Genome editing method not cutting genome, gene therapy composition using same, and recombinant adenovirus vector

The use of Cas nickase and adenovirus vector for single-strand breaks in the CRISPR/Cas9 system addresses off-target mutations, ensuring safe and efficient genome editing for therapeutic applications.

WO2026034576A1PCT designated stage Publication Date: 2026-02-12JUNTENDO EDUCATIONAL FOUNDATION
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/JP2025/028033
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-07
Filing Date
2025-08-06
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

The CRISPR/Cas9 system's imperfect accuracy leads to off-target mutations when applied to human genome editing, making it impractical for therapeutic use due to the risk of unintended chromosomal damage such as large-scale deletions and rearrangements.

Method used

A genome editing method using a Cas nickase to introduce only single-strand breaks (nicks) without double-strand breaks, facilitated by a recombinant adenovirus vector containing genes for Cas nickase and guide RNA, enabling targeted replacement or insertion of nucleotide sequences through homologous recombination.

Benefits of technology

Reduces the probability of unintended genomic damage while maintaining editing efficiency, allowing safe and effective genome editing for gene therapy and cell therapy applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000077_0000
    Figure 00000077_0000
  • Figure 00000077_0001
    Figure 00000077_0001
  • Figure 00000078_0000
    Figure 00000078_0000
Patent Text Reader

Abstract

The present disclosure relates to a genome editing method that does not cut the genome, a gene therapy composition using the same, and a recombinant adenovirus vector.
Need to check novelty before this filing date? Find Prior Art

Description

Genome editing method without genome cutting, gene therapy composition using the same, and recombinant adenovirus vector

[0001] The present disclosure relates to a genome editing method that does not cut the genome, a gene therapy composition using the same, and a recombinant adenovirus vector.

[0002] The CRISPR / Cas9 system, one of the CRISPR / Cas systems found in prokaryotes, is a genome editing technology that efficiently rewrites gene sequences and is expected to have clinical applications in the treatment of cancer and genetic diseases. The basic CRISPR / Cas9 system consists of the Cas9 protein, which cleaves double-stranded DNA, the CRISPR RNA (crRNA) that determines the position specificity on the target genome, and a guide RNA (gRNA) consisting of an activating RNA (trans-activating crRNA: tracrRNA) that is partially complementary to the crRNA and serves as a scaffold for binding to the Cas9 protein. The guide RNA consisting of the crRNA and tracrRNA can also be supplied as a single guide RNA (single guide RNA / sgRNA) in which they are fused together. The guide RNA can then be expressed in target cells using an appropriate vector containing DNA encoding it.

[0003] Although the CRISPR / Cas9 system achieves site-specific genome cleavage, its accuracy is not perfect, and the genome may be cleaved at a position other than the originally intended genome region (off-target cleavage), resulting in off-target mutations. Since the human genome has a huge size of about 3000 M bases, if the CRISPR / Cas9 system is applied directly to human genome editing therapy, there is a possibility that non-target sites will be cleaved at hundreds of locations, making it impossible to put into practical use as a therapeutic method.

[0004] To date, various developments have been made to suppress off-target mutations of the Cas9 protein. For example, Cas9 nickase, which cleaves (nicks) only one strand of DNA, is used to generate nicks (single-strand breaks) in the sense and antisense strands of double-stranded DNA at adjacent positions (for example, within about 30 base pairs from the 5' ends of two guide RNAs), so that the genome is cleaved at the site only when nicks are formed at these two positions (double nicking system), and attempts have been made to significantly reduce the frequency of off-target mutations.

[0005] International Publication No. 2020 / 067004

[0006] The present disclosure aims to provide a genome editing method that does not cleave the genome, a gene therapy composition utilizing the same, and a recombinant adenovirus vector used in gene therapy, etc. The present disclosure preferably introduces only nicks (single-strand breaks) without introducing double-strand breaks into the genomic DNA to be edited. The present disclosure also preferably introduces only nicks (single-strand breaks) without introducing double-strand breaks into the donor DNA. The present disclosure preferably introduces only nicks (single-strand breaks) without introducing double-strand breaks into the genomic DNA to be edited and the donor DNA. This can eliminate the problem of unintended chromosomal damage (e.g., large-scale deletions and rearrangements) that may occur in the genome when double-strand breaks are introduced. That is, when a nickase derived from a Cas endonuclease (Cas nickase) is used, only nicks are introduced into double-stranded DNA without introducing double nicks, enabling replacement of a target site with a replacement nucleotide sequence or insertion of an insertion gene into a target site. This method can also be applied to the additional introduction of functional genes necessary for gene therapy or the replacement of abnormal genes with functional genes. Of course, the additional introduction of functional genes necessary for gene therapy or the replacement of abnormal genes with functional genes is possible even if double-strand breaks are introduced into the DNA to be edited instead of nicks. However, not making double-strand breaks is expected to reduce the probability of unintended large-scale genome deletions or rearrangements, and editing efficiency was not significantly impaired compared to when double-strand breaks were made. In this respect, the method of the present disclosure can be applied not only to genome editing of research cells, but also to gene therapy and cell therapy, which require safety.

[0007] In another aspect of the present disclosure, a double-strand break or a double-nicking double-strand break is introduced into the genomic DNA to be edited (and preferably the donor DNA) using a Cas endonuclease or a Cas nickase, at the same position as the nick introduction position described above.

[0008] The present invention provides the following: (1) A recombinant adenovirus vector comprising a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA is double-stranded and has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on the genome of a cell, and a replacement nucleotide sequence between the upstream and downstream arms, the guide RNA targets the target site on the genome, and one or more regions selected from the group consisting of the target site upstream (i.e., the upstream arm homologous region) and downstream (i.e., the downstream arm homologous region), as well as regions further outside thereof, and is capable of introducing a nick near the target sequence, and the donor DNA has the target sequence in one or more regions selected from the group consisting of the replacement nucleotide sequence, the upstream arm, the downstream arm, and regions further outside thereof, thereby allowing the guide RNA to generate a nick in the donor DNA {when the guide RNA targets the target site on the genome, the replacement nucleotide sequence may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with different amino acid sequences}, The recombinant adenovirus vector of the present invention is characterized in that the target site of the gene is a full-length or a part of a gene having a genetic mutation and an abnormality caused by the mutation, and the replacement nucleotide sequence is a region corresponding to the full-length or a part of the gene having a normal function.(3) A recombinant adenovirus vector comprising a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on the genome of a cell, and has an insertion nucleotide sequence between the upstream arm and the downstream arm, wherein the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and the upstream and downstream thereof, and further outside thereof, and is capable of introducing a nick near the target sequence, and the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the insertion nucleotide sequence, the upstream arm, the downstream arm, and further outside thereof, thereby allowing the guide RNA to generate a nick {when the guide RNA targets the target site on the genome, the insertion nucleotide sequence may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with different amino acid sequences}, (4) A recombinant adenovirus vector according to any one of (1) to (3) above, which can introduce a nick into the donor DNA at one of (i) further upstream of its upstream arm and (ii) further downstream of its downstream arm, and can introduce double nicking in the other (i.e., when one of the two is (i), the other is (ii), and when one of the two is (ii), the other is (i). (5) A recombinant adenovirus vector according to any one of (1) to (4) above, in which the nucleotide sequence to be inserted or replaced on the donor DNA has a length of 1 kb to 5 kb (e.g., 1 kb to 4 kb or 1 kb to 3 kb). (6) The recombinant adenoviral vector according to any one of (1) to (5) above, wherein the upstream arm and the downstream arm on the donor DNA are each 1 kb to 3 kb (e.g., 1 kb to 2 kb).(7) A method for replacing a target sequence on a cell genome with a replacement nucleotide sequence, comprising: providing an isolated cell; and introducing a recombinant adenovirus vector into the cell; wherein the recombinant adenovirus vector comprises a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA; wherein the donor DNA has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on the cell genome, and has a replacement nucleotide sequence between the upstream arm and the downstream arm; wherein the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and its upstream and downstream regions and further outside thereof, and is capable of introducing a nick near the target sequence; and wherein the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the replacement nucleotide sequence, the upstream arm, the downstream arm, and further outside thereof, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets the target site on the genome, the replacement nucleotide sequence may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with different amino acid sequences}. This method introduces a nick or double nicking into the donor DNA, but without introducing a double-strand break into the genome, and the target site is replaced with the replacement nucleotide sequence.(8) A method for knocking in an insertion nucleotide sequence into a cell genome, comprising: providing an isolated cell; and introducing a recombinant adenovirus vector into the cell; wherein the recombinant adenovirus vector comprises a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA; wherein the donor DNA has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on the cell genome, and has an insertion nucleotide sequence between the upstream arm and the downstream arm; wherein the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and the upstream and downstream thereof, and further outside thereof, and is capable of introducing a nick near the target sequence; and wherein the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the insertion nucleotide sequence, the upstream arm, the downstream arm, and further outside thereof, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets the target site on the genome, the insertion nucleotide sequence may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with different amino acid sequences}. (9) The method according to (7) or (8) above, wherein a nick is generated in one of (i) the upstream arm further upstream and (ii) the downstream arm further downstream of the donor DNA, and a double nicking is generated in the other. (10) The method according to any of (7) to (9) above, wherein the nucleotide sequence for insertion or replacement on the donor DNA has a length of 1 kb to 5 kb (e.g., 1 kb to 4 kb or 1 kb to 3 kb). (11) The method according to any of (7) to (10) above, wherein the upstream arm and the downstream arm on the donor DNA are each 1 kb to 3 kb (e.g., 1 kb to 2 kb).(12) A composition for use in the method according to any one of (7) to (11), comprising: (i) a recombinant adenoviral vector comprising the donor DNA, used in combination with a recombinant adenoviral vector comprising a gene encoding a Cas nickase and a gene encoding a guide RNA targeting the target sequence; (ii) a recombinant adenoviral vector comprising a gene encoding a Cas nickase and a gene encoding a guide RNA targeting the target sequence, used in combination with a recombinant adenoviral vector comprising the donor DNA; (iii) a recombinant adenoviral vector comprising a gene encoding a guide RNA targeting the target sequence and the donor DNA, used in combination with a recombinant adenoviral vector comprising the gene encoding a Cas nickase; or (iv) a recombinant adenoviral vector comprising a gene encoding a Cas nickase, used in combination with a recombinant adenoviral vector comprising the donor DNA and a gene encoding a guide RNA targeting the target sequence. (13) The invention according to any one of the above, wherein the in vitro gene editing efficiency is 0.5% or more. (14) Any of the above-mentioned inventions, wherein the in vitro gene editing efficiency is 1% or more. (15) Any of the above-mentioned inventions, wherein the in vitro gene editing efficiency is 1.5% or more. (16) The invention according to (13) above, wherein the in vitro gene editing efficiency is about 4% or less, or about 3.5% or less, or about 3% or less. (17) The invention according to (14) above, wherein the in vitro gene editing efficiency is about 4% or less, or about 3.5% or less, or about 3% or less. (18) The invention according to (15) above, wherein the in vitro gene editing efficiency is about 4% or less, or about 3.5% or less, or about 3% or less.

[0009] The present disclosure is based on the above-mentioned findings of the present inventors. (101) An adenovirus vector comprising a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA is double-stranded and has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on a cell's genome, and a sequence to be replaced with the target site (for example, the full length or a portion of a gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy) is present between the upstream and downstream arms, (when the sequence to be replaced with the target site is the full length or a portion of a gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy, the target site on the genome is, for example, the full length or a portion of a gene for gene therapy, such as a gene encoding a metabolic enzyme having a genetic mutation that causes a metabolic disorder, and the full length or a portion of the donor DNA corresponds to the full length or a portion of the target site on the genome), and the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and the upstream and downstream thereof, and further outside thereof, and can introduce a nick near the target sequence, The donor DNA has the target sequence in one or more regions selected from the group consisting of the replacement nucleotide sequence, the upstream arm, the downstream arm, and outside thereof, thereby allowing a nick to be generated in the donor DNA by the guide RNA {when the guide RNA targets a target site on the genome, the replacement nucleotide sequence may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with a different amino acid sequence}, thereby introducing a nick or double nicking into the donor DNA without introducing a double-strand break into the genome, and replacing the target site with a sequence to be replaced with (for example, the full length or part of a gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy), thereby modifying or repairing a gene on the genome. This is an adenovirus vector.(102) An adenovirus vector comprising a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on a cell's genome, and a sequence to be inserted into the target site (for example, the full length of a gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy) between the upstream arm and the downstream arm, wherein the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, its upstream and downstream, and its outer regions, and can introduce a nick near the target sequence, and the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the nucleotide sequence for insertion, the upstream arm, the downstream arm, and its outer regions, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets the target site on the genome, the nucleotide sequence for insertion may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with different amino acid sequences}, (103) The adenovirus vector according to (101) or (102), wherein a nick or double nicking is introduced into the donor DNA without introducing a double-strand break into the genome, and a sequence to be replaced with the target site (for example, the full-length of a gene for gene therapy such as a gene encoding a metabolic enzyme for gene therapy) is knocked in to the target site, and preferably, the sequence to be replaced with the target site (for example, the full-length of a gene for gene therapy such as a gene encoding a metabolic enzyme for gene therapy) can be expressed from the genome. (103) The adenovirus vector according to (101) or (102), wherein a nick can be generated in the donor DNA at either (i) a position further upstream of the upstream arm or (ii) a position further downstream of the downstream arm, and a double nicking can be generated in the other position.(104) The adenoviral vector according to any one of (101) to (103) above, wherein the full length or a part of the gene encoding a gene for gene therapy, such as a metabolic enzyme for gene therapy, on the donor DNA has a length of 1 kb to 5 kb (e.g., 1 kb to 4 kb or 1 kb to 3 kb). (105) The adenoviral vector according to any one of (101) to (104) above, wherein the upstream arm and the downstream arm on the donor DNA are each 1 kb to 3 kb (e.g., 1 kb to 2 kb).(106) A method for repairing a gene such as a gene encoding a metabolic enzyme in a cellular genome, comprising: providing an isolated cell having a gene such as a gene encoding a metabolic enzyme having a genetic mutation and a resulting abnormality; and introducing an adenoviral vector into the cell, wherein the adenoviral vector comprises a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA; the donor DNA has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site in the cellular genome, and has the full length or a portion of a gene for gene therapy such as a gene encoding a metabolic enzyme for gene therapy between the upstream arm and the downstream arm; the target site in the genome is the full length or a portion of a gene for gene therapy such as a gene encoding a metabolic enzyme having a genetic mutation that causes a metabolic abnormality; the full length or a portion of the donor DNA corresponds to the full length or a portion of the target site in the genome; and the guide RNA has one or more regions selected from the group consisting of the target site in the genome, and the upstream and downstream thereof, and further outside thereof, as its target sequence, and can introduce a nick near the target sequence; The donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the replacement nucleotide sequence, the upstream arm, the downstream arm, and outside thereof, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets a target site on the genome, the replacement nucleotide sequence may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using a codon with a different amino acid sequence}, thereby introducing a nick or double nicking into the donor DNA without introducing a double-strand break into the genome, and the target site is replaced with the full length or part of a gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy, thereby repairing the gene on the genome.(107) A method for knocking in a gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy, into a cellular genome, comprising: providing an isolated cell having a gene, such as a gene encoding a metabolic enzyme having a genetic mutation and a resulting abnormality; and introducing an adenoviral vector into the cell, wherein the adenoviral vector comprises a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA has an upstream arm and a downstream arm capable of undergoing homologous recombination with the upstream and downstream of a target site on the cellular genome, and carries the full-length or functional fragment of the gene for gene therapy, such as the gene encoding a metabolic enzyme for gene therapy, between the upstream arm and the downstream arm, and wherein the guide RNA has one or more regions selected from the group consisting of the target site on the genome, and the upstream and downstream thereof, and further outside thereof, as its target sequence, and is capable of introducing a nick near the target sequence, (108) The method according to (106) or (107), wherein the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the nucleotide sequence for insertion, the upstream arm, the downstream arm, and outside thereof, thereby allowing a nick to be generated by the guide RNA (when the guide RNA targets a target site on the genome, the nucleotide sequence for insertion may be a sequence that is not cleaved by the guide RNA, which can be achieved, for example, by using codons with different amino acid sequences). Thus, a nick or double nicking is introduced into the donor DNA without introducing a double-strand break into the genome, and the full-length gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy, is knocked in at the target site, allowing the gene for gene therapy, such as a metabolic enzyme for gene therapy, to be expressed from the genome. (109) The method according to (108) or (109), wherein the donor DNA can be nicked at one of (i) further upstream of the upstream arm and (ii) further downstream of the downstream arm, and double nicking can be generated in the other.(109) The method according to any one of (106) to (108) above, wherein the entire length or a part of the gene for gene therapy, such as a gene encoding a metabolic enzyme for gene therapy, on the donor DNA has a length of 1 kb to 5 kb (e.g., 1 kb to 4 kb or 1 kb to 3 kb). (110) The method according to any one of (106) to (109) above, wherein the upstream arm and the downstream arm on the donor DNA are each 1 kb to 3 kb (e.g., 1 kb to 2 kb). (111) A composition for use in the method according to any one of (106) to (110), comprising: (i) a recombinant adenovirus vector comprising the donor DNA, used in combination with a recombinant adenovirus vector comprising a gene encoding Cas nickase and a gene encoding a guide RNA that targets the target sequence; (ii) a recombinant adenovirus vector comprising a gene encoding Cas nickase and a gene encoding a guide RNA that targets the target sequence, used in combination with a recombinant adenovirus vector comprising the donor DNA; (iii) a recombinant adenovirus vector comprising a gene encoding a guide RNA that targets the target sequence and the donor DNA, used in combination with a recombinant adenovirus vector comprising a gene encoding Cas nickase; or (iv) a recombinant adenovirus vector comprising a gene encoding a guide RNA that targets the target sequence, used in combination with a recombinant adenovirus vector comprising the donor DNA, and a gene encoding Cas nickase. (120) Any of the above-described inventions, wherein the target site is a safe harbor region (e.g., the AAVS1 region, the CCR5 region, or the hROSA26 region). (130) Any of the above-described inventions, wherein the Cas nickase comprises a Cas9 nickase. (131) Any of the above-described inventions, wherein the Cas nickase comprises a MAD7. (132) Any of the above-described inventions, wherein the Cas nickase comprises a Cas12a. (201) 1 x 10. 2 cells, 1 x 10 3 cells, 1 x 10 4 cells, 2 x 10 4 cells, 3 x 10 4cells, 4 x 10 4 cells, 5 x 10 4 cells, 6 x 10 4 cells, 7 x 10 4 cells, 8 x 10 4 cells, 9 x 10 4 cells, or 1 x 10 5 Any of the above-mentioned inventions, wherein cells are edited and the number of cells in which the sequence of the target site in the genomic DNA has changed before and after editing is below the detection limit.

[0010] Figure 1A illustrates the introduction or repair of point mutations using an AAV vector. AAV vectors are limited in the gene length they can carry, and the introduction or repair of point mutations has traditionally been performed. Figure 1B illustrates the replacement of large genes or fragments thereof using an adenoviral vector (AdV). The dotted lines represent non-limiting examples of cleavage sites. Figure 1C shows a promoter that utilizes an endogenous promoter on the genome and replaces only the protein coding region. The dotted lines represent non-limiting examples of cleavage sites. Figure 2 is a schematic diagram showing the structure of the vector used in this study. In the figure, the L arm represents the upstream arm, the R arm represents the downstream arm, pro represents the promoter, pA represents the poly(A) addition signal, the diamond represents the gene encoding the optionally introduced shRNA against Cypor, and the rectangle represents the gene encoding the gRNA. In the figure, two copies of the gRNA-encoding gene are introduced, but one copy is also acceptable. The two copies may be identical, target different locations, or be a pair that introduces double nicking. The scissors in the figure represent an example of the location of the gRNA target sequence on the donor DNA. Figure 3 shows a scheme for introducing the Pah gene into the safe harbor region and a primer set (277F and 279R) for verifying introduction. Figure 4A shows PCR results for the transgene after gene introduction using Cas9 and Cas9 nickase (NC9). Figure 4B is a graph that quantifies the gene introduction efficiency shown in Figure 4A. Figure 4C shows the disruption rate of the target site in the genome using the method of the present disclosure. A low disruption rate indicates that the genome is not double-cut and does not cause genomic instability. Figure 5 shows the knockdown effect of Cypor using shRNA. "Pah" in the figure represents the AxYPah vector, and "GFP" represents the AxYGFP vector. Figure 6A shows an example of the construction of a recombinant adenoviral vector (AxYGFP-G) that introduces one nick into the genome and one nick into the donor DNA. Figure 6B shows the results of gene transfer into the genome using AxYGFP-G. The presence of a band indicates successful homologous recombination."m" indicates a molecular weight marker, and the numbers at the top of the photographs represent the MOI of the viral vector, as shown in Figures 6B, 6E, 6H, 6J, and 6M. Figure 6C shows the results of flow cytometry based on fluorescence from the GFP gene integrated into the genome by homologous recombination with AxYGFP-G. The numbers in the figure indicate the percentage (%) of GFP-positive cells among all cells. "Cas9n" in the figure refers to Cas9 nickase. Figure 6D shows an example of the construction of a recombinant adenoviral vector (AxYGFP-G+G) that introduces one nick into the genome and one nick into the donor DNA outside each of the upstream and downstream arms. Figure 6E shows the results of gene transfer into the genome using AxYGFP-G+G. Figure 6F shows an example of the construction of a recombinant adenoviral vector (AxYGFP-0) that introduces one nick into the genome and no double-strand breaks or nicks into the donor DNA. Figure 6G shows an example of a recombinant adenovirus vector (AxYGFP-LR) that introduces one nick in the region of the genome where the upstream arm of the donor DNA hybridizes, one nick in the region of the genome where the downstream arm of the donor DNA hybridizes, and one nick in each of the upstream and downstream arms of the donor DNA. Figure 6H shows the results of gene transfer into the genome using AxYGFP-LR. The presence of a band indicates successful homologous recombination. Figure 6I shows an example of a recombinant adenovirus vector (AxYGFP-D) that introduces one nick in the genome and a double-nicked double-strand break in the donor DNA. Figure 6J shows the results of gene transfer into the genome using AxYGFP-D. The presence of a band indicates successful homologous recombination. Figure 6K shows the results of flow cytometry based on fluorescence from the GFP gene integrated into the genome by homologous recombination using AxYGFP-D. The numbers in the figure indicate the percentage of GFP-positive cells among all cells. Figure 6L shows an example of the construction of a recombinant adenoviral vector (AxYGFP-D+G) that introduces one nick into the genome and double nicks and one nick outside the upstream and downstream arms of the donor DNA. Figure 6M shows the results of gene transfer into the genome using AxYGFP-D+G.The presence of a band indicates successful homologous recombination. Figure 6N shows the results of flow cytometry based on the fluorescence of the GFP gene integrated into the genome by homologous recombination with AxYGFP-D+G. The numbers in the figure indicate the percentage (%) of GFP-positive cells among all cells. Figure 7 shows an example of a recombinant adenovirus vector (AdV) carrying donor DNA. The AdV shown in Figure 7 carries eight guide RNAs, divided into two groups: two and six. Figure 8 shows an example of a genome sequence containing a phenylketonuria (PKU) mutation and the corresponding sequence of the donor DNA used to repair it. A restriction enzyme cleavage site was introduced into the donor DNA sequence by changing the codon without changing the encoded amino acid as an additional mutation for easy detection of knock-in. Figure 9 shows an example of the structure of a genome containing a PKU mutation, an example of the structure of the donor DNA used to repair it, and an example of the structure of the genome after repair. "n" indicates the site corresponding to the PKU mutation, and "4m" indicates four mutations used to introduce the restriction enzyme cleavage site. Figure 10 shows the alignment of the sequences at the 4m introduction site and the PKU mutation site. Figure 11 shows the results of the knock-in experiment. Cas9 represents Cas9 nuclease, and NC9 represents Cas9 nickase. The presence of a new fragment (2 kbp to 3 kbp) generated by cleavage with StuI indicates successful knock-in using donor DNA. Bands indicating successful knock-in are observed in lanes 10 to 15. Figure 12 is a graph created by calculating the knock-in efficiency from the density of the band indicating successful knock-in. Figure 13A shows a scheme of a treatment experiment for a model mouse exhibiting phenylketonuria (PKU). Figure 13B shows the blood phenylalanine concentration of the model mouse after the treatment experiment. Figure 13C is a photograph showing the appearance of the model mouse after the treatment experiment, showing the density of the body hair. FIG. 14 shows an example of a technique for introducing multiple nicks (first and second nicks in the figure) without causing double-strand breaks in the genome.

[0011] The present disclosure discloses an adenoviral vector useful for gene therapy. This disclosure utilizes a Cas nickase, which is recruited to a target sequence by a Cas guide RNA (also referred to simply as "guide RNA") and can introduce a nick into double-stranded DNA near the target sequence. A donor DNA introduces a nucleotide sequence (e.g., a therapeutic gene) into the genome to replace the target site. The donor DNA has an upstream arm and a downstream arm as homologous arms, allowing homologous recombination to occur upstream and downstream of the target site. The donor DNA has a region containing the upstream arm, the nucleotide sequence (e.g., a therapeutic gene), and the downstream arm in this order, but may also contain the target sequence outside the region. This allows the target site to be replaced with the nucleotide sequence (e.g., a therapeutic gene) without introducing a double-strand break into the genome. The target site is a region (e.g., a safe harbor region) that allows the introduction and expression of the nucleotide sequence (e.g., a therapeutic gene), or the entire or a portion of an abnormal gene. In the method disclosed herein, when the sequence between the upstream arm and downstream arm in the donor DNA undergoes homologous recombination with a region homologous to the upstream arm and downstream arm in the genome, the sequence between the region homologous to the upstream arm and downstream arm in the genome (e.g., containing an abnormal sequence or mutation) is replaced with the nucleotide sequence between the upstream arm and downstream arm in the donor DNA. Because the genome is not cut, it is expected to be less likely to induce unintended large-scale deletions or recombinations in the genome, and may be useful as a platform technology for gene therapy. In the case of gene therapy, the abnormal sequence and mutation are repaired to a functional sequence. When a therapeutic gene is introduced into a region (e.g., a safe harbor region) where the target site allows the introduction and expression of the therapeutic gene, the therapeutic gene itself is functional (the therapeutic gene may be the full length or a portion of the original gene as long as it is functional). When the target site is all or part of an abnormal gene, the donor DNA has a sequence (the functional sequence of the corresponding portion) between the upstream arm and downstream arm that is to be replaced with that all or part.

[0012] Genome editing disclosed herein involves editing a target site using donor DNA as a template through homologous recombination repair. Therefore, if the target site contains a sequence, that sequence replaces the nucleotide sequence between the upstream arm and downstream arm in the donor DNA. If the target site does not contain a sequence, the nucleotide sequence between the upstream arm and downstream arm in the donor DNA is inserted at that location. In the case of a replacement, the nucleotide sequence between the upstream arm and downstream arm is conveniently referred to as a replacement nucleotide sequence. In the case of an insertion, the nucleotide sequence between the upstream arm and downstream arm is conveniently referred to as an insertion nucleotide sequence. However, whether insertion or replacement occurs depends on the target site in the edited genome, and the nucleotide sequence between the upstream arm and downstream arm can be any sequence. If there is no nucleotide sequence between the upstream arm and downstream arm, the target site is deleted. In other words, the replacement of the target site with the nucleotide sequence between the upstream arm and downstream arm can be used to induce substitution, insertion, or deletion at the target site.

[0013] In one aspect, the method of the present invention is an in vivo method. That is, a virus (particularly an adenoviral vector) comprising the Cas nickase of the present disclosure, guide RNA, and donor DNA is administered to a subject, thereby replacing a target site in the genome of the cells of the subject with the sequence between the upstream and downstream arms of the donor DNA, or inserting the sequence between the upstream and downstream arms of the donor DNA into the target site. The present disclosure also provides a pharmaceutical composition for use in such an in vivo method, comprising a virus (particularly an adenoviral vector) comprising the Cas nickase, guide RNA, and donor DNA. In vivo means performed within a living body, and in vitro means performed otherwise (outside a living body). The pharmaceutical composition has a composition suitable for administration to a subject.

[0014] In one aspect, the method of the present invention is an in vitro method. That is, an isolated cell is infected with a virus (particularly an adenoviral vector) comprising the Cas nickase, guide RNA, and donor DNA of the present disclosure, thereby expressing them, and the target site on the genome in the cell is replaced with the sequence between the upstream and downstream arms of the donor DNA, or the sequence between the upstream and downstream arms of the donor DNA is inserted into the target site. The present disclosure also provides a composition comprising a virus (particularly an adenoviral vector) comprising the Cas nickase, guide RNA, and donor DNA for use in such an in vitro method. This composition has a composition suitable for in vitro use.

[0015] 6A, 6D, 6F, 6G, 6I, and 6L show non-limiting examples of embodiments of genome editing of the present disclosure. For convenience of explanation, a region homologous to an upstream arm on the genome is referred to as an upstream arm homologous region, and a region homologous to a downstream arm on the genome is referred to as a downstream arm homologous region. The target site is between the upstream arm homologous region and the downstream arm homologous region.

[0016] In one embodiment, one nick is introduced into the genome and one into the donor DNA, thereby promoting homologous recombination with the donor DNA. The nick in the genome can preferably be introduced at the target site between the upstream arm homologous region and the downstream arm homologous region, as in the case of knock-in, which typically involves a double-strand break. Alternatively, the nick in the donor DNA can be introduced into the replacement / insertion nucleotide sequence, the upstream arm, or further upstream of the upstream arm, or further downstream of the downstream arm. The guide RNA sequence specifying the nick position can target a different sequence using a new guide RNA (a different guide RNA). However, genome editing can be performed in the presence of donor DNA having the same sequence as the target sequence of the guide RNA in the genome (e.g., the replacement / insertion nucleotide sequence, preferably located further outside the upstream arm and downstream arm, e.g., near the end of the donor DNA), thereby introducing a nick into the genome and donor DNA using a single guide RNA. In this case, the guide RNA that nicks the target site and the guide RNA that nicks further upstream or downstream of the donor DNA are the same guide RNA, allowing for a reduced number of guide RNAs to be used in the construction. An example of this embodiment is shown in FIG. 6A.

[0017] In one embodiment, one nick is introduced into the genome and two nicks are introduced into the donor DNA, thereby promoting homologous recombination with the donor DNA. The nicks in the donor DNA may be introduced at one position on the upstream arm or further upstream of the upstream arm, and one position on the downstream arm or further downstream of the downstream arm. Furthermore, the nicks in the genome may preferably be introduced at a target site between the upstream arm homologous region and the downstream arm homologous region. When the guide RNA targets a target site in the genome, the replacement nucleotide sequence may include the target site, or may be a sequence that is not cleaved by the guide RNA. An example of this embodiment is shown in Figure 6D.

[0018] In one embodiment, one nick can be introduced into the upstream arm homologous region and one nick can be introduced into the downstream arm homologous region on the genome. Furthermore, one nick can be introduced into the donor DNA at a position corresponding to the above. Corresponding positions refer to positions that are located at the same position when aligned. In this case, the expression unit and its surrounding sequence shown in the figure can be integrated by replacing the sequence between the two nicks on the genome and the donor. This mechanism is only possible using nicks; if double-strand breaks are used, the expression unit and its surrounding sequence would be excised and removed by the two double-strand breaks in the donor sequence, so this mechanism has not been used in previous knock-in methods using double-strand breaks. An example of this embodiment is shown in Figure 6G.

[0019] In one embodiment, a single nick is introduced into the genome at the target site between the upstream arm homologous region and the downstream arm homologous region or further outside the homologous region. Alternatively, a double nicking may be introduced into the donor DNA, either further upstream of the upstream arm or further downstream of the downstream arm. An example of this embodiment is shown in Figure 6I.

[0020] In one embodiment, a single nick is introduced into the genome at the target site between the upstream and downstream arm homologous regions or further outside the homologous region. Alternatively, a single nick is introduced into one end of the donor DNA and a double nick is introduced into the other end. An example of this embodiment is shown in Figure 6L.

[0021] As described above, genome editing according to the present disclosure can be performed in various embodiments. In a preferred embodiment, no double-strand breaks (including double nicking) are introduced into the genomic DNA, but only a nick, particularly a single nick, is introduced. When multiple nicks are introduced into the genomic DNA, the nicks can be introduced so as not to cause double-strand breaks in the genomic DNA. For example, multiple nicks are introduced into the same strand of the genomic DNA so that double-strand breaks are not induced by the multiple nicks introduced into the genomic DNA. This embodiment is shown, for example, in FIG. 14. Furthermore, a nick, double nicking, or double-strand break is introduced into the donor DNA, thereby promoting homologous recombination by the donor DNA more than when a nick is introduced. An adenoviral vector that enables this contains DNA encoding a gRNA that targets the nick site. Nick or double nicking refers to either a nick, double nicking, or a nick and double nicking. It is desirable to avoid introducing a double-nicking break into the target sequence site between the upstream arm homologous region and the downstream arm homologous region, as this may lead to unintended genome modification during genome editing. In either embodiment, double nicking may be introduced into the donor DNA further upstream of the upstream arm and / or further downstream of the downstream arm. It is desirable that the upstream arm and the downstream arm have an appropriate length for inducing homologous recombination.

[0022] When multiple nicks are introduced into the same strand of genomic DNA to prevent double-strand breaks, the single-stranded fragments into which the nicks have been introduced are more likely to be released from the genome and be accessible to the donor DNA at that location, which may further increase the efficiency of homologous recombination. In this way, introducing multiple nicks into the same strand of the genome can be a strategy to increase the efficiency of homologous recombination with the donor DNA while preventing double-strand breaks.

[0023] In a preferred embodiment, the gRNA that introduces a nick into the genomic DNA also introduces a nick into the donor DNA, which is made possible by providing the target sequence of the gRNA on the donor DNA as well.

[0024] In a preferred embodiment, a nick is introduced into the genomic DNA, while a double nicking is introduced into the donor DNA. In this embodiment, preferably, one gRNA can introduce a nick into each of the donor DNA genomic DNAs, and another gRNA can introduce another nick at a position close to the nick in the donor DNA. Preferably, the other gRNA targets a sequence not present in the genome, more preferably, it does not introduce a nick into the genome, and even more preferably, such a sequence can be an artificial sequence. The adenoviral vector of the present disclosure can include DNA encoding such donor DNA and / or gRNA.

[0025] When nicking a target site in the genome, if the nucleotide sequence to be inserted or replaced in the donor DNA is identical to the target site, the donor DNA may also be nicked. To avoid this, the sequence in the donor DNA can be made cleavage resistant by changing only the codons without changing the amino acids it encodes.

[0026] When a nick is created at a target site on the genome using a guide RNA and a nucleotide sequence for insertion in the donor DNA is inserted therein, a target sequence for the guide RNA can be additionally introduced into the donor DNA, thereby facilitating the integration (knock-in) of the nucleotide sequence for insertion in the donor DNA into the genome, which is a preferred embodiment. For example, even when an additional nick is created in the donor DNA, a target sequence for the guide RNA or a new guide RNA can be introduced into the donor DNA. When double nicking is introduced into the donor DNA, the sequence of the donor DNA can also be designed so that double nicking occurs with one guide RNA.

[0027] When a guide RNA targets a target site on the genome, the replacement nucleotide sequence may include the target site, or may be a sequence that is not cleaved by the guide RNA to reduce the possibility of introducing mutations into the replacement nucleotide sequence. To ensure that the replacement / insertion nucleotide sequence is not cleaved by the guide RNA, for example, this can be achieved by using different codons without changing the amino acid sequence (which may be a designed amino acid sequence) encoded by the replacement / insertion nucleotide sequence. In addition, the target sequence of the guide RNA or another guide RNA can be added to a preferred position in the donor DNA. Whether the inserted or replaced nucleotide sequence is the designed sequence can be determined by sequencing.

[0028] In some aspects, this gene editing efficiency (number of edited cells / total number of cells) may be 0.5% or more, 0.6% or more, 0.7% or more, 0.8% or more, 0.9% or more, 1.0% or more, 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more, 1.5% or more, 1.6% or more, 1.7% or more, 1.8% or more, 1.9% or more, or 2% or more, for example, 5% or less, 4% or less, 3% or less, or 2.5% or less, for example, 0.5% to 3%, 1% to 2.5%, 1.5% to 2%, or 1.5% to 2.5%. Gene editing efficiency can be measured using, for example, Hepa1-6 cells. Gene editing efficiency can also be calculated from the abundance of gene editing-specific PCR amplification products or their restriction enzyme fragments, or from the number of gene editing-specific sequence reads. When the therapeutic gene encodes a metabolic enzyme that is the causative gene for a metabolic disorder, high expression in some cells can be expected to activate metabolism and alleviate or cure symptoms. Furthermore, driving the expression of the therapeutic gene with a promoter stronger than the native promoter of each therapeutic target gene can be expected to increase the expression level of the therapeutic gene in edited cells. To this end, the donor DNA can contain a therapeutic gene or a fragment thereof operably linked to a promoter. In one aspect, the metabolic enzyme metabolizes amino acids.

[0029] In some embodiments, the cells can be isolated cells. In some embodiments, the cells are derived from mammals, particularly human cells or non-human mammals, such as non-human primates such as chimpanzees, gorillas, orangutans, monkeys, marmosets, and bonobos; non-human mammals (e.g., carnivores, artiodactyls, perissodactyls, and rodents) such as pigs, rats, mice, cows, sheep, goats, horses, and dogs; and birds such as chickens. In some embodiments, the subject can be, for example, a mammal, particularly human cells or non-human mammals, such as non-human primates, such as chimpanzees, gorillas, orangutans, monkeys, marmosets, and bonobos; non-human mammals (e.g., carnivores, artiodactyls, perissodactyls, and rodents) such as pigs, rats, mice, cows, sheep, goats, horses, and dogs; and birds such as chickens.

[0030] In some embodiments, the cell or isolated cell may be a cell selected from the group consisting of a pluripotent cell and a pluripotent stem cell (such as an embryonic stem cell and an induced pluripotent stem cell). In some embodiments, the cell may be a tissue stem cell. In some embodiments, the cell may be a somatic cell. In some embodiments, the cell may be a germline cell (e.g., a germ cell). In some embodiments, the cell may be a cell line. In some embodiments, the cell may be an immortalized cell. In some embodiments, the cell may be a cancer cell. In some embodiments, the cell may be a non-cancerous cell. In some embodiments, the cell may be a cell from a patient with a disease. In some embodiments, the cell may be a cell from a healthy individual. In one aspect, the cell may be an animal cell (e.g., a human cell), for example, a cell selected from the group consisting of insect cells (e.g., silkworm cells), HEK293 cells, HEK293T cells, Expi293F™ cells, FreeStyle™ 293F cells, Chinese hamster ovary cells (CHO cells), CHO-S cells, CHO-K1 cells, and ExpiCHO cells, and cells derived from these cells. In a preferred aspect, in the above-mentioned cells, all alleles of the target region of the chromosomal genome are modified, and the modified regions each have a different (distinguishable) selectable marker gene from each other. Among these cells, human cells may be preferably the target of editing.

[0031] To achieve the above, in the present disclosure, Cas nickase, guide RNA, and donor DNA can be introduced into cells in vivo or in vitro. Cas nickase, guide RNA targeting a target sequence, and donor DNA can be introduced into cells (e.g., in vitro or in vivo) using an adenoviral vector. Adenoviral vectors have a double-stranded DNA genome. Therefore, Cas nickase, guide RNA, and donor DNA can be expressed in cells by an adenoviral vector that expressibly contains a nucleic acid molecule (DNA) encoding Cas nickase, a nucleic acid molecule (DNA) encoding guide RNA, and further contains donor DNA. However, if the Cas nickase, guide RNA, and donor DNA cannot be contained in a single adenoviral vector due to size issues, the Cas nickase, guide RNA, and donor DNA can be contained separately in two adenoviral vectors.

[0032] In some cases, the Cas nickase, guide RNA, and donor DNA cannot be contained in a single recombinant adenoviral vector. In this case, the Cas nickase, guide RNA, and donor DNA may be incorporated into two or more recombinant adenoviral vectors, and in some embodiments, they are incorporated into two recombinant adenoviral vectors. When the Cas nickase, guide RNA, and donor DNA are incorporated into two adenoviral vectors, various methods for incorporating them can be considered. In the present disclosure, the following combinations of adenoviruses may be used, but are not limited to: (i) an adenovirus vector comprising donor DNA is used in combination with an adenovirus vector comprising a gene encoding Cas nickase and a gene encoding guide RNA; (ii) an adenovirus vector comprising a gene encoding Cas nickase and a gene encoding guide RNA is used in combination with an adenovirus vector comprising donor DNA; (iii) an adenovirus vector comprising a gene encoding guide RNA and donor DNA is used in combination with an adenovirus vector comprising a gene encoding Cas nickase; or (iv) an adenovirus vector comprising a gene encoding Cas nickase is used in combination with an adenovirus vector comprising a gene encoding guide RNA and donor DNA.

[0033] The recombinant adenovirus vector is not particularly limited and can be appropriately selected depending on the purpose, but the recombinant adenovirus vectors described below are preferred.

[0034] The placement of the nucleic acid molecule encoding the Cas guide RNA on the recombinant adenovirus vector is not particularly limited and can be selected appropriately depending on the purpose. The nucleic acid molecule may be placed entirely at one site, or may be divided and placed at two or more sites.

[0035] The nucleic acid molecule encoding the Cas guide RNA can be used together with a control region that drives its expression, such as a promoter, in the same manner as the Cas guide RNA expression unit in the recombinant adenoviral vector having the Cas guide RNA expression unit of the present disclosure described below.

[0036] The nucleic acid molecule encoding the Cas nickase (e.g., Cas9 nickase) can be used together with a promoter, polyA, etc., in the same manner as the Cas protein expression unit in a recombinant adenoviral vector having a Cas guide RNA expression unit described later in the present disclosure.

[0037] The nucleic acid molecule encoding the Cas nickase (e.g., Cas9 nickase) is preferably arranged in the same manner as the Cas protein expression unit in a recombinant adenoviral vector having a Cas guide RNA expression unit of the present disclosure, as described below.

[0038] The donor DNA has a region containing an upstream arm, a therapeutic gene, and a downstream arm in this order, but may also contain the target sequence outside the region. The target sequence may be directly linked to the upstream arm or the downstream arm, or may be linked via a spacer sequence. The spacer sequence may be an artificial sequence (including a sequence that does not exist in nature) or a natural sequence. The spacer sequence and the target sequence may be genomic sequences that are continuous with the region on the genome to which the upstream arm or the downstream arm hybridizes.

[0039] The method for producing the recombinant adenoviral vector is not particularly limited, and the vector can be produced by a method commonly used by those skilled in the art.

[0040] <Other Components> The other components are not particularly limited as long as they do not impair the effects of the present disclosure and can be selected appropriately depending on the purpose, and examples thereof include pharmaceutically acceptable carriers. A pharmaceutically acceptable carrier refers to a substance that aids in the administration of an active substance (such as Cas nickase or Cas guide RNA) to a cell, organism, or subject. The pharmaceutically acceptable carrier is not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include water, salt (such as sodium chloride), saline, lactated Ringer's solution, sugar (such as sucrose or glucose), pH adjusters, isotonic agents, preservatives, and the like. These may be used alone or in combination of two or more.

[0041] The administration method of the pharmaceutical composition for gene therapy is not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, and subcutaneous administration. The administration route is also not particularly limited and can be selected appropriately depending on the purpose, and can be any route including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). The parenteral administration is not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include oral, intravenous, intramuscular, intraarteriolar, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposome formulations, intravenous infusion, and transdermal patches.

[0042] In the present disclosure, an "effective amount" or a "sufficient amount" refers to an amount of an agent (e.g., a Cas protein such as Cas nickase, a Cas guide RNA, etc.) that is sufficient to produce a beneficial or desired result. A therapeutically effective amount may vary depending on one or more of the subject and disease state being treated, the subject's weight and age, the severity of the disease state, the mode of administration, etc., and can be readily determined by one of ordinary skill in the art. A particular amount may vary depending on one or more of the particular agent selected, the target cell type, the location of the target cells in the subject, the administration regimen to be followed, whether it is administered in combination with other agents, the timing of administration, and the physical delivery system in which it is delivered.

[0043] The present disclosure also relates to a method for treatment by genome editing (gene therapy method) characterized by administering a pharmaceutical composition for gene therapy to a subject, or a method for treatment by genome editing (gene therapy method) using a recombinant adenoviral vector of the present disclosure or a recombinant adenoviral vector having a Cas guide RNA expression unit of the present disclosure, as described below.

[0044] (Recombinant Adenovirus Vector) In the present disclosure, a "recombinant adenovirus vector" (sometimes referred to as an "adenovirus vector") refers to an adenovirus that contains in its genome a base sequence that is different from the base sequence specific to adenovirus.

[0045] The origin of the recombinant adenovirus vector is not particularly limited and can be appropriately selected depending on the purpose, but is preferably a human-derived adenovirus isolated from a human, and more preferably type 2 or type 5, which are classified as type C.

[0046] The recombinant adenoviral vector of the present disclosure may be a novel recombinant adenoviral vector that lacks a 12.4K gene sequence in the L4 / E3 region and has an L4 polyA region sequence, and the recombinant adenoviral vector has a modified backbone that enables it to carry a longer nucleic acid region as a payload.

[0047] The recombinant adenovirus vector preferably lacks bases 27,864 to 28,137 and 28,200 and beyond in the L4 / E3 region, based on the positioning of adenovirus type 5.

[0048] The recombinant adenovirus vector preferably contains the entire region from the left end of the genome to base 358 in the E1 region, as positioned in adenovirus type 5.

[0049] The method for producing the recombinant adenovirus vector is not particularly limited, and any known method can be appropriately selected depending on the purpose. For example, the recombinant adenovirus vector can be produced by using an existing adenovirus vector as a base and introducing a deletion or insertion of a target sequence using standard genetic recombination techniques commonly used by those skilled in the art.

[0050] The existing adenoviral vector is not particularly limited and can be appropriately selected depending on the purpose, but the adenoviral vector described in Miyake S, Saito I et al. (PNAS, 93:1320-1324, 1996) is preferred. The adenoviral vector described in Miyake S, Saito I et al. has a deletion of bases 455 to 3,328 in the E1 region and a deletion of bases 28,593 to 30,470 in the E3 region, and also has a site for inserting foreign DNA (cloning site) in the E4 region.

[0051] The recombinant adenoviral vector can be amplified using, for example, 293 cells, which are usually used in combination with Ad5 adenoviral vectors.

[0052] The recombinant adenovirus vector can carry a human therapeutic gene, a so-called reporter gene such as a GFP gene, a gene encoding a protein such as a recombinase, a regulatory gene such as a promoter or a polyA sequence, or a base sequence that has no function.

[0053] The insertion site of the gene or the like carried in the recombinant adenoviral vector is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include the E1 region, E3 region, E4 region, etc. The gene or the like may be inserted into one site or two or more sites.

[0054] The recombinant adenovirus vector can be suitably used for genome editing using the CRISPR / Cas system.

[0055] In this disclosure, "genome editing" refers to a series of genetic manipulations in which DNA is inserted, replaced, or removed from target DNA, e.g., the genome of a cell, using one or more nucleases and / or nickases. The nucleases create specific double-strand breaks at desired locations in the genome, and the cell's endogenous machinery repairs the created breaks by homology-directed repair (HDR) or non-homologous end joining (NHEJ). The nickases create specific single-strand breaks at desired locations in the genome. In some embodiments, two nickases can be used to create two single-strand breaks in opposite strands of the target DNA, thereby generating blunt or overhanging ends. Any suitable nuclease can be introduced to induce genome editing of the target DNA sequence, including, but not limited to, CRISPR-associated protein (Cas) nuclease, Cpf1, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, other endo- or exo-nuclease, variants thereof, fragments thereof, and combinations thereof.

[0056] In vivo, in vitro, and ex vivo genome editing can be performed in the presence of vanillin, p53 inhibitors, β3 adrenergic receptor agonists (e.g., L755507), DNA ligase IV inhibitors, non-homologous end joining inhibitors (e.g., SCR7, SCR7 pyrazine), and / or RAD51 activators (e.g., RS-1), which can further improve the efficiency of genome editing.

[0057] For in vitro and ex vivo gene editing of cells, a method may be preferably used in which a gene encoding a membrane protein is introduced so that the membrane protein is expressed in successfully edited cells, and the cells are separated by flow cytometry based on the expression of the membrane protein. This method may be preferably used when selecting and amplifying correctly edited cells from a large number of cells.

[0058] In the present disclosure, "genome cleavage" or "genome cleavage" means that both strands of the double-stranded nucleic acid constituting the genome are cleaved in association with the above-described genome editing. The cleavage of the double-stranded nucleic acid may be performed by cleaving the sense strand and the antisense strand at corresponding base pairs to generate blunt ends, or by cleaving the sense strand and the antisense strand at different positions adjacent to each other to generate protruding ends.

[0059] In the present disclosure, the term "CRISPR / Cas system" refers to a system that utilizes CRISPR (clustered regularly interspaced short palindromic repeat) nucleic acids and Cas proteins (CRISPR-associated proteins), which are immune mechanisms possessed by prokaryotes. "CRISPR / Cas systems" are classified into Class 1 and Class 2, and Class 2 "CRISPR / Cas systems" are further classified into Type II, Type V, and Type VI (Yamano et al., Molecular Cell, 2017, Vol. 6, pp. 633-645).

[0060] A system that utilizes Cas9 as a Cas protein, classified as a type II "CRISPR / Cas system," utilizes the Cas9 protein derived from Streptococcus pyogenes, a guide RNA (gRNA) consisting of CRISPR RNA (crRNA) and a trans-acting RNA (trans-activating crRNA: tracrRNA) that is partially complementary to the crRNA and serves as a scaffold for binding to the Cas9 protein. The crRNA and tracrRNA may be supplied as a fused single RNA molecule (single guide RNA) or as separate RNA molecules (sometimes referred to as "non-single guide RNA"). In one embodiment, the "CRISPR / Cas9 system" is supplied to a target cell as a DNA fragment encoding the Cas9 protein, a DNA fragment encoding the crRNA, and a DNA fragment expressing the tracrRNA. In one embodiment, the "CRISPR / Cas9 system" is supplied as a DNA fragment encoding the Cas9 protein and a DNA fragment encoding a single guide RNA. In one embodiment, these DNA fragments are supplied to target cells using a viral vector. These DNA fragments can be supplied to target cells using a single viral vector or separate viral vectors. The DNA encoding the tracrRNA is not particularly limited and can be appropriately selected from known sources, such as the plasmid (pX260) manufactured by Addgene. Cas proteins include type V Cas12a (Cpf1), type I Cas3, and type V MAD7, with Cas12a and MAD7 preferably replacing Cas9. In addition to adenoviral vectors, viral vectors include, for example, adeno-associated viral (AAV) vectors, lentiviral vectors, and herpes viral vectors, which can be preferably used to deliver the nickase and donor DNA of the present disclosure to cells. In addition to viral vectors, lipid vesicles such as lipid nanoparticles and liposomes, as well as other drug delivery vesicles, can be preferably used to deliver the nickase and donor DNA of the present disclosure to cells.The adenoviral vector is not particularly limited, but may be one disclosed in WO2024 / 162452A. The adenoviral vector may be equipped with all components necessary for knock-in (nickase, gRNA, and donor DNA). Such an adenoviral vector is called an integrated adenoviral vector. Alternatively, all components necessary for knock-in (nickase, gRNA, and donor DNA) may be equipped in multiple adenoviral vectors.

[0061] The recombinant adenoviral vector may expressibly carry a nucleic acid encoding a Cas guide RNA, a nucleic acid encoding a short hairpin RNA, a nucleic acid encoding a Cas nuclease protein, and donor DNA. For nucleic acid expression, the nucleic acid is preferably operably linked to a control sequence (e.g., a promoter). These nucleic acids may be incorporated into an expression unit. The expression unit is not particularly limited, but, for example, when incorporating a protein, it contains elements necessary for protein expression, such as a 5' untranslated region including a promoter, a coding region, a polyA addition sequence, and a 3' untranslated region. Below, specific examples are described in which nucleic acids are incorporated into expression units. However, each nucleic acid does not necessarily have to be incorporated into a separate expression unit; it is sufficient that the nucleic acids are operably linked to a control sequence (e.g., a promoter) and transcribed into RNA.

[0062] The recombinant adenovirus vector can be suitably used as a recombinant adenovirus vector having one or more units selected from the group consisting of a Cas guide RNA expression unit, a short hairpin RNA expression unit, a Cas protein expression unit, and a donor DNA expression unit.

[0063] <Cas guide RNA expression unit> The Cas guide RNA expression unit (hereinafter sometimes referred to as "guide RNA expression unit") refers to a DNA building block for expressing a Cas guide RNA (sometimes referred to as "guide RNA") used in the CRISPR / Cas system. The Cas guide RNA expression unit contains a DNA nucleic acid sequence that is transcribed into the Cas guide RNA.

[0064] Examples of the "Cas guide RNA" include a "single Cas guide RNA" that uses a single guide RNA in which crRNA and tracrRNA are fused, and a "non-single Cas guide RNA" that uses a non-single guide RNA in which crRNA and tracrRNA are separate.

[0065] The "Cas guide RNA expression unit" can be in the form of a "single Cas guide RNA expression unit" for expressing a single Cas guide RNA, a "crRNA expression unit" for expressing crRNA, or a "tracrRNA expression unit" for expressing tracrRNA.

[0066] The "Cas guide RNA expression unit" may consist of only a "single Cas guide RNA expression unit", or may consist of a "crRNA expression unit" and a "tracrRNA expression unit", or may include a "single Cas guide RNA expression unit", a "crRNA expression unit", and a "tracrRNA expression unit".

[0067] In this specification, the number of the Cas guide RNA expression units is counted as one for each of a "single Cas guide RNA expression unit," a "crRNA expression unit," and a "tracrRNA expression unit." That is, when one "crRNA expression unit" and one "tracrRNA expression unit" are used, the number of the Cas guide RNA expression units is two.

[0068] In the non-single Cas guide RNA embodiment, the number of "crRNA expression units" and "tracrRNA expression units" may be the same or different.

[0069] In this specification, the adenoviral essential regions refer to the E1A, E1B, E2A, E2B, and E4 regions of the early gene group, and the L1 to L5 regions of the late gene group. Furthermore, "sandwiched with at least a portion of the adenoviral essential regions" means that at least a portion of the adenoviral essential regions are present between the separately mounted Cas guide RNA expression units, and all of the adenoviral essential regions may be present.

[0070] It is preferable that the Cas guide RNA expression unit is divided and mounted in two or more regions selected from the group consisting of the E1 region (hereinafter sometimes referred to as the "E1 region"), the E3 region (hereinafter sometimes referred to as the "E3 region"), and the E4 region (hereinafter sometimes referred to as the "E4 region") of the adenoviral vector.

[0071] In the adenoviral vector, the E1 region of the adenovirus is preferably deleted. In this case, the function is complemented in 293 cells having DNA of the E1 region. The E1 region deleted in the adenoviral vector may be referred to as an "E1-deleted region" or an "E1-deleted integration site." As used herein, the term "E1 region" also includes a deleted E1 region. In this specification, "a region being deleted" includes both cases where the entire region is deleted and cases where only a portion of the region is deleted.

[0072] The E3 gene cluster in adenovirus is not essential for viral replication. Therefore, it is preferable that the E3 region is deleted in the adenovirus vector. The E3 region deleted in the adenovirus vector may be referred to as an "E3 deleted region" or an "E3 deleted integration site." In this specification, the E3 region also includes a deleted E3 region.

[0073] The E4 region in the adenoviral vector is a region containing the adenovirus E4 gene cluster. The E4 region may or may not be gene-deleted. The E4 region is a region that contains a site where foreign DNA can be integrated without necessarily being deleted (hereinafter, sometimes referred to as the "E4 integration site"). In this specification, the E4 region also includes a deleted E4 region.

[0074] In this specification, when a range of multiple numerical values ​​is indicated, it also means a range formed by any combination of the lower limit and upper limit values ​​of those multiple ranges.

[0075] The Cas guide RNA expression unit can include, in addition to DNA encoding the Cas guide RNA, an expression regulatory region that drives its expression, such as a promoter. The promoter is not particularly limited and can be appropriately selected depending on the purpose. Examples include a U6 promoter, an H1 promoter, and a tRNA promoter. Among the promoters, the truncated U6 promoter (SEQ ID NO: 1) described below is preferred.

[0076] Typically, when a vector contains multiple guide RNA expression units, they are arranged adjacently in tandem so that they are in the same transcription direction.

[0077] Furthermore, the Cas guide RNA expression unit may target one site or may target two or more sites.

[0078] The vector is also useful for treating genetic diseases. Therefore, the present disclosure also relates to a composition or pharmaceutical composition containing the vector of the present disclosure. The genetic disease is not particularly limited and can be appropriately selected depending on the purpose. Examples of genetic diseases include autosomal recessive genetic diseases, X-linked genetic diseases, and autosomal dominant genetic diseases. Examples of genetic diseases include metabolic disorders, such as amino acid metabolism disorders such as phenylketonuria (PAH, PKU, BH4, GTPCH, PTPS, DHPR, PCD, DNAJC12), maple syrup urine disease (BCKDHA, BCKDHB, or DBT), homocystinuria (CBS), tyrosinemia, type I hypertyrosinemia (FAH), type II hypertyrosinemia (TAT), type III hypertyrosinemia (HPD), hyperprolinemia (PRODH), prolidase deficiency (PEPD), hypermethioninemia (MTHFR, MTR, or MTRR), nonketotic hyperglycinemia (GLDC, AMT), hyperargininemia (ARG1), Hartnup disease (SLC6A19), lysinuric protein intolerance (SLC7A7), and cystinosis (CTNS); Methylmalonic acidemia (MUT, MMAA or MMAB), propionemia (PCCA or PCCB), β-ketothiolase deficiency (ACAT1), isovaleric acidemia (IVD), 3-methylcrotonyl CoA carboxylase deficiency (MCCC1 or MCCC2), methylglutaconic aciduria (TAZ, OPA3 or DNAJC19, etc.), 3-hydroxy-3-methylglutaric acidemia (HMGCL), 3-hydroxy-3-methylglutaryl CoA synthetase deficiency (GMG CS2), succinyl-CoA:3-ketoacid CoA transferase (SCOT) deficiency (OXCT1), multiple carboxylase deficiency (BTD or HLCS), glutaric acidemia type 1 (GCDH), glutaric acidemia type 2 (ETFA, ETFB or ETFDH), primary hyperoxaluria (AGXT, GRHPR or HOGA1), alkaptonuria (HGD), glyceroluria (GK), and organic acid metabolism disorders such as congenital disorders of bile acid metabolism (HSD3B7, AKR1D1);Fatty acid metabolism disorders such as systemic carnitine deficiency (SLC22A5), carnitine palmitoyltransferase I deficiency (CPT1A), carnitine palmitoyltransferase II deficiency (CPT2), carnitine acylcarnitine translocase deficiency (SLC25A20), very long-chain acyl-CoA dehydrogenase deficiency (ACADVL), medium-chain acyl-CoA dehydrogenase deficiency (ACADM), short-chain acyl-CoA dehydrogenase deficiency (ACADS), triglyceride deficiency (HADHA, HADHB), and 3-hydroxyacyl-CoA dehydrogenase deficiency (HADHA); pyruvate dehydrogenase complex deficiency (PDHA1, PDHB, DLAT, PDHX, Mitochondrial diseases such as DLD, pyruvate carboxylase deficiency (PC), fumarase deficiency (FH), succinyl-CoA ligase deficiency (SUCLA2, SUCLG1), mitochondrial respiratory chain complex deficiency, mitochondrial DNA depletion syndromes (POLG, TK2, RRM2B), mitochondrial DNA mutations (including Leigh syndrome (MT-ND1, MT-ND4 (Leigh Syndrome), MT-TL1 (MELAS), MT-TK (MERRF)), MELAS and MERRF), mitochondrial DNA deletions (including Kearns-Sayre syndrome); Carbohydrate metabolism disorders such as hereditary fructose intolerance (ALDOB), galactose-1-phosphate uridyltransferase deficiency (GALT), galactokinase deficiency (GALK1), uridyl diphosphate galactose-4-epimerase deficiency (GALE), fructose-1,6-bisphosphatase deficiency (FBP1), phosphoenolpyruvate carboxykinase deficiency (PCK1), glycogen synthase deficiency (glycogen storage disease type 0) (GYS1), glycogen storage disease type Ia (G6PC), glycogen storage disease type Ib (SLC37A4), glycogen storage disease type III (AGL), glycogen storage disease type IV (GBE1), glycogen storage disease type V (PYGM), glycogen storage disease type VI (PYGL), glycogen storage disease type VII (PFKM), glycogen storage disease type IX (PHKA1, PHKA2, PHKB, PHKG2), and glucose transporter 1 (GLUT1) deficiency (SLC2A1);Mucopolysaccharidosis type I (IDUA), mucopolysaccharidosis type II (IDS), mucopolysaccharidosis type III (SGSH, NAGL U, HGSNAT, GNS), mucopolysaccharidosis type IV (GALNS, GLB1), mucopolysaccharidosis type VI (ARSB), mucopolysaccharidosis type VII (GUSB), fucosidosis (FUCA1), mannosidosis (MAN2B1), aspartylglucosaminuria (AGA), sialidosis (NEU1), galactosialidosis (CTSA), GM1-gangliosidosis (GLB1), GM2-gangliosidosis (HEXA (Tay-Sachs), HEXB (Sandhoff)), metachromatic leukodystrophy (ARSA), Niemann-Pick disease (SMPD1 (Types A and B), NPC1, NPC2 (Type Lysosomal storage disorders such as Gaucher disease (GBA), Fabry disease (GLA), Krabbe disease (GALC), Farber disease (ASAH1), multiple sulfatase deficiency (SUMF1), mucolipidosis type II (I-cell disease) (GNPTAB), mucolipidosis type III (GNPTAB, GNPTG), Pompe disease (GAA), acid lipase deficiency (LIPA), cystinosis (CTNS), free sialic acid storage disease (SLC17A5), and neuronal ceroid lipofuscinosis (any of CLN1 to CLN14); peroxisomal biogenesis disorders such as peroxisome biogenesis disorders (PEX1, PEX2, PEX3), adrenoleukodystrophy (ABCD1), and Refsum disease (PHYH, PEX7); Metal metabolism disorders such as Wilson disease (ATP7B), Menkes disease (ATP7A), Occupational-Horn syndrome (ATP7A), aceruloplasminemia (CP), and sulfite oxidase deficiency (SUOX);Purine-pyrimidine metabolism disorders such as acrodermatitis enteropathica congenita (SLC39A4), hypoxanthine-guanine phosphoribosyltransferase deficiency (Lesch-Nyhan syndrome) (HPRT1), adenine phosphoribosyltransferase deficiency (APRT), xanthinuria type I (XDH), xanthinuria type II (MOCOS), urate transporter disorders (URAT1, GLUT9), and orotic aciduria (UMPS); vitamin metabolism disorders such as congenital folate malabsorption (SCL39A4); biopterin metabolism disorders (GCH1, PCBD1, PTS, Neurotransmitter disorders such as QDPR, tyrosine hydroxylase deficiency (TH), aromatic L-amino acid decarboxylase deficiency (DDC), dopamine β-hydroxylase deficiency (DBH), GABA aminotransferase deficiency (ABAT), and succinic semialdehyde dehydrogenase deficiency (ALDH5A1); lipid metabolism disorders such as primary hyperchylomicronemia (LPL, APOC2, APOA5, GPIHBP1), familial hypercholesterolemia (PCSK9, etc.), familial combined hyperlipidemia (MTTP), abetalipoproteinemia (MTTP), and high-density lipoprotein (HDL) deficiency (ABCA1, APOA); Ehlers-Danlos syndrome (classic type: COL5A1, COL5A2, articular type: TNXB, vascular type: COL3A1, robust type: PLOD1, cutaneous type: ADAMTS2, and multiple types: B4GALT7, These include connective tissue disorders such as B3GALT6, CHST14, and SLC39A13, lipoid proteinosis (ECM1), and alpha-1-antitrypsin deficiency (alpha-1-antitrypsin; AAT). Gene editing of the present disclosure may be particularly effective for metabolic disorders, as it is believed that normalizing enzymes in some cells can alleviate or cure symptoms.

[0079] Genetic diseases to be treated also include the following diseases:

[0080] Chronic kidney disease: Finnish type congenital nephrotic syndrome (NPHS1, NPHS2, LAMB2, PLCE1), Galloway-Mowat syndrome (LAGE3, OSGEP, TP53RK, TPRKB), Alport syndrome (COL4A3, COL4A4, COL4A5), Epstein syndrome (MHY9), Nail-Patera syndrome (LMX1B), nephronophthisis (NPHP1), Gittelman syndrome (NKCC2, ROMK1, ClC-Kb), Bartter syndrome (NKCC2, ROMK1, ClC-Kb), polycystic kidney disease (PKD1, PKD2, PKHD1).

[0081] Chronic respiratory disease ciliary dyskinesia syndrome (including Kartagener syndrome) (DNAH5, DNAI1, DNAH11, TXNDC3, DNAI2, KTU, RPGR, OFD1, RSPH9, RSPH4A), cystic fibrosis (CFTR).

[0082] Endocrine disorders: insulin-like growth factor 1 (IGF-1) resistance (IGF1R), vitamin D-dependent rickets (CYP27A1, VDR), primary hypophosphatemic rickets (PHEX, FGF23, DMP1, ENPP1, SLC34A3), lipodystrophy (lipoatrophy) (AGPAT2, BSCL2, CAV1, PTRF), multiple endocrine neoplasia type 1 (Wermer syndrome) (MEN1), multiple endocrine neoplasia type 2 (Sipple syndrome) (RET), von Hippel-Lindau disease (VHL), McCune-Albright syndrome (GPCR), Noonan syndrome (PTPN11, etc.), Bardet-Biedl syndrome (BBS1-BBS14).

[0083] Mediterranean fever familial connective tissue disease (MEFV), cryopyrin-associated periodic fever syndrome (NLRP3), TNF receptor-associated periodic syndrome (TNFRSF1A), Blau syndrome / early-onset sarcoidosis (NOD2), Nakajo-Nishimura syndrome (PSMB8), hyper-IgD syndrome (mevalonate kinase deficiency) (MVK), interleukin I receptor antagonist molecule deficiency (IL1RN), adenosine deaminase 2 (ADA2) deficiency (ADA2).

[0084] Maturity-onset diabetes of the young (MODY) (GCK, HNF-1A, HNF-4A, HNF-1B, etc.).

[0085] Diamond-Blackfan anemia (GATA1, RPL5, RPL9, RPL11, RPL15, RPL18, RPL26, RPL27, RPL31, RPL35, RPL35A, RPS7, RPS10, RPS15A, RPS17, RPS19, RPS24, RPS26, RPS27, RPS28, RPS29), thalassemia (HBB), hereditary spherocytosis (SPTA1, SPTB1, ANK1, SLC4A1, ELB42, etc.), stomatocytosis (SPTA1, SPTB1, ANK1, SLC4A1, ELB42, etc.), sickle cell disease (HBB), glucose-6-phosphate dehydrogenase deficiency (G6PD), congenital antithrombin deficiency Congenital prothrombin deficiency (F2), congenital fibrinogen deficiency (F1), Bernard-Soulier syndrome (GPIbα, GPIbβ, GPIX), May-Hegglin anomaly (MYH9), Fanconi anemia (FANCA, FANCW, etc.).

[0086] Immunological diseases: X-linked severe combined immunodeficiency (IL2RG), reticulum dysplasia (AK2), adenosine deaminase (ADA) deficiency (ADA), Omenn syndrome (RAG1, RAG2, artemis, IL7RA, RMRP, ADA, DNA ligase IV, IL-2RG, AK2), purine nucleoside phosphorylase deficiency (PNP), CD8 deficiency (CD8A), ZAP-70 deficiency (ZAP70), MHC class I deficiency (TAP1, TAP2, TAPBP), MHC class II deficiency (RFANK, RFX5, RFXAP, MHC2TA), Wiskott-Aldrich syndrome (WASP), ataxia-telangiectasia mutated (ATM), Nijmegen chromosome breakage syndrome (NBS1), Bloom syndrome (BLM) , ICF syndrome (DNMT3B), PMS2 deficiency (PMS2), Lynch syndrome (MLH1, MSH2, MSH6, PMS2), Liddle syndrome (RNF168), Schimke syndrome (SMARCAL1), Hyper-IgE syndrome (STAT3, DOCK8, TYK2), Immunodeficiency with hepatic veno-occlusion (SP110), Dyskeratosis congenita (DKC1, TERC, TERT, NHP2, NOP10, TINF2), X-linked agammaglobulinemia (BTK), Chediac Higashi syndrome (CHS1 / LYST), X-linked lymphoproliferative syndrome (SAP / SH2D1A, XIAP / BIRC4), autoimmune lymphoproliferative syndrome (ALPS) (FAS, FASLG, CASP10), perforin deficiency (FHL2), UNC13D / Munc13-4 deficiency (FHL3), syntaxin 11 deficiency (FHL4), STXBP2 / Munc18-2 deficiency (FHL5), severe congenital neutropenia (ELANE, GFI1, HAX1, G6PC3, VPS) 45), cyclic neutropenia (ELANE), leukocyte adhesion deficiency (INTGB2, FUCT1, FERMT3), Shwachman-Diamond syndrome (SBDS), myeloperoxidase deficiency (MPO), anhidrotic ectodermal dysplasia with immunodeficiency (NEMO, IκBα), IRAK4 deficiency (IRAK4), MyD88 deficiency (MYD88), congenital complement deficiencies (C7, C9, C5, C6, C8), hereditary angioedema (C1 inhibitor deficiency) (C1IN).

[0087] Neuromuscular diseases CASK abnormalities (CASK), CASK, Rett syndrome (MECP2), tuberous sclerosis complex (TSC2, TSC1), Gorlin syndrome (PTCH1), von Hippel-Lindau disease (VHL), Werner syndrome (WRN), Cockayne syndrome (CSA, CSB, XPB, XPD, XPG), Hutchinson-Gilford syndrome (LMNA), Alexander disease (GFAP), congenital cerebral leukodystrophy (PLP1, GJC2, TUBB4A, MBP, SLC16A2, HSPD1, SLC17A5, POLR3B, FAM126A, POLR3A, SOX10,POLR1C, etc.), macrocephalic leukoencephalopathy with subcortical cysts (MLC1, HEPACAM), vanishing white matter syndrome (EIF2B), ATR-X syndrome (ATRX), fragile X syndrome (FMR1), DDX3X-related neurodevelopmental disorder (DDX3X), congenital glycosylation disorder (PMM2), cerebral creatine deficiency syndrome (GATM, GAMT, SLA6A8), Apert syndrome (FGFR2), Crouzon disease (FGFR2, FGFR3), Pfeiffer syndrome (FGFR, FGFR2), Seather-Chotzen syndrome (TWIST), spinal muscular atrophy (SMN) ), congenital insensitivity to pain and anhidrosis (NTRK1, NGFB), hereditary motor and sensory neuropathies (PMP22, MPZ, KF1B, MFN2, RAB7, TRPV4, GARS, NEFL, HSPB1, HSPB8, AARS, GDAP1, MTMR, SBF2, MTMR13, SH3TC2, NDRG1, PRX, HK1, FGD4, FIG4, GJB1, etc.), Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (DMD), Emery-Dreifuss muscular dystrophy (EMD, LMNA), Fukuyama congenital muscular dystrophy (FKTN), Loxosin-deficient congenital muscular dystrophy (LNMA2), Ullrich congenital muscular dystrophy (COL6A1, COL6A2, COL6A3), myotubular myopathy, congenital fiber inequality, nemaline myopathy, central core disease, multicore disease, minicore disease (ACTA1, NEB, TPM2, TPM3, TNNT1, CFL2, KBTBD13, RYR1, SEPN1, MTM1, DMN2, BIN1, FHL1, etc.), Schwartz-Jampel syndrome (HSPG2), Unverricht-Lundborg disease (CSTB), Lafora disease (EPM2A, E PM2B), spinocerebellar degeneration (ATXN3, SCA6, SCA31, DRPLA), pantothenate kinase-associated neurodegeneration (PANK2), infantile neuroaxonal dystrophy (PLA2G6), WDR45-associated neurodegeneration (WDR45), neurofibromatosis type 1 (NF1), infantile bilateral striatal necrosis (nup62, SLC19A3, ADAR1), Aicardi-Goutières syndrome (TREX1, RNASEH2A, RNASEH2B, RNASEH1C, SAMHD1, ADAR, IFIH1), familial hypercholesterolemia (LDLR, APOB, PCSK9).

[0088] Chronic digestive diseases: lactose intolerance (LCT), sucrose isomaltose deficiency (SI), congenital glucose-galactose malabsorption (SLC5A1), enterokinase deficiency (PRSS7), lipase deficiency (PNLIP), microvillous inclusion disease (MYO5B), familial adenomatous polyposis (APC), juvenile polyposis (SMAD4, BMPR1A), Peutz-Jeghers syndrome (LKB1 / STK11), Cowden syndrome (PTEN), autoimmune enteropathy (including IPEX syndrome) (FOXP3), nonspecific multiple small intestinal ulcers (SLCO2A1), Alagille syndrome (JAG1, NOTCH2), progressive familial intrahepatic cholestasis (ATP8B1, ABCB11, ABCB4), hereditary pancreatitis (PRSS1, SPINK1), Talcott syndrome (FGFR3).

[0089] Skin disease group oculocutaneous albinism (congenital albinism) (TYR, TYRP1, MATP, SLC24A5, C10orf11, HPS1, AP3B1, HPS4, JPS5, HPS6, DTNBP1, BLOC1S3, PLDN, LY ST, MYOSA, RAB27A, MLPH), keratinoid ichthyosis (including epidermolytic ichthyosis (dominant / recessive) and superficial epidermolytic ichthyosis) (KRT1, KRT10), clown-like ichthyosis (ABCA12), Netherton syndrome (SPINK5), Sjögren-Larson syndrome (ALDH3A2), xeroderma pigmentosum (XPA, XPB, XPC, XPD, DDB2, XPF, ERCC5, POLH), Recklinghausen disease, (NF1), hypertrophic skin Dermatoperiosteal disease (HPGD, SLCO2A1), anhidrotic ectodermal dysplasia (EDA, EDAR, EDARADD), congenital porphyria (UROS, FECH, ALAS2, UROD, HMBS, ALAD, PPOX, CPOX).

[0090] Bone system diseases achondroplasia (FGFR3), achondroplasia (FGFR3), thanatophoric osteodysplasia (FGFR3), osteogenesis imperfecta (COL1A1, COL1A, FKBP10, LEPRE1, CRTAP, PPIB, SERPINH1, SERPINF1, BMP1), osteopetrosis (TCIRG1, CLCN7, OSTM1, TNFSF11) (RANKL), TNFRSF11A (RANK), PLEKHM1, CA2, LRP5, IKBKG (NEMO), FERMT3 (KIND3), RASGRP2 (CalDAG-GEF1), SNX10), multiple cartilaginous exostoses (EXT1, EXT2, EXT3), type II collagen dysplasia-associated disease (COL2A1), pseudoachondroplasia (COMP), Larsen syndrome (FLNB), fibrodysplasia ossificans progressiva (ACVR1 / ALK2), TRPV4 dysregulation (TRPV4 dysregulation), Beales syndrome (FBN2), hereditary hemorrhagic telangiectasia (Endoglin, ALK-1), Marfan syndrome (FBN1).

[0091] Genetic eye / ear diseases: X-linked retinitis pigmentosa (RPGR, RP2), macular dystrophy (BEST1, ABCA4), hereditary retinal dystrophy (RPE65), Usher syndrome (MYO7A, USH1C, CDH23, PCDH15, USH1G, USH2A, ADGRV1(GPR98), WHRN(DFNB31), CLRN1, HARS1), branchio-oto-renal syndrome (EYA1, SIX1), early-onset bilateral sensorineural hearing loss (ACTG1, CDH23, COCH, KCNQ4, TECTA, TMPRSS3, WFS1, EYA4, MYO6, MYO15A, POU4F3), congenital hearing loss (GJB2, SLC26A4, OTOF), preferably X-linked retinitis pigmentosa (RPGR, RP2).

[0092] In some embodiments, a gene encoding the causative enzyme may be introduced into a subject with a metabolic genetic disease. In some embodiments, a gene encoding fumarylacetoacetate hydrolase (FAH) may be introduced into a subject with hereditary tyrosinemia type 1 (HT1). In some embodiments, a gene encoding ornithine transcarbamylase (OTC) may be introduced into a subject with ornithine transcarbamylase (OTC) deficiency. In some embodiments, a gene encoding galvamyl phosphate synthase (CPS) may be introduced into a subject with methylmalonic acidemia. In some embodiments, a gene encoding methylmalonyl-CoA mutase may be introduced into a subject with methylmalonic acidemia.

[0093] In some embodiments, a gene encoding α-L-iduronidase may be introduced into a subject with mucopolysaccharidosis type I. In some embodiments, a gene encoding iduronate-2-sulfatase may be introduced into a subject with mucopolysaccharidosis type II. In some embodiments, a gene encoding heparan N-sulfatase may be introduced into a subject with mucopolysaccharidosis IIIA. In some embodiments, a gene encoding α-N-acetylglucosaminidase may be introduced into a subject with mucopolysaccharidosis IIIB. In some embodiments, a gene encoding acetyl-CoA:α-glucosaminide N-acetyltransferase may be introduced into a subject with mucopolysaccharidosis IIIC. In some embodiments, a gene encoding N-acetylglucosamine-6-sulfatase may be introduced into a subject with mucopolysaccharidosis IIID.

[0094] In one aspect, a gene encoding arylsulfatase A may be introduced into a subject with metachromatic leukodystrophy. In one aspect, a gene encoding acid sphingomyelinase may be introduced into a subject with Niemann-Pick disease type A or type B. In one aspect, a gene encoding an NPC1 protein or an NPC2 protein may be introduced into a subject with Niemann-Pick disease type C. In one aspect, a gene encoding acid α-glucosidase may be introduced into a subject with Pombe disease. In one aspect, a gene encoding α-galactosidase A may be introduced into a subject with Fabry disease.

[0095] In some embodiments, BCKDHA, BCKDHB, and DBT (OMIM: 248600) may be introduced into a subject with maple syrup urine disease (MSUD). In some embodiments, one or more selected from the group consisting of MTHFR (OMIM: 236250) and CBS (OMIM: 236200) may be introduced into a subject with homocystinuria. In some embodiments, TAT (OMIM: 276600) may be introduced into a subject with tyrosinemia type II. In some embodiments, ASS1 (OMIM: 215700) may be introduced into a subject with citrullinemia type I. In some embodiments, SLC25A13 (OMIM: 605814) may be introduced into a subject with citrullinemia type II. In some embodiments, ASL (OMIM: 207900) may be introduced into a subject with argininosuccinic aciduria. In some embodiments, CPS1 (OMIM: 237300) may be introduced into a subject with carbamoyl phosphate synthetase I (CPS I) deficiency. In some embodiments, ARG1 (OMIM: 207800) may be introduced into a subject with argininemia (arginase deficiency). In some embodiments, SLC25A15 (OMIM: 238970) may be introduced into a subject with hyperammonemia-homocitrullinemia (HHH) syndrome. In some embodiments, N-acetylglutamate synthase (NAGS) (OMIM: 237310) may be introduced into a subject with N-acetylglutamate synthase (NAGS) deficiency. In some embodiments, ornithine transcarbamylase (OTC) (OMIM: 311250) may be introduced into a subject with OTC deficiency. In some embodiments, a subject with pyruvate dehydrogenase (PDH) complex deficiency may be treated with one or more genes selected from the group consisting of PDHA1 (OMIM: 312170), PDHB (OMIM: 614111), DLAT (OMIM: 245348), DLD (OMIM: 245900), PDHX (OMIM: 245349), and PDP1 (OMIM: 608782).

[0096] In one embodiment, a gene encoding alpha antitrypsin can be introduced into a subject with alpha antitrypsin deficiency. In one embodiment, a gene encoding lipoprotein lipase can be introduced into a subject with lipoprotein lipase deficiency. In one embodiment, a gene encoding glucocerebrosidase (GBA) can be introduced into a subject with Gaucher disease. Many mitochondrial diseases can also be targeted. A normal form of the mutated gene causing the mitochondrial disease can be introduced into a subject with the mitochondrial disease. By introducing the full-length gene, it is possible to produce effects in subjects with a variety of different mutations. On the other hand, if it is only necessary to treat a group of subjects with a specific mutation, a portion of the gene can be introduced into the subject to replace only the mutation site.

[0097] The above-mentioned genetic diseases are caused by abnormalities in the genes shown in parentheses immediately following each disease, and gene therapy can be performed by replacing the abnormality with a functional gene. Therefore, if multiple causative genes are known, gene therapy can be attempted by testing which of the causative genes is abnormal, identifying the causative gene, and then introducing a gene with normal function. Furthermore, the method disclosed herein does not introduce double-strand breaks into the genome and is thought to reduce the risk of, for example, chromosomal translocations, and therefore is thought to reduce side effects associated with gene insertion into the genome. This may be particularly useful as a gene introduction or replacement technique in vivo, both in vivo and in vitro, and particularly in gene therapy.

[0098] In addition, recombinant adenoviral vectors having a short hairpin RNA expression unit, and recombinant adenoviral vectors having a Cas guide RNA expression unit and a short hairpin RNA expression unit, which will be described later, can also be suitably used for similar purposes.

[0099] <Other Components> The other components are not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include a Cas protein expression unit and a donor DNA unit.

[0100] <<Cas Protein Expression Unit>> The Cas protein expression unit contains at least a gene encoding a Cas protein, and has other components such as a promoter and polyA, as necessary.

[0101] The Cas protein refers to a protein or derivative thereof that functions as an effector molecule constituting the "CRISPR / Cas system." For example, "Cas protein" refers to a Cas9 protein, a Cpf1 protein, or a mutant thereof having DNA cleavage activity. In one embodiment, the "Cas protein" is a Cas nuclease having DNA double-strand cleavage activity. In one embodiment, the "Cas protein" is a Cas nickase having the activity of cleaving only one strand of a DNA double strand. In one embodiment, the Cas nickase may be a Cas9 (D10A) nickase having a mutation in the RuvC domain (Jinek et al., 2012, Science, 2012, Vol. 337, no. 6096, pp. 816-821). Among these, Cas9 nuclease and Cas9 nickase are preferred, and Cas9 nickase is more preferred.

[0102] The promoter is not particularly limited and can be appropriately selected depending on the purpose. Examples include the CB promoter (CB pro), CAG promoter (CAG pro), CMV promoter (CMV pro), PGK promoter (PGK pro), human EF1α promoter (sometimes referred to as the "EF promoter"), and albumin promoter (Alb pro). Among these, a truncated EF promoter (SEQ ID NO: 2) (hereinafter sometimes referred to as the "EFd promoter") is preferred. In gene therapy, DNA for gene therapy can be introduced operably into a native promoter on the genome, and in this case, the native promoter on the genome is used as the promoter.

[0103] The poly A is not particularly limited and can be appropriately selected depending on the purpose. For example, poly A derived from bovine growth hormone can be used.

[0104] The site where the Cas protein expression unit is placed is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include the E1 region, E3 region, E4 region, etc. Among these, the E1 region and E4 region are preferred.

[0105] The site where the Cas protein expression unit is placed may be the same as or different from the site (region) where the Cas guide RNA expression unit is placed.

[0106] <<Donor DNA Unit>> The donor DNA unit contains at least the donor DNA sequence to be knocked in, and, if necessary, has other components such as a left arm sequence and a right arm sequence, which will be described later.

[0107] The donor DNA sequence may be a gene-coding or non-gene-coding sequence.

[0108] In the treatment of genetic diseases, etc., knock-in is required to replace an abnormal gene sequence with a normal gene sequence. The DNA fragment used for knock-in has base sequences used for homologous recombination on both sides (upstream and downstream) of the normal gene sequence. These sequences are generally called the left arm sequence (upstream) and the right arm sequence (downstream). The upstream arm and downstream arm can each induce homologous recombination with a homologous sequence on the genome, and the efficiency of homologous recombination can be improved by introducing a double-strand break or nick nearby. The upstream and downstream arms can each typically be 500 bp to 3,000 bp, for example, 1 kbp to 3 kbp, 1 kbp to 2 kbp, or 1 kbp to 1.5 kbp, or 1.5 kbp to 2 kbp, or 0.5 kbp to 1.5 kbp. The length of the sequence flanked by the upstream and downstream arms can be 1 kbp to 5 kbp, for example, 1 kbp to 4 kbp, for example, 1.5 kbp to 3 kbp, or 1.5 kbp to 2.5 kbp, although it is considered preferable that the upstream arm and downstream arm are longer.

[0109] The total length of the donor DNA is approximately 7.0 kbp or less, 6.9 kbp or less, 6.8 kbp or less, 6.7 kbp or less, 6.6 kbp or less, 6.5 kbp or less, 6.4 kbp or less, 6.3 kbp or less, 6.2 kbp or less, 6.1 kbp or less, 6.0 kbp or less, 5.9 kbp or less, 5.8 kbp or less, 5.7 kbp or less, 5.6 kbp or less, 5.5 kbp or less, 5.4 kbp or less, 5.3 kbp or less, 5.2 kbp or less, 5.1 kbp or less, 5.0 kbp or less, 4.9 kbp or less, 4.8 kbp or less, or 4.7 kbp or less.

[0110] The site where the donor DNA unit is placed is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include the E1 region, the E3 region, the E4 region, etc. The site where the Cas protein expression unit is placed may be the same as or different from the sites (regions) where the Cas guide RNA expression unit and the Cas protein expression unit are placed.

[0111] A recombinant adenoviral vector having the Cas guide RNA expression unit can be made into an "integrated Cas adenoviral vector" (sometimes referred to as an "all-in-one Cas adenoviral vector") by further incorporating at least one of the Cas protein expression unit and the donor DNA unit.

[0112] Furthermore, an integrated Cas adenoviral vector containing the donor DNA unit can efficiently introduce the donor DNA sequence into a specific location on the genome. Typically, when introducing double nicking, the integrated Cas knock-in nucleic acid vector is composed of a set (two) of Cas guide RNA expression units for generating double nicking, one donor DNA sequence, and one gene encoding a Cas protein, but this configuration is not limited to this. When introducing a single nick, the integrated Cas knock-in nucleic acid vector is composed of a Cas guide RNA expression unit (or an expression unit for one type of Cas guide RNA; it may have multiple genes expressing the same Cas guide RNA) for generating a nick, one donor DNA sequence, and one gene encoding a Cas protein, but this configuration is not limited to this.

[0113] The method for producing a recombinant adenoviral vector having the Cas guide RNA expression unit is not particularly limited, and a known method can be selected appropriately depending on the purpose. For example, the vector can be produced by a method in which the Cas guide RNA expression unit and, if necessary, other components are inserted into a cosmid vector containing a portion of the adenoviral genomic DNA, and then transfected into 293 cells to obtain a recombinant adenoviral vector (full-length DNA transfer method: Fukuda et al., Microbiol. Immunol. 2006, Vol. 50, pp. 463-454). When using the full-length DNA transfer method using 293 cells, the culture period using 293 cells is not particularly limited and can be selected appropriately depending on the purpose, but is preferably continued for 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, or 24 days or more.

[0114] The adenovirus vector that can be used as the recombinant adenovirus vector having the Cas guide RNA expression unit is not particularly limited and can be selected appropriately depending on the purpose, but the recombinant adenovirus vector of the present disclosure described above can be preferably used.

[0115] When the recombinant adenoviral vector having the Cas guide RNA expression unit has the Cas protein expression unit, the genome editing activity of the Cas protein can occur in the host cell, so it is preferable to culture it under culture conditions that make this activity less likely to occur. It is also desirable to culture it under conditions that can suppress the expression of the Cas protein. In one aspect, the expression of the Cas protein can be suppressed by introducing a vector that expresses an siRNA that suppresses the expression of the Cas protein into the cultured cells.

[0116] The recombinant adenoviral vector having the Cas guide RNA expression unit is preferably configured so that the Cas guide RNA expression unit induces double nicking. In a more preferred embodiment, the recombinant adenoviral vector having the Cas guide RNA expression unit is preferably configured so that the Cas guide RNA expression unit induces nicks without inducing double-strand breaks (and double nicking).

[0117] In the present disclosure, a Cas guide RNA expression unit is "configured to induce double nicking" means that at least two Cas guide RNA expression units are selected to induce single-strand breaks, or "nicks," in the sense and antisense strands, respectively, at adjacent positions on the genome, thereby causing double-strand breaks in the two strands of genomic DNA near the two nicks. Not causing double-strand breaks means that double-strand breaks of this type are not performed.

[0118] The recombinant adenovirus vector having the Cas guide RNA expression unit can be used in genome editing experiments by applying an effective amount to cultured cells, and can also be used in genome editing experiments or disease treatment by administering an effective amount to animals other than humans, or in genome editing disease treatment by administering an effective amount to humans.

[0119] <Short Hairpin RNA Expression Unit> The short hairpin RNA expression unit refers to a DNA structural unit for expressing a short hairpin RNA, and includes a DNA nucleic acid sequence that is transcribed into a short hairpin RNA.

[0120] The short hairpin RNA is RNA having a length of 55 to 65 bases. The structure of the short hairpin RNA comprises a sense strand of a 21-base target sequence, a 9-base loop sequence, an antisense strand, and a terminating poly-U. After transcription, the short hairpin RNA forms a hairpin structure and is processed to become an siRNA. The sequences and lengths of the loop sequence and terminating poly-U are not particularly limited as long as they do not impair the effects of the present disclosure, and can be appropriately selected depending on the purpose.

[0121] The arrangement of the short hairpin RNA expression units on the vector genome is not particularly limited, as long as a total of six or more short hairpin RNA expression units are divided and arranged at two or more sites, and can be appropriately selected depending on the purpose.

[0122] The site on the vector where the short hairpin RNA expression unit is placed is not particularly limited and can be appropriately selected depending on the purpose.

[0123] The short hairpin RNA expression unit is preferably carried in a site selected from the group consisting of the E1 region, the E3 region, and the E4 region of the adenoviral vector.

[0124] The number of short hairpin RNA expression units in one arrangement site is not particularly limited and can be appropriately selected depending on the purpose. Among these, two or more are preferred.

[0125] The upper limit of the number of short hairpin RNA expression units in one arrangement site (the maximum number of consecutive short hairpin RNA expression units) is not particularly limited and can be selected appropriately depending on the purpose. The lower limit of the number of short hairpin RNA expression units in one arrangement site (the minimum number of consecutive short hairpin RNA expression units) is not particularly limited and can be selected appropriately depending on the purpose, but two is preferred.

[0126] Similar to the above-described Cas guide RNA expression unit, the short hairpin RNA expression unit can include, in addition to the DNA encoding the short hairpin RNA, an expression regulatory region such as a promoter that regulates its expression.

[0127] Usually, when a vector contains multiple short hairpin RNA expression units, they are arranged adjacently in tandem so that they are in the same transcription direction.

[0128] The sequence of the DNA encoding the short hairpin RNA is not particularly limited and can be appropriately selected depending on the purpose.

[0129] <Other Components> The other components are not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include a donor DNA unit.

[0130] The method for producing the recombinant adenoviral vector having the short hairpin RNA expression unit is not particularly limited, and any known method can be appropriately selected depending on the purpose.

[0131] The adenovirus vector that can be used as the recombinant adenovirus vector having the short hairpin RNA expression unit is not particularly limited and can be selected appropriately depending on the purpose, but the recombinant adenovirus vector of the present disclosure described above can be preferably used.

[0132] (Recombinant adenovirus vector having a Cas guide RNA expression unit and a short hairpin RNA expression unit) In one aspect, the recombinant adenovirus vector having a Cas guide RNA expression unit and a short hairpin RNA expression unit of the present disclosure has, at least on the vector genome, two or more Cas guide RNA expression units and two or more short hairpin RNA expression units, and may further have other components as necessary.

[0133] <Cas guide RNA expression unit> The Cas guide RNA expression unit is the same as the Cas guide RNA expression unit described above in the section on recombinant adenovirus vectors having a Cas guide RNA expression unit.

[0134] The target of the Cas guide RNA in the Cas guide RNA expression unit is not particularly limited and can be selected appropriately depending on the purpose, but a safe harbor region is preferred.

[0135] The safe harbor region is a gene region where the inserted gene is unlikely to be suppressed in expression and where it is known that deletion of the gene does not adversely affect cells.

[0136] The sequence of the Cas guide RNA targeting the safe harbor region is not particularly limited and can be appropriately selected from the safe harbor regions according to the purpose. Examples of the safe harbor region include, but are not limited to, the AAVS1 region, the CCR5 region, the SHS231 region, and the hROSA26 region. In a preferred embodiment of the present invention, even when editing the safe harbor region, double-strand breaks are not introduced into genomic DNA.

[0137] <Short Hairpin RNA Expression Unit> The short hairpin RNA expression unit is the same as the short hairpin RNA expression unit described in the section on the recombinant adenovirus vector having a short hairpin RNA expression unit.

[0138] The target of the short hairpin RNA in the short hairpin RNA expression unit is not particularly limited and can be selected appropriately depending on the purpose, but Cypor mRNA is preferred. Cypor is cytochrome P450 reductase, an enzyme that transfers electrons from NADPH to P450. The sequence of the short hairpin RNA targeting the Cypor mRNA is not particularly limited, and any RNA that has the effect of knocking down the Cypor mRNA can be appropriately designed and used.

[0139] The arrangement of the Cas guide RNA expression unit and the short hairpin RNA expression unit on the vector genome is not particularly limited, as long as there are two or more Cas guide RNA expression units and two or more short hairpin RNA expression units, and can be selected appropriately depending on the purpose. They may be arranged together at one site, or may be divided and arranged at two or more sites.

[0140] The sites on the vector where the Cas guide RNA expression unit and the short hairpin RNA expression unit are placed are not particularly limited and can be selected appropriately depending on the purpose, but it is preferable to place them at one or more sites selected from the group consisting of the E1 region, E3 region, and E4 region of the adenovirus vector.

[0141] When the Cas guide RNA expression unit and the short hairpin RNA expression unit are divided into two or more sites and placed on the vector, there are no particular restrictions on the sites on the vector at which they are placed and they can be selected appropriately depending on the purpose, but it is preferable that they are divided into two or more sites sandwiched between at least a portion of the essential region of the adenovirus.

[0142] When the Cas guide RNA expression unit and the short hairpin RNA expression unit are divided and placed in two or more locations, it is preferable that the Cas guide RNA expression unit and the short hairpin RNA expression unit are divided and placed in two or more locations selected from the group consisting of the E1 region, E3 region, and E4 region of the adenovirus vector.

[0143] The total number of Cas guide RNA expression units and short hairpin RNA expression units in one placement site is not particularly limited and can be selected appropriately depending on the purpose.

[0144] There is no particular limit to the upper limit of the number of Cas guide RNA expression units in one placement site (the maximum number of consecutive Cas guide RNA expression units) and this can be selected appropriately depending on the purpose. There is no particular limit to the lower limit of the number of Cas guide RNA expression units in one site (the minimum number of consecutive Cas guide RNA expression units) and this can be selected appropriately depending on the purpose, but two is preferred.

[0145] The upper limit of the number of short hairpin RNA expression units in one arrangement site (the maximum number of consecutive short hairpin RNA expression units) is not particularly limited and can be selected appropriately depending on the purpose. The lower limit of the number of short hairpin RNA expression units in one arrangement site (the minimum number of consecutive short hairpin RNA expression units) is not particularly limited and can be selected appropriately depending on the purpose, but two is preferred.

[0146] Examples of cases in which the Cas guide RNA expression unit and the short hairpin RNA expression unit are divided and placed in two or three locations are not particularly limited and can be selected appropriately depending on the purpose. For example, they can be placed in the same manner as the above-mentioned Cas guide RNA expression unit.

[0147] <Other Components> The other components are not particularly limited and can be selected appropriately depending on the purpose. Examples include the same components as those described in the above-mentioned section on the recombinant adenoviral vector having a Cas guide RNA expression unit and the section on the recombinant adenoviral vector having a short hairpin RNA expression unit.

[0148] The method for producing a recombinant adenovirus vector having the Cas guide RNA expression unit and the short hairpin RNA expression unit is not particularly limited, and a known method can be appropriately selected depending on the purpose.

[0149] The adenovirus vector that can be used as the recombinant adenovirus vector having the Cas guide RNA expression unit and the short hairpin RNA expression unit is not particularly limited and can be appropriately selected depending on the purpose, but the recombinant adenovirus vector of the present disclosure described above can be preferably used. Furthermore, although a recombinant adenovirus vector is exemplified in the explanation of the technology in this disclosure, a recombinant virus vector or recombinant vector can be used instead of the recombinant adenovirus vector.

[0150] Hereinafter, we will demonstrate that it is possible to knock in the entire expression unit without causing double-strand breaks. Test examples of the present disclosure will be described, but the present disclosure is not limited to these test examples.

[0151] Example 1: Construction of an Expression Unit Knock-in Vector for the Treatment of Phenyleketonuria (PKU) Figures 1A and 1B show a comparison of conventional point mutation repair and expression unit knock-in. Point mutation repair normalizes only one mutated base (see Figure 1A). However, even within a single disease, there are many different types of mutated bases, and therefore, it is necessary to construct a vector for each type of point mutation. In contrast, the expression unit knock-in method leaves the mutated base site intact (see Figure 1B). Donor DNA containing a large therapeutic gene expression unit is integrated into a safe harbor region (such as the mouse Rosa26 region) (see Figure 1B). This allows treatment of a single disease with various mutations with a single vector. Furthermore, by simply replacing the cDNA in the vector, it is possible to sequentially construct therapeutic vectors for many genetic diseases.

[0152] In this test example, the expression unit knock-in vector used was the Yakushi-Pah vector (also known as the AxYPah vector) carrying a unit that expresses the Pah gene, which is the gene responsible for PKU, or the Yakushi-GFP vector (also known as the AxYGFP vector) carrying a GFP expression unit. Their structures are shown in Figure 2. These vectors are used in co-infection with the AxCBCas9 vector, which expresses Cas9 from the CB promoter, and the AxCBNC9 Cas9 nickase expression vector. The Hepa1-6 cell line was used.

[0153] The donor DNA size was 6.8 kb when using the human Pah expression unit and 6.2 kb when using the GFP gene expression unit, far exceeding the maximum size (4.7 kb) that can be integrated into AAV vectors. The donor DNA contained either a normal Pah gene expression unit (2.3 kb) or a GFP expression unit (1.8 kb) (Figure 2), flanked by a 1.7 kb right arm DNA and a 1.9 kb left arm DNA (Figure 2), as well as two shRNA expression units targeting the mouse Cypor gene (shown by the two diamonds in Figure 2). These were integrated into the E1 site of the vector. The combined length of both arms was an exceptionally large 3.6 kb, almost unparalleled in size. Furthermore, the lengths of the units integrated by knock-in were 2.3 kb and 1.8 kb, respectively, suggesting that integration of such large DNA fragments would be extremely difficult. In addition, in order to carry out an in vivo selection method for knocking down the Cypor gene (cytochrome p450 reductase) (Tiyaboonchai A, Grompe M et al., NatCommun, 13:7391, 2022), we attempted to knock down cypor mRNA (see Example 3).

[0154] Two identical guide RNA expression units targeting the safe harbor region for knock-in are integrated into the E4 site of the vector (two boxes in Figure 2). The same target sequence (20 bases) is also integrated into the right end of the donor DNA, and the donor DNA is cleaved or nicked at this position (diagonal triangle at the right end of the donor DNA in Figure 2), thereby increasing knock-in efficiency. The target base sequence of the guide RNA is shown below. Target base sequence: GACTGGAGTTGCAGATCACG (SEQ ID NO: 3).

[0155] Example 2: Knock-in efficiency of expression unit knock-in vectors Figure 3 shows the structure of the mouse genome in the safe harbor region (Rosa26 region) before knock-in, the donor DNA on the knock-in vector, and the donor DNA on the mouse genome after knock-in. Examples of primer sequences are as follows: 277F (SEQ ID NO: 20): 5'- aaacgtggagtaggcaatacccagg -3' 70F (SEQ ID NO: 21): 5'- cttgagcatctgacttctggctaataaagg -3' 279R (SEQ ID NO: 22): 5'- agctttcagctttgtatagatgaagcac -3'

[0156] To evaluate the efficiency of the expression unit knock-in method, the mouse liver-derived cell line Hepa1-6 was infected with the AxYGFP vector, the Cas9-expressing vector AxCBCas9 (which expresses the cleaving Cas9 gene), or the Cas9 nickase-expressing vector AxCBNC9 (which expresses the nicking Cas9 gene), at an MOI of 100:100, 150:50, or 20:180, respectively. After 3 days, total cellular DNA was extracted and subjected to 35 cycles of PCR using the 277F and 279R primers shown in Figure 3. These primers are located outside the donor DNA sequence and produce a 3.8-kb band in the absence of knock-in, and a 6.9-kb band in the presence of knock-in via co-infection of the AxYPah vector with AxCBCas9 or AxCBNC9. The results are shown in Figure 4A. Note that 1w1 in Figure 4A is the negative control, representing the empty vector Ax1w1, which does not contain an insert. The knock-in efficiency, calculated by quantifying the band intensity, is shown in Figure 4B.

[0157] When the Rosa26 target was cleaved by co-infection with the AxYPah vector and AxCBCas9 (denoted Cas9), a 6.9-kb knock-in band was observed above a very thick 3.8-kb band (indicated by a square) at both ratios. This result is noteworthy considering the large size of the insert (2.3 kb). Surprisingly, when the Rosa26 target was nicked by co-infection with AxCBNC9, a 6.9-kb knock-in band (indicated by a square) was observed under both conditions. Quantification (Figure 4B) revealed that the knock-in efficiency by nicking was 2%, only half the 4% knock-in efficiency by nicking, demonstrating a very high efficiency.

[0158] Furthermore, under these experimental conditions, a higher ratio of AxYPah vector to AxCBNC9 vector resulted in higher efficiency of nick-mediated knock-in, suggesting that further increasing the ratio of AxYPah vector may further increase knock-in efficiency.

[0159] In the case of cleavage-mediated knock-in (Cas9 in Figure 4A), numerous bands of varying intensity were observed below the thick 3.8 kb band (see the box in Figure 4A). Many of these bands indicate on-target cleavage of the Rosa26 target, resulting in multiple DNA deletions including the cleavage site. Notably, in the case of nick-mediated knock-in (NC9 in Figure 4A), these multiple bands were significantly reduced compared to cleavage (see the box in Figure 4A). This suggests that nick-mediated knock-in results in fewer nonspecific deletions at the on-target site.

[0160] The original Cas9 knock-in technique involves cutting the cellular genome at the target site and then utilizing the resulting repair mechanism to achieve knock-in. However, the DNA ends generated by the cuts are repeatedly rejoined by Cas9, and only stabilized once base mutations occur. This results in a very high rate of on-target disruption at the target site, ranging from small insertions and deletions (indels) to large-scale chromosomal rearrangements. While this mechanism is useful for gene knockout, it faces a major problem: its safety cannot be guaranteed.

[0161] However, because nickase-mediated knock-in does not involve cleavage, it may be possible to avoid disruption of the target site or chromosomal rearrangement. Therefore, we sequenced the PCR products flanking the target site and then examined the efficiency of disruption of the cellular genome at the on-target site using the TIDE method (https: / / tide.nki.nl / ).

[0162] As shown in Figure 4C, when Cas9 was used, the on-target disruption efficiency was over 95%, and the target sequences on both chromosomes were almost completely disrupted. However, surprisingly, the genome disruption efficiency of nickase-mediated knock-in was below the detection limit of the quantitative experiment. This result suggests the high safety of nickase-mediated knock-in. In this test, approximately 1 × 10 5 Cells were edited and the target sequence was analyzed by PCR. The disclosed method demonstrated on-target genome disruption efficiency below the detection limit, suggesting that it is an extremely safe genome editing method.

[0163] Example 3: Examination of knockdown efficiency of double Cypor shRNA Generally speaking, if a single vector can perform the combination of knocking out gene DNA to block gene expression and selectively growing genome-edited cells by simultaneously expressing Cypor shRNA, highly efficient genome editing can be expected.

[0164] The activity of the multiple guide RNAs expressed by this vector is evident from the knock-in that occurred. In this example, the shRNA was carried on the same vector as the donor DNA. To examine the activity of two co-expressed shRNAs to knock down the expression of the target Cypor mRNA, Hepa1-6 cells were infected with the AxYPah vector, the AxYGFP vector, or the 1w1 vector lacking the expression unit, along with a Cas9 expression vector at an MOI of 30. Total cellular RNA was extracted 3 days later. Using 2 μg of this RNA, cDNA was prepared using the random primer method, and the expressed Cypor mRNA was quantified. The results are shown in Figure 5. The amount of detected Cypor mRNA was reduced to 4% for the AxYPah vector and 3% for the AxYGFP vector compared to infection with the control 1w1 vector. The mRNA of the mouse TFRC gene present in the same cDNA was quantified; the AxYPah vector was 99% of the control, and the AxYGFP vector was 80% of the control, showing no significant difference. These results suggest that the knockdown efficiency of Cypor shRNA was approximately 96% and 97% for the AxYPah and AxYGFP vectors, respectively, suggesting a high efficiency. One possible reason for this high efficiency is the additive effect of co-expressing two shRNAs against each mRNA target.

[0165] The target sequences of the shRNA and primers used in this experiment are shown below. The underlined portions of the shRNA sequence indicate the front and back strands of the 21-base shRNA target. The ununderlined portion of the shRNA sequence between the front and back strands is the loop sequence, and the seven A's at the end encode a termination poly-U.

[0166] Cypor shRNA 1: GAAGAAGTGTCTCTATTCAGCTTCAAGAACGCTGAATAGAGACACTTCTTCAAAAAAA (SEQ ID NO: 4) Cypor shRNA 2: GAACATTATTGTATTCTATGGTTCAAGAACCCATAGAATACAATAATGTTCAAAAAAA (SEQ ID NO: 5) Cypor mRNA detection primer 268-F: GGGACTCTCACGAAGACACCAGTGC (SEQ ID NO: 6) Cypor mRNA detection primer 269-R: CCACGTGATCTCCAGATTCATACCTG (SEQ ID NO: 7) TFRC mRNA detection primer 270-F: ATGATGGATCAAGCCAGATCAGC (SEQ ID NO: 8) TFRC mRNA detection primer 271-R: TGTATGTATTCTGGCTCAGCTGC (SEQ ID NO: 9)

[0167] Example 4: Effect of Introducing Nicks or Double Nicks into the Ends of Donor DNA Fragments. In this example, we investigated whether introducing a nick or double nicks into the end of the donor DNA fragment in a Yakushi vector-based homologous recombination system could increase knock-in efficiency by simultaneously introducing a nick into the chromosomal target (without introducing a double-strand break into the chromosome) and a nick or double nick into the end of the donor DNA fragment on the vector. Specifically, a Yakushi vector containing donor DNA was co-transfected with a vector expressing Cas9 nickase, such as AxCBNC9. The donor DNA end or arm DNA contained a Cas9 nickase target sequence (Figure 2 and Figures 6A, 6D, 6F, 6G, 6I, and 6L, indicated by an up-pointing triangle) identical to the target sequence on the host genome chromosome. This figure shows the introduction of a nick, indicated by an up-pointing triangle, into the 1.9 kb L-terminus of the donor DNA (the right-hand end of the donor DNA in the figure). In this example, with the aim of developing a vector with even higher efficiency for knock-in using nickase in particular, we investigated the knock-in efficiency when nicks were inserted at both ends of the donor DNA rather than at one end, or when double-nicking cleavage was introduced rather than nicking.

[0168] The vectors shown in Figures 6A, 6D, 6F, 6G, 6I, and 6L were constructed. The structure of the vector in Figure 6A is shown in Figure 2. In this series of experiments, the GFP gene was used as the cDNA. In Figure 6A, one gRNA was used to introduce one nick at each end of the chromosome and the donor. In Figure 6D, one gRNA was used to introduce one nick at each end of the donor and one nick at the chromosome. In Figure 6G, one nick was introduced in the upstream and downstream arms of the donor DNA, and one nick was introduced at the corresponding positions on the chromosome. In Figure 6I, two gRNAs were used to introduce double nicks at one end of the donor DNA. In Figure 6L, one nick was introduced at one end of the donor DNA, a double nick was introduced at the other end, and one nick was introduced at the corresponding positions on the chromosome. In both cases, when two nicks were introduced, they were introduced on the same strand to avoid double-strand breaks (more specifically, to separate the effects of double-strand breaks). As shown in Figure 6C, knock-in was observed in 2.28% of cells in the standard system, while knock-in efficiencies of 2.68% and 2.99% were observed in Figures 6K and 6N, respectively.

[0169] Hereinafter, the donor end target sequence identical to the target sequence on the chromosome is referred to as the G sequence, and the other sequence paired with it for double nicking is referred to as the C sequence. By expressing a gRNA targeting the G sequence, Cas nickase can form one nick in each of the G sequences in the chromosome and the donor DNA. The C sequence can be, for example, a sequence not present in the genome (e.g., a foreign sequence, e.g., an artificial sequence), and one nick is formed only under the expression of a gRNA targeting the C sequence. The conditions under which double-stranded breaks occur in double-stranded DNA by double nicking have been well studied, and double-stranded breaks occur efficiently when the distance between the two target sequences is approximately -5 bp to 30 bp (a negative value means that the 5' ends of the two target sequences overlap).

[0170] The structure of the target site where a nick is introduced is shown below. Sequence around the right end of the donor DNA: tacgtaCCTCGTGATCTGCAACTCCAGTCaccggtgcgatcgcgtatacgctgaggccctagggcatgcCGACTAGATGAAGGAGAGCCTTTC (SEQ ID NO: 28). Lowercase letters indicate the artificial sequence, and uppercase letters indicate the same sequence as the sequence on the chromosome. The underlines indicate the back strand of the G target sequence + PAM sequence (upward triangle) and the C target sequence (downward triangle, specifically the artificial sequence consisting of AgeI-AsiSI-BstZ17I-BbvCI). The capital letters that follow indicate the sequence at the 5' end of the L arm.

[0171] Sequence of the left end of the donor DNA containing the G target sequence: TTCTAGTATCCTATTTGTTTcgataggcctCCTCGTGATCTGCAACTCCAGTCgtgcac (SEQ ID NO: 29). This sequence was the left end sequence of the donor for AxYGFP-G+G, AxYGFP-D+G, and AxYGFP-LR. Lowercase letters indicate the artificial sequence, and uppercase letters indicate the sequence on the chromosome. The G target sequence is underlined. The 5' 20 bases (TTC...TTT) are the sequence of the 3' end of the L arm.

[0172] In addition, the left end sequences of AxYGFP-G and AxYGFP-D, which do not have a guide target sequence at the left end of the donor, have an artificial sequence following 20 bases at the 3' end of the L arm.

[0173] L target sequence and R target sequence of AxYGFP-LR vector LR-L12 GCCTCTTCTTTAGGCGGCCC (SEQ ID NO: 30) LR-R12 gTTATAGGTCCTGAAGAAGCT (SEQ ID NO: 31) In L12 and R12, the target sequences of the above guide RNAs are set at positions approximately 1.2 kb from the origin of the arm toward each arm within the sequences of the L arm (1.9 kb) and R arm (1.7 kb). The origin of the L arm is located at the left end of the L arm, and the origin of the R arm is located at the right end of the R arm.

[0174] To evaluate the knock-in efficiency of each vector, Hepa1-6 cells were infected with the vectors at an MOI ranging from 100 to 1 at a 3:1 ratio with the nickase-expressing vector AxCBNC9. Total cellular DNA was extracted 72 hours later. Subsequently, 35 cycles of PCR were performed to amplify the downstream region of the target site in Rosa26 using the 70F and 279R primers shown in Figure 3 . Gene knock-in was achieved in all patterns, as shown in Figures 6B, 6E, 6H, 6J, and 6M. While the knock-in efficiency of the donor DNA shown in Figure 6A was 2.28% (see Figure 6C), the knock-in efficiency of the donor DNA shown in Figures 6I and 6L was 2.68% and 2.99%, respectively (Figures 6K and 6M), demonstrating improved knock-in efficiency.

[0175] This knock-in efficiency is expected to be therapeutically effective in certain gene therapies, such as in vivo metabolic enzyme replacement therapy, because even if the therapeutic gene is not knocked into all cells, if the enzymes replaced by the knocked-in therapeutic gene function in some cells, it can lead to the alleviation of pathological symptoms.

[0176] Example 5: Repair experiment by knock-in of a phenylketonuria point mutation site using Cas9 nickase The mutated enzyme in phenylketonuria (PKU) is phenylalanine hydroxylase, and in the model mouse, there is a single base mutation, TTC → TCC, in which phenylalanine is mutated to serine.

[0177] To investigate the knock-in efficiency of Cas9 nickase in point mutation repair, we constructed and used the g(6+2) knock-in vector shown in the upper panel of Figure 7. This vector contains a large 4 kb donor DNA with the normal amino acid sequence to be replaced in the center of the donor DNA. It also contains eight guide RNA expression units, divided into six in the E4 region and two in the E1 region.

[0178] The g(6+2) vector, when co-infected with the original Cas9-expressing vector AxCBCas9 (Figure 7, center), contains six identical guide RNA expression units that recognize a single target sequence upstream of the mutated base in the model mouse genome, resulting in highly efficient cleavage of this target site and knock-in replacement of the mutated base. Furthermore, when co-infected with AxNC9 (Figure 7, bottom), which expresses Cas9 nickase, the same vector efficiently introduces nicks at the same position. When more than six guide RNAs are loaded, they are loaded in two locations to avoid vector instability, with the upper limit of six guide RNAs loaded at one location.

[0179] It is also known that double-strand breaks at the end of the donor DNA increase knock-in efficiency (Irion U et al. Development, vol. 141:4827-4830, 2014). In contrast, in this example, the g(6+2) vector has two units expressing two guide RNAs that introduce a double-strand break (control group) or a nick (test group) at the E1 site, and a double-strand break (control group) or a nick (test group) is introduced at the left end of the donor DNA at the position indicated by the vertical arrow in the upper row of Figure 7. The two guide RNA target sequences overlap, and their target base sequences are shown below (underlined sequences indicate the common sequence). Terminal break / nick 1: gAACGGCGTCAATTGCATGCA (SEQ ID NO: 10) Terminal break / nick 2: gCGTCAATTGCATGCAAGGTC (SEQ ID NO: 11)

[0180] Figure 8 shows the target sequences (boxed) of the six guide RNAs contained in the g(6+2) vector. The target base sequence is shown below. Knock-in cleavage / nicking sequence: gTCGTCTCGAGATTTCTTGGG (SEQ ID NO: 12).

[0181] This guide RNA allows Cas9 or Cas9 nickase to introduce a double-strand break or nick 23 bases upstream (indicated by a triangle in the figure) of the disease-causing mutant base (right end). The guide RNA also contains the artificial sequence "CCTAGGAGGCCTAG" (SEQ ID NO: 19) containing restriction enzyme sites (AvrII, StuI) described below, as shown in Figure 8 (the underlined nucleotides represent the modified nucleotides).

[0182] The in vitro knock-in efficiency of the above-described knock-in vector for PKU treatment at the mutation site was examined. A schematic diagram of the experiment is shown in Figure 9. This experiment was a model experiment, and the sequence corresponding to the PKU mutation in the mouse cell line Hepa1-6 (indicated by n in the upper part of the figure) was normal. The donor DNA carried by the g(6+2) vector is shown in the middle part of Figure 9 (labeled "Donor DNA") with a bold black line. Using a normal fragment as the donor DNA not only makes it indistinguishable from DNA repaired by knock-in, but also poses the problem of the target sequence of the multiple guide RNA cleaving the donor DNA. Therefore, as shown in the lower center of Figure 8, the donor DNA was designed to contain four artificial mutations (C, A, A, C) within the donor sequence without changing the amino acid sequence (the mutation is indicated by "4m" in the middle part of Figure 9).

[0183] The sequence from the artificial sequence to the PKU mutant sequence is shown in Figure 10. In Figure 10, from the top to bottom, the amino acid sequence of the PKU mouse (SEQ ID NO: 13), the nucleotide sequence of the PKU mouse (SEQ ID NO: 14), the nucleotide sequence of the donor (SEQ ID NO: 15), and the amino acid sequence of the donor (SEQ ID NO: 16) are shown. AvrII and StuI represent the introduced restriction enzyme sites. Amino acid sequence of the PKU mouse: FLGGLAFRVS (SEQ ID NO: 13) Nucleotide sequence of the PKU mouse: TTCTTGGGTGGCCTGGCCTTCCGAGTCTcC (SEQ ID NO: 14) Nucleotide sequence of the donor: TTCCTAGGAGGCCTAGCCTTCCGAGTCTTC (SEQ ID NO: 15) Amino acid sequence of the donor: FLGGLAFRVF (SEQ ID NO: 16)

[0184] This artificial mutation contains AvrII and StuI restriction sites, facilitating detection of cellular DNA successfully repaired by knock-in. Furthermore, these four bases are specific to the donor DNA and are not complementary to the mouse genome, allowing for the design of PCR primers that detect only the donor DNA. Furthermore, two of the four bases (C and A) overlap with the 20-base target sequence of the therapeutic guide RNA, preventing the guide RNA from cleaving the donor DNA.

[0185] Hepa1-6 cells were infected with the g(6+2) vector and either the Cas9 expression vector or the Cas9 nickase expression vector at a total multiplicity of infection (MOI) of 200. Three days later, total cellular DNA was extracted and analyzed by PCR. PCR was then performed using primers designed on both sides of the donor sequence. The full-length PCR fragment (over 4 kb) was digested with StuI (to distinguish KI) and subjected to electrophoresis to quantify knock-in efficiency. The results are shown in Figure 11. The nucleotide sequences of the upstream primer 140F and downstream primer 193R are shown below. Upstream primer 140F: ACAATATGAACCAACAAGTACCTCC (SEQ ID NO: 17) Downstream primer 193R: CACAGGACAGCCTCATAGCTTGTCC (SEQ ID NO: 18)

[0186] Because StuI is introduced by knock-in, the intensity of the band resulting from its cleavage (right half of Figure 11) indicates the efficiency of knock-in. The quantification results are shown in Figure 11. The numbers indicate the co-infection ratio; for example, 150:50 indicates an MOI of 150 for the g(6+2) vector and an MOI of 50 for the Cas9 vector or Cas9 nickase vector. When native Cas9 was used, the intensity of the two approximately 2 kb bands (indicated by the arrows and box on the right) resulting from full-length DNA cleavage by StuI was compared to the uncleaved band (very intense upper band), resulting in a knock-in efficiency of 3% to 4% (Figure 11, lanes 10-12). The approximately 3.5 kb and approximately 1.5 kb bands (indicated by *) are nonspecific bands also observed in the control 1w1 vector (empty vector). On the other hand, when Cas9 nickase was used, a knock-in efficiency of approximately 1% was obtained, although it was lower than that of Cas9 (Figure 11, lane 13). Furthermore, when Cas9 was used, numerous bands were observed below the full length of 4 kb (Figure 11, lanes 1-3), suggesting that various deletions and rearrangements occurred near the cleavage site. However, when Cas9 nickase was used, such bands were hardly observed. Based on the above, knock-in using Cas9 nickase was observed even in point mutation repair, and its efficiency was thought to be about one-quarter that of the original Cas9. It also suggested the possibility of less off-target cleavage near the target site.

[0187] In the above, it was an unexpected result that the knock-in efficiency did not change significantly whether double-strand cleavage by the original Cas9 or nick formation by Cas9 nickase was used (approximately 4% with Cas9 and approximately 1-2% with Cas9 nickase). The larger the knock-in fragment, the lower the knock-in efficiency. However, in the expression unit knock-in, a DNA fragment as large as 2.3 kb was introduced by knock-in, and the presence of a sequence that inhibits knock-in due to secondary structure around the PKU mutation has been suggested, so the knock-in efficiency of this expression unit is thought to be unexpectedly high.

[0188] Example 6: Treatment experiment of phenylketonuria (PKU) model mice by knocking in the entire expression unit using Cas9 nickase For the purpose of knock-in treatment of PKU model mice, the inventors constructed a knock-in vector AxYPah carrying a unit that expresses a normal human Pah gene from the CB promoter, as an example of the Yakushi vector shown in Figure 2. The experimental scheme is shown in Figure 13A.

[0189] This vector incorporates the entire therapeutic Pah expression unit and a Cypor shRNA expression unit for Cypor selection into the target site in the Rosa26 safe harbor region by knock-in. If knock-in therapy using the nickase expression vector is successful, the resulting mouse (called Nickey mouse) will be a groundbreaking mouse model that avoids off-target cleavage and chromosome rearrangements due to on-target disruption, which currently hinder the practical application of genome editing therapy, and offers the potential for long-term, safe therapy, including lifelong cure.

[0190] The effectiveness of treatment in model mice can be confirmed by observing darkening of the coat color and a decrease in blood phenylalanine levels. Decreased activity of phenylalanine hydroxylase (PAH), encoded by the Pah gene, leads to the accumulation of phenylalanine, and the amount of melanin decreases due to a decrease in tyrosine, which is downstream in the metabolic pathway. Therefore, although the model mice are C57BL / 6, which are naturally black, the coat color of the model mice is grayish-brown due to hypomelanin. If treatment is successful, the metabolic system will normalize, and the coat color of the model mice will change to black, confirming the effectiveness of the treatment. Hypomelanin is also a condition in humans, and patients are pale-skinned.

[0191] PKU is an autosomal recessive genetic disease. 8 rVT / animal), Cas9-expressing AxCBCas9 or nickase-expressing AxCBNC9 (both 2x10 8The mice were intravenously injected with vanillin at 100 mg / kg body weight via the facial vein along with rVT (per mouse). To increase knock-in efficiency, 100 mg / kg vanillin was then administered subcutaneously for 5 days after birth. Furthermore, intraperitoneal administration of acetaminophen (APAP) was initiated from 7 weeks of age.

[0192] Mice co-infected with AxCBCas9 expressing the native Cas9 gene showed darkening of coat color at 15 weeks of age and complete darkening of the entire body at 27 weeks of age. Furthermore, blood phenylalanine levels began to decrease at 20 weeks of age, confirming the therapeutic effect. Notably, mice co-infected with nickase-expressing AdV showed darkening of coat color at 20 weeks of age, later than those co-infected with Cas9. Blood phenylalanine levels began to decrease at 26 weeks of age, and complete darkening of the entire body was observed at 27 weeks of age. Further observations are ongoing. Therefore, the therapeutic efficacy of a safe nickase knock-in vector confirmed in this experiment is a groundbreaking achievement. It is also noteworthy that these results were obtained with just a single injection of the therapeutic vector.

[0193] Figure 13B shows the results of serial measurements of blood phenylalanine in model mice. When co-administered with the Cas9-expressing AxCBCas9 vector, blood levels at 26 weeks of age were reduced to approximately one-third, to approximately 500 μM, in all three mice (#3, #4, #5). A blood phenylalanine level of approximately 600 μM or less is classified as mild hyperphenylalaninemia. Therefore, this reduction in blood levels is sufficient to improve symptoms in patients. On the other hand, when co-administered with the nickase-expressing AdV, blood levels in one mouse (#14) were reduced by half, to 700 μM. This effect is also considered therapeutically beneficial. A clear reduction was also observed in the other two mice (#23 and #24).

[0194] Figure 13C shows photographs of these mice at 27 weeks of age. The coat color of the mouse (#2), which was not administered acetaminophen (APAP) and did not undergo Cypor selection for the knock-in cells, was grayish-brown (as was the case with the model mice not administered with the vector). However, when AxCBCas9, which expresses the original Cas9 gene, was co-administered, the entire body was observed to be black. However, the change in coat color was not uniform. For example, in mouse #5, the middle of the back was dark black (indicated by the square), but the tail appeared brownish-gray. Since the black color progresses from the head to the tail, it is likely that the entire body will become black over time.

[0195] On the other hand, when AxCBNC9 expressing nickase was co-administered, darkening of coat color was observed in mice #23 and #24, except for #14, which showed a significant decrease in blood phenylalanine. Furthermore, the darkened areas (indicated by squares) were only a small part of the whole, and the darkening appears to progress from the head and upper back to the tail. The darkening of coat color in these model mice clearly demonstrates that the Yakushi vector improves metabolism over the long term, suggesting that cDNA replacement may be a safe, lifelong cure for many genetic diseases.

Claims

1. A recombinant adenovirus vector comprising a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA is double-stranded and has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on the genome of a cell, and a replacement nucleotide sequence between the upstream and downstream arms, and the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and regions upstream and downstream of the target site and further outside thereof, and is capable of introducing a nick near the target sequence, and the donor DNA has the target sequence in one or more regions selected from the group consisting of the replacement nucleotide sequence, the upstream arm, the downstream arm, and further outside thereof, thereby allowing a nick to be generated in the donor DNA by the guide RNA {when the guide RNA targets the target site on the genome as a target sequence, the replacement nucleotide sequence may be a sequence that is not cleaved by the guide RNA}, This allows a recombinant adenovirus vector to introduce a nick or double nicking into the donor DNA, but without introducing a double-strand break into the genome, and to replace the target site on the genome with a replacement nucleotide sequence.

2. The recombinant adenovirus vector according to claim 1, wherein the target site is the full length or a portion of a gene having a genetic mutation and the resulting abnormality, and the replacement nucleotide sequence is a region corresponding to the full length or a portion of the gene having normal function.

3. A recombinant adenovirus vector comprising a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA has upstream and downstream arms capable of homologous recombination with the upstream and downstream of a target site on the genome of a cell, and has an insertion nucleotide sequence between the upstream and downstream arms, wherein the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and regions upstream and downstream of the target site, and further outside thereof, and is capable of introducing a nick near the target sequence, and wherein the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the insertion nucleotide sequence, the upstream arm, the downstream arm, and further outside thereof, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets the target site on the genome, the insertion nucleotide sequence may be a sequence that is not cleaved by the guide RNA}, thereby introducing a nick or double nicking into the donor DNA but without introducing a double-strand break into the genome, and allowing the insertion nucleotide sequence to be inserted into the target site.

4. A recombinant adenovirus vector according to any one of claims 1 to 3, which is capable of generating a nick in the donor DNA at either (i) a position further upstream of its upstream arm or (ii) a position further downstream of its downstream arm, and double-nicking at the other position.

5. A recombinant adenoviral vector according to any one of claims 1 to 4, wherein the nucleotide sequence for insertion or replacement on the donor DNA has a length of 1 kb to 4 kb.

6. A recombinant adenoviral vector according to any one of claims 1 to 5, wherein the upstream arm and downstream arm on the donor DNA are each 1 kb to 3 kb.

7. A method for replacing a target sequence on a cell's genome with a replacement nucleotide sequence, comprising: providing an isolated cell; and introducing a recombinant adenovirus vector into the cell, wherein the recombinant adenovirus vector comprises a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA, wherein the donor DNA has an upstream arm and a downstream arm capable of homologous recombination with the upstream and downstream of a target site on the cell's genome, and a replacement nucleotide sequence between the upstream and downstream arms, wherein the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and regions upstream and downstream of the target site and further outside thereof, and is capable of introducing a nick near the target sequence, and wherein the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the replacement nucleotide sequence, the upstream arm, the downstream arm, and further outside thereof, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets the target site on the genome as a target sequence, the replacement nucleotide sequence may be a sequence that is not cleaved by the guide RNA}, This method introduces a nick or double nicking into the donor DNA, but without introducing a double-strand break into the genome, and the target site is replaced with the replacement nucleotide sequence.

8. A method for knocking in an insertion nucleotide sequence into a cell's genome, comprising: providing an isolated cell; and introducing a recombinant adenovirus vector into the cell; the recombinant adenovirus vector comprises a gene encoding a Cas nickase, a gene encoding a guide RNA, and donor DNA; the donor DNA has upstream and downstream arms capable of homologous recombination with regions upstream and downstream of a target site on the cell's genome, and has an insertion nucleotide sequence between the upstream and downstream arms; the guide RNA targets one or more regions selected from the group consisting of the target site on the genome, and regions upstream and downstream of the target site and further outside thereof, and is capable of introducing a nick near the target sequence; the donor DNA has a target sequence for the guide RNA in one or more regions selected from the group consisting of the insertion nucleotide sequence, the upstream and downstream arms, and further outside thereof, thereby allowing a nick to be generated by the guide RNA {when the guide RNA targets the target site on the genome, the insertion nucleotide sequence may be a sequence that is not cleaved by the guide RNA}; This method introduces a nick or double nicking into the donor DNA, but without introducing a double-strand break into the genome, and the insertion nucleotide sequence is knocked in at the target site.

9. The method according to claim 8, wherein the donor DNA can be nicked at one of (i) the upstream arm further upstream and (ii) the downstream arm further downstream, and double-nicked at the other.

10. The method of any one of claims 7 to 9, wherein the inserted or replaced nucleotide sequence on the donor DNA has a length of 1 kb to 3 kb.

11. The method of any one of claims 7 to 10, wherein the upstream arm and the downstream arm on the donor DNA are each 1 kb to 2 kb.

12. A composition for use in the method of any one of claims 7 to 11, comprising: (i) a recombinant adenoviral vector comprising the donor DNA, used in combination with a recombinant adenoviral vector comprising a gene encoding a Cas nickase and a gene encoding a guide RNA targeting the target sequence; (ii) a recombinant adenoviral vector comprising a gene encoding a Cas nickase and a gene encoding a guide RNA targeting the target sequence, used in combination with the recombinant adenoviral vector comprising the donor DNA; (iii) a recombinant adenoviral vector comprising the donor DNA and a gene encoding a guide RNA targeting the target sequence, used in combination with a recombinant adenoviral vector comprising the gene encoding a Cas nickase; or (iv) a recombinant adenoviral vector comprising a gene encoding a Cas nickase, used in combination with a recombinant adenoviral vector comprising the donor DNA and a gene encoding a guide RNA targeting the target sequence.

Citation Information

Patent Citations

  • Delivery, engineering and optimization of systems, methods and compositions for sequence engineering and therapeutic applications

    JP2016501531A

  • Genome editing method

    JP2018011525A