Methods for modulating FOXP3 induction and expression in CD4+ t cells
The CRISPR-based genomic editing system addresses the limitations of current FOXP3 modulation methods by precisely targeting cis-regulatory elements and trans-regulatory factors, achieving scalable and cell-type-specific FOXP3 modulation in CD4+ T cells for improved therapeutic applications.
Patent Information
- Application Number
- PCT/US2025/042223
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-15
- Filing Date
- 2025-08-15
- Publication Date
- 2026-02-19
AI Technical Summary
Current methods for modulating FOXP3 expression in human CD4+ T cells lack precision, scalability, and cell-type specificity, often bypassing endogenous regulatory circuits and risking dysregulated or supra-physiological levels, complicating therapeutic strategies for autoimmune diseases and oncology.
A CRISPR-based genomic editing system that targets specific cis-regulatory elements and trans-regulatory factors to precisely modulate FOXP3 expression in CD4+ T cells, using CRISPRi and CRISPRn screens to map regulatory networks, and incorporates CRISPRoff for targeted DNA methylation, enabling selective induction, stabilization, or suppression of FOXP3 without affecting Treg function.
Enables precise, context-dependent modulation of FOXP3 levels in CD4+ T cells, providing scalable and cell-type-specific solutions for programming FOXP3 expression, enhancing therapeutic strategies in autoimmune diseases and oncology.
Smart Images

Figure IMGF000014_0001 
Figure IMGF000015_0001 
Figure IMGF000017_0001
Abstract
Description
[0001] GL2024-11-02PCT / / 3730.237WO1
[0002] METHODS FOR MODULATING FOXP3 INDUCTION AND EXPRESSION IN CD4+ T CELLS
[0003] PRIORITY
[0004] This application claims the benefit of priority to U.S. Provisional Serial No. 63 / 683,587, filed August 15, 2024, which is incorporated by reference as if fully set forth herein.
[0005] FIELD OF THE INVENTION
[0006] The present disclosure relates to biotechnology, specifically to methods and systems for modulating FOXP3 expression in human CD4+ T cells (Tconv) using CRISPR-based genomic editing techniques.
[0007] BACKGROUND
[0008] FOXP3 is a lineage-defining transcription factor (TF) controlling differentiation and maintenance of suppressive function of regulatory T cells (Tregs). Foxp3 is exclusively expressed in Tregs in mice. However, in humans, FOXP3 is not only constitutively expressed in Tregs; it is also transiently expressed in stimulated CD4+CD25" conventional T cells (Tconvs)1-3. Mechanisms governing this expression of FOXP3 in human Tconvs are not understood.
[0009] SUMMARY
[0010] The regulation of FOXP3 expression in human CD4+ T cells presents a significant challenge in the field of immunotherapy and immune modulation. FOXP3, a lineage-defining transcription factor, plays a central role in the differentiation and suppressive function of regulatory T cells (Tregs). While FOXP3 expression is constitutively maintained in Tregs, conventional CD4+ T cells (Tconvs) exhibit transient FOXP3 expression upon activation. This transient expression in Tconvs is poorly understood, and existing methods for modulating FOXP3 expression lack precision, scalability, and cell-type specificity. Current approaches, such as cytokine-driven induction, epigenetic modifiers, and viral vector-based overexpression, suffer from limitations including heterogeneous expression, lack of cell-type selectivity, and risks of dysregulated or supra-physiological FOXP3 levels. Furthermore, these methods often bypass endogenous regulatory circuits, leaving the underlying cis-regulatory and trans-regulatory mechanisms largely unexplored, particularly in human Tconvs. This gap in understanding and technological capability complicates the development of robust therapeutic strategies for autoimmune diseases, transplantation, and oncology.
[0011] The present disclosure addresses these limitations by providing a novel system and method for modulating FOXP3 expression in human CD4+ T cells using CRISPR-based genomic editing techniques. The described system identifies and leverages specific cis-regulatory elements, such as CNSO, NCNS, and PPP, and trans-regulatory factors, including GATA3, STAT5, and ETS1, that influence FOXP3 expression in Tconvs. By employing CRISPR interference (CRISPRi) and CRISPR nuclease (CRISPRn) screens, the approach systematically maps the regulatory network controlling FOXP3 expression. This methodology GL2024-11-02PCT / / 3730.237WO1 enables precise, context-dependent modulation of FOXP3 levels, allowing for selective induction, stabilization, or suppression of FOXP3 in Tconvs without compromising Treg function. Additionally, the system incorporates advanced epigenetic editing tools, such as CRISPRoff, to target DNA methylation states at specific regulatory loci, further enhancing the specificity and stability of FOXP3 modulation.
[0012] By integrating these innovative techniques, the described technology overcomes the limitations of prior approaches, offering a scalable, targeted, and cell-type-specific solution for programming FOXP3 expression. This advancement not only deepens the understanding of FOXP3 regulation in human T cells but also paves the way for the development of next generation engineered T cell therapies tailored to diverse disease contexts.
[0013] In one embodiment, the disclosure includes an isolated human conventional CD4+T cell having altered FOXP3 activity as a result of a genetic modification in one or more trans-regulatory factor genes selected from FOXO1 , GATA3, STAT5, NFKB2, IKZF1 , FOXP1 , FOXP3, PTEN, ST T5A, STAT5B, ATXN7L3, IRF4, YY1, NR4A3, BCL11B, ZBTB32, GABPA, SMAD4, TAF5L, SETDB1, IKZF3, HIF1A, ZNF143, MGA, ETS 1, DNMT1, MBD2, TFDP1, MTF1, SATB1, FOXN2, VARS, YBX1, EGR2, E2F3, IRF2, ZNF574, MAP2K1, or GMEB1.
[0014] In another embodiment, the disclosure includes an engineered human conventional CD4+T cell comprising a catalytically inactive Cas9 fusion protein containing a DNMT3A DNA methyltransferase domain, a Kriippel-associated box (KRAB) domain, and a DNMT3L domain, together with at least one guide RNA targeting a selected cis-regulatory element of the FOXP3 locus — namely a non-conserved noncoding sequence upstream of the transcriptional start site, a cis-regulatory clement within the PPP1R3F promoter region, or the CNSO element — resulting in increased DNA methylation at the targeted site and a modulated FOXP3 expression profile upon activation.
[0015] In another embodiment, at least one guide RNA comprises a spacer sequence selected from SEQ ID NOs: 1 to 34.
[0016] In another embodiment, the disclosure includes a method for modulating FOXP3 expression in human conventional CD4+T cells, comprising: obtaining CD4+CD25 cells; contacting them with the Cas9-DNMT3A-KRAB-DNMT3L fusion and guide RNA specific to a chosen cis-regulatory element of FOXP3; culturing under conditions permissive for ribonucleoprotein assembly and targeted DNA methylation; stimulating via a T cell receptor agonist to induce FOXP3; and isolating cells that exhibit increased DNA methylation at the targeted element and an altered FOXP3 expression level relative to untreated controls.
[0017] In another embodiment, the disclosure includes a method for selectively modulating FOXP3 expression in a mixed population of regulatory and conventional CD4+T cells by delivering the Cas9- DNMT3A-KRAB-DNMT3L fusion and a Tconv-specific guide RNA, culturing under permissive conditions, stimulating to induce FOXP3, and identifying conventional T cells with a modulated FOXP3 profile while preserving regulatory T cell expression. GL2024-11-02PCT / / 3730.237WO1
[0018] In another embodiment, the disclosure includes a method for modulating FOXP3 expression by targeting trans-regulatory factors via a CRISPR-associated nuclease or interference system together with guide RNAs complementary to genomic loci encoding factors such as GATA3, STAT5A, STAT5B, FOXO1, DNMT1, MBD2, or ETS 1, followed by culturing, stimulation, and selection of cells showing altered FOXP3 activation relative to controls.
[0019] In yet another embodiment, the disclosure includes a method for preventing, inhibiting, or treating autoimmune disease by administering to a subject a composition of human conventional CD4+T cells genetically modified in one or more of the aforementioned loci, wherein the cells may be injected or systemically administered — autologous or allogeneic — to address conditions such as rheumatoid arthritis, Crohn’s disease, multiple sclerosis, systemic lupus erythematosus, myasthenia gravis, Graves’ disease, type 1 diabetes, graft-versus-host disease, and other autoimmune disorders.
[0020] These and other features will be more clearly understood from the following detailed description.
[0021] DRAWINGS
[0022] Many aspects of the present disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale. Instead, emphasis is placed on clearly illustrating the principles of the present disclosure. Furthermore, components can be shown as transparent in certain views for clarity of illustration only and not to indicate that the illustrated component is necessarily transparent.
[0023] FIGS. 1A-1E. CRISPRi tiling screen identifies shared and cell type-specific cis-regulators of FOXP3. a. Schematic depicting CRISPRi-bascd screens for FOXP3 cis-regulators. b. CRISPRi F0XP3 locus-tiling screen -loglO(p-value) of gRNA enrichment in FOXP3 high vs. low FACS bins in Treg (top) and Tconv (bottom), zoomed in on the F0XP3 and PPP1R3F transcriptional start site. Blue, gRNA enriched in FOXP3 High FACS bin. Red, gRNA enriched in FOXP3 Low FACS bin. Outlined, adjusted p- value is less than or equal to 0.05. Treg conserved noncoding sequences (CNS0-3) and novel Tconv enhancer, NCNS, are highlighted in grey. Treg, n = 2 donors; Tconv, n = 2 donors, c-d. Arrayed validation of F0XP3 TSS, FLICR, CNSO, and NCNS region-associated CRISPRi-responsive elements with paired Cas9 RNPs plotted along the FOXP3 locus at 0- and 48-hours post-stimulation in Tregs (c) and Tconv (d). Top and middle, locations of tiled deletions are indicated as tiles 1-24. Treg bar plots indicate the donor normalized FOXP3 MFI in deletions vs. paired AAVS 1 gRNA controls. Tconv bars indicate the donor- normalized %FOXP3+ Tconv in deletions vs. paired AAVS 1 gRNA controls. Colors of bars indicate the FOXP3 directional change of the mean with deletion. Blue, increased. Red, decreased. Width of bars indicates cutting location of Cas9 RNPs. Points indicate individual replicates of tiled deletions. Bars: Treg n = 2 donors; Tconv bar plots. n= 3 donors. Bottom, heatmap depicting mean log2 fold change in gRNA enrichment in FOXP3 high vs. low bins, summarized over 100 bp windows across the locus, f. Representative flow plots depicting FOXP3 expression with Tile 14 and paired AAVS 1 deletions in resting Tconv. Numbers indicate percent of FOXP3+cells. Tile number corresponds to Tiled Deletions in (c, d). GL2024-11-02PCT / / 3730.237WO1
[0024] FIGS. 1A-2F. Supplementary Data: CRISPRi FOXP3 locus tiling screen identifies cis-regulators of FOXP3 in Tconv. a. Flow cytometry plots depicting FOXP3 and HELIOS expression in CRISPRi tiling screen Treg and Tconv donors 7 days post-initial stimulation, b. Representative flow cytometry plots of FOXP3 expression in AAVS1 -targeted Tconv at 0, 24, and 48 hours post-restimulation with anti- CD28 / CD3 / CD2 antibody complexes, c. Example representative gating strategy of Tconv and Treg FOXP3 expression in CRISPRi tiling screen, d. CRISPRi FOXP3 locus-tiling screen -log 10(p- value) of gRNA enrichment in FOXP3 high vs. low FACS bins in Treg (top) and Tconv (bottom), plotted along the FOXP3 locus. Blue, sgRNA enriched in FOXP3 High FACS bin. Red, sgRNA enriched in FOXP3 Low FACS bin. Outlined, adjusted p-value less than or equal to 0.05. Treg, n = 2 donors; Tconv, n = 2 donors, e. Comparison of CRISPRi FOXP3 locus-tiling screen log2 fold change of grouped gRNA enrichment in FOXP3 low vs. high FACS bins in individual Treg donors (top) and individual Tconv donors (bottom). gRNAs were grouped into 500 bp bins shifted 50 bp across the locus, and enrichment testing was conducted on bins. Color indicates grouped gRNA enrichment in FOXP3 low bins (red) or FOXP3 high bins (blue). Outline indicated significance (FDR < 0.05). f. Donor-normalized change in %FOXP3+Tconv in KO vs. AAVS1- targeting controls (Tconv) or donor-normalized change in FOXP3 MFI in KO vs. AAVS1 -targeting controls (Treg) at 0- or 48-hours post-stimulation. Points indicate individual gRNAs targeting AAVS1, FOXP3, or PPP1R3F. Stars indicate significant normalized change in %FOXP3+ / FOXP3 MFI relative to AAVS1- targeting controls using a one-way ANOVA followed by Dunnett’s test (*: P < 0.05; **: P < 0.01; ***: P < 0.001; Tconv, n = 3 donors; Treg, n = 2 donors, x 4 sgRNAs per target or 3 AAVS1 -targeting sgRNA controls).
[0025] FIGS. 3A-3D. CRISPRn transcription factor screens identify trans-regulators of FOXP3 in Tconv. a. Schematic depicting CRISPRn-based screens for FOXP3 trans-regulators in Tconv. b. Volcano plot of log2 fold change of gene sgRNA enrichment in FOXP3 high vs. low FACS bins versus -loglO of p-value. Color of points indicates significance (FDR < 0.05). Blue, significantly enriched in FOXP3 high FACS bin. Red, significantly enriched in FOXP3 low FACS bin. Gray, not significant (n = 3 donors), c. Arrayed validation of top FOXP3 maintenance and suppressive regulators in resting and stimulated Tconv. Color indicates directional effect in screen. Stars indicate significant normalized change in %FOXP3+ Tconv relative to AAVS1 -targeting controls using a one-way ANOVA followed by Dunnett’s test, independent at each time point (*: P < 0.05; **: P < 0.01; ***: P < 0.001; n = 2 donors x 2 gRNAs per target or 6 gRNAs targeting AAVS1 control) d. Representative flow plots of AAVS1, GATA3, and ETS1 knock-out in stimulated Tconv.
[0026] FIGS. 4A-4I. Supplementary Data: CRISPRn screen and arrayed validation identify and characterize Tconv FOXP3 trans-regulators. a. Example representative gating strategy of Tconv FOXP3 expression in CRISPRn trans-regulator screen, b. Number of sorted cells per sgRNAs in FOXP3 low and FOXP3 high FACS bins across the three donors, c. Top, log2 fold change of individual sgRNA enrichment in FOXP3 high vs. low FACS bins for significant FOXP3 maintenance and suppressive regulators (FDR < 0.05; n = 3 donors). sgRNAs corresponding to the labelled significant gene are colored blue (gene enriched GL2024-11-02PCT / / 3730.237WO1 in FOXP3 high bin), red (gene enriched in FOXP3 low bin), or gray (non-targeting control sgRNA). Bottom, distribution of sgRNA in screen, d. CRISPRn trans-regulator screen donor correlation plots of log2 fold change of gene sgRNA enrichment in FOXP3 high vs. low FACS bins. Color of points indicates significance. Pink, significant in both donors. Blue / green, significant in indicated donor only. Gray, not significant (FDR < 0.05). e. Representative gating strategy of Tconv FOXP3+cells in arrayed validation at 0 hours post-stimulation. FOXP3hi gate was set on cells receiving a FOXP3 KO gRNA, as shown, f. Representative gating strategy of Tconv FOXP3+cells in arrayed validation at 48 hours post-stimulation. FOXP3hi gate was set on cells receiving a FOXP3 KO gRNA, as shown, g. Arrayed validation of top FOXP3 maintenance and suppressive regulators in Tconv at 0- and 24-hours post-stimulation. Color indicates directional effect in screen. Stars indicate significant donor-normalized change in FOXP3 MFI in KO vs. AAVS1 -targeting controls using a one-way ANOVA followed by Dunnett’s test, independent at each time point (*: P < 0.05; **: P < 0.01; ***: P < 0.001 ; n = 2 donors x 2 gRNAs per target or 6 gRNAs targeting AAVS1 control), h. Editing efficiency (% modified reads) of arrayed validation genes and AAVS1 -targeting controls. Color of bars indicates individual gRNAs (n = 2 donors x 2 gRNA per gene or 6 sgRNA targeting AAVS1 control), i. Arrayed validation of top Tconv FOXP3 maintenance and suppressive regulators in Tregs at 0- and 48-hours post-stimulation. Color indicates directional effect in Tconv screen. Stars indicate significant normalized change in FOXP3 MFI in KO vs. AAVS 1 -targeting controls using a one-way ANOVA followed by Dunnett’s test, independent at each time point (*: P < 0.05; p < o.Ol; ***: P < 0.001; n = 2 donors x 2 gRNAs per target or 6 gRNAs targeting AAVS1 control).
[0027] FIGS. 5A-5F. a. Predicted transcription factor binding sites of positive FOXP3 trans-rcgulators (top, red) and negative FOXP3 trans-regulators (bottom, blue) plotted along the FOXP3 locus, b-e. Effect of trans-regulator KO on DNA accessibility24at the FOXP3 locus with CNS0 and NCNS locations indicated. Differentially accessible ATAC-seq peaks with an adjusted p-value < 0.05 are indicated by bars below significant peaks. Navy bars indicate significantly decreased accessibility relative to AAVS1 KO controls; red bars indicate significantly increased accessibility (Padj < 0.05; n = 2 donors), b. Normalized ATAC-seq signal of GATA3 KO (black) vs. AAVS 1 KO (gray) in Tconv plotted above GATA3 ChlP-seq in human Thl cells39(red), c. Normalized ATAC-seq signal of IRF4 KO (black) vs. AAVS1 KO (gray) in Tconv plotted above IRF4 ChlP-seq in human CD4+ T cells40(yellow), d. Normalized ATAC-seq signal of STAT5A KO (black) vs. AAVS1 KO (gray) in Tconv plotted above STAT5B ChlP-seq in human T cells treated with IL-241(green), e. ATAC-seq signal of ETS 1 KO (black) vs. AAVS 1 KO (gray) in Tconv plotted above ETS1 ChlP-seq in human THP-6 cell line (blue). Bottom, gene and conservation mapping at the FOXP3 locus, f. Effect of regulator KO on expression24of CRISPRi-tiled FOXP3 locus genes. Colored tiles indicate significant differential expression. Genes without significant differential expression across all samples are excluded. Light blue, negative regulator in Tconv screen. Red, positive regulator in Tconv screen (Padj < 0.05).
[0028] FIGS. 6A-6C. Supplementary Data: FOXP3 trans-regulator interactions. GL2024-11-02PCT / / 3730.237WO1 a-b. RNA Polymerase II ChlP-seq in resting (a) and stimulated (b) Tconv (ref.43). Two donors are shown per stimulation condition, c. Effect of regulator KO on expression24of FOXP3 trans-regulators. Colored tiles indicate significant differential expression. Genes without significant differential expression across all samples are excluded. Light blue, negative regulator in Tconv screen. Red, positive regulator in Tconv screen (Padj < 0.05).
[0029] FIGS. 7A-7C. CNSO, NCNS, and PPP cis-regulatory activity is dependent on DNA demethylation. a. Whole genome bisulfite sequencing in human Bulk T cells from 2 donors, manually aligned to the FOXP3 and PPP1R3F transcriptional start site region. CNSO and NCNS locations are indicated. Midline indicates 50% methylated. Blue, 0-50% methylated shown as a range from 0 to -1 (unmethylated). Red, 50-100% methylated, shown in a range from 0 to 1 (methylated). Two replicates per donor are shown, b. Percent FOXP3+ Tconv receiving targeting CRISPRoff gRNAs normalized to AAVS1 -targeting CRISPRoff gRNAs at 0, 24, and 48 hours post anti-CD3 / CD28 / CD2 stimulation. Stars indicate significant normalized change in %FOXP3+ Tconv relative to AAVS1 -targeting controls using a one-way ANOVA followed by Dunnett’s test (*: P < 0.05; **: P < 0.01; ***: P < 0.001; n = 2 donors x 2 gRNA conditions per targeted elements or 7 gRNA conditions targeting AAVS1 control), c. Representative flow plots of FOXP3 expression in Tconv receiving a AAVS1 -targeting CRISPRoff gRNA or gRNAs targeting the PPP1R3F promoter, CNSO and NCNS, or CNSO, NCNS, and the PPP1R3F promoter 48 hours post anti- CD3 / CD28 / CD2 stimulation.
[0030] Sequences for CNS0-3 (SEQ ID NOs: 39-41), which are regions that are enhancers of FOXP3 expression. CNSO and NCNS (SEQ ID NO: 40) arc regions involved in maintenance of FOXP3 expression. >NCNS range=chrX:49276300-49278600 TTCAAATATTTCTTTGATCTGCTGAACAACTCACTGATGTAGGTATTATT ATCCCCTCCTTAGAGATGAGGTAACTGAGGCACAGAGAGGTTAAGTAACT TGCCCCAGGTCACACAGCTGATAGGTGGCAGAGCTGGAATTGTTCAAAAT TGCATATCCTAACCCTTTATTGAGTTGTGAAATCAATTTACTGGGTTTCA ACAAGCATTAAAAAGAAAAAGGAAATAGCATAAGAAATGCCAGTGTATCA CCACATGCAGTAAAGGTAAGTATTGTTTCACTCGAAGAACAACCATTTTT CAGTTATTTATATGTCTGTTTACACGTGTGGGTGTGCTGGGTTATGATGT AGAATGGATTTCTTACTATGGGTCGTGGCCAAAGAATGAAGTCATGGCTG TTGAAGAAGCTCATGGCACGAGAAACTGCTCTCCCTCTACCCCACTGGAT CACCCGCAAGTCCCAGAGTTGAGGCTGACACACTTGTTGGGGAAGGCAAA GCAGTGCCCCACATAACTTGGTGGCTTTCACAGCCACCTTCAAACCCTGT TCTTTTCAGAAAGCAGATGGCTCAGGGTAACTGCAATTCTGAGTATCGTG GGGCAGGTTTCTGAAGCCACTCATCCCCCCGGAAAGTCAGCGTTATCTTC AGGTTGACTACATGGGAGCCGGGGTCTGCTGAGTTTCCCTTTGGGTTTCA GTGCCTGACCCACTTTGGGCTGGCAAAATTCTTTGAAAACATGAATGCTG GGGGTGCTCCAGAGGACTCGGGTGGTGGTGGCAATGGCAGTCTGTGACTG CTCTGAAAGTCTGCTTTGCTTTTCTCCACAGGGCTTGTCAGCCCTCACCC GL2024-11-02PCT / / 3730.237WO1
[0031] GCTCGCTTACTCTGTGACTGGCGAATCACCTTTCTTGGCTTTCTTGGCTG GCCTAGGCCGGGGCCAACACCACCTCTTTCCAAATCCTCACCCTCTGGTC TCCTCGGGGCCTATCAGCTTGGCAGCCATTGTGTTTCCTGATGGCCGGAG GAATTTGCACGCCCAGGAGACTGGCGTGCAGGCCTGAGATGGCCCCTTTT AGTCGACACCAGCTTGACTAGTGCTCACTAGCACCCAAATGATGCATGTC CAAGATTTTCCAGATCTGTGTGCCCTGGCCCCTATGGCTCACTGCCCTTG AGGGGATGCCACGTGGTACTTGTGGGGCTGGTGCCAAAAGAACAGGTTTC CTTCTTGAAAACGAGCAGGCATACTGCAGGTACAGTTTTGTTCTTAATCT TCTCCCTCCCCATTTTTCTAAGAACCCCTCTTCTCTGTTACCGATCAGTG AGTCAGTATACATTTGTACTTGATTTCTCTTACTATCCTCATGTTGATTG AAGTCATAGCTGCCCTTGAGTTTTTACTGTGAAAGACGGTTCAAAGATAA CTTGTTTCTTTTTAAGCCCACAATTTCAAACTCTCTTCAAAGTGGAGCCC TCCTGGAGTGTTTGTTACCAGCGTGGTTGTGTAGTCAGTGAGTGTAGAGA TGCAGTTCCTTGAGTTTTAGTTTTTGCATTTGTAAAAAGGAAGGGTGTTG TTTTGAAGGATAGATGTGAAGGTTTTCAAATGCCTTGGTGTGTCAATGAG AGGGGCCCATGGTGGAGGAGGTGAACAATACATGCTTGTGCTTTCTGCTT TCATATCTGACTTTGGAGAACGACTTGTTTGCTTCTGTCGATGTTGTGGA TCTTGGGATTGGCTCAATGGCGTGACCTGCTTTTTGGATGTTCTCGCCCT CCTCAGCCATGGAAAGGGTGCTCTGGGGGCTGAAGGATTGATTGTGTATT 1 G T 11 T T C 1 T 1 C T C C 1 T C C I C C AAC 1 GAAT T G 1 G GAG T C C T 11 AC C 1 G C 1 GGC,lAGC,l'GA,l"rCC,l'GAG,rGT,rCTCCT'l"rTTC,rG,l,CTCACA,l,CTA,l'GAC,r GCAGTGGCTTTTAGAAGCCTGTTTGTAATATATGTCCGGACTAGGCCAGA 'I'GGAGGAGAAGGCT'l'GCC'rGC'rAC'l'GCGCACAGG'l'GGGAGGGCTGGCT'l"!' CTGTCTGTCTGTGGGCCTTCTTGAAGAGGCTTGGTTTAGAAGATCCTAGG AGGAGGATGTTTTCTGTCATGAAGGACTATGGTAACAAAAAGAAGTAAGT TAGTGCAGCCTGGCAGAAATTGTGTTGAAACAAAAGTCCAAAGACCTGGA TTTTAGGACCACGGAGGGGATTGGTGTGAGACCAAGCTGGTTTGCTCTGA ATCTCTCTTTCTCATCTGTGATGTGTGGGAGGTGGCAGCTGGGCTCCCAG AGTCACCCACCCTAGGCCCTGTAGTATTCTGATTCAAGTACCTCTGGTGG
[0032] G (SEQ ID NO: 38)
[0033] >CNS0 range=chrX:49272800-49274000
[0034] GGTGCTATGATTATCCCCATTTAGTAGAGGGGAGACAGGTAGCTCAGAGA GATGAGCCAGCTTGCTCAAAGCCTCTCAGCTAGTGAGTGACAGGGCCAGG GAAGAAATGCTAGGGACATTTATTTTTTTCTATTTTTTTTTTTTAAACTG GTCCTCTAGAAAGCGTGGCATGATTCAGGGCAAATTCTGGATTTCACTCT TGGTGTTCCCAGCATGTCGTGCTTTCCTTTTACCTTTTTTTTTTTTTTTG CTTTATCGAGGTATACCTACATAAAGTGTACTGATATTCTGTGTATAGCC GL2024-11-02PCT / / 3730.237WO1
[0035] CAGTGGATTTGTACATATGTATGCACTTGTGTAGCCACCACCCAGATGAA
[0036] GATACTGAGCAGGTCCAGTACCCCAGAGCTACCTTCATTTCTATCACTTT
[0037] CCCAAGCTGTCATCCCCGCCGGCTGTCATGGGAACCCTGTCTGTAAGATG
[0038] CGACAGTTTGGGTAAAGGAGTTTGGTCATTTTAAAGAGTGTGAAAGGCAG
[0039] AGAACAGAGAAATCAAAACCTTGCAGGGCCAAGGTGGGTGGAGAGGGTGT
[0040] TTTTCTTTTAACATACATGGGCGGTTTTAAGGAGAAATTGAAGCAGCCTG
[0041] TTCAGACAATTGTTTTGGTATCTGGCCCCAGGTCTGTGGTTCCTAACATG
[0042] ACTTGTGATATTATTTTAAGTGGGCAGATGGCTTTTTGATAGCTTCTTTA
[0043] TCTTTCGATCTCAGCTCTTGCAAAGGGGAGGTTGGTGCTCATTGCAAGAT
[0044] CAGCGATAAGGGTTTCTTTGTAGGTCGGTGGCTTTCTTGGTGAGTACATT
[0045] TCAACATATTATTGTTTTAGAACCTGTGTGCTGCCAGTGACTTGCAGCAC
[0046] TGTTGAAGACTAGCCACCCTTTGTGACCTAGCCCTCTTGGGAAATGGCGG
[0047] AGGATCTCAGGGTATATCCCTTACCTGTGGGAGCCCTATCAGAGGGCTTC
[0048] CTGTTGAGGAAATGTTGGCTGTAGGCCCTCTGTGCACTGAGCACAGCCAC
[0049] ATCAGGTGAGGGCATGGGAGAAGTCCGTGGTAGCCATCAGGATAGAGTTC
[0050] AGAAACCCAAATGGCTGCTTTCCCTGGGTTGCTGGACCAGGCATTTGGTA
[0051] ACTCTAAAGCTTAGAGATGATTCATCGACAAGCATTTATTGACTGCCTAC
[0052] TGTGTGCTGGGCACAGTGCTAGGTTCCAGCAGGGAAAGAGATGCAGAGTG
[0053] G ISEQ ID NO: 39)
[0054] >CNS2 range=chrX:49260470-49261090
[0055] CCTGTGGTCACTTCTGAAGCTGCCTGGACACTTGGCCAGAGCTAAGAATT
[0056] CTCCCCAAACACATGTGGGATGGCCTGACTCAGCAAAGCATAGATACATT
[0057] CTCAGACAGGGACATGGAGATGATCTGTCTGGGGGTAGAGGACCTAGAGG
[0058] GCCGGGCTGGGCAGCCGGCTTCCTGCACTGTCTGTTGGGACGTCCCTTTC
[0059] TGACTGGGTTTCTCAGAAGCTGAATGGGGGATGTTTCTGGGACACAGATT
[0060] ATGTTTTCATATCGGGGTCTGCATCTGGGCCCTGTTGTCACAGCCCCCGA
[0061] CTTGCCCAGATTTTTCCGCCATTGACGTCATGGCGGCCGGATGCGCCGGG
[0062] CTTCATCGACACCACGGAGGAAGAGAAGAGGGCAGATACCCCACCCCACA
[0063] GGTTTCGTTCCGAGAACTGGCTGCCCTGTCCTGCAGCAGGCTTGGCCCAG
[0064] GTGGGGTGACATGGGTGCTGGTGGATGTGGTAGGTGATGTCCATCTGGCC
[0065] ACTATGACAAGCCCCTAGCTCTGAAGACCTGGCCCTTCTTGGGTTGTGGA
[0066] GAGGACCCAGGTTTGAAGCTCTGAGAGTGCCAGGCAGGCTCCACAGATAC
[0067] TGGGACCCCTGGGGTCTTCAA (SEQ ID NO: 40)
[0068] >CNS3 range=chrX:49258054-49258264
[0069] GCCTCCTCCTCTCCTGAGACAGGGATTGGGAGGTCGGGGAGAGCCTCCAA
[0070] TCTCTGAGGCCTGGCAGGTGGGGATTTTCTTGGCCCTGCAACATCTGCAT GL2024-11-02PCT / / 3730.237WO1
[0071] AAGTCACAGACTTGCCTGGGACCCAGAAACCACTTCCTGTGCCCCAGCCA GCCCCCCTCCCGCCCAGTGCCACAGTAAAGGTCGGCACCTGTAGGTCCAG GTACCCCACCC (SEQ ID NO: 41)
[0072] FIG. 8. illustrates trans regulatory gRNA sequences (SEQ ID NOs: 42-236; published gRNA library named the Brunello library and described in Sanson, K. R., et al., Nat. Commun (2018)).
[0073] DESCRIPTION
[0074] The field of modulating gene expression in immune cells has seen rapid advances with the advent of programmable genome-editing tools. In particular, the control of lineage-defining transcription factors in CD4+T cells offer a powerful means to reprogram cellular behavior. Forkhead box P3 (FOXP3) functions as a central regulator of regulatory T cell identity and suppressive capacity. While FOXP3 expression is constitutively maintained in regulatory T cells (Tregs), conventional CD4+T cells (Tconvs) can transiently express FOXP3 upon activation. Precisely tuning FOXP3 levels across distinct T cell subsets will therapeutic strategies in autoimmunity, transplantation, and oncology.
[0075] Therapeutic applications demand methods that can induce, sustain, or silence FOXP3 expression with high specificity in defined T cell populations. In autoimmune disorders or graft-versus-host disease, enforcing FOXP3 expression in autoreactive or alloreactive Tconvs can endow them with regulatory traits and limit tissue damage. Conversely, transiently dampening FOXP3 in Tregs can potentiate anti-tumor immunity by alleviating local immune suppression. Robust and scalable approaches to program FOXP3 at the genomic level enables the next generation of engineered T cell medicines tailored to diverse disease settings.
[0076] Despite extensive characterization of promoter and enhancer elements controlling FOXP3 in Tregs, existing strategies for modulating FOXP3 face significant challenges. Cytokine-driven induction yields heterogeneous and reversible FOXP3 expression, and epigenetic modifiers often lack cell-type selectivity. Viral vector-based overexpression can bypass endogenous regulatory circuits, yet risks dysregulated or supra-physiological FOXP3 levels. Current genome-editing approaches have primarily focused on coding regions or broad epigenetic marks, leaving cis-regulatory sequences in Tconvs largely unexplored. As a result, there remains a need for targeted methods that differentiate between Treg and Tconv regulatory networks.
[0077] A particular challenge lies in identifying and perturbing the noncoding control regions that govern FOXP3 induction in conventional T cells without compromising Treg function. Cell type specific enhancers and silencers have not been comprehensively mapped in human Tconvs, and the transcription factors that engage these elements remain undefined. Moreover, technologies capable of delivering precise epigenetic modifications at selected loci to stably program FOXP3 expression are not yet established. Addressing these gaps is needed for creating streamlined, context dependent control over FOXP3 in engineered T cell products.
[0078] Provided herein are methods, kits and devices for modifying Tconvs, e.g., human Tconvs. Described herein is a high-throughput CRISPRi / CRISPRn screening platform to map and functionally GL2024-11-02PCT / / 3730.237WO1 analyze cis-regulatory elements and trans-acting factors that influence FOXP3 expression in primary human Tconvs and Tregs. The simultaneous use of locus- wide CRISPRi tiling and genome-scale CRISPRn screening in primary human T cells, combined with integration of functional genomics data, enables comprehensive mapping of FOXP3 regulatory networks, which has not been described before.
[0079] The screens identify NCNS as a Tconv-speciftc positive cis-regulatory element necessary for FOXP3 induction and PPP as a negative cis-regulator of FOXP3 in human Tconvs. Selective perturbation of NCNS disrupts FOXP3 induction in Tconvs without influencing Tregs, while inactivation of PPP promotes and stabilizes FOXP3 expression in Tconvs. The ability to modulate FOXP3 expression in a cell- type-specific manner without disrupting Tregs is a distinct technical advantage that addresses the problem of non-specific modulation methods.
[0080] Provided herein is the use of CRISPRoff to induce targeted DNA methylation at specific FOXP3 regulatory elements (CNSO, NCNS, PPP), enabling stable, heritable silencing or activation of FOXP3 expression in human Tconvs. The ability to achieve durable FOXP3 modulation without altering the underlying DNA sequence represents a significant technical advancement over transient or non-specific methods.
[0081] Also provided herein is the identification and functional validation of Tconv specific FOXP3 transregulators. Described herein is the identification and validation of trans-acting factors (e.g., GATA3, STAT5A / B, FOXO1, BCL11B as positive regulators; DNMT1, MBD2, ETS1, TFDP1 as negative regulators) that specifically control FOXP3 expression in human Tconvs. This provides new molecular targets for selective modulation of FOXP3 in Tconvs, addressing the lack of tools for Tconv-spccific FOXP3 control.
[0082] Further provide herein is the generation of engineered T cell products with programmed FOXP3 expression for therapeutic applications in autoimmune disease, transplantation, and cancer immunotherapy. The ability to selectively induce, stabilize, or silence FOXP3 in defined T cell subsets without affecting other populations is novel. This approach addresses the limitations of non-specific, unstable, or unsafe T cell products previously described, enabling precision-engineered T cell therapeutics.
[0083] The methods can include (a) incubating a sample comprising human Tconvs with one or more CRISPR guide RNAs (crRNA) that bind a target site in the human genome, e.g., associated with FOXP3 expression, and a Cas enzyme or nucleic acid encoding Cas. Such methods are useful for modifying FOXP3 expression in Tconvs. The resulting modified Tconvs are useful in therapeutic methods.
[0084] One aspect provides positive and negative cis elements for controlling FOXP3 induction and expression in human CD4+T cells. In one aspect, selective perturbation of positive cis-element NCNS in CD4+T cells can selectively turn off FOXP3 expression in Tconv while allowing FOXP3 expression in Treg. In another aspect, selective perturbation of negative cis-element PPP in human CD4+cells can induce and stabilize FOXP3 in Tconv-derived Treg therapeutics to enhance Treg stability and function in autoimmune applications. In one aspect, FOXP3 induction in T cells (as described) can additionally limit GL2024-11-02PCT / / 3730.237WO1 restimulation-induced cell death or alter T cell metabolic state to generate more robust engineered T cell therapeutics to treat cancer.
[0085] (CRISPR)ZCRISPR-associated (Cas) systems
[0086] Genomic editing has been performed by using clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems (see e.g., Marraffini and Sontheimer. Nature Reviews Genetics 11 : 181-190 (2010); Sorek et al. Nature Reviews Microbiology 2008 6: 181-6; Karginov and Hannon. Mol Cell 2010 1 :7- 19; Hale et al. Mol Cell 2010:45:292-302; Jinek et al. Science 2012 337:815- 820; Bikard and Marraffini Curr Opin Immunol 2012 24: 15-20; Bikard et al. Cell Host & Microbe 2012 12: 177-186; all of which are incorporated by reference herein in their entireties).
[0087] However, a CRISPR guide RNA system can be adapted for use in the methods and compositions described herein. Two RNAs can be used in CRISPR genomic editing systems: a CRISPR RNA (crRNA), which is a 17-20 nucleotide sequence complementary to the target RNA, and a trans-activating crRNA (tracrRNA) that is a binding scaffold for the Cas nuclease. In some cases, the two RNAs are fused to make a single guide RNA (sgRNA). The tracrRNA forms a stem loop that is recognized and bound by the cas nuclease. The crRNA typically has shorter sequence than the tracrRNA. The term “guide RNA” as used herein refers to either a single guide RNA (sgRNA) or a crRNA. The CRISPR technique is generally described, for example, by Mali et al. Science 339:823-6 (2013); which is incorporated by reference herein in its entirety.
[0088] The guide RNA system used herein is encoded within or adjacent to the ncRNA coding region of the expression cassettes. Hence, upon transcription of the guide RNA, it can target a Cas enzyme to the desired location in the genome, where it can cleave the genomic RNA for generation of a genomic modification or alter gene expression at the site by targeting CRISPRi, CRISPRa, CRISPRon, or CRISPRoff machinery to the site.
[0089] CRISPR / Cas
[0090] The Type II CRISPR is a well characterized system that carries out targeted DNA double-strand break in four sequential steps. First, two non-coding RNA, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat regions of the pre-crRNA and mediates the processing of pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA: tracrRNA complex directs Cas9 to the target DNA via Watson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates cleavage of target DNA to create a double-stranded break within the protospacer. Activity of the CRISPR / Cas system comprises of three steps: (i) insertion of alien DNA sequences into the CRISPR array to prevent future attacks, in a process called 'adaptation, ' (ii) expression of the relevant proteins, as well as expression and processing of the array, followed by (iii) RNA-mediated interference with the alien nucleic acid. Thus, in the bacterial cell, several of the so-called 'Cas' proteins are involved with the natural function of the GL2024-11-02PCT / / 3730.237WO1
[0091] CRISPR / Cas system. The primary products of the CRISPR loci appear to be short RNAs that contain the invader targeting sequences, and are termed guide RNAs
[0092] "Casl" polypeptide refers to CRISPR associated (Cas) proteinl. Casl (COG1518 in the Clusters of Orthologous Group of proteins classification system) is the best marker of the CRISPR-associated systems (CASS). Based on phylogenetic comparisons, seven distinct versions of the CRISPR-associated immune system have been identified (CASS 1-7). Casl polypeptide used in the methods described herein can be any Casl polypeptide present in any prokaryote. In certain embodiments, a Casl polypeptide is a Casl polypeptide of an archaeal microorganism. In certain embodiments, a Casl polypeptide is a Casl polypeptide of a Euryarchaeota microorganism. In certain embodiments, a Casl polypeptide is a Casl polypeptide of a Crenarchaeota microorganism. In certain embodiments, a Casl polypeptide is a Casl polypeptide of a bacterium. In certain embodiments, a Casl polypeptide is a Casl polypeptide of a gram negative or gram-positive bacteria. In certain embodiments, a Casl polypeptide is a Casl polypeptide of Pseudomonas aeruginosa. In certain embodiments, a Casl polypeptide is a Casl polypeptide of Aquifex aeolicus. In certain embodiments, a Casl polypeptide is a Casl polypeptide that is a member of one of CASsl-7. In certain embodiments, Casl polypeptide is a Casl polypeptide that is a member of CASS3. In certain embodiments, a Casl polypeptide is a Casl polypeptide that is a member of CASS7. In certain embodiments, a Casl polypeptide is a Casl polypeptide that is a member of CASS3 or CASS7.
[0093] In some embodiments, a Casl polypeptide is encoded by a nucleotide sequence provided in GenBank at, e.g., GenelD number: 2781520, 1006874, 9001811, 947228, 3169280, 2650014, 1175302, 3993120, 4380485, 906625, 3165126, 905808, 1454460, 1445886, 1485099, 4274010, 888506, 3169526, 997745, 897836, or 1193018 and / or an amino acid sequence exhibiting homology (e.g., greater than 80%, 90 to 99% including 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) to the amino acids encoded by these polynucleotides and which polypeptides function as Casl polypeptides.
[0094] There are three types of CRISPR / Cas systems which all incorporate RNAs and Cas proteins. Types I and III both have Cas endonucleases that process the pre-crRNAs, that, when fully processed into crRNAs, assemble a multi-Cas protein complex that is capable of cleaving nucleic acids that are complementary to the crRNA.
[0095] In type II CRISPR / Cas systems, crRNAs are produced using a different mechanism where a transactivating RNA (tracrRNA) complementary to repeat sequences in the pre-crRNA, triggers processing by a double strand-specific RNase III in the presence of the Cas9 protein. Cas9 is then able to cleave a target DNA that is complementary to the mature crRNA however cleavage by Cas 9 is dependent both upon basepairing between the crRNA and the target DNA, and on the presence of a short motif in the crRNA referred to as the PAM sequence (protospacer adjacent motif)). In addition, the tracrRNA must also be present as it base pairs with the crRNA at its 3' end, and this association triggers Cas9 activity.
[0096] The Cas9 protein has at least two nuclease domains: one nuclease domain is similar to a HNH endonuclease, while the other resembles a Ruv endonuclease domain. The HNH-type domain appears to GL2024-11-02PCT / / 3730.237WO1 be responsible for cleaving the DNA strand that is complementary to the crRNA while the Ruv domain cleaves the non-complementary strand.
[0097] The requirement of the crRNA-tracrRNA complex can be avoided by use of an engineered "singleguide RNA" (sgRNA) that comprises the hairpin normally formed by the annealing of the crRNA and the tracrRNA (see Jinek, et aL (2012) Science 337:816 and Cong et al. (2013) Sciencexpress / 10.1126 / science.1231143). In S. pyrogenes, the engineered tracrRNA: crRNA fusion, or the sgRNA, guides Cas9 to cleave the target DNA when a double strand RNA:DNA heterodimer forms between the Cas associated RNAs and the target DNA. This system comprises the Cas9 protein and an engineered sgRNA
[0098] "Cas polypeptide" encompasses a full-length Cas polypeptide, an enzymatically active fragment of a Cas polypeptide, and enzymatically active derivatives of a Cas polypeptide or fragment thereof. Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof.
[0099] RNA Components of CRISPR / Cas
[0100] The Cas9 related CRISPR / Cas system comprises two RNA non-coding components: tracrRNA and a pre-crRNA array containing nuclease guide sequences (spacers) interspaced by identical direct repeats (DRs). To use a CRISPR / Cas system to accomplish genome engineering, both functions of these RNAs must be present (see Cong, et al. (2013) Sciencexpress 1 / 10.1126 / science 1231143). In some embodiments, the tracrRNA and pre-crRNAs are supplied via separate expression constructs or as separate RNAs. In other embodiments, a chimeric RNA is constructed where an engineered mature crRNA (conferring target specificity) is fused to a tracrRNA (supplying interaction with the Cas9) to create a chimeric cr-RNA- tracrRNA hybrid (also termed a single guide RNA). (see Jinek, ibid and Cong, ibid).
[0101] Chimeric or sgRNAs can be engineered to comprise a sequence complementary to any desired target. The RNAs comprise 22 bases of complementarity to a target and of the form G[nl9], followed by a protospacer-adjacent motif (PAM) of the form NGG. Alternatively, sgRNAs can be designed to target any region of interest simply by identifying a suitable target sequence that conforms to the G[n20]GG formula.
[0102] A polynucleotide having one or more gRNAs can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. Moreover, gRNAs can be introduced as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
[0103] There are several types of CRISPR systems, some of which are summarized in the chart below.
[0104] CRISPR System Types Overview GL2024-11-02PCT / / 3730.237WO1
[0105] A “guide RNA” or “gRNA” as provided herein refers to a ribonucleotide sequence capable of binding a cas nuclease, thereby forming ribonucleoprotein complex. The gRNA includes a nucleotide sequence complementary to a target site (e.g., near or at a genomic site to be edited). In some cases, the guide RNA includes one or more RNA molecules. TracrRNAs can be used to facilitate assembly of a ribonucleoprotein complex that includes the gRNA together with the tracrRNA and a cas nuclease. A complementary nucleotide sequence of the guide RNA can mediate binding of the ribonucleoprotein complex to the target site thereby providing the sequence specificity of the ribonucleoprotein complex. Thus, the guide RNA includes a sequence that is complementary to a target nucleic acid sequence such that the guide RNA binds a target nucleic acid sequence.
[0106] In some cases, the complement of the guide RNA includes a sequence having a sequence identity of about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% to a target nucleic acid (e.g., a target viral RNA sequence). In some cases, the guide RNA includes a sequence having sequence identity of about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% to the target nucleic acid sequence. In some cases, the guide RNA or complement thereof, includes a sequence having a sequence identity of at least about 90%, 95%, or 100% to a target sequence. In some cases, segment bound by a guide RNA within the target nucleic acid is about or at least about 10, 15, 20, 25, or more nucleotides in length.
[0107] The guide RNA is a single-stranded ribonucleic acid, although in some cases it may form some double-stranded regions by folding onto itself. In some cases, the guide RNA is about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more nucleic acid residues in length. In some cases, the guide RNA is from about 10 to about 30 nucleic acid residues in length. In some cases, the guide RNA is about 20 nucleic acid residues in length. For example, the length of the guide RNA can be at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
[0108] 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
[0109] 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
[0110] 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
[0111] 99, 100 or more nucleotides or residues in length. In some cases, the guide RNA is from 5 to 50, 10 to 50, 15 to 50, 20 to 50, 25 to 50, 30 to 50, 35 to 50, 40 to 50, 45 to 50, 5 to 75, 10 to 75, 15 to 75, 20 to 75, 25 GL2024-11-02PCT / / 3730.237WO1 to 75, 30 to 75, 35 to 75, 40 to 75, 45 to 75, 50 to 75, 55 to 75, 60 to 75, 65 to 75, 70 to 75, 5 to 100, 10 to 100, 15 to 100, 20 to 100, 25 to 100, 30 to 100, 35 to 100, 40 to 100, 45 to 100, 50 to 100, 55 to 100, 60 to 100, 65 to 100, 70 to 100, 75 to 100, 80 to 100, 85 to 100, 90 to 100, 95 to 100, or more nucleotides or residues in length. In some cases, the guide RNA is from 10 to 15, 10 to 20, 10 to 30, 10 to 40, or 10 to 50 residues in length.
[0112] Exemplary CRISPR guide RNA (crRNA)
[0113] A CRISPR guide RNA system can be adapted for use in the methods and compositions described herein. The guide RNAs can include: a CRISPR RNA (crRNA or spacer), which is a 17-20 nucleotide sequence complementary to the target DNA, and a trans-activating crRNA (tracrRNA or stem) that is a binding scaffold for the Cas nuclease. In some cases, the two RNAs are fused to make a single guide RNA (sgRNA). The tracrRNA forms a stem loop that is recognized and bound by the Cas nuclease. The term “guide RNA” as used herein refers to either a single guide RNA (sgRNA) or a crRNA (spacer). The CRISPR technique is generally described, for example, by Mali et al. Science 339:823-6 (2013): which is incorporated by reference herein in its entirety.
[0114] In some cases, the at least one CRISPR guide RNA (crRNA) has a sequence with at least 95% sequence identity to any of SEQ ID NOs: 1 to 34, or a nucleotide sequence with at least 80%, 82%, 84%, 85%, 87%, 89%, 90%, 92%, 94%, 95%, 97%, 98% or 99% nucleic acid sequence identity thereto, or a combination thereof.
[0115] GL2024-11-02PCT / / 3730.237WO1
[0116] In some cases, the cellular sample can be incubated with one or two or more crRNAs. For example, the sample can be incubated with at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or at least eight, or at least nine, or at least ten, or more crRNAs. In some cases, the at least one crRNA has at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or more sequence identity to any SEQ ID NOs: 1 to 34. In some cases, the targeting sequence in at least one crRNA has at least about 70%, about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, or more sequence identity to any SEQ ID NO: 1 to 34.
[0117] In one example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more crRNAs specific for one or more cis- or trans- regulatory regions for FOXP3 are employed in a method to alter the activity of T cells, e.g., in a physiological sample. GL2024-11-02PCT / / 3730.237WO1
[0118] Positive and negative cis elements controlling FOXP3 induction and expression in human CD4+T cells are provided herein. Selective perturbation of positive cis-element NCNS in CD4+T cells can selectively turn off FOXP3 expression in Tconv while allowing FOXP3 expression in Treg, or selective perturbation of negative cis-element PPP in human CD4+cells can induce and stabilize FOXP3 in Tconv- derived Treg therapeutics to enhance Treg stability and function in autoimmune applications. FOXP3 induction in T cells (as described) can additionally limit restimulation-induced cell death or alter T cell metabolic state to generate more robust engineered T cell therapeutics to treat cancer. In some cases, the at least one CRISPR guide RNA (crRNA) has a sequence with at least 95% sequence identity to any of SEQ ID NOs: 1 to 34, or a nucleotide sequence with at least 80%, 82%, 84%, 85%, 87%, 89%, 90%, 92%, 94%, 95%, 97%, 98% or 99% nucleic acid sequence identity thereto, or a combination thereof.
[0119] In various methods, crRNA(s) that can be used to suppress FOXP3 expression (one or more of SEQ ID NOS: 1 to 34). These guide RNAs can also be used enhance FOXP3 expression in various methods. In some cases, the crRNAs can include additional sequences such as spacer sequences.
[0120] Exemplary Cells for Modification
[0121] In one embodiment, the cells that are modified with gRNAs or the genome of which is modified to have the modified sites described herein or expresses a protein have one or more of the modifications disclosed herein, are immune cells. In one embodiment, the cells are T cells. In one embodiment, the cells are Tconvs cells. In one embodiment, the cells are Teff cells. In one embodiment, the cells are CD4+cells. In one embodiment, the cells are CD8+cells. In one embodiment, the cells are CAR-T cells. In one embodiment, the cells arc naive T cells, stem cell memory cells, T SCM; T Central Memory cells, T CM; T effector memory cells, T EM; or T effector cells, T BEE. In one embodiment, the cells are Th (T helper)!, Th2, Th9, Th 17, Th22, Treg (regulatory T cells), or Tfh (follicular helper T cells). In one embodiment, the cells are regulatory T cells, NK cells, or B cells.
[0122] Exemplary Therapeutic Uses of Modified Cells
[0123] Ex vivo or in vivo genome edited immune cells can be employed for therapeutic purposes. In addition, synthetic constructs that alter immune cell function (e.g., by incorporating or using functional proteins or protein domains that are identified by the screening method) may be employed for therapeutic purposes.
[0124] Immune cells modified as described herein may be employed in a method to prevent, inhibit or treat an autoimmune disease. In one embodiment, cells of a mammal may be obtained and modified as described herein and reintroduced to the mammal to, for example, suppress an immune function in the mammal, thereby alleviating one or more symptoms of the autoimmune disease. Autoimmune diseases within the scope of this disclosure include but are not limited to rheumatoid arthritis, Crohn's disease, multiple sclerosis, systemic lupus erythematosus (SLE), autoimmune encephalomyelitis, myasthenia gravis (MG), Hashimoto's thyroiditis, Goodpasture's syndrome, pemphigus (e.g., pemphigus vulgaris), Grave's disease, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, scleroderma with anti-collagen antibodies, mixed connective tissue disease, polymyositis, pernicious anemia, idiopathic GL2024-11-02PCT / / 3730.237WO1
[0125] Addison's disease, autoimmune-associated infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), bullous pemphigoid, Sjogren's syndrome, insulin resistance, and autoimmune diabetes mellitus (type 1 diabetes mellitus; insulin-dependent diabetes mellitus). In one embodiment, the autoimmune disease is multiple sclerosis (MS), systemic sclerosis (SSc), type 1 diabetes (T1D), Grave's disease (GD), systemic lupus erythematosus (SLE), aplastic anemia (AA), or vitiligo.
[0126] Immune cells modified as described herein may be employed in a method to prevent, inhibit or treat cancer. In one embodiment, cells of a mammal may be obtained and modified as described herein and reintroduced to the mammal to, for example, augment an immune function in the mammal, thereby alleviating one or more symptoms of the cancer. Cancers within the scope of this disclosure include but are not limited to carcinomas (e.g., squamous-cell carcinomas, adenocarcinomas, hepatocellular carcinomas, and renal cell carcinomas), particularly those of the bladder, bone, bowel, breast, cervix, colon (colorectal), esophagus, head, kidney, liver (hepatocellular), lung, nasopharyngeal, neck, ovary, pancreas, prostate, and stomach; leukemias, such as acute myelogenous leukemia, acute lymphocytic leukemia, acute promyelocytic leukemia (APL), acute T-cell lymphoblastic leukemia, adult T-cell leukemia, basophilic leukemia, eosinophilic leukemia, granulocytic leukemia, hairy cell leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, neutrophilic leukemia and stem cell leukemia; benign and malignant lymphomas, particularly Burkitt's lymphoma, Non-Hodgkin's lymphoma and B-cell lymphoma; benign and malignant melanomas; myeloproliferative diseases; sarcomas, particularly Ewing's sarcoma, hemangiosarcoma, Kaposi's sarcoma, liposarcoma, myosarcomas, peripheral neuroepithelioma, and synovial sarcoma; tumors of the central nervous system (e.g., gliomas, astrocytomas, oligodendrogliomas, ependymomas, glioblastomas, neuroblastomas, ganglioneuromas, gangliogliomas, medulloblastomas, pineal cell tumors, meningiomas, meningeal sarcomas, neurofibromas, and Schwamromas); germ-line tumors (e.g., bowel cancer, breast cancer, prostate cancer, cervical cancer, uterine cancer, lung cancer (e.g., small cell lung cancer, mixed small cell and non-small cell cancer, pleural mesothelioma, including metastatic pleural mesothelioma small cell lung cancer and non-small cell lung cancer), ovarian cancer, testicular cancer, thyroid cancer, astrocytoma, esophageal cancer, pancreatic cancer, stomach cancer, liver cancer, colon cancer, and melanoma; mixed types of neoplasias, particularly carcinosarcoma and Hodgkin's disease; and tumors of mixed origin, such as Wilms' tumor and teratocarcinomas, among others.
[0127] Edited cells described herein may be used to alleviate symptoms and / or progression of graft- versus-host disease (GvHD) and promote transplant tolerance. This can include solid organ transplants.
[0128] Vectors or Vehicles for Delivery
[0129] Delivery vectors or vehicles include, for example, viral vectors, microparticles, nanoparticles, liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of nucleic acid, e.g., gRNA or encoding a polypeptide, or a protein to a host cell, e.g., GL2024-11-02PCT / / 3730.237WO1 a gene to provide for recombinant expression of a polypeptide encoded by the gene. Vectors or vehicles can also comprise other components or functionalities that further modulate gene delivery and / or gene expression, or that otherwise provide beneficial properties. Such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector by the cell; components that influence localization of the transferred gene within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the gene. Such components also might include markers, such as detectable and / or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector or have taken up protein delivered by a vehicle. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Selectable markers can be positive, negative or bifunctional. Positive selectable markers allow selection for cells carrying the marker, whereas negative selectable markers allow cells carrying the marker to be selectively eliminated. A variety of such marker genes have been described, including bifunctional (i.e., positive / negative) markers (see, e.g., WO 92 / 08796; and WO 94 / 28143). Such marker genes can provide an added measure of control that can be advantageous in gene therapy contexts. A large variety of such vectors are known in the art and are generally available.
[0130] Vectors or vehicles within the scope of the disclosure include, but are not limited to, isolated nucleic acid, e.g., plasmid-based vectors which may be extra-chromosomally maintained, and viral vectors, e.g., recombinant adenovirus, retrovirus, lentivirus, herpesvirus, poxvirus, papilloma virus, or adcno-associatcd virus, including viral and non-viral vectors, or proteins which are present in liposomes, e.g., neutral or cationic liposomes, such as DOSPA / DOPE, DOGS / DOPE or DMRIE / DOPE liposomes, and / or associated with other molecules such as DNA-anti-DNA antibody-cationic lipid (DOTMA / DOPE) complexes. Vectors or vehicles may be administered via any route including, but not limited to, intramuscular, buccal, rectal, intravenous or intracoronary administration, and transfer to cells may be enhanced using electroporation and / or iontophoresis. In one embodiment, vectors are locally administered.
[0131] Retroviral vectors
[0132] Retroviral vectors exhibit several distinctive features including their ability to stably and precisely integrate into the host genome providing long-term transgene expression. These vectors can be manipulated ex vivo to eliminate infectious gene particles to minimize the risk of systemic infection and patient-to-patient transmission. Pseudotyped retroviral vectors can alter host cell tropism.
[0133] Lentiviruses
[0134] Lentiviruses are derived from a family of retroviruses that include human immunodeficiency virus and feline immunodeficiency virus. However, unlike retroviruses that only infect dividing cells, lentiviruses can infect both dividing and nondividing cells. Although lentiviruses have specific tropisms, pseudotyping the viral envelope with vesicular stomatitis virus yields virus with a broader range (Schnepp et al., Meth. Mol. Med., 69:427 (2002)). GL2024-11-02PCT / / 3730.237WO1
[0135] Adenoviral vectors
[0136] Adenoviral vectors may be rendered replication-incompetent by deleting the early (El A and E1B) genes responsible for viral gene expression from the genome and are stably maintained into the host cells in an extrachromosomal form. These vectors have the ability to transfect both replicating and nonreplicating cells and, in particular, these vectors have been shown to efficiently infect cardiac myocytes in vivo, e.g., after direction injection or perfusion. Adenoviral vectors have been shown to result in transient expression of therapeutic genes in vivo, peaking at 7 days and lasting approximately 4 weeks. The duration of transgene expression may be improved in systems utilizing neural specific promoters. In addition, adenoviral vectors can be produced at very high titers, allowing efficient gene transfer with small volumes of virus.
[0137] Adeno-associated virus vectors
[0138] Recombinant adeno-associated viruses (rAAV) are derived from nonpathogenic parvoviruses, evoke essentially no cellular immune response, and produce transgene expression lasting months in most systems. Moreover, like adenovirus, adeno-associated virus vectors also have the capability to infect replicating and nonreplicating cells and are believed to be nonpathogenic to humans.
[0139] AAV vectors include but are not limited to AAV1, AAV2, AAV5, AAV7, AAV8, AAV9 or AAVrh.10.
[0140] Plasmid DNA vectors
[0141] Plasmid DNA is often referred to as "naked DNA" to indicate the absence of a more elaborate packaging system. Direct injection of plasmid DNA to myocardial cells in vivo has been accomplished. Plasmid-based vectors are relatively nonimmunogenic and nonpathogenic, with the potential to stably integrate in the cellular genome, resulting in long-term gene expression in postmitotic cells in vivo. Plasmid DNA may be delivered to cells as part of a macromolecular complex, e.g., a liposome or DNA-protein complex, and delivery may be enhanced using techniques including electroporation.
[0142] Formulations and Dosages
[0143] The modified immune cells can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human patient in a variety of forms adapted to the chosen route of administration, e.g., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.
[0144] In one embodiment, the immune cells may be administered by infusion or injection. Solutions of the immune cells can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[0145] The pharmaceutical dosage forms suitable for injection or infusion may include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under GL2024-11-02PCT / / 3730.237WO1 the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it may be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0146] Sterile injectable solutions are prepared by incorporating the active agent in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation include vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.
[0147] Useful solid carriers may include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water-alcohol / glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as antimicrobial agents can be added to optimize the properties for a given use. Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.
[0148] Useful dosages of the cells may be from 1 x 104to 1 x 106, 1 x 105to 1 x 107, 1 x 106to 1 x 108, 1 x 107to 1 x 109, 1 x 108to 1 x IO10, 1 x IO10to 1 x 1012, or 1 x 1011to 1 x 1015cells.
[0149] The amount of for use alone or with other agents will vary with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.
[0150] Definitions
[0151] The term "about" as used herein when referring to a measurable value such as an amount, a length, and the like, is meant to encompass variations of ±20% or +10%, including +5%, +1%, or +0.1% from the specified value.
[0152] "Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, bacterial, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation, is not associated with all or a portion of the polynucleotide with which it is associated in nature. GL2024-11-02PCT / / 3730.237WO1
[0153] The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. In general, the polynucleotide of interest is cloned and then expressed in transformed organisms, for example, as described herein. The host organism expresses the foreign nucleic acids to produce the RNA, RT-DNA, or protein under expression conditions.
[0154] As used herein, a "cell" refers to any type of cell isolated from a prokaryotic, eukaryotic, or archaeon organism, including bacteria, archaea, fungi, protists, plants, and animals, including cells from tissues, organs, and biopsies, as well as recombinant cells, cells from cell lines cultured in vitro, and cellular fragments, cell components, or organelles comprising nucleic acids. The term also encompasses artificial cells, such as nanoparticles, liposomes, polymersomes, or microcapsules encapsulating nucleic acids. The methods described herein can be performed, for example, on a sample comprising a single cell or a population of cells. The term also includes genetically modified cells.
[0155] "Recombinant host cells," "host cells", "cells", "cell lines", "cell cultures", and other such terms denoting microorganisms or higher eukaryotic cell lines cultured as unicellular entities refer to cells which can be, or have been, used as recipients for recombinant vector or other transferred DNA, and include the original progeny of the original cell which has been transfected.
[0156] A "coding sequence" or a sequence which "encodes" a selected polypeptide or a selected RNA, is a nucleic acid molecule which is transcribed (in the case of DNA templates) into RNA and / or translated (in the case of mRNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences (or "control elements"). The boundaries of the coding sequence can be determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, ncRNAs, tracrRNAs, ncRNAs modified to include heterologous sequences, cDNA from viral, prokaryotic or eukaryotic ncRNA (e.g., IncRNA), mRNA, viral or prokaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence may be located 3' to the coding sequence.
[0157] Typical "control elements," include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, poly adenylation sequences (located 3' to the translation stop codon), sequences for optimization of initiation of translation (located 5’ to the coding sequence), and translation termination sequences.
[0158] "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper polymerases are present. The promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence, and the promoter sequence can still be considered "operably linked" to the coding sequence.
[0159] "Encoded by" refers to a nucleic acid sequence which codes for a polypeptide or RNA sequence. For example, the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 GL2024-11-02PCT / / 3730.237WO1 to 5 amino acids, more preferably at least 8 to 10 amino acids, and even more preferably at least 15 to 20 amino acids from a polypeptide encoded by the nucleic acid sequence. The RNA sequence or a portion thereof contains a nucleotide sequence of at least 3 to 5 nucleotides, more preferably at least 8 to 10 nucleotides, and even more preferably at least 15 to 20 nucleotides.
[0160] The terms ’ isolated," "purified," or "biologically pure" refer to material that is free to varying degrees from components which normally accompany it as found in its native state. "Isolate" denotes a degree of separation from original source or surroundings. "Purify" denotes a degree of separation that is higher than isolation. A "purified" or "biologically pure" protein is sufficiently free of other materials such that any impurities do not materially affect the biological properties of the protein, DNA, or RNA or cause other adverse consequences. That is, a nucleic acid or peptide of this invention is purified if it is substantially free of cellular material, viral material, or culture medium when obtained from nature or when produced by recombinant DNA techniques, or free from chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, for example, polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term "purified" can denote that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For a protein that can be subjected to modifications, for example, phosphorylation or glycosylation, different modifications may give rise to different isolated proteins, which can be separately purified.
[0161] "Substantially purified" generally refers to isolation of a substance (nucleic acid, compound, polynucleotide, protein, polypeptide, peptide composition) such that the substance comprises the majority percent of the sample in which it resides. Typically, in a sample, a substantially purified component comprises 50%, including 80%-85%, including 90-95% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well-known in the art and include, for example, ionexchange chromatography, affinity chromatography and sedimentation according to density.
[0162] A "vector" is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non- viral vectors, particulate carriers, and liposomes). Typically, "vector construct," "expression vector," and "gene transfer vector," mean any nucleic acid construct capable of directing the expression of a nucleic acid of interest and which can transfer nucleic acid sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.
[0163] "Expression" refers to detectable production of a gene product by a cell. The gene product may be a transcription product (i.e., RNA), which may be referred to as "gene expression", or the gene product may be a translation product of the transcription product (i.e., a protein), depending on the context.
[0164] "Mammalian cell" refers to any cell derived from a mammalian subject suitable for transfection with vector systems comprising, as described herein. The cell may be xenogeneic, autologous, or allogeneic. The cell can be a primary cell obtained directly from a mammalian subject. The cell may also be a cell derived from the culture and expansion of a cell obtained from a mammalian subject. Immortalized GL2024-11-02PCT / / 3730.237WO1 cells are also included within this definition. In some embodiments, the cell has been genetically engineered to express a recombinant protein and / or nucleic acid.
[0165] The term "subject" includes animals, including both vertebrates and invertebrates, including, without limitation, invertebrates such as arthropods, mollusks, annelids, and cnidarians; and vertebrates such as amphibians, including frogs, salamanders, and caecillians; reptiles, including lizards, snakes, turtles, crocodiles, and alligators: fish; mammals, including human and non-human mammals such as nonhuman primates, including chimpanzees and other apes and monkey species; laboratory animals such as mice, rats, rabbits, hamsters, guinea pigs, and chinchillas; domestic animals such as dogs and cats; farm animals such as sheep, goats, pigs, horses and cows; and birds such as domestic, wild and game birds, including chickens, turkeys and other gallinaceous birds, ducks, geese, and the like. In some cases, the disclosed methods find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; primates, and transgenic animals.
[0166] FOXP3 (forkhead box P3; FOX proteins belong to the forkhead / winged-helix family of transcriptional regulators and are presumed to exert control via similar DNA binding interactions during transcription), also known as scurfin, is a protein involved in immune system responses. A member of the FOX protein family, FOXP3 appears to function as a master regulator of the regulatory pathway in the development and function of regulatory T cells. Regulatory T cells generally turn the immune response down. In cancer, an excess of regulatory T cell activity can prevent the immune system from destroying cancer cells. In autoimmune disease, a deficiency of regulatory T cell activity can allow other autoimmune cells to attack the body's own tissues.
[0167] The human FOXP3 genes contain 11 coding exons. Exon-intron boundaries are identical across the coding regions of the mouse and human genes. By genomic sequence analysis, the FOXP3 gene maps to the p arm of the X chromosome (specifically, Xpll.23; Chr X: 49.25 - 49.27). Human mRNA sequence for FOXP3 can be found at accession numbers NM_001114377, NM_014009’ human protein sequence can be found at NP_001107849, NP_054728 (all accession numbers and their sequences are incorporated herein by references).
[0168] An example of human FOXP3 mRNA sequence (SEQ ID NO: 35)
[0169] 1 agtttcccac aagccaggct gatccttttc tgtcagtcca cttcaccaag cctgcccttg
[0170] 61 gacaaggacc cgatgcccaa ccccaggcct ggcaagccct cggccccttc cttggccctt
[0171] 121 ggcccatccc caggagcct c gcccagctgg agggctgcac ccaaagcctc agacctgctg
[0172] 181 ggggcccggg gcccaggggg aaccttccag ggeegagate ttegaggegg ggcccatgcc
[0173] 241 tcctcttctt ccttgaaccc catgccacca tcgcagctgc agctctcaac ggtggatgcc
[0174] 301 cacgcccgga cccctgagct gcaggtgcac cccctggaga gcccagccat gatcagcctc
[0175] 361 acaccaccca ccaccgccac Lgggg LcL Lc LcccLcaagg cccggccLgg cclcccaccL
[0176] 421 gggatcaacg tggccagcct ggaatgggtg tccagggagc cggcactgct ctgcaccttc
[0177] 481 ccaaat ccca gtgcacccag gaaggacagc acccttt cgg ctgtgcccca gagctcctac
[0178] 541 ccactgctgg caaatggtgt etgeaagtgg cccggatgtg agaaggtett cgaagagcca GL2024-11-02PCT / / 3730.237WO1
[0179] 601 gaggacttcc tcaagcactg ccaggcggac catcttctgg atgagaaggg cagggcacaa 661 tgtctcctcc agagagagat ggtacagtct ctggagcagc agctggtgct ggagaaggag 721 aagctgagtg ccatgcaggc ccacctggct ggqaaaatqq cactgaccaa qqcttcatct 781 gtggcatcat ccgacaaggg ctcctgctgc atcqtaqctq ctgqcaqcca aqgccctgtc 841 gtcccagcct ggtctggccc ccgggaggcc cctqacagcc tgttaqctqt ccgqagqcac 901 ctgtggggta gccatggaaa cagcacattc ccaqaqttcc tccacaacat qqactacttc 961 aagttccaca acatgcgacc ccctttcacc tacgccacgc tcatccgctg ggccatcctg 1021 gaggctccag agaagcagcg gacactcaat gagatctacc actggttcac acgcatgttt 1081 gccttcttca gaaaccatcc tgccacctgg aaqaacqcca tccqccacaa cctqagt ctq 1141 cacaaqtgct ttgtgcggqt qqaqaqcqaq aaqqqqqctq tqtqqaccqt qqatqaqctq 1201 gaqttccqca agaaacggag ccaqaqqccc agcagqtgtt ccaaccctac acctggcccc 1261 tgacctcaag atcaaqgaaa qgaqgatgqa cgaacaqgqq ccaaactgqt qqgaqgcaga 1321 ggtggtgggg gcagggatga taggccctgg atgtgcccac agggaccaag aagtgaggtt 1381 tccactgtct tgcctgccag ggcccctgtt cccccgctgg cagccacccc ctcccccatc 1441 atatcctttg ccccaaggct qctcaqagqq qccccqqtcc tqgccccaqc ccccacctcc 1501 gccccagaca caccccccag tcqagccctg caqccaaaca qagccttcac aaccagccac 1561 acagaqcctg cctcaqctqc tcqcacagat tacttcagqq ctgqaaaaqt cacacaqaca 1621 cacaaaaLg L cacaa Lcc Lg LcccLcac Lc aacacaaacc ccaaaacaca gagagcc Lgc 1681 ctcagtacac tcaaacaacc tcaaagctgc atcatcacac aatcacacac aagcacagcc 1741 ctgacaaccc acacacccca aggcacgcac ccacagccag cctcagggcc cacaggggca 1801 ctqtcaacac aggggtgtgc ccaqaqqcct acacaqaaqc aqcqacagta ccctcaqgat 1861 ctqaqqtccc aacacqagct cgctcacaca cacqgcctqt tagaattcac ctgtgtatct 1921 cacgcatatg cacacqcaca qccccccaqt gggtctcttg agtcccgtgc agacacacac 1981 agccacacac actgccatgc caaaaatacc ccgtgtctcc cctgccactc acctcactcc 2041 cattccctga gccctgatcc atgcctcagc ttagactgca gaggaactac tcatttattt 2101 gggatccaag gcccccaacc cacagtaccg t ccccaataa actgcagccg agctcccca
[0180] An example of human FOXP3 protein sequence (SEQ ID NO: 36)
[0181] 1 MPNPRPGKPS APSLALGPSP GASPSWRAAP KASDLLGARG PGGTFQGRDL RGGAHASSSS
[0182] 61 LNPMPPSQLQ LPTLPLVMVA PSGARLGPLP HLQALLQDRP HFMHQLSTVD AHARTPVLQV
[0183] 121 HPLESPAMIS LTPPTTATGV FSLKARPGLP PGINVASLEW VSREPALLCT FPNPSAPRKD
[0184] 181 STLSAVPQSS YPLLANGVCK WPGCEKVFEE PEDFLKHCQA DHLLDEKGRA QCLLQREMVQ
[0185] 241 SLEQQLVLEK EKLSAMQAHL AGKMALTKAS SVASSDKGSC CIVAAGSQGP VVPAWSGPRE
[0186] 301 APDSLFAVRR HLWGSHGNST FPEFLHNMDY FKFHNMRPPF TYATLIRWAI LEAPEKQRTL
[0187] 361 NEIYHWFTRM FAFFRNHPAT WKNAIRHNLS LHKCFVRVES EKGAVWTVDE LEFRKKRSQR
[0188] 421 PSRCSNPTPG P
[0189] In regulatory T cell model systems, the FOXP3 transcription factor occupies the promoters for genes involved in regulatory T-cell function and may inhibit transcription of key genes following stimulation of T cell receptors.
[0190] "Gene transfer" or "gene delivery" refers to methods or systems for reliably inserting DNA or RNA of interest into a host cell. Such methods can result in transient expression of non-integrated transferred GL2024-11-02PCT / / 3730.237WO1
[0191] DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells. Gene delivery expression vectors include, but are not limited to, vectors derived from bacterial plasmid vectors, viral vectors, non-viral vectors, alphaviruses, pox viruses and vaccinia viruses.
[0192] The term "derived from" is used herein to identify the original source of a molecule but is not meant to limit the method by which the molecule is made which can be, for example, by chemical synthesis or recombinant means.
[0193] A polynucleotide or nucleic acid "derived from" a designated sequence refers to a polynucleotide or nucleic acid that includes a contiguous sequence of approximately at least about 6 nucleotides, preferably at least about 8 nucleotides, more preferably at least about 10-12 nucleotides, and even more preferably at least about 15-20 nucleotides corresponding, i.e., identical or complementary to, a region of the designated nucleotide sequence. The derived polynucleotide will not necessarily be derived physically from the nucleotide sequence of interest, but may be generated in any manner, including, but not limited to, chemical synthesis, replication, reverse transcription or transcription, which is based on the information provided by the sequence of bases in the region(s) from which the polynucleotide is derived. As such, it may represent either a sense or an antisense orientation of the original polynucleotide.
[0194] The terms "hybridize" and "hybridization" refer to the formation of complexes between nucleotide sequences which are sufficiently complementary to form complexes via Watson-Crick base pairing.
[0195] The term "homologous region" refers to a region of a nucleic acid with homology to another nucleic acid region. Thus, whether a "homologous region" is present in a nucleic acid molecule is determined with reference to another nucleic acid region in the same or a different molecule. Further, since a nucleic acid is often double-stranded, the term "homologous, region," as used herein, refers to the ability of nucleic acid molecules to hybridize to each other. For example, a single-stranded nucleic acid molecule can have two homologous regions which are capable of hybridizing to each other. Thus, the term "homologous region" includes nucleic acid segments with complementary sequences. Homologous regions may vary in length but will typically be between 4 and 500 nucleotides (e.g., from about 4 to about 40, from about 40 to about 80, from about 80 to about 120, from about 120 to about 160, from about 160 to about 200, from about 200 to about 240, from about 240 to about 280, from about 280 to about 320, from about 320 to about 360, from about 360 to about 400, from about 400 to about 440, etc.).
[0196] As used herein, the terms "complementary" or "complementarity" refers to polynucleotides that are able to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in an anti-parallel orientation between polynucleotide strands. Complementary polynucleotide strands can base pair in a Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil (U) rather than thymine (T) is the base that is considered to be complementary to adenosine. However, when uracil is denoted in the context of the present invention, the ability to substitute a thymine is implied, unless otherwise stated. "Complementarity" may exist between GL2024-11-02PCT / / 3730.237WO1 two RNA strands, two DNA strands, or between an RNA strand and a DNA strand. It is generally understood that two or more polynucleotides may be "complementary" and able to form a duplex despite having less than perfect or less than 100% complementarity. Two sequences are "perfectly complementary" or " 100% complementary" if at least a contiguous portion of each polynucleotide sequence, comprising a region of complementarity, perfectly base pairs with the other polynucleotide without any mismatches or interruptions within such region. Two or more sequences are considered "perfectly complementary" or " 100% complementary" even if either or both polynucleotides contain additional non-complementary sequences as long as the contiguous region of complementarity within each polynucleotide is able to perfectly hybridize with the other. "Less than perfect" complementarity refers to situations where less than all of the contiguous nucleotides within such region of complementarity are able to base pair with each other. Determining the percentage of complementarity between two polynucleotide sequences is a matter of ordinary skill in the art.
[0197] The term "donor polynucleotide" or “donor DNA” refers to a nucleic acid or polynucleotide that provides a nucleotide sequence of an intended edit to be integrated into the genome at a target locus by HDR or recombineering.
[0198] A "target site" or "target sequence" is the nucleic acid sequence recognized (i.e., sufficiently complementary for hybridization) by a guide RNA (gRNA) or a homology arm of a donor polynucleotide (donor DNA). The target site may be allele-specific (e.g., a major or minor allele). For example, a target site can be a genomic site that is intended to be modified such as by insertion of one or more nucleotides, replacement of one or more nucleotides, deletion of one or more nucleotides, or a combination thereof.
[0199] In general, "a CRISPR system" refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding a Cas gene, and a CRISPR array nucleic acid sequence including a leader sequence and at least one repeat sequence. In some embodiments, one or more elements of a CRISPR system are derived from a type I, type II, or type III CRISPR system. Casl and Cas2 are found in all three types of CRISPR -Cas systems, and they are involved in spacer acquisition. In the I-E system of E. coli, Casl and Cas2 form a complex where a Cas2 dimer bridges two Casl dimers. In this complex Cas2 performs a non-enzymatic scaffolding role, binding double-stranded fragments of invading DNA, while Casl binds the single-stranded flanks of the DNA and catalyzes their integration into CRISPR arrays.
[0200] In some embodiments, one or more elements of a CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system can be characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
[0201] In certain embodiments, the disclosure provides protospacers that are adjacent to short (3 - 5 bp) DNA sequences termed protospacer adjacent motifs (PAM). The PAMs are important for type I and type II systems during acquisition. In type I and type II systems, protospacers are excised at positions adjacent to a PAM sequence, with the other end of the spacer cut using a ruler mechanism, thus maintaining the GL2024-11-02PCT / / 3730.237WO1 regularity of the spacer size in the CRISPR array. The conservation of the PAM sequence differs between CRISPR-Cas systems and may be evolutionarily linked to Casl and the leader sequence.
[0202] In some embodiments, a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system. In general, CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), also known as SPIDRs (SPacer Interspersed Direct Repeats), constitute a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al, J. BacterioL, 169:5429-5433 (1987): and Nakata et al., J. BacterioL, 171:3553-3556 (1989)), and associated genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium tuberculosis (See, Groenen et al., Mol. Microbiol., 10: 1057-1065 (1993); Hoe et al., Emerg. Infect. Dis., 5:254-263 (1999); Masepohl et al, Biochim. Biophys. Acta 1 07:26-30 (1996); and Mojica et al, Mol. Microbiol, 17:85-93 (1995)). The CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al, OMICS J. Integ. Biol., 6:23-33 (2002); and Mojica et al, Mol. Microbiol., 36:244-246 (2000)). In general, the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al., (2000), supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al., J. BacterioL, 182:2393-2401 (2000)). CRISPR loci have been identified in more than 40 prokaryotes (See c.g., Jansen et al, Mol. Microbiol., 43:1565-1575 (2002); and Mojica ct al, (2005)) including, but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanobacteriumn, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thernioplasnia, Corynebacterium, Mycobacterium, Streptomyces, Aquifrx, Porphvromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium, Thermoanaerobacter, Mycoplasma, Fusobacterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myrococcus, Campylobacter, Wolinella, Acinetobactei; Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella. Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and Thermotoga.
[0203] In some embodiments, an enzyme coding sequence encoding a CRISPR enzyme (e.g., cas9) is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells may be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g. about one or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, GL2024-11-02PCT / / 3730.237WO1 among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are readily available, for example, at the "Codon Usage Database", and these tables can be adapted in a number of ways. See Nakamura, Y, et al. "Codon usage tabulated from the international DNA sequence databases: status for the year 2000" Nucl. Acids Res. 28:292 (2000). Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, Pa.), are also available. In some embodiments, one or more codons (e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more, or all codons) in a sequence encoding a CRISPR enzyme correspond to the most frequently used codon for a particular amino acid.
[0204] "Administering" a nucleic acid, such as an expression cassette, comprises transducing, transfecting, electroporating, translocating, fusing, phagocytosing, shooting or ballistic methods, etc., i.e., any means by which a nucleic acid can be transported across a cell membrane.
[0205] The subject matter disclosed herein is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
[0206] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosed subject matter.
[0207] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosed subject matter belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the disclosed subject matter, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.
[0208] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and reference to "the nucleic acid" includes reference to one or more nucleic acids and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection GL2024-11-02PCT / / 3730.237WO1 with the recitation of any features or elements described herein, which includes use of a "negative" limitation.
[0209] It is appreciated that certain features of the disclosed subject matter, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosed subject matter, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the disclosed subject matter and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0210] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the disclosed subject matter is not entitled to antedate such publication. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
[0211] The following Example illustrates some of the materials, methods, and experiments that were used or performed in the development of the invention.
[0212] EXAMPLE
[0213] Introduction
[0214] Regulatory T cells (Trcgs) arc a specialized subset of CD4+T cells that maintain sclf-tolcrancc and immune homeostasis. The transcription factor FOXP3 is a lineage-defining factor in Tregs, and its continued expression is needed for proper Treg differentiation, suppressive function, and maintenance of cellular identity. In mice, expression of Foxp3 is exclusive to Tregs, and FOXP3 therefore serves as a useful marker for Treg identification5,6. However, Treg-specific expression of FOXP3 expression is not conserved in human cells. Both human Tregs and CD4+CD25' conventional T cells (Tconvs) are capable of FOXP3 expression, with the former exhibiting constitutive expression and the latter transient expression upon cellular activation1-3. In vitro stimulation via CD3 is sufficient to induce FOXP3 expression in a subset of Tconv, and combination with CD28 stimulation and / or exogenous IL-2 further enhances the proportion of FOXP3+Tconvs in vitro1,2. Strong in vitro activation signals are capable of inducing FOXP3 expression in almost all Tconvs1 2. While the function of FOXP3 is well-characterized in Tregs, the functional significance of FOXP3 expression in human Tconvs is not fully understood. Transient expression of FOXP3 does not prevent proliferation or expression of pro-inflammatory cytokines, including IL-2 and INF-y2,3. FOXP3 expression in Tconvs has been shown to decrease sensitivity to restimulation-induced cell death7, indicating a potential role in modulating activation responses.
[0215] Similarly, regulators of FOXP3 expression in human and murine Tregs have been extensively deciphered, while those governing expression in Tconvs remain largely unknown. In Tregs, four evolutionarily conserved noncoding sequences with FOXP3 enhancer activity, named CNSO-3, have been GL2024-11-02PCT / / 3730.237WO1 identified in the F0XP3 locus. These cis-regulatory sequences regulate distinct aspects of FOXP3 expression. CNSO, which lies upstream of the FOXP3 promoter, is involved in IL-2 induced FOXP3 expression during thymic Treg development8,9. CNS1 and CNS2 lie within intron 1 of F0XP3. CNS1 deficiency in mice is associated with impaired peripheral induction of Foxp3 in gut-associated lymphoid tissue, mesenteric lymph nodes, and during differentiation of induced Tregs (iTregs) from naive CD4+T cells10. CNS2 controls heritable maintenance of FOXP3, and its stable activity is dependent on demethylation of CpG dinucleotides within the element10,11. Finally, CNS3 lies within intron 2 of F0XP3 and regulates de novo induction of FOXP3 expression in thymic and peripheral Treg development10. Transacting transcription factors and chromatin modifiers that interact with these cis-elements have also been characterized, including, for example, STAT5 at CNSO, NFAT and Smad3 at CNS1, Foxp3, Runxl, Cbf- , and GATA3 at CNS2, and c-Rel at CNS38-10,12-14. More recent CRISPR nuclease (CRISPRn) screens, mostly in murine Tregs, have identified additional transcription factors, chromatin modifiers, and post- transcriptional factors that integrate into gene regulatory circuits controlling Foxp3 expression15-17.
[0216] DNA is differentially regulated in the FOXP3 locus between Tregs and Tconvs. In both human and murine systems, CNS2 is demethylated in Tregs but near-completely methylated in Tconvs, including naive CD4+T cells that are capable of differentiation into iTregs10,11,18. Tregs and Tconvs additionally have differential methylation at the F0XP3 promoter, with demethylation in Tregs and partial methylation in Tconvs11,19. Furthermore, inhibition of the maintenance DNA methyltransferase DNMT1 induces FOXP3 expression in Tconvs, further indicating a role for DNA methylation in the regulation of FOXP3 expression in Tconvs20.
[0217] To discover cis- and trans-regulators required for regulation of FOXP3 expression in human Tconvs, CRISPR interference (CRISPRi) screens were performed tiling the F0XP3 locus in Treg and Tconvs and CRISPRn screens targeting trans-acting regulators in Tconvs were performed. CRISPRi tiling screens were previously used to identify cis-regulatory regions within the CD28-CTLA4-ICOS locus21. Here, using CRISPRi tiling screens surrounding F0XP3, Tconv enhancers of F0XP3 expression at CNSO and a novel Tconv-specific non-conserved noncoding sequence (NCNS) located upstream of CNSO were identified. Arrayed validations of these sites additionally identified a suppressive cis element overlapping with the PPP1R3F promoter (PPP). In parallel, CRISPRn trans-regulator screening identified multiple trans-factors, including GATA3, STAT5, IRF4, ETS1 and DNA methylation-associated regulators DNMT1 and MBD2. Analysis of ChlP-seq and ATAC-seq paired with knock-out (KO) of GATA3, STAT5, IRF4, and ETS1 revealed regulation of CNSO and NCNS accessibility. Finally, CRISPR OFF was used to epigentically silence CNSO, NCNS, and / or PPP, demonstrating marked methylation-dependent effects of these elements on FOXP3 expression in Tconvs. Collectively, this work identified Tconv cis-elements and the trans-factors that interact with them, building a network of regulators controlling FOXP3 expression in human Tconvs.
[0218] Methods
[0219] Primary human T cell isolation and culture GL2024-11-02PCT / / 3730.237WO1
[0220] Primary human T cells subsets were isolated from peripheral blood mononuclear cells (PBMCs) sourced from consented, fresh Human Peripheral Blood Leukopaks (STEMCELL Technologies, catalog no. 70500). Leukopaks were washed twice with IX volume of EasySep Buffer (DPBS, 2% fetal bovine serum (FBS), 1 mM pH 8.0 EDTA) using centrifugation and resuspended at 150e6-200e6 cells / mL. CD4+CD25highCD12710wTregs and CD4+CD251OWTconv were isolated from washed PBMCs using the EasySep Human CD4+CD1271O"CD25+Regulatory T Cell Isolation Kit (STEMCELL Technologies, catalog no. 18063) according to manufacturer’s protocol. For enhanced cell purity, Tregs were stained for CD4 (Biolegend, catalog no. 344634 or 344620), CD25 (Tonbo, catalog no. 20-0259-T100), and CD127 (Becton Dickinson, catalog no. 557938) and further sorted into a CD4+CD25h,ghCD12710" population via FACS on a BD FACSAria or BD FACSAria Fusion I. Treg and Tconv were cultured in X-VIVO15 media (Lonza, catalog no. 02-053Q) supplemented with 5% FBS, 55 uM 2-Mercaptoethanol, and 4 mM N- AcetyLL-Cysteine. For CRISPRi screening, CRISPRi validation, and CRISPRn screening, recombinant Human IL-2 (R&D Systems, catalog no. 202-GMP or BT-002-GMP) was supplemented at 200 lU / mL, and cells were stimulated for 48 hours with CTS Dynabeads CD3 / CD28 beads (Thermo Fisher Scientific, catalog no. 40203D) at a cell to bead ratio of 1:1. After 48 hours, beads were removed using magnetic separation. For all subsequent experiments, cells were cultured using recombinant Human IL-2 (R&D Systems, catalog no. 202-GMP or BT-002-GMP) supplemented at 300 lU / mL and stimulated with 12.5 uL / mL Immunocult Human CD3 / CD28 / CD2 T Cell Activator (STEMCELL Technologies, catalog no. 10970), to enhance cell recovery, growth, and viability. Cells were cultured at 37°C and 5% CO2 and split to 5E5-1.5E6 cells / mL every 48 hours by topping off media and completely replacing the appropriate dose of IL-2.
[0221] Libraries and plasmids
[0222] The CRISPRi gRNA library was designed and cloned spanning chrX:49, 221,036-49, 322, 247 (hg38), as previously described21, and contains 15,029 gRNAs flanked by a 5’-NGG protospacer adjacent motifs. Briefly, gRNA sequences with cloning adapters were synthesized by Agilent Technologies, amplified, and cloned into pCRISPRia-v2 (Addgene, 84832). The dCas9-ZIM3 plasmid was designed and cloned, as previously described21. The CRISPRn gRNA library contains 6000 gRNAs targeting 1349 transcription factors, chromatin modifiers, and immune genes of interest, with 593 non-targeting controls and 13 EGFP-targeting controls24.
[0223] Lentivirus production
[0224] Lentiviruses containing the CRISPRi gRNA library, dCas9-ZIM3 construct, and CRISPRn gRNA library were generated as previously described33. Low passage number Human Embryonic Kidney 293T cells were thawed and cultured at 37°C and 5% CO2 in DMEM, high glucose, GlutaMAX Supplement medium (Fisher Scientific, catalog no. 10566024) supplemented with 10% FBS, 100 U / mL Penicillin- Streptomycin (Fisher Scientific, catalog no. 15140122), 2 mM L-glutamine (Fisher Scientific, catalog no. 25030081), 10 mM HEPES (Sigma, catalog no. H0887-100ML), IX MEM Non-Essential Amino Acids Solution (Fisher Scientific, catalog no. 11140050), and 1 mM Sodium Pyruvate (Fisher Scientific, catalog GL2024-11-02PCT / / 3730.237WO1 no. 11360070) for at least 3 passages, without exceeding 80% confluency. On day 0, 293T cells were seeded in a flat-bottom culture vessel at medium-high confluency in Opti-MEM I Reduced Serum Medium (Fisher Scientific, catalog no. 31985088) supplemented with 5% FBS, 100 U / mE Penicillin-Streptomycin (Fisher Scientific, catalog no. 15140122), 2 mM E-glutamine (Fisher Scientific, catalog no. 25030081), IX MEM Non-Essential Amino Acids Solution (Fisher Scientific, catalog no. 11140050), and 1 mM Sodium Pyruvate (Fisher Scientific, catalog no. 11360070) to achieve 95% confluency following overnight incubation at 37°C and 5% CO2 overnight. When cells reached approximately 95% confluency, transfection complexes were assembled. To assembled transfection complexes, supplement-free Opti-MEM (Fisher Scientific, catalog no. 31985088) was adjusted to room temperature. Eipofectamine3000 Mastermix was assembled by adding 0.79 uE Lipofectamine 3000 reagent (Fisher Scientific, catalog no. L3000075) per cm2of the 293T culture vessel to 1 / 8 293T culture volume of room temperature supplement-free Opti- MEM. In parallel, P3000 Mastermix was assembled by adding 125 ng psPAX2 (Addgene 12260) per cm2of the 293T culture vessel, 62.5 ng pMD2.G (Addgene 12259) per cm2of the 293T culture vessel, and 167 ng transfer plasmid (CRISPRi gRNA library, dCas9-ZIM3, or CRISPRn gRNA library) per cm2of the 293T culture vessel to 1 / 8 293T culture volume of room temperature supplement-free Opti-MEM. After addition of plasmids, 0.71 uE p3000 Reagent (Fisher Scientific, catalog no. L3000075) per cm2of the 293T culture vessel was added. Mastermixes were mixed gently by inversion, and Eipofcctaminc3000 Mastermix was added dropwise to P3000 Mastermix, gently inverting to mix. The combined transfection mix was incubated at room temperature for 15 min. One-fourth volume of the 293T medium was removed, and the equivalent volume of transfection complex was added to 293T cultures and incubated for 6 hours at 37°C and 5% CO2. After incubation, media was removed and replaced with fresh complete media with IX ViralBoost Reagent (Alstem, catalog no. VB100) and incubated 18 hours at 37°C and 5% CO2. Twenty- four hours after transfection, media was transferred to 50 mL centrifuge tubes and centrifuged at 300g for 5 min to remove cell debris. Supernatant was transferred to a new tube and stored at 4°C, and fresh complete media with IX ViralBoost was gently replaced on 293T. Forty-eight hours post-transfection, media was collected again, as described, and combined with supernatant collected at 24-hours posttransfection. Eenti-X Concentrator (Takara Bio, catalog no. 631232) was added to combined supernatant, and lentiviral particles were concentrated according to manufacturer’s protocol and resuspended in supplement-free Opti-MEM to 1 % of the original culture volume. Lentiviral particles were aliquoted and frozen at -80°C, thawing immediately prior to use.
[0225] CRISPRi screen
[0226] CRISPRi screens were conducted in Tconv and Treg from the same two donors, with a third donor used only in Tconv.
[0227] Lentiviral infection and selection
[0228] Twenty-four hours post-stimulation, cells were infected with titered dCas9-ZIM3 lentivirus, targeting approximately 80% infection, by addition to culture flasks. Cells and lentivirus were gently pipetted once with a large serological pipette to mix. Forty -eight hours post-stimulation, cells were infected GL2024-11-02PCT / / 3730.237WO1 with gRNA library lentivirus, targeting approximately 60% infection, by addition to culture flasks and gently mixing. Twenty-four hours post-gRNA library lentivirus infection, viral media was removed, and cells were resuspended in media containing 1.5 ug / mL puromycin to select for cells with proper gRNA integration. Cells were cultured in puromycin-supplemented media for 48 hours.
[0229] Cell purity intracellular staining
[0230] Seven days post-stimulation, a small fraction of Treg and Tconv were removed from culture to assess cell population purity. 5E4-3E5 cells per donor and cell type were transferred to a 96-well V-bottom plate, centrifuged at 300g for 5 minutes, and supernatant was removed. Cells were washed with 200 uL EasySep buffer and resuspended in 50 uL of staining solution containing Ghost Dye Red 780 Live / Dead stain (Tonbo, catalog no. 13-0865-T500) and antibodies targeting CD4 (Biolegend, catalog no. 344634). Cells were incubated on ice for 20 minutes, protected from light. After staining, cells were washed by addition of 150 uL EasySep, centrifuged at 300g for 5 minutes, and supernatant was removed. Intracellular staining was conducted using the FOXP3 Fix / Perm Buffer Set (Biolegend, catalog no. 421403). Kit components were diluted in DPBS according to manufacturer’s protocol. Cells were resuspended in 50 uL IX FOXP3 Fix / Perm Buffer and incubated at room temperature for 30 minutes, protected from light. After fixation, cells were washed by addition of 150 uL IX FOXP3 Perm Buffer, centrifuged at 300g for 5 minutes, and supernatant was removed. Cells were permeabilized in 200 uL IX FOXP3 Perm Buffer for 15 minutes at room temperature, protected from light. Following permeabilization, cells were centrifuged at 300g for 5 minutes, and supernatant was removed. Cells were resuspended in 50 uL IX FOXP3 Perm Buffer containing antibodies targeting FOXP3 (Biolcgcnd, catalog no. 126406) and HELIOS (Biolcgcnd, catalog no. 137216) and incubated 30 minutes at room temperature, protected from light. Following intracellular staining, cells were washed by addition of 150 uL IX FOXP3 Perm Buffer, centrifuged at 300g for 5 minutes, and supernatant was removed. Cells were resuspended in 200 uL EasySep for flow cytometry. Stained cells were analyzed on an Attune NxT Flow Cytometer.
[0231] Restimulation and cell sorting
[0232] Nine days post-stimulation, cells were restimulated at a 1 : 1 cell to bead ratio with CTS Dynabeads CD3 / CD28 (Thermo Fisher Scientific, catalog no. 40203D). Forty-eight hours post-restimulation, beads were separated from cells using magnetic isolation. Treg and Tconv were counted, washed, and stained with Ghost Dye Red 780 Live / Dead stain (Tonbo, catalog no. 13-0865-T500) and antibodies targeting CD4 (Biolegend, catalog no. 344634), FOXP3 (Biolegend, catalog no. 126406) and HELIOS (Biolegend, catalog no. 137216), as described in Cell purity intracellular staining, with adjusted volumes to accommodate large cell numbers. Cells were sorted on lymphocytes, singlets, live cells, BFP+ (a marker of the gRNA library plasmid), and FOXP3 high and low bins that captured the top and bottom 25% of FOXP3 expression in each cell type. Following sorting, cells were pelleted and lysed, and genomic DNA (gDNA) was extracted using phenol-chloroform gDNA extraction.
[0233] Library preparation and sequencing GL2024-11-02PCT / / 3730.237WO1
[0234] Regions containing the lentivirally integrated gRNA were amplified using PCR with custom primers. PCR reactions were conducted using 2 ug gDNA per 50 uL reaction with 0.5 uM forward and reverse primers, 0.075 U / uLTaKaRa Ex Taq DNA polymerase (Takara Bio, catalog no. RR001C), 0.2 mM dNTP, and IX Ex Taq Buffer and amplified under the following cycling conditions: 1 min at 95°C, (30 s at 95°C, 30 s at 60°C, 30 s at 72°C) x 25 cycles, 10 min at 72°C, hold at 4°C. Following amplification, aliquots of individual samples were pooled, and primer dimers removed using a 1.4X SPR1 bead cleanup. Proper amplification and concentration were assessed using Qubit quantification and DS 1000 High Sensitivity Tapestation analysis, according to manufacturers’ protocols. Samples were pooled equimolarly and sequenced on an Illumina HiSeq4000 instrument using a custom sequencing primer.
[0235] CRISPRi screen analysis
[0236] CRISPRi pooled screens were analyzed using MAGeCK34(vO.5.9.5). A count file containing individual gRNA abundance across all donors was generated using the command mageck count with specification -norm-method none. For combined donor analysis, differential enrichment of sgRNAs was determined using DESeq2 (v 1.40.2), as described previously21. Guide RNAs with fewer than ten reads were excluded. To decrease noise in individual donor comparison analysis, 500 bp bins shifted by 50 bp across the FOXP3 locus were generated, and all gRNAs within each bin were grouped as a “Gene” element for subsequent MAGeCK analysis. Using the count file described with binned “Gene” annotations, bin enrichment was assessed using the command mageck test. Significance was called as FDR < 0.05. CRISPRi screen validation Cas9 RNP assembly
[0237] To validate CRISPRi screening in an arrayed format, paired crRNAs tiling CRISPRi-responsive and control regions were designed to delete approximately 1 kb of DNA. Single (3) and paired (2) crRNAs targeting the AAVS 1 safe-harbor locus were designed as negative controls, and single crRNAs from the Brunello Library targeting FOXP3 exons (4) were included as positive controls35. Additional single crRNAs from the Brunello Library targeting PPP1R3F exons (4) were included to control for effects of gene KO when tiling across the TSS region35. To assemble RNPs for individual edits and paired deletions, individual custom crRNAs targeting regions of interest (Dharmacon) and Edit-R CRISPR-Cas9 Synthetic tracrRNA (Dharmacon, catalog no. U-002005-20) were resuspended in Nuclease-Free Duplex Buffer (IDT, catalog no. 11-01-03-01) at 160 uM, complexed at a 1: 1 molar ratio to create a 80 uM solution of RNA complexes, and incubated 30 min at 37°C. Single-stranded oligonucleotides (ssODN; 100 uM stock, sequence: TTAGCTCTGTTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTGGTAATATTACGGTAC CGAGCACTATCGATACAATATGTGTCATACGGACACG; SEQ ID NO: 37) were mixed at a 1 : 1 molar ratio with complexed RNA and incubated 5 min at 37°C. Cas9 protein (Berkeley Macrolab, 40 uM stock) was slowly added at a 1: 1 molar ratio of Cas9 to RNA complexes, mixed thoroughly, and incubated 15 min at 37°C. For RNPs used in paired deletions, individually assembled RNPs were mixed 1: 1 with the appropriate RNP pair. RNPs were frozen at -80°C and thawed at room temperature prior to use. GL2024-11-02PCT / / 3730.237WO1
[0238] RNP electroporation
[0239] Human Treg and Tconv from the same two healthy donors and an additional donor in Tconv were isolated and stimulated as described above. Forty-eight hours post-stimulation, cells were counted, pelleted via centrifugation, and resuspended at 2E4-7.5E4 cells / uL in freshly supplemented P3 Primary Cell Nucleofector Solution (Lonza, catalog no. V4SP-3096). For single RNP edits, 20 uL cells were mixed with 3.5 uL RNP, and 22 uL was transferred to a 96-well Nucleocuvette Plate (Lonza, catalog no. V4SP-3096). For paired RNP deletions, 20 uL cells were mixed with 7 uL paired RNPs, and 24.5 uL was transferred to a 96-well Nucleocuvette Plate (Lonza, catalog no. V4SP-3096). Cells were nucleofected using a Lonza 4D 96-well electroporation system with pulse code EO-115 (Treg) or EH-115 (Tconv). Immediately after electroporation, 80 uLpre-warmed media was added to each well, and the cells were incubated for 15 min at 37°C. Following incubation, cells were plated at approximately 1E6 cells / mLfor culture.
[0240] Flow cytometry analysis of arrayed validation
[0241] Nine days post-stimulation, a portion of cells were stained with Ghost Dye Red 780 Live / Dead stain (Tonbo, catalog no. 13-0865-T500) and antibodies targeting CD4 (Biolegend, catalog no. 344620), CD25 (Tonbo, catalog no. 20-0259-T100), FOXP3 (Biolegend, catalog no. 126406), and HELIOS (Biolegend, catalog no. 137216), as described in Cell purity intracellular staining, above. Remaining unstained cells was restimulated with CTS Dynabeads CD3 / CD28 beads (Thermo Fisher Scientific, catalog no. 40203D) at a cell to bead ratio of 1:1. Forty-eight hours post-restimulation, beads were removed via magnetic separation, and cells were stained as described on day 9. Flow cytometry data from stained cells was collected on an Attune NxT Flow Cytometer. Analysis with gating on lymphocytes, singlets, live cells, and CD4+ cells was conducted using FlowJo. Flow cytometry statistics were exported via the FlowJo Table Editor and visualized in R using ggplot2 (v3.5.1).
[0242] CRISPRn screen
[0243] CRISPRn screens were conducted in Tconv isolated from three healthy donors. Screens were conducted as previously described24, with minor modifications.
[0244] Lentiviral infection and electroporation
[0245] Cells were isolated and stimulated, as described above. Twenty-four hours post-stimulation, cells were infected with titered gRNA library lentivirus, targeting approximately 85% infection, by addition to culture flasks. Cells and lentivirus were gently pipetted once with a large serological pipette to mix. Twenty-four hours post-gRNA library lentivirus infection, viral media was removed, and cells were washed with IX volume pre-warmed media and plated at approximately 1E6 cells / mL.
[0246] Cas9 RNPs were assembled as described in Cas9 RNP assembly, above, using a Guide Swap crRNA method36(Edit-R crRNA nontargeting Control 3, Dharmacon, catalog no. U-007503-01-05). Seventy-two hours post-stimulation, cells were pelleted, and resuspended at 7.5E4 cells / uL in freshly supplemented P3 Primary Cell Nucleofector Solution (Lonza, catalog no. V4SP-3096). 20 uL of cell were mixed with 7 uL RNP, and 25 uL was transferred to a 96-well Nucleocuvette Plate (Lonza, catalog no. V4SP-3096) and electroporated, as described in RNP electroporation, above. GL2024-11-02PCT / / 3730.237WO1
[0247] Restimulation and cell sorting
[0248] Nine days post-stimulation, cells were restimulated at a 1 : 1 cell to bead ratio with CTS Dynabeads CD3 / CD28 (Thermo Fisher Scientific, catalog no. 40203D). Forty-eight hours post-restimulation, beads were separated from cells using magnetic isolation. Cells were counted and stained with Ghost Dye Red 780 Live / Dead stain (Tonbo, catalog no. 13-0865-T500) and antibodies targeting FOXP3 (Biolegend, catalog no. 320116) and HELIOS (Biolegend, catalog no. 137216), as described in Cell purity intracellular staining, with adjusted volumes to accommodate large cell numbers. Cells were sorted on lymphocytes, singlets (x2), live cells, GFP+ (a marker of the gRNA library plasmid), and FOXP3 high and low bins that captured the top and bottom 25% of FOXP3 expression. Following sorting, cells were pelleted and lysed, and gDNA was extracted using phenol-chloroform gDNA extraction.
[0249] Library preparation and sequencing
[0250] Regions containing the lentivirally integrated gRNA were amplified using PCR with custom primers. PCR reactions were conducted using 1.75 ug gDNA per 50 uL reaction with 0.25 uM forward and reverse primers and IX NEBNext Ultra II Q5 Master Mix (New England Biolabs, catalog no. M0544). Reactions were amplified under the following cycling conditions: 3 min at 98°C, (10 s at 98°C, 10 s at 63°C, 25 s at 72°C) x 23 cycles, 2 min at 72°C, hold at 4°C. Following amplification, aliquots of individual samples were pooled, and primer dimers removed using a 1.25X SPRI bead cleanup. Proper amplification and concentration were assessed using Qubit quantification and DS 1000 High Sensitivity Tapestation analysis, according to manufacturers’ protocols. Samples were pooled equimolarly and sequenced on an Illumina HiScq4000 instrument using a custom sequencing primer.
[0251] CRISPRn screen analysis
[0252] CRISPRn pooled screens were analyzed using MAGeCK34(vO.5.9.5). A count file containing individual gRNA abundance across all donors was generated using the command mageck count with specification -norm-method none. Differentially enriched gRNAs and significantly enriched genes in high and low bins were identified using the command mageck test, specifying -sort-criteria pos.
[0253] CRISPRn screen validation
[0254] Top FOXP3 maintenance and suppressive regulators were selected for arrayed validation, and two crRNAs were selected for each regulator. Six crRNAs targeting the AAVS 1 locus were additionally included as negative controls. Cas9 RNPs were assembled as described in Cas9 RNP assembly, above. Human Tconv from two healthy donors were isolated and stimulated as described above. Forty-eight hours post-stimulation, cells were electroporated with trans-regulator targeting RNPs, as described in RNP electroporation, above. Nine days post-stimulation, a portion of cells were stained with Ghost Dye Red 780 Live / Dead stain (Tonbo, catalog no. 13-0865-T500) and antibodies targeting CD4 (Biolegend, catalog no. 344634), FOXP3 (Biolegend, catalog no. 126406), and HELIOS (Biolegend, catalog no. 137216), as described in Cell purity intracellular staining, above. Remaining unstained cells was restimulated with 12.5 uL / mL Immunocult Human CD3 / CD28 / CD2 T Cell Activator (STEMCELL Technologies, catalog no. 10970). Forty-eight hours post-restimulation, cells were stained as described on day 9. Flow cytometry GL2024-11-02PCT / / 3730.237WO1 data from stained cells was collected on an Attune NxT Flow Cytometer. Analysis with gating on lymphocytes, singlets, live cells, and CD4+ cells was conducted using FlowJo. Flow cytometry statistics were exported via the FlowJo Table Editor and visualized in R using ggplot2 (v3.5.1).
[0255] Genotyping of arrayed CRISPRn knock-outs
[0256] Genomic DNA from 3E4-2E5 cells was isolated from arrayed samples using QuickExtract DNA Extraction Solution (Biosearch Technologies, catalog no. QE09050), using manufacturer’s protocol with reduced reagent volume to accommodate processing in a 96-well PCR plate. Paired PCR primers were designed flanking the gRNA cut site to generate an amplicon of approximately 200 bp. PCR reactions were conducted for each sample using 4 uL QuickExtract-isolated gDNA per 25 uL reaction, 0.5 uM forward and reverse primers, and IX NEBNext Ultra II Q5 Master Mix (New England Biolabs, catalog no. M0544). Reactions were amplified under the following cycling conditions: 3 min at 98°C, (20 s at 94°C, 20 s at 65- 57.5°C (with 0.5°C incremental decreases per cycle), 1 min at 72°C) x 15 cycles, (20 s at 94°C, 20 s at 58°C, 1 min at 72°C) x 20 cycles, 10 min at 72°C, hold at 4°C. Amplified DNA was dilute 1 :200, and 1 uL was used per 25 uL of a second PCR amplification with 1 uM forward and reverse primers and IX NEBNext Ultra II Q5 Master Mix to attached sequencing adapters and indices. Reactions were amplified under the following cycling conditions: 30 s at 98°C, (10 s at 98°C, 30 s at 60°C, 30 s at 72°C) x 12 cycles, 2 min at 72°C, hold at 4°C. Following amplification, samples were pooled in equal volume, and primer dimers were removed using a 1.3X SPRI bead cleanup. Proper amplification and concentration were assessed using Qubit quantification and DS 1000 High Sensitivity Tapestation analysis, according to manufacturers’ protocols. The pooled samples were sequenced on an Illumina MiScq instrument with PE 150 reads. Analysis of editing efficiency was performed using CRISPResso237(v2.2.12), using the command CRISPRessoBatch — batch_settings [crispresso_samplesheet] — skip_failed — n_processes 4 — exclude_bp_from_left 0 — exclude_bp_from_right 0 — plot_window_size 10.
[0257] Transcription factor binding site analysis
[0258] Datasets containing human or human-predicted position weight matrices for human transcription factors were acquired from JASPAR202027(v0.99.10) using TFBSTools (v 1.38.0) in R or sourced from CisBP (Homo sapiens, downloaded 09-29-2020)26. Motif sites in a region of interest were identified using ‘matchMotifs’ from motifatchr (v 1.22.0) using default settings and specifying the genome as BSgenome.Hsapien.UCSC.hg38 (vl.4.5).
[0259] KO ATAC-seq analysis
[0260] KO ATAC-seq data was analyzed as previously described24, using only ATAC-seq data from male donors and without removal of reads mapping to ChrX and ChrY. Briefly, sequencing read adapters were trimmed using cutadapt (v2.10) to a minimum length of 20 bp, and reads were mapped to GRCh38 using bowtie2 (v2.4.1). Low-quality reads were filtered using SAMtools (vl.10), reads mapping to ENCODE blacklist regions removed with bedtools (v2.29.2), and duplicates removed using picard (v2.23.3), and reads mapping to ChrM were removed. Called peaks were generated using MACS2 (v2.2.7.1), and a consensus peak file was generated. The GenomicAlignments (v 1.36.0) summarizeOverlaps function was GL2024-11-02PCT / / 3730.237WO1 used to count Tn5 insertion sites overlapping each consensus peak to generate a count matrix. Significantly differentially accessible peaks over AAVS 1 control samples were identified using DESeq2 (v 1.40.2). Scaling factors for ATAC-seq bigwig visualization were generated using the DESeq2 (vl.40.2) estimateSizeFactorsForMatrix function, as previously described21. Donor replicate files for each KO were merged into consensus bigwig files and visualized in R using ggplot2 (v3.5.1).
[0261] KO RNA-seq analysis
[0262] A pre-processed KO RNA-seq differential expression analysis file was downloaded from ref.24. Processing of this file was described in (ref24): fastq adapters were trimmed using cutadapt (v2.10), reads were mapped to human genome GRCh38 using STAR (v2.7.5b), excluding multi-mapping reads, UMIs extracted using umi_tools (v 1.0.1), reads deduplicated using umi_tools, and Gencode v35 gene counts generated using featureCounts (v2.0.1). Differentially expressed genes for KO over AAVS1 controls were identified using Limma (v3.44.3). ChlP-seq analysis
[0263] Pre-processed ChlP-seq bigwigs were downloaded from ChIP- Atlas38. ChIP- Atlas processing uses Bowtie2 for alignment to the human genome GRCh38, SAMtools to convert to BAM format, sort, and remove PCR duplicates, bedtools to calculate coverage scores in reads per million mapped reads, MACS2 to call peaks, and the UCSC BedGraphToBigWig tool to generate bigwig coverage files. ChlP-seq data for the indicated cell type were generated in the following papers: GATA3 (in vitro differentiated primary human Thl cells, ref.39), IRF4 (refs40), STAT5B (human CD4+ T cells stimulated with IL-2 for 1 hour, ref.41), ETS 1 (Human T-ALL cell line THP-6 cells treated with shControl (Sigma, SHC002), ref.42), RNAP2 in Tconv (ref.43). Bigwig files were visualized in R using ggplot2 (v3.5.1).
[0264] Whole genome bisulfite sequencing & analysis
[0265] Whole genome bisulfite sequencing was conducted as described in (ref.32). Briefly, gDNA from repetitively stimulated Bulk T cells treated with non-targeting sgRNA and CRISPRoff mRNA was collected from two donors in technical replicate and used for WGBS library generation. To analyze, raw fastq files were processed using the nf-methylseq:2.6.0 pipeline60 with default parameters and three_prime_clip_Rl 10' and '-three_prime_clip_r2 10' options. To visualize the methylation status at individual loci, the base level methylation status was extracted from BedGraph files from the nf-methylseq pipeline. Results were converted into an IGV friendly format and data were displayed as bar charts in which methylated regions were considered as methylation percentage from 50%-100% shown in range of 0.5 to 1 in red, and un-methylated regions considered as methylation percentage from 0%-50% shown in range of -1 to -0.5 in blue.
[0266] CRISPRoff modification
[0267] To assemble CRISPRoff RNA complexes, chemically modified CRISPRoff mRNA encoding dCas9 fused to DNMT3A, KRAB, and a DNMT3L protein domain (Aldevron) and custom sgRNAs (Synthego) targeting regions of interest were thawed on ice. If using multiple sgRNAs per condition, sgRNAs were pooled at a 1 : 1 molar ratio. For each condition, 1 .56 ug CRISPRoff mRNA (1.03 ug / uL GL2024-11-02PCT / / 3730.237WO1 stock) and 2 ug sgRNA (or pooled sgRNA; 3.2 ug / uL stock) were mixed and placed at 4°C. CRISPRoff RNA complexes were electroporated into cells as described in RNP Electroporation, using 2.14 uL RNA complexes per 20 uL cells and electroporating using code DS- 137.
[0268] Plots and Genomic Tracks
[0269] Gene tracks were plotted from GENCODE hg38 knownGene annotations downloaded from the UCSC Genome Browser (ref.31) Table Browser and visualized in R using ggplot2 (v3.5.1). PhyloP lOOway conservation track data were sourced from phyloPlOOway downloaded from the UCSC Genome Browser Table Browser and visualized in R with ggplot2 using 25 bp windowing bins, unless otherwise noted. Results
[0270] CRISPRi tiling screen identifies cis elements controlling FOXP3 expression
[0271] To map FOXP3 cis-regulatory regions systematically, a pooled CRISPRi screen was designed that targeted the FOXP3 locus (Figure 1A). The gRNA library consisted of 15,029 gRNA spanning a 101 kb region from 43.7 kb downstream of the FOXP3 TSS to 57.5 kb upstream of the TSS. CD4+CD251OWhuman Tconvs and CD4+CD25hlghCD12710whuman Tregs were isolated from the blood of two healthy donors (and Tconvs from a third donor) and cells were stimulated with anti-CD3 / CD28 beads. One- and two-days poststimulation, dCas9-ZIM3 CRISPRi machinery was lentivirally delivered followed by the gRNA library. Infected cells were selected using puromycin, expanded, and high cell purity of HELIOS+FOXP3+Treg cultures and HELIOS-FOXP3- Tconv cultures was verified (Figure 2A). Cells were restimulated on day 9 post-initial stimulation. Forty-eight hours post restimulation, when Tconvs upregulate FOXP3 (Figure 2B), cells were fixcd / pcrmcabilizcd and stained for FOXP3 expression, and FACS-sortcd into bins of high (top -25%) and low (bottom -25%) FOXP3 expression (Figure 2C).
[0272] Cis-regulatory elements involved in both maintenance and repression of FOXP3 expression were identified (Figure IB, Figure 2D). Improved statistical significance was achieved in Tconv with the exclusion of donor 2, which, when analyzed by grouping neighboring gRNAs into sliding 500 bp bins and testing binned significance (to decrease noise), showed no low bin enrichment at the FOXP3 transcriptional start site (TSS) and was subsequently excluded (Figure 2E). With this exception, consistency was observed between Treg and Tconv donors (Figure 2E). As expected, the TSS of F0XP3 was the most responsive to CRISPRi tiling in both Tconv and Treg, resulting in significant gRNA enrichment in the FOXP3 low bin, indicating the strongest role in FOXP3 maintenance within the locus. In human Tregs, numerous gRNAs across the first 8 kb of the FOXP3 gene body showed similar responsiveness to CRISPRi. Significant gRNAs enriched in the FOXP3 low bin mapped to CNS1, 2, and 3. However, no significant gRNAs in these regions were enriched in the FOXP3 low Tconv bin, suggesting that these enhancers are not needed for FOXP3 induction in Tconvs (Figure IB, Figure 2D). A Treg- specific 4.6 kb FOXP3-repressive element was also identified 1.1 kb upstream of the FOXP3 TSS that maps to FLICR, a IncRNA transcript described in mice22. Previous work has shown that Flier acts in cis to negatively regulate Foxp3 expression, and Flier knockdown or deletion increases Foxp3 expression22. Interestingly, cis elements controlling FOXP3 induction were identified in Tconvs, some of which were distinct from the elements required for FOXP3 GL2024-11-02PCT / / 3730.237WO1 maintenance in Tregs (Figure IB). CNSO was needed for FOXP3 expression in both human Treg and Tconvs (Figure IB). A 2 kb non-conserved non-coding sequence (NCNS) approximately 11.8 kb upstream of the FOXP3 TSS emerged as a selective Tconv- specific regulator of FOXP3 induction (Figure IB). Taken together, the CRISPRi screens revealed that FOXP3 expression in human Tconvs depends on a set of cis- regulatory elements distinct from the well-characterized Treg elements and nominated a novel element selectively required in Tconvs.
[0273] To validate the results of the CRISPRi screens and assess the quantitative effects of cis-element perturbation on FOXP3 expression, an orthogonal CRISPRn deletion strategy using paired Cas9 RNPs to excise elements of interest was designed. Using this strategy, Cas9 RNPs were designed to generate 24 different ~1 kb deletions across the F0XP3 TSS, FLICR, CNSO, and NCNS in resting and stimulated human Treg and Tconvs. In an arrayed fashion. FOXP3 MFI (Tregs; Figure 1C) and the percent of FOXP3+cells (Tconvs; Figure ID) was measured for each targeted deletion and for AAVS1 -targeted control cells.
[0274] Treg tiled deletions revealed a rapid transition from FOXP3-maintenance cis-elements (Tiles 1-5, Figure 1C) to suppressive elements (Tiles 6-9, Figure 1C), particularly at 0 hours post-stimulation. Deletions targeting the TSS (Tile 4) and CNSO (Tiles 18-21) decreased FOXP3 in both Treg and Tconv, with the largest CNSO effect observed with Tile 21 in Tregs and 18 in Tconv. NCNS-targeting in Tconv led to a decreased percentage of FOXP3+cells in resting Tconv and a mild decrease in activated Tconv (Tile 23). Interestingly, deletion of tiles overlapping with the promoter and TSS of the neighboring gene PPP1R3F resulted in an increase in the percent of FOXP3+resting Tconv, while KO of PPP1R3F did not increase FOXP3 expression in resting or stimulated Tconv or Treg (Figure 1D-E, Figure 2F). These results indicate that CRISPRi-responsive CNSO and NCNS positively regulate FOXP3 expression in Tconv, while the PPP1R3F promoter region (PPP), which was not identified via CRISPRi screening, negatively regulates FOXP3 expression in Tconv.
[0275] Decoding trans-regulators of Tconv FOXP3 expression with CRISPR KO screens
[0276] To identify trans-regulators required for FOXP3 expression in human Tconvs, a pooled SLICE- based CRISPRn genetic screen was designed in primary human Tconv (Figure 3A)23. A library of 6000 gRNAs was used, targeting 1349 human transcription factors, chromatin modifiers, and immune genes in addition to non-targeting controls24. CD4+CD251OWhuman Tconvs were isolated from the blood of three healthy donors, cells were stimulated with anti-CD3 / CD28 beads, and the gRNA library was delivered via lentivirus and Cas9 ribonucleoproteins (RNPs) via electroporation. Cells were expanded and restimulated on day 9 post-initial stimulation. Two-days post restimulation, cells were fixed and stained for FOXP3 expression and sorted via FACS into bins of high (top -25%) and low (bottom -25%) FOXP3 expression (Figure 3A, Figure 4A).
[0277] Sufficient cellular coverage (Figure 4B) was achieved to identify 23 positive regulators and 15 negative regulators of FOXP3 expression in human Tconvs (FDR < 0.05) (Figure 3B). Multiple individual gRNAs targeting significant gene regulators were consistently enriched in FOXP3 high or low FACS bins for repressor or maintenance genes, respectively, and consistency in gene hits was observed between GL2024-11-02PCT / / 3730.237WO1 individual donors (Figure 4C-D). Multiple positive regulators of Tconv FOXP3 expression have previously been linked to FOXP3 expression in mouse and / or human Tregs, including GATA314, STAT5A / STAT5B8,25, and ATXN7L315. However, until now these regulators have not been shown to shape FOXP3 expression in human Tconvs.
[0278] The effects of individual TF knock outs (KOs) were validated in arrayed fashion. For top candidate TFs that promoted or repressed FOXP3 in the pooled screen, KO was performed with Cas9 RNPs in an arrayed format and levels of FOXP3 protein were measured in resting and stimulated (48 hours poststimulation) Tconvs via flow cytometry (Figure 3C-D, Figure 4E-G). High editing efficiency of KOs was achieved as assessed by targeted amplicon sequencing (mean percentage modified reads of 92.0%; Figure 4H). Individual KOs with Cas9 RNPs replicated the directionality of FOXP3 changes observed in the pooled screen, with the exception of VARS2 KO, which did not have a significant effect on FOXP3 with Cas9 RNPs (Figure 3C). GATA3 KO and FOXO1 KO both resulted in large, significant reductions in the percentage of FOXP3+cells at 48 hours post-stimulation, decreasing the percentage of FOXP3+cells nearly to levels of FOXP3 KO (Figure 3C-D). BCL11B also yielded a significant reduction in the percentage of FOXP3+cells. FOXP3 is minimally expressed in resting Tconvs, and we were only able to detect significant differences in regulator KOs that increased FOXP3 expression in resting cells. KO of TFDP1, ETS1, and DNMT1 all increased FOXP3 expression in resting Tconvs, with DNMT1 KO increasing the percentage FOXP3+cells 14.9-fold relative to AAVS 1 controls (43.0% expressed FOXP3 in resting DNMT1 KO Tconvs; Figure 3C). At 48 hours post-stimulation, DNMT1, TFDP1, and ETS 1 KOs also increased the percentage FOXP3+cells, along with KOs of YBX1 and mcthyl-CpG binding domain protein MBD2 (Figure 3C-D), though DNMT1 KO resulted in high cell toxicity post-stimulation (data not shown). The observed repression of FOXP3 in Tconvs by DNMT1 (a maintenance DNA methyl transferase) and MBD2 is consistent with previous studies describing the importance of methylation at the FOXP3 locus (including at the promoter and CNS2) limiting FOXP3 expression in Tconvs10 11 18-20. A distinct and only partially overlapping set of Tconv regulators also displayed FOXP3 regulation in Tregs, including positive regulators GATA3 and FOXP1 and negative regulators DNMT1, TFDP1, YBX1, and ETS1. BCL11B KO showed no effect on FOXP3 expression at either timepoint, despite strong effects on the %FOXP3+cells in Tconv (Figure 3C, Figure 41). Collectively, RNP-based validation identified Tconv trans-regulators of FOXP3 expression, highlighting FOXO1, GATA3, and STAT5 as top positive regulators, and ETS 1 and DNA methylation-associated regulators DNMT1 and MBD2 as top repressors of FOXP3 expression in Tconvs.
[0279] Trans-regulators bind to PPP, CNSO, and NCNS to control FOXP3 expression
[0280] We next attempted to integrate trans-regulators and F0XP3 cis-regulatory elements into networks controlling expression of FOXP3 in human Tconvs and Tregs. Motif analysis using predicted transcription factor motifs from CisBP26and JASPAR27highlighted candidate binding sequences of regulators in the locus. Binding motifs for positive FOXP3 trans-regulators aligned across the FOXP3 locus, including just upstream of the FOXP3 TSS (FOXO1 , FOXP1 , GATA3, IKZF3, and STAT5A), at CNSO (YY1 , IKZF1 , GL2024-11-02PCT / / 3730.237WO1
[0281] IRF4, GATA3, NFKB2, and BCL11B), and at the novel Tconv-specific NCNS (YY1, FOXO1, FOXP1, BCL11B, STAT5A, and STAT5B, among others) (Figure 5A). In contrast, binding motifs for negative F0XP3 trans-regulators nominated by the TF screens in Tconvs clustered within PPP, including motifs for EGR2, ETS 1, DNMT1, TFDP1, and MBD2, among others (Figure 5A). Interestingly, binding motifs for ZBTB32, a positive regulator of FOXP3 with reported chromatin-repressive activity28-29, aligned proximal to PPP (Figure 5A). In short, motif analysis suggests that factors that promote F0XP3 expression in human Tregs may bind directly to CNSO and NCNS, two enhancers critical for expression of FOXP3 in human Tconvs; binding of multiple factors and regulation at PPP could conversely limit FOXP3 levels in human Tconvs.
[0282] We assessed the effect of FOXP3 regulators on chromatin state at czs-regulatory regions required for proper FOXP3 expression. Published datasets from were used to measure changes in chromatin accessibility with KO of FOXP3 trans-regulators compared to AAVS1 -targeted controls in CD4+CD25" Tconv24. KO-ATAC-seq datasets were available for 9 regulators in human Tconvs: ATXN7L3, ETS1, FOXP1, GATA3, IRF2, IRF4, MBD2, STAT5A, and YY1. Among these, GATA3, IRF4, STAT5A, and ETS 1 KO each resulted in differentially accessible peaks in the F0XP3 locus (Figure 5B-E). KO of positive regulators GATA3, IRF4, and STAT5A caused decreased accessibility at CNSO and NCNS, with IRF4 KO additionally causing decreased accessibility at a distal accessible region within the CACNA1F gene body (Figure 5B-D). Decreased accessibility at NCNS with STAT5A KO is consistent with previous reports of a STAT5-responsive element at this site in murine Tregs8.
[0283] Public ChlP-scq datasets revealed GATA3 binding at CNSO, the site of a large change in accessibility, indicating GATA3 likely maintains FOXP3 expression in part via direct maintenance of CNSO accessibility (Figure 5B). STAT5B ChlP-seq in T cells treated with IL-2 aligned at both CNSO and NCNS, consistent with differential accessibility at these sites and indicative of a role of IL-2 signaling in CNSO and NCNS function (Figure 5D). Interestingly, IRF4 bound PPP, but not CNSO or NCNS, suggesting the possibility of an indirect role in regulating accessibility of these elements (Figure 5B).
[0284] To understand how trans-regulators affect expression in the broader FOXP3 locus and of each other, we assessed differential expression of genes within the CRISPRi-tiled F0XP3 locus and of FOXP3 trans-regulators using KO RNA-seq data24complementary to KO ATAC-seq targets. STAT5B KO and GATA3 KO decrease expression of PPP1R3F, while ETS1 KO increases PPP1R3F expression (Figure 5F). RNA polymerase II (RNAP2) ChlP-seq in resting and stimulated Tconv indicate strong RNAP2 binding at CNSO and NCNS (Figure 6A-B). Thus, accessibility changes may alter RNAP2 recruitment to change expression of locus genes. Interestingly, KO of multiple positive regulators decrease STAT5B and ZBTB32 levels, indicating regulators may converge on STAT5B and ZBTB32, or pathways that induce their expression (Figure 6C). These results indicate that CNSO and NCNS accessibility is controlled by GATA3, STAT5, IRF4, and ETS 1. Binding of GATA3 and STAT5 to CNSO and NCNS may directly maintain accessibility.
[0285] CNSO, NCNS, and PPP activity is dependent on DNA hypo-methylation GL2024-11-02PCT / / 3730.237WO1
[0286] A hallmark feature of the F0XP3 locus in Tregs is DNA demethylation at CNS2 (a site known as the Treg-specific de-methylated region, TSDR), whereas this site is methylated in Tconvs, limiting F0XP3 expression10,11,30. Notably, KO of DNMT1, a factor involved in DNA methylation maintenance, and methyl-CpG binding domain protein MBD2 both increased FOXP3 expression in Tconvs. Motif analysis identified DNMT1 and MBD2 motifs at PPP, where a 1.6 kb CpG island containing 140 CpGs exists (CpG visualized via ref.31). To examine if DNA methylation at the key Tconv regulatory regions may contribute to gene regulation, we analyzed whole genome bisulfite sequencing (WGBS) in repetitively stimulated bulk T cells from two human donors (Figure 7A)32. WGBS revealed hypomethylation at the FOXP3 promoter, PPP, CNSO, and NCNS (Figure 7A).
[0287] To determine if hypomethylation is critical for function of these elements, we targeted each site with CRISPRoff, an epigenome editor reported to recruit DNA methylation to a site in a programmable manner4,32. Briefly, CD4+CD251OWTconvs from two human donors were stimulated with anti- CD28 / CD3 / CD2 antibody complexes. Two days post-stimulation, mRNA encoding catalytically inactive dCas9 fused to DNMT3A, KRAB, and a DNMT3L protein domain was electroporated into Tconvs with gRNAs targeting PPP, CNSO, NCNS, or AAVS 1 control regions. Nine days post-initial stimulation, Tconvs were restimulated with anti-CD28 / CD3 / CD2 antibody complexes, and flow cytometry for FOXP3 was conducted at 0, 24, and 48 hours post-restimulation.
[0288] CRISPRoff targeting of CNSO and NCNS resulted in a significant reduction in the percentage of stimulated Tconvs expressing FOXP3, with the greatest reduction when the elements were simultaneously targeted (Figure 7B). Co-targcting of CNSO and NCNS with CRISPRoff reduced the percentage of FOXP34cells at 24 hours post-stimulation over 31-fold compared to AAVS1 controls, nearly completely abrogating FOXP3 expression in all targeted cells (Figure 7B-C). Conversely, CRISPRoff targeting at PPP significantly increased the percentage of FOXP34cells, increasing 14.6-fold at 0 hours post-stimulation and 1.89-fold at 48 hours post-stimulation, compared to AAVS1 controls (Figure 7B-C). Interestingly, simultaneous targeting of CNSO, NCNS, and PPP almost completely abrogated FOXP3 expression, mimicking the effect of CNSO and NCNS targeting (Figure 7B-C). Although close 3D contact of these elements with the FOXP3 promoter may induce FOXP3 promoter methylation, loss of FOXP3-enhancing effects with CRISPRoff targeting at CNSO and NCNS strongly suggests that hypomethylation of CNSO and NCNS is important for human Tconv competency to express FOXP3. Furthermore, PPP serves as a negative cis regulator of F0XP3 in human Tconvs, and inactivating this element with targeted methylation potently induces FOXP3 in resting Tconvs, provided that CNS and NCNS remain active.
[0289] Discussion
[0290] FOXP3 cis-regulatory elements and the transcription factors that bind them have been extensively characterized in human Tregs, but regulation governing the transient expression of FOXP3 in human Tconvs has thus far remained elusive. This is in large part due to the absence of FOXP3 expression in murine Tconvs while the majority of functional work has been performed in mouse models. Here, F0XP3 locus-tiling CRISPRi screens and trans-regulator CRISPRn screens were performed in primary human GL2024-11-02PCT / / 3730.237WO1
[0291] CD4+T cells to identify cis- and trans-regulators controlling FOXP3 expression in Tconvs. Intriguingly, the CNSO enhancer shares FOXP3-enhancing capacity in Tregs, but NCNS and suppressive element PPP exhibit cell- type specific control of FOXP3 in human Tconvs.
[0292] Mirroring cis-regulators, trans-regulators of FOXP3 in Tconv are only partially overlapping with Treg regulators. Among the most prominent of these shared regulators are STAT5 and GATA3. Though their activity in Tregs has been described at CNS214’25, which is methylated and inactive in Tconv10 11 18, STAT5 additionally plays a critical role in Foxp3 induction via CNSO8,9. Both STAT5A and STAT5B were identified as significant regulators of FOXP3 expression and detected STAT5B binding at both CNSO and NCNS in human Tconvs, indicating a route of shared regulation. Though interaction of GATA3 with Treg CNSO has not been described, it was found that GATA3 maintains CNSO accessibility in Tconv. The transregulator screens also identified a number of non-overlapping regulators, including positive regulator BCL11 B and repressor MBD2.
[0293] Strikingly, methylation emerged as a theme among cis- and trans-regulators of FOXP3 in Tconv. Methylation-associated factors MBD2 and DNMT1 were identified among the strongest repressors of FOXP3, and CNSO, NCNS, and PPP each displayed a degree of hypomethylation. Due to broad, genomewide effects of DNMT1, it is difficult to ascertain if DNMT1 loss influences gradual methylation loss at CNSO or NCNS that is responsible for FOXP3 induction. Loss of methylation at CNS2 due to disrupted methylation maintenance with cell division may also account for this effect. Targeted CRISPRoff localization at CNSO and / or NCNS potently prevented induction of FOXP3, supporting one of two hypotheses. In the first, hypomcthylation may be crucial to CNSO and NCNS function and necessary for FOXP3 expression. In this case, CNSO and NCNS function may depend on the activity of the other, as individual and dual targeting strongly limit FOXP3 expression, an effect larger than KO of any individual trans-regulator. Additionally, this model indicates PPP methylation is unable to induce FOXP3 expression without CNSO and NCNS hypomethylation. In the second hypothesis, CNSO and NCNS may share close 3D-genomic contacts with the FOXP3 promoter, and CRISPRoff localization at these elements may enable epigenetic changes at the promoter. In this case, CNSO and NCNS may both form contacts with the FOXP3 promoter, consistent with similar effects seen with individual and dual targeting. Future experiments assessing locus-wide methylation paired with CRISPRoff and Hi-C will decipher this mechanism. Interestingly, methylation targeted to PPP potently induced FOXP3 expression, even in resting Tconv, indicating that PPP limits FOXP3 induction in resting Tconv. Similar results have been reported at the CD28-CTLA4-ICOS locus in human Tconv and Treg, where CRISPRi-inactivation of the CTLA4 TSS enhanced expression of neighboring CD28 and ICOS, while KO of CTLA4 had no effect21. Such transcriptional interference could explain this suppressive role.
[0294] Overall, this work characterized multiple novel cis elements that enhance or limit FOXP3 expression in human Tconv, identified transcription factors and chromatin modifiers that promote and suppress FOXP3 expression, and characterized the role of select transcription factors in maintaining accessibility at FOXP3 enhancers. Furthermore, cis-regulator function was characterized through targeted GL2024-11-02PCT / / 3730.237WO1
[0295] CRISPRoff epigenetic modification, revealing CNSO and NCNS targeting completely prevents FOXP3 expression, while PPP targeting potently induces FOXP3 in resting cells. This characterization of the FOXP3 locus reveals novel routes to manipulate in situ cis elements to specifically enforce or silence Tconv FOXP3 expression. Broadly, this study highlights a systematic approach to comprehensively map a network of cis- and trans-regulators at a gene of interest, which can be expanded to other critical immune loci.
[0296] Bibliography
[0297] 1. Wang, J., loan-Facsinay, A., van der Voort, E. I. H., Huizinga, T. W. J. & Toes, R. E. M. Transient expression of FOXP3 in human activated nonregulatory CD4+ T cells. Eur. J. Immunol. 37, 129-138 (2007).
[0298] 2. Allan, S. E. et al. Activation-induced FOXP3 in human T effector cells does not suppress proliferation or cytokine production. Int. Immunol. 19, 345-354 (2007).
[0299] 3. Gavin, M. A. et al. Single-cell analysis of normal and FOXP3-mutant human T cells: FOXP3 expression without regulatory T cell development. Proc. Natl. Acad. Sci. U. S. A. 103, 6659-6664 (2006).
[0300] 4. Nunez, J. K. et al. Genome-wide programmable transcriptional memory by CRISPR-based epigenome editing. Cell 184, 2503-2519 (2021).
[0301] 5. Fontenot, J. D., Gavin, M. A. & Rudensky, A. Y. Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol. 4, 330-336 (2003).
[0302] 6. Hori, S., Nomura, T. & Sakaguchi, S. Control of regulatory T cell development by the transcription factor Foxp3. Science (80-. ). 299, 1057-1061 (2003).
[0303] 7. Voss, K. et al. FOXP3 protects conventional human T cells from premature restimulation-induced cell death. Cell. Mol. Immunol. 18, 194-205 (2021).
[0304] 8. Dikiy, S. et al. A distal Foxp3 enhancer enables interleukin-2 dependent thymic Treg cell lineage commitment for robust immune tolerance. Immunity 54, 931-946 (2021).
[0305] 9. Kawakami, R. et al. Distinct Foxp3 enhancer elements coordinate development, maintenance, and function of regulatory T cells. Immunity 54, 947-961 (2021).
[0306] 10. Zheng, Y. et al. Role of conserved non-coding DNA elements in the Foxp3 gene in regulatory T- cell fate. Nature 463, 808-812 (2010).
[0307] 11. Kim, H.-P. & Leonard, W. J. CREB / ATF-dependent T cell receptor-induced FoxP3 gene expression: A role for DNA methylation. J. Exp. Med. 204, 1543-1551 (2007).
[0308] 12. Tone, Y. et al. Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nat. Immunol. 9, 194-202 (2008).
[0309] 13. Vaeth, M. et al. Dependence on nuclear factor of activated T-cells (NFAT) levels discriminates conventional T cells from Foxp3+ regulatory T cells. Proc. Natl. Acad. Sci. U. S. A. 109, 16258-16263 (2012).
[0310] 14. Wang, Y, Su, M. A. & Wan, Y. Y. An Essential Role of the Transcription Factor GATA-3 for the Function of Regulatory T Cells. Immunity 35, 337-348 (201 1). GL2024-11-02PCT / / 3730.237WO1
[0311] 15. Cortez, J. T. et al. CRISPR screen in regulatory T cells reveals modulators of Foxp3. Nature 582, 416^120 12020).
[0312] 16. Loo, C.-S. et al. A Genome-wide CRISPR Screen Reveals a Role for the Non-canonical Nucleosome-Remodeling BAF Complex in Foxp3 Expression and Regulatory T Cell Function. Immunity 53, 143-157 (2020).
[0313] 17. Schumann, K. et al. Functional CRISPR dissection of gene networks controlling human regulatory T cell identity. Nat. Immunol. 21, 1456-1466 (2020).
[0314] 18. Baron, U. et al. DNA demethylation in the human FOXP3 locus discriminates regulatory T cells from activated FOXP3+ conventional T cells. Eur. J. Immunol. 37, 2378-2389 (2007).
[0315] 19. Janson, P. C. J. et al. FOXP3 promoter demethylation reveals the committed Treg population in humans. PLoS One 3, el612 (2008).
[0316] 20. Nagar, M. et al. Epigenetic inheritance of DNA methylation limits activation-induced expression of FOXP3 in conventional human CD25-CD4+ T cells. Int. Immunol. 20, 1041-1055 (2008).
[0317] 21. Mowery, C. T. et al. Systematic decoding of cis gene regulation defines context-dependent control of the multi-gene costimulatory receptor locus in human T cells. Nat. Genet. 56, 1156-1167 (2024).
[0318] 22. Zemmour, D., Pratama, A., Loughhead, S. M., Mathis, Di. & Benoist, C. Flier, a long noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc. Natl. Acad. Sci. U. S. A. 114, E3472-E3480 (2017).
[0319] 23. Shifrut, E. et al. Genome- wide CRISPR Screens in Primary Human T Cells Reveal Key Regulators of Immune Function. Cell 175, 1958-1971 (2018).
[0320] 24. Freimer, J. W. et al. Systematic discovery and perturbation of regulatory genes in human T cells reveals the architecture of immune networks. Nat. Genet. 54, 1133-1144 (2022).
[0321] 25. Zorn, E. et al. IL-2 regulates FOXP3 expression in human CD4+CD25+ regulatory T cells through a STAT-dependent mechanism and induces the expansion of these cells in vivo. Blood 108, 1571-1579 (2006).
[0322] 26. Weirauch, M. T. et al. Determination and inference of eukaryotic transcription factor sequence specificity. Cell 158, 1431-1443 (2014).
[0323] 27. Baranasic, D. JASPAR2020: Data package for JASPAR database (version 2020). R package version 0.99.8. (2020).
[0324] 28. Shin, H. M. et al. Transient expression of ZBTB32 in anti-viral CD8+ T cells limits the magnitude of the effector response and the generation of memory. PLoS Pathog. 13, el006544 (2017).
[0325] 29. Omori, M. et al. CD8 T cell-specific downregulation of histone hyperacetylation and gene activation of the IL-4 gene locus by ROG, repressor of GATA. Immunity 19, 281-294 (2003).
[0326] 30. Kressler, C. et al. Targeted De-Methylation of the FOXP3-TSDR Is Sufficient to Induce Physiological FOXP3 Expression but Not a Functional Treg Phenotype. Front. Immunol. 11, 6098901 (2021). GL2024-11-02PCT / / 3730.237WO1
[0327] 31. Nassar, L. R. et al. The UCSC Genome Browser database: 2023 update. Nucleic Acids Res. 51, D1188-D1195 (2023).
[0328] 32. Goudy, L. E. et al. Integrated Epigenetic and Genetic Programming of Primary Human T Cells. (2024).
[0329] 33. Schmidt, R. et al. CRISPR activation and interference screens decode stimulation responses in primary human T cells. Science (80-. ). 375, eabj4008 (2022).
[0330] 34. Li, W. et al. MAGeCK enables robust identification of essential genes from genome-scale CRISPR / Cas9 knockout screens. Genome Biol. 15, 554 (2014).
[0331] 35. Sanson, K. R. etal. Optimized libraries for CRISPR -Cas9 genetic screens with multiple modalities. Nat. Commun. 9, 5416 (2018).
[0332] 36. Ting, P. Y. et al. Guide Swap enables genome-scale pooled CRISPR-Cas9 screening in human primary cells. Nat. Methods 15, 941-946 (2018).
[0333] 37. Clement, K. et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol. 37, 215—226 (2019).
[0334] 38. Oki, S. et al. ChlP-Atlas: a data-mining suite powered by full integration of public ChlP-seq data. EMBO Rep. 19, e46255 (2018).
[0335] 39. Kanhere, A. et al. T-bet and GATA3 orchestrate Thl and Th2 differentiation through lineagespecific targeting of distal regulatory elements. Nat. Commun. 3, 1268 (2012).
[0336] 40. Saini, A. et al. Signal integration in lymphocytes via convergent genomic actions of NFATs with IRF4 and IRF8. GEO:GSE104921 (2018).
[0337] 41. Liao, W., Lin, J.-X., Wang, L., Li, P. & Leonard, W. J. Modulation of cytokine receptors by IL-2 broadly regulates differentiation into helper T cell lineages. Nat. Immunol. 12, 551-559 (2011).
[0338] 42. McCarter, A. C. et al. Combinatorial ETS 1 -Dependent Control of Oncogenic NOTCH1 Enhancers in T-cell Leukemia. Blood Cancer Discov. 1, 178-197 (2020).
[0339] 43. Arce, M. M. et al. Centralized control of dynamic gene regulatory circuits governs human T cell rest and activation [IN PREPARATION]. (2024).
[0340] All publications, patent applications, patents and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control.
Claims
GL2024-11-02PCT / / 3730.237WO1WHAT IS CLAIMED IS:
1. An isolated human conventional CD4+ T cell (Tconv) comprising altered FOXP3 activity as a result of a genetic modification in one or more of F0X01, GAT A3, STAT5, NFKB2, IKZF1, FOXP1, FOXP3, PTEN, STAT5B, STAT5A, ATXN7L3, IRF4, YY1, NR4A3, BCL11B, ZBTB32, GABPA, SMAD4, TAF5L, SETDB1, IKZF3, HIF1A, ZNF143, MGA ETS1, DNMT1, MBD2, TFDP1, MTF1, SATB1, FOXN2, VARS, YBX1, EGR2, E2F3, IRF2, ZNF574, MAP2K1, or GMEB1.
2. An isolated human conventional CD4+ T cell (Tconv) comprising altered FOXP3 activity as a result of a genetic modification associated with a gRNA having one of SEQ ID NOs: 42 to 236, or a combination thereof.
3. The isolated Tconv of claim 2 or 3 comprising altered FOXP3 activity as a result of a genetic modification in one of FOXO1, GAT A3 or STAT5.
4. The isolated Tconv of any one of claims 2 to 4 comprising altered F0XP3 activity as a result of a genetic modification in one of ETS1, DNMT1 or MBD2.
5. An engineered human conventional CD4+ T cell (Tconv) comprising: a catalytically inactive CRISPR-associated protein 9 (dCas9) fused to a DNMT3A DNA methyltransferase domain, a Kruppel-associated box (KRAB) domain, and a DNMT3L domain; at least one guide RNA comprising a spacer sequence complementary to i) a nonconserved noncoding sequence (NCNS) cis-regulatory element located upstream of the transcriptional start site of the human FOXP3 gene, ii) a cis-regulatory element within the PPP1R3F promoter (PPP) region of the human FOXP3 locus or iii) a CNSO cis-regulatory element of the human FOXP3 gene; and increased DNA methylation at the NCNS, CNS) or PPP element relative to an unmodified human conventional CD4+ T cell; wherein the engineered T cell exhibits reduced or increased FOXP3 expression upon activation relative to the unmodified human conventional CD4+ T cell.
6. The engineered Tconv of claim 5, wherein the at least one guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs: 1 to 34.GL2024-11-02PCT / / 3730.237WO17. An engineered human conventional CD4+ T cell (Tconv), comprising: a catalytically inactive CRISPR-associated protein 9 (dCas9) fused to a DNMT3A DNA methyltransferase domain, a Kruppel-associated box (KRAB) domain, and a DNMT3L domain; at least one guide RNA comprising a spacer sequence complementary to a cis-regulatory element selected from the group consisting of CNSO, NCNS, and PPP within the human FOXP3 locus; and increased DNA methylation at the targeted cis-regulatory element relative to an unmodified human conventional CD4+ T cell; wherein the engineered T cell exhibits a modulated FOXP3 expression profile upon activation, the modulation comprising either reduced or increased FOXP3 expression, relative to the unmodified human conventional CD4+ T cell.
8. The Tconv of claim 7, wherein the at least one guide RNA comprises a sequence selected from the group consisting of SEQ ID NOs: 1 to 34.
9. A method for modulating FOXP3 expression in human conventional CD4+ T cells (Tconv), comprising: obtaining a sample comprising human CD4+ CD25- conventional T cells (Tconv); contacting the sample with: a catalytically inactive Cas9 fusion protein comprising a DNMT3A DNA methyltransferase domain, a Kruppel-associated box (KRAB) domain, and a DNMT3L domain; and at least one guide RNA comprising a spacer sequence complementary to a cis-regulatory element of the human FOXP3 locus selected from the group consisting of: a non-conserved noncoding sequence (NCNS) located upstream of the FOXP3 transcriptional start site, a cis- regulatory element within the promoter region of PPP1R3F (PPP), and a conserved noncoding sequence (CNSO) upstream of the FOXP3 transcriptional start site; culturing the contacted cells under conditions permissive for assembly of a ribonucleoprotein complex between the catalytically inactive Cas9 fusion protein and the guide RNA and for targeted DNA methylation at the cis-regulatory element; stimulating the cells via a T cell receptor agonist to induce F0XP3 expression; and isolating cells exhibiting increased DNA methylation at the targeted cis-regulatory element and a modulated level of F0XP3 expression relative to a control cell not contacted with the catalytically inactive Cas9 fusion protein and the guide RNA.GL2024-11-02PCT / / 3730.237WO110. The method of claim 9, wherein the at least one guide RNA comprises a spacer sequence selected from the group consisting of SEQ ID NOs: 1 to 34.
11. The method of claim 9 or 10, wherein the cis-regulatory element is the non-conserved noncoding sequence located upstream of the FOXP3 transcriptional start site.
12. The method of claim 9 or 10, wherein the cis-regulatory element is the promoter region of PPP1R3F within the FOXP3 locus.
13. The method of claim 9 or 10, wherein the cis-regulatory element is the conserved noncoding sequence CNSO upstream of the FOXP3 transcriptional start site.
14. The method of any one of claims 9 to 13, wherein stimulating the cells comprises contacting the cells with an anti-CD3 / CD28 / CD2 antibody complex.
15. A method for selectively modulating FOXP3 expression in human T cells, comprising: isolating a population of human CD4+ T cells comprising both regulatory T cells (Tregs) and conventional T cells (Tconvs); delivering to the population a catalytically inactive CRIS PR-associated protein 9 (dCas9) fusion protein comprising a DNMT3A DNA methyltransferase domain, a Kruppel- associated box (KRAB) domain, and a DNMT3E domain, together with at least one guide RNA comprising a spacer sequence complementary to a Tconv-specific cis-regulatory element of the FOXP3 gene selected from the group consisting of NCNS and PPP; culturing the cells under conditions that permit assembly of a ribonucleoprotein complex and targeted DNA methylation at the selected cis-regulatory element; stimulating the cells to induce FOXP3 expression; and identifying Tconvs exhibiting a modulated FOXP3 expression profile upon activation, wherein the FOXP3 expression in Tregs remains substantially unaltered.
16. The method of claim 15, wherein the at least one guide RNA comprises a spacer sequence selected from SEQ ID NOs: 1 to 34.
17. The method of claim 15 or 16, wherein stimulating the cells comprises contacting the cells with an anti-CD3 / CD28 / CD2 antibody complex.
18. The method of any one of claims 15 to 17, wherein isolating the population comprises sorting cells by fluorescence-activated cell sorting using antibodies for CD4, CD25, and CD 127.GL2024-11-02PCT / / 3730.237WO119. A method for modulating F0XP3 expression in human conventional CD4+ T cells (Tconv) by targeting trans-regulatory factors, comprising: obtaining a population of human CD4+ CD25- conventional T cells (Tconv); introducing into the population at least one CRISPR-associated nuclease or interference system together with at least one guide RNA complementary to a genomic locus encoding a trans-regulatory factor selected from the group consisting of GAT A3, STAT5A, STAT5B, FOXO 1 , DNMT1 , MBD2 or ETS 1 ; culturing the cells under conditions that permit genome editing or transcriptional modulation of the targeted trans-regulatory factor; stimulating the cells to induce F0XP3 expression; and selecting cells exhibiting an altered level of F0XP3 expression upon activation relative to control cells not subjected to targeting of the trans-regulatory factor.
20. The method of claim 19, wherein the trans-regulatory factor is GATA3.
21. The method of claim 19 or 20, further comprising administering the selected cells to a subject in need thereof.
22. A method to prevent, inhibit or treat an autoimmune disease in a mammal comprising administering to the mammal a composition having a plurality of human conventional CD4+ T cell (Tconv) cells with a genetic modification in one or more of FOXO1, GATA3, STAT5, NFKB2, IKZF1, FOXP1, FOP3, PTEN, STAT5B, STAT5A, ATXN7L3, IRF4, YY1, NR4A3, BCL11B, ZBTB32, GABPA, SMAD4, TAF5L, SETDB1, IKZF3, HIF1A, ZNF143, MGA ETS1, DNMT1, MBD2, TFDP1, MTF1, SATB1, FROXN2, VARS, YBX1, EGR2, E2F3, IRF2, ZNF574, MAP2K1, or GMEB1.
23. The method of claim 22, wherein the modification is in GAT A3, STAT5A, STAT5B, FOXO1, DNMT1, MBD2 or ETS1.
24. A method to prevent, inhibit or treat an autoimmune disease in a mammal, comprising administering to the mammal a composition having a plurality of Tconv cells modified with one of SEQ ID NOs: 43 to 236.GL2024-11-02PCT / / 3730.237WO125. The method of any one of claims 22 to 24, where the cells are injected.
26. The method of any one of claims 22 or 25, where the cells are systemically administered.
27. The method of any one of claims 22 to 26, wherein the mammal is a human.
28. The method of any one of claims 22 to 27, wherein the autoimmune disease is rheumatoid arthritis, Crohn's disease, multiple sclerosis (MS), systemic sclerosis (SSc), systemic lupus erythematosus (SLE), autoimmune encephalomyelitis, myasthenia gravis (MG), Hashimoto's thyroiditis, Goodpasture’s syndrome, pemphigus (e.g., pemphigus vulgaris), Grave's disease (GD), aplastic anemia (AA), vitiligo, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, scleroderma with anti-collagen antibodies, mixed connective tissue disease, polymyositis, pernicious anemia, idiopathic Addison's disease, autoimmune-associated infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), graft vs host disease (GvHD) or promote organ transplant tolerance, bullous pemphigoid, Sjogren's syndrome, insulin resistance, or autoimmune diabetes mellitus (type 1 diabetes (T1D) mellitus; insulin-dependent diabetes mellitus).
29. The method of any one of claims 22 to 28, wherein the cells are autologous cells or allogeneic cells.
Citation Information
Patent Citations
Modified pluripotent stem cells and methods of making and use
US20210040449A1
Gene targets for manipulating t cell behavior
WO2021076744A1
Compositions, systems, and methods for programming t cell phenotypes through targeted gene repression
WO2023137472A2