAAATCCAACACTCTTGGTGCCTGCCTGCCCC TACACCTTTAAAACCCTTAAAGCAGTAAGCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGA CACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGCTAAA AATAACCCTGTCCCTGGTGGATATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGC TTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTA GACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGC AAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTACTCTCAGGGGCCC CTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGC CCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAGCGAAACCCAGCAGACAATGTAG CTCAGCCCAGTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGA GACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG GTGTCCAGACCGGTGCCACCATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGT CCCCAGGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGTGGCATCTATT CAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACATTCGAGCAACTTCACAAGAAATGTC TAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTCCCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCC CCATCCAGTTCGTCTGGAAGAGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAA CTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTGAACCAGCACC TTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTACGCAGGGATCTTCCACTTCCAGTTCTGGC GCTATGGAGAGTGGGTGGACGTGGTTATAGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGT CCAACCACCGCAATGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGCTC TGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAGATCAGGGATG CTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCCCTCATGGGCTGCTCCATTGATGATG GCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATA TGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTC CGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGGCTGGATGAGG TCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTGGAGTGGAACGGTTCTT GGAGTGATAGATGGAAGGACTGGAGCTTTGTGGACAAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGG ATGGAGAGTTCTGGATGTCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCG ATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGGGGTTGCTCTG CCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAGTACCGTCTGAAGCTCCTGGAGGAGGACG ATGACCCTGATGACTCGGAGGTGATTTGCAGCTTCCTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGA Attorney Docket No.: PAT059898-WO-PCT / KATE-037 AGCTAGGGGCCAGTCTCTTCACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCAGC ACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATGCGGGAGGTGT CCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACCTACGAGCCCCACCAGGAGGGGGAAT TCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAG TGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACC AGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCT CTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCT GTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACAC TGGAGTCCTGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACC ACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGCACCATCAACA GCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAACCAGCTCTATGACATCATTACCATGC GGTACGCAGACAAACACATGAACATCGACTTTGACAGTTTCATCTGCTGCTTCGTTAGGCTGGAGGGCATGTTCA GAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTTCTGGAGTGGCTGCAGCTCACCA TGTATGCCTGATTACCGAAACCCAGCAGACAATGTAGCTAATACTCGAAACCCAGCAGACAATGTAGCTACAATA TTCATACAGCTAGATAACCAAAGAGCTCATGAAACCCAGCAGACAATGTAGCTGACTACTCATACAGCTAGATAA CCAAAGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCC GTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGT CTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGC AGGCATGCTGGGGAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGC CGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGC (SEQ ID NO: 2416) Nucleic acid Sequence 4 annotated T A A A A A C A G C G T C G A T C C G C T C G T Attorney Docket No.: PAT059898-WO-PCT / KATE-037 CATCGAAAACTACGCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTG GACGTGGTTATAGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGT CCAACCACCGCAATGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCA A A A G G G T T T C C G C C G G G A C A A G T T C G A A C T G G A G Attorney Docket No.: PAT059898-WO-PCT / KATE-037 GGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGA (SEQ ID NO: 2411) A C GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGTAGCTTTAGCCGGCTTGCTTG CTTTTGGAGTCTGCCCCTCGTATGTACAGATCGGGGTCAGCCTGAGACGTGGGCGGGTTCCTTCCCAGGCGTTGC AGCTCTCTTTCCTCCCTCACTCTCCAGTTCCTCTGGCTCAGTGAGGGATTTGGGATTTCTGTGTGTGGGGCATGG ACAGATACTACTCTTAGTGAAAAGCTGGACAAGGTGGAGTAGAGCATCAAGGGTGAGTGCCACTACGGGTCTAGG CTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCC CCCCCCCCCCAACACCTGCTGCCTGCTAAAAATAACCCTGTCCCTGGTGGATATCAAGGCTGTGGGGGACTGAGG GCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCC GGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGG GGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACG AGCTGAAAGCTCATCTACTCTCAGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTC CTCTATATAACCCAGGGGCACAGGGGCTGCCCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAG CCAGCCAGCAAACATCACTGCAAGTCTTAACAGCCCAGTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAA GGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACT GACATCCACTTTGCCTTTCTCTCCACAGGTGTCCAGACCGGTGCCACCATGCCGACCGTCATTAGCGCATCTGTG GCTCCAAGGACAGCGGCTGAGCCCCGGTCCCCAGGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCT GGGGGTGGAAACCCAAGTGGCATCTATTCAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAG ACATTCGAGCAACTTCACAAGAAATGTCTAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTCCCACCGGATGAG ACCTCTCTCTTTTATAGCCAGAAGTTCCCCATCCAGTTCGTCTGGAAGAGACCTCCGGAAATTTGCGAGAATCCC CGATTTATCATTGATGGAGCCAACAGAACTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCC ATTGCCTGCCTGACCCTGAACCAGCACCTTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTAC GCAGGGATCTTCCACTTCCAGTTCTGGCGCTATGGAGAGTGGGTGGACGTGGTTATAGATGACTGCCTGCCAACG TACAACAATCAACTGGTTTTCACCAAGTCCAACCACCGCAATGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTAT GCTAAGCTCCATGGTTCCTACGAAGCTCTGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGG GTGGCAGAGTTTTTTGAGATCAGGGATGCTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGC TCCCTCATGGGCTGCTCCATTGATGATGGCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGG GAGTTGATTGCACGGATGGTAAGGAATATGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCA GATGAAAGACCGACCCGGACAATCATTCCGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCAC GCCTACTCTGTCACGGGGCTGGATGAGGTCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCG TGGGGCCAGGTGGAGTGGAACGGTTCTTGGAGTGATAGATGGAAGGACTGGAGCTTTGTGGACAAAGATGAGAAG GCCCGTCTGCAGCACCAGGTCACTGAGGATGGAGAGTTCTGGATGTCCTATGAGGATTTCATCTACCATTTCACA AAGTTGGAGATCTGCAACCTCACGGCCGATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAAC GAGGGCCGCTGGGTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAG TACCGTCTGAAGCTCCTGGAGGAGGACGATGACCCTGATGACTCGGAGGTGATTTGCAGCTTCCTGGTGGCCCTG ATGCAGAAGAACCGGCGGAAGGACCGGAAGCTAGGGGCCAGTCTCTTCACCATTGGCTTCGCCATCTACGAGGTT CCCAAAGAGATGCACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGC AAAACCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCC ACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTT GAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTTCGGACAGAGCA AACAGCAACAAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAG CAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAG CAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTCGTGAACAAACAC AAGGACCTGAAGACACACGGGTTCACACTGGAGTCCTGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCT GGAAAGCTCAACCTGCAGGAGTTCCACCACCTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTAT GACACAGACCAGTCCGGCACCATCAACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAAC AACCAGCTCTATGACATCATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGACAGTTTCATCTGC TGCTTCGTTAGGCTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTC AACGTTCTGGAGTGGCTGCAGCTCACCATGTATGCCTGATTACCAAACATCACTGCAAGTCTTAAAATACTCAAA CATCACTGCAAGTCTTAAACAATATCAACAAAATCACTGATGCTGGAGCTCATAAACATCACTGCAAGTCTTAAG Attorney Docket No.: PAT059898-WO-PCT / KATE-037 ACTACCAACAAAATCACTGATGCTGGACTAGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCAT CTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATG AGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGG AGGATTGGGAAGAGAATAGCAGGCATGCTGGGGAAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGC GCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGC GAGCGAGCGCGC (SEQ ID NO: 2417) Nucleic acid Sequence 5 annotated T T G T G A G T C T T G G C C G C C C A G C T A T A T T G C T G C G T C C G Attorney Docket No.: PAT059898-WO-PCT / KATE-037 TCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCC GATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGC TGGGTACGGGGTTGCTCTGCCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACC G G G C C C C A A G C C C C C C T A C T T G G G A Nucleic acid 6 GCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGT GAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTTTAAAATAAGCTGCATACATC Attorney Docket No.: PAT059898-WO-PCT / KATE-037 CACTTATTCAGAATGATAGCTTTTTATTTCAGGTCAAGAGGGACAGCCCAGAGTCTAAGAGGATCATATTCAGCT CACAGCTGCAGTTCTCAAATTACACTGATCAGGCAGATTCTGACAAATCCAACACTCTTGGTGCCTGCCTGCCCC TACACCTTTAAAACCCTTAAAGCAGTAAGCCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGA CACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCCCCAACACCTGCTGCCTGCTAAA AATAACCCTGTCCCTGGTGGATATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGC TTATACGTGCCTGGGACTCCCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTA GACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGC AAGCTGCACGCCTGGGTCCGGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTACTCTCAGGGGCCC CTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGC CCTCATTCTACCACCACCTCCACAGCACAGACAGACACTCAGGAGCCAGCCAGCGAAACCCAGCAGACAATGTAG CTCAGCCCAGTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGA GACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG GTGTCCAGACCGGTGCCACCATGCCGACCGTCATTAGCGCATCTGTGGCTCCAAGGACAGCGGCTGAGCCCCGGT CCCCAGGGCCAGTTCCTCACCCGGCCCAGAGCAAGGCCACTGAGGCTGGGGGTGGAAACCCAAGTGGCATCTATT CAGCCATCATCAGCCGCAATTTTCCTATTATCGGAGTGAAAGAGAAGACATTCGAGCAACTTCACAAGAAATGTC TAGAAAAGAAAGTTCTTTATGTGGACCCTGAGTTCCCACCGGATGAGACCTCTCTCTTTTATAGCCAGAAGTTCC CCATCCAGTTCGTCTGGAAGAGACCTCCGGAAATTTGCGAGAATCCCCGATTTATCATTGATGGAGCCAACAGAA CTGACATCTGTCAAGGAGAGCTAGGGGACTGCTGGTTTCTCGCAGCCATTGCCTGCCTGACCCTGAACCAGCACC TTCTTTTCCGAGTCATACCCCATGATCAAAGTTTCATCGAAAACTACGCAGGGATCTTCCACTTCCAGTTCTGGC GCTATGGAGAGTGGGTGGACGTGGTTATAGATGACTGCCTGCCAACGTACAACAATCAACTGGTTTTCACCAAGT CCAACCACCGCAATGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTTCCTACGAAGCTC TGAAAGGTGGGAACACCACAGAGGCCATGGAGGACTTCACAGGAGGGGTGGCAGAGTTTTTTGAGATCAGGGATG CTCCTAGTGACATGTACAAGATCATGAAGAAAGCCATCGAGAGAGGCTCCCTCATGGGCTGCTCCATTGATGATG GCACGAACATGACCTATGGAACCTCTCCTTCTGGTCTGAACATGGGGGAGTTGATTGCACGGATGGTAAGGAATA TGGATAACTCACTGCTCCAGGACTCAGACCTCGACCCCAGAGGCTCAGATGAAAGACCGACCCGGACAATCATTC CGGTTCAGTATGAGACAAGAATGGCCTGCGGGCTGGTCAGAGGTCACGCCTACTCTGTCACGGGGCTGGATGAGG TCCCGTTCAAAGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAATCCGTGGGGCCAGGTGGAGTGGAACGGTTCTT GGAGTGATAGATGGAAGGACTGGAGCTTTGTGGACAAAGATGAGAAGGCCCGTCTGCAGCACCAGGTCACTGAGG ATGGAGAGTTCTGGATGTCCTATGAGGATTTCATCTACCATTTCACAAAGTTGGAGATCTGCAACCTCACGGCCG ATGCTCTGCAGTCTGACAAGCTTCAGACCTGGACAGTGTCTGTGAACGAGGGCCGCTGGGTACGGGGTTGCTCTG CCGGAGGCTGCCGCAACTTCCCAGATACTTTCTGGACCAACCCTCAGTACCGTCTGAAGCTCCTGGAGGAGGACG ATGACCCTGATGACTCGGAGGTGATTTGCAGCTTCCTGGTGGCCCTGATGCAGAAGAACCGGCGGAAGGACCGGA AGCTAGGGGCCAGTCTCTTCACCATTGGCTTCGCCATCTACGAGGTTCCCAAAGAGATGCACGGGAACAAGCAGC ACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAAACCTACATCAACATGCGGGAGGTGT CCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCCTCCACCTACGAGCCCCACCAGGAGGGGGAAT TCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCTGAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAG TGAAAAAGAAAAAAACCAAGCCCATCATCTTCGTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACC AGGAGTCAGAGGAGGGCAAAGGCAAAACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCT CTGATCAGGAAAGTGAGGAACAGCAACAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCT GTGCAGATGAGCTCAAGAAGGTCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACAC TGGAGTCCTGCCGTAGCATGATTGCGCTCATG...

Claims

1. Attorney Docket No.: PAT059898-WO-PCT / KATE-037 from the full contents of this document, including references to the scientific and patent literature cited herein. The subject matter herein contains important information, exemplification and guidance that can be adapted to the practice of this invention in its various embodiments and equivalents thereof.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 CLAIMS What Is Claimed Is:

1. A recombinant nucleic acid comprising: a muscle specific promoter; a sequence encoding calpain 3 (CAPN3) or biologically active fragment thereof; at least one heart de-targeting miRNA binding site; and at least one dorsal root ganglia (DRG) de-targeting miRNA binding site.

2. The recombinant nucleic acid of claim 2, wherein the muscle specific promoter comprises a CK8 promoter, a desmin promoter, a Mb promoter, a MCK promoter, a MHCK7 promoter, a skeletal muscle alpha actin promoter, or a TTNI2 promoter.

3. The recombinant nucleic acid of claim 1 or claim 2, wherein the muscle specific promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407.

4. The recombinant nucleic acid of any one of claims 1-3, wherein the muscle specific promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407.

5. The recombinant nucleic acid of any one of claims 1-4, wherein the muscle specific promoter comprises or consists of the nucleic acid sequence of SEQ ID NO: 2404.

6. The recombinant nucleic acid of any one of claims 1-5, wherein the sequence encoding CAPN3 is a sequence encoding human CAPN3.

7. The recombinant nucleic acid of any one of claims 1-6, wherein the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, atAttorney Docket No.: PAT059898-WO-PCT / KATE-037 least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408.

8. The recombinant nucleic acid of any one of claims 1-7, wherein the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408.

9. The recombinant nucleic acid of any one of claims 1-8, wherein the at least one heart de-targeting miRNA binding site comprises a binding site for miR-221 or miR-499.

10. The recombinant nucleic acid of any one of claims 1-9, wherein the at least one heart de-targeting miRNA binding site comprises a binding site for miR-221-3p or miR-499-5p.

11. The recombinant nucleic acid of any one of claims 1-10, wherein the at least one heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403.

12. The recombinant nucleic acid of any one of claims 1-11, wherein the at least one heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403.

13. The recombinant nucleic acid of any one of claims 1-12, wherein the at least one heart de-targeting miRNA binding site comprises a first, a second, a third, and a fourth heart de- targeting miRNA binding site.

14. The recombinant nucleic acid of any one of claims 1-13, wherein each of the first, the second, the third, and the fourth heart de-targeting miRNA binding sites comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 15. The recombinant nucleic acid of any one of claims 1-14, wherein each of the first, the second, the third, and the fourth heart de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403.

16. The recombinant nucleic acid of any one of claims 1-15, wherein the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338, miR-138, or miR-9.

17. The recombinant nucleic acid of any one of claims 1-16, wherein the at least one DRG de-targeting miRNA binding site comprises a binding site for miR-338-3p, miR-138- 5p, or miR-9-5p.

18. The recombinant nucleic acid of any one of claims 1-17, wherein the at least one DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399- 2401.

19. The recombinant nucleic acid of any one of claims 1-18, wherein the at least one DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

20. The recombinant nucleic acid of any one of claims 1-19, wherein the at least one DRG de-targeting miRNA binding site comprises a first and a second DRG de-targeting miRNA binding site.

21. The recombinant nucleic acid of any one of claims 1-20, wherein each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 22. The recombinant nucleic acid of any one of claims 1-21, wherein each of the first and the second DRG de-targeting miRNA binding sites comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401.

23. The recombinant nucleic acid of any one of claims 1-22, further comprising an intron.

24. The recombinant nucleic acid of claim 23, wherein the intron comprises a simian virus 40 (SV40) intron sequence, a minute virus of mice (MVM) intron, a RK intron, a β- globin intron, and / or a chicken β-actin (CBA) intron, including functional variants or fragments thereof.

25. The recombinant nucleic acid of claim 23 or claim 24, wherein the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410.

26. The recombinant nucleic acid of any one of claims 23-25, wherein the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410.

27. The recombinant nucleic acid of any one of claims 1-26, further comprising a polyadenylation (PolyA) signal.

28. The recombinant nucleic acid of claim 27, wherein the PolyA signal comprises a bovine growth hormone polyadenylation (bgh-PolyA) signal, a synthetic PolyA signal, or an SV40 PolyA signal.

29. The recombinant nucleic acid of claim 27 or claim 28, wherein the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 30. The recombinant nucleic acid of any one of claims 27-29, wherein the PolyA signal comprises the bgh-PolyA signal, and the bgh-PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411.

31. The recombinant nucleic acid of any one of claims 1-30, further comprising a 5′ inverted terminal repeat (ITR) and a 3′ ITR.

32. The recombinant nucleic acid of claim 31, wherein the 5′ ITR and / or the 3′ ITR is an adeno-associated virus 2 (AAV2) ITR, or a variant or fragment thereof.

33. The recombinant nucleic acid of claim 31 or claim 32, wherein the 5′ ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409.

34. The recombinant nucleic acid of any one of claims 31-33, wherein the 5′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409.

35. The recombinant nucleic acid of any one of claims 31-34, wherein the 3′ ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412.

36. The recombinant nucleic acid of any one of claims 31-35, wherein the 3′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2412.

37. The recombinant nucleic acid of any one of claims 1-36, wherein the recombinant nucleic acid comprises, optionally from 5′ to 3′: a 5′ ITR; a promoter; a first heart de-targeting miRNA binding site;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 an intron; a sequence encoding CAPN3; a second heart de-targeting miRNA binding site; a third heart de-targeting miRNA binding site; a first DRG de-targeting miRNA binding site; a fourth heart de-targeting miRNA binding site; a second DRG de-targeting miRNA binding site; a PolyA signal; and a 3′ ITR.

38. The recombinant nucleic acid of claim 37, wherein: the 5′ ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; the first heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the intron comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 the second heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the third heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the first DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the fourth heart de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the second DRG de-targeting miRNA binding site comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the PolyA signal comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and the 3′ ITR comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 39. The recombinant nucleic acid of claim 37 or claim 38, wherein the recombinant nucleic acid is selected from: a) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at leastAttorney Docket No.: PAT059898-WO-PCT / KATE-037 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; b) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%,Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, atAttorney Docket No.: PAT059898-WO-PCT / KATE-037 least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; c) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%,Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; d) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%,Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; e) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at leastAttorney Docket No.: PAT059898-WO-PCT / KATE-037 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; f) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%,Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, atAttorney Docket No.: PAT059898-WO-PCT / KATE-037 least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; g) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%,Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412; and h) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%,Attorney Docket No.: PAT059898-WO-PCT / KATE-037 at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2412.

40. The recombinant nucleic acid of any one of claims 37-39, wherein: the 5′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2409; the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407; the first heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the intron comprises or consists of the nucleic acid sequence of SEQ ID NO: 2410; the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408; the second heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the third heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the first DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the fourth heart de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of SEQ ID NO: 2402 or SEQ ID NO: 2403; the second DRG de-targeting miRNA binding site comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2399-2401; the PolyA signal comprises or consists of the nucleic acid sequence of SEQ ID NO: 2411; and the 3′ ITR comprises or consists of the nucleic acid sequence of SEQ ID NO: 2412.

41. The recombinant nucleic acid of any one of claims 37-40, wherein the recombinant nucleic acid is selected from: a) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; b) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; c) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; d) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; e) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2405; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2399; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; f) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2404; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; g) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2406; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403;Attorney Docket No.: PAT059898-WO-PCT / KATE-037 a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412; and h) a recombinant nucleic acid comprising: a 5′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2409; a promoter comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2407; a first heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; an intron comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2410; a sequence encoding CAPN3 comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2408; a second heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a third heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2402; a first DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2400; a fourth heart de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2403; a second DRG de-targeting miRNA binding site comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2401; a PolyA signal comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2411; and a 3′ ITR comprising or consisting of the nucleic acid sequence of SEQ ID NO: 2412.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 42. The recombinant nucleic acid of any one of claims 1-41, wherein the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2413-2420.

43. The recombinant nucleic acid of any one of claims 1-42, wherein the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2413-2420.

44. A recombinant nucleic acid comprising a promoter, wherein the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407.

45. The recombinant nucleic acid of claim 44, wherein the promoter comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2404-2407.

46. The recombinant nucleic acid of claim 44 or claim 45, further comprising a sequence encoding CAPN3, optionally wherein the sequence encodes human CAPN3.

47. The recombinant nucleic acid of claim 46, wherein the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408.

48. The recombinant nucleic acid of claim 46 or claim 47, wherein the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 49. The recombinant nucleic acid of any one of claims 44-48, wherein the recombinant nucleic acid comprising the promoter exhibits enhanced expression in skeletal muscle cells compared to non-skeletal muscle cells and / or cardiac muscle cells.

50. A recombinant nucleic acid comprising a promoter, wherein the promoter comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2442-2451.

51. The recombinant nucleic acid of claim 50, further comprising an enhancer comprising or consisting of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2433-2441.

52. The recombinant nucleic acid of claim 50 or claim 51, wherein the recombinant nucleic acid comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 2423-2432.

53. The recombinant nucleic acid of any one of claims 50-52, wherein the recombinant nucleic acid comprises or consists of the nucleic acid sequence of any one of SEQ ID NOs: 2423-2432.

54. The recombinant nucleic acid of any one of claims 50-53, further comprising a sequence encoding CAPN3, optionally wherein the sequence encodes human CAPN3.

55. The recombinant nucleic acid of claim 54, wherein the sequence encoding CAPN3 comprises or consists of a nucleic acid sequence that is at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at leastAttorney Docket No.: PAT059898-WO-PCT / KATE-037 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of SEQ ID NO: 2408.

56. The recombinant nucleic acid of claim 54 or claim 55, wherein the sequence encoding CAPN3 comprises or consists of the nucleic acid sequence of SEQ ID NO: 2408.

57. The recombinant nucleic acid of any one of claims 50-56, further comprising at least one heart de-targeting miRNA binding site.

58. The recombinant nucleic acid of claim 57, wherein the at least one heart de-targeting miRNA binding site comprises a binding site for miR-221-3p or miR-499-5p.

59. The recombinant nucleic acid of any one of claims 50-58, wherein the recombinant nucleic acid comprising the promoter exhibits enhanced expression in skeletal muscle cells compared to non-skeletal muscle cells and / or cardiac muscle cells.

60. An adeno-associated virus (AAV) particle comprising the recombinant nucleic acid of any one of claims 1-59 and a capsid protein.

61. The AAV particle of claim 60, wherein the capsid protein is derived from a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh, AAVrh10, AAVrh74, AAV-DJ, AAV-DJ / 8, Anc80, and AAV7m8, or a derivative, hybrid or chimeric serotype thereof.

62. The AAV particle of claim 60 or claim 61, wherein the AAV particle has increased muscle tropism compared to a wild type AAV9 particle.

63. The AAV particle of any one of claims 60-62, wherein the AAV particle has reduced liver tropism compared to a wild type AAV9 particle.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 64. The AAV particle of any one of claims 60-63, wherein the capsid protein comprises an amino acid sequence of formula (I): (I) X1NX2X3X4RGDRX5X6L (SEQ ID NO: 1), wherein each of X1-X6is any amino acid.

65. The AAV particle of claim 64, wherein the amino acid sequence of formula (I) is in a hypervariable region IV (HVR IV) relative to a wild type AAV9 capsid.

66. The AAV particle of claim 64 or claim 65, wherein, relative to a wild type AAV9 capsid, X1 is a substitution at amino acid 451, X2 is a substitution at amino acid 453, X3 is a substitution at amino acid 454, X4is a substitution at amino acid 455, and RGDRX5X6L (SEQ ID NO: 2422) is inserted after amino acid 455.

67. The AAV particle of any one of claims 64-66, wherein: X1is A, I, F, G, H, L, M, Q, S, T, or V; X2 is A, G, S, T, or Y; X3is S, N, G, or P; X4 is A, G, H, I, M, S, T, or V; X5is A, G, or Q; and X6 is A, I, L, M, N, S, or Y.

68. The AAV particle of any one of claims 64-67, wherein the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 801-1599.

69. The AAV particle of any one of claims 64-68, wherein the amino acid sequence of formula (I) comprises of any one of SEQ ID NOs: 1600-2398.

70. The AAV particle of any one of claims 64-69, wherein the amino acid sequence of formula (I) comprises or consists of any one of SEQ ID NOs: 2-800.

71. The AAV particle of any one of claims 64-70, wherein the amino acid sequence of formula (I) comprises or consists of SEQ ID NOs: 191, 198, 199, 215, 256, 379, 544, 550, or 748.Attorney Docket No.: PAT059898-WO-PCT / KATE-037 72. The AAV particle of any one of claims 64-71, wherein the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector.

73. The AAV particle of any one of claims 64-72, wherein the amino acid sequence of formula (I) comprises or consists of SEQ ID NO: 215 and the capsid protein further comprises a deletion of amino acid G267 relative to a wild type AAV9 vector.

74. A pharmaceutical composition comprising the recombinant nucleic acid of any one of claims 1-59, the adeno-associated virus (AAV) particle of any one of claims 60-73, and a pharmaceutically acceptable carrier.

75. A method of treating limb girdle muscular dystrophy 2A (LGMD2A) in a subject in need thereof, the method comprising administering to the subject an effective amount of the recombinant nucleic acid of any one of claims 1-59, the adeno-associated virus (AAV) particle of any one of claims 60-73, or the pharmaceutical composition of claim 74.

76. The method of claim 75, wherein the subject is a human subject.

77. The method of claim 75 or claim 76, wherein the subject has at least one mutation in the calpain 3 (CAPN3) gene.

78. The method of any one of claims 75-77, wherein the administering comprises intramuscular administration, subcutaneous injection, intravenous injection, or intravenous (IV) administration.

79. The use of the recombinant nucleic acid of any one of claims 1-59, the adeno- associated virus (AAV) particle of any one of claims 60-73, or the pharmaceutical composition of claim 74 for the manufacture of a medicament for treating limb girdle muscular dystrophy 2A (LGMD2A).

80. The recombinant nucleic acid of any one of claims 1-59, the adeno-associated virus (AAV) particle of any one of claims 60-73, or the pharmaceutical composition of claim 74 for use in treating limb girdle muscular dystrophy 2A (LGMD2A).

Images