Naturally competent vibrio natriegens engineered as a tool for scalable synthetic biology

Modified Vibrio natriegens strains with specific genetic disruptions and a Vibrio cholerae tfoX gene insertion provide improved transformation competence, addressing the lack of advancement in E. coli strains since the 1980s, enabling efficient and scalable transformation protocols.

WO2026036060A1PCT designated stage Publication Date: 2026-02-12CORNELL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/041312
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-09
Filing Date
2025-08-08
Publication Date
2026-02-12

AI Technical Summary

Technical Problem

Strains of competent E. coli used for transformation have not significantly changed since the 1980s, necessitating the development of alternative bacteria with improved transformation competence.

Method used

Modified Vibrio natriegens strains with a disruption of the V. natriegens dns gene, genomic insertion of a Vibrio cholerae tfoX gene, and disruption of a heterologous LacI gene, enabling plasmid transformation competence at room temperature without media exchange or electrical stimulation.

Benefits of technology

The modified Vibrio natriegens exhibit enhanced plasmid transformation efficiency, remaining competent after freeze-thaw cycles and facilitating rapid, scalable transformation protocols using minimal media.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000033_0001
    Figure IMGF000033_0001
  • Figure IMGF000034_0001
    Figure IMGF000034_0001
  • Figure IMGF000034_0002
    Figure IMGF000034_0002
Patent Text Reader

Abstract

Provided are modified Vibrio natriegens (V. natriegens ) that are plasmid transformation competent at room temperature. The modified V. natriegens are characterized by having a disruption of V. natriegens dns gene, a genomic insertion of a Vibrio cholerae tfoX gene, and a disruption of a heterologous LacI gene. The combination of the disruption of V. natriegens dns gene, the genomic insertion of a Vibrio cholerae tfoX gene, and the disruption of the heterologous LacI gene provides for enhanced plasmid transformation efficiency, relative to plasmid transformation efficiency using modified V. natriegens that include the disruption of the V. natriegens dns gene and an introduced a Vibrio cholerae tfoX gene, but not the disruption of the heterologous LacI gene. Cell culture media used to generate the modified bacteria are provided. Kits that include the modified bacteria or the cell culture media are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.: 018617.01861 NATURALLY COMPETENT VIBRIO NATRIEGENS ENGINEERED AS A TOOL FOR SCALABLE SYNTHETIC BIOLOGY CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No.63 / 681,621, filed August 9, 2024, the entire disclosure of which is hereby incorporated herein by reference. FIELD This disclosure relates modified cells and cell culture media. The modified cells exhibit improved transformation efficiency, related to unmodified or differently modified cells. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under contract no. DE- AR0001608 awarded by the Advanced Research Projects Agency – Energy, U.S. Department of Energy. The government has certain rights in the invention. SEQUENCE LISTING The instant application contains a Sequence Listing submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy was created on August 7, 2025, is named “018617_01861_ST26.xml” and is 63,616 bytes in size. BACKGROUND Despite dramatic changes in virtually every other aspect of synthetic biology workflows, strains of competent E. coli used for transformation have not significantly changed since the 1980s. There is thus and ongoing and unmet need for alternative types of bacteria cells that are modified to exhibit improved transformation competence. The present disclosure is pertinent to this need. BRIEF SUMMARY This disclosure provides modified Vibrio natriegens (V. natriegens ) that are plasmid transformation competent at room temperature. The modified V. natriegens comprise a disruption of V. natriegens dns gene, a genomic insertion of a Vibrio cholerae tfoX gene, and a disruption of a heterologous LacI gene. The disclosure demonstrates that the combination of the disruption of V. natriegens dns gene, the genomic insertion of a Vibrio cholerae tfoX gene, and the disruption of the heterologous LacI gene provides for enhanced plasmid transformation efficiency, relative to plasmid transformation efficiency using modified V. natriegens that include the disruption of the V. natriegens dns gene and an introduced a Vibrio cholerae tfoX gene, but not the disruption of the heterologous LacI gene. In examples, the described modified V. natriegens remain plasmid transformation competent after at least one freeze-thaw cycle. In an example, disruption of the heterologous lacI sequence comprises a truncation. In a non-limiting example, the truncation is such that only the first 1016 bases of an E. coli lacI gene are present. A representative and non-limiting example of a modified V. natriegens of this disclosure has a genome that comprises a sequence that is at least 95% identical to SEQ ID NO:1. The sequence that is at least 95% identical to SEQ ID NO:1 may be homologously recombined into the genome. In examples, the disclosure provides described modified V. natriegens of which are present in a frozen state. In examples, the disclosure provides described modified V. natriegens in a culture media that comprises 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potassium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride, at a pH of approximately 7.4. The disclosure provides a method comprising introducing into a plurality of modified V. natriegens at least one circular DNA, at least one linear DNA, or a combination thereof, such that the circular DNA, the linear DNA, or the combination thereof is / are introduced into the bacteria. In an example, two circular DNAs are introduced into the described bacteria. In an example, at least one circular DNA and at least one linear DNA are introduced into the bacteria. In examples, the DNA is introduced into the bacteria without media exchange or media addition, and without using electrical stimulation, heat shock, or chemical transformation. The disclosure includes a kit comprising described modified Vibrio natriegens bacteria and at least one sealed or sealable container that contains the bacteria. The kit may include printed material that provides instructions for culturing and / or transforming the modified bacteria. In an example, the modified bacteria that are provided with the kit may be frozen. In another aspect, the disclosure provides culture media that comprises, consists essentially of, or consists of 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potassium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride, at a pH of approximately 7.4, Kits that comprise the culture media or reagents for making the culture media are also provided. In an example, the disclosure provides method of making modified V. natriegens that are plasmid transformation competent at room temperature. The method comprises homologously recombining into a chromosome of V. natriegens a DNA sequence comprising a sequence that is at least 95% identical to SEQ ID NO:1. The disclosure also provides an isolated polynucleotide, optionally provided as a component of a kit, wherein the isolated polynucleotide comprises a sequence that is at least 95% identical to SEQ ID NO:1. In examples, the isolated polynucleotide may be circular or linear. BRIEF DESCRIPTION OF FIGURES Fig.1. Vibrio natriegens genomically engineered for natural competence is transformable via direct addition of plasmid DNA to cells growing in a new minimal competence media (MCM). (A) Natural plasmid transformation (NPT) is enabled by genomic expression of tfoX from V. cholerae, which allows for plasmid transformation without media exchange or addition, electroporation / heat shock, or a separate recovery step as is typical for conventional chemical or electrochemical competent cells (B). (C) We have developed two protocols, a High Efficiency protocol (HE, 106cfu / µg), which requires only the use of an incubator and a deep freezer; and a Zero Capital protocol (104cfu / µg), which requires no capital equipment at all and can be done entirely at room temperature. Because cells are transformed in their growth media, with no further concentration or media exchange, either protocol can be easily scaled, and the high efficiency transformation can be completed with as little as 50 minutes of hands-on time when started with frozen NPT competent cells. Fig.2. Minimal competence media (MCM) derived from essential seawater components plus acetate is used to both grow out and freeze genomically engineered V. natriegens strain NC1 in a state of natural competence. In order to simplify the protocol for eventual directed evolution and automated cloning applications, we developed this singular media which is used to create and transform naturally competent cells. (A,B) Using our strain Vn NC1 engineered to contain heterologous V. cholerae tfoX, we observe that transformation frequency (transformed cfus / untransformed viable cfus) is insensitive to acetate and sodium concentration over a wide range of concentrations, but overall growth (number of viable cfus in 50 µL) is maximized close to 3 mM acetate and 350 mM sodium. (C) Transformation is pH dependent and robust in pH ranging from 7 to 8, but falls to zero at lower pH despite growth at pH as low as 6 sufficient to detect natural transformation (Fig.8). In order to center pH in an area with robust transformation and cfu yield, MCM is used at a final pH of 7.4, buffered by HEPES, for all subsequent experiments. (D,E) Transformation frequency is relatively insensitive to the period of time that cells are grown out statically prior to transformation, but the overall number of transformed cfus increases as the cellsgrow in MCM, and cells achieve a much higher maximal density under 30◦C growth. In allof the above figures, cells are flash frozen in glycerol after outgrowth, thawed, incubatedstatically with 25 ng of DNA for 30 minutes at 30◦C for transformation, and recovered inLBv2 with shaking at 37◦C for 1 hour.Fig.3. Optimization of transformation of engineered strain Vn NC1 shows that NPT is rapid and remains robust. (A) Given a limit of 90 minutes of hands-on time, allowing cells to incubate for 90 minutes in MCM yields a higher transformation frequency than a 30 minute incubation followed by addition of fresh media (LBv2, recovery media (RM)(1), or MCM) and 60 minutes of shaking incubation. Because cells are metabolically functional during the active transformation process, they quickly begin to express antibiotic resistance genes, eliminating the value of a separate recovery step. The performance of subsequent experiments are compared to the no recovery condition (dashed orange line). (B,C) Cells can be thawed at room temperature (RT Melt) with no loss in efficiency, and prior to DNA addition can even be vortexed at full speed for up to a minute with minimal losses. (D) Cells lose an order of magnitude in transformation efficiency if shaken during incubation rather than being left to take up and express DNA statically. E) We consider full immediate transformation without flash freezing at 30 and 20◦C (starting with cells grown out in 30 or 20◦C, respectively, and proceeding directly afterthe prior outgrowth step to transformation), corresponding to High Efficiency (HE) and Zero Capital (0Cap) protocols. Notably, cells consistently lose approximately an order of magnitude in transformation frequency if they are not flash frozen after they are generated. (F) In 350 µL of unconcentrated cells in media, yield (transformed cfu per µg of added plasmid DNA) is optimized at approximately 25 ng of added pDS5.30 DNA. Transformation yield with pUC19 is lower. (G) In all temperature conditions tested, optimal transformation efficiency and yield is reached within 45 minutes of incubation. While eventual transformation yield is sensitive to initial growth temperatures (Fig.2D,E), incubation withplasmid DNA is accomplished efficiently and comparably from 20-37◦C in a window up to3 hours, with overall yield falling off slightly after that period.25 ng of plasmid DNA is used for experiments in all subplots except F. Fig.4. NPT (Natural Plasmid Transformation) of genomically engineered V. natriegens produces culturable single colonies within a standard workday, providing for rapid cloning. (A) A rapid, high efficiency protocol (requiring only an incubator and deep freezer), V. natriegens transformation and growth is so fast that single colonies are visible (≈ 0.7 mm) and can be picked within a standard workday when transformation is done first thing in the morning. (B) Plasmids miniprepped from V. natriegens are transformable back into V. natriegens with the same yield as those produced from E. coli DH5α. (C) Arbitrary, common molecular biology reactions (a ligation via Kinase, Ligase, and Dpn1 (KLD), deleting GFP expression from pDS5.30; and a Gibson assembly, inserting GFP expression into a pUC19 backbone) can be transformed directly into the natural competence strain of V. natriegens without any additional cleaning steps, yielding 11,000 and 140 transformants, respectively, from 2 µL of reaction product. Fig.5. Cotransformation of plasmids and linear DNA enables rapid scarless and markerless genomic edits of genomically engineered V. natriegens. (A) As in MuGENT (Dalia T, et al.2017. ACS Synth Biol.6(9):1650–1655. doi: 10.1021 / acssynbio.7b00116), unselected genomic edits can be paired with selectable markers due to a high rate of natural competence co-transformation. By using a plasmid to convey selection, the resulting strain can be easily cured of the plasmid without leaving a selectable marker behind in the genome. (B) We use this co-transformation to remove camR from the strain used throughout this study and the resulting strain Vn NC7 retains natural competence. Fig.6: Schematics depicting the contextual arrangement of Vc tfoX insertion. All iterations in this study were inserted at the same site in V. natriegens chromosome 1, downstream of the gene glpD and upstream of zntB. (A,B,C) 3 working designs for genomic Vc tfoX expression derived from the expression sequence in pST 140 LVL2 cam. However, none of these exhibit inducibility of natural competence as tfoX expression is constitutively on, as could be expected given the defective lacI sequences. See Fig.15. (D,E,F) 4 failed designs for genomic expression of tfoX. In Vn NC3, the sequence which is inducible in PMMB67EH-tfoX is inserted into the same site, but no NPT is observed even under IPTG induction. In Vn NC4, we sought to embrace the constitutive nature of Vn NC1 and simply delete the broken lacI sequence, but the resulting strain exhibited no NPT. A subsequent two variants (Vn NC5, NC6) based on the strong P23 promoter validated in the V. natriegens genome could not be inserted into the genome successfully. Both versions use the same P23 promoter but in Vn NC6 an excessive second ribosomal binding site is deleted. All sequences for plasmids used to generate tDNA for genomic editing are included in Supplementary Information. Fig.7: Strain Vn NC1 exhibits NPT when transformed using the protocol described in Dalia et al. Here, we use Vn NC1 in the protocol as described in Dalia et al. (Dalia T, et al.2017. ACS Synth Biol.6(9):1650–1655. doi: 10.1021 / acssynbio.7b00116) in lieu of MCM and our associated protocol. When NC1 is grown out in rich LBv2 media and then diluted into artificial seawater in the presence of transforming plasmid pDS5.30, we observe NPT at a frequency comparable to our protocol without flash freezing (Fig.3E). As we observe with our protocol (Fig.3A), use of a secondary recovery step does not increase the frequency of transformation. NPT frequency is shown relative to the no recovery condition used as a benchmark established in Fig.3 (dashed orange line). Fig.8: Total survivorship of Vn NC1 during transformation is slightly increased under higher pH in HEPES buffer. Total number of unselected colony forming units in 50 µL of MCM after transformation, as a function of pH, buffered with either PIPES or HEPES, as indicated. V. natriegens readily grows in MCM from at least pH 6.12 to 7.99. Despite this, NPT is pH-dependent (Fig.2C), occurring at a reduced frequency for lower pH, and is undetectable at pH 6.12. Fig.9: The addition of glycerol in immediate transformation of Vn NC1 after 30◦C outgrowth does not restore the transformation frequency observed in the case of flash freezing. This indicates that the addition of glycerol is not the driver of increased transformation frequency. NPT frequency is shown relative to the no recovery condition used as a benchmark established in Fig.3 (dashed orange line). Fig.10: Pyruvate is an effective alternative carbon / energy source in lieu of acetate. Under immediate transformation after outgrowth (with no flash freezing and -80◦C storage), pyruvate is the next-best carbon / energy source in lieu of acetate for driving natural transformation of Vn NC1 using MCM. All carbon / energy sources in MCM are at 3 mM. Additionally, a mixture of 10% LBv2 and 90% Instant Ocean Media produces measurable transformation. NPT frequency is shown relative to the no recovery condition used as a benchmark established in Fig.3 (dashed orange line). Fig.11: Vn NC1 grown out in Pyruvate MCM and 10% LBv2 can be frozen and preserved in a natural competence state. As in the primary experiments with acetate-based MCM, freezing and -80◦C storage prior to transformation enhances transformation in pyruvate MCM and 10% LBv2 (compare with Fig. 10). NPT frequency is shown relative to the no recovery condition used as a benchmark established in Fig. 3 (dashed orange line). Fig.12: Vn NC8 remains in a constitutive natural competence state despite attempted correction of the lacI sequence. This is borne out by subsequent RT-qPCR measurements of tfoX expression levels (Fig. 15) and reflective of a novel 233 bp deletion in lacI. NPT frequency is shown relative to the no recovery condition used as a benchmark established in Fig. 3 (dashed orange line). Fig.13: IPTG induction of pMMB67EH-tfoX achieves the same frequency of NPT as strain NC1. In this experiment, we use the same high efficiency protocol (with flash freezing) that we developed for our strain Vn NC1. There does not appear to be an increase in NPT frequency, despite an additional order of magnitude increase in Vc tfoX mRNA expression levels (Fig.15), indicating that there could be a ceiling to tfoX expression efficacy. As discussed in the main text, however, IPTG is only 50 µM, half of what is typically used for induction. NPT frequency is shown relative to the no recovery condition used as a benchmark established in Fig.3 (dashed orange line). Fig.14: Despite the lack of inducibility of strain Vn NC8, it is sensitive to addition of IPTG with falling total survival in MCM. While frequency of NPT stays largely constant (Fig. 12), the yield (A) falls as a result of falling total survival (B). Since transcriptional expression of tfoX (Fig.15) remains constant, and we have been unsuccessful in our attempts to create a version with the correct lacI sequence (Supplementary Note S2), it is unclear what the mechanism for this toxicity may be. Fig.15: RT-qPCR establishes transcriptional upper and lower bounds for Vc tfoX expression necessary to trigger NPT in V. natriegens. (A) Induction of strain ∆dns containing plasmid pMMB67EH-tfoX (Dalia T, et al.2017. ACS Synth Biol.6(9):1650– 1655. doi: 10.1021 / acssynbio.7b00116) exhibits IPTG- inducible Vc tfoX expression, as expected. Further, while leaked tfoX transcripts are measured, they appear to be tolerated as no leaky transformation in the - IPTG condition is observed (Fig.13). (B,C) Constitutive expression of tfoX mRNA from strain NC1 is higher than that of NC7. (D) Corresponding to the lack of IPTG inducibility shown in Fig.12, mRNA production from the Ptac promoter in NC8 remains insensitive to the addition of IPTG. In all RT- qPCR experiments in this figure, mRNA is extracted from cells grown out in MCM as they would prior to the addition of transforming DNA. Measured tfoX is normalized relative to expression of genomic gyrB mRNA expression. Fig.16. Graph showing that the entire tfoX / lacI (broken) / camR insertion present in strain V. natriegens NC1 can be ported to a plasmid, and when grown under competence-inducing conditions in MCM, makes the wild type transformable by a second plasmid (pDS5.30) but with reduced frequency relative to the NC1 strain. Supplementary Notes are referred to herein as “Note S” followed by the corresponding number. DETAILED DESCRIPTION Unless defined otherwise herein, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Every numerical range given throughout this specification includes its upper and lower values, as well as every narrower numerical range that falls within it, as if such narrower numerical ranges were all expressly written herein. Although relevant subject matter will be described in terms of certain examples, other examples, including examples that do not provide all of the benefits and features set forth herein, are also within the scope of this disclosure. The steps of the methods described in the various examples disclosed herein are sufficient to carry out the methods of the present invention. Thus, in an example, the method consists essentially of a combination of the steps of the methods disclosed herein. In another example, the method consists of such steps. As used in the specification and the appended claims, the singular forms “a” "and” and “the" include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another example includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent “about” or “approximately” it will be understood that the particular value forms another example. The term “about” and “approximately” in relation to a numerical value encompass variations of + / -10%, + / - 5%, or + / - 1%. This disclosure includes all materials and reagents, reagent combinations, cell culture components, times, temperatures, cells, cell media, and competence parameters, as described herein. The disclosure includes all steps individually and in combination, including but not necessarily performing all some or described steps sequentially. The disclosure includes all cells produced by the described methods, and articles of manufacture such as kits that include the described modified cells, the cell culture media, and any combination thereof. The disclosure includes all polynucleotide sequences described herein, all polynucleotide sequences that are at least 95% identical to the expressly described sequences, and all polynucleotide sequences that are complementary to such sequences. Aspects of this disclosure comprise V. natriegens strains edited for natural competency, use of these strains to develop a pared-down media for growth, preservation, and transformation of cells, and a protocol for creating and using these cells which optionally uses no capital equipment. Previous biotechnological usage of V. cholerae tfoX expression in V. natriegens is predicated on use of a plasmid to express it (Dalia TN, et al.2017. Multiplex genome editing by natural transformation (MuGENT) for synthetic biology in Vibrio natriegens. ACS Synth Biol.6(9):1650–1655. doi: 10.1021 / acssynbio.7b00116; Stukenberg D, Hoff J, Faber A, Becker A.2022. NT-CRISPR, combining natural transformation and CRISPR-Cas9 counterselection for markerless and scarless genome editing in Vibrio natriegens. Commun Biol.5(1):1–13. ISSN 2399-3642. doi: 10.1038 / s42003-022-03150-0). This presents an obstacle when using V. natriegens for cloning of other plasmids. The present disclosure provides in part a V. cholerae tfoX gene that is integrated into the bacteria genome. The disclosure also provides a minimal media which supports both growth and a state of natural competence which is maintained for tens of hours. The disclosure facilitates production of modified cells which transformed in this singular media, without any exchange, concentration, or separate media recovery, enabling the entire process to be able to be completed with no capital equipment, or enhanced with only the use of an incubator and deep freezer (Fig.1A), which is contrasted with “typical” preparations of chemical or electrochemical competent cells (Fig.1B). The engineered naturally competent cells can be frozen and thawed for later use, which without intending to be bound by any particular theory, is believed to be the first demonstration of this property. The disclosure demonstrates that NPT is practically useful, illustrated by transformation of plasmids (Fig.1C), representative cloning reactions, and co-transformation of plasmid and linear PCR product for genomic editing. The disclosure also demonstrates how the rapidity of both NPT and V. natriegens growth can be harnessed to perform transformation and then isolation of single colonies by the end of a typical workday (e.g., approximately 8 hours). The disclosure provides a useful third way of plasmid transformation, joining chemical and electrochemical competency. In an example, the disclosure provides modified V. natriegens that are transformation competent at room temperature, and as discussed herein, remain transformation competent after at least one freeze-thaw cycle. In examples, “transformation competent” and “plasmid transformation competent” mean a plasmid or linear DNA can be introduced and maintained in the described cells. In examples, room temperate is 20 - 22 degrees Celsius (68 to 72 degrees Fahrenheit). A freeze-thaw cycle means the V. natriegens were frozen and unfrozen at least one time. The modified V. natriegens comprise disruption of V. natriegens dns gene, a genomic insertion of a Vibrio cholerae tfoX gene, and a disruption of a heterologous LacI gene. The LacI gene is heterologous because V. natriegens do not include an endogenous LacI gene. In examples, the LacI gene is adapted from E. coli. The disclosure demonstrates that the combination of the disruption of V. natriegens dns gene, the genomic insertion of a Vibrio cholerae tfoX gene, and the disruption of the heterologous LacI gene, provides for enhanced plasmid transformation efficiency, relative to plasmid transformation efficiency using modified V. natriegens that include the disruption of the V. natriegens dns gene and an introduced a Vibrio cholerae tfoX gene, but not the disruption of the heterologous LacI gene. In examples, the disrupted LacI gene comprises a truncation. In an example, a deletion of approximately or precisely 233 bp is deleted from the LacI. In examples, a segment of the heterologous LacI gene comprises or consists of the first 1016 bps of an E. Coli LacI gene. In examples, a deleted segment of LacI includes a stop codon, wherein, had the deletion not been made, the stop codon would have been in the same open reading frame as an open reading frame that is immediately 5’ to the deletion. In an example, the deletion leaves an intact open reading frame that is immediately 5’ to the deletion, such that translation of an mRNA transcribed from a segment of the chromosome that spans the deletion site can continue for approximately or precisely 274 bp of the mRNA. In examples, the modified V. natriegens of this disclosure includes a chromosome comprising a segment as depicted in Fig.6 and designated as NC1, NC7, or NC8. In examples, the genome of the modified V. natriegens comprise a sequence that is at least 95% identical to SEQ ID NO:1, and wherein that sequence is homologously recombined into the V. natriegens genome. The disclosure includes modified V. natriegens provided in a frozen state. In examples, the modified V. natriegens may be provided in a dry form and may be reconstituted by addition of a suitable liquid. In examples, the disclosure provides a media that is suitable for use in making and / or using the described modified bacteria. In examples, the media comprises, consists essentially of, or consists of a liquid characterized by including approximately the following concentrations: 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potassium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride, which may be provided at a pH of approximately 7.4. In examples, the disclosure provides a method comprising introducing into a plurality of modified V. natriegens bacteria at least one circular DNA, at least one linear DNA, or a combination thereof, such that the circular DNA, the linear DNA, or the combination thereof is introduced into the bacteria. Various uses for introducing circular and linear DNA molecules (e.g., transformations) are discussed below. In examples, the disclosure provides a kit comprising modified V. natriegens bacteria as described herein. The kit further comprises at least one sealed or sealable container that contains the described bacteria. The kit may also include printed material that provides instructions for culturing and / or transforming the modified bacteria. The bacteria in the kit may be provided in a frozen state. In an example, the disclosure provides the culture media described above. In an example, the disclosure provides a kit comprising the culture media, or comprising a combination of reagents for making the culture media. In an example, the disclosure provides a method of making the described modified bacteria by homologous recombination of a DNA molecule into the genome of V. natriegens. DNA molecules that can be used are generally illustrated via the constructs shown in Fig.6 and designated as NC1, NC7, and NC8, and as illustrated by SEQ ID NO:1. In examples, a transformation protocol of this disclosure can be performed without electrical stimulation, such as electroporation, and without using a heat shock, and without using chemical transformation, the latter including well known reagents such as magnesium sulfate and / or and calcium chloride. As illustrated by the instant description and the accompanying figures, the utility of the described V. natriegens as a cloning tool extends beyond the V. natriegens research community. Low-capital transformation is expected to be useful for diverse users including physics or chemistry laboratories seeking to perform synthetic biology, low-resource environments such as classrooms and labs in the developing world or teaching institutions, International Genetically Engineered Machine (iGEM) teams, and in high-throughput robotic applications in directed evolution or highly parallelized cloning. The elimination of steps in previously available cloning workflows (using a shaker, keeping cells on ice, and related devices and methods that will be apparent to those skilled in the art) is expected to facilitate scaleup in robotic automation applications where these prior approached complicated cell handling. This disclosure demonstrates high-efficiency plasmid uptake in an engineered V. natriegens which contains genomically integrated expression of tfoX from Vibrio cholerae, which is expected to be a useful chassis for molecular and synthetic biology research. In examples, the disclosure demonstrates that representative strains as described herein can be used for efficient plasmid transformation, using a simplified shared media for competence expression, incubation, and recovery, enabling scalable, low-capital plasmid engineering using V. natriegens as a tool. The following Examples are intended to illustrate but not limit the disclosure. Genomic integration of heterologous tfoX creates a V. natriegens natural competence strain It has previously been demonstrated that Vibrio natriegens is naturally transformable via plasmid expression of heterologous tfoX derived from V. cholerae (Dalia TN, et al.2017. Multiplex genome editing by natural transformation (MuGENT) for synthetic biology in Vibrio natriegens. ACS Synth Biol.6(9):1650–1655. doi: 10.1021 / acssynbio.7b00116). Briefly, in the protocol described by Dalia et al., cells containing pMMB-tfoX (containing Isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible V. cholerae tfoX) are grown up overnight in rich media (LBv2 with IPTG to overexpress tfoX. This dense culture is then diluted 1:100 in an artificial seawater. Transforming DNA (tDNA) is added and cells are incubated statically for 5 hours (h) under these starvation conditions, prior to recovery in rich media and plating under selective conditions. While the reference of Dalia et al. demonstrate that linear PCR product containing long 3 kB homology arms can be used for genomic editing, in Simpson et al. (Simpson CA, Podicheti R, Rusch DB, Dalia AB, van Kessel JC. 2019. Diversity in natural transformation frequencies and regulation across Vibrio species. mBio.10(6):e02788–19. doi: 10.1128 / mBio.02788-19) it was reported that the same protocol can be used to trigger the uptake of full plasmids in V. natriegens. In initial tests, we confirmed that V. natriegens containing either pMMB67EH-tfoX (Simpson et al.) or pST_140_LVL2 cam (from Stukenberg et al. (Stukenberg D, Hoff J, Faber A, Becker A.2022. NT-CRISPR, combining natural transformation and CRISPR-Cas9 counterselection for markerless and scarless genome editing in Vibrio natriegens. Commun Biol.5(1):1–13. ISSN 2399-3642. doi: 10.1038 / s42003-022-03150-0), also containing Vc tfoX) showed that ectopic expression of Vc tfoX via a plasmid can efficiently drive transformation of a second plasmid via NPT. However, because these systems are predicated on plasmid expression of Vc tfoX, the present disclosure provides a genomically integrated version which is useful as a NPT-based host for molecular biology without interference from a second helper plasmid. Starting with the type strain (ATCC 14048), we used NT-CRISPR (Stukenberg, et al.) to perform a clean deletion of dns. NT-CRISPR uses the genomic editing process described in Dalia et al. in combination with a CRISPR counterselection which introduces double-strand breaks at the unedited genomic sequence in order to create scarless genomic edits. dns was removed because it encodes an extracellular nuclease which can reduce the efficacy of natural transformation and will likely degrade the quality of plasmid DNA. The disclosure includes creation of a strain with a genomically integrated copy of Vc tfoX. Producing such a strain proved to be unexpectedly difficult. We first created plasmid pDS5.29 (which contains IPTG-inducible Vc tfoX) to facilitate integration of linear tDNA containing Vc tfoX into the genome. Starting with the Δdns strain containing pDS5.29, we used the protocol from Dalia et al. as to simultaneously knock in camR, lacI, and Ptac- driven Vc tfoX in a genomic insertion derived from pST_140_LVL2 cam. This insertion, and all subsequent insertions described, are located on chromosome 1, downstream of the gene glpD and upstream of zntB (Fig.6). However, this approached only worked with extremely low efficiency, and we observed only one working version which retained natural competence after curation of pDS5.29, which contained a broken lacI sequence (IPTG inducibility of tfoX is lost) which we believe arose spontaneously during production of the tDNA template (Fig.6A). This strain with the broken lacI sequence lacking IPTG inducibility (Vn NC1) was validated to do plasmid transformation using the protocol described in Dalia et al. (Fig.7) and used exclusively in the development of a streamlined NPT protocol. A representative sequence used in homologous recombination in some examples of this disclosure is provided by SEQ ID NO:1. We attempted to restore IPTG inducibility using genomic editing with pDS5.29 as previously described but were not successful. We successfully inserted a different version of the lacI / Vc tfoX construct, this time derived from pMMB67EH-tfoX (Dalia TN, et al.2017. Multiplex genome editing by natural transformation (MuGENT) for synthetic biology in Vibrio natriegens. ACS Synth Biol.6(9):1650–1655. doi) at the same genomic site (Vn NC3, Fig.6D) but observed that NPT could not be induced with IPTG in this strain. We then chose to an approach that facilitates constitutive tfoX expression, deleting lacI in order to create Vn NC4 (Fig.6E), and two versions using the optimized strong constitutive genomic promoter P23 from Wu et al. (13) (Vn NC5, NC6, Fig.6F) in lieu of Ptac. However, Vn NC4 unexpectedly also did not exhibit NPT, and we were unable to create strains Vn NC5 and NC6 because the genomic edit could not be inserted, leading us to speculate that tfoX expression from the P23 promoter may be lethal. Therefore, we continued development using strain Vn NC1, although the IPTG induction issue is further discussed in herein. Development of Minimal Competence Media (MCM) enables preservation of naturally competent V. natriegens without media exchange We next sought to reduce the protocol described in Dalia et al. such that both outgrowth and transformation could be accomplished in the same media, specifically optimizing for plasmid transformation into a new Vn NC1 strain. As previously described, this protocol previously required outgrowth in a rich media followed by static incubation under dilute starvation conditions. In this disclosure, we demonstrate creation of a single media which could be used for many rounds of directed engineering, eliminating dilution of dense culture into seawater and making the process simpler to roboticize. Without intending to be bound by any particular interpretation, it is considered that by combining a suboptimal nutrient (acetate) which is proximal to carbon starvation with the essential components of the artificial seawater mixture (e.g., a culture media of the disclosure) it is possible to induce competence in a singular media. This mixture comprises essential salts and acetate minimal competence media, referred to herein as “MCM.” The disclosure unexpectedly demonstrates that cells can be readily preserved in the competence state in MCM via flash freezing and revived later for transformation. The disclosure includes the demonstration that cells could be used as a drop-in replacement for traditional chemically or electrochemically competent cells, transforming an arbitrary plasmid with a pBR322 origin and GFP (green fluorescent protein) expression (pDS5.30). In E. coli, growth on acetate as a sole carbon and energy source triggers broad catabolite derepression via the cAMP (cyclic adenosine monophosphate) receptor protein (CRP), which is associated with induction of natural competence in diverse species and is a condition needed for induction of natural competence in V. natriegens. MCM comprises, consists essentially of, or consists of a minimal set of essential ions and trace nutrients with a low concentration of acetate being used as the sole carbon and energy source. During initial experiments, it was determined that acetate concentration and pH were the predominant media determinants of the frequency at which NPT occurs. We did not find a substantial impact due to the concentration of any of the other media components, either in excess or in limiting conditions (including magnesium, nitrogen, phosphorus, and sulfur), nor was it beneficial to add any additional media components which are present at significant levels in natural seawater but inessential for growth (e.g. calcium). Transformation frequency is steady as a function of acetate concentration from 0.75 to 50 mM, but falls off at higher levels (Fig.2A). The total number of viable cfus are considered to be maximized at 3 mM acetate, and this is used for all subsequent described experiments. Similarly, a sodium concentration of 350 mM is used in all subsequent experiments as this is considered to maximize the total number of viable cells (Fig.2B). The natural transformation is highly sensitive to pH, however, as transformation becomes undetectable below pH 6.5 (Fig.2C), despite the fact that there are a sufficient number of untransformed cells to detect a transformation frequency as low as 10−6(Fig.8). pH is adjusted to 7.4 and buffered using HEPES to center it in the optimal range for all subsequent experiments. NPT is streamlined to create a transformation protocol with minimal hands-on and total runtime Briefly, single colonies of strain Vn NC1 are used to inoculate 20 mL of MCM, which is grown statically overnight for a period of time at either 30 or 20 °C. After this outgrowth period, 350 μL aliquots are taken, mixed with glycerol, and then flash frozen prior to storage and then subsequent transformation. To transform, cells are thawed, plasmid DNA is added, and cells are incubated statically with the plasmid DNA. In earlier experiments (Fig.2), cells are recovered at 37 °C in a shaking incubator in rich media for 1 h and then plated. Transformation is sensitive to the length and temperature of the outgrowth time, with frequency and cfu / μg yield maximized around 18–20 h for outgrowth at 30 °C (Fig.2D) and at approximately 24–40 h at 20 °C (Fig.2E). For the case of room temperature outgrowth, the state of natural competence is maintained for at least over a day after the maximal cell density is reached, without substantial loss in transformation frequency or yield after 50 h of outgrowth. In subsequent experiments, cells are collected at 18 h when grown at 30 °C, and at 24 h when grown at 20 °C. Shaking cells during this initial outgrowth stage destroys subsequent competence. This disclosure includes improving the protocol for transforming the cells (Fig.3), based on the demonstration that cells remain metabolically active during NPT, and many aspects of previously available transformation protocols can be omitted. In order to produce a transformation protocol which is competitive with chemical transformation in terms of hands- on time, the disclosure includes limiting the transformation time to approximately 1.5 h (which would be typical for a chemical transformation with a 30 min incubation and 1 h of recovery, neglecting the other steps). Given a time budget of 1.5 h, we were surprised to find that a 30 min static incubation followed by addition of a recovery media (LBv2, Recovery Media, or MCM) under typical recovery conditions (shaking at 37 °C) performs more poorly than simply incubating cells statically for 1.5 h with no recovery step at all and plating cells immediately after incubation (Fig.3A). We later tested and found that this is similar also for the original Dalia et al. protocol when applied to plasmid transformation, as omitting the recovery step after the 5-h incubation in seawater has a minimal impact on transformation frequency (Fig.7). Cells are insensitive to being melted at room temperature (Fig.3B) and are robust and can be vortexed for up to 60 s at maximum speed prior to the addition of plasmid DNA (Fig.3C). Shaking during incubation reduces transformation frequency by over an order of magnitude but does not eliminate it (Fig.3D). We next tested the impact of using cells immediately after overnight outgrowth, rather than after −80 °C storage, and found that freezing cells enhances transformation efficiency by almost an order of magnitude (Fig.3E). We grew out, incubated, and plated each experiment entirely at either 30 or 20 °C. The 20 °C protocol requires no capital equipment (representative examples of which include an Optical Density (OD) meter, centrifuge, incubator, shaker, freezer, ice machine, heat bath / electroporator, or deep freezer), which supports what is described herein as “0Cap Protocol” (Supplementary Note S4), while the 30 °C protocol only requires an incubator. The addition of glycerol prior to flash freezing is not the driver of increased transformation frequency, as the addition of glycerol has no impact when cells are immediately transformed after outgrowth (Fig.9). We improved the transformation frequency and yield (cfu per μg of added transforming plasmid DNA) as a function of the amount of added DNA (Fig.3F) using both pDS5.30 and an arbitrary plasmid commonly used to report transformation efficiency commercially (pUC19). Transformation frequency increases rapidly as up to 25 ng of DNA are added to a standard 460 μL aliquot of cells, with marginal increases in total frequency as up to several hundred nanograms are added, with cfu / μg yield maximized around 50–250 ng. pDS5.30 consistently provides a higher yield at these concentrations. Transformation frequency and yield is insensitive to incubation temperatures ranging from 20 to 37 °C, increasing with incubation time until plateauing around 45 min (Fig.3G). Transformation in which cells are plated immediately after DNA addition with no incubation at all results in a surprisingly high transformation frequency (≈ 10−5), indicating that some of this activity may be occurring on the plate as dilutions dry. Incubation on ice results in no transformants (not shown). This result, in combination with the prior result finding that transformation efficiency is not improved by the addition of recovery media, indicates that cells begin expressing antibiotic resistance genes from the plasmid immediately upon uptake during static incubation in MCM, unlike with traditional chemically competent cells which are inactive when incubated on ice. High energy food sources like sugars inhibit NPT in a singular media where there is no subsequent dilution or media exchange step, likely due to carbon catabolite repression impacts on natural competence. Using the minimal MCM components, and a diverse array of potential metabolites in lieu of acetate at the same 3 mM concentration (glucose, sucrose, gluconate, formate, pyruvate, sorbitol, and tryptone), the disclosure includes analysis of options other than acetate as a carbon / energy source in MCM. We found that pyruvate is the next-best inducer of natural transformation (Fig.10), which is competent at a frequency on the order of 10−4. A mixture of 10% LBv2 and 90% artificial seawater also exhibited transformation, although at a low frequency on the order of 10−6. Replication of the creation of competent cells using pyruvate MCM and 10% LBv2 with flash freezing and −80 °C storage shows improved transformation frequency (Fig.11), as was the case for acetate MCM. Naturally competent V. natriegens is an effective tool for plasmid cloning Transformation of the described frozen competent cells through isolation of single colonies is possible within a standard workday (i.e., approximately 8 hours) due to the combination of rapid V. natriegens growth and the fact that a 45-min incubation is sufficient to maximize NPT transformation frequency and yield (Fig.4G). As a demonstration of this capability, we began a transformation at 9 AM (Fig.4A). NPT competent cells were removed from the deep freezer and then thawed on the benchtop for approximately 5 min. Transforming plasmid DNA was then added and cells were incubated for 45 min at 30 °C, and then immediately plated (37 °C) on pre-warmed LBv2 agar plates using plating beads at around 10 AM. By 3:30 PM, small single colonies were visible, which we then imaged at 4:30 PM and used a single one to inoculate a culture tube of LBv2. By 9 AM on the following day, that overnight culture yielded an OD of 9.2 in 3 mL of media. The ability to obtain the single colony stage within a standard workday is significant and gives the described cloning strain of V. natriegens enhanced utility relative to using E. coli. Upon plating, transformants of E. coli cloning strains will not be visible to the naked eye after 6 h of growth. As a result, outgrowth of colonies is typically carried out overnight. This means that, depending on timing, many protocols which typically take two days to complete can be done in one if started in the morning using the described modified cell, and as described herein. Plasmids can be readily extracted from V. natriegens using standard miniprep kits developed for use with E. coli. These plasmids can then be used to transform V. natriegens with the same yield as plasmids derived from E. coli DH5α (Fig.4B). We next demonstrated that two arbitrary molecular biology reactions can be transformed directly into V. natriegens NPT competent cells (Fig.4C). We used KLD, an enzyme mixture produced by NEB which is used to circularize linear PCR fragments. This product includes kinase, ligase, and dpn1 optimized to ligate PCR product and remove confounding template plasmid DNA in a single reaction. We used PCR to delete the GFP expression sequence from pDS5.30 and KLD for the subsequent ligation to create new plasmid pDS5.44. We then directly transformed 2 μL of this reaction product (the standard volume recommended by NEB for a transformation with E. coli) into our Vn NC1 competent cells via NPT, yielding 11,000 transformed cfus. Similarly, we used Gibson assembly (via NEB Hifi) to insert a GFP expression sequence into pUC19, producing new plasmid pDS5.43. NPT transformation of 2 μL of Gibson assembly reaction product into strain Vn NC1 produced a yield of 140 transformed cfus. Cotransformation of plasmid and linear DNA enables scarless genomic editing Because natural transformation is a highly non-Poisson process such that a DNA uptake event is strongly correlated with additional uptake events, it is expected that there are many instances of cotransformation where several distinct DNA molecules are taken up by the same cell. Therefore, in the presence of mixed selectable and nonselectable genetic material, if a cell takes up selectable material, there is an increased likelihood that unselected material was taken up simultaneously. The high rate of cotransformation is used in MuGENT, where selectable and nonselectable genomic edits are paired in order to rapidly incorporate genomic edits which are not directly selectable. The present disclosure demonstrates it is similarly possible to cotransform both selectable plasmid DNA and arbitrary linear DNA at an increased rate for genomic editing in V. natriegens (Fig.5A). In all previous experiments, the natural competence strain of V. natriegens still contained the chloramphenicol resistance gene camR. This is unnecessary and undesirable for subsequent cloning which might utilize chloramphenicol, and thus we sought to delete it. In order to test this cotransformation hypothesis, we attempted to cotransform an arbitrary plasmid (pDS5.30, which contains kanamycin resistance) and tDNA for homologous recombination-based deletion of camR, derived from plasmid pDS5.45. Using 400 ng of transforming DNA with 3 kB homology arms, paired with 25 ng of pDS5.30, we cotransformed these and determined that 22% of cells received the desired edit (8 out of 36 colonies tested for simultaneous loss of genomic chloramphenicol resistance and gain of plasmid-based kanamycin resistance), indicating a high rate of cotransformation of the camR deletion along with plasmid uptake. Cells were then easily cured of pDS5.30 and we verified with whole-genome sequencing that the resulting strain had the expected sequence and remained naturally competent, although with reduced transformation frequency (Fig.5B). RT-qPCR establishes upper and lower limits of mRNA Vc tfoX expression sufficient for natural competence induction Next, we again sought to correct the missing LacI sequence present in both strains Vn NC1 and NC7, attempting to restore 67 base pairs at the end of the LacI sequence (see pDS5.59 in Supplementary Information table). Starting with strain NC1, and using the cotransformation protocol described in the previous example, we attempted to simultaneously knock out CamR and restore the missing LacI base pairs. However, the strain appeared to be highly resistant to this edit, with only a single colony out of approximately 40 tested appearing to contain camR loss (despite a high 20% success rate producing Vn NC7 from NC1 in a very similar edit). The resulting strain, Vn NC8 (Fig.6C), was Sanger sequenced to confirm lacI restoration of the missing base pairs, however subsequent whole-genome sequencing revealed a new, completely novel deletion of 233 base pairs within the lacI sequence. Prior to receiving the sequencing results, we were disappointed to find that this new strain continued to lack IPTG inducibility (Fig.12), with constant transformation frequency at all levels of IPTG induction, comparable to that of Vn NC7. We sought to understand the cause of the described challenges in cloning IPTG inducible Vc tfoX expression. In the new strain Vn NC8, we observed a curious toxicity stemming from IPTG addition, where the strain exhibited lowered total yield (Fig.14A) due to reduced total survival as a function of added IPTG (Fig.14B). In prior tests of the use of our finalized protocol optimized for our genomically integrated expression of tfoX on the Δdns strain containing the plasmid pMMB67EH-tfoX (Simpson et al.), we also found that while IPTG induction worked as expected (Fig.13), it also appeared to reduce total survival in MCM at 100 and 200 μM IPTG, regardless of plasmid uptake. In Fig.13, pMMB67EH- tfoX is induced with 50 μM IPTG, half of what is typical. We had assumed that this must be due to lethal tfoX overexpression under stressful natural competence conditions, although this now appears to be incorrect. The reason for this IPTG toxicity remains unclear and is discussed further in Supplementary Note S2. Disappointed that inducibility could not be restored in our NPT strains, we used RT- qPCR in order to shed additional light on relative tfoX expression levels in order to better understand our working versions. We extracted RNA from each strain grown out in competence-inducing MCM conditions and measured tfoX expression relative to expression of arbitrary gene gyrB (Fig.15). The Δdns strain containing pMMB67EH-tfoX (Dalia et al.,) shows unambiguous inducibility with IPTG (Fig.15A, using only 50 μM IPTG for induction), with a dynamic range spanning two orders of magnitude. Strain Vn NC1, with genomically integrated tfoX, exhibits substanially lower tfoX mRNA expression (83.6% lower than pMMB67EH-tfoX maximum expression, Fig.15B). Strain Vn NC7 has still lower expression (94% lower than the pMMB67EH-tfoX maximum, and 63.5% lower than Vn NC1, Fig.15C). Despite apparent IPTG toxicity (Fig.14), Vn NC8 does not appear to exhibit any significant changes in tfoX expression as a function of IPTG addition, as could be expected given the large deletion, but furthering the mystery of apparent toxicity (Supplementary Note S2). Across the spectrum of IPTG conditions, Vn NC8 expresses tfoX mRNA at levels comparable to Vn NC7. Despite detectable circuit leak from tfoX expression by pMMB67EH-tfoX (Fig.15A) in the absence of IPTG, it is sufficiently tolerated such that there are no detectable escaped transformants (Fig.13). This establishes an upper ceiling of tfoX mRNA expression that can be tolerated in the OFF condition without unwanted natural competence expression. At the high end of expression, there appears to be a floor for tfoX expression sufficient to maximize NPT frequency, as despite the fact that maximal tfoX expression by pMMB67EH-tfoX does not increase NPT frequency beyond what is observed with Vn NC1 (Fig.13, relative to the orange line). However, differences in Vn NC1 and NC7 transformation frequency (Fig.5B, relative to the orange line) are probably due to reduced tfoX transcriptional expression in Vn NC7 relative to Vn NC1. In this disclosure, we have shown that a genomically engineered strain of V. natriegens created specifically for enhanced natural competence can be used as an effective chassis for low-cost and low-capital plasmid engineering. Natural plasmid transformation (NPT), using the described strain and specific transformation media, allows for alternate growth and high-efficiency transformation without exchange of media. Further, cells can be flash frozen and stored in this naturally competent state. Plasmids can be cotransformed with linear DNA for genomic editing, enabling diverse scarless genomic edits without requiring additional genomic insertions or additional plasmid engineering for CRISPR counterselection. Due to the low-resource intensity and yet high efficiency of the transformation protocol, this disclosure supports the use of the described V. natriegens as a next-generation molecular biology workhorse, especially for low-resource laboratory environments. NPT is a third alternative to chemical or electrochemical transformation of plasmids in V. natriegens. Many microbes are capable of a state of natural competence under the right conditions and many more are likely to be as specific environmental triggers are discovered. Even E. coli, the current molecular biology workhorse, is capable of natural transformation of plasmids while on solid media independent of the type IV pilus although the efficiency and protocol make it impractical for routine cloning. In general, natural competence in bacteria is controlled by an eclectic set of diverse environmental and physiological conditions. While natural transformation is used extensively as a tool to modify diverse microbial genomes, few microbes have previously been engineered specifically for enhanced natural competence, most notably B. subtilis and V. cholerae. B. subtilis is a poor substitute for E. coli due to its evolutionary distance, preference for multimeric plasmids, and poor diversity of plasmids mutually compatible with E. coli. To our knowledge, there are no previous demonstrations of cells in a naturally competent state with comparable general utility to traditional frozen E. coli-based chemical competent cells. NPT can be efficiently accomplished with 50 min of hands-on time, less than half of the time required for chemically competent cells (Fig.4A), and requires neither a heat shock nor electroporation. Additionally, NPT competent cell preparation is minimal when given the benefit of the present disclosure, requiring no wash steps and functioning within a wide time window which does not require monitoring of OD (Fig.2D). It is a dynamic process by which cells actively take up DNA in a physiologically controlled process at temperatures relevant for growth, as opposed to chemical transformation which occurs via diffusion while cells are maintained on ice. The fact that cells remain metabolically active under these conditions may explain why a separate recovery step is not required in order to express antibiotic resistance genes (Fig.3A). In total, the disclosure provides automation friendly approaches and enables unique applications. For example, it would be possible to independently transform collections of many clonally isolated individuals, at room temperature and with no separate chilling or shaking steps, in 96-well plates in MCM. Aside from general cloning usage, the fact that cells can be grown, transformed, and subsequently recovered in the same media all at the same temperature without media exchange is expected to have significant advantages in continuous evolution. For example, in multiplexed automated genome engineering (MAGE), DNA for recombineering is delivered via electroporation and the process is thus bottlenecked by transformation efficiency. Especially given the feedstock flexibility and extremely high growth rate of V. natriegens, NPT of nonreplicative plasmids and directed evolution is expected to provide a useful combination. While E. coli can also be grown and transformed in a shared media, cells must be chilled during transformation and recovered under growth conditions prior to antibiotic selection. The present disclosure may exclude this step, and other previously desired or required steps and reagents, as discussed herein. Materials and Methods Working with V. natriegens In general, growth of V. natriegens was performed in LBv2 liquid media or LBv2 agar plates. When necessary, antibiotics were used in both solid and liquid culture at a final concentration of 200 μg / mL (kanamycin), 2 μg / mL (chloramphenicol), and 10 μg / mL (carbenicillin, see Supplementary Note S1). In instances where it was necessary to transform V. natriegens via conventional means, cells were made electrocompetent using the protocol as previously described. Glycerol stocks were created by mixing cells in late exponential growth (≈ OD 1) at a ratio of 3:1 with 60% glycerol prior to storage in a −80 °C freezer. In instances where artificial seawater media was used, we filter sterilized 28 g / L of Instant Ocean Sea Salt in deionized water. Genomic editing of V. natriegens A dns knockout of the V. natriegens wild type strain (ATCC 14,048) was created using NT-CRISPR, using the protocol as described in Stukenberg et al.. Briefly, this protocol uses natural transformation of linear tDNA with flanking 3 kB homology arms to make genomic edits, followed by CRISPR-based counterselection which introduces double-strand breaks selecting against the original, unedited sequence. The 3 kB homology arms amplified from V. natriegens WT genomic DNA as a template were assembled in pUC19 via Gibson assembly (NEBuilder HiFi DNA Assembly), creating pDS5.13. This plasmid was then used as a template to create the tDNA needed for genomic editing via PCR amplification using DNS_Upstream_F / DNS_Downstream_R. CRISPR counterselection was accomplished using the spG Cas9 NT-CRISPR plasmid (pST_140_LVL2 cam, Addgene 179334) with spacer sequence tgcactatccagtgccgccg (pDS5.17), as described in Stukenberg et al., using annealed primers dns_gRNA_F / dns_gRNA_R to replace a sfGFP dropout fragment with the gRNA spacer sequence. We then inserted the tfoX / lacI / camR construct from Stukenberg et al. into the Δdns V. natriegens strain. In order to accomplish this, we created a second helper plasmid (pDS5.29) containing tfoX and GFP to aid in curation. pDS5.29 is created using the origin, kanR, and GFP expression sequences from pEvolvR-enCas9-PolI3M-TBD (Halperin SO, et al.2018. CRISPR-guided DNA polymerases enable diversification of all nucleotides in a tunable window. Nature.560(7717):248–252. ISSN 1476-4687. doi: 10.1038 / s41586-018-0384-8.) and the lacI / tfoX expression sequence from Stukenberg et al. pST_140_LVL2_cam using Gibson assembly with primers 528_BB_F / 529_BB_CORRECTED_R, GFP_Liftout_F / GFP_Liftout_R and 529_Ins_CORRECTED_F / 528_Ins_R. Using this helper plasmid and tDNA derived from pDS5.27 (containing the insertion and homology arms, with SEQ ID NO:1), we inserted the construct into the genome following the protocol for natural transformation from Dalia et al.. Cells were plated for chloramphenicol resistance, and verification of the insertion at the expected location was confirmed by colony PCR. As in NT-CRISPR, cells were then cured of the helper plasmid via 37 °C antibiotic-free growth in LBv2 for 6 h, plating a 10−7dilution on LBv2 agar plates, and then striking colonies onto kanamycin plates in order to verify helper plasmid loss. NPT protocol development Plasmid pDS5.30 was created explicitly as a test case for optimization of the NPT protocol. It is derived from the plasmid pEvolvR-enCas9-PolI3M-TBD, edited to remove the EvolvR system which was not utilized in this disclosure. The plasmid contains GFP expression which makes it easy to determine that transformants received the plasmid and are not spontaneous abx-resistant mutants. In all iterations, cells of the natural competence strain or the negative control were first struck out from a glycerol stock onto LBv2 plates for single colonies. On the subsequent day, a single colony was used to inoculate 20 mL of media in 100 mL flasks to create cells with a state of natural competence. In instances where cells are preserved in the −80 °C freezer, 350 μL of overnight culture is added to 110 μL of 60% glycerol, mixed by pipetting up and down, placed on ice for several minutes, and then flash frozen in liquid nitrogen. In early iterations, cells from the freezer are thawed on ice (Figs.2 and 3A), while in subsequent experiments cells are thawed on the benchtop. In instances where cells are used for immediate transformation without freezing, DNA is directly added to 350 μL of overnight culture, except in Fig.9 where 110 μL of 60% glycerol is also added. Except in cases where the amount of DNA is explicitly changed (Fig.3F), 25 ng of plasmid DNA is used for all NPT transformations. Cells are then incubated in the presence of the plasmid tDNA. This is done statically, with the exception of Fig.3D, for a period of time ranging from 0 to 6 h, at either 30 °C or room temperature. In early iterations (Fig.2), 1 mL of LBv2 is added and cells are placed in a shaker at 37 °C for recovery. After it became clear that there was limited benefit from the addition of recovery media (Fig.3A, discussed above), cells are plated immediately after incubation, diluting as appropriate in order to calculate transformation efficiencies. Plated cells are grown out at 37 °C, except for in Fig.3E 20 °C which is a demonstration of the fully room temperature protocol. In an example, MCM consists of: 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potassium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride. In order to prevent precipitation, 1 mL of undilute hydrochloric acid is used to lower the pH of 900 mL of deionized water prior to adding the media components and water to a total volume of 1 L. The final mixture is then adjusted upwards to pH 7.4 using 1 M sodium hydroxide and sterile filtered. The media will precipitate if autoclaved. This recipe is used for all experiments in included figures except Fig.2A–C, indicated in pink, where 10 mM PIPES is used in lieu of HEPES and the pH is adjusted to 7, and in Figs.10 and 11, where various carbon / energy compounds are used in lieu of acetate, as indicated. Representative protocols for NPT in the described natural competence strain, describing both the high speed / efficiency and low-capital transformations, a provided as protocols in Supplementary Notes S3 and S4, respectively. With the exception of Fig.3F where indicated in gray, all plasmid transformations were done using pDS5.30, a plasmid with a pBR322 origin which expresses kanamycin resistance and GFP. Development of NPT as a tool for cloning In order to test the utility of NPT and V. natriegens as a host for cloning, we designed two arbitrary Gibson assembly and KLD reactions, creating final plasmids pDS5.43 and pDS5.44, respectively. The requisite PCRs were completed using NEB Hot Start Q5. PCR product for Gibson assembly was cleaned using a Zymo Clean & Concentrator kit and then used in a NEBuilder HiFi DNA Assembly reaction as described by the manufacturer. In the KLD reaction (NEB KLD Enzyme Mix), pDS5.30 is PCR amplified using primers TransientKan_F and DelGFP_R in order to excise the GFP sequence from pDS5.30, producing plasmid pDS5.44 and an easy-to-visualize change from green to white cells. This PCR product is used directly in the KLD reaction without further cleaning, per the manufacturer’s instruction. In both, 2 μL of reaction product is added directly to the competent cells in media, just as with plasmid DNA in the previously described NPT protocol. Miniprep extraction of plasmid DNA from V. natriegens was accomplished using the E.Z.N.A Plasmid DNA Mini Kit I produced by Omega Bio-Tek, following the manufacturer’s instructions. For the demonstration of producing single colonies within a standard workday, colonies are imaged using an Azure Biosystems Gel Imaging System. The image contrast is altered in order to highlight the presence of colonies and facilitate measurement of their size. Cotransformation of plasmid DNA with linear tDNA for genomic editing tDNA with 3 kB homology arms (as described in Dalia et al.), designed for the deletion of camR which was previously inserted, was created by assembly of plasmid pDS5.45 via Gibson assembly, from which tDNA was amplified with PCR using primers CamRtDNALift_F and CamRtDNALift_R and column purified. Cotransformation of plasmid DNA and linear tDNA with homology arms for genomic editing was done using the described protocol for plasmid transformation in our natural competence strain. Twenty-five nanograms of pDS5.30 was cotransformed with 400 ng of linear tDNA. Once plated, we streaked 36 arbitrary colonies onto chloramphenicol plates in order to estimate the frequency of genomic editing. Deletion of camR was additionally verified by colony PCR and Sanger sequencing. Whole-genome sequencing was done by Plasmidsaurus. We attempted to use the same procedure in order to restore the broken lacI sequence present in strains Vn NC1 and NC7. We used Gibson assembly to insert the lacI sequence from pST_140_LVL2 cam into pDS5.27 but with a changed compositional context (removing camR but retaining the camR terminator sequence), producing plasmid pDS5.59. As with creation of linear tDNA from pDS5.27, we used primers _5.25_Liftout_F / R to amplify tDNA from this plasmid template and used this in conjunction with pDS5.30 for cotransformation as previously described (400 ng linear DNA, 25 ng pDS5.30 plasmid). As discussed in the main text, the only version which received an edit deleting camR also contained a substantial new defect in the transferred lacI sequence. RT-qPCR to measure relative Vc tfox mRNA concentration For each condition, 20 mL of MCM plus the appropriate amount of IPTG was inoculated with a single colony of the specified strain and incubated at 30 °C for 18 h. Samples were then either prepared directly after for RNA extraction or were frozen at −80 °C until needed before being thawed on ice. Due to the low density of culture growth in MCM, samples were centrifuged for 10 min at 4 °C in 15 mL tubes order to concentrate them. All but 2 mL of media are aspirated from the tube and is then centrifuged again for an additional 2 min at 4 °C in a microcentrifuge tube. All but 200 μL of media are then aspirated from the tube and the remainder is resuspended by pipetting. The Zymo Direct-Zol RNA Miniprep Plus Kit was then used to purify 100 μL of the remaining fluid into 50 μL of concentrated RNA. Forty-three microliters of this RNA is then digested using 4U of DNase in a 50 μL reaction for an initial 30-min reaction incubated at 37 °C, then an additional 4 U of DNase are added for a second 30-min reaction at 37 °C. One microliter of 0.5 M EDTA is then added and the mixture is heat inactivated at 75 °C for 10 min. The resulting solution was then cleaned using the RNA Clean and Concentrate-5 Kit from Zymo and eluted into 40 μL of ddH2O. Concentrations for RNA samples were taken on a Qubit Fluorometer. Any samples with RNA concentrations too low were reconcentrated into 15 μL of solution using the same kit. In order to prepare samples for development of the qPCR standard curves, segments of tfoX and gyrB were PCR amplified using a cPCR protocol with OneTaq HS 2X MM with Standard Buffer on single colonies from the Vn NC7 strain. Resulting samples were cleaned using the DNA Clean and Concentrator-5 from Zymo. Concentration measures were taken on the Nanodrop Fluorometer. For each qPCR run, the LunaUniversal One-Step MasterMix was utilized in the QuantStudio 7 Pro. Standard curves were generated using tfoX and gyrB standards at dilutions ranging from 1:10 to 1:100,000. Two microliters of each of these diluted standards were combined with the recommended quantities of the Luna Mix in triplicate. For each test sample, 5 ng of total RNA were added to the recommended quantities of Luna Mix in triplicate, as well as a noRT negative control where the reverse transcriptase was removed, a positive control to measure for baseline expression of the gyrB control gene, and a gyrB noRT control containing the gyrB primers without reverse transcriptase. All reactions had a final volume of 20 μL. Supplementary Materials / Notes Note S1: Ampicillin vs. carbenicillin sensitivity in V. natriegens While ampicillin and carbenicillin are treated interchangeably when used for E. coli selection, we have observed that in V. natriegens carbenicillin exhibits dramatically stronger selection on solid media than ampicillin does. In our tests, concentrations as low as 2 µg / mL of carbenicillin can be sufficient for counterselection, while there are colonies which escape ampicillin selection at concentrations as high as 50 µg / mL in freshly made plates. Ultimately, we use carbenicillin at a concentration of 10 µg / mL for selection of pUC19 recipients (Methods). Further, however, we observe that V. natriegens grown out under robust conditions (outgrowth in unselective rich liquid or solid media) can quickly develop tolerance to carbenicillin selection on plates. While cells from a weakened state (glycerol stocks or cells grown out in our described MCM protocol) will die on plates with 10 µg / mL carbenicillin, cells which are taken from rich liquid media or streaked from single colonies will require stronger plate counterselection. We do not observe this issue in antibiotic selection in liquid culture. We observe this phenomenon in the ATCC type strain and thus this is a general problem when working with V. natriegens and not the result of our genomic editing. In further development of V. natriegens as a drop-in replacement for E. coli, the disclosure includes editing strains for enhanced sensitivity to beta lactam antibiotics, for example by deleting genomic beta lactamases. Note S2: IPTG Sensitivity observed in strain Vn NC8 despite constant tfoX expression While it initially appeared that we had successfully restored the lacI sequence when creating Vn NC8 (Sanger sequencing had shown that missing base pairs at the end of the coding region were restored), subsequent whole genome sequencing showed that a novel 233 bp deletion within lacI arose during this new editing attempt (see Fig.6). Throughout our attempts to edit and insert the combined lacI / tfoX inducible construct, there appears to have been consistent selection for defective lacI sequences which arise as a rare event during editing. The mechanism for this remains unclear. Despite the fact that strain Vn NC8 is insensitive to IPTG induction and continues to constitutively remain competent (Fig.12), with constant genomic expression of tfoX as a function of added IPTG (Fig.15), it exhibits dramatic sensitivity to IPTG addition. Falling total survival (in MCM) as a function of IPTG added spans two orders of magnitude (Fig.14), resulting in poor transformation yields despite minimal effects to transformation frequency. IPTG-driven circuit toxicity could make a lot of sense if an excessively- strong Ptac promoter was causing excess tfoX expression. However, this is clearly not the case (Fig.15), especially given that from pMMB67EH-tfoX tfoX can be expressed by an additional order of magnitude. While we have measured this effect most completely in strain NC8, we have observed unanticipated IPTG sensitivity in other constructs as well when they are grown in MCM (in general, IPTG does not seem to cause issues in rich media). The disclosure includes using alternative inducible promoters to improve inducibility. Note S3: Representative NPT protocol optimized for high efficiency 1. Prepare: LBv2 plates with and without the appropriate antibiotic; 60% sterile glycerol; liquid nitrogen (if flash freezing); 2. Prepare 1× minimal competence media (MCM): 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6mM potassium phosphate, 7 mM potas- sium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride. In order to prevent precipitation, 1 mL of undilute hydrochloric acid is used to lower the pH of 900 mL of deionized water prior to adding the media components and water to a total volume of 1 L. The final mixture is then gradually adjusted upwards to pH 7.4 using 1 M sodium hydroxide and sterile filtered. The media will precipitate if autoclaved. 3. Streak cells from a glycerol stock onto LBv2 plates for single colonies. Incubate overnight at 37 ◦C. 4. From a single colony, inoculate 20 mL of MCM in a sterile flask. Incubate for 18 hours, statically, at 30 ◦C. Note that MCM, and acetate in general, is a very poor nutrient, and growth will be only barely visible with the naked eye and not detectable with an OD meter. 5. Briefly resuspend cells by swishing the flask, and take as many 350 µL aliquots as needed. These can either be added to 110 µL 60% glycerol, flash frozen, and stored at -80 ◦C, or used immediately in subsequent steps. 6. If using frozen cells, thaw them at room temperature for ≈ 5 minutes. 7. Add ≥ 25 ng of plasmid DNA to the cells. Invert or vortex briefly to mix. 8. Allow cells to incubate statically for at least 45 minutes at 37 ◦C. Per Fig.3G, cells can be incubated for up to 3 hours with minimal additional gains to transformation frequency or yield at temperatures ranging from 20 to 37 ◦C. 9. Dilute in MCM as necessary to get single colonies (for a typical transformation, 1- 2 orders of magnitude is sufficient), spread onto a prewarmed LBv2 plate, and grow at 37 ◦C for single colonies. Small colonies are visible 6-7 hours after plating. Efficiency is reduced if cells are diluted in a medium other than MCM. Note S4: Room temperature NPT protocol optimized for no capital equipment 1. Prepare: LBv2 plates with and without the appropriate antibiotic; 60% sterile glycerol. 2. Prepare 1× minimal competence media (MCM): 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potas- sium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride. In order to prevent precipitation, 1 mL of undilute hydrochloric acid is used to lower the pH of 900 mL of deionized water prior to adding the media components and water to a total volume of 1 L. The final mixture is then gradually adjusted upwards to pH 7.4 using 1 M sodium hydroxide and sterile filtered. The media will precipitate if autoclaved. 3. Streak cells from a glycerol stock onto LBv2 plates for single colonies. From this point on, no capital equipment is necessary. When grown at room temperature, single colonies will become visible 24 hours after being struck out. 4. From a single colony, inoculate 20 mL of MCM in a sterile flask. Incubate statically at room temperature for 24 hours (although competency is maintained for at least up to 50, Main Fig.2E). Note that MCM, and acetate in general, is a very poor nutrient, and growth will be only barely visible with the naked eye and not detectable with an OD meter. 5. Briefly resuspend cells by swishing the flask, and take as many 350 µL aliquots as needed. 6. Add ≥ 25 ng of plasmid DNA to the cells. Invert to mix. 7. Allow cells to incubate statically for at least 45 minutes at room temperature. Spread on a room temperature LBv2 plate. Small colonies are visible 24 hours after plating at room temperature. The sequence used for homologous recombination to produce the described modified cells with enhanced transformation capability and the capacity to maintain the enhanced transformation capability after freezing is as follows, with one strand of a double stranded amplicon shown. The disclosure includes use of a circular and linear double stranded DNA wherein the second strand is complementary to the sequence described below: Key: Underlined: 1st3kb homology arm Italics: V. cholerae tfoX, coding region (noncoding strand) Bold, italics, underlined: lacI sequence which includes the first 1016 bases (coding strand) Italics, underlined: After the 1016thbase, lacI is truncated but an additional 274 bp should continue to be translated until a stop codon is reached. Bold, italics: camR sequence, coding region (coding strand) Underlined: 2nd 3kb homology arm Sequence cgtatttcggttgatgacgatcattctctttcgcgtgttgccaacccacggtatgcctaacaaagtgttcggcaaaagagtgggaaacctccagacaa ccagccaaaacggtatcaacgtagctttgcattatcgggctgttagagcagggcggcagtggctcgtcctttacataaacccaaatagcgtgatcgg gattaaatggttggtctgtttcaatttgatcggggcgaagttgaatacgatgatagccacgttcgcgacgatcgaattctgctaaagcttcatcattgact tcaagtagcacgccgttgacctgtccttgtccttcgttaacgaccagcggggacaaggtgtaactttcatcgattttgccccaatagcgaactaatccg tgtgcgatgactggaatcgctgcgcctgtttgtcctgtcaactttcgagaagcggaattaatcaagctgccatagccgaatatgtacatctgtttacgtc ccttacttaattgcgaaccgcctttctttatacctaacccttcgtagaagcacaaactttacccccaaagtatagtcttctccctaacatgtatttttaatgtat gtttatggtagtatccattttgtcgctgaaaatctctgggctggcaataatgatccgatcattcaacctgcatcgaaacaagcttgagggccaaaaaatg ctgaatatcaccgataaaaaagtggaagaaaaaatccctgcatggctgcgtttagggtttcgaccgtttttcctatttggcgctatctatgccatcgtcg ctatagcgatgtgggtgtggatgttccagaccggacagcccagtgcactgcgcgttcctgctctttggtggcatgtgcatgaaatgttatttggtttttca atggcgatcgtcgctggctttgtgttaactgcggtacaaaactggacgggaataaatggcaccaaacattacacactgttggctatttttgccttgtggc ttgcgcccagaattttactctggacgccaatccctttgtggttaacgagtactatcgaagcgttatttttattgtttgtcgcttatgaagtagggatccgagt ataccgctctaaagggtggcgaaatctgttttttgtcccgctgttcttattggcgatctttgctaactttgccagctacgcgacggtgaagggcatgcca ccattttcctcttcagcggtttggcacgctatgctgtggtggtttaccttgttattgtcggtaatgggtgcacgggtcattccgttctttactgcccgccgttt taacttcgaaaaagcgcaaccgttggtatggcttgattggctggcaaaccttcctttggtgatgttgtttatcttaagcttcttccctgtaactttttctcaac ttggtcaacctttaatggtgtttgcaggcattgctcagttggttcgcttcttacgttggaagccatggctaaccttaagtgagccactggtttggtcgctgc acgcggcgtatttgtgtttaccattgagtttacttttgcgcggagcttggggggatgcatttgcaagtcataacctgattcacttattcgcgataggtgcct taggcggtttgatattagcgatgatttcgcgtgtcaccatggggcatacggggcgtatgatttacaaaggacccaatatgagtatcgccttcgctgcc gttattgccgcagctgtggttcgtagttttgctgtgattttcgaccctgccagaatgatgttgtggatagatatcagcggcggattgtggatattcgcattt ggcatgtttgtatggcgatttggttttatgctggttactccgcgtgccgacggtcatccaggataaagctacagcgtaaaaaagaggagagggcatct cctctttattgtttcttcgcgaaactactcgtcgtcgcttttgttagttaacccaaagcgttttaacagcagccactccagagcaaatataataattaatgct acgcagaaccaagtgaaggcagttgcagagtccacgccaggcatgccgccgatattaatacccagtagcccagttaaaaaactggtcggtaagaa aatagtggcaaccagtgtaaacagataactgtttttattggttttttcatcgcgattgtgcttaatctcttcctggaataatgccacttcgcccagataaaag tcgatggtttcgttaatgcgcgtaatgttgttgtgcgcgaatcgatactgatgtggtctggaaaccaccagatcagagcttgattcaagcaaatcacgg atcgcatattgctgcggacgtataaagcgtttgatagaaataagcgccttttgagcggagatatgcttataggtggactcatcgttcacgtcgaaatgat taagagtttcttcaatcgtatccagataaagatcaatcttcccgtttaagccttcgatgatttgattaagcaggcttgccaaactctttggtcccttctgttca gccaaggcctggcggatttccataatcgcacgcgaagggattttccgtgttgaaatcaacgcaccttggaaatataaaatccgaatactaagcatatc ttctggagacgcattctcattcatattgatgccacgcagaatcaacatgaagttttcatcgtccagagggtgaaaagaggggcgactttcatcggcga gtaaatgatcaacggtcgctttaggcacttgattgtgctccagccagccacgaatatctggatgaagtctttcgcagtggtaccaatgtttcgctttgatt tcttgtgatgtcgttgcttcttgagttgctattggcgttgaaaaatcccaatgctcaatcataaaccccatattcttttccttatcatgagattacttgcagtct attgaatgagtatgattgcatttttagcgaaaagtctacgaaaaatttccgaaagcgctaaaacaacaaagcctgcacgaagcaggcttggtcacgg gggcctttctgcgtttatacgctagtaagcgaaaaaaaaccccgccctgtcaggggcggggtttttttttttaagcacgctgctgacaactttctaaca gttggcgcttacgcggctcttgcagcagtttccagtgaatgccttcaatcgcacccgcaaacttccacagtagttttacatcgacatcacttccata agcttgacgcaccttattaaacacttctggcgcaccgaggctcataaaagtttccacatcgtcaatgcccgctttttttaccatacgctccaaagtc agttgcatattgggtaaatcccgtagacgacgactggctgctgagcgttgaaattcccgctgattcacagaaaactgaatcgagcgttcaataat cgagtctagctcagggtgatgttgctcatacagttcagtgatgtcgtaatagtttacggttgccgttgtctgttttttaacatggcgatatttctcgcac cctaaggccaagagctcagggtcgagctcttctccaccacgcacaaaaatgcggtcttcactgaccaacacatacatagcgtcgtgttgaaac aagccaataccaccaaacatcgagcgtttttggtaggcgccaaacttagttacgtagtcgaaaaactgttgctcattcatatccattgattatttctc ctctttctctagtaaattgtgagcgctcacaattccacacattatacgagccgatgattaattgtcaacacagccgaatggcgcaaaacctttcgcggta tggcatgatagcgcccggaagagagtcaattcagggtggtgaatatgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttata tgaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggtggagctgaattacatt cccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaatt gtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggc ggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcacta atgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattatttactcccatgaggacggtacgcgactgggcgtggagcatct ggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcac tcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggca tcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatat ctcggtagtgggatacgacgataccgaagatagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaacc agcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgccagtctcactggtgaaaagaaaaaccaccct ggcgcccaatacgcaaaccgcctctcctatttgctccgggtacgcaccgtatcaactgacggactcagctaccgctgaaatgaatatcggagt atattacctcttacggttctccgaagaccgcgcaacgttcgaatggttgacgctctacccgcagagctccgagttgggttccagagtccatatctg gacttcacataaaacaagtgcgatagtgaaagaatttgagaatatagacgggtttatcttgtacctgctctctcagccacagacacagctcggta ccaaagacgaacaataagacgctgaaaagcgtcttttttcgttttggtcctgttttgatcgggcacgtaagaggttccaactttcaccataatgaaata agatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgata tatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggccttttta aagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatg aaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaatac cacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaata tgtttttcgtttcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaa atattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatga attacaacagtactgcgatgagtggcagggcggggcgtaatttgatatcgagctcgcttggactcctgttgatagatccagtaatgacctcagaact ccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgattggagtcattagcccacttgtgagaggttcacgactttctgttgtaa cttttcttttaagtattctgcaagagatagcttttcttcgtcgctcatgtagagcccgatcttggtacgacgccataaaatgtcttcgtcagtcagggccatt tcatggttcatcaagtagtcaatttcacgctgatatacgccaccggcttgtgtagagaaggcttggcctaaatcggcttcacttgtcgctcccttcattag ctcccacgtttgtgttccaaactgagtgacgtaacgtagaataagcgcttttggtgcccaggcgtacttggcgtggatctgtttcgccagttgttcgcga ctacagctgaagttaccgcccggcagagcttggtttgctgtccagttaccgcccatttgtggcaggaatggcgccagctttttcatcgccgcttcaccc agttttcggtaagtcgttagtttaccgccgaaaaccgaaagtaatggagcttgatcgaattctgcatctagctctagcgtgtagtctcgcgtgatcgcct gtggcgagtctgactcatcatcgcacagtgggcgcacaccgctgtatgtccacaccacatcttcgcgcgatagctggtggacgaagtgctggttaa caatgtcgatcagataatcgacttcgtcatcagagatcgcaacttctcgtgggtcgcctttgtattcgacatctgtggtaccgacgatcgagaacttatc taagtacgggatcataaacacgatgcggttatctttgttttgcagaatataagcctgaggttcgttgtggatacgaggaacaacaatgtgcgaaccttta atcaaacgaatattacgtggagaagcttgctctaatccttcatcaaagaactgttttacccacggtcccgcagcgttaaccagtgctttcgctttacgttc aaaacgttgatctgtcattgtgtcgtgaattgtgacatgccagatgccgctttcgcgatgcgctttttctactcggcagtagttacgaacttctgcatggtt ttcacgtgctgcgagaacgttaagtagaactaagcgagcatcatctacccagcagtcggagtattcaaaaccggtttttatctccggttttaacaagcc agactttgccagattaacggtcttgctgcctgggagcgtagtgcgtttacctaagttatcgtaaaggaacaaaccacagcggatcatccacgctgga cgtaaaaatggacgatgaggtaaacggaaacgcataggtaacgcaacatgaggtgctttgcgaaggattacttcacgttctgcgagcgcttccgaa actaaacgaaactcgtagtgttcaaggtagcgtaatccaccatgaataagtttggagcttgctgaagaggttgcagatgcaaagtcgttagcttcatac aaaccaacacttaatccacggcctgcagcatcagcagcgataccagccccgttaatgccgccaccgataatgatcaagtctaaaggagtggatga gtcagttgtggaagcatttttttgtatactcataaatttgacctctttggtgagcgaacgagcattttagaacatgacttaatcctatcttaggtttcgtttgtg gtcatctgttattttcgtttttgagcgttttgtgtgatttgggcacaaaaaaacctctgtctaagtaaggcagaggtcatttaaaggttcaagtttgagcgaa ttatttattttcttcgtctgtcgccccgtttgcgtcgacaacttcaagagggatggaggcttcttttaaaatagacagaatttcttcaggtggctgcttattgg taaatatcatgtttaactgagcgatattgcccagtttcaccatcgcattgcggccaaacttagtgtggtctacggccagaaatacgctgcgactgttatc gatgataacctgttttactcgtacttcatggtaatcgaagtccagcagtgaaccatcgaaatcaataccactgattccgagaataccgaaatcgaggc ggaattgttttacgaagtccagagtggcttcaccgacaataccaccatcgcggttacgaacttcgccgccagccagtatcactttgatttctgggttag ggtaaagaatggtcgcaacattgatgttgttagtgaccactcgaagttgtttgtggtttttattgagtgcacgtgcaacggcttccggcgtcgttccgata tcgataaagagcgtcgcgccatcaggtatgtgtttgaccacctcttctgcaatcacatctttttcgttgaagttaagtgctttacgcgtgttgtaagaggta ttttccgagctgagagggatggtggcaccaccgtgatagcgacgaattctattatcgtcggcgagctcattgagatcgcgtcggatggtttgtgggct gacattgaatcgttcaaccaactcatccgtgctgacatagccttgttttttcaccaactcgacaatctgctggtgtctaggtatttgcttcacttaggactc cattgtgcacgggtagctagctcccaatgcttaacattcgaaatatattgagtaatttggagatattgtgctcgaatttgcgcgttgtgagaagtaaagc gatcaaggaatcggggataagacgcaaaaagagcgctcgaatggcgctctttgttggtgttggtaggggattaatcgtcttcgtcgtgaagttctgac caagtttgagcacatttcactgcacgcttccagcctttgtagcgacgattacgcttctcttcatcatcatgaggctcaaatgtacgatcaattaccgcttta ccttgcagttcatcgaggctatcccaatatcctaccgctaagcctgccagataagctgcacccagagcggttacttcagtgacttcagggcgaagta cttgcgtatttagtacgtcagactggaattgc (SEQ ID NO:1) Supplementary Information Tables Plasmid Table Primer Table Genomic Sequences Table

Claims

What is claimed is:

1. Modified Vibrio natriegens (V. natriegens ) that are plasmid transformation competent at room temperature, the modified V. natriegens comprising a disruption of V. natriegens dns gene, a genomic insertion of a Vibrio cholerae tfoX gene, and a disruption of a heterologous LacI gene, and wherein the combination of the disruption of V. natriegens dns gene, the genomic insertion of a Vibrio cholerae tfoX gene, and the disruption of the heterologous LacI gene provides for enhanced plasmid transformation efficiency, relative to plasmid transformation efficiency using modified V. natriegens that include the disruption of the V. natriegens dns gene and an introduced a Vibrio cholerae tfoX gene, but not the disruption of the heterologous LacI gene.

2. The modified V. natriegens of claim 1, wherein the V. natriegens remain plasmid transformation competent after at least one freeze-thaw cycle.

3. The modified V. natriegens of claim 1, wherein the disruption of the heterologous lacI sequence comprises a truncation, and wherein optionally the truncation is such that only the first 1016 bases of an E. coli lacI gene are present.

4. The modified V. natriegens of claim 3, wherein the genome of the modified V. natriegens comprise a sequence that is at least 95% identical to SEQ ID NO:

1.

5. The modified V. natriegens of claim 4, wherein the sequence that is at least 95% identical to SEQ ID NO:1 is homologously recombined into said genome.

6. The modified V. natriegens of any one of claims 1-5, wherein the modified V. natriegens are present in a frozen state.

7. The modified V. natriegens of any one of claims 1-5, wherein the modified V. natriegens are present in a culture media that comprises 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potassium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride, at a pH of approximately 7.

4.

8. A method comprising introducing into a plurality of modified V. natriegens bacteria according any one of claims 1-5 at least one circular DNA, at least one linear DNA, or a combination thereof.

9. The method of claim 8, wherein at the at least one circular DNA is introduced into the bacteria.

10. The method of claim 9, wherein two circular DNAs are introduced into the bacteria.

11. The method of claim 8, wherein at least one circular DNA and at least one linear DNA are introduced into the bacteria.

12. The method of claim 8, wherein the at least one circular DNA, at least one linear DNA, or the combination thereof, is introduced into the bacteria without media exchange or media addition, and without using electrical stimulation, heat shock, or chemical transformation.

13. A kit comprising modified Vibrio natriegens bacteria as in any of claims 1-5, the kit further comprising at least one sealed or sealable container that contains said bacteria.

14. The kit of claim 13, further comprising printed material that provides instructions for culturing and / or transforming the modified bacteria.

15. The kit of claim 13, wherein the modified bacteria are present in a frozen state.

16. A culture media that comprises 9 mM HEPES, 3 mM sodium acetate, 1.9 mM ammonium chloride, 1.6 mM potassium phosphate, 7 mM potassium chloride, 1 mM magnesium sulfate, 31 mM magnesium chloride, and 350 mM sodium chloride, at a pH of approximately 7.4, 17. A kit comprising the culture media of claim 16.

18. A method of making Vibrio natriegens (V. natriegens ) that are plasmid transformation competent at room temperature, the method comprising homologously recombining into a chromosome of said bacteria a DNA sequence comprising a sequence that is at least 95% identical to SEQ ID NO:

1.

19. An isolated polynucleotide, optionally provided as a component of a kit, wherein the isolated polynucleotide comprises a sequence that is at least 95% identical to SEQ ID NO:

1. 20 The isolated polynucleotide of claim 19, wherein the isolated polynucleotide is circular or linear.

Citation Information

Patent Citations

  • Expression system for product manufacturing

    WO2024158973A2