Oligonucleotides for modulating synaptogyrin-3 expression

Abstract

The invention relates to an oligonucleotide comprising a gapmer of formula 5'-F-G-F'-3', where each one of F and F' is a region which independently comprises between 3 and 4 nucleosides, and wherein each one of said F and F' region independently comprises at least one chemically modified nucleoside defining the 5' and 3' end of the F and F' region, and wherein G is a region between 9 and 11 nucleosides for recruiting RNaseH, which oligonucleotide can target regions within the synaptogyrin-3 RNA sequence. In particular, these oligonucleotides are provided for use as a medicament in general, and for treating or inhibiting progression of tauopathies or symptoms of tauopathies.

Description

[0001] PaVer / SyngrASO3 / 849

[0002] OLIGONUCLEOTIDES FOR MODULATING SYNAPTOGYRIN-3 EXPRESSION

[0003] FIELD OF THE INVENTION

[0004] The invention relates to new agents which can target the regions within the synaptogyrin-3 RNA sequence, said new agents being for example oligonucleotide inhibitors such as antisense oligonucleotides. In another aspect, the invention relates to said new agents which can target synaptogyrin-3 for use as a medicament in general, and for treating or inhibiting progression of tauopathies or symptoms of tauopathies.

[0005] BACKGROUND

[0006] Tau pathology is associated with more than twenty neurodegenerative diseases, including, for example, Alzheimer's disease or progressive supranuclear palsy (PSP) (Wang & Mandelkow 2016 Nat Rev Neurosci 17:5-21, Martinez-Maldonado et al. 2021 J Alzheimers Dis, 79(4): 1517-1531). Hyperphosphorylation or mutation of the microtubule-associated protein Tau is common to all of these diseases, collectively termed Tauopathies, and filamentous inclusions of hyperphosphorylated Tau are hallmark pathologies of Alzheimer's disease and other Tauopathies (Ballatore et al 2007 Nature Reviews Neuroscience 8:663- 672). Clinically, tauopathies can present with a range of phenotypes that include cognitive / behavioral- disorders, movement disorders, language disorders and non-specific amnestic symptoms in advanced age (Zhang et al 2022 Mol Neurodegener 17(1):28). Tau pathology is identified as a key mediator of neurotoxicity itself (Roberson et al 2007 Science 316:750-754; Hutton et al 1998 Nature 393:702-705; Caffrey & Wade-Martins 2007 Neurobiol Dis 27:1-10; Le Guennec et al 2016 Molecular Psychiatry 1-7).

[0007] Previous work of the inventors of current application indicated that when Tau is present at pre-synaptic terminals it binds to and clusters synaptic vesicles. Synaptogyrin-3 (Syngr3) was identified as a physical interactor of Tau (W02019 / 016123). Moreover, it was demonstrated in vivo that the partial loss of Syngr3 - both in mice and in fly expressing pathogenic P301S Tau ("PS19"), well-accepted models for tauopathy that recapitulates features seen in patients, including synaptic loss, neuroinflammation and cognitive decline - restores working memory and rescues synaptic degeneration. Interestingly, partial (and complete) loss of Syngr3 is benign in mice and fruit flies. Given the potential of Syngr3 as a clinical target for tauopathies, it is advantageous to develop inhibitors that specifically downregulate Syngr3 transcript levels. The inventors of current application have previously found out that some subsequences within the Synaptogyrin-3 gene are significantly more accessible for oligonucleotides such as antisense oligonucleotide (ASO) molecules and therefore are preferred target regions for designing PaVer / SyngrASO3 / 849 oligonucleotides suitable for or capable of reducing the expression and / or activity of Synaptogyrin-3 (W02023 / 021046).

[0008] Since tauopathies are still considered as untreatable diseases, constant efforts are made to depict clinical and pathological characteristics, identify biomarkers, elucidate underlying pathogenesis to achieve early diagnosis and develop disease-modifying therapies (Zhang et al., 2022 Mol Neurodegener 17(1):28). Still, search for new therapies which could restore the physiological Tau functions or decrease Tau pathology remains a challenge.

[0009] SUMMARY OF THE INVENTION

[0010] The present invention concerns novel oligonucleotides, preferably ASOs, such as gapmers, which are capable of specific binding to the regions to Synaptogyrin-3 transcript, thereby reducing the expression of Synaptogyrin-3 through antisense technology.

[0011] In a first aspect, the invention concerns an oligonucleotide comprising a gapmer of formula 5'-F-G-F'-3', where each one of F and F' is a region independently comprising between 3 and 4 nucleosides; wherein each one of said F and F' regions independently comprises at least one chemically modified nucleoside defining the 5' and 3' end of the F and F' region; and wherein G is a region between 9 and 11 nucleosides for recruiting RNaseH; wherein said oligonucleotide comprises a contiguous nucleotide portion of at least 10 contiguous nucleotides in length, the contiguous nucleotide portion being at least 90% complementary to an equal length portion of a target region within the Synaptogyrin-3 nucleotide sequence as depicted in SEQ ID No. 1; and wherein the target region within the Synaptogyrin-3 nucleotide is comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ ID No. 1 and wherein the endpoints are included.

[0012] Preferably, said at least one chemically modified nucleoside is 2' sugar modified nucleoside defining the 5' and / or 3' end of the F and F' region and / or a nucleoside featuring one or more internucleoside linkage In another aspect, the invention relates to a pharmaceutical composition comprising the oligonucleotide of the invention.

[0013] In yet another aspect, the invention relates to the oligonucleotide according to any embodiment of the first aspect or the pharmaceutical composition according the invention for use as a medicament.

[0014] The invention further relates to use of said oligonucleotide or pharmaceutical composition according to the invention in treating or inhibiting progression of a tauopathic disorder or for use in treating or inhibiting a symptom of a tauopathic disorder. Preferably, said tauopathic disorder is selected from the PaVer / SyngrASO3 / 849 group consisting of Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration Pick's disease, frontotemporal dementia with parkinsonism associated with chromosome 17 (FTDP-17), post-encephalitic parkinsonism, Parkinson's disease complex of Guam, Guadeloupean parkinsonism, Huntington disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallevorden-Spatz disease, Niemann Pick type C, chronic traumatic encephalopathy, tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-related mental retardation, non-Guamanian motor neuron disease with neurofibrillary tangles, neurodegeneration with brain iron accumulation, Gerstmann- Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcification, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis and parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

[0015] BRIEF DESCRIPTION OF THE FIGURES

[0016] Figure 1 illustrates exemplary, non-limiting, schematic architectures of the oligonucleotides, in particular the gapmers of the invention (5' to 3'). In Figure 1 the four parent ASO molecules are shown, each one consisting of the 16 nucleotides (depicted as boxes) corresponding to sequences SEQ ID No. 2, 3, 4, and 5. The parent ASO molecules served as a basis for development of new oligonucleotides of the invention, by micro-walking the sequences. Newly designed gapmers of formula 5'-F-G-F'-3', where each one of F and F' is a region independently comprising between 3 and 4 chemically modified nucleosides, are defined by the sequences shown as SEQ ID No. 6 to 25 in Fig. 1. The central portion, i.e., the G-region constituted by DNA nucleotides, is indicated as underlined in the sequences SEQ ID No. 6 to 25, and depicted by a white boxes in the pattern design column. For all the oligonucleotides shown in Figure. 1. The F and F' regions which regions independently comprise chemically modified nucleotides, preferably LNA-modified nucleosides and / or 2' sugar modified nucleosides, which are shown as not-underlined the sequence column and as grey-shaded boxes in pattern design column. The mismatch to the closest off- target is marked by a star.

[0017] Figure 2 A-C shows the improvement of selectivity for the oligonucleotides as an effect on the expression on Syngr-3 as well as on other potential off target genes (such as CTNNA2, PTPRJ, STS, EXOC4, RAD51B, TTC7A, GET4, SAMD4B, EDH3, SUN1, and FAHD1). Fig. 2A-The selectivity of the parent oligonucleotide of SEQ ID No. 3 and the corresponding newly developed oligonucleotides of sequences SEQ ID No. 13- 17. Fig. 2B-The selectivity of the parent oligonucleotide of SEQ ID No. 2 and the corresponding newly PaVer / SyngrASO3 / 849 developed oligonucleotides of sequences SEQ ID No. 6-7 and SEQ ID No. 11-12. Fig. 2C- The selectivity of the parent oligonucleotide of SEQ ID No. 4 and the newly developed oligonucleotides of sequences SEQ ID No. 18-22.

[0018] DETAILED DESCRIPTION OF THE INVENTION

[0019] Definitions

[0020] In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description. The present invention is described with respect to particular embodiments and with reference to certain figures but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes.

[0021] It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence", is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more" and "at least one" can be used interchangeably herein.

[0022] Furthermore, "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B", "A or B", "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0023] Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

[0024] It is understood that wherever aspects are described herein with the language "comprising", otherwise analogous aspects described in terms of "consisting of" and / or "consisting essentially of" are also provided. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. PaVer / SyngrASO3 / 849

[0025] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

[0026] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0027] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower). For example, if it is stated that an oligonucleotide of the present disclosure reduces expression the Syngr-3 transcript in a cell following administration of an oligonucleotide of the present disclosure by at least about 60%, it is implied that the Syngr-3 expression levels are reduced by a range of 50% to 70%.

[0028] The terms "reverse complement", "reverse complementary" and "reverse complementarity" as used herein are interchangeable with the terms "complement", "complementary" and "complementarity". The terms "identical" or percent "identity" in the context of two or more nucleic acids refer to two or more sequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.

[0029] The term "percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matched positions shared by the sequences over a comparison window, taking into account additions or deletions (i.e. gaps) that must be introduced for optimal alignment of the two sequences. A matched position is any position where an identical nucleotide or amino acid is presented in both the target and reference sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides or amino acids. Likewise, gaps presented in the reference sequence are not counted since target sequence nucleotides or amino acids are counted, not nucleotides or amino acids from the reference sequence. PaVer / SyngrASO3 / 849

[0030] One such non-limiting example of a sequence alignment algorithm is, for example, the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain aspects, Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain aspects, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using a NWSgapdna. CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative aspects, the GAP program in the GCG software package, which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5). Alternatively, in certain aspects, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4. One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software. In certain aspects, the default parameters of the alignment software are used.

[0031] One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. Sequence alignments can be derived from multiple sequence alignments. One suitable program to generate multiple sequence alignments is ClustalW2, available from www.clustal.org. Another suitable program is MUSCLE, available from www.drive5.com / muscle / . ClustalW2 and MUSCLE are alternatively available, e.g., from the EBI (European Bioinformatics Institute). In certain aspects, the percentage identity "X" of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y / Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. Different regions within a single polynucleotide target sequence that align with a polynucleotide reference sequence can each have their own percent sequence identity. It is noted that the percent PaVer / SyngrASO3 / 849 sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.

[0032] As used in the present disclosure, the terms "oligonucleotide", "oligonucleotide molecule", "oligonucleotide of the invention" and "oligonucleotide of the present disclosure" and grammatical variants thereof are used interchangeably.

[0033] The terms "defined by SEQ ID No. X" or "of SEQ ID No. X" as used herein refer to a biological sequence consisting of the sequence of nucleotides given in the SEQ ID No. X. SEQ ID No. X is interchangeable with SEQ ID NO: X. When the present application refers to "a group consisting of SEQ ID No. 2-4", this is identical to a group consisting of SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4.

[0034] The target region within the Synaptogyrin-3 nucleotide sequence of the invention is a nucleic acid sequence, e.g., an mRNA, a primary mRNA transcript or a pre-mRNA, capable of encoding Synaptogyrin- 3, more particularly human Synaptogyrin-3. The oligonucleotides of the invention are specifically designed to downregulate the expression of these targets, which can eventually lead to the target degradation. "Synaptogyrin3", "Synaptogyrin3", "synaptogyrin-3", "synaptogyrin-3", "Syngr3", "Syngr- 3", "SYNGR3" or "SYNGR-3" are interchangeably used and refer herein to Synaptogyrin-3 transcript if not otherwise specified.

[0035] The human nucleic acid sequence of Synaptogyrin-3 (hSyngr-3) is set forth in SEQ ID No. 1; however also within the scope of the invention are nucleic acid sequence variants of Synaptogyin-3 as may exist due to allelic variation, e.g., a mRNA encoding a Synaptogyrin-3 allelic variant. Such variations are defined herein as "allelic variants of SEQ ID No. 1". The term "allelic variants" refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. These allelic variants can vary at either the polynucleotide and / or polypeptide level and are included in the present disclosure. Alternatively, non-naturally occurring variants can be produced by mutagenesis techniques or by direct synthesis. In some embodiments, the synaptogyrin-3 variant is a splice variant. In some embodiments, the synaptogyrin-3 variant is a post-translationally modified variant. In some embodiments, the synaptogyrin-3 variant is a mutant synaptogyrin-3, e.g., a mutant comprising at least one nucleotide point mutation, deletion, or insertion. In some embodiments, the mutation is a silent mutation. In some aspects, the synaptogyrin-3 variant is a mutant protein comprising at least one amino acid substitution, deletion, or insertion. In some embodiments, the synaptogyrin-3 variant is a loss of function variant. In some embodiments, the synaptogyrin-3 variant is a gain of function variant. PaVer / SyngrASO3 / 849

[0036] "Specific to synaptogyrin-3" as used herein is referring to the fact that the oligonucleotide of the invention is acting at the level of synaptogyrin-3 and not at the level of another transcript, i.e. off-target genes. Specificity can be ascertained by e.g. determining the expression level of closely related RNA sequences.

[0037] The term "statistically significantly" different is well known by the person skilled in the art. Statistical significance measures the probability of the null hypothesis being true compared to the acceptable level of uncertainty regarding the true answer. It should be interpreted that the term "statistically significant", as used herein relates a result, wherein a p value which is the probability of obtaining a result at least as extreme, given that the null hypothesis were true. The difference is considered statistically significant if the p value calculated is less than the pre-specified alpha (a), and said a can be, for example, set as 0.05, 0.01 or 0.001.

[0038] Nucleic acid molecules inhibiting the expression of Synaptogyrin-3

[0039] The present disclosure provides nucleic acid molecules, more particularly oligonucleotides, that comprise a sequence complementary (fully or partially) to a region of a mRNA or pre-mRNA encoding the human Synaptogyrin-3 protein, or a mRNA or pre-mRNA of an allelic variant or isoform thereof (e.g., any of the variants and isoform disclosed in the UniProtKB / Swiss-Prot 043761 entry). SEQ ID No. 1 represents the nucleic acid sequence of the human Synaptogyrin-3 gene (Ensembl GRCh38:16; 1989660:1994275).

[0040] SEQ ID No. 1: Gene Sequence human Syngr3, Ensembl GRCh38:16 (1989660:1994275)

[0041] CCTACCCCTTTACTCCCTCACCCAAGTGCCCTTCCCAGAGGAGCGGACTCCTCCTGTCTGTCCTCCCGGCTCTAGCA AAGTCTGCGCCCAGCACCCGAGCCCCACCCTGCCCCCGGGGACCTGGCTGGTGGGTTCCTGAGGATGGTCTCCA TCTCGGGACCGGGGCAGGCAGGTGAGGGTGGGGGATGGGAGGTGGGCGCGGCGGAGGGAGAGGAGGGACC CGGCCCCGCGCGCATGGACCCAGTGGGGGGCGCGGGCGCGGCCCCGCCCCGTCCCGCGCGTCCCCGCCGCGGC CGGCGCGCGCTCCCGGGAGGCGGCAGCGGCTGCAGCGTTGGTAGCATCAGCATCAGCATCAGCGGCAGCGGCA GCGGCCTCGGGCGGGGCCGGCCGGACGGACAGGCGGACAGAAGGCGCCAGGGGCGCGCGTCCCGCCCGGGC CGGCCATGGAGGGCGCCTCCTTCGGCGCGGGCCGCGCAGGGGCCGCCCTGGACCCCGTGAGCTTTGCGCGGCG GCCCCAGACCCTGCTCCGGGTCGCGTCCTGGGTGAGTGGTCCCTGCCCGGGCCCCCGCTCCCGCCCCTGCCTCGC GACCTTCAGGCCCCTACCAGCCCCCTGCCCCCTACCCCCTGCCCCCTGCTTCTCGCCCCCCGACCTCACTCACTCTC ATCCTCGCCGGCCCCTCCCCCGCCGGCCTCAGGTTGGGGTGACGTCACCGGGCAGGGCGCGCCCACCTGCGGGC GGAGGAGGGGCCGGCGGCGCCGGAGAGGGACCTTGAGAGGTCACCGCCGGTCGCCTCTACCCCTACCTCCTCC CCGGGTCTAATTTCAGTCCCTTTCCGCAGCCCTTACTCCGTTTTTCCTGTTCTCGTGACCTGGAAGCAGGGACGGG GTGGGGACGGAATTCTCCGAGGGGCAGGAGGGGGCTACGGGAACCGAGAAGCGCCTCCCCTTCCCCCGCACAC PaVer / SyngrASO3 / 849

[0042] ACACCCTCGGGTCTCCTTGGCAGGGAGCCTGTCCCCTGGCCCCCAGTTCCAGCTGTGAGTTGAGGGAGGAGAGG

[0043] CTCTGGGCTGGGAGGGCTTCCTGGCGGCGGTGTGGAAGGCAGGTTTGGGAGCAGCCTAGCCCACTGGGGCGTC

[0044] CCTGGGAGGGCCCTGCTGCTCCTTCCCTCCGGCAGGGGAGGTGGCAGTTGGGTGCCGAGCTCTGGGTTTTGTCC

[0045] AGGTGGCAACCTCTGGGCCAGCCGCACCTCGGCGCCTGTCTTGGAGGAGGGCGGTGCCCACGGTGGGGCAGGG

[0046] GCTTTGGCCTCCCCTGCGGAGTGGCTCTGACCAGACCGGGAGGCAGGACGCTGCGTTTTGGTCCGAGCGCACGT

[0047] CCCGACTTGTGGCCCACTCTTGGGGACAAGTGCATGTCCCGGCTTCCCCCTTGGCTCCACTCTCGGAGCTGGAGC

[0048] GGGAAAGGAGCGAAGGGATGAGGTTGAGGCTGGAGGTCGTTTCTTGGAAACACAGGGCTGCCCCGTGCAGCG

[0049] CTGGTTAAAATGACTGCGGTCCCCCTCATGCCTGTCTCCCGGAACTGGTGGGCAGGAGGCATTGAGGTTTGACG

[0050] GAACCTCAGAGGTCAACGGTGTCATCTTTTCAGCCCAAACACTTACAGGTGATATTAATAATCAGTCACGTGGGG

[0051] GCTGTCATCCCTCGGGTACCCACCACGTGCAGGAAGCTGGGTGGACATGTCTGTCCCAGCACTGCATGAGCTGT

[0052] GCCCGTCACCCTATTTGCATGCTAGAAAACAGGCCAGACAGTTCCCAACCGCGCAGGAAGCAACAGCTCCGCTG

[0053] CCTCCATACCCTCCCTCCCGCCCCGCTCTGCCTGCTGCACTCTCACCTCCCCTTCGCCGTTCCGGCTCCAGCCTGGG

[0054] AATCGCGGGCCCAGGTGAAGGCTCCTGTTCCCACACTCTTGAGTGGGCTCTGAGGGGACTCCACGGGCCCACGC

[0055] GGTGCAGAGTACCTGGCTTGAATCAACCCCGGCTTTTGTCAGCCATGTGATCCCGGACAAGTCACTTCACCTGTT

[0056] GGGGTCCCAATGTCCCCCGCATTTATAAAGAGAATAAGAACAATGGCGATCCCACGGGGACTTTCTGAGGATTT

[0057] GGTGAGGGGACGCATGTAAAGTGGCTGTTTAACACAATGTCTGGGCATAGTAGATGCTCACTAAACGGCCCGTG

[0058] TTGTCAATAATTACTAAATACGCGAGGGTTCGGGAAAGAAAGAGGTGACACCGCCCCCCACCCAGATACGGGCC

[0059] TGGGAACGCAGGGACAGGCCCAGGGGCGTGGGCGCTCGAGGCGGGCTCGCAGAGGTCGGGTCGCCGCAGGG

[0060] CCCTGAGCGCCGCGCCGCACGCAGGTGTTCTCCATCGCCGTCTTCGGGCCCATCGTCAACGAGGGCTACGTGAA

[0061] CACCGACAGCGGCCCCGAGCTGCGCTGCGTGTTCAACGGGAACGCGGGCGCCTGCCGCTTCGGCGTCGCGCTG

[0062] GGCCTCGGAGCCTTCCTCGCCTGCGCCGCCTTCCTGCTGCTCGATGTGCGCTTCCAGCAAATCAGCAGCGTCCGC

[0063] GACCGCCGGCGCGCGGTGTTGCTGGACCTGGGCTTCTCAGGTGGGCGGGGCCGGGGCGGTGAGCGCGGAGAG

[0064] CCTTCCGGGTGGGCGGGGAGGGGGCGGGGCCTGGGCGGGGAACACCGCTGGAGTTTCCAGCTGGGCGTGGCC

[0065] GTGACGAGGGGCGGGGACTGAGGCAGGGAGTGTCAATGGGCCTCCCGGGTGGGCGGGGAGGGGGCGGAGCC

[0066] TGGACGGGGAGCGCCGCGGGACTTTCTAGGTAGGCGGGGCCCGGGTCTGGGCGGAGCCTGGGCGCGGAACGG

[0067] GTCTGGCGCTCCCGGGTGGGCGGGGTCAGCGCAGGAGAGGGAGGCGGGACCTCGCGCCACGCGGCGAGCCCA

[0068] GGCGAGGCGCCCCAAGCCTCGGGCCCACCGACCTTTCCTCCTCCGGGCGAGGCCGCCGTGGGCCACCGCGTGGA

[0069] GCGTCGCCCTGACGCGCCGCACTGTTCGCAGGACTCTGGTCCTTCCTGTGGTTCGTGGGCTTCTGCTTCCTCACCA

[0070] ATCAGTGGCAGCGCACGGCGCCAGGGCCGGCCACGACGCAGGCGGGGGACGCGGCGCGGGCCGCCATCGCCT

[0071] TCAGCTTCTTCTCCATCCTCAGCTGGGTGAGTGCGGGGCCCGGGAGGGCGGGGCGAAGGGGCGGGCGCTCGGC

[0072] TGATCCCGGCTGACCCCGCTGACCCCGCCCCGCGCAGGTGGCGCTCACCGTGAAGGCCCTGCAGCGGTTCCGCC

[0073] TGGGCACCGACATGTCACTCTTCGCCACCGAACAGCTGAGCACCGGGGCGAGCCAGGCCTACCCCGGCTATCCG

[0074] GTGGGCAGCGGCGTGGAGGGCACCGAGACCTACCAGAGCCCGCCCTTCACCGAGACCCTGGACACCAGCCCCA

[0075] AAGGGTACCAGGTGCCCGCCTACTAGCGGCTGGCAGGCACAGACCAGGGCTCCAAGGCCACCCCACCAACGCA PaVer / SyngrASO3 / 849

[0076] GGCCCCAGGGTCTCCGGGACCTCCCTTGGGTCCTTCCAGCTCAGTGCCGCGGACAGAGTAGGTGGCCGCTTTGC GCCATCCGGGGCCAAGAGGGGGTGGACCCGCGTGTCTGGGCTGCCCCTGCCAAGTTCCCCCAGTCCCTCAGCAC CTGGCCCCAGGACTGAGGTCCTGAGAAGGGGATAGCACTGCCCAGGACGTGTGTCCCTAGCCTGGAATGGACT GGCCTGGGGAAGGCTTTCCCCTCTTGGGCCACACCTGCTCACTCTGGGGTTGGGGGTCCAGCTGCCCTCTACGAT CAGGTGCAGGGGCTGCCCAGGACAAAGCGGGGGCAGGGGAAAGACACCACCCTCGCCCCAAGACTGGGGATC CTGGCCACTGTTCCCATCCCATGTCCCTGTGGGTAGTGACTGTCTCGTTTCTGTCATGGTGGTGCGTCCCGTCCGG AGCCACTCTCCACTTTCTCTCACAGGCTGCTAGAACAGCCCAGCCCTGTCAGTGTTGTGATCATGGTCCAGTCTTC GGGTTTCACCTCCTAGTACTCCACAAGCTGCTCCTCTCTCTGTGGCCCCGGCCCCTGCCCAGGTGTGGGTGGTTCT GGCCAGGAAGGCACAAGGTAGCTGTGGGCCAAGACACCAGCCCTGTCCTAGCCCTTCAGTAAGACCTTGCCAGG AGAGGAGAAGGATGCCTGGGTGCCAGGCAAGACAAGCCCCTCAGCAGGAGAGAGGCCCAGAGGCTCCAGCTG GCCACCGTGCCCCACAAGATGGCCCCTGTGTGGTTCCCTTTACCTTGGCTTCCTGGCCCAGTCCCTGCCTCTCCAC CTGCACCCTGCTTCCTGGCCCAGTCCCAGGTTGGAGTCCCTCTGCATAGCTGACTACTCATGCATTGCTCAAAGCT GGCTTTTCACATTAAGTCAACACCAAACGTGGTTGCCACATTTCATCAGACAGACACCTCCCTCTGGAGATGCAGT TGAGTGACAACCTTGTTACATTGTAGCCTAGACCAATTCTGTGTGGATATTTAAGTGAACATGTTTACAATTTTTG TATATATCACTCTCTCCCTCTCCTGAAAGACCAGAGATTGTGTATTTTCAGTGTCCCATGTTCCGACTGCACCTTCT TTACAATAAAGACTGTAACTGAGCTGACTGTGA

[0077] The nucleic acid molecule or the oligonucleotide of the present disclosure is preferably an antisense oligonucleotide, herein further referred to as an ASO comprising a gapmer of formula 5'-F-G-F'-3', where each one of F and F' is a region independently comprising between 3 and 4 nucleosides; wherein each one of said F and F' regions independently comprises one or more chemically modified nucleosides defining the 5' and 3' end of the F and F' region; and wherein G is a region between 9 and 11 nucleosides for recruiting RNaseH; wherein said oligonucleotide comprises a contiguous nucleotide portion of at least 10 contiguous nucleotides in length, the contiguous nucleotide portion being at least 90% complementary to an equal length portion of a target region within the Synaptogyrin-3 nucleotide sequence as depicted in SEQ ID No. 1; and wherein the target region within the Synaptogyrin-3 nucleotide is comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ ID No. 1 and wherein the endpoints are included.

[0078] Terms "antisense oligonucleotides" or "ASOs" are used interchangeably in this disclosure, refer to short, oligodeoxynucleotides that can alter RNA and reduce, restore, or modify protein expression through various mechanisms. The ASOs are preferably synthetic molecules. In particular, by the term ASO it is referred to an oligonucleotide capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. An antisense PaVer / SyngrASO3 / 849 oligonucleotide (ASO), can be, for example a single stranded antisense oligonucleotide, such as a high affinity modified antisense oligonucleotide interacting with RNase H, such as a gapmer. The antisense oligonucleotides are preferably not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than 50% across of the full length of the oligonucleotide.

[0079] "Nucleotides" as used herein refer to the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which are absent in nucleosides). A nucleotide without a phosphate group is called a "nucleoside" and is thus a compound comprising a nucleobase moiety and a sugar moiety. As used herein, "nucleobase" means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Naturally occurring nucleobases of RNA or DNA comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

[0080] The term "contiguous nucleotides" or "contiguous nucleotide sequence" refers to the region of the oligonucleotide which is complementary to the target nucleic acid. "Contiguous" as used herein means next or together in sequence, hence the contiguous nucleotides are linked nucleotides (i.e. no additional nucleosides are present between those that are linked).

[0081] The terms "oligomer" or "oligonucleotide" in the context of the present disclosure are used interchangeably and refer to a molecule formed by covalent linkage of two or more nucleotides. Herein, a single nucleotide (unit) can also be referred to as a monomer or unit.

[0082] In some aspects, the present disclosure provides a derivative of an oligonucleotide of the present disclosure which is a conjugate, e.g., a GalNAc conjugate. The term "derivative" as used herein refers to a chemical compound related structurally to a compound disclosed herein (e.g., an oligonucleotide of the present disclosure), e.g., having the same carbon skeleton, but chemically modified to introduce, e.g., a side chain or group, in one or more positions, and wherein the derivative possesses a biological activity (e.g., the capacity to reduce Syngr3 expression) that is substantially similar to a biological activity of the entity or molecule it is a derivative. PaVer / SyngrASO3 / 849

[0083] The term, "complementary" means that two sequences are complementary when the sequence of one can bind to the sequence of the other in an anti-parallel sense wherein the 3'-end of each sequence binds to the 5'-end of the other sequence and each A, T(U), G, and C of one sequence is then aligned with a T(U), A, C, and G, respectively, of the other sequence. Normally, the complementary sequence of the oligonucleotide has at least 90%, preferably 95%, most preferably 100% complementarity to a defined sequence.

[0084] In determining the degree of "complementarity" between oligonucleotides of the disclosure (or regions thereof) and the target region, such as those disclosed herein, the degree of "complementarity" (also, "homology" or "identity") is expressed as the percentage identity (or percentage homology) between the sequence of the oligonucleotide (or region thereof) and the sequence of the target region (or the reverse complement of the target region) that best aligns therewith. The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, dividing by the total number of contiguous monomers (e.g. nucleotides) in the oligomer (e.g. oligonucleotide), and multiplying by 100. In such a comparison, if gaps exist, it is preferable that such gaps are merely mismatches rather than areas where the number of monomers within the gap differs between the oligomer of the disclosure and the target region.

[0085] As used throughout the present disclosure, the terms "target regions of SEQ ID No. 1" or "target region in the synaptogyrin-3 mRNA transcript" or "target region" in general, as well as grammatical variants thereof refer to regions or subsequences in a synaptogyrin-3 mRNA transcript that are targeted by the oligonucleotides of the present disclosure. In some embodiments, the synaptogyrin-3 mRNA transcript containing the target region is the synaptogyrin-3 mRNA transcript set forth in SEQ ID No. 1. However, in other aspects, the synaptogyrin-3 mRNA transcript containing the target region can be a synaptogyrin- 3 mRNA transcript variant, e.g., an allelic variant, of the synaptogyrin-3 mRNA transcript set forth in SEQ ID No. 1, an isoform thereof, or an ortholog thereof.

[0086] As used herein, the term "reducing", e.g., reducing the expression of hSYNGR3 mRNA transcript and / or hSYNGR3 protein level and / or hSYNGR3 activity refers to the ability of an oligonucleotide of the present disclosure (e.g., an ASO or siRNA) to statistically significantly reduce (or decrease, inhibit or lower) the expression of the hSYNGR3 gene transcript and / or hSYNGR3 protein level and / or activity in a cell, a tissue, or a subject. In some aspects, the term "reducing" refer to complete inhibition (100% inhibition or non-detectable level) of hSyngr3 gene transcript and / or hSyngr3 protein level and / or activity. In other aspects, the term "reducing" refers, e.g., to at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, to at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least 90%, at least 95% or at least 99% reduction or inhibition of PaVer / SyngrASO3 / 849 hSyngr3 mRNA transcript and / or hSYNGR3 protein expression and / or activity in a cell, a tissue, or a subject.

[0087] The terms "individual", "subject", "host", and "patient", are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. The compositions and methods described herein are applicable to both human therapy and veterinary applications. In some aspects, the subject is a mammal, and in other aspects the subject is a human. As used herein, a "mammalian subject" includes all mammals, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like) and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like).

[0088] The oligonucleotide(s) of the invention are developed typically for modulating the expression of Synaptogyrin-3 as target nucleic acid in a mammal. In some embodiments the antisense oligonucleotides, is typically for inhibiting the expression of a target nucleic acid. More particularly, the oligonucleotides of the application are provided as being capable of reducing the level of Synaptogyrin- 3 (pre-)mRNA transcript (and thus indirectly SYNGR3 protein) in a cell, wherein the reduction is determined by comparison to a control situation, i.e. the level of Synaptogyrin-3 mRNA transcript in the same cell or same cell type grown in the same conditions but in the absence of the oligonucleotide of the application.

[0089] The oligonucleotides described in the application are partially or fully complementary to an equal length portion of a target region within the Synaptogyrin-3 as depicted in SEQ ID No. 1 or allelic variants thereof. The specific target regions will be described in detail below. In another embodiment, the oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to one of said specific target regions, and may, in some embodiments further comprise one or more additional nucleotides such as 1, 2, 3, 4, 5, 6, 7, 8 or 9 further nucleotides in addition to the contiguous nucleotide sequence. In some embodiments the additional nucleotides are complementary to the contiguous nucleotide sequence and are capable of forming a stem loop (hairpin) structure by hybridizing to the contiguous nucleotide sequence. In some embodiments the additional nucleotides are 1 to 5 phosphodiester linked nucleotides.

[0090] In one embodiment, the nucleic acid molecule(s) or the oligonucleotide(s) of the application is manmade and / or is chemically synthesized and / or is typically purified or isolated.

[0091] In a further particular embodiment, the single stranded antisense oligonucleotide of the invention does not contain RNA nucleosides, since this will decrease nuclease resistance. More particularly, the antisense oligonucleotide of the invention comprises one or more chemically modified nucleosides or PaVer / SyngrASO3 / 849 nucleotides, such as LNA modified and / or 2' sugar modified nucleosides. Furthermore, it is advantageous that the nucleosides which are not modified are DNA nucleosides.

[0092] In a first aspect the invention concerns an oligonucleotide comprising a gapmer of formula 5'-F-G-F'-3', where each one of F and F' is a region independently comprising between 3 and 4 nucleosides; wherein each one of said F and F' regions independently comprises at least one chemically modified nucleoside, defining the 5' and / or 3' end of the F and F' region, and wherein G is a region between 9 and 11 nucleosides for recruiting RNaseH; wherein said oligonucleotide comprises a contiguous nucleotide portion of at least 10 contiguous nucleotides in length, the contiguous nucleotide portion being at least 90% complementary to an equal length portion of a target region within the Synaptogyrin-3 nucleotide sequence as depicted in SEQ ID No. 1; and wherein the target region within the Synaptogyrin-3 nucleotide is comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ ID No. 1 and wherein the endpoints are included.

[0093] Preferably, the oligonucleotides of the present disclosure reduce Synaptogyrin-3 expression levels, Synaptopgyrin-3 activity (e.g., dopamine transporter activity), Synaptogyrin-3-mediated exocytosis, any interaction with protein(s), or other cellular components, or a combination thereof. The oligonucleotides of the present disclosure is preferably capable of reducing the level of Synaptogrin-3 transcript in a cell compared to a control condition in the absence of the oligonucleotide, while said oligonucleotide shows more specificity towards the target and / or less effect on the off-target genes.

[0094] Preferably, said at least one chemically modified nucleoside is 2' sugar modified nucleoside defining the 5' and / or 3' end of the F and F' region and / or a nucleoside featuring one or more internucleoside linkage. Preferably, said 2' sugar modified nucleoside is selected from the group consisting of 2'-O-methyl-, 2'-O- methoxyethyl-, 2'-O-alkyl-, 2' -alkoxy, 2' -amino-, 2'-fluoro- and LNA nucleosides. It has been surprisingly found that particularly presence of said at least one chemically modified nucleoside defining the 5' and / or 3' end of the F and F' region, for example locked nucleic acid (herein further referred to as LNA) led to an increased specificity for affecting the synaptogyring-3 expression.

[0095] The oligonucleotides of the disclosure may be chemically modified by incorporating high affinity nucleosides such as 2' sugar modified nucleosides, such as 2' -4' bicyclic ribose modified nucleosides, including LNA and cET or 2' substituted modifications like of 2'-O-alkyl-, 2'-O-methyl-, 2'-O-methoxyethyl (MOE) 2' -alkoxy-, 2' -amino-, 2' -fluoro-, arabino nucleic acid (ANA), 2'-fluoro-ANA, and the like.

[0096] Preferably, said oligonucleotide comprises at least one nucleoside featuring one or more internucleoside linkage, wherein said one or more internucleoside linkage is between one or more nucleosides of region PaVer / SyngrASO3 / 849

[0097] F and / or F' and / or between F and G and / or between F' and G, and wherein said internucleoside linkages are phosphorothioate internucleoside linkages. In an embodiment, the oligonucleotide, e.g. the therapeutic antisense oligonucleotide of the invention comprises one or more internucleoside linkages modified from the natural phosphodiester, such one or more modified internucleoside linkages that is for example more resistant to nuclease attack. The term "modified internucleoside linkage" is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Increased resistance of the oligonucleotide towards nucleases compared to a phosphodiester linkage is particular advantage for therapeutic oligonucleotides. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester. In a particular embodiment, the modified internucleoside linkage is phosphorothioate.

[0098] Phosphorothioate internucleoside linkages are particularly useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. The use of fully phosphorothioate modified oligonucleotides or contiguous nucleotide sequences is often used in antisense oligonucleotides. Phosphorothioate modifications may be incorporated into the 5' and 3' ends of an antisense oligonucleotides.

[0099] In an embodiment, the oligonucleotide of the invention comprises nuclease resistant linkages, such as phosphorothioate linkages, which are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers. PaVer / SyngrASO3 / 849

[0100] Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and / or affinity enhancing regions such as regions F and F' for gapmers. Gapmer oligonucleotides may, in some embodiments comprise one or more phosphodiester linkages in region F or F', or both region F and F', which the internucleoside linkage in region G may be fully phosphorothioate. In particular embodiments, all the internucleoside linkages in the contiguous nucleotide sequence of the antisense oligonucleotide are phosphorothioate linkages.

[0101] In other embodiments, antisense oligonucleotide may comprise other internucleoside linkages (other than phosphodiester and phosphorothioate), for example alkyl phosphonate / methyl phosphonate internucleosides.

[0102] In a preferred embodiment, the oligonucleotide of the disclosure comprises at least one chemically modified nucleoside, preferably, 2, 3, 4, 5, 6, 7 or 8 chemically modified nucleosides. Said chemically modified nucleoside can preferably feature a locked nucleic acid modification (herein referred to as "LNA"), ethylene-bridged nucleic acid (ENA) and / or (S)-constrained ethyl (cEt) modification. Preferably, the oligonucleotide of the disclosure comprises at least one 2' sugar modified nucleoside selected from the list consisting of 2'-O-methyl (2'-0Me), 2'-O-methoxyethyl (2'-MOE) and 2'-Fluoro (2'-F).

[0103] In other embodiments, the oligonucleotides of the disclosure may comprise one or more of the above described chemically modified sugar nucleosides and may comprise one or more of the above described phosphorothioate internucleoside linkages. In one embodiment, the antisense molecules comprise in all odd positions a 2'0-Methyl modification and all even positions in the antisense sequence comprise a 2'fluoro modification. In some embodiments of the invention, the first two, three or four 5' and the last two, three, four 3', internucleoside linkages of the antisense oligonucleotide are phosphorothioate modified nucleosides.

[0104] The oligonucleotide of the present disclosure comprises a gapmer which comprises the contiguous nucleotide sequence of at least 10 contiguous nucleotides in length which are at least 90% complementary to an equal portion of a target region within the Synaptogyrin-3 transcript comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ. ID No. 1 and wherein the endpoints are included, which target regions were identified as the particularly favored target region within the synaptogyrin-3 region for development of the antisense oligonucleotides (herein further below referred to as ASOs) comprising the gapmer-type of ASOs. Preferably, the oligonucleotide of the invention is 17, 18 or 19 nucleotides in length. The oligonucleotides of said length were found to be particularly effective as Synaptogyrin-3 ASOs, preferably directed against human Synaptogyrin-3 transcripts, with the minimal interference with other genes, including the off- target genes. PaVer / SyngrASO3 / 849

[0105] In a preferred embodiment, the oligonucleotide of the present disclosure can bind to the Synaptogyrin- 3 transcript as depicted in SEQ ID No. 1, thereby allowing for the specific reduction of the Synaptogyrin- 3 expression levels.

[0106] The oligonucleotides of the present disclosure are capable of modulating the expression of the synaptogyrin-3 gene by specifically targeting a region in a synaptogyrin-3 RNA, e.g., a mRNA or pre- mRNA. In some aspects, the oligonucleotide of the present disclosure is capable of down-regulating expression of the synaptogyrin-3 gene by binding to such target region. Thus, in some aspects, the oligonucleotide of the present disclosure can affect (reduce or inhibit) the expression of synaptogyrin-3, e.g., in a mammalian subject such a human, by binding to a specific target region in a synaptogyrin-3 RNA, e.g., an mRNA or pre-mRNA. In some aspects, the oligonucleotide of the present disclosure can affect the expression of synaptogyrin-3 in a human cell, by binding to a specific target region in a synaptogyrin-3 RNA, e.g., an mRNA. In some aspects, the RNA is an mRNA, such as pre-mRNA. In some aspects, the RNA is a mature mRNA. The oligonucleotide according to the present disclosure is preferably capable of hybridizing to the target nucleic acid.

[0107] In a preferred embodiment, the oligonucleotide of the present disclosure is capable of statistically significantly reducing the level of Synaptogrin-3 transcript in a cell compared to a control condition in the absence of the oligonucleotide. It should be understood that the wording "in a cell" can refer to any cell of any organism, preferably a human cell in a human organism, or it can refer to a cell in a culture, for example any drosophila, mouse, primate, or human cell in a culture or in vitro assay.

[0108] In some embodiments, the oligonucleotides of the present disclosure bind to the target region of Synaptogyrin 3 (e.g., a subsequence of an mRNA or pre-mRNA) wherein the target region within the Synaptogyrin-3 nucleotide is comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ ID No. 1 (including the endpoints) and the effect on synaptogyrin-3 expression and / or activity level is at least about 10% to about 20% reduction in synaptogyrin-3 expression and / or activity level compared to the normal or control synaptogyrin-3 expression level (e.g., the synaptogyrin-3 expression level of a cell, animal or human treated with saline) and / or normal or control synaptogyrin-3 activity level (e.g. the expression level of a cell, animal or human treated with saline). In some aspects, the reduction in synaptogyrin-3 expression and / or activity is at least about 10%, about least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% compared to the normal or control expression and / or activity level. In some aspects, the reduction in synaptogyrin-3 expression and / or activity is about 10%, about 15%, PaVer / SyngrASO3 / 849 about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% compared to the normal or control synaptogyrin-3 expression and / or activity level.

[0109] In some embodiments, the synaptogyrin-3 expression level and / or protein level and / or activity level after the administration of an oligonucleotide of the present disclosure is less than about 2%, less than about 5%, less than about 10%, less than about 15%, less than about 20%, less than about 25%, less than about 30%, less than about 35%, less than about 40%, less than about 45%, less than about 50%, less than about 55%, less than about 60%, less than about 65%, less than about 70%, less than about 75%, or less than about 80% of the synaptogyrin-3 expression level and / or protein level and / or activity level prior to the administration of an oligonucleotide of the present disclosure.

[0110] In some embodiments, the synaptogyrin-3 expression level and / or protein level and / or activity level after the administration of an oligonucleotide of the present disclosure is about 2% to about 5%, about 5% to about 10%, about 10% to about 15%, about 15% to about 20%, about 20%, to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 50% to about 55%, about 55% to about 60%, about 60% to about 65%, about 65% to about 70%, about 70% to about 75%, or about 75% to about 80% of the synaptogyrin-3 expression level and / or protein level and / or activity level prior to the administration of an oligonucleotide of the present disclosure.

[0111] In a preferred embodiment, the oligonucleotide of the present disclosure is a single stranded nucleic acid molecule. Such structure allows for an improved selectivity and efficacy of the oligonucleotide of the present disclosure.

[0112] It has been surprisingly found that some regions within the Synaptogyrin-3 pre-mRNA transcript are significantly more accessible for oligonucleotides such as ASO molecules and therefore are preferred regions for designing oligonucleotides suitable for or capable of reducing the expression and / or activity of Synaptogyrin-3. The oligonucleotide of the invention is preferably derived from the "parent" ASO molecule. Preferred examples of said parent ASO molecules are gapmers of 16 nucleotides in length, shown in Table 1 defined by SEQ ID No. 2-5. Preferably, the oligonucleotides of the present disclosure are derived from the parent ASO molecules by micro-walking technique.

[0113] Based on the optimization of the parent molecules, we proposed the gapmers which exert reduce the human Syngr-3 transcript, while affecting less off-target genes compared to the known ASOs. The new structures can be obtained by transcript-walking the borders of the identified target regions of Synaptogyrin-3 as well as the parent molecules (SEQ ID No. 2-5, Table 1). PaVer / SyngrASO3 / 849

[0114] Table 1. Overview of the parent ASO oligonucleotides which preferably could be used for the development of the oligonucleotides of the present disclosure. The bold and underlined part of the sequence indicates the central portion, i.e. the G region of the parent ASO gapmer. The nucleotides which are not underlined form modified F and F' regions comprising the chemically modified nucleosides defining the 5' and / or 3' end of said F and F' regions.

[0115] Preferably, the oligonucleotide according to the present disclosure comprises a gapmer of a structure defined by a sequence showing at least 90% sequence identity to any one of SEQ ID No. 6-25.

[0116] In a particularly preferred embodiment, the oligonucleotide according to the present disclosure consist essentially of a oligonucleotide defined by at least 90% sequence identity to any one of SEQ ID No. 6-25. In one embodiment, the oligonucleotide of the invention consists of a gapmer of a sequence shown as SEQ ID No. 6-25.

[0117] The sequences defining the gapmers of the preferred embodiment of the present invention are shown in Table 2.

[0118] Table 2. Overview of the newly developed, oligonucleotide gapmers according to the present invention. The bold and underlined part of the sequence indicates the central portion, i.e. a G region of the gapmer, which G region lacks the chemical modifications. The not-underlined nucleotides form F and F' regions, which F and F' regions comprise the chemically modified nucleosides defining the 5' and / or 3' end of the F and F' region. PaVer / SyngrASO3 / 849

[0119] In a preferred embodiment, the oligonucleotide of the present invention complementary (full or partially complementary) to the target region within the Synaptogyrin-3 molecule of SEQ ID No. 1, said target region being selected from SEQ ID No. 26, 27, 28, or 29. Said preferred target regions of Synaptogyrin-3 molecule are shown below in Table 3. In another particular embodiment, the oligonucleotide of the invention comprises or consists of 17, 18, or 19, which is fully or partially complementary to the target region or a portion thereof defined by SEQ ID No. 26, 27 , 28, or 29.

[0120] Table 3. Preferred target regions of Synaptogyrin-3, corresponding to sequences SEQ ID No. 26, 27, 28, and 29 PaVer / SyngrASO3 / 849

[0121] The skilled person is aware of how to design the oligonucleotides disclosed herein. Non-limiting examples are PFRED, an open source siRNA and ASO design tool from Pfizer (Sciabola et al 2020 PLoS One); the antisense LNA Gapmer Custom Builder Help from Qiagen. Manufacturers of ASO and / or RNAi products also provide guidelines for designing ASO molecules.

[0122] In some embodiment, the oligonucleotides of present disclosure may comprise at least one nucleotide variant (e.g., an LNA unit). In some embodiments, the oligonucleotide of the present disclosure further comprises at least one non-nucleotide or non-polynucleotide moiety covalently (e.g., a GalNac moiety) attached to said oligonucleotide directly or via a linker positioned between the contiguous nucleotide sequence and the non-nucleotide or non-polynucleotide moiety.

[0123] In a preferred embodiment, the oligonucleotide of the present disclosure comprises at least one nucleoside featuring one or more internucleoside linkage, e.g., a phosphorothioate linkage. In some, aspects all the internucleoside linkages in an oligonucleotide of the present disclosure are non-cleavable, e.g., phosphorothioates linkages. In some aspects, the non-cleavable internucleoside linkages, e.g., a phosphorothioate linkages, are present only in the wing portions of a gapmer, e.g., the last 1, 2, 3 or 4 linkages at the 5' end or the oligonucleotide, and the last 1, 2, 3 or 4 linkages at the 3' end or the oligonucleotide. In some aspects, the oligonucleotide of the present disclosure comprises nucleotide analogues. In some aspects, the oligonucleotide of the present disclosure comprises affinity enhancing nucleotide analogues. In some aspects, the nucleotide analogues are sugar modified nucleotides, such as sugar modified nucleotides independently or dependently selected from the group consisting of 2'-O- alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, and 2'-fluoro-DNA units.

[0124] In some embodiments, the oligonucleotide of the present disclosure comprises, consists, or consists essentially of a sequence selected from the group consisting of SEQ ID No. 6-25.

[0125] In a preferred embodiment, the oligonucleotide of the present disclosure comprises one or more locked nucleic acids (LNA). In some aspects, the LNA oligonucleotide comprises a wing on each side (5' and 3') PaVer / SyngrASO3 / 849 of each F and F' region, independently, wherein said F and F' region, independently comprise or consist of 1, 2, 3 or 4 nucleotide analogues, preferably LNA analogues.

[0126] In some embodiments, the LNA is oxy-LNA, thio-LNA, amino-5 LNA, 5'-methyl-LNA, ENA, cET, cMOE or a combination thereof. In some aspects, the LNA is an stereoisomer in the beta-D configuration or the alpha-L configuration. In some aspects, the oligonucleotide of the application comprises at least one cET unit. In some aspects, the oligonucleotide comprises 2, 3, 4, 5, 6, 7 or 8 LNA units. In some aspects, every LNA unit in the oligonucleotide is a stereoisomer in the same configuration. In some aspects, every LNA unit in the oligonucleotide is a beta-D-oxy LNA unit or every LNA unit in the oligonucleotide is an alpha- L-oxy-LNA unit. In some aspects, the sequence of the oligonucleotide comprises at least one phosphorothioate, phosphorodithioate, or boranophosphate internucleoside linkage. In some aspects, one or more of the internucleoside linkages comprises a chiral center in the R conformation and / or in the S conformation. In some aspects, the oligonucleotide comprising an LNA can form a duplex with a human synaptogyrin-3 target sequence, preferably selected from the group consisting of SEQ. ID No. 26- 29 of with increased thermal stability with respect to a corresponding duplex comprising the corresponding oligonucleotide without LNA.

[0127] In some embodiments, the oligonucleotide of the present disclosure can optionally comprise a further 1 to 6 nucleotides (e.g., one, two, three, four, five or six nucleotides), which can form or comprise a biocleavable nucleotide region, such as a phosphate nucleotide linker. In some aspects, the biocleavable nucleotide region is formed of a short stretch of nucleotides (e.g. 1, 2, 3, 4, 5 or 6 nucleotides) which are physiologically labile. This can be achieved by using phosphodiester linkages with DNA / RNA nucleosides, or if physiological liability can be maintained, other nucleoside can be used.

[0128] In an embodiment, the oligonucleotide of the present disclosure is an ASO molecule conjugate comprising an ASO molecule covalently attached to non-nucleotide or non-polynucleotide moiety, which can be attached to the 5' end, 3' end, or both. In an embodiment, the non-nucleotide or non- polynucleotide moiety is a targeting moiety that is attached to the 5' -end or to the 3' -end of the ASO molecule. In some aspects, the targeting moiety is linked to the ASO molecule via a linker. In some aspects, the targeting moiety comprises a carbohydrate conjugate moiety comprising a carbohydrate selected from the group consisting of galactose, lactose, N-acetylgalactosamine (GalNAc), mannose, mannose-6-phosphate, and combinations thereof. In some aspects, the carbohydrate conjugate moiety is not a linear carbohydrate polymer. In some aspects, the carbohydrate conjugate moiety is a carbohydrate group comprising 1, 2, 3, or 4 carbohydrate moieties. In some aspects, the carbohydrate PaVer / SyngrASO3 / 849 moieties are identical or non-identical. In some aspects, the carbohydrate conjugate moiety comprises at least one asialoglycoprotein receptor targeting conjugate moiety. In some aspects, the asialoglycoprotein receptor targeting conjugate moiety comprises a monovalent, divalent, trivalent, or tetravalent GalNAc cluster. In some aspects, each GalNAc in the GalNAc cluster is attached to a branch point group via a spacer. In some aspects, the branch point group comprises di-lysine. In some aspects, the spacer comprises a PEG spacer. In some aspects, the linker comprises a C6 to C12 amino alkyl group or a biocleavable phosphate nucleotide linker comprising between 1 to 6 nucleotides. In some aspects, the targeting moiety targets the oligonucleotide of the present disclosure to the central nervous system (CNS). In some embodiments, the targeting moiety allow the oligonucleotide of the present disclosure to permeate through the blood-brain-barrier (BBB).

[0129] In an independent aspect, the present invention relates to a pharmaceutical composition comprising the oligonucleotide of the present disclosure.

[0130] Furthermore, the invention relates to the use of the oligonucleotides of the present disclosure as a medicament, in particular for use in treating or inhibiting progression of a tauopathic disorder or for use in treating or inhibiting a symptom of a tauopathic disorder. Furthermore, the invention also provides methods of treatment comprising the administration of the oligonucleotides of the present disclosure, or a combination thereof, to a subject in need thereof. Also provides are pharmaceutical compositions, pharmaceutical formulations, and kits and articles of manufacture comprising the oligonucleotides of the present disclosure. Also provided are methods of manufacture of the oligonucleotides of the present disclosure.

[0131] The present disclosure therefore provides an in vitro or in vivo method of down-regulating or inhibiting the expression of synaptogyrin-3 protein and / or mRNA transcript in a cell which is expressing synaptogyrin-3 protein and / or mRNA, said method comprising administering an oligonucleotide of the present disclosure, e.g., as a pharmaceutical composition of the present disclosure to said cell to down- regulate or inhibit the expression of synaptogyrin-3 protein and / or mRNA in said cell. Suitably the cell is a mammalian cell such as a human cell.

[0132] According to the first aspect, an oligonucleotide of the present disclosure is an ASO. In some embodiments, the oligonucleotide of the present disclosure comprises an antisense oligonucleotide (ASO), e.g., an unconjugated or conjugated ASO. Antisense oligonucleotides or ASOs according to the invention can be synthetic, 17, 18 or 19 nucleotide long, single-stranded nucleic acid polymers of diverse chemistries, which can be employed to modulate gene expression via various mechanisms. ASOs of the invention can be RNase H competent and steric block ASOs. Preferably, the oligonucleotide of the present disclosure is a gapmer. Gapmer designs are disclosed, e.g., in WO 2007 / 146511A2, which is PaVer / SyngrASO3 / 849 herein incorporated by reference in its entirety. Gapmers could be considered as preferably RNAse H ASOs comprising the "wings", herein referred to as F and F' regions, which F and F' regions comprise the nucleosides featuring chemical modifications and the central bases, herein referred to as G region, which G region comprises the nucleosides which may or may not lack the chemical modifications.

[0133] ASOs can also modulate gene expression by steric hindrance or occupancy and only mechanisms. Steric block oligonucleotides are designed to bind to target transcripts with high affinity but do not induce target transcript degradation as they lack RNase H competence. Such oligonucleotides therefore comprise either nucleotides that do not form RNase H substrates when paired with RNA or a mixture of nucleotide chemistries such that runs of consecutive DNA-like bases are avoided. Steric block oligonucleotides can mask specific sequences within a target transcript and thereby interfere with transcript RNA-RNA and / or RNA-protein interactions. The most widely used application of steric block ASOs is in the modulation of alternative splicing in order to selectively exclude or retain a specific exon(s) in order to disrupt the translation of the target gene. ASOs can also be designed to interfere with maturation and stability of the RNA transcript or to block its interaction with the translation apparatus. In case the ASO can enter the nucleus, mRNA maturation can be modulated by inhibition of 5'-cap formation, inhibition of mRNA splicing or activation of RNaseH (Chan et al 2006 Clin Exp Pharmacol Physiol 33:533-540; this reference also describes some of the software available for assisting in design of ASOs).

[0134] In some embodiments, the ASO comprises an antisense oligomer of 17, 18 or 19 nucleotides in length, wherein said antisense oligomer is at least 90%, at least 95% or 100% identical to a subsequence of any of SEQ ID No. 6 -25. In some embodiments, the ASO is conjugated to a targeting moiety, e.g., to a GalNAc moiety.

[0135] GAPMERs: In particular embodiments, the antisense oligonucleotide of the invention or the contiguous nucleotide sequence thereof is a gapmer. A gapmer or gapmer oligonucleotide comprises at least three distinct structural regions: a 5'-flank, a gap and a 3'-flank or F-G-F' in the '5 -> 3' orientation. The "gap" region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5' flanking region (F) comprising one or more sugar modified nucleosides, and by a 3' flanking region (F') comprising one or more sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F' enhance the affinity of the oligonucleotide for the target nucleic acid (i.e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F' are 2' sugar modified nucleosides, such as independently selected from LNA and 2'-MOE. PaVer / SyngrASO3 / 849

[0136] In a gapmer design, the 5' and 3' most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5' (F) or 3' (F') region respectively. The flanks may further be defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5' end of the 5' flank and at the 3' end of the 3' flank. Regions F-G-F' form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F'.

[0137] Regions F and F' independently comprise 3 or 4 contiguous nucleosides, of which 3 or 4 independently can be 2' sugar modified and defines the 5' and 3' end of the F and F' region. Region F is positioned immediately adjacent to the 5' DNA nucleoside of region G. In one embodiment, the 3' most nucleoside of region F is a sugar modified nucleoside, for example a 2' substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside. Region F' is positioned immediately adjacent to the 3' DNA nucleoside of region G. In one embodiment, the 5' most nucleoside of region F' is a sugar modified nucleoside, for example a 2' substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0138] In a preferred embodiment, the region F of a gapmer is between 3 and 4 contiguous nucleotides in length. In particular embodiments, the 5' most nucleoside of region F is LNA modified nucleoside or a sugar modified nucleoside. In some embodiments the two 5' most nucleoside of region F are sugar modified nucleoside. In some embodiments the 5' most nucleoside of region F is an LNA nucleoside. In some embodiments the two 5' most nucleoside of region F are LNA nucleosides. In some embodiments the two 5' most nucleoside of region F are LNA nucleosides. In some embodiments the two 5' most nucleoside of region F are 2' substituted nucleoside nucleosides, such as two 3' MOE nucleosides. In some embodiments the 5' most nucleoside of region F is a 2' substituted nucleoside, such as a MOE nucleoside.

[0139] Preferably, said gapmer is with a 3-10-4, 4-10-3, 4-10-4, 3-11-3, 3-11-4, 4-11-3, or 4-11-4 gapmer design.

[0140] In one embodiment, region F' is between 3 and 4 contiguous nucleotides in length. Particularly embodiments provide that the 3' most nucleoside of region F' is a sugar modified nucleoside. In some embodiments the two 3' most nucleoside of region F' are sugar modified nucleoside. In some embodiments the two 3' most nucleoside of region F' are LNA nucleosides. In some embodiments the 3' most nucleoside of region F' is an LNA nucleoside. In some embodiments the two 3' most nucleoside of region F' are 2' substituted nucleoside nucleosides, such as two 3' MOE nucleosides. In some embodiments the 3' most nucleoside of region F' is a 2' substituted nucleoside, such as a MOE nucleoside. PaVer / SyngrASO3 / 849

[0141] In some embodiments, region F and F' independently consists of or comprises a contiguous sequence of sugar modified nucleosides. In some embodiments, the sugar modified nucleosides of region F may be independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl- RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units. In some embodiments, region F and F' independently comprises both LNA and a 2' substituted modified nucleosides. In some embodiments, region F and F' consists of only one type of sugar modified nucleosides, such as only MOE or only beta-D-oxy LNA or only ScET. Such designs are also termed uniform flanks or uniform gapmer design.

[0142] In some embodiments, all the nucleosides of region F or F', or F and F' are LNA nucleosides, such as independently selected from beta-D-oxy LNA, ENA or ScET nucleosides. In some embodiments region F consists of 3 or 4 contiguous LNA nucleosides. In some embodiments, all the nucleosides of region F and F' are LNA nucleosides or beta-D-oxy LNA nucleosides.

[0143] In some embodiments, all the nucleosides of region F or F', or F and F' are 2' substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments region F consists of 3 or 4 contiguous OMe or MOE nucleosides. In some embodiments only one of the flanking regions can consist of 2' substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments it is the 5' (F) flanking region that consists 2' substituted nucleosides, such as OMe or MOE nucleosides whereas the 3' (F') flanking region comprises at least one LNA nucleoside, such as beta-D-oxy LNA nucleosides or cET nucleosides. In some embodiments it is the 3' (F') flanking region that consists 2' substituted nucleosides, such as OMe or MOE nucleosides whereas the 5' (F) flanking region comprises at least one LNA nucleoside, such as beta- D-oxy LNA nucleosides or cET nucleosides.

[0144] In some embodiments the 5' most and the 3' most nucleosides of region F and F' are LNA nucleosides, such as beta-D-oxy LNA nucleosides or ScET nucleosides.

[0145] Region G comprises or consists of 9, 10 or 11 nucleosides which are capable of recruiting RNase H. One or more cytosine (C) DNA in the gap region may in some instances be methylated (e.g. when a DNA c is followed by a DNA g) such residues are either annotated as 5-methyl-cytosine (meC). In some embodiments the gap region G may consist of 9, 10 or 11 contiguous phosphorothioate linked DNA nucleosides. In some embodiments, all internucleoside linkages in the gap are phosphorothioate linkages The overall length of the gapmer design F-G-F' may be, for example 17, 18 or 19 nucleosides.

[0146] In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F' and region PaVer / SyngrASO3 / 849

[0147] G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkages between the nucleosides of region F or F', F and F' are phosphorothioate internucleoside linkages.

[0148] In some embodiments, the gapmer of the invention is a LNA Gapmer. An LNA gapmer is a gapmer wherein either one or both of region F and F' comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F' comprises or consists of beta-D-oxy LNA nucleosides. Preferably, said gapmer is with a 3(LNA)-10(DNA)-4(LNA), 4(LNA)-10(DNA)-3(LNA), 4(LNA)-10(DNA)-4(LNA), 3(LNA)-11(DNA)-3(LNA), 3(LNA)-11(DNA)-4(LNA), 4(LNA)-11(DNA)-3(LNA), or 4(LNA)-11(DNA)-4(LNA gapmer design (LNA-DNA-LNA).

[0149] In other embodiments, the gapmer of the invention is a MOE Gapmer. A MOE gapmers is a gapmer wherein regions F and F' consist of MOE nucleosides. In some embodiments the MOE gapmer is of design [MOE]3-4-[Region G]-[MOE] [Region G]9-11-[MOE] 3-4, such as [MOE]3-6-[Region G]-[MOE] 3-6, wherein region G is as defined in the Gapmer definition. Preferably said MOE gapmers are with a 3(MOE)- 10(DNA)-4(MOE), 4(MOE)-10(DNA)-3(MOE), 4(MOE)-10(DNA)-4(MOE), 3(MOE)-11(DNA)-3(MOE), 3(MOE)-11(DNA)-4(MOE), 4(MOE)-11(DNA)-3(MOE), or 4(MOE)-11(DNA)-4(MOE) gapmer design (MOE- DNA-MOE).

[0150] In particular embodiments, the gapmer of the invention can also further comprise a region D' and / or D". Said regions refer to additional 5' and / or 3' nucleosides which may or may not be fully complementary to the target nucleic acid. The addition of region D' or D" may be used for the purpose of joining the contiguous nucleotide sequence, such as the gapmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or for ease of synthesis or manufacture. Region D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively to generate designs of the following formulas D'-F-G-F', F-G-F'-D" or D'-F-G-F'-D". In this instance the F-G-F' is the gapmer portion of the oligonucleotide and region D' or D" constitute a separate part of the oligonucleotide.

[0151] Region D' or D" may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F' region is not a sugar-modified nucleotide, such as a DNA or RNA or base modified versions of these. The D' or D' region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5' and / or 3' end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. 1 PaVer / SyngrASO3 / 849

[0152] Chemical modifications

[0153] In some aspects, the oligonucleotides of the present disclosure comprise non-naturally occurring nucleotide analogues, e.g., nucleotides which have modified sugar moieties, such as bicyclic nucleotides or 2' modified nucleotides, such as 2' substituted nucleotides. An essential step in the evolution of the antisense technology was the creation, innovation and evaluation of the medicinal chemistry of oligonucleotides. The goals were to enhance the affinity for the target sequence (thereby increasing potency), assure effective distribution to peripheral tissues, enhance the duration of action by increasing resistance to degradation by nucleases, improve pharmacokinetic characteristics, reduce the class generic (chemically based) toxicities of the chemical classes widely used for therapeutics, and create designs that support multiple post-binding mechanisms, thereby broadening the utility of the technology.

[0154] Within the antisense field a broad effort was initiated to modify essentially every position in a dinucleotide except those required for Watson-Crick base pairing. Thousands of analogues have been synthesized and evaluated so far, and novel analogues continue to be investigated. Three major classes of modifications can be distinguished: modifications of the internucleotide linkage, alterations of the ribose sugar and bioconjugations with for example GalNAc.

[0155] Phosphorothioates

[0156] In some aspects, the oligonucleotides of the present disclosure comprise one or more non-cleavable internucleotide linkages, e.g., phosphorothioate linkages. The phosphodiester backbone of unmodified DNA and RNA oligonucleotides is highly susceptible to degradation by nucleases in vivo. So, to develop oligonucleotides for therapeutic applications, it was necessary to identify backbone modifications that reduce their susceptibility to nuclease degradation while not compromising other key characteristics such as RNase Hl activation and RNA binding too much.

[0157] In phosphorothioate (PS) linkages, a non-bridging oxygen in the phosphate group is substituted by sulfur. The PS moiety provides significant protection against nucleases. Importantly, because of the impact of the greater size of sulfur compared with oxygen, the negative charge of the PS moiety at physiological pH is more widely distributed than in a phosphodiester (PO) moiety. This increases the lipophilicity of oligonucleotides that contain PS moieties, facilitating binding to proteins and thereby preventing rapid excretion of the oligonucleotides by the kidney and facilitating uptake of oligonucleotides into cells and tissues. The PS moiety is the most widely used backbone modification in ASOs and RNAi molecules such as siRNAs.

[0158] Ribose sugar modifications

[0159] In some aspects, the oligonucleotides of the present disclosure comprise non-naturally occurring nucleotide analogues, e.g., nucleotides which have modified sugar moieties, such as bicyclic nucleotides PaVer / SyngrASO3 / 849 or 2' modified nucleotides, such as 2' substituted nucleotides. Oligonucleotides are frequently modified at the ribose sugar, primarily with the aim of improving properties such as affinity and / or nuclease resistance. Such modifications include those where the ribose ring structure is modified (e.g. locked nucleic acids or LNAs), where the sugar moiety is replaced by a non-sugar moiety (e.g. peptide nucleic acids or PNAs) or where the substituent groups on the ribose ring are altered to groups other than the hydrogen or 2' and OH group naturally found in DNA and RNA nucleosides.

[0160] Non-limiting examples of ring structure modifications are HNAs (hexitol nucleic acids) where the ribose ring is replaced with a hexose ring, an UNA (unlocked nucleic acid) where an unlinked ribose ring lacks a bond between the C2 and C3 carbons or a Locked Nucleic Acid (LNA) where the C2' and C4' of the ribose sugar ring are linked by a methylene bridge (also referred to as a"2'-4' bridge"), which restricts or locks the conformation of the ribose ring. The locking of the conformation of the ribose (also referred to as Bridged Nucleic Acids or BNAs) is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. Non-limiting examples of LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxy LNA such as (S)-6'-methyl-beta-D-oxy-LNA (ScET) and 2'-O,4'-C-ethylene-bridged nucleic acid (ENA) or those disclosed in WO 1999 / 014226, WO 2000 / 66604, WO 1998 / 039352, WO 2004 / 046160, WO 2000 / 047599, WO 2007 / 134181 , WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071 , WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401 , WO 2009 / 067647, and WO 2008 / 150729, all of which are herein incorporated by reference in their entireties.

[0161] Since BN A modifications enhance both nuclease stability and the affinity of the oligonucleotide for target RNA, they have been incorporated into the flanking regions of gapmers to improve target binding. As such, cEt-flanking 3-10-3 gapmers are more efficacious than the MOE 5-10-5 equivalents. Importantly, BNAs are excluded from the DNA gap region because they are not compatible with RNase H-mediated cleavage. LNA modifications have also been utilized in steric block ASOs, such as miRNA inhibitors.

[0162] Non-limiting examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA (2'- OMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA (2'-F), and 2'-F-ANA nucleoside. These modifications increase oligonucleotide nuclease resistance by replacing the nucleophilic 2'-hydroxyl group of unmodified RNA, leading to improved stability in plasma, increased tissue half-lives and consequently prolonged drug effects. These modifications also enhance the binding affinity of the oligonucleotide for complementary RNA and some 2' modifications reduce pro- inflammatory effects. The 2'-ribose modifications are not compatible with RNase H activity, meaning they are typically used for steric block oligonucleotides, or for the flanking sequences in gapmer ASOs. Although most effort was done in modifying the 2' position, substituents can be introduced at the 3', 4' or 5' positions as well. PaVer / SyngrASO3 / 849

[0163] The present disclosure provides oligonucleotides comprising or consisting of a simple sequence of natural occurring nucleotides - preferably 2'-deoxynucleotides (referred here generally as "DNA"), but also possibly ribonucleotides (referred here generally as "RNA"), or a combination of such naturally occurring nucleotides and one or more non-naturally occurring nucleotides, i.e., "nucleotide analogues", such as nucleotides having the ribose sugar modifications disclosed above.

[0164] In some embodiments, a nucleic acid or oligonucleotide of the present disclosure (e.g., an ASO) comprises a modification motif (e.g., the pattern of distribution of nucleotide analogs along the sense and antisense sequences, internucleoside linkages, conjugate moieties, etc.) disclosed in U.S. Pat. Nos. 8,110,674; 8,420,799; 8,809,516; 9,222,091; 9,708,615; 10,273,477; 9,290,760; 10,233,448; or 9,796,974; U.S. Appl. Publ. No. 2018 and 0258427A1; or Int'l Publ. WO2018098328A1, all of which are herein incorporated by reference in their entireties.

[0165] In an embodiment, the oligonucleotide comprises at least one chiral internucleoside linkage and / or at least one 8-oxo-deoxyadenosine, and / or at least one phosphoryl DMI amidate diester internucleoside linkage (PN) and / or at least one 8-oxo-deoxyadenosine, and / or at least one phosphoramidite internucleoside linkage and / or at least one phosphoramidate internucleoside linkage. And / or least one pseudouridine and / or at least one isouridine and / or at least one glycol nucleic acid (GNA) and / or a loop, and / or a cleavable loop.

[0166] In some aspects, the oligonucleotide of the present disclosure is a conjugate, e.g., a GalNAc conjugate. The delivery potential of ASOs and RNAi molecules such as siRNAs can be enhanced through direct covalent conjugation of various moieties that promote intracellular uptake, target the drug to specific cells / tissues or reduce clearance from the circulation. Non-limiting examples are lipids, peptides, aptamers, antibodies and sugars. Bioconjugates constitute distinct, homogeneous, single-component molecular entities with precise stoichiometry, meaning that high-scale synthesis is relatively simple and their pharmacokinetic properties are well defined. Furthermore, bioconjugates are typically of small size meaning that they generally exhibit favourable biodistribution profiles. For example, conjugating ASOs to the sugar moiety GalNAc results in more productive delivery to hepatocytes without a meaningful shift in distribution to other tissues and results in 15-30 fold increases in potency for RNA targets in those cells.

[0167] ASOs can also be loaded to exosomes. Exosomes are heterogeneous, lipid bilayer-encapsulated vesicles approximately 100 nm in diameter that are generated as a result of the inward budding of the multivesicular bodies. Exosomes are thought to be released into the extracellular space by all cells, where they facilitate intercellular communication via the transfer of their complex macromolecular cargoes. Exosomes present numerous favourable properties in terms of oligonucleotide drug delivery of PaVer / SyngrASO3 / 849 which crossing biological membranes, such as the blood-brain-barrier (BBB) is highly relevant for treatments of CNS disorders.

[0168] In one embodiment, the oligonucleotide(s) of the invention is man-made and / or is chemically synthesized and / or is typically purified or isolated. Accordingly, the present disclosure provides a method of manufacturing the oligonucleotide(s) of the invention comprising chemically synthesizing the nucleic acid molecule(s) or the oligonucleotide(s) of the invention. In some aspects, the method comprises the conjugation of a delivery moiety, e.g., a GalNAc moiety.

[0169] The present disclosure also provides a method for designing or manufacturing an oligonucleotide of the present disclosure (e.g., an ASO) capable of inhibiting a human synaptogyrin-3 (hSYNGR3) gene transcript and / or hSYNGR3 protein expression and / or activity in a cell, a tissue, or a subject, wherein the oligonucleotide of the present disclosure is complementary (partially or fully complementary) to any of the target regions target region within the Synaptogyrin-3 nucleotide is comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ ID No. 1 and wherein the endpoints are included. In some embodiments, the complementary sequence of the oligonucleotide of the present disclosure partially overlaps of a nucleotide sequence set for in SEQ ID No. 26, 27, 28 or 29. In some aspects, the complementarity is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% complementary.

[0170] As used herein the term "manufacturing" refers to chemically synthesizing, e.g., using solid phase synthesis, an oligonucleotide of the present disclosure. In some aspects, manufacturing further comprises chemically attaching or conjugating a moiety such a delivery moiety (e.g., a GalNAc moiety), and / or a targeting moiety.

[0171] The present disclosure also provides a method of manufacturing an oligonucleotide of the present disclosure, the method comprising chemically synthesizing the oligonucleotide of the present disclosure using sequential solid phase oligonucleotide synthesis. The present disclosure provides a method of manufacturing an oligonucleotide of the present disclosure comprising a conjugate moiety, wherein the method comprises covalently attaching the conjugate moiety (e.g., at least one non-nucleotide or nonpolynucleotide moiety) covalently to the oligonucleotide disclosed herein. In some aspects, the conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, for example a carbohydrate conjugate moiety such as a GalNAc moiety) is attached to an oligonucleotide disclosed herein directly or via a linker positioned between the oligonucleotide sequence and the conjugate moiety.

[0172] In some aspects, the non-nucleotide or non-polynucleotide moiety is a liver targeting moiety that is attached to the 5' -end or to the 3' -end of an oligonucleotide disclosed herein. In some aspects, the liver PaVer / SyngrASO3 / 849 targeting moiety is linked to the oligonucleotide via a linker. In some aspects, the liver targeting moiety comprises a carbohydrate conjugate moiety comprising a carbohydrate selected from the group consisting of galactose, lactose, N-acetylgalactosamine (GalNAc), mannose, mannose-6-phosphate, and combinations thereof. In some aspects, the carbohydrate conjugate moiety is not a linear carbohydrate polymer. In some aspects, the carbohydrate conjugate moiety is a carbohydrate group comprising 1, 2, 3, or 4 carbohydrate moieties. In some aspects, all the carbohydrate moieties are identical. In some aspects, at least one carbohydrate moiety is different (non-identical) with respect to the other carbohydrate moieties. In some aspects, the carbohydrate conjugate moiety comprises at least one asialoglycoprotein receptor targeting conjugate moiety. In some aspects, the asialoglycoprotein receptor targeting conjugate moiety comprises a monovalent, divalent, trivalent, or tetravalent GalNAc cluster. In some aspects, each GalNAc in the GalNAc cluster is attached to a branch point group via a spacer. In some aspects, the branch point group comprises di-lysine. In some aspects, the spacer comprises a PEG spacer. In some aspects, the linker comprises a C6 to C12 amino alkyl group or a biocleavable phosphate nucleotide linker comprising between 1 to 6 nucleotides.

[0173] In some embodiments, covalently attaching the conjugate moiety (e.g., a non-nucleotide or nonpolynucleotide moiety, such as a GalNAc moiety) to the oligonucleotide comprises: (i) chemically synthesizing the oligonucleotide; and, (ii) adding by chemical synthesis or conjugation the conjugate moiety to the oligonucleotide to yield an oligonucleotide conjugate. In some aspects, adding by chemical synthesis or conjugation the conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) to the oligonucleotide to yield an oligonucleotide conjugate comprises: (i) incorporating by chemical synthesis or conjugation at least one conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) to the oligonucleotide; (ii) incorporating by chemical synthesis or conjugation at least one linker to the oligonucleotide or conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety); (iii) incorporating by chemical synthesis or conjugation at least one branching point to the oligonucleotide or conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety); (iv) incorporating by chemical synthesis or conjugation at least one spacer to the oligonucleotide or conjugate moiety (e.g., a non- nucleotide or non-polynucleotide moiety, such as a GalNAc moiety); or, (v) a combination thereof. In some aspects, (i) at least one linker is interposed between the oligonucleotide and a branching point; (ii) at least one branching point is interposed between a linker and a conjugate moiety (e.g., a non- nucleotide or non-polynucleotide moiety, such as a GalNAc moiety); (iii) at least one, two, or three conjugate moieties (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) are attached to a branching point; (iv) at least one polymer spacer (e.g., a PEG spacer) is interposed between PaVer / SyngrASO3 / 849 a conjugate moiety (e.g., a non-nucleotide or non-polynucleotide moiety, such as a GalNAc moiety) and a branching point; or, (v) any combination thereof.

[0174] The oligonucleotides according to the present invention may be prepared in the form of their pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the nucleic acid molecules or oligonucleotides of the present invention and are formed from suitable nontoxic organic or inorganic acids or organic or inorganic bases. Acid-addition salts include for example those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid and nitric acid, and those derived from organic acids such as p- toluene sulfonic acid, salicylic acid, methane sulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, and the like. Base-addition salts include those derived from ammonium, potassium, sodium and, quaternary ammonium hydroxides, such as for example, tetramethyl ammonium hydroxide. The chemical modification of a pharmaceutical compound into a salt is a technique well known to pharmaceutical chemists in order to obtain improved physical and chemical stability, hygroscopicity, flowability and solubility of compounds. For example, the pharmaceutically acceptable salt of the nucleic acid molecules or oligonucleotides provided herein may be a sodium salt. Provided herein is a pharmaceutically acceptable salt of the nucleic acid molecules or oligonucleotides described herein. In one embodiment, the pharmaceutically acceptable salt is a sodium or a potassium salt.

[0175] In another aspect, the invention provides pharmaceutical compositions comprising the oligonucleotides according to the any embodiment of the first aspect or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent includes phosphate- buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the nucleic acid molecules or oligonucleotides of the application are used in the pharmaceutically acceptable diluent at a concentration of 50-300 mM solution.

[0176] Non-limiting examples of pharmaceutically acceptable diluents, carriers, adjuvants, suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations and the like. The nucleic acid molecules or oligonucleotides of the application or salts thereof may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including but not limited to route of administration, extent of disease, or dose to be administered. Pharmaceutical compositions comprising any of the nucleic acid molecules or oligonucleotides of the application or salts PaVer / SyngrASO3 / 849 thereof may be sterilized by conventional sterilization techniques or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration.

[0177] In another independent aspect, the invention relates to the oligonucleotide or the pharmaceutical composition of the invention for use as a medicament.

[0178] In yet another aspect the present invention relates to the oligonucleotide or the pharmaceutical composition of the invention for use in treating or inhibiting progression of a tauopathic disorder or for use in treating or inhibiting a symptom of a tauopathic disorder.

[0179] Preferably, said tauopathic disorder is selected from the group consisting of Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration Pick's disease, frontotemporal dementia with parkinsonism associated with chromosome 17 (FTDP-17), post-encephalitic parkinsonism, Parkinson's disease complex of Guam, Guadeloupean parkinsonism, Huntington disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallevorden-Spatz disease, Niemann Pick type C, chronic traumatic encephalopathy, tangle- only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-related mental retardation, non-Guamanian motor neuron disease with neurofibrillary tangles, neurodegeneration with brain iron accumulation, Gerstmann-Straussler- Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcification, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis and parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

[0180] In another preferred embodiment, said symptom of the tauopathic disorder is selected from the group of mild cognitive impairment, dementia, cognitive decline, decline of motor function, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neuronal degeneration, neuronal dysfunction, synapse loss, and amyloid deposition.

[0181] Preferably, the synaptic dysfunction is pre-synaptic dysfunction.

[0182] It was previously shown that SYNGR-3 interacts with pathological Tau at the presynapse and that reducing the level of SYNGR-3 rescued Tau-induced defects in vesicle mobility and neurotransmitter release. Inhibiting the expression of synaptogyrin-3 to reduce binding between synaptogyrin-3 and (the N-terminal sequence of) the tau protein is thus at the heart of the current invention. Therefore in a second aspect, any of the nucleic acid molecules or oligonucleotides described in current application is provided for use as a medicament. More particularly for use to treat tauopathies. PaVer / SyngrASO3 / 849

[0183] Tauopathies are a diverse group of disorders all having in common their association with prominent accumulation of intracellular tau protein. The tau protein is abundantly expressed in the central nervous system. The group of tauopathies is growing as recently Huntington disease (Fernandez-Nogales et al 2014 Nat Med 20:881-885) and chronic traumatic encephalopathy (CTE; McKee et al 2009 J Neuropathol Exp Neurol 68,709-735) were added.

[0184] Different classifications of tauopathies exist. In one classification system, tauopathic disorders are divided in predominant Tau pathologies, tauopathies associated with amyloid deposition and tauopathies associated with another pathology (Williams et al 2006 Intern Med J 36:652-660). Predominant Tau pathologies include progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration, Pick's disease, frontotemporal dementia with parkinsonism associated with chromosome 17 (FTDP-17), post-encephalitic parkinsonism, Parkinson's disease complex of Guam, and Guadeloupean parkinsonism. Tauopathic disorders associated with amyloid deposition include Alzheimer's disease, Down's syndrome, dementia pugilistica, familial British dementia and familial Danish dementia. Tauopathic disorders associated with another pathology include myotonic dystrophy, Hallevorden-Spatz disease, and Niemann Pick type C.

[0185] Another classification is based on the isoform type found in the aggregates although overlaps may exist: 4R tauopathies include progressive supranuclear palsy (PSP), corticobasal degeneration, tangle predominant dementia, and argyrophilic grain disease. 3R tauopathies include Pick disease, and 3R+4R tauopathies include Alzheimer's disease (Dickson et al 2011 J Mol Neurosci 45:384-389; Murray et al 2014 Alzheimer's Res Ther 6:1). The tau protein is discussed herein in more detail further below.

[0186] Further tauopathies include tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-related mental retardation, non-Guamanian motor neuron disease with neurofibrillary tangles, neurodegeneration with brain iron accumulation, Gerstmann- Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcification, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis and parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis (Murray et al 2014 Alzheimer's Res Ther 6:1; Spillantini & Goedert 2013 Lancet Neurol 12:609-622).

[0187] Symptoms of tauopathic disorders include clinical or pathological symptoms such as mild cognitive impairment, dementia, cognitive decline (e.g. apathy, impairment in abstract thought), decline of motor function (causing e.g. postural instability, tremor or dystonia), oculomotor and bulbar dysfunction. Criteria for diagnosing dementia are outlined in e.g. the Diagnostic and Statistical Manual of Mental Disorders (DSM) or in the International Classification of Disease (ICD) and are subject to regular updates. PaVer / SyngrASO3 / 849

[0188] The type of clinical symptoms depends on which region of the brain is affected by the tauopathy and explains why Alzheimer's disease is mainly a dementing disease and why Parkinson's disease is mainly affecting movement. Stereotypical temporospatial propagation of tau inclusions creates a consistent pattern of brain lesions in at least Alzheimer's disease and argyrophilic grain disease. The spreading may in part occur in a trans-synaptic manner (Spillantini & Goedert 2013 Lancet Neurol 12:609-622; Liu et al 2012 PloS One 7:e31802). Molecular symptoms of tauopathic disorders include synaptic dysfunction (in particular pre-synaptic dysfunction), neurotoxicity, neuronal degeneration, neuronal dysfunction, synapse loss and amyloid deposition.

[0189] Given that the oligonucleotides according to the present disclosure are preferably able to target synaptogyrin-3 and reduce its expression, any of said oligonucleotides is thus applicable for use as a medicament. In an independent aspect, the oligonucleotide according to any embodiment of the first aspect or a pharmaceutical composition comprising said oligonucleotide is used as a medicament.

[0190] Preferably, the oligonucleotides herein described are provided for use in (a method for) treating or inhibiting progression of a tauopathic disorder or for use in (a method for) treating or inhibiting a symptom of a tauopathic disorder.

[0191] In particularly preferred embodiment, the oligonucleotides of the invention are inhibitors of human synaptogyrin-3 expression. The expression or function of synaptogyrin-3 is (partially) inhibited such as to restore pathological Tau-induced presynaptic dysfunction. In the methods for treating or inhibiting progression of a tauopathic disorder or a symptom of a tauopathic disorder, any of the nucleic acid molecules or oligonucleotides herein described is administered to a subject in need thereof (a subject suffering of or displaying a tauopathy or symptom thereof) in an effective amount, i.e. in an amount sufficient to treat or to inhibit progression of a tauopathic disorder or a symptom of a tauopathic disorder.

[0192] For the purpose of treating, preventing or inhibiting (progression of) an intended disease or disorder, and in method for treating, preventing or inhibiting (progression of) an intended disease or disorder, an effective amount of the therapeutic compound is administered to a subject in need thereof. An "effective amount" of an active substance in a composition is the amount of said substance required and sufficient to elicit an adequate response in treating, preventing, inhibiting (progression of) the intended or targeted medical indication. It will be clear to the skilled artisan that such response may require successive (in time) administrations with the composition as part of an administration scheme. The effective amount may vary depending on the nature of the compound, the route of administration of the compound (crossing of the blood-brain barrier and the cell membrane are potential barriers to be taken by oligonucleotides as described herein), the health and physical condition of the individual to be treated, the age of the individual to be treated (e.g. dosing for infants may be lower than for adults) the PaVer / SyngrASO3 / 849 taxonomic group of the individual to be treated (e.g. human, non-human primate, primate, etc.), the capacity of the individual's system to respond effectively, the degree of the desired response, the formulation of the active substance, the treating doctor's assessment and other relevant factors. The effective amount further may vary depending on whether it is used in monotherapy or in combination therapy. Determination of an effective amount of a compound usually follows from pre-clinical testing in a representative animal or in vitro model (if available) and / or from dose-finding studies in early clinical trials.

[0193] Any of the oligonucleotides described herein is provided for use in (a method for) treating or inhibition progression of a tauopathic disorder wherein the tauopathic disorder is selected from the group consisting of Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsyparkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration Pick's disease, frontotemporal dementia with parkinsonism associated with chromosome 17 (FTDP-17), post-encephalitic parkinsonism, Parkinson's disease complex of Guam, Guadeloupean parkinsonism, Huntington disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallevorden-Spatz disease, Niemann Pick type C, chronic traumatic encephalopathy, tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-related mental retardation, non-Guamanian motor neuron disease with neurofibrillary tangles, neurodegeneration with brain iron accumulation, Gerstmann-Straussler- Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcification, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis and parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

[0194] Any of the nucleic acid molecules or oligonucleotides described herein is thus likewise applicable for use in (a method for) treating or inhibition progression of a symptom of tauopathic disorder selected from the group of mild cognitive impairment, dementia, cognitive decline, decline of motor function, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neuronal degeneration, neuronal dysfunction, synapse loss, and amyloid deposition. In particular, in relation to synaptic dysfunction it concerns pre-synaptic dysfunction.

[0195] "Treatment" refers to any rate of reduction or retardation of the progress of the disease or disorder compared to the progress or expected progress of the disease or disorder when left untreated. More desirable, the treatment results in no / zero progress of the disease or disorder (i.e. "inhibition" or "inhibition of progression") or even in any rate of regression of the already developed disease or disorder. Tauopathies are in general progressive disorders, and progression may imply propagation of PaVer / SyngrASO3 / 849 pathological tau protein (Asai et al 2015 Nat Neurosci 18:1584-1593; deCalignon et al 2012 Neuron 73:685-697).

[0196] "Reduction" or "reducing" as used herein refers to a statistically significant reduction. More particularly, a statistically significant reduction upon administering the inhibitor of the invention compared to a control situation wherein the inhibitor is not administered. In a particular embodiment, said statistically significant reduction is an at least 25%, 30%, 35%, 40%, 45% or 50% reduction compared to the control situation.

[0197] The application also provides methods of treating or inhibiting progression of a symptom of a tauopathic disorder, the method comprises the step of administering any of the nucleic acid molecules or oligonucleotides herein described to a subject in need thereof.

[0198] In one embodiment, a method of reducing the expression level of synaptogyrin-3 in a subject is provided, comprising the step of administering any of the nucleic acid molecules or oligonucleotides herein described to the subject.

[0199] Diagnosis of tauopathic disorders

[0200] The present disclosure provides the oligonucleotides of the present disclosure which could be conjugated to a detectable moiety, for example, a radiotracer, a fluorescent moiety (e.g., a fluorescent protein), or any detectable moiety known in the art. Also provided are methods for the diagnosis or prognosis of tauopathic disorders, methods to monitor the efficacy of a treatment, methods to select a patient for treatment, or methods to select a subject for a clinical trial or to exclude a subject from a clinical trial comprising administering a nucleic acid molecule or oligonucleotides of the present disclosure. The nucleic acid molecules or oligonucleotides of the present disclosure can also be used for diagnostic purposes. Magnetic resonance imaging (MRI) in itself allows for radiologic determination of brain atrophy. Midbrain atrophic signs such as the Hummingbird or Penguin silhouette are for instance indicators of progressive supranuclear palsy (PSP). Determination of tau protein content in the cerebrospinal fluid (CSF) may also serve as an indicator of tauopathies. The ratio between the 33 kDa / 55 kDa tau-forms in CSF was e.g. found to be reduced in a patients with PSP (Borroni et al 2008 Neurology 71:1796-1803).

[0201] Recently, in vivo imaging techniques of neurodegeneration have become available. Such techniques can clearly support the clinical diagnosis of neurodegenerative diseases in general and of tauopathies in particular. In vivo diagnosis of tauopathies benefits from the existence of Tau imaging ligands detectable by positron emission tomography (PET), and include the radiotracers 2-(l-(6-((2-[18F]fluoroethyl) (methyl) amino)-2-naphthyl)ethylidene) malononitrile ([18F]FDDNP), 2-(4-aminophenyl)-6-(2-

[0202] ([18F]fluoroethoxy))quinolone ( [18F]TH K523), and [18F]T807 and [18F]T808 (Murray et al 2014 Alzheimer's Res Ther 6:1). In addition, MRI can be used to detect tauopathies, and PET imaging with PaVer / SyngrASO3 / 849 fluorodeoxyglucose (FDG,18F agent) is indicative of synaptic activity (Murray et al 2014 Alzheimer's Res Ther 6:1). Beta-amyloid, that can be detected in vivo, e.g. by using florbetapir (or other amyloid markers) in combination with PET, proved to be an accurate biomarker for at least Alzheimer's disease (Clark et al 2011 J Am Med Assoc 305:275-283) and the florbetapir-PET technique received FDA approval in 2012. The availability of in vivo tauopathy detection techniques is further supportive for selecting subjects that can benefit from synaptogyrin-3 inhibitory therapies as described herein.

[0203] Inhibition of synaptogyrin-3

[0204] By using the oligonucleotides of the disclosure, inhibition of synaptogyrin-3 is obtained at the expression level. In other words, the administration of an oligonucleotide of the present disclosure can reduce the level of mRNA encoding synaptogyrin-3, which in turn would result in a lower protein expression level of synaptogyrin-3. In some embodiments, such reduction of expression levels of synaptogyrin-3 can result in a reduction in synaptogyrin-3 activity. As demonstrated previously (see W02019 / 016123 and US20220403021A1, which are herein incorporated by reference in their entireties), partial inhibition of synaptogyrin-3 is sufficient to restore pathological Tau-induced presynaptic dysfunction. As such, inhibition of synaptogyrin-3 expression and / or activity implies several possible levels of inhibition.

[0205] In some embodiments, the administration of the oligonucleotide of the present disclosure can result in a reduction in synaptogyrin-3 mRNA level of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least 95%, or even about 100% with respect to control conditions (e.g., prior to the administration of the oligonucleotide of the present disclosure). In some aspects, the administration an oligonucleotide of the disclosure can result in a reduction in synaptogyrin-3 protein level of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least 95%, or about 100% with respect to control conditions (e.g., prior to the administration of the oligonucleotide of the present disclosure). In some aspects, the administration an oligonucleotide of the disclosure can result in a reduction in synaptogyrin-3 activity level of at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least 95%, or about 100% with respect to control conditions (e.g., prior to the administration of the oligonucleotide of the present disclosure). PaVer / SyngrASO3 / 849

[0206] The skilled person is familiar with multiple ways of determining the level of synaptogyrin-3 in a cell and hence to determine a reduction of the Syngr-3 transcript level compared to a control. A non-limiting example is quantitative reverse transcriptase (RT)-PCR. In current application the Syngr-3 levels have been determined using a TaqMan assay.

[0207] Administrating the nucleic acid molecules of the invention

[0208] The oligonucleotides of the present invention may be administered via intravenous, subcutaneous, intramuscular, intracerebral, intracerebroventricular, intraventricular, intraocular, or intrathecal administration. In some embodiments, the administration is via intrathecal administration.

[0209] SYNGR-3 gene inactivation, i.e. inhibition of expression of the target gene, can be achieved by administering said inhibitor to the subject (see Examples). An oligonucleotide construct can be delivered, for example as an expression plasmid, which when transcribed in the cell, produces the oligonucleotide that is complementary to at least a unique portion of the cellular SYNGR-3 RNA. Alternatively, oligonucleotide inhibitors can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing these inhibitors targeted against SYNGR-3 from a plasmid include, for example the U6 or Hl RNA polymerase III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. Nonlimiting examples are neuronal-specific promoters, glial cell specific promoters, the human synapsin 1 gene promoter, the Hb9 promotor or the promoters disclosed in US7341847B2.

[0210] The recombinant plasmids comprising any of the nucleic acid molecules or oligonucleotides of the invention can also comprise inducible or regulatable promoters for expression of the nucleic acid molecule or oligonucleotide in a particular tissue or in a particular intracellular environment. The nucleic acid molecule or oligonucleotide expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly, e.g. in brain tissue or in neurons. The oligonucleotides according to the present disclosure can also be expressed intracellularly from recombinant viral vectors. The recombinant viral vectors comprise sequences encoding the nucleic acid molecules or oligonucleotides of the invention and any suitable promoter for expressing them. The nucleic acid molecules or oligonucleotides will be administered in an "effective amount" which is an amount sufficient to cause a statistically significant reduction of the SYNGR-3 transcript. Generally, an effective amount of a nucleic acid molecule or oligonucleotide targeting SYNGR- 3 transcripts comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of inhibitor can be administered. PaVer / SyngrASO3 / 849

[0211] Drug administration across blood-brain barrier

[0212] The blood-brain barrier (BBB) is a protective layer of tightly joined cells that lines the blood vessels of the brain, which poses a challenge in the delivery of drugs, such as the synaptogyrin-3 inhibitors described herein, to the central nervous system / brain in that drugs transported by the blood not necessarily will pass the blood-brain barrier. Although the BBB often is to some degree affected or broken down in case of a tauopathic disorder, it may be needed to rely on a means to enhance permeation of the BBB for a candidate drug for treating a tauopathic disorder to be able to enter the affected brain cells. Several options are nowadays available for delivery of drugs across the BBB (Peschillo et al 2016 J Neurointervent Surg 8:1078-1082; Miller & O'Callaghan 2017 Metabolism 69:S3- S7; Drapeau & Fortin 2015 Current Cancer Drug Targets 15:752-768).

[0213] The oligonucleotides of the present disclosure can be directly injected into the brain (invasive strategy) or can be directed into the brain after BBB disruption with a pharmacological agent (pharmacologic strategy). Direct drug deposition may be improved by the technique of convection-enhanced delivery. Longer term delivery of a therapeutic protein (e.g. the oligonucleotide of the present disclosure which acts as a synaptogyrin-3 inhibitor as describe herein) can be achieved by implantation of genetically modified stem cells, by recombinant viral vectors, by means of osmotic pumps, or by means of incorporating the therapeutic drug in a polymer (slow release; can be implanted locally).

[0214] BBB transcytosis and efflux inhibition are other strategies to increase brain uptake of drugs supplied via the blood. Using transferrin or transferrin-receptor antibodies as carrier of a drug is one example of exploiting a natural BBB transcytosis process (Friden et al. 1996, J Pharmacol Exp Ther 278:1491-1498). The oligonucleotides according to any embodiment of the first aspect can alternatively be loaded in liposomes to enhance their crossing of the BBB, an approach also known as liposomal Trojan horse strategy. In another embodiment, the oligonucleotides can be delivered intranasally.

[0215] A more recent and promising avenue for delivering therapeutic drugs to the brain consists of (transient) BBB disruption by means of ultrasound, more particularly focused ultrasound (FUS; Miller et al. 2017, Metabolism 69:S3-S7). Besides being non-invasive, this technique has, often in combination with realtime imaging, the advantage of precise targeting to a diseased area of the brain. Therapeutic drugs can be delivered in e.g. microbubbles e.g. stabilized by an albumin or other protein, a lipid, or a polymer. Therapeutic drugs can alternatively, or in conjunction with microbubbles, be delivered by any other method, and subsequently FUS can enhance local uptake of any compound present in the blood (e.g. Nance et al. 2014, J Control Release 189:123-132). Just one example is that of FUS-assisted delivery of antibodies directed against toxic amyloid-beta peptide with demonstration of reduced pathology in mice (Jordao et al. 2010, PloS One 5:el0549). Microbubbles with a therapeutic drug load can also be induced to burst (hyperthermic effect) in the vicinity of the target cells by means of FUS, and when driven by e.g. PaVer / SyngrASO3 / 849 a heat shock protein gene promoter, localized temporary expression of a therapeutic protein can be induced by ultrasound hyperthermia (e.g. Lee Titsworth et al. 2014, Anticancer Res 34:565-574). Alternatives for ultrasound to induce the hyperthermia effect are microwaves, laser-induced interstitial thermotherapy, and magnetic nanoparticles (e.g. Lee Titsworth et al. 2014, Anticancer Res 34:565-574). Intracellular drug administration

[0216] Besides the need to cross the BBB, drugs targeting disorders of the central nervous system, such as the synaptogyrin-3 inhibitors described herein, may also need to cross the cellular barrier. Although most antisense oligonucleotides are readily taken up by neurons and glia after reaching the nervous system, it can be advantageous to use facilitators of intracellular drug uptake.

[0217] One solution is the use of cell-penetrating proteins or peptides (CPPs). Such peptides enable translocation of the drug of interest coupled to them across the plasma membrane. CPPs are alternatively termed Protein Transduction Domains (TPDs), usually comprise 30 or less (e.g. 5 to 30, or 5 to 20) amino acids, and usually are rich in basic residues, and are derived from naturally occurring CPPs (usually longer than 20 amino acids), or are the result of modelling or design. A non-limiting selection of CPPs includes the TAT peptide (derived from HIV-1 Tat protein), penetratin (derived from Drosophila Antennapedia -Antp), pVEC (derived from murine vascular endothelial cadherin), signal-sequence based peptides or membrane translocating sequences, model amphipathic peptide (MAP), transportan, MPG, polyarginines; more information on these peptides can be found in Torchilin 2008 (Adv Drug Deliv Rev 60:548-558) and references cited therein. The commonly used CPP is the transduction domain of TAT termed TATp. The TAT peptide was e.g. used to shuffle a tau-fragment into neuronal cells (Zhou et al. 2017).

[0218] CPPs can be coupled to carriers such as nanoparticles, liposomes, micelles, or generally any hydrophobic particle. Coupling can be by absorption or chemical bonding, such as via a spacer between the CPP and the carrier. To increase target specificity an antibody binding to a target-specific antigen can further be coupled to the carrier (Torchilin 2008, Adv Drug Deliv Rev 60:548-558)

[0219] CPPs have already been used to deliver payloads as diverse as plasmid DNA, oligonucleotides, siRNA, peptide nucleic acids (PNA), proteins and peptides, small molecules and nanoparticles inside the cell (Stalmans et al. 2013, PloS One 8:e71752).

[0220] Kits and products of manufacture

[0221] Also provided herein are kits and products of manufacture comprising one or more compositions (e.g., an oligonucleotide of the present disclosure or pharmaceutical compositions comprising an oligonucleotide of the present disclosure) described herein. In some aspects, provided herein is a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions described herein. In some aspects, the kit or product of manufacture PaVer / SyngrASO3 / 849 comprises, e.g., a first container comprising a first pharmaceutical composition comprising an oligonucleotide of the present disclosure, a second container containing a solvent, and optionally an instruction for use. In some aspects, the kit or product of manufacture comprises a container comprising an oligonucleotide of the present disclosure and optionally an instruction for use.

[0222] In some aspects, the kit contains a pharmaceutical composition described herein and any prophylactic or therapeutic agent, such as those described herein. In some aspects, the kit further comprises instructions to administer a composition of the present disclosure according to any method disclosed herein. In some aspects, the kit is for use in the treatment of a medical indication disclosed herein. In some aspects, the kit is a diagnostic kit.

[0223] All of the references cited above, as well as all references cited herein, are incorporated herein by reference in their entireties.

[0224] The sequences of biomolecules (e.g., proteins, genes) disclosed herein and identified by either database accession number or gene name are incorporated by reference. The database accession numbers disclosed herein (e.g, Genbak accession numbers) refer to the database version that in effect on February 1, 2023. The nucleic acid sequences of genes identified by name as well as their official names and alternative names correspond to those in the version of the Genbank database active on February 1, 2023, and are herein incorporated by reference. The amino acid sequences of proteins identified by name or translation products of genes identified by name as well as their official and alternative names correspond to those in the version of the UniProt database active on February 1, 2023, and are herein incorporated by reference.

[0225] Although the invention has been described and illustrated in the foregoing illustrative embodiments, it is understood that the present disclosure has been made only by way of example, and the numerous changes in the details of implementation of the invention can be made without departing from the spirit and scope of the invention, which is only limited by the claims that follow. Features of the disclosed embodiments can be combined and rearranged in various ways. The various embodiments can be combined with one or more other embodiments to form new embodiments.

[0226] The following examples are offered by way of illustration and not by way of limitation.

[0227] Protein expression

[0228] Protein Expression was measure by western blot after 8 days of ASOs incubation using a Polyclonal Rabbit SYNGR3 (Novus Biologicals). Gapdh (glyceraldehyde-3-phosphate dehydrogenase) or Actin were used as loading controls. PaVer / SyngrASO3 / 849

[0229] EXAMPLES

[0230] Example 1. Design and synthesis of optimised antisense 17-mer and 18-mer oligonucleotides specifically directed against human SYNGR3 transcripts

[0231] A bioinformatic analysis was performed to identify an ASO screening set designed to mediate RNaseH dependent cleavage of human Syngr3 (pre-)mRNA (NCBI Gene ID: 9143, ENSG 00000127561). We derived all possible ASO sequences, from the human target mRNA, in a 16-mer 3-10-3 LNA gapmer design based on relevant spliced and unspliced transcripts (reference transcript SYNGR 3-201; ENST 00000248121.7). The following parameters were taken into consideration for the in-silico analysis:

[0232] (a) Species cross reactivity for human, cynomolgus monkey, rhesus monkey and mouse

[0233] ASOs were first selected based on the Syngr 3-201 transcript. Additionally, ASOs specifically directed against the remaining human SYNGR3 transcripts were identified as well (isoform specific ASOs).

[0234] (b) Specificity

[0235] Target specificity in human, rhesus monkey, cynomolgus monkey and mouse was performed to identify ASOs with a low number of predicted off-targets to avoid unintended downregulation of non-target transcripts by full or partial complementarity to a ASO sequence. For each ASO sequence, the specificity was predicted based on the identification of predicted off-targets with up to 3 mismatches both in unspliced and primary transcript (nuclear and cytoplasmic targets) of the following species: human, cynomolgus monkey, rhesus monkey and mouse. To speed up the calculation and focus only on relevant ASOs, the candidate set was gradually reduced based on the predicted specificity. For this purpose, preliminary analyses were carried out that only consider off targets with few mismatches. This allowed an early exclusion of ASOs for which very many off targets are predicted.

[0236] (c) Analysis of sequences that contain hepatoxic, immune-stimulatory motifs

[0237] Motifs that can lead to toxicity were identified based on the published literature. Motifs such as TCC and / or TGC, CG and / or CT and / or TG and / or GC, and GT, are predicted to induce hepatoxicity, and motifs such as GC are known to induce the immune system. The number of occurrences of such motifs were counted and used to rank the ASO sequences.

[0238] (d) Sequence motifs known to influence activity (as described in literature)

[0239] Motifs predicted to decrease ASOs activity were identified and used for sequence ranking. Motifs such as GGGG and / or ACTG and / or AAA and / or TAA are known to reduce ASOs activity. Similarly, the identification of sequence motifs expected to increase activity, were also counted and taken into account for sequence ranking (CCAC and / or TCCC and / or ACTC and / or GCCA and / or CTCT). PaVer / SyngrASO3 / 849

[0240] (e) Single nucleotide polymorphism (SNP)

[0241] SNPs located in ASO target sites were identified and mapped to human transcripts NC_000016.10 (1989970...1994275) and NM_004209.6. Targeting regions with high number of SNP occurrences were avoided.

[0242] (f) Exclusion ofASOs with runs of 4 or more consecutive Gs orASOs showing G tetraplex motifs

[0243] Example 2. Human iPSC-derived neurons

[0244] To evaluate the silencing effect of the lead molecules, 20 new oligonucleotides of the invention (ASOs corresponding to SEQ ID No 6-25) as well as the parent molecules defined by SEQ ID No. 2, 3, 4 and 5, were tested in human iPSC-derived neurons (obtained from healthy donors). iPSCs are adult pluripotent stem cells generated from somatic cells by the introduction of reprogramming factors. Like other pluripotent stem cells, iPSCs can be differentiated into neurons and glial cells by exposure to a combination of growth factors and cell culture conditions. Human iPSCs (hiPSCs) thus make it possible to study to perform screening and functional assay in a more physiological environment.

[0245] In particular, we have used K0LF2.1J cell line parental cell line to generate neurons according to the published protocol. Briefly, hiPSC were maintained on Matrigel-coated plates with StemFlex medium (Gibco) and medium changes were performed every two days. At day 21 of differentiation, neural progenitors were plated on coverslips coated with poly-D-lysine and mouse-lamininin-terminal differentiation medium (Neurobasal-A medium (Gibco), supplemented with lx B27 devoid of vitamin A; lx GlutaMax, lx PenSrep; lOng / ml GDNF; lOng / ml BDNF; 0.5mM dbcAMP; lOpM DAPT; 0.2mM Ascorbic Acid; 100nM SR11237).

[0246] K0LF2.1J derived neurons were seeded 30k density / well, in a 96-well plate. The culture medium was changed 2-3 times a week during subsequent culture using a specific medium. After 21 days in culture, the different ASOs were directly added to the culture medium. After 4 or 8 days in culture, cells were processed for the different readouts (single addition of ASOs molecules).

[0247] To quantify the amount of mRNA, we performed RNA extraction after 4 days in culture using a 'Cells-to- CT technology' kit. The effect of each ASO molecule on SYNGR3 mRNA level and the selected closest off- target genes was quantified by qPCR, using specific and validated Taqman probes obtained from ThermoFisher. The identification of each probe used is as follows: for SYNGR3, Hs01093817_gl; for GAPDH, Cat.nr. 4485713; for HPRT1, Hs02800695_ml; for EHD3, Hs00997783_mH; for TTC7A, Hs01049781_ml; for SUN1, Hs00964062_ml; for GET4, Hs00944514_ml; for FAHD1, Hs00540098_sl; for SAMD4B, Hs00216043_ml; for PTPRJ, Hs01119326_ml; for CTNNA2, Hs01093122_ml; for STS, PaVer / SyngrASO3 / 849

[0248] Hs00996676_ml; for RAD51B, Hs01568763_ml' for EXOC4, Hs00253986_ml. For normalization, the amounts of GAPDH and HPRT1 were used as reference. Vehicle-treated samples were set to 1, and maximum inhibition of SYNGR3 mRNA expression was expressed in percentage values and shown in Table 4. Table 4. Potency, target engagement and toxicity of newly synthesized, gapmers of the invention, defined bySEQ ID No. 6 to 25, with the G regions indicated in bold and underlined part of the sequence, and F and F' regions (not bold, no underline) featuring LNA-modified nucleosides; compared to the efficacy of the parental molecules defined by SEQ ID No. 2-5, which are indicated by gray highlight. To quantify the effect on protein expression, cell lysates were prepared after 8 days of ASO incubation with the cells. Protein expression was measured by western blot using a Polyclonal Rabbit SYNGR3 (Novus Biologicals). GAPDH or ACTIN were used as loading controls. The maximum inhibition of SYNGR3 protein expression was calculated and expressed in percentage values.

[0249] For assessment of neuronal toxicity, the effect of each ASO molecule (10 pM) was quantified after 8 days of treatment. At this time point, the levels of SYNGR3 protein expression are decreased by >50%. We PaVer / SyngrASO3 / 849 have used a homogeneous assay, based on ATP concentration within the cells. ATP is a marker for cell viability due to its presence in all metabolically active cells. ATP concentration declines rapidly when cells undergo necrosis or apoptosis, and so monitoring ATP is a good indicator of cytotoxic, cytostatic and proliferation effects (ATPIite 1 STEP Luminescence Assay System).

[0250] Example 3. Toxicity assay

[0251] On-target toxicity - Cell viability of long-term exposure to ASOs:

[0252] K0LF2.1J derived neurons were plate in 96-well in terminal medium. Medium was changed every 2-3 days. At day 21, ASOs were added at the final concentration of 10 pM and cellular viability (ATP metabolism) was measured after 8 days of incubation. The timepoint of 8 days was chosen based on the low levels of protein expression after addition of the ASOs molecules. The results of the experiment are shown in Table 4.

[0253] The tests have shown that some compounds, like the new ASO gapmer defined by the SEQ ID No. 6, of a specific pattern design 3(LNA)-10 (DNA)-4(LNA), showed remarkable inhibitory activity on both mRNA Syngr3 inhibition applied in a concentration of 3 pM (results expressed as a % inhibition), while in a concentration of 10 pM did not affect the neuronal viability. The results obtained for this compound are promising, as they represent the improvement (IC5o <50nM)of the activities of the previously characterised parental molecules. The results obtained by compound defined by SEQ ID No. 10, SEQ ID No. 13, and SEQ ID No.23-25 are promising for further development of therapies, too, as the compounds showed relatively low IC50 values f-of Syngr-3 transcript inhibition, and no observed toxic effects even in the concentration of 10 pM.

[0254] Example 4. ASOs off-target prediction in silico.

[0255] An off-target prediction for human, cynomolgus monkey, and rhesus monkey was conducted with the NCBI RefSeq and the Ensembl database using the latest database version available. For this analysis we have included 16 ASOs sequences. Based on these analyses a detailed listing of all predicted off- target transcripts matched by the candidate ASOs with up to 2 mismatches was generated. The off-target analysis was conducted using 1) the mature transcriptome (defines cytoplasmic off-targets) and the primary transcriptome (defines nuclear and mitochondrial off-target). Potential off targets were defined as essential (Wang, T. et al., 2015; Blomen, V. A. et al., 2015; Hart, T. et al., 2015) or housekeeping genes (Hounkpeet al., 2021; Eisenberg et al., 2013). The levels of gene expression was obtained from expression Atlas EMBL-EBI.

[0256] Additionally, binding affinity of the ASO with on and off target sites was calculated with a dedicated software. Free energy of duplex destabilization was calculated by subtraction of the free energy of the PaVer / SyngrASO3 / 849 match (on target site) from that of the mismatch (off target site). The closer free energy values are to zero, the more stable the potential binding to the off-target site. Therefore, we have considered off- target genes with a free energy level up to 2 to experimentally validate the in-silico predictions (see table 5). For three of the parental ASOs molecules, the top ranked off-target genes were experimentally tested. Table 5 shows the fold-difference representing the ratio of the off-target gene potency / Syngr3 potency. The fold-difference can be considered as a good indication of the specificity of the developed compounds for inhibition of Syngrin_3 transcript only. We have indicated fold difference of the closest off-target genes (the location of the mismatch is indicated in Table 1 by a star), since the others off- target genes show to be slightly or not affected at all by SYNGR3-ASOs. Table 5. The fold-difference representing the ratio of the off-target gene potency / Syngr3 potency of the developed new ASOs as well as the "parent" molecules. PaVer / SyngrASO3 / 849

[0257] The fold-difference represents the ratio of the off-target gene potency / Syngr3 potency. In addition we considered the classification into housekeeping / essential gene, the expression in the CNS and the availability of TaqMan probes.

[0258] PaVer / SyngrASO3 / 849

[0259] Table 6. Off-target analysis of selected newly developed gapmer oligonucleotides and the parent ASOs on Sygr-3 as well as off-target gene transcripts. The results include IC50 values of the parent molecules as well as newly synthesized ASOs, and the fold difference (i.e., off-target gene potency / Syngr3 potency).

Claims

PaVer / SyngrASO3 / 849CLAIMS1. An oligonucleotide comprising a gapmer of formula 5'-F-G-F'-3', where each one of F and F' is a region independently comprising between 3 and 4 nucleosides; wherein each one of said F and F' regions independently comprises at least one chemically modified nucleoside, defining the 5' and / or 3' end of the F and F' region; and wherein G is a region between 9 and 11 nucleosides for recruiting RNaseH; wherein said oligonucleotide comprises a contiguous nucleotide portion of at least 10 contiguous nucleotides in length, the contiguous nucleotide portion being at least 90% complementary to an equal length portion of a target region within the Synaptogyrin-3 nucleotide sequence as depicted in SEQ ID No. 1; and wherein the target region within the Synaptogyrin-3 nucleotide is comprised between nucleobase positions 2141 to 2160, 2029 to 2048, 2209 to 2228 or between 1562 and 1581 of SEQ ID No. 1 and wherein the endpoints are included.

2. The oligonucleotide according to claim 1, wherein said at least one chemically modified nucleoside is 2' sugar modified nucleoside defining the 5' and / or 3' end of the F and F' region and / or a nucleoside featuring one or more internucleoside linkage.

3. The oligonucleotide according to any one of claims 1 or 2, wherein said oligonucleotide comprises 17, 18 or 19 nucleotides in length.

4. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is capable of binding to the Synaptogyrin-3 transcript as depicted in SEQ ID No. 1.

5. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is capable of statistically significantly reducing the level of Synaptogrin-3 transcript in a cell compared to a control condition in the absence of the oligonucleotide.

6. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is a single stranded nucleic acid molecule.

7. The oligonucleotide according to any one of the previous claims, wherein said target region within the Synaptogyrin-3 nucleotide sequence is selected from SEQ ID No. 26, 27, 28, or 29.

8. The oligonucleotide according to any one of the previous claims wherein said oligonucleotide is of a sequence showing at least 90% sequence identity to any one of SEQ ID No. 6-25.

9. The oligonucleotide according to any one of the previous claims, wherein the oligonucleotide consists of a gapmer of a sequence shown as SEQ ID No. 6-25.

10. The oligonucleotide according to any one of the previous claims wherein the 2' sugar modified nucleoside is selected from the group consisting of 2'-O-methyl-, 2'-O-methoxyethyl-, 2'-O-alkyl-, 2'- alkoxy, 2' -amino-, 2'-fluoro- and LNA nucleosides.PaVer / SyngrASO3 / 84911. The oligonucleotide according to claim 10, wherein said oligonucleotide comprises at least one nucleoside featuring one or more internucleoside linkage, wherein said one or more internucleoside linkage is between one or more nucleosides of region F and / or F' and / or between F and G and / or between F' and G, and wherein said internucleoside linkages are phosphorothioate internucleoside linkages.

12. A pharmaceutical composition comprising the oligonucleotide according to any one of the preceding claims.

13. The oligonucleotide according to any of claims 1-11 or the pharmaceutical composition according to claim 12 for use as a medicament.

14. The oligonucleotide according to any of claims 1-11 or the pharmaceutical composition according to claim 12 for use in treating or inhibiting progression of a tauopathic disorder or for use in treating or inhibiting a symptom of a tauopathic disorder.

15. The oligonucleotide according to any of claims 1-11 or the pharmaceutical composition according to claim 12 for use according to claim 14 wherein the tauopathic disorder is selected from the group consisting of Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsy-parkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration Pick's disease, frontotemporal dementia with parkinsonism associated with chromosome 17 (FTDP-17), post-encephalitic parkinsonism, Parkinson's disease complex of Guam, Guadeloupean parkinsonism, Huntington disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallevorden-Spatz disease, Niemann Pick type C, chronic traumatic encephalopathy, tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-related mental retardation, non-Guamanian motor neuron disease with neurofibrillary tangles, neurodegeneration with brain iron accumulation, Gerstmann-Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcification, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis and parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

16. The oligonucleotide according to any of claims 1-11 or the pharmaceutical composition according to claim 12 for use according to claim 14 wherein the symptom of the tauopathic disorder is selected from the group of mild cognitive impairment, dementia, cognitive decline, decline of motor function, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neuronal degeneration, neuronal dysfunction, synapse loss, and amyloid deposition.

17. The oligonucleotide according to any of claims 1-11 or the pharmaceutical composition according to claim 12 for use according to claim 16 wherein the synaptic dysfunction is pre-synaptic dysfunction.PaVer / SyngrASO3 / 84918. A method of treating or inhibiting progression of a tauopathic disorder or treating or inhibiting a symptom of a tauopathic disorder comprising administering an effective dose of an oligonucleotide according to any of claims 1 and 11 or the pharmaceutical composition according to claim 12 to a subject in need thereof.

19. The method of claim 18, wherein the tauopathic disorder is selected from the group consisting of Alzheimer's disease, progressive supranuclear palsy (PSP), progressive supranuclear palsyparkinsonism (PSP-P), Richardson's syndrome, argyrophilic grain disease, corticobasal degeneration Pick's disease, frontotemporal dementia with parkinsonism associated with chromosome 17 (FTDP- 17), post-encephalitic parkinsonism, Parkinson's disease complex of Guam, Guadeloupean parkinsonism, Huntington disease, Down's syndrome, dementia pugilistica, familial British dementia, familial Danish dementia, myotonic dystrophy, Hallevorden-Spatz disease, Niemann Pick type C, chronic traumatic encephalopathy, tangle-only dementia, white matter tauopathy with globular glial inclusions, subacute sclerosing panencephalitis, SLC9A6-related mental retardation, non-Guamanian motor neuron disease with neurofibrillary tangles, neurodegeneration with brain iron accumulation, Gerstmann-Straussler-Scheinker disease, frontotemporal lobar degeneration, diffuse neurofibrillary tangles with calcification, chronic traumatic encephalopathy, amyotrophic lateral sclerosis of Guam, amyotrophic lateral sclerosis and parkinsonism-dementia complex, prion protein cerebral amyloid angiopathy, and progressive subcortical gliosis.

20. The method of claim 19, wherein the symptom of the tauopathic disorder is selected from the group of mild cognitive impairment, dementia, cognitive decline, decline of motor function, oculomotor and bulbar dysfunction, synaptic dysfunction, neurotoxicity, neuronal degeneration, neuronal dysfunction, synapse loss, and amyloid deposition.

21. The method of claim 20, wherein the synaptic dysfunction is pre-synaptic dysfunction.

Images