Protein degradation complex and use thereof

By designing the BLA structure of the SYVN1 binding compound and utilizing the SYVN1 proteasome system, highly efficient and selective degradation of the target protein was achieved, solving the problem of targeted degradation technology for transmembrane proteins and providing a new treatment method for diseases.

WO2026046278A1PCT designated stage Publication Date: 2026-03-05GUANGDONG HONG KONG MACAO GREATER BAY AREA PRECISION MEDICINE RESEARCH INSTITUTE (GUANGZHOU) +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/117492
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-28
Filing Date
2025-08-28
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

Existing targeted protein degradation technologies are difficult to effectively target and degrade transmembrane or secreted proteins, and traditional PROTACs drugs have low cell permeability and poor oral bioavailability, making it difficult to develop effective drugs.

Method used

A series of SYVN1-binding compounds were designed to selectively degrade target proteins, such as BRD4, NAMPT, CDK2, BTK, PD-L1, EGFR, MIF, and GPR52, through a BLA-structured protein degradation complex, where B is the target protein ligand, L is the linker, and A is the SYVN1-binding compound.

Benefits of technology

It achieves highly efficient and selective degradation of target proteins, solves the problems of cell permeability and bioavailability of traditional drugs, provides a new treatment strategy, and is applicable to the treatment of a variety of diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025117492-FTAPPB-I100001
    Figure PCTCN2025117492-FTAPPB-I100001
  • Figure PCTCN2025117492-FTAPPB-I100002
    Figure PCTCN2025117492-FTAPPB-I100002
  • Figure PCTCN2025117492-FTAPPB-I100003
    Figure PCTCN2025117492-FTAPPB-I100003
Patent Text Reader

Abstract

The present invention belongs to the technical field of medicinal chemistry, and specifically relates to a targeted protein degradation complex containing an SYVN1 binding compound and the use thereof. The present invention identifies a series of compounds that interact with SYVN1. The compounds can be used as "warheads" to participate in ERAD and effectively degrade transmembrane protein targets. On the basis of the SYVN1 binding compound, a new TPD technology for hijacking ERAD is established, providing a brand-new platform for treating TMSPs and other proteins that are difficult to target by means of current TPD technologies. Further, the compounds that interact with SYVN1 are linked, via a chemical linker, to a known ligand that interacts with a protein target, thereby generating a series of ERADEC molecules. The molecules can significantly degrade the target protein, providing a new possibility for a targeted degradation drug.
Need to check novelty before this filing date? Find Prior Art

Description

A protein degradation complex and its application Technical Field

[0001] This invention belongs to the field of pharmaceutical chemistry technology, specifically relating to a targeted protein degradation complex containing a SYVN1 binding compound and its application. Background Technology

[0002] Targeted degradation is a newly emerging drug design approach that has emerged in the last two decades. Unlike most traditional drugs that inhibit the function of target proteins by tightly binding to their active sites, targeted degradation drugs attempt to selectively eliminate target proteins using the cell's own protein degradation system, providing a potentially promising therapeutic strategy for disease treatment.

[0003] The discovery of targeted drugs typically relies on specific “pockets” in proteins that allow for the interaction of activity regulation with small molecule inhibitors. However, most pathogenic proteins have unknown activities or lack such pockets, thus preventing them from being targeted by inhibitors. Targeted protein degradation (TPD) technologies, such as proteolytic-targeting chimeras (PROTACs), hijack intracellular degradation mechanisms, such as ubiquitinated proteasomes (UPS) or autophagy, to selectively degrade target proteins, enabling targeted therapy of proteins that are typically difficult to target and providing a promising new avenue for drug discovery. In medical applications, because targeted protein degradation technologies only require a weak binding to the target protein to be effective, they offer a new pathway to overcome “undruggable” targets and target 80% of proteins that traditional small molecule or antibody drugs cannot yet penetrate, thus attracting significant attention from the scientific and pharmaceutical communities. Compared to traditional event-driven small molecule drugs, PROTACs based on this novel TPD mechanism exhibit highly efficient and durable anti-tumor effects with high selectivity. However, due to the relatively large molecular weight of PROTACs, which violates the five principles of drug-likeness in traditional medicinal chemistry, drugs developed based on this technology typically have low cell permeability and poor oral bioavailability. Furthermore, it is difficult to summarize systematic structure-activity relationships for PROTAC optimization, which is detrimental to the development of new drugs. Simultaneously, these methods face challenges in degrading transmembrane or secretory proteins (TMSPs) due to the requirement that cytosolic components participate in the degradation mechanism.

[0004] TMSPs, comprising 40% of the products of protein-coding genes, represent the largest class of drug targets. Targeting secreted proteins (TMSPs) is crucial for both drug discovery and basic research. However, TMSPs are difficult to target by intracellular protein degradation mechanisms (including UPS and autophagy) because they fold within the endoplasmic reticulum (ER) during synthesis. They are then packaged into vesicles for transport to the Golgi apparatus and then to the membrane or extracellular space. During this process, degrading agents and mechanisms have significant difficulty entering the vesicle transport system to degrade TMSPs. Therefore, TMSPs are largely resistant to traditional UPS- and autophagy-based protein degraders.

[0005] On the other hand, since almost all TMSPs fold within the ER, they are fully accessible to endoplasmic reticulum-associated degradation (ERAD) after folding. The endoplasmic reticulum is the core site of protein synthesis and quality control, where proteins fold to form their functional conformations. Genetic mutations, molecular chaperone saturation, or thermodynamic perturbations can lead to folding failures, producing "defective" proteins. These misfolded proteins not only lack function but also accumulate and trigger endoplasmic reticulum stress, disrupting cellular homeostasis. Due to the lack of degradation capacity in the endoplasmic reticulum lumen, most misfolded proteins must be transported to the cytoplasm via the ERAD pathway for degradation by the proteasome. ERAD dysregulation can lead to abnormalities in the skeletal motor system, cystic fibrosis, and neurodegenerative diseases; some viruses can even hijack this system to invade. Reversal operation is the rate-limiting step in ERAD, responsible for the transport of misfolded proteins across the endoplasmic reticulum membrane, but the participating proteins, mechanisms, and regulation remain important unsolved problems in this field due to the large size and conformational diversity of the substrates.

[0006] Synoviolin protein (SYVN1), also known as 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase degradation 1 (HRD1), is an endoplasmic reticulum-associated E3 ubiquitin ligase and an important molecule mediating ERAD. It specifically accepts ubiquitin from endoplasmic reticulum-associated E2 ubiquitin conjugating enzyme 7 (UBC7) and transfers it to substrate proteins to promote their degradation. SYVN1 plays a crucial role in maintaining intracellular protein homeostasis and preventing disease. Summary of the Invention

[0007] This invention discovers a series of SYVN1 binding compounds. Using these compounds as a platform, a series of ERADEC molecules were designed and prepared targeting different proteins, including bromodomain protein 4 (BRD4), nicotinamide phosphoribosyltransferase (NAMPT), cyclin-dependent protein kinase 2 (CDK2), Bruton's tyrosine kinase (BTK), programmed cell death receptor ligand 1 (PD-L1), epidermal growth factor receptor (EGFR), macrophage migration inhibitory factor (MIF), and orphan G protein-coupled receptor (GPR52).

[0008] In a first aspect, the present invention provides a protein degradation complex or a pharmaceutically acceptable salt thereof, the structure of the complex being: BLA, wherein B is a target protein ligand, L is a linker, and A is a SYVN1 binding compound.

[0009] Furthermore, the BLA is... TBM is the target protein binding portion, which can bind to the target protein; L is the linker; SBM is the SYNV1 binding portion, which can bind to the SYVN1 protein.

[0010] Furthermore, A corresponds to SBM, and B corresponds to TBM.

[0011] Furthermore, the SYNV1 binding portion is a fragment of a compound capable of binding to SYVN1.

[0012] Furthermore, the compounds that can bind to SYVN1 are selected from the group consisting of: desonide, deisobutylcyclosone, budesonide, and 5,7,4′-trimethoxyflavone.

[0013] Furthermore, the structural formula of the described deneide is:

[0014] Furthermore, the structural formula of the deisobutyl ring Zonade is as follows:

[0015] Furthermore, the structural formula of the budesonide is as follows:

[0016] Furthermore, the SYVN1 binding compound is desonide, with the following structure:

[0017] Furthermore, the SBM is R1 and R2 are each independently selected from H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, and 4-8 membered heterocyclic groups.

[0018] Furthermore, R1 and R2 are each independently selected from H, C1-C6 alkyl, and C3-C6 cycloalkyl.

[0019] Furthermore, R1 and R2 are each independently selected from H, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, n-hexyl, cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl.

[0020] Furthermore, the SBM is in Indicates the site connected to L.

[0021] Furthermore, the SBM is in Indicates the site connected to L.

[0022] Furthermore, the L linker is selected from the following structures and any combination thereof: substituted or unsubstituted amino, carbonyl, halogen, cyano, C1-C4 alkyl, C3-C6 cycloalkyl, alkane chain, PEG chain, alkyne, olefin, 6-10 aryl, 5-10 heteroaryl, 3-10 heterocyclic alkane, spirocyclic and / or bridged ring structures.

[0023] Furthermore, the L connector is -L1-L2-L3-L4-L5-L6-L7-L8-.

[0024] Furthermore, L1, L2, L3, L4, L5, L6, L7, and L8 are each independently selected from the following group: none, -O-, -NH-, -NR'-, carbonyl, C1-C20 alkylene, C2-C20 alkenylene, C2-C20 ynynylene, C3-C6 cycloalkylene, -(CH2CH2O) n -, -CH2CH2(CH2CH2O) n -、-(CH2CH2O) n CH2CH2-、-CH2(CH2CH2O) n -、-(CH2CH2O) n CH2-、-(OCH2CH2) n -, -CH2CH2(OCH2CH2) n -、-(OCH2CH2) n CH2CH2-、-CH2(OCH2CH2) n -、-(OCH2CH2) n CH2-, -NHCO-, -CONH-, -COO-, -OCO-, PEG chain, 6-10 arylene, 5-10 heteroarylene, 3-10 heterocyclic alkyl, wherein R' is H or C1-C3 alkyl, and n is an integer from 1 to 5.

[0025] Furthermore, L1, L2, L3, L4, L5, L6, L7, and L8 are each independently selected from the following group: none, -O-, -NH-, carbonyl, C1-C15 alkylene, C2-C15 alkenylene, C2-C15 alkyneylene, -(CH2CH2O). n -, -CH2CH2(CH2CH2O) n -、-(CH2CH2O) n CH2CH2-、-(OCH2CH2) n -, -CH2CH2(OCH2CH2) n -、-(OCH2CH2) n CH2CH2-, -NHCO-, -CONH-, -COO-, -OCO-, 5-8-membered heteroaryl, 4-8-membered heterocyclic alkyl, n is an integer from 1 to 5.

[0026] further,

[0027] L1 is selected from the following group: none, C1-C4 alkylene, C2-C4 alkenylene, -(CH2CH2O) n CH2CH2-;

[0028] L2 is selected from the following group: none, -NHCO-, -CONH-, -CO-, 4-8 membered heterocyclic alkylene groups;

[0029] L3 is selected from the following group: none, C1-C15 alkylene, C2-C15 alkenylene, -(CH2CH2O) n CH2CH2-;

[0030] L4 is selected from the following group: none, -NHCO-, -CONH-, -CO-, 5-8 quinone heteroaryl;

[0031] L5 is selected from the following group: C1-C15 alkylene, C2-C15 alkenylene, -(CH2CH2O) n CH2CH2-、-(CH2CH2O) n CH2-, -(CH2CH2O) n -;

[0032] L6 is selected from the following groups: none, -COO-, -CONH-, -NHCO-, -CO-;

[0033] L7 is selected from the following group: none, C1-C4 alkylene, C2-C4 alkenylene, -NH-, -O-;

[0034] L8 is -CO-.

[0035] further,

[0036] L1 is selected from the following group: none, C1-C4 alkylene, -(CH2CH2O) n CH2CH2-;

[0037] L2 is selected from the following group: none, -NHCO-, -CONH-, -CO-, piperazine-;

[0038] L3 is selected from the following group: none, C1-C15 alkylene, -(CH2CH2O) n CH2CH2-;

[0039] L4 is selected from the following group: none, -NHCO-, -CONH-, -CO-, and triazolyl;

[0040] L5 is selected from the following group: C1-C15 alkylene, C2-C15 alkenylene, -(CH2CH2O) n CH2CH2-、-(CH2CH2O) n CH2-, -(CH2CH2O) n -;

[0041] L6 is selected from the following group: None, -COO-, -CONH-, -CO-;

[0042] L7 is selected from the following group: none, C1-C4 alkylene, -NH-, -O-;

[0043] L8 is -CO-;

[0044] Where n is 1, 2, 3 or 4.

[0045] Furthermore, the piperazine group is selected from the group consisting of:

[0046] Where a represents the connection site at the proximal end of the SBM and b represents the connection site at the proximal end of the TBM.

[0047] Furthermore, the triazolyl group is selected from the group consisting of:

[0048] Where a represents the connection site at the proximal end of the SBM and b represents the connection site at the proximal end of the TBM.

[0049] Furthermore, n can be 1, 2, 3, or 4.

[0050] In this paper, the letters L, L1, L2, L3, L4, L5, L6, L7, and L8 are written with the left side indicating a bond to B and the right side indicating a bond to A.

[0051] Furthermore, the 5-10 member heteroaryl, 3-10 member heterocyclic alkanes, spirocyclic and bridged ring structures contain 1-3 heteroatoms.

[0052] Furthermore, the heteroatom is selected from one or more of N, O and / or S.

[0053] Furthermore, the target proteins are selected from the following group: bromodomain protein 4 (BRD4), nicotinamide phosphoribosyltransferase (NAMPT), cyclin-dependent protein kinase 2 (CDK2), Bruton's tyrosine kinase (BTK), programmed cell death receptor ligand 1 (PD-L1), epidermal growth factor receptor (EGFR), macrophage migration inhibitory factor (MIF), and orphan G protein-coupled receptor (GPR52).

[0054] Furthermore, the B target protein ligands include, but are not limited to, ligands of proteins such as bromodomain protein 4 (BRD4), nicotinamide phosphoribosyltransferase (NAMPT), cyclin-dependent protein kinase 2 (CDK2), Bruton's tyrosine kinase (BTK), programmed cell death receptor ligand 1 (PD-L1), epidermal growth factor receptor (EGFR), macrophage migration inhibitory factor (MIF), and orphan G protein-coupled receptor (GPR52).

[0055] Furthermore, the TBM is selected from the following group: in Indicates the site connected to L.

[0056] Furthermore, A, B, L, and L1 to L8 are each independently the corresponding functional groups of the compounds in the examples.

[0057] Furthermore, the TBM is a fragment of an inhibitory compound of the target protein, more preferably a fragment of a degradative compound of the target protein.

[0058] In one embodiment of the present invention, when B is a bromine domain protein 4 (BRD4) ligand, the structural formula of the protein degradation complex is as follows:

[0059] In one embodiment of the present invention, when B is a nicotinamide phosphoribosyltransferase (NAMPT) ligand, the structural formula of the protein degradation complex is:

[0060] In one embodiment of the present invention, when B is a cyclin-dependent protein kinase 2 (CDK2) ligand, the structural formula of the protein degradation complex is:

[0061] In one embodiment of the present invention, when B is a Bruton's tyrosine kinase (BTK) ligand, the protein degradation complex has the following structural formula:

[0062] In one embodiment of the present invention, when B is a programmed cell death receptor ligand 1 (PD-L1) ligand, the structural formula of the protein degradation complex is:

[0063] In one embodiment of the present invention, when B is an epidermal growth factor receptor (EGFR) ligand, the structural formula of the protein degradation complex is:

[0064] In one embodiment of the present invention, when B is a macrophage migration inhibitory factor (MIF) ligand, the structural formula of the protein degradation complex is:

[0065] In one embodiment of the present invention, when B is an orphan G protein-coupled receptor (GPR52) ligand, the protein degradation complex has the following structural formula:

[0066] In a second aspect, the present invention provides a protein-degrading pharmaceutical composition comprising the protein-degrading complex described in the first aspect or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0067] Thirdly, the present invention provides the use of the protein degradation complex of the first aspect or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of the second aspect in the preparation of a medicament for the prevention and / or treatment of diseases related to the activity or expression level of a target protein.

[0068] Furthermore, the diseases associated with the activity or expression level of the target protein are selected from the following group: solid tumors, hematologic malignancies, fibrosis, cardiovascular and cerebrovascular diseases, metabolic diseases, viral infections, immune diseases, infertility, inflammatory diseases, inflammatory bone diseases, sepsis, glomerulonephritis, pancreatitis, immune myocarditis, colitis, chronic inflammatory diseases, cancer, Gram-negative and / or Gram-positive sepsis, schizophrenia, cognitive impairment, brain malformations and ADHD, female reproductive system-related diseases, neurodegenerative diseases, and chronic pain.

[0069] Furthermore, the solid tumors are selected from the following group: testicular nucleoprotein midline carcinoma, renal cell carcinoma, breast cancer, pancreatic cancer, neuroblastoma and glioma, liver cancer, colorectal cancer, melanoma, neuroblastoma and glioma, prostate cancer, endometrial cancer, gastric cancer, ovarian cancer, colon cancer, cervical cancer, lung cancer, triple-negative breast cancer, bladder cancer, urothelial carcinoma, head and neck squamous cell carcinoma, glioblastoma, classical Hodgkin lymphoma, glioma, head and neck squamous cell carcinoma, esophageal cancer, and glioma.

[0070] Furthermore, the hematologic malignancies include acute myeloid leukemia (including acute promyelocytic leukemia, acute monocytic leukemia, etc.), acute lymphoblastic leukemia (including B-cell acute lymphoblastic leukemia, T-cell acute lymphoblastic leukemia), chronic myeloid leukemia, chronic lymphocytic leukemia; myelodysplastic syndromes, myeloproliferative neoplasms (including polycythemia vera, essential thrombocythemia, essential myelofibrosis, chronic neutrophilic leukemia, chronic eosinophilic leukemia, etc.); Hodgkin's lymphoma, non-Hodgkin's lymphoma (including diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, Burkitt's lymphoma, peripheral T-cell lymphoma, anaplastic large cell lymphoma, cutaneous T-cell lymphoma, etc.); multiple myeloma, primary macroglobulinemia (… Macroglobulinemia, light chain amyloidosis; plasma cell leukemia, hairy cell leukemia, large granular lymphocytic leukemia, acute NK cell leukemia / lymphoma; pediatric hematologic malignancies (such as childhood acute lymphoblastic leukemia, childhood acute myeloid leukemia, childhood lymphoma, etc.).

[0071] Furthermore, the aforementioned immune diseases include systemic lupus erythematosus, Sjögren's syndrome, systemic sclerosis (scleroderma), mixed connective tissue disease, polyarteritis nodosa, microscopic polyangiitis, eosinophilic granulomatous polyangiitis (Churg-Strauss syndrome), granulomatous polyangiitis (Wegener's granulomatosis), adult-onset Still's disease, antiphospholipid syndrome; rheumatoid arthritis, juvenile idiopathic arthritis, psoriatic arthritis, ankylosing spondylitis, polymyositis, dermatomyositis, mixed myositis; psoriasis, vitiligo, pemphigus, bullous pemphigoid, cutaneous lupus erythematosus. Localized scleroderma (localized sclerosis, patchy scleroderma); Type 1 diabetes, autoimmune thyroiditis (Hashimoto's thyroiditis), Graves' disease, Addison's disease, autoimmune hypophysitis, primary ovarian insufficiency (autoimmune type); Multiple sclerosis, neuromyelitis optica, myasthenia gravis, autoimmune encephalitis (including anti-NMDA receptor encephalitis, etc.), Guillain-Barré syndrome, chronic inflammatory demyelinating polyneuropathy; Crohn's disease, ulcerative colitis, autoimmune gastritis, autoimmune hepatitis, primary biliary cholangitis, primary sclerosing cholangitis.

[0072] Furthermore, the neurodegenerative diseases mentioned include Alzheimer's disease (senile dementia), frontotemporal dementia, Lewy body dementia, mild cognitive impairment; Parkinson's disease, Parkinsonian syndrome, progressive supranuclear palsy, multiple system atrophy, corticobasal degeneration; Huntington's disease, spinocerebellar ataxia (including SCA1, SCA2, SCA3 / Machado-Joseph disease, SCA6, etc. subtypes), Friedreich ataxia; amyotrophic lateral sclerosis (ALS), primary lateral sclerosis, spinal muscular atrophy; Prion's disease (Cryptokines' disease, ... Syndrome, fatal familial insomnia, etc.; motor neuron disease (MND), frontotemporal dementia combined with motor neuron disease (FTD-MND); retinitis pigmentosa (hereditary neurodegenerative eye disease), Leber hereditary optic neuropathy.

[0073] Furthermore, the chronic pain includes chronic headache disorders, including migraine, tension headache, cluster headache, and chronic daily headache; neuropathic pain, including postherpetic neuralgia, trigeminal neuralgia, diabetic peripheral neuropathy pain, chemotherapy-induced peripheral neuropathy pain, HIV-related peripheral neuropathy pain, sciatica, and brachial plexus injury-related pain; central pain syndromes, including pain after spinal cord injury, pain associated with multiple sclerosis, pain after stroke, and pain associated with brain injury; and cancer-related chronic pain, including pain from cancerous bone metastases, chronic pain after cancer surgery, and chronic pain associated with radiotherapy and chemotherapy.

[0074] Furthermore, the metabolic diseases include obesity, metabolic syndrome, insulin resistance syndrome, fatty liver (including non-alcoholic fatty liver disease and non-alcoholic steatohepatitis), gout, and hyperuricemia; diabetes (including type 1 diabetes, type 2 diabetes, gestational diabetes, monogenic diabetes mellitus (MODY), and juvenile-onset diabetes), diabetic complications (diabetic nephropathy, diabetic retinopathy, diabetic neuropathy, and diabetic cardiovascular disease); and dyslipidemia, including hypercholesterolemia, familial hypercholesterolemia, mixed hyperlipidemia, hypertriglyceridemia, and low high-density lipoproteinemia.

[0075] Furthermore, the cardiovascular and cerebrovascular diseases mentioned include coronary atherosclerotic heart disease (including stable angina, unstable angina, and myocardial infarction), asymptomatic myocardial ischemia; hypertension, pulmonary hypertension, cardiovascular diseases related to primary aldosteronism, and renal hypertension; heart failure (including heart failure with reduced ejection fraction (HFrEF) and heart failure with preserved ejection fraction (HFpEF), left ventricular failure, and right ventricular failure; arrhythmias (including atrial fibrillation, atrial flutter, ventricular tachycardia, ventricular fibrillation, atrioventricular block, and Wolff-Parkinson-White syndrome); and valvular heart disease (aortic stenosis, mitral regurgitation, and mitral stenosis). Tricuspid regurgitation, pulmonary stenosis, etc.; cardiomyopathy (dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy); peripheral artery disease (atherosclerotic peripheral artery disease, occlusive arteriosclerosis, Buerger's disease / thromboangiitis obliterans); venous thromboembolism (deep vein thrombosis, pulmonary embolism), chronic venous insufficiency; cerebrovascular diseases, including ischemic stroke (cerebral infarction, transient ischemic attack), hemorrhagic stroke (cerebral hemorrhage, subarachnoid hemorrhage), cerebral aneurysm, cerebral arteriovenous malformation; carotid artery stenosis, vertebrobasilar insufficiency, aortic dissection.

[0076] Furthermore, when the protein degradation complex contains a bromine domain protein 4 (BRD4) ligand, and the target protein of the protein degradation complex is BRD4, the pharmaceutical composition is used to treat diseases such as solid tumors, hematologic malignancies, and fibrosis.

[0077] Furthermore, the solid tumors include, but are not limited to, testicular nucleoprotein midline carcinoma, renal cell carcinoma, breast cancer, pancreatic cancer, neuroblastoma, and glioma.

[0078] Furthermore, the hematologic malignancies include, but are not limited to, leukemia, multiple myeloma, lymphoma, myelodysplastic syndrome, and myeloproliferative neoplasms.

[0079] Furthermore, when the protein degradation complex contains a nicotinamide phosphoribosyltransferase (NAMPT) ligand, and the target protein of the protein degradation complex is NAMPT, the pharmaceutical composition is used to treat tumors, cardiovascular and cerebrovascular diseases, diabetes, and autoimmune diseases.

[0080] Furthermore, the tumors include, but are not limited to, liver cancer, colorectal cancer, breast cancer, melanoma, neuroblastoma and glioma, prostate cancer, endometrial cancer, gastric cancer and chronic leukemia.

[0081] Furthermore, when the protein degradation complex contains a cyclin-dependent protein kinase 2 (CDK2) ligand, and the target protein of the protein degradation complex is CDK2, the pharmaceutical composition is used to treat tumors, viral infections, immune diseases, and infertility.

[0082] Furthermore, the tumors include, but are not limited to, breast cancer, ovarian cancer, prostate cancer, colon cancer, and cervical cancer.

[0083] Furthermore, the immune diseases mentioned include, but are not limited to, rheumatoid arthritis, systemic lupus erythematosus, and pemphigus vulgaris.

[0084] Furthermore, when the protein degradation complex contains a Bruton tyrosine kinase (BTK) ligand, and the target protein of the protein degradation complex is BTK, the pharmaceutical composition is used to treat autoimmune diseases and inflammatory diseases.

[0085] Furthermore, the autoimmune diseases mentioned include, but are not limited to, autoimmune hemolytic anemia, immune thrombocytopenic purpura, multiple sclerosis, atopic dermatitis, rheumatoid arthritis, dry eye syndrome, chronic pemphigus, primary membranous nephropathy, systemic lupus erythematosus, chronic spontaneous urticaria, asthma, and allergies.

[0086] Furthermore, when the protein degradation complex contains programmed cell death receptor ligand 1 (PD-L1), and the target protein of the protein degradation complex is PD-L1, the pharmaceutical composition is used to treat tumor-related diseases.

[0087] Furthermore, the tumor-related diseases include, but are not limited to, liver cancer, lung cancer, pancreatic cancer, ovarian cancer, triple-negative breast cancer, bladder cancer, urothelial carcinoma, renal cell carcinoma (RCC), colorectal cancer (CRC), gastric cancer (GC), melanoma, head and neck squamous cell carcinoma, glioblastoma, classical Hodgkin lymphoma, and any other type of solid tumor.

[0088] Furthermore, when the protein degradation complex contains an epidermal growth factor receptor (EGFR) ligand, and the target protein of the protein degradation complex is EGFR, the pharmaceutical composition is used to treat tumor-related diseases.

[0089] Furthermore, the tumor-related diseases include, but are not limited to, glioma, breast cancer, lung cancer, ovarian cancer, head and neck squamous cell carcinoma, cervical cancer, esophageal cancer, prostate cancer, liver cancer, colon cancer, pancreatic cancer, gastric cancer, and other epithelial-derived tumors and gliomas.

[0090] Furthermore, when the protein degradation complex contains a macrophage migration inhibitory factor (MIF) ligand, and the target protein of the protein degradation complex is MIF, the pharmaceutical composition is used to treat inflammatory bone diseases, sepsis, glomerulonephritis, pancreatitis, immune myocarditis, colitis, chronic inflammatory diseases, cancer, Gram-negative and Gram-positive sepsis, etc.

[0091] Furthermore, when the protein degradation complex contains an orphan G protein-coupled receptor (GPR52) ligand, and the target protein of the protein degradation complex is GPR52, the pharmaceutical composition is used to treat Huntington's disease, schizophrenia, cognitive impairment, brain malformation, and ADHD.

[0092] Furthermore, when the protein degradation complex contains a bromodomain protein 4 (BRD4) ligand, i.e. when the protein degradation complex targets BRD4, the pharmaceutical composition is used to treat or prevent diseases related to the BRD4 pathway.

[0093] Furthermore, the diseases associated with the BRD4 pathway include, but are not limited to:

[0094] Malignant tumors, including acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, diffuse large B-cell lymphoma, multiple myeloma, neuroblastoma, Ewing's sarcoma, melanoma, breast cancer, prostate cancer, ovarian cancer, lung cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, colorectal cancer, glioma and other solid tumors or hematologic malignancies;

[0095] Inflammatory and autoimmune diseases, including rheumatoid arthritis, systemic lupus erythematosus, psoriasis, atopic dermatitis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), asthma, Sjögren's syndrome, multiple sclerosis, etc.

[0096] Cardiovascular and metabolic diseases, including atherosclerosis, heart failure, hypertrophic cardiomyopathy, diabetes and its complications, fatty liver disease, etc.

[0097] Fibrosis-related diseases, including pulmonary fibrosis, liver fibrosis, kidney fibrosis, myocardial fibrosis, and fibrotic diseases of other organs;

[0098] Viral infectious diseases, including HIV infection, hepatitis B virus-related diseases, hepatitis C virus-related diseases, human papillomavirus-related diseases, and other viral infection-related diseases.

[0099] Furthermore, when the protein degradation complex contains a nicotinamide phosphoribosyltransferase (NAMPT) ligand, i.e. when the protein degradation complex targets NAMPT, the pharmaceutical composition is used to treat or prevent diseases related to the NAMPT pathway.

[0100] Furthermore, the diseases associated with the NAMPT pathway include, but are not limited to:

[0101] Malignant tumors, including acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, non-small cell lung cancer, small cell lung cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, gastric cancer, colorectal cancer, hepatocellular carcinoma, melanoma, glioblastoma, multiple myeloma and other solid tumors or hematologic malignancies.

[0102] Metabolic diseases, including type 2 diabetes, obesity, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, and insulin resistance-related diseases;

[0103] Cardiovascular diseases, including atherosclerosis, coronary heart disease, myocardial ischemia-reperfusion injury, heart failure, pulmonary hypertension, etc.

[0104] Inflammatory and autoimmune diseases, including rheumatoid arthritis, psoriasis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), systemic lupus erythematosus, multiple sclerosis, Sjögren's syndrome, etc.

[0105] Neurological diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), and other neurodegenerative diseases;

[0106] Acute injury and ischemia-reperfusion-related diseases, including acute kidney injury, acute lung injury, stroke, myocardial infarction and other ischemia-reperfusion injuries.

[0107] Furthermore, when the protein degradation complex contains a cyclin-dependent protein kinase 2 (CDK2) ligand, i.e. when the protein degradation complex targets CDK2, the pharmaceutical composition is used to treat or prevent diseases related to the CDK2 pathway.

[0108] Furthermore, the diseases related to the CDK2 pathway include, but are not limited to:

[0109] Malignant tumors, including breast cancer (especially estrogen receptor-positive and triple-negative subtypes), ovarian cancer, endometrial cancer, prostate cancer, non-small cell lung cancer, small cell lung cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, colorectal cancer, melanoma, glioma, osteosarcoma, neuroblastoma, acute myeloid leukemia, acute lymphoblastic leukemia, multiple myeloma and other solid tumors or hematologic malignancies;

[0110] Proliferative-related diseases and tissue abnormalities, including psoriasis, atopic dermatitis, chronic obstructive pulmonary disease-related proliferative abnormalities, and fibrotic diseases (pulmonary fibrosis, liver fibrosis, kidney fibrosis, and myocardial fibrosis);

[0111] Female reproductive system-related diseases, including polycystic ovary syndrome (PCOS), premature ovarian failure, ovulation disorders, and hormone-dependent diseases;

[0112] Neurological disorders, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and other neurodegenerative diseases associated with abnormal activation of the cell cycle;

[0113] Cardiovascular diseases, including atherosclerosis, heart failure, myocardial hypertrophy, and myocardial ischemia-reperfusion injury.

[0114] Furthermore, when the protein degradation complex contains a Bruton tyrosine kinase (BTK) ligand, i.e. when the protein degradation complex targets BTK, the pharmaceutical composition is used to treat or prevent diseases related to the BTK pathway.

[0115] Furthermore, the diseases associated with the BTK pathway include, but are not limited to: hematologic malignancies, including chronic lymphocytic leukemia, mantle cell lymphoma, Waldenström macroglobulinemia, marginal zone lymphoma, diffuse large B-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, multiple myeloma, and other B-cell malignancies.

[0116] Autoimmune diseases, including systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, multiple sclerosis, myasthenia gravis, thrombocytopenic purpura, autoimmune hemolytic anemia, and other autoimmune-related diseases;

[0117] Inflammatory diseases, including asthma, chronic obstructive pulmonary disease, allergic rhinitis, atopic dermatitis, psoriasis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), polyangiitis and other chronic inflammatory diseases;

[0118] Transplant-related diseases, including graft-versus-host disease (GVHD) and organ transplant rejection.

[0119] Furthermore, when the protein degradation complex contains programmed cell death receptor ligand 1 (PD-L1), i.e. when the protein degradation complex targets PD-L1, the pharmaceutical composition is used to treat or prevent diseases related to the PD-L1 pathway.

[0120] Furthermore, the diseases associated with the PD-L1 pathway include, but are not limited to:

[0121] Malignant tumors, including non-small cell lung cancer, small cell lung cancer, melanoma, renal cell carcinoma, hepatocellular carcinoma, gastric cancer, gastroesophageal junction adenocarcinoma, colorectal cancer (microsatellite instability), esophageal squamous cell carcinoma, esophageal adenocarcinoma, head and neck squamous cell carcinoma, bladder cancer / urothelial carcinoma, biliary tract cancer, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, breast cancer (including triple-negative breast cancer), prostate cancer, soft tissue sarcoma, mesothelioma, neuroblastoma and other solid tumors;

[0122] Hematologic malignancies include Hodgkin's lymphoma, primary mediastinal large B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, peripheral T-cell lymphoma, anaplastic large cell lymphoma, NK / T-cell lymphoma, and multiple myeloma.

[0123] Chronic viral infectious diseases, including chronic hepatitis B, chronic hepatitis C, human immunodeficiency virus infection, EB virus-related diseases, HPV-related diseases, etc.

[0124] Immune-related diseases and transplant rejection, including organ transplant rejection, hematopoietic stem cell transplant rejection, and other diseases that can benefit from regulating the PD-1 / PD-L1 pathway.

[0125] Furthermore, when the protein degradation complex contains an epidermal growth factor receptor (EGFR) ligand, i.e., when the protein degradation complex targets EGFR, the pharmaceutical composition is used to treat or prevent diseases related to the EGFR pathway.

[0126] Furthermore, the diseases related to the EGFR pathway include, but are not limited to:

[0127] Malignant tumors, including non-small cell lung cancer (EGFR-mutated, wild-type, and drug-resistant mutant), small cell lung cancer, glioblastoma, melanoma, breast cancer (including triple-negative breast cancer), ovarian cancer, cervical cancer, endometrial cancer, prostate cancer, bladder cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, esophageal cancer, colorectal cancer, head and neck squamous cell carcinoma, biliary tract cancer, nasopharyngeal carcinoma, thyroid cancer, and other solid tumors or hematologic malignancies associated with abnormal EGFR activation;

[0128] Benign or proliferative diseases, including psoriasis, atopic dermatitis, chronic obstructive pulmonary disease-related proliferative abnormalities, pulmonary fibrosis, liver fibrosis, kidney fibrosis and other fibrotic diseases;

[0129] Ophthalmic diseases, including corneal neovascularization, macular degeneration, diabetic retinopathy, and other ophthalmic diseases associated with abnormal EGFR signals;

[0130] Cardiovascular and metabolic diseases, including atherosclerosis, pulmonary hypertension, myocardial hypertrophy, diabetic complications, and metabolic syndrome-related lesions.

[0131] Furthermore, when the protein degradation complex contains a macrophage migration inhibitory factor (MIF) ligand, i.e. when the protein degradation complex targets MIF, the pharmaceutical composition is used to treat or prevent diseases related to the MIF pathway.

[0132] Furthermore, the diseases associated with the MIF pathway include, but are not limited to:

[0133] Malignant tumors, including non-small cell lung cancer, small cell lung cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, prostate cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, colorectal cancer, esophageal cancer, head and neck squamous cell carcinoma, melanoma, glioblastoma, multiple myeloma, acute myeloid leukemia, diffuse large B-cell lymphoma, and other solid tumors or hematologic malignancies associated with high MIF expression;

[0134] Inflammatory diseases, including inflammatory bowel disease (Crohn's disease, ulcerative colitis), rheumatoid arthritis, psoriasis, systemic lupus erythematosus, asthma, chronic obstructive pulmonary disease, atopic dermatitis, and other chronic inflammation-related diseases;

[0135] Metabolic and cardiovascular diseases, including obesity, type 2 diabetes, metabolic syndrome, non-alcoholic fatty liver disease, atherosclerosis, myocardial ischemia-reperfusion injury, heart failure, and pulmonary hypertension.

[0136] Neurological disorders, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, stroke and other ischemic / inflammatory neurodegenerative diseases;

[0137] Acute injuries and transplant-related diseases include acute kidney injury, acute lung injury, graft-versus-host disease, and organ transplant rejection.

[0138] Furthermore, when the protein degradation complex contains an orphan G protein-coupled receptor (GPR52) ligand, i.e. when the protein degradation complex targets GPR52, the pharmaceutical composition is used to treat or prevent diseases related to the GPR52 pathway.

[0139] Furthermore, the diseases associated with the GPR52 pathway include, but are not limited to:

[0140] Neuropsychiatric disorders, including schizophrenia, bipolar disorder, depression, anxiety disorder, obsessive-compulsive disorder, schizophrenia-related cognitive impairment, and other mental illnesses;

[0141] Neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, spinocerebellar ataxia and other neurodegenerative diseases related to imbalances in dopamine and glutamate signaling pathways;

[0142] Drug dependence and addiction, including methamphetamine addiction, cocaine addiction, alcohol dependence, nicotine dependence, and other psychoactive substance addiction-related disorders;

[0143] Metabolic diseases, including obesity, type 2 diabetes, metabolic syndrome, non-alcoholic fatty liver disease, and other diseases associated with abnormal regulation of energy metabolism by the central nervous system.

[0144] Fourthly, the present invention provides a method for preventing and / or treating diseases related to the activity or expression level of a target protein, comprising the steps of: administering the protein degradation complex of the first aspect or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of the second aspect, to a subject in need of such treatment.

[0145] Fifthly, the present invention provides the use of desonide in the preparation of the protein degradation complex described in the first aspect of the invention or a pharmaceutically acceptable salt thereof, wherein desonide is bound to SYVN1.

[0146] In a sixth aspect, the present invention provides a targeted protein degradation method in which a chemical ligand interacts with the main ER-E3 SYVN1 to perform targeted degradation by hijacking ERAD.

[0147] Furthermore, the targeted protein degradation method can target and degrade transmembrane proteins, secretory proteins, and other proteins.

[0148] Furthermore, the chemical ligand is the SBM portion of the protein degradation complex described in the first aspect.

[0149] Furthermore, the targeted protein is the target protein targeted by TBM in the protein degradation complex described in the first aspect.

[0150] In a seventh aspect, the present invention provides a screening method, comprising the steps of:

[0151] (a) Provide a molecule, said molecule having structure,

[0152] TBM is the target-binding part, which can bind to the target protein; L is the linker; SBM is the SYVN1-binding part, which may bind to SYVN1.

[0153] (b) Contact the molecule with a system in which the levels of target proteins or target gene expression are abnormally elevated.

[0154] (c) Detect the level of target protein or target gene expression in the system;

[0155] (d) Output results:

[0156] If the target protein level or target gene expression level is significantly reduced, the molecule can be used as a protein degradation complex to degrade the target protein.

[0157] If the target protein level or target gene expression level is not significantly reduced, the molecule cannot be used as a protein degradation complex to degrade the target protein.

[0158] Furthermore, the system with abnormally elevated target protein levels includes: (a) an in vitro system containing cells with abnormally elevated target protein levels or abnormally elevated target gene expression levels, or (b) an in vivo body of a subject suffering from a condition related to abnormally elevated target protein levels or abnormally elevated target gene expression levels.

[0159] Furthermore, "significantly reduced" means that, compared to the system without the addition of the molecule, the level of the target protein or the expression level of the target gene is reduced by at least 50%, preferably at least 70%, and more preferably at least 90% after the addition of the molecule.

[0160] Eighthly, the present invention provides a method for degrading a target protein, comprising the steps of: contacting a protein degradation complex or a pharmaceutically acceptable salt thereof with the target protein, wherein the SBM portion of the protein degradation complex interacts with the major ER-E3 SYVN1, thereby performing targeted degradation by hijacking ERAD.

[0161] Furthermore, the method described is an in vitro non-diagnostic and non-therapeutic method.

[0162] Furthermore, the contact is an external contact.

[0163] Ninthly, the present invention provides a testing method, the method comprising the following steps:

[0164] (a) Provide one molecule;

[0165] (b) React the molecule with the SYVN1 protein and detect the degree of interaction between the molecule and SYVN1;

[0166] (c) Output results:

[0167] When the molecule interacts strongly with SYVN1, it can hijack ERAD for targeted degradation by interacting with the main ER-E3 SYVN1, thereby degrading the target protein.

[0168] When the interaction between the molecule and SYVN1 is weak, it cannot hijack ERAD for targeted degradation by interacting with the main ER-E3 SYVN1, thus failing to degrade the target protein.

[0169] Furthermore, "strong" means that the Kd (dissociation constant) of the molecule with SYVN1 is between submolar and micromolar, while "weak" means that the Kd (dissociation constant) of the molecule with SYVN1 is greater than the micromolar level.

[0170] In a tenth aspect, the present invention provides a method for preparing a protein degradation complex or a pharmaceutically acceptable salt thereof, said method comprising any one of the following:

[0171] The S1.SYVN1-interacting compound undergoes esterification with succinic anhydride, and is then coupled with the corresponding target protein ligand via a linker to obtain the target product.

[0172] Compounds that interact with S2.SYVN1 undergo esterification with carboxyl-containing linkers and are linked to the corresponding target protein ligands.

[0173] Compounds interacting with S3.SYVN1 and linkers containing hydroxyl groups can generate two types of esters via a one-pot process under weakly basic conditions, which are then linked to the corresponding target protein ligands.

[0174] Compounds interacting with S4.SYVN1 are first degraded into carboxylic acids under strongly alkaline conditions, and then coupled with the corresponding target protein ligands via linkers to obtain the target product.

[0175] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Beneficial effects

[0176] 1. This invention has discovered a series of compounds that interact with SYVN1. These compounds can act as “warheads” in ERAD and effectively degrade transmembrane protein targets.

[0177] 2. Based on the SYVN1 binding compound, this invention establishes a novel TPD technology for hijacking ERAD, which demonstrates high efficiency in degrading TMSP (sub-nM to nM DC50 in degrading the membrane protein target PD-L1) and can be extended to other targets; ERADECs based on this technology provide a novel platform for treating TMSPs and other proteins that are difficult to target with current TPD technologies.

[0178] 3. This invention links SYVN1 interacting compounds with known ligands that interact with protein targets through chemical linkers, generating a series of ERADEC molecules; these molecules can significantly degrade target proteins at sub-nM to nM concentrations, and cover different types of target proteins such as transmembrane proteins and secretory proteins; the ERADEC molecules of this invention provide new possibilities for targeted drug degradation. Attached Figure Description

[0179] Figure 1 shows candidate compounds from a compound library based on compound chips and oblique incident light reflection difference (OI-RD).

[0180] Figure 2 shows candidate compounds from another compound library based on compound chips and oblique incident light reflection difference (OI-RD).

[0181] Figure 3 shows the interaction between desonide and SYVN1 detected by microthermophoresis (MST) experiment.

[0182] Figure 4 shows the interaction between desonide analogues and SYVN1 detected by micro-thermophoresis (MST) experiment.

[0183] Figure 5 shows the interaction between SYVN1 and desonide and its analogues detected by isothermal titration calorimetry (ITC).

[0184] (A) The interaction between SYVN1 and desinede was detected using the ITC experiment. Desinede can interact with SYVN1.

[0185] (B) The interaction between SYVN1 and its analogue prednisolone was detected using the ITC experiment. Prednisolone did not interact with SYVN1.

[0186] (C) The interaction between SYVN1 and deisobutylcyclosonemid was detected by ITC experiments. Deisobutylcyclosonemid interacts with SYVN1.

[0187] (D) The interaction between SYVN1 and budesonide was detected using the ITC experiment. Budesonide can interact with SYVN1.

[0188] Figure 6 shows that desonide can function as a molecular glue between mHTT and SYVN1.

[0189] (A) HTRF measurement of changes in desonide-induced mHTT levels in HEK293T cells after knockdown of indicated E3 ligases or deubiquitinases.

[0190] (B) Representative protein blotting and quantification showed that desonide-induced mHTT reduction was blocked by Syvn1 knockdown.

[0191] (C) Representative IP western results showed that treatment with desonide (3 μM) for 2 hours in transiently transfected HEK293T cells enhanced mHTT-SYVN1 interaction.

[0192] (D) Representative IP western blot results showed that the enhanced mHTT poly-Ub was eliminated by SYVN1 knockdown and desonide (3 μM) treatment for 24 h. Experiments were performed in transiently transfected cells treated with the proteasome inhibitor HEK293Tmycin (100 nM).

[0193] Figure 7 shows that the reduction in PD-L1 protein levels is independent of KEAP1.

[0194] Figure 8 shows that ERADECs significantly reduced PD-L1 levels in the sub-nM to nM concentration range.

[0195] A. Representative protein blots: Cell samples treated with a specified concentration of PB-2b for 48 hours. PB-2b significantly reduced PD-L1 levels in the sub-nanomolar to nanomolar concentration range. Samples loaded into each lane were from different culture wells.

[0196] B. Representative protein blots: Cell samples treated with a specified concentration of P3 for 48 hours were used. P3 significantly reduced PD-L1 levels in the sub-nanomolar to nanomolar concentration range. Samples loaded into each lane were from different culture wells.

[0197] C. Representative protein blots: Cell samples treated with a specified concentration of PB-3a for 48 hours were used. PB-3a significantly reduced PD-L1 levels in the sub-nanomolar to nanomolar concentration range. Samples loaded into each lane were from different culture wells.

[0198] D. Representative protein blots: Cell samples treated with a specified concentration of P7 for 48 hours. P7 significantly reduces PD-L1 levels in the sub-nanomolar to nanomolar concentration range. Samples loaded into each lane were from different culture wells.

[0199] E. ERADEDS compounds affect the DC activity of PD-L1. 50 And the Dmax data table.

[0200] Figure 9 shows the targeted degradation of PD-L1 by ERADEC molecules P12 and P13 in A375 cell assays.

[0201] Figure 10 shows the targeted degradation of PD-L1 by ERADEC molecules P12 and P13 in MDA-MB-231 cell assays.

[0202] Figure 11 shows the dependence of SYVN1 and ERAD in SYVN1 knockdown / knockout cell lines.

[0203] The PD-L1 reduction effect of A.ERADEC P3 treatment was present in MDA-MB-231 cells, but not in SYVN1 knockdown cells.

[0204] The PD-L1 reduction effect of B.ERADEC PB1b treatment was present in parental U-251MG cells, but not in SYVN1 knockout cells.

[0205] Figure 12 shows that the control compound failed to induce PD-L1 degradation.

[0206] A. Control compounds with the PD-L1 ligand removed (P2-ΔT) or the SYVN1 ligand removed (P2-ΔS) failed to induce PD-L1 degradation.

[0207] B. The control compound P10, which does not bind to SYVN1, failed to induce PD-L1 degradation.

[0208] Figure 13 shows the specific dependence of ERADECs compounds on ERAD.

[0209] A. Representative Western blot and quantitative analysis of MDA-MB-231 cells treated with the specified compounds for 48 hours. P2: 500 nM, MG132: 1 μM, chloroquine (CQ): 20 μM. Proteasome inhibitors blocked the P2-induced decrease in PD-L1 levels, while autophagy inhibitors did not.

[0210] B. MDA-MB-231 cells were transfected with VCP / p97 small interfering RNA (VCP_si) or non-targeted small interfering RNA (Neg_si) for 48 hours, followed by treatment with 500 nM PB-1b or dimethyl sulfoxide as a control for 48 hours. Knockdown of VCP / p97 significantly eliminated P8-induced PD-L1 degradation.

[0211] C. Similar to (B), but using the VCP inhibitor CB5083 (200 nM).

[0212] Figure 14 shows that ERADECs represented by compounds PB1b, PB2b, PB1a, and PB3a can bind to SYVN1.

[0213] Figure 15 shows that ERADECs represented by compounds P7, PB2b, and PB3a can bind to SYVN1.

[0214] Figure 16 shows that proteomics analysis revealed that global ERAD activity was not significantly affected.

[0215] Figure 17 shows the inhibition of mouse solid tumors by ERADEC molecules targeting PD-L1.

[0216] A. Female NOG mice (NOD.Cg-Prkdc scid Il2rg tm1Sug / JicCrl) In vivo experimental diagram. Five million A375 cells were subcutaneously (sc) injected into the right groin of mice. Three days after transplantation, these mice were intravenously (iv) injected with human peripheral blood mononuclear cells (pBMCs). When the tumor volume reached approximately 200 mm... 3 Start administering medication on day 0 (set as day 0).

[0217] B. Pharmacokinetic results of intravenous injection of P8 and P9 in ICR mice (Cancer Institute mice). The bar chart represents the mean ± standard error (SEM).

[0218] C. In NOG mice, the tumor suppressive efficacy of BMS-202, atezolizumab (a clinically used PD-L1 antibody), P2, P8, and P9 was evaluated by intravenous (iv) administration (at a dose of 2.5 mg / kg (mpk) or 5 mg / kg every two days).

[0219] D. Similar to (C), but the test indicator is body weight.

[0220] Typical solid tumor images and weights from different treatment groups on day 23 after E.A375 cell injection. The tumor weight in most ERADECs-treated groups was significantly lower than that in the atezolizumab or BMS-202-treated groups.

[0221] F. Representative Western blots and quantitative analysis of PD-L1 levels in tumor tissues.

[0222] On day 23 after G.A375 cell injection, CD3 levels in dissociated solid tumor tissue were analyzed. + Flow cytometry analysis of T cells confirmed that P-ERADECs can increase T cell infiltration.

[0223] H. Similar to (F), but transplanted using MDA-MB-231 cells and with a specified higher dose of P-ERADECs.

[0224] In all in vivo experiments, n represents the number of mice. All bar charts represent the mean ± standard error; (C) used two-way ANOVA with multiple comparison tests, and (EH) used one-way ANOVA with multiple comparison tests. ns: P>0.05, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0225] Figure 18 shows that ERADECs enhanced the infiltration of T cells in tumors in vivo.

[0226] Figure 19 shows the tumor inhibition of ERADEC molecules P9 and P13 in in vivo solid tumor assays.

[0227] A. Changes in tumor volume;

[0228] B. Changes in mouse body weight;

[0229] C. Optical photographs of the tumor.

[0230] Figure 20 shows the inhibition of PD-L1 protein expression in tumors by ERADEC molecules P9 and P13 in an in vivo solid tumor assay.

[0231] Figure 21 shows that ERADEC molecules failed to inhibit tumors in SYVN1 knockout mice in vivo.

[0232] A. Changes in tumor volume;

[0233] B. Changes in mouse body weight;

[0234] C. Changes in tumor weight.

[0235] Figure 22 shows that ERADEC molecules failed to inhibit PD-L1 protein expression in tumors in SYVN1 knockout mice in vivo.

[0236] Figure 23 shows the E1-targeted degradation of EGFR by the ERADEC molecule.

[0237] A. Compound design diagram and two-dimensional structure of ERADEC E1 targeting EGFR (left), and representative surface plasmon resonance (SPR) detection results (middle and right), confirming its binding interaction with SYVN1.

[0238] B. Representative protein blots (from three independent experiments) and quantitative analysis using NCI-H1975 cells treated with a specified concentration of E1 for 24 hours showed decreased EGFR expression.

[0239] C. Similar to (C), but using cells transfected with non-targeted small interfering RNA (Neg_si) or SYVN1 small interfering RNA (SYVN1_si) for 48 hours, followed by treatment with the specified compound for 24 hours. SYVN1 knockdown blocked EGFR degradation.

[0240] D. Similar to (D), but using cells treated with a combination of CB5083 (200 nM) and E1 (200 nM). VCP inhibitors can block EGFR degradation.

[0241] E. Similar to (L), but using VCP / p97 small interfering RNA (VCP_si). The E1 concentration was 200 nM. VCP knockdown blocked EGFR degradation.

[0242] Figure 24 shows the targeted degradation of MIF by ERADEC molecule A1.

[0243] Figure 25 shows the targeted degradation of BTK by BD1 in the ERADEC molecule.

[0244] Figure 26 shows the targeted degradation of BRD4 by ERADEC molecules with 6CA.

[0245] Figure 27 shows the homogeneous time-resolved fluorescence (HTRF) detection of the formation of the PD-L1-P-ERADEC-SYVN1 ternary complex using P7, recombinant purified PD-L1-GST, and SYVN1-His.

[0246] Figure 28 shows that P-ERADECs may interact with Y227 of SYVN1 to induce targeted degradation.

[0247] Figure 29 shows the structural prediction of the SYVN1-desonide complex using AutoDock Vina.

[0248] Figure 30 shows the results of visualizing the structural prediction model using PyMOL.

[0249] Figure 31 shows the experimental confirmation of the SYVN1 binding site. Detailed Implementation

[0250] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0251] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0252] Terminology Explanation

[0253] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0254] The bromodomain and extraterminal domain (Bet) family of chromatin-binding proteins is an epigenetic regulatory protein that regulates gene expression and participates in tumorigenesis.

[0255] Bromodomain protein 4 (BRD4): As a member of the Bet family, it has multiple structural patterns, including two short mutant Brd4-S (containing 722 and 796 residues respectively) and one long mutant Brd4-L, with Brd4-L being the most prevalent in humans. Each domain of BRD4 can bind to many transcriptional regulators, thereby controlling processes such as cell proliferation, chromatin assembly and reorganization, inflammatory responses, and oxidative stress. BRD4 is widely expressed in humans, especially in mid-pregnancy embryos, testes, ovaries, and the brain, where expression levels are high. It is also highly expressed in many cancer cells and fibrotic cells.

[0256] Nicotinamide phosphoribosyltransferase (NAMPT), also known as pre-B cell colony-enhancing factor (PBEF) or visceral adipose tissue, is a protein with diverse biological effects. In the body, NAMPT exists in both intracellular and extracellular forms. Intracellular NAMPT is the rate-limiting enzyme in the mammalian nicotinamide adenine dinucleotide (NMN) salvage pathway, catalyzing the conversion of nicotinamide to nicotinamide mononucleotide (NMN). NMN is further converted to NAD under the catalysis of nicotinamide mononucleotide adenylate transferase. NAD is an important coenzyme in cellular redox reactions, playing a crucial role in various cellular physiological processes. Through NAD synthesis, NAMPT participates in cellular material and energy metabolism, DNA repair, and protein modification. Extracellular NAMPT acts as a growth factor and pro-inflammatory cytokine, participating in immune metabolism and various inflammatory responses.

[0257] Cyclin-dependent kinase 2 (CDK2) is a highly conserved subtype of cyclin-dependent protein kinases. In eukaryotic cells, CDK2 is mainly distributed in the cytoplasm, centrosome, nucleus, Golgi apparatus, cytoplasmic membrane, and endosomes. CDK2 is located on chromosome 12 (12q13), consists of 298 amino acids, and its full-length cDNA is approximately 897 bases long with a relative molecular weight of 33 kDa.

[0258] Bruton's tyrosine kinase (BTK) belongs to the TEC kinase family and is one of the non-receptor tyrosine kinases found in the cytoplasm. It is expressed in all hematopoietic cells except T cells, terminally differentiated plasma cells, and natural killer cells. It is widely involved in B cell activation, proliferation, and survival; it also participates in Fcγ receptor (FcγR) signaling pathways, cytokine signaling, and chemokine signaling, making it a key kinase for B cell and immune regulation.

[0259] Programmed death receptor ligand 1 (PD-L1): PD-1 is a type I transmembrane protein composed of 288 amino acids, including extracellular IgV and IgC regions, a transmembrane region, and an intramembrane region. It is mainly expressed by various immune cells, including B cells, T cells, natural killer cells, dendritic cells, and tumor-infiltrating lymphocytes. PD-L1, as an endogenous ligand of PD-1, is also a type I transmembrane protein, including an extracellular IgV region, a transmembrane region, and an intramembrane region that bind to PD-1. It is frequently expressed in various tumor cells, such as melanoma, colon cancer, lung cancer, pancreatic cancer, and ovarian cancer. Under normal physiological conditions, the main function of the PD-1 / PD-L1 pathway is to regulate the intensity of the immune response to an appropriate level, enabling the body to successfully complete the immune response while avoiding harmful effects. However, in the tumor microenvironment, PD-L1 on the surface of tumor cells interacts with PD-1 on the surface of T cells, leading to a decrease in effector T cell function, suppression of the anti-tumor immune response, and thus allowing tumor growth. Blocking the binding of PD-1 and PD-L1 can restore T cell activity and enhance the body's ability to kill tumors.

[0260] Epidermal growth factor receptor (EGFR): The epidermal growth factor receptor family is one of the most representative and thoroughly studied molecules among receptor-type tyrosine kinases. Currently, four structurally and functionally similar members of the human epidermal growth factor receptor family are known: EGFR (HER-1), ErbB2 (HER-2), ErbB3 (HER-3), and ErbB4 (HER-4). EGFR is one of the best-understood receptors in the epidermal growth factor receptor family, and changes in the EGFR signaling pathway can lead to malignant transformation of cells. Many mechanisms lead to malignant transformation due to EGFR dysregulation, including receptor overexpression, activating mutations, alterations in dimer formation, activation of the autocrine growth factor regeneration cycle, and deficiency of specific phosphorylases. Among these, gene overexpression is the most common EGFR dysregulation mechanism leading to tumor development and progression.

[0261] Macrophage migration inhibitory factor (MIF) is an evolutionarily conserved low molecular weight protein (12.5 kDa) composed of 114 amino acid residues. It is a ligand for four membrane receptors: CD74, chemokine receptor 2 (CXCR2), CXCR4, and CXCR7. Initially described as an activated T-cell-derived cytokine that inhibits macrophage migration and promotes macrophage aggregation in the disease progression of delayed-type hypersensitivity reactions, MIF can be released by many types of immune cells in the body, including monocytes, macrophages, neutrophils, T lymphocytes, B lymphocytes, mast cells, dendritic cells, basophils, and eosinophils. In addition, certain endocrine cells, endothelial cells, and epithelial cells can also secrete it upon inflammatory stimulation or injury.

[0262] Orphan G protein-coupled receptors (GPR52): GPCRs are membrane proteins with seven transmembrane helical domains. There are over 800 members in the human genome, and the fine structures of more than 60 GPCRs have been reported, significantly advancing rational drug design and development based on molecular structure. Orphan receptors are named for their undiscovered endogenous ligands (i.e., natural signaling molecules in the body). More than 100 have been discovered, but none have had their known molecular structures reported. GPR52 is a typical orphan GPCR, primarily expressed in the brain and playing important physiological roles. It is considered a potential target for treating various mental illnesses, including Huntington's disease, schizophrenia, cognitive impairment, brain malformations, and ADHD.

[0263] Endoplasmic reticulum-associated degradation (ERAD): ERAD is the main pathway for clearing misfolded proteins from the endoplasmic reticulum (ER), and it is divided into the following subtypes: 1. Membrane protein degradation: Misfolded membrane proteins are retrogradely transported to the cytoplasm via transport complexes on the ER membrane, ubiquitinated, and then degraded by the proteasome. 2. Intracellular protein degradation: Misfolded proteins in the ER lumen are released into the cytoplasm through transport channels on the ER membrane, ubiquitinated, and then degraded by the proteasome.

[0264] Endoplasmic reticulum-associated degradation conjugation chimeras (ERADECs): ERADECs are bifunctional molecular tools that specifically bind to target proteins through the chimeric design of target protein ligands and endoplasmic reticulum E3 ubiquitin ligase ligands. They recruit core ubiquitin ligases of the ERAD pathway (such as SYVN1), triggering ubiquitination of the target protein, which is then retrogradely transported to the cytoplasm and degraded by the proteasome.

[0265] Hijacking ERAD: refers to the process of using artificially designed molecules (such as ERADECs) to specifically label and remove designated pathogenic proteins through the cell's inherent endoplasmic reticulum-associated degradation (ERAD) pathway.

[0266] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0267] As used herein, the terms “containing” or “including (comprise)” can be open-ended, semi-closed, or closed. In other words, the terms also include “consistently made of” or “composed of”.

[0268] As used herein, the term “room temperature” or “normal temperature” refers to a temperature of 4–40°C, preferably 25 ± 5°C.

[0269] In this invention, the halogen is F, Cl, Br or I.

[0270] In this invention, unless otherwise specified, the terms used have the general meanings known to those skilled in the art.

[0271] In this invention, the terms "C1-C6" refer to having 1, 2, 3, 4, 5, or 6 carbon atoms, "C1-C4" refers to having 1, 2, 3, or 4 carbon atoms, and so on. Similarly, "3-10" refers to having 3, 4, 5, 6, 7, 8, 9, or 10 ring atoms, and so on.

[0272] In this invention, the term "alkyl" refers to a saturated linear or branched hydrocarbon group, wherein the alkyl group used herein, or as part of other groups, has 1 to 12 carbon atoms (i.e., C1-C12 alkyl), 1 to 9 carbon atoms (i.e., C1-C9 alkyl), 1 to 6 carbon atoms (i.e., C1-C6 alkyl), 1 to 4 carbon atoms (i.e., C1-C4 alkyl), or 1 to 3 carbon atoms (i.e., C1-C3 alkyl). Non-limitingly included are methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, and hexyl; preferably ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl.

[0273] In this invention, the term "alkenyl" refers to a straight-chain or branched hydrocarbon group containing at least one (e.g., 1, 2, or 3) double bonds, for example, the term "C2-C 12 "Alkenyl" refers to a straight-chain or branched alkenyl group having 2 to 12 carbon atoms (including 2-6 carbon atoms or 2-4 carbon atoms) and containing one or two double bonds, including vinyl, propenyl, butenyl, isobutenyl, pentenyl and hexenyl, etc.

[0274] In this invention, the term "alkynyl" refers to a straight-chain or branched alkynyl group containing one (e.g., 1, 2, or 3) triple bond, for example, the term "C2-C". 12 "Alynyl" refers to a straight-chain or branched alkynyl group with 2 to 12 carbon atoms (including 2-6 carbon atoms or 2-4 carbon atoms) containing one or two triple bonds. It includes, without limitation, ethynyl, propynyl, butynyl, isobutynyl, pentyynyl (2-methyl-3-butynyl, 2-pentynyl, 3-pentynyl) and hexynyl, etc.

[0275] Divalent groups such as "alkylene", "alkenylene", and "alkynylene" refer to divalent groups formed by the loss of one H atom from alkyl, alkenyl, or alkynyl groups. The alkyl, alkenyl, or alkynyl groups defined above in this article can be used for alkylene, alkenylene, and alkynylene, respectively.

[0276] In this invention, the term "cycloalkyl" refers to a saturated monocyclic, bridged, or spirocyclic cyclic hydrocarbon moiety. For example, the term "C3-C8 cycloalkyl" refers to a monocyclic, bridged, or spirocyclic cyclic alkyl group having 3 to 8 carbon atoms on the ring. Similarly, the term "C3-C6 cycloalkyl" refers to a monocyclic, bridged, or spirocyclic cyclic alkyl group (preferably monocyclic) having 3 to 8 carbon atoms on the ring. Non-limitingly, it includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and cyclodecyl, etc. The term "bridged cycloalkyl" non-limitingly includes bicyclo[1,1,1]pentyl, bicyclo[2,1,1]hexyl, bicyclo[2,2,1]heptyl, bicyclo[2,2,2]octyl, bicyclo[3,2,2]octyl, etc.

[0277] In this invention, the term "aryl" refers to a hydrocarbon moiety comprising one or more aromatic rings. For example, the term "C6-C..." 10 "Aryl" refers to an aromatic cyclic group with 6 to 10 carbon atoms that does not contain heteroatoms on the ring, such as phenyl and naphthyl.

[0278] In this invention, the term "aryl" refers to a divalent group formed by the loss of a hydrogen atom from an aryl group as defined above.

[0279] In this invention, the term "heterocyclic alkyl" refers to a saturated or unsaturated, non-aromatic (e.g., containing one or two double bonds) cyclic group comprising at least one (e.g., 1, 2, 3, or 4) cyclic heteroatoms (e.g., N, O, or S). Heterocyclic alkyl groups may have 3 to 10 cyclic atoms (i.e., 3 to 10-membered heterocyclic groups), preferably, the heterocyclic group may have 3 to 6 (e.g., 3, 4, 5, or 6) cyclic atoms (i.e., 3 to 6-membered heterocyclic groups). Examples of heterocyclic groups include, for example, tetrahydropyridyl, pyrrolinyl, dihydropyridyl, dihydrofuranyl, dihydrothiophenyl, morpholinyl, piperazineyl, and piperidinyl.

[0280] In this invention, the term "heterocyclic alkyl" refers to a divalent group formed by the loss of a hydrogen atom by a heterocyclic alkyl group as defined above.

[0281] In this invention, the term "heteroaryl" refers to an aromatic cyclic group comprising at least one (e.g., 1, 2, 3, or 4) cyclic heteroatoms (e.g., N, O, or S). Heteroaryl groups may have 5 to 10 cyclic atoms (i.e., 5 to 10-membered heteroaryl groups), preferably, the heterocyclic group may have 5 or 6 cyclic atoms (i.e., 5 to 6-membered heteroaryl groups). Examples of heteroaryl groups include, for example, furanyl, pyrroleyl, thiopheneyl, oxazolyl, imidazolyl, thiazolyl, pyridinyl, quinolinyl, isoquinolinyl, indolyl, pyrimidinyl, pyranyl, and triazolyl (e.g., 1,2,3-triazolyl or 1,2,4-triazolyl).

[0282] In this invention, the term "hybrid aryl" refers to a divalent group formed by the loss of a hydrogen atom by a heteroaryl group as defined above.

[0283] The term "multiple" can refer to 2, 3, 4, 5, or 6.

[0284] In this invention, the term "substituted or unsubstituted" means that the group is unsubstituted or substituted by one or more (e.g., 1, 2, 3, and 4) substituents. Unless otherwise defined herein, the substituents may be selected from the group consisting of: -halogens, -OR a -OC(O)R a -NR a R b -SR a -R a -CN, -NO2, -CO2Ra -CONR a R b -C(O)R a -OC(O)NR a R b -NR b C(O)R a -NR b C(O)2R a -NR a -C(O)NR b R c -NH-C(NH2)=NH, -NR a C(NH2)=NH、-NH-C(NH2)=NR a -S(O)R a -S(O)2R a -S(O)2NR a R b -NR a S(O)2R b -N3; where R a R b and R c Independently selected from: hydrogen, deuterium, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Hydroxyalkyl, C 1-6 Deuterated alkyl, C 1-6 aminoalkyl, C 3-6 cycloalkyl, C 2-4 alkenyl, C 2-4 Alkynyl, unsubstituted aryl and heteroaryl, unsubstituted -C 1-4 alkylene-aryl or heteroaryl and unsubstituted -C 1-4 Alkylene-aryloxy compounds, etc.

[0285] The protein degradation complex of the present invention

[0286] As used herein, the term "protein degradation complex of the present invention" refers to the protein degradation complex described in the first aspect of the present invention, as shown in Table 1 below. This term also includes various crystalline forms of the compound, pharmaceutically acceptable salts, hydrates, or solvates.

[0287] In this invention, "A", "SYVN1 binding portion", and "SBM" are used interchangeably and refer to the portion of the protein degradation complex used to bind to SYVN1, which is composed of fragments of compounds capable of binding to SYVN1. The SBM can effectively bind to SYVN1, interact with the main ER-E3 SYVN1, and perform targeted degradation by hijacking ERAD.

[0288] In this invention, “B”, “target protein ligand”, “TBM”, and “target protein binding portion” are used interchangeably and refer to the portion of the protein degradation complex used to bind to the target protein, which is composed of fragments of compounds capable of binding to the target protein.

[0289] In this invention, "target protein" refers to the protein targeted by TBM in the protein degradation complex, which may include various pathogenic targets.

[0290] Salts that may form from the compounds of this invention are also within the scope of this invention. Unless otherwise stated, compounds of this invention are understood to include their salts. The term "salt" as used herein refers to a salt that forms an acidic or basic form with an inorganic or organic acid and a base. Furthermore, when a compound of this invention contains a basic segment, it includes, but is not limited to, pyridine or imidazole; when it contains an acidic segment, it includes, but is not limited to, carboxylic acids; and any zwitterions ("internal salts") that may form are included within the scope of the term "salt." Pharmaceutically acceptable (i.e., non-toxic and physiologically acceptable) salts are preferred, although other salts are also useful, for example, for separation or purification steps in the preparation process. The compounds of this invention may form salts, for example, by reacting the compound with a certain amount, such as an equimolar amount, of an acid or base, precipitating it in a medium, or by freeze-drying it in an aqueous solution.

[0291] Some compounds in this invention may contain basic fragments, including but not limited to amines, pyridines, or triazole rings, which may form salts with organic or inorganic acids. Typical acids that can form salts include acetates (such as acetic acid or trihaloacetic acids, such as trifluoroacetic acid), adipates, alginates, ascorbic acid salts, aspartate salts, benzoates, benzenesulfonates, hydrogen sulfates, borates, butyrates, citrates, camphor salts, camphor sulfonates, cyclopentanepropionate, diethylene glycol salts, dodecyl sulfates, ethanesulfonates, fumarates, glucono-2-phosphates, glycerol phosphates, hemisulfates, heptarates, hexanoates, hydrochlorides, hydrobromide, and hydroiodide. Salts, hydroxyethanesulfonates (e.g., 2-hydroxyethanesulfonate), lactates, maleates, methanesulfonates, naphthalenesulfonates (e.g., 2-naphthalenesulfonate), nicotinates, nitrates, oxalates, pectates, persulfates, phenylpropionates (e.g., 3-phenylpropionates), phosphates, picrates, neopentanoates, propionates, salicylates, succinates, sulfates (e.g., those formed with sulfuric acid), sulfonates, tartrates, thiocyanates, toluenesulfonates such as p-toluenesulfonate, dodecanoates, etc.

[0292] Some compounds of this invention may contain acidic fragments, including but not limited to carboxylic acids, which may form salts with various organic or inorganic bases. Typical base-formed salts include ammonium salts, alkali metal salts such as sodium, lithium, and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, and salts formed with organic bases (such as organic amines), such as benzathine, dicyclohexylamine, hepatoamine, N-methyl-D-glucosamine, N-methyl-D-glucosamide, tert-butylamine, and salts formed with amino acids such as arginine, lysine, etc.

[0293] In this invention, ERADECs with short rigid linkers or long polyethylene glycol (PEG) links (e.g., P6, P8, P9) failed to reduce PD-L1, suggesting that the L portion may have some influence on the activity of ERADECs.

[0294] Table 1 Exemplary compound structures

[0295] Pharmaceutical compositions and their uses

[0296] The present invention provides a pharmaceutical composition comprising the protein degradation complex of the present invention or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable carrier.

[0297] The protein degradation complex of the present invention can be used to selectively degrade ERAD by intervening with the major ER-E3 SYVN1, and thus can be used to prepare medicaments for the prevention and / or treatment of diseases related to the activity or expression level of the target protein, or diseases related to endoplasmic reticulum-associated degradation (ERAD), or diseases related to the activity or expression level of the B target protein.

[0298] The protein degradation complex of the present invention can be used in combination with other known drugs for treating or improving similar conditions. When used in combination, the administration method and dosage of the original drug can remain unchanged, while the compound of the present invention is taken simultaneously or subsequently. When the compound of the present invention is taken concurrently with one or more other drugs, a pharmaceutical composition containing one or more known drugs and the compound of the present invention is preferred. Drug combination also includes taking the compound of the present invention with one or more other known drugs during overlapping time periods. When the compound of the present invention is used in combination with one or more other drugs, the dosage of the compound of the present invention or the known drugs may be lower than the dosage of either drug alone. When used to treat cancer, the pharmaceutical composition may also contain one or more anticancer agents, for example, selected from (but not limited to): PARP1 / 2 inhibitors, chemotherapeutic agents that induce DNA damage in cancer cells, DNA alkylation agents, DNA or RNA synthesis inhibitors, EGFR, ALK, or FGFR tyrosine receptor kinase inhibitors, KRAS, MEK, or ERK tumor signaling pathway inhibitors, and tumor immunotherapy drugs (such as PD-1 antibodies, PD-L1 antibodies, etc.).

[0299] "Pharmaceutically acceptable excipients" and "pharmaceutically acceptable carriers" refer to substances that facilitate the formulation and / or administration and / or absorption of the active agent by an individual and can be included in the compositions disclosed herein without causing significant adverse toxicological effects on that individual. Non-limiting examples of pharmaceutically acceptable carriers and excipients include water, NaCl, physiological saline solutions, lactated Ringer's solution, conventional sucrose, conventional glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, salt solutions (e.g., Ringer's solution), alcohols, oils, gelatin, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethyl cellulose, polyvinylpyrrolidone, and pigments. Such formulations can be sterilized and, if desired, mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts affecting osmotic pressure, buffers, colorants, and / or aromatic substances that will not harmfully react with or interfere with the activity of the compounds provided herein. Those skilled in the art will recognize that other pharmaceutical carriers and excipients are suitable for the disclosed compounds.

[0300] In some embodiments, the pharmaceutical compositions of the present invention may be in solid or liquid form.

[0301] The pharmaceutical product containing the active ingredient of this invention can be a suitable oral dosage form, such as tablets, pills, lozenges, water-soluble or oily suspensions, dispersed latex powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Orally administered pharmaceutical products can be prepared according to known process methods of the pharmaceutical ingredient manufacturer. These compositions may include one or more of the following agents: sweeteners, flavoring agents, coloring agents, and protective agents, to provide an elegant and palatable pharmaceutical formulation. The tablet contains the active ingredient mixed with non-toxic, pharmaceutically acceptable excipients suitable for tablet production. Examples of such excipients include inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate, or sodium phosphate; granulating agents, disintegrants such as corn starch or alginic acid; binding agents such as starch, gelatin, or gum arabic; and lubricants such as magnesium stearate, stearic acid, or talc. The tablet may be uncoated or coated to delay degradation and absorption in the gastrointestinal tract, thereby maintaining its activity over a longer period.

[0302] The active compound may be administered to a subject via any suitable route, including orally, parenterally, by inhalation spray, locally, rectally, nasally, sublingually, vaginally, or via an implantable cartridge. As used herein, the term "parenterally" includes subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrasheathic, intrahepatic, intralesional, and intracranial injection or infusion techniques. Preferably, the composition is administered orally, intraperitoneally, or intravenously.

[0303] Pharmaceutical compositions suitable for use in this invention are typically in the form of discrete units in solid form, such as tablets, capsules, pouches, powders, granules, lozenges, patches, suppositories, pills, or in liquid form, such as liquid formulations, injectable or infusionable solutions or suspensions.

[0304] The precise amount of compound provided to an individual for therapeutic efficacy will depend on the route of administration, the type and severity of the disease and / or condition, and individual characteristics such as general health, age, sex, weight, and tolerance to the drug. Those skilled in the art will be able to determine the appropriate dosage based on these and other factors. When administered in combination with other therapeutic agents, the “therapeutic efficacy” of any other therapeutic agent will depend on the type of drug used. Appropriate dosages are known for approved therapeutic agents and can be adjusted by those skilled in the art based on the individual’s condition, the type of condition being treated, and the amount of the compound of the invention used below. Preferably, the compositions should be formulated such that an inhibitory dose of 0.01-100 mg / kg body weight / day can be administered to patients receiving these compositions. In some embodiments, the compositions of the invention provide doses from 0.01 mg to 50 mg. In other embodiments, doses of 0.1 mg-25 mg or 5 mg-40 mg are provided.

[0305] Examples of subjects to which the pharmaceutical compositions or therapeutic agents of the present invention are administered include mammals (e.g., humans, mice, rats, hamsters, rabbits, cats, dogs, cattle, sheep, monkeys, etc.).

[0306] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0307] Example 1: Preparation of the compound

[0308] 1.1 6CA: 2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6(2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thiophene[3,2-f][1,2,4]trizolor[4,3-a][4,3-a][1,4]diaza-6-yl]acetamido)hexanoate

[0309] Reaction route:

[0310] 1.1.1 Preparation of intermediate 3,2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6-(2-((tert-butoxycarbonyl)aminohexanoate)

[0311] 6-((tert-Butoxycarbonyl)aminohexanoic acid (115 mg, 0.5 mmol) and desonide (208 mg, 0.5 mmol) were dissolved in acetone (10 mL). 3-(((ethylimino)methylene)amino-N,N-dimethylpropyl-1-amine hydrochloride (115 mg, 0.6 mmol) and 4-dimethylaminopyridine (18 mg, 0.15 mmol) were added sequentially to the reaction mixture. The reaction mixture was stirred overnight at room temperature. The reaction was quenched with water, extracted with ethyl acetate (20 mL x 2), washed with saturated brine, and the extract was colorless. The organic phase was dried over sodium sulfate and then evaporated to dryness. The residue was purified by column chromatography to give 2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol [2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6-(2-((tert-butoxycarbonyl)aminohexanoate) (180 mg, yield 57%). LCMS: MS m / z (ESI): 529.8 [M-100+H] + .

[0312] 1.1.2 Preparation of intermediate 4,2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6-aminohexanoate

[0313] 2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6-(2-((tert-butoxycarbonyl)aminohexanoate) (180 mg, 0.29 mmol) was dissolved in dichloromethane (5 mL), and trifluoroacetic acid (1 mL) was added under ice bath conditions. The reaction solution was stirred under ice bath conditions for 1 hour. The reaction solution was concentrated, and the residue was treated with... Dissolved in dichloromethane, the solution was adjusted to pH 7 with saturated sodium bicarbonate solution, extracted with dichloromethane (20 mL * 2), washed with saturated brine, dried over anhydrous sodium sulfate, and the organic phase was concentrated to give 2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol [2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6-aminohexanoate (150 mg, yield 98%). LCMS: MS m / z (ESI): 530.2 [M+H]+.

[0314] 1.1.3 Preparation of 2-((6Ar,7S,8aS,8Bs,11Ar)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6(2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thiophene[3,2-f][1,2,4]triazolol[4,3-a][4,3-a][1,4]diaza-6-yl]acetamido)hexanoate

[0315] 2-((6aR,7S,8aS,8bS,11aR)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol [2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6-aminohexanoate (30 mg, 0.057 mmol) and 5(S)-2-(4-(-chlorophenyl) 2,3,9-Trimethyl-6H-thiophene[3,2-f][1,2,4]triazolol[4,3-a][1,4]diaza-6-yl)acetic acid (23 mg, 0.057 mmol) was dissolved in N,N-dimethylformamide (2 mL), and N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)hexafluorophosphate urea (32 mg, 0.086 mmol) and triethylamine (17 mg, 0.17 mmol) were added. The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was purified by prep-HPLC to give 2-((6Ar,7S,8aS,8Bs,11Ar)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-oxoethyl 6(2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thiophene[3,2-f][1,2,4]triazolol[4,3-a][4,3-a][1,4]diaza-6-yl]acetamido)hexanoate as a white solid (16 mg, yield 27%). m / z (ESI): 912.5 [M+H] + . 1H NMR (400MHz, DMSO-d6) δ8.18(t,J=5.5Hz,1H),7.49(d,J=8.7Hz,2H),7.42(d,J=8.6Hz,2H),7.32(d,J=10.0Hz, 1H),6.17(dd,J=10.1,1.8Hz,1H),5.92(s,1H),5.14(d,J=17.9Hz,1H),4.83(dd,J=9.1,3.7Hz,2H),4.71(d,J=1 7.9Hz,1H),4.54–4.46(m,1H),4.31(s,1H),3.30–3.02(m,4H),2.59(s,3H),2.44–2.24(m,6H),2.13-1.95(d,m, 2H),1.79(s,2H),1.69–1.42(m,11H),1.37(d,J=10.8Hz,8H),1.12(s,3H),1.01(t,J=11.6Hz,2H),0.82(s,3H).

[0316] 1.2 8CA: 2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol[2',1':4,5]indo[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-(2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6-hydro-thiophene[3,2-f][1,2,4]triazolol[4,3-a][1,4]diazaphen-6-yl)acetamido)octanoate

[0317] Reaction route:

[0318] 1.2.1 Preparation of intermediate 3,2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-((tert-butoxycarbonyl)amino)octanoate

[0319] At room temperature, 8-((tert-butyloxycarbonyl)amino)octanoic acid (100 mg, 0.386 mmol), desonide (160 mg, 0.385 mmol), and acetone (10 mL) were added to a 50 mL single-necked round-bottom flask. Then, 3-(((ethylimino)methylene)amino-N,N-dimethylpropyl-1-amine hydrochloride (115 mg, 0.6 mmol) and 4-dimethylaminopyridine (18 mg, 0.15 mmol) were added sequentially to the reaction mixture, and the reaction mixture was stirred overnight at room temperature. The reaction was quenched with water, extracted with ethyl acetate (10 mL * 2), the organic phase was washed with saturated brine, dried over anhydrous sodium sulfate, and the residue obtained by rotary evaporation was purified by prep-HPLC to obtain 2. -((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-((tert-butoxycarbonyl)amino)octanoate (250 mg, 98% yield). LCMS: MS m / z (ESI): 657.8 [M+H]+.

[0320] 1.2.2 Preparation of intermediate 4,2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-aminooctanoate

[0321] Add 2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanohydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-((tert-butoxycarbonyl)amino)octanoate (250 mg, 0.38 mmol) and dichloromethane (5 mL) to a 50 mL single-necked round-bottom flask, then add trifluoroacetic acid (1.5 mL) under ice bath cooling. Stir the reaction mixture under ice bath conditions for 2 hours. The reaction solution was concentrated, and the residue was dissolved in dichloromethane. Saturated sodium bicarbonate solution was added to pH 7, and the mixture was extracted with dichloromethane (20 mL * 2). The solution was washed with saturated brine and dried over anhydrous sodium sulfate. The organic phase was concentrated to give 2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol [2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-aminooctanoate (200 mg, yield 67.8%). LCMS: MS m / z (ESI): 557.9 [M+H]+.

[0322] 1.2.3 Preparation of 2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-(2-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6-hydro-thiophene[3,2-f][1,2,4]triazolol[4,3-a][1,4]diazaphen-6-yl)acetamido)octanoic acid ester

[0323] At room temperature, 2-((6aR,7S,8aS,8bS,11aR,12aS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecanehydro-8bH-naphthol[2',1':4,5]indeno[1,2-d][1,3]dioxo-8b-yl)-2-ethoxy-8-aminooctanoate (20 mg, 0.05 mmol) was added to a 50 mL single-necked round-bottom flask. Chlorophenyl)-2,3,9-trimethyl-6H-thiophene[3,2-f][1,2,4]triazolol[4,3-a][1,4]diaza-6-yl)acetic acid (23 mg, 0.057 mmol) and N,N-dimethylformamide (2 mL) were added, followed by 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolol[4,5-b]pyridinium 3-oxide hexafluorophosphate (32 mg, 0.086 mmol) and triethylamine (17 mg, 0.17 mmol). The reaction mixture was stirred at room temperature for 2 h. The reaction mixture was purified by prep-HPLC to give a white solid (11 mg, yield: 21.7%). LCMS: MS m / z (ESI): 940.3 [M+H]+. 1 H NMR (500MHz, DMSO-d6) δ8.17(t,J=5.7Hz,1H),7.49-7.47(d,J=7.5Hz,2H),7.43-7.41(d,J=8Hz,2H),7.32(d,J=6Hz,1H),6 .17(dd,J=9.1,1.7Hz,1H),5.92(s,1H),5.14(d,J=5.6Hz,1H),4.83-4.81(dd,J=8.1,3.4Hz,2H),4.70(d,J=6Hz,1H),4.50- 4.48(m,1H),4.30(s,1H),3.24-3.22(m,2H),3.20-3.18(m,2H),2.59(s,3H),2.41-2.37(m,8H),2.33(m,1H),2.32(m,1H), 1.78(s,2H),1.62(s,3H),1.57-1.51(m,8H),1.43-1.42(d,J=8Hz,6H),1.12(s,4H),1.06(s,3H),1.00(m,2H),0.82(s,3H).

[0324] 1.3 Preparation of ND1:2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-4-oxo-4-((12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)amino)butyrate

[0325] 1.3.1 Preparation of 4-(2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethoxy)-4-oxobutyric acid

[0326] At room temperature, 500 mg of desonide and 141 mg of succinic anhydride were dissolved in 11 mL of tetrahydrofuran. 159 mg of 4-dimethylaminopyridine was added with stirring, and the mixture was stirred at room temperature for 5 hours. The reaction solution was concentrated, and the residue was dissolved in 150 mL of dichloromethane and washed separately with 100 mL of 1 mol / L citric acid aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to obtain 500 mg of a white solid, which was 4-(2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethoxy)-4-oxobutyric acid, in 89% yield. 1H NMR (600MHz, DMSO-d6) δ12.23(s,1H),7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.8Hz,1H),5.92(s,1H),5.1 6(d,J=17.8Hz,1H),4.84(d,J=4.6Hz,1H),4.81(d,J=3.5Hz,1H),4.73(d,J=17.8Hz,1H),4.34–4.29(m,1H),2 .65(t,J=6.7Hz,2H),2.56–2.49(m,3H),2.32–2.27(m,1H),2.09(qd,J=11.2,4.0Hz,1H),2.02–1.96(m,1H), 1.83–1.75(m,2H),1.61–1.46(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.08–0.98(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.46,185.10,173.12,171.54,170.09,156.40,127.12,121.70,110.73,97.23,81.04,68.1 8,67.11,54.84,49.34,45.53,43.65,33.76,33.42,31.18,29.92,28.58,28.32,26.28,25.34,20.80,16.43.HRMS(ESI + )m / z calcd for C 28 H 36 O9[M+H] + 517.2432; found 517.2381.

[0327] 1.3.2 Preparation of N-((4-nitrophenyl)sulfonyl)-1-(tert-butoxycarbonyl)piperazine

[0328] Under ice bath conditions, 2.2 g of p-nitrobenzenesulfonyl chloride and 2.2 g of piperazine-1-carboxylic acid tert-butyl ester were dissolved in 10 mL of dichloromethane, and 2 mL of triethylamine was slowly added dropwise with stirring. After 6 hours, the system was diluted with 300 mL of dichloromethane. The organic phase was then washed successively with water and a 1 mol / L citric acid aqueous solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated to give 3.5 g of a white solid, N-((4-nitrophenyl)sulfonyl)-1-(tert-butyloxycarbonyl)piperazine, in 94% yield. 1H NMR (600MHz, DMSO-d6) δ8.47–8.39(m,2H),8.03–7.97(m,2H),3.40(br s,4H),2.99–2.91(m,4H),1.34(s,9H).

[0329] 1.3.3 Preparation of tert-butyl 4-((4-aminophenyl)sulfonyl)piperazine-1-carboxylate

[0330] 500 mg of N-((4-nitrophenyl)sulfonyl)-1-(tert-butyloxycarbonyl)piperazine was dissolved in a mixture of 7.8 mL of ethanol and 2.6 mL of water. 226 mg of reduced iron powder and 360 mg of ammonium chloride were added with stirring at room temperature, followed by heating to 80 °C and stirring for 5 hours. After the reaction was complete, the mixture was cooled to room temperature, filtered with diatomaceous earth as an aid, the filtrate was concentrated, and then slurried with a mixture of ethanol and water (ethanol:water = 1:1, V / V) for 1 hour. The mixture was then filtered, and the filter cake was dried to give 372 mg of a white solid, tert-butyl 4-((4-aminophenyl)sulfonyl)piperazine-1-carboxylate, in 81% yield. 1 H NMR (600MHz, DMSO-d6) δ7.36–7.31(m,2H),6.67–6.61(m,2H),6.10(s,2H),3.37(br s,4H),2.76–2.71(m,4H),1.34(s,9H).

[0331] 1.3.4 Preparation of tert-butyl 4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazine-1-carboxylate

[0332] 3.5 g of tert-butyl 4-((4-aminophenyl)sulfonyl)piperazine-1-carboxylate and 2.7 g of N,N'-thiocarbonyldiimidazole were dissolved in 20 mL of dry dichloromethane and stirred at room temperature for 2 hours. Then, 1.1 g of 3-aminomethylpyridine was added and stirring continued for 5 hours. A solid precipitated in the reaction system. After filtration and drying of the filter cake, 3.0 g of a white solid was obtained as tert-butyl 4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazine-1-carboxylate, yield 60%. 1H NMR (600MHz, DMSO-d6) δ10.12(s,1H),8.61(s,1H),8.57(d,J=1.7Hz,1H),8.47(dd,J=4.8,1.7Hz,1H),7.80(d,J= 8.8Hz,2H),7.77–7.74(m,1H),7.65(d,J=8.8Hz,2H),7.37(dd,J=7.9,4.8Hz,1H),4.78(d,J=5.5Hz,2H),3.39(br s,4H),2.87–2.81(m,4H),1.34(s,9H).

[0333] 1.3.5 Preparation of 1-(4-(piperazin-1-ylsulfonyl)phenyl)-3-(pyridin-3-ylmethyl)thiourea

[0334] 2.5 g of tert-butyl 4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazine-1-carboxylate was dissolved in 10 mL of dry dichloromethane. 2 mL of trifluoroacetic acid was slowly added with stirring at room temperature. After stirring for 5 hours, the reaction mixture was poured into ice water, and the pH was adjusted to 8 with a 2 mol / L sodium hydroxide aqueous solution. Extraction was performed with dichloromethane (200 mL × 3). The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 95:5, V / V) to give 1.6 g of a white solid as 1-(4-(piperazine-1-ylsulfonyl)phenyl)-3-(pyridin-3-ylmethyl)thiourea, in 80% yield. 1 H NMR (600MHz, DMSO-d6) δ10.17(s,1H),8.65(s,1H),8.57(d,J=1.8Hz,1H),8.47(dd,J=4.7,1.8Hz,1H),7.80(d,J=8.7Hz,2H),7.76(d,J= 7.8Hz,1H),7.64(d,J=8.7Hz,2H),7.38(dd,J=7.8,4.7Hz,1H),4.79(d,J=5.0Hz,2H),3.17(s,1H),2.82–2.74(m,4H),2.74–2.69(m,4H).

[0335] 1.3.6 Preparation of tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate

[0336] 120 mg of 1-(4-(piperazin-1-ylsulfonyl)phenyl)-3-(pyridin-3-ylmethyl)thiourea and 106 mg of 12-((tert-butoxycarbonyl)amino)dodecanoic acid were dissolved in 3 mL of dichloromethane. 128 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, 103 mg of 1-hydroxybenzotriazole, and 160 μL of N,N-diisopropylethylamine were added with stirring at room temperature. After stirring for 2 hours, the reaction solution was diluted with 100 mL of dichloromethane and washed successively with water and saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to give 103 mg of white solid as tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate, yield 49%). 1 H NMR (600MHz, DMSO-d6) δ10.31(s,1H),8.73(s,1H),8.57(s,1H),8.48(d,J=4.0 Hz,1H),7.84(d,J=8.7Hz,2H),7.77(d,J=7.8Hz,1H),7.65(d,J=8.7Hz,2H),7.3 8(dd,J=7.7,4.8Hz,1H),6.73(t,J=4.9Hz,1H),4.79(d,J=5.3Hz,2H),3.51(s, 4H),2.93–2.78(m,6H),2.22(t,J=7.5Hz,2H),1.36(s,9H),1.28–1.15(m,18H). 13 C NMR (151MHz, DMSO) δ181.21,171.21,156.03,149.32,148.60,144.70,135.80,134.65,128.98,128.82,123.91,121.75,7 7.72,46.55,46.28,45.08,44.59,40.56,32.52,29.92,29.42,29.38,29.36,29.28,29.16,28.74,26.71,25.03.HRMS(ESI + )m / z calcd for C 34 H 52 N6O5S2[M+H] + 689.3513; found 689.3534.

[0337] 1.3.7 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-4-oxo-4-((12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)amino)butyrate

[0338] Dissolve 60 mg of tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate in 2 mL of dry dichloromethane. Slowly add 1 mL of trifluoroacetic acid with stirring at room temperature. After reacting for 1 hour, concentrate the reaction solution. Dissolve the residue again in 2 mL of dichloromethane. Add N,N-diisopropylethylamine dropwise until no white smoke is produced. Next, under stirring at room temperature, 44 mg of 4-(2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethoxy)-4-oxobutyric acid, 36 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, 29 mg of 1-hydroxybenzotriazole and 44 μL of N,N-diisopropylethylamine were added to the above system. After stirring for 2 hours, the reaction solution was diluted with 50 mL of dichloromethane and washed successively with water and saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to give 46 mg of a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a) ,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 4-oxo-4-((12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)amino)butyrate, yield 49%. 1H NMR(600MHz,DMSO-d6)δ10.31(s,1H),8.73(t,J=5.2Hz,1H),8.57(d,J=1.6Hz,1H),8.47(dd,J=4.7,1.4Hz,1H),7.86–7.80(m,3H),7.76(d,J=7.9Hz,1H),7.64(d,J=8.8Hz,2H),7.37(dd,J=7.8,4.8Hz,1H),7.32(d,J=10.1Hz,1H),6.16(dd,J=10.1,1.9Hz,1H),5.91(s,1H),5.13(d,J=17.8Hz,1H),4.83(d,J=4.6Hz,1H),4.81(d,J=3.7Hz,1H),4.79(d,J=5.6Hz,2H),4.70(d,J=17.9Hz,1H),4.33–4.28(m,1H),3.55–3.46(m,4H),3.05–2.94(m,2H),2.90–2.80(m,4H),2.62(t,J=7.1Hz,2H),2.55–2.51(m,1H),2.37(t,J=7.1Hz,2H),2.32–2.25(m,1H),2.22(t,J=7.5Hz,2H),2.08(qd,J=11.2,4.0Hz,1H),2.02–1.95(m,1H),1.82–1.74(m,2H),1.60–1.44(m,3H),1.42–1.32(m,10H),1.24–1.16(m,14H),1.12(s,3H),1.06–0.96(m,2H),0.81(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.51,185.10,180.71,171.76,170.71,170.13,170.09,156.40,148.81,148.09,144.20,135.32,134.16,128.47,128.32,127.10,123.42,121.68,121.25,110.70,97.22,81.01,68.16,66.96,54.85,49.33,46.05,45.78,45.51,44.59,44.10,43.64,40.06,38.51,33.75,33.40,32.02,31.16,29.90,29.81,29.07,28.95,28.92,28.81,28.75,28.69,26.36,26.27,25.34,24.54,20.77,16.42.HRMS(ESI+ )m / z calcd for C 57 H 78 N6O 11 S2[M+H] + 1087.5243; found 1087.5286.

[0339] 1.4 Preparation of ND2: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1,17-dioxo-1-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-4,7,10,13-tetraoxa-16-azaeicosane-20-ester)

[0340] 1.4.1 Preparation of tert-butyl (15-oxo-15-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-3,6,9,12-tetraoxapentadecanyl)carbamate

[0341] Replacing 12-((tert-butoxycarbonyl)amino)dodecanoic acid with 5,8,11,14-tetraoxa-2-azaheptadecanoic acid 1-tert-butyl ester, and using the same raw materials, reagents, and preparation method as in 1.3.6, yielded a white solid, (15-oxo-15-(4-((4-(3-(pyridin-3-ylmethyl)thioureo)phenyl)sulfonyl)piperazin-1-yl)-3,6,9,12-tetraoxapentadecanyl)carbamate tert-butyl ester, with a yield of 68%. 1H NMR (600MHz, DMSO-d6) δ10.20(s,1H),8.66(t,J=5.3Hz,1H),8.57(d,J=1.9Hz,1H),8.48(dd,J =4.8,1.5Hz,1H),7.82(d,J=8.8Hz,2H),7.79–7.76(m,1H),7.66(d,J=8.8Hz,2H),7.39(dd,J=7 .8,4.8Hz,1H),6.72(t,J=5.4Hz,1H),4.79(d,J=5.6Hz,2H),3.57–3.44(m,14H),3.42(s,4H),3 .37(t,J=6.1Hz,2H),3.06(q,J=6.0Hz,2H),2.92–2.83(m,4H),2.52–2.49(m,2H),1.37(s,9H). 13 C NMR (151MHz, DMSO-d6) δ180.88,169.27,155.79,148.82,148.17,144.27,135.64,134.41,128.74,128.52,123.69,121.63,77. 84,69.89,69.86,69.84,69.82,69.72,69.61,69.28,66.77,46.22,45.89,44.77,44.46,40.33,40.06,32.78,28.35.HRMS (ESI + )m / z calcd for C 33 H 50 N6O9S2[M+Na] + 761.2973; found 761.2998.

[0342] 1.4.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1,17-dioxo-1-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-4,7,10,13-tetraoxa-16-azaeicosane-20-ester)

[0343] Replace tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate with (15-oxo-15-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-3,6,9,12-tetraoxapentadecanyl)carbamate tert-butyl, and use the same raw materials, reagents and preparation method as in step 7 of Example 1. The resulting off-white solid is 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS, 12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1,17-dioxo-1-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-4,7,10,13-tetraoxa-16-azaeicosane-20-ester, 13% yield. 1H NMR(600MHz,DMSO-d6)δ10.40(s,1H),8.79(t,J=5.7Hz,1H),8.57(d,J=1.7Hz,1H),8.47(dd,J=4.8,1.5Hz,1H),7.94(t,J=5.6Hz,1H),7.86(d,J=8.8Hz,2H),7.77(d,J=7.9Hz,1H),7.65(d,J=8.8Hz,2H),7.38(dd,J=7.6,5.0Hz,1H),7.32(d,J=10.1Hz,1H),6.16(dd,J=10.1,1.9Hz,1H),5.92(s,1H),5.14(d,J=17.8Hz,1H),4.84(d,J=4.6Hz,1H),4.81(d,J=3.7Hz,1H),4.79(d,J=5.6Hz,2H),4.71(d,J=17.8Hz,1H),4.35–4.28(m,1H),3.56–3.38(m,20H),3.24–3.14(m,2H),2.93–2.80(m,4H),2.61(d,J=6.8Hz,2H),2.56–2.50(m,3H),2.40(t,J=7.1Hz,2H),2.32–2.26(m,1H),2.08(qd,J=11.1,3.9Hz,1H),2.02–1.96(m,1H),1.82–1.75(m,2H),1.61–1.43(m,3H),1.38(s,3H),1.36(s,3H),1.12(s,3H),1.06–0.96(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.54,185.10,180.72,171.75,170.49,170.10,168.95,156.42,148.73,148.03,144.24,135.39,134.20,128.46,128.31,123.45,121.67,121.18,110.71,97.22,81.01,69.74,69.72,69.67,69.57,69.55,69.05,68.15,66.99,66.63,54.84,49.33,46.03,45.73,45.51,44.54,44.25,43.64,40.13,40.06,38.59,33.75,33.40,32.61,31.16,29.90,29.68,28.59,26.27,25.34,20.78,16.41.HRMS(ESI+ )m / z calcd for C 56 H 76 N6O 15 S2[M+H] + 1137.4883; found 1137.4933.

[0344] 1.5 Preparation of ND3: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1,14-dioxo-1-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-4,7,10-trioxa-13-azaheptadecane-17-ester)

[0345] 1.5.1 Preparation of tert-butyl(2-(2-(2-(3-oxo-3-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)propoxy)ethoxy)ethoxy)ethyl)carbamate

[0346] Replacing 12-((tert-butoxycarbonyl)amino)dodecanoic acid with 5,8,11-trioxa-2-azatetradecanoic acid 1-tert-butyl ester, and using the same raw materials, reagents, and preparation method as in 1.3.6, yielded a white solid, tert-butyl(2-(2-(2-(3-oxo-3-(4-((4-(3-(pyridin-3-ylmethyl)thioureo)phenyl)sulfonyl)piperazin-1-yl)propoxy)ethoxy)ethoxy)ethyl)carbamate, with a yield of 97%. 1H NMR (600MHz, DMSO-d6) δ10.19(s,1H),8.68–8.63(m,1H),8.57(d,J=1.8Hz,1H),8.47(dd,J=4.8,1. 6Hz,1H),7.84–7.80(m,2H),7.76(dt,J=7.8,1.9Hz,1H),7.67–7.63(m,2H),7.37(ddd,J=7.9,4.8, 0.7Hz,1H),6.74(t,J=5.5Hz,1H),4.79(d,J=5.6Hz,2H),3.57–3.49(m,6H),3.45(s,4H),3.42(s,4 H),3.36(t,J=6.1Hz,2H),3.05(q,J=6.0Hz,2H),2.92–2.81(m,4H),2.53–2.51(m,2H),1.36(s,9H). 13 C NMR(151MHz,DMSO-d6)δ180.69,168.94,155.55,148.91,148.18,144.14,135.24,134.11,128.55,128.35,123.39,1 21.34,77.55,69.67,69.56,69.46,69.13,66.62,46.04,45.73,44.65,44.24,40.13,40.06,32.61,28.20.HRMS(ESI + )m / z calcd for C 31 H 46 N6O8S2[M+Na] + 717.2711; found 717.2738.

[0347] 1.5.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1,14-dioxo-1-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)-4,7,10-trioxa-13-azaheptadecane-17-ester)

[0348] Replace tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate with tert-butyl(2-(2-(2-(3-oxo-3-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)propoxy)ethoxy)ethoxy)ethyl)carbamate. The remaining raw materials, reagents, and preparation methods are the same as in 1.3.7. The resulting off-white solid is 2-((6aR,6bS,7S,8aS,8bS,11aR,12) (aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1,14-dioxo-1-(4-((4-(3-(pyridin-3-ylmethyl)thiourene)phenyl)sulfonyl)piperazin-1-yl)-4,7,10-trioxa-13-azaheptadecane-17-ester, 32% yield. 1H NMR(600MHz,DMSO-d6)δ10.27(s,1H),8.71(t,J=5.3Hz,1H),8.58(d,J=1.5Hz,1H),8.49(dd,J=4.8,1.4Hz,1H),7.94(t,J=5.6Hz,1H),7.86–7.82(m,2H),7.79(d,J=7.9Hz,1H),7.66(d,J=8.8Hz,2H),7.40(dd,J=7.8,4.8Hz,1H),7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),5.14(d,J=17.8Hz,1H),4.84(d,J=4.6Hz,1H),4.82–4.77(m,3H),4.71(d,J=17.9Hz,1H),4.33–4.30(m,1H),3.58–3.50(m,6H),3.47(s,4H),3.44–3.37(m,6H),3.23–3.15(m,2H),2.92–2.83(m,4H),2.62(t,J=6.8Hz,2H),2.56–2.51(m,3H),2.40(t,J=7.1Hz,2H),2.32–2.27(m,1H),2.12–2.05(m,1H),2.01–1.96(m,1H),1.82–1.75(m,2H),1.62–1.43(m,3H),1.39(s,3H),1.36(s,3H),1.12(s,3H),1.07–0.97(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.53,185.09,180.71,171.75,170.50,170.08,168.95,156.40,148.59,147.89,144.17,135.58,134.29,128.56,128.33,127.09,123.51,121.67,121.29,110.71,97.23,81.02,69.67,69.56,69.54,69.04,68.16,66.99,66.62,54.85,49.33,46.03,45.72,45.51,44.59,44.25,43.64,40.14,40.05,38.59,33.75,33.40,32.61,31.16,29.90,29.69,28.59,26.27,25.34,20.78,16.42.HRMS(ESI +m / zcalcd for C 54 H 72 N6O 14 S2[M+H] + 1093.4621; found 1093.4605.

[0349] 1.6 Preparation of CD1: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 4-((2-(2-(2-((4-((5-amino-1-(3-methylthiophene-2-carbonyl)-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)amino)-4-oxobutyrate

[0350] 1.6.1 Preparation of tert-butyl (2-(2-(2-((4-nitrophenyl)sulfonamido)ethoxy)ethoxy)ethyl)carbamate

[0351] 500 mg of 4-nitrobenzenesulfonyl chloride was dissolved in a mixed solvent of 5 mL dichloromethane and 1 mL triethylamine. 672 mg of 2-(2-(2-aminoethoxy)ethoxy)ethyl tert-butyl carbamate was added with stirring at room temperature. Stirring was stopped after 2 hours. The reaction mixture was diluted with 150 mL dichloromethane in a separatory funnel and washed successively with 1 mol / L citric acid aqueous solution and saturated sodium chloride aqueous solution. The organic phase was collected and dried over anhydrous sodium sulfate. The filtrate was filtered and concentrated. The residue was subjected to column chromatography (dichloromethane:methanol = 98:2, V / V) to give 900 mg of a clear, viscous substance, which was 2-(2-(2-((4-nitrophenyl)sulfonamide)ethoxy)ethoxy)ethyl)butyl carbamate, in 92% yield. 1 H NMR (600MHz, DMSO-d6) δ8.43–8.39(m,2H),8.12(s,1H),8.07–8.03(m,2H),6.73(t,J=5.3Hz,1H),3. 42–3.36(m,6H),3.34–3.32(m,2H),3.03(q,J=6.0Hz,2H),3.01–2.96(m,2H),1.36(s,9H).HRMS(ESI + )m / z calcd for C 17 H 27 N3O8S[M+Na]+ 456.1411; found 456.1425.

[0352] 1.6.2 Preparation of tert-butyl (2-(2-(2-((4-aminophenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate

[0353] 1 g of tert-butyl (2-(2-(2-(((4-nitrophenyl)sulfonamido)ethoxy)ethoxy)ethyl)carbamate was dissolved in a mixed solvent of 12 mL ethanol and 4 mL water. 618 mg of ammonium chloride and 516 mg of reduced iron powder were added. The mixture was heated to 80 °C and stirred for 5 hours, then cooled to room temperature. The reaction solution was filtered with diatomaceous earth as an aid. The filtrate was concentrated, and the residue was subjected to column chromatography (dichloromethane:methanol = 98:2, V / V) to obtain 910 mg of a red viscous substance, which was tert-butyl (2-(2-(2-((4-aminophenyl)sulfonamido)ethoxy)ethoxy)ethyl)carbamate, in 98% yield. 1 H NMR (600MHz, DMSO-d6) δ7.43–7.38(m,2H),7.12(t,J=6.0Hz,1H),6.72(t,J=5.4Hz,1H),6.62–6.57(m,2H),5.90( s,2H),3.46–3.40(m,4H),3.37–3.33(m,4H),3.05(q,J=6.0Hz,2H),2.80(q,J=6.1Hz,2H),1.36(s,9H).HRMS(ESI + )m / z calcd for C 17 H 29 N3O6S[M+Na] + 426.1669; found 426.1682.

[0354] 1.6.3 Preparation of tert-butyl(2-(2-(2-((4-(3-((3,5-dimethyl-1H-pyrazol-1-yl)(imino)methyl)thiourea)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate

[0355] 948 mg of tert-butyl (2-(2-(2-(((4-aminophenyl)sulfonamido)ethoxy)ethoxy)ethyl)carbamate was dissolved in 9 mL of N,N-dimethylformamide. 409 μL of N,N-diisopropylethylamine and 628 mg of N,N'-thiocarbonyldiimidazole were added to the mixture with stirring at room temperature. After 12 hours, 473 mg of 3,5-dimethylpyrazole-1-nitrate and 132 mg of potassium hydroxide were added to the above system. The mixture was heated to 55 °C and stirred for 6 hours before heating was stopped. The reaction solution was diluted with 300 mL of ethyl acetate in a separatory funnel and washed successively with water and saturated sodium chloride aqueous solution. The organic phase was collected, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The residue was subjected to column chromatography (dichloromethane:methanol = 99:1, V / V) to give 425 mg of a clear, viscous substance as tert-butyl(2-(2-(2-((4-(3-(((3,5-dimethyl-1H-pyrazol-1-yl)(imino)methyl)thiourea)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate, yield 31%). 1 H NMR (600MHz, DMSO-d6) δ10.73(s,1H),10.08(s,1H),8.88(s,1H),7.94–7.49(m,5H),6.73(t,J=5.5Hz,1H),6.14(s,1H),3.4 6–3.41(m,4H),3.39–3.34(m,4H),3.04(q,J=6.0Hz,2H),2.91–2.86(m,2H),2.50(s,3H),2.20(s,3H),1.36(s,9H).HRMS(ESI + )m / z calcd for C 24 H 37 N7O6S2[M+Na] + 606.2139; found 606.2160.

[0356] 1.6.4 Preparation of tert-butyl(2-(2-(2-((4-((5-amino-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate

[0357] 400 mg of tert-butyl(2-(2-(2-((4-(3-(((3,5-dimethyl-1H-pyrazol-1-yl)(imino)methyl)thiourea)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate was dissolved in 5 mL of tetrahydrofuran, and 1 mL of hydrazine hydrate (AR, 80% solution) was added. The mixture was heated to 55 °C and stirred for 3 hours, after which heating was stopped. The reaction mixture was concentrated and diluted with 150 mL of ethyl acetate in a separatory funnel, and washed successively with water and saturated sodium chloride aqueous solution. The organic phase was collected and dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The residue was subjected to column chromatography (dichloromethane:methanol = 95:5, V / V) to give 283 mg of a clear, viscous substance as tert-butyl(2-(2-(2-((4-((5-amino-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate, yield 85%). 1 H NMR (600MHz, DMSO-d6) δ11.31(s,1H),9.24(s,1H),7.61(d,J=9.0Hz,2H),7.58(d,J=9.0Hz,2H),7.30(t,J=6.0Hz,1H),6.72( t,J=5.6Hz,1H),5.94(s,2H),3.46–3.40(m,4H),3.39–3.33(m,4H),3.04(q,J=5.9Hz,2H),2.83(q,J=6.0Hz,2H),1.36(s,9H). 13 C NMR (151MHz, DMSO-d6) δ157.11,155.54,145.94,128.85,127.66,114.76,77.55,69.51,69.36,69.12,69.05,42.20,40.06,28.20.

[0358] 1.6.5 tert-butyl(2-(2-(2-((4-((5-amino-1-(3-methylthiophene-2-carbonyl)-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate

[0359] Under a nitrogen atmosphere, 340 mg of tert-butyl(2-(2-(2-((4-(((5-amino-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate was dissolved in 3.5 mL of dry pyridine. 146 mg of 3-methylthiophene-2-acyl chloride was added dropwise with stirring at room temperature. After 2 hours, the reaction mixture was diluted with 150 mL of ethyl acetate in a separatory funnel and washed successively with 1 mol / L aqueous citric acid solution and saturated sodium chloride solution. The organic phase was collected and dried over anhydrous sodium sulfate. The filtrate was filtered and concentrated. The residue was subjected to column chromatography (dichloromethane:methanol = 98:2, V / V) to give 400 mg of a clear, viscous substance as tert-butyl(2-(2-(2-((4-((5-amino-1-(3-methylthiophene-2-carbonyl)-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate, yield 94%). 1 H NMR (600MHz, DMSO-d6) δ9.92 (s, 1H), 8.05 (d, J = 5.0Hz, 1H), 7.86 (s, 2H), 7.83 ( d,J=8.9Hz,2H),7.74(d,J=8.9Hz,2H),7.42(t,J=6.0Hz,1H),7.16(d,J=5.0Hz, 1H),6.70(t,J=5.2Hz,1H),3.46–3.40(m,4H),3.37(t,J=6.0Hz,2H),3.35–3.32 (m,2H),3.03(q,J=5.9Hz,2H),2.87(q,J=6.0Hz,2H),2.63(s,3H),1.34(s,9H). 13 C NMR(151MHz,DMSO-d6)δ160.22,157.04,156.84,155.53,150.51,144.04,135.63,131.39,131.14, 127.86,123.92,116.08,77.53,69.52,69.35,69.12,69.05,42.26,40.06,28.18,17.70.HRMS(ESI + )m / z calcd for C 25 H 35 N7O7S2[M+Na] + 632.1932; found 632.1917.

[0360] 1.6.6 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 4-((2-(2-(2-((4-((5-amino-1-(3-methylthiophene-2-carbonyl)-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)amino)-4-oxobutyrate

[0361] Replace tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate with tert-butyl(2-(2-(2-((4-((5-amino-1-(3-methylthiophene-2-carbonyl)-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)carbamate. The remaining raw materials, reagents, and preparation methods are the same as in 1.3.7. The resulting off-white solid is 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12) bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 4-((2-(2-(2-(4-((5-amino-1-(3-methylthiophene-2-carbonyl)-1H-1,2,4-triazol-3-yl)amino)phenyl)sulfonamide)ethoxy)ethoxy)ethyl)amino)-4-oxobutyrate, yield 44%. 1H NMR(600MHz,DMSO-d6)δ9.93(s,1H),8.04(d,J=5.0Hz,1H),7.92(t,J=5.6Hz,1H),7.86(s,2H),7.82(d,J=8.9Hz,2H),7.74(d,J=9.0Hz,2H),7.43(t,J=6.0Hz,1H),7.31(d,J=10.1Hz,1H),7.16(d,J=4.9Hz,1H),6.16(dd,J=10.1,1.9Hz,1H),5.91(s,1H),5.12(d,J=17.8Hz,1H),4.82(d,J=4.6Hz,1H),4.79(d,J=3.6Hz,1H),4.69(d,J=17.9Hz,1H),4.32–4.28(m,1H),3.47–3.42(m,4H),3.40–3.35(m,4H),3.19–3.14(m,2H),2.87(q,J=6.0Hz,2H),2.63(s,3H),2.62–2.59(m,2H),2.54–2.50(m,1H),2.38(t,J=7.1Hz,2H),2.28(dd,J=13.3,2.5Hz,1H),2.06(qd,J=11.2,4.2Hz,1H),2.00–1.94(m,1H),1.80–1.73(m,2H),1.59–1.42(m,3H),1.37(s,3H),1.35(s,3H),1.10(s,3H),1.06–0.95(m,2H),0.80(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.54,185.12,171.76,170.52,170.12,160.22,157.05,156.84,156.43,150.54,144.05,135.65,131.40,131.12,127.87,127.11,123.92,121.68,116.09,110.71,97.22,81.02,69.52,69.44,69.07,69.06,68.16,67.00,54.85,49.33,45.51,43.65,42.28,38.57,33.76,33.40,31.17,29.90,29.67,28.57,26.27,25.33,20.78,17.72,16.42.HRMS(ESI + )m / z calcd for C 48 H 61 N7O 13S2[M+H] + 1008.3842; found 1008.3862.

[0362] 1.7 BD1: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3] Preparation of dioxolane-8b-yl)-2-oxoethyl 4-((2-(2-(2-(4-((E)-4-((R)-3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazin-1-yl)ethoxy)ethoxy)ethyl)amino)-4-oxobutyrate

[0363] 1.7.1 Preparation of (E)-4-(4-(tert-Butoxycarbonyl)piperazin-1-yl)but-2-enoic acid

[0364] 2.3 g of piperazine-1-carboxylic acid tert-butyl ester and 5.1 mL of triethylamine were dissolved in 20 mL of tetrahydrofuran. 2 g of (E)-4-bromobut-2-enoic acid was slowly added under ice bath conditions. A large amount of white solid precipitated in the reaction system. After stirring at room temperature for 2 hours, the mixture was filtered. The filtrate was concentrated, and the residue was subjected to column chromatography (dichloromethane:methanol = 96:4, V / V) to give 1.9 g of white solid as (E)-4-(4-(tert-butyloxycarbonyl)piperazine-1-yl)but-2-enoic acid, in 58% yield. 1 H NMR(600MHz,DMSO-d6)δ6.70(dt,J=15.7,6.1Hz,1H),5.91(d,J=15.7Hz,1H),3.31(br s,4H),3.10(dd,J=6.1,1.2Hz,2H),2.33–2.28(m,4H),1.39(s,9H).HRMS(ESI + )m / z calcd for C 13 H 22 N₂O₄[M+H] + 271.1652; found 271.1658.

[0365] 1.7.2 Preparation of (R,E)-4-(4-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazine-1-carboxylic acid tert-butyl ester

[0366] 500 mg of (R)-3-(4-phenoxyphenyl)-1-(piperidin-3-yl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine and 625 mg of (E)-4-(4-(tert-butoxycarbonyl)piperazin-1-yl)but-2-enoic acid were dissolved in 13 mL of dichloromethane. 544 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, 436 mg of 1-hydroxybenzotriazole, and 674 μL of N,N-diisopropylethylamine were added with stirring at room temperature. After stirring for 3 hours, the reaction mixture was diluted with 250 mL of dichloromethane and washed successively with water and saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to obtain 678 mg of a white solid, which was (R,E)-4-(4-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazine-1-carboxylic acid tert-butyl ester, with a yield of 82%. 1 H NMR(600MHz,DMSO-d6)δ8.25(s,1H),7.68–7.62(m,2H),7.46–7.40(m,2H),7.19(t,J=7.4Hz,1H), 7.17–7.14(m,2H),7.14–7.11(m,2H),6.71–6.57(m,1H),6.53–6.43(m,1H),4.78–4.61(m,1H),4.5 8–4.47(m,0.5H),4.18–3.99(m,2H),3.75–3.68(m,0.5H),3.34–3.05(m,6H),2.97(s,1H),2.35–2 .20(m,5H),2.17–2.07(m,1H),1.99–1.90(m,1H),1.63–1.50(m,1H),1.40–1.36(m,9H).LC-MS(ESI + )m / z calcd for C 35 H 42 N8O4[M+H] + 639.3402; found 639.3434.

[0367] 1.7.3 Preparation of (R,E)-1-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-(piperazin-1-yl)but-2-en-1-one

[0368] Dissolve 670 mg of (R,E)-4-(4-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazine-1-carboxylic acid tert-butyl ester in 4 mL of dry dichloromethane, and slowly add 2 mL of trifluoroacetic acid dropwise with stirring at room temperature. After reacting for 3 hours, the pH was adjusted to greater than 7 with a sodium carbonate aqueous solution of 2 mol / L. The mixture was extracted with dichloromethane (200 mL × 3). The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 97:3, V / V) to obtain 560 mg of a white solid, which was (R,E)-1-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-(piperazin-1-yl)but-2-en-1-one, with a yield of 99%. 1 H NMR (600MHz, DMSO-d6) δ8.25(s,1H),7.65(s,2H),7.47–7.41(m,2H),7.19(t,J=7.4Hz,1H),7.15(d, J=8.6Hz,2H),7.14–7.11(m,2H),6.72–6.53(m,1H),6.53–6.34(m,1H),4.78–4.61(m,1H),4.60–4.46 (m,0.5H),4.18–4.01(m,1.5H),3.75–3.68(m,0.5H),3.26–3.15(m,0.5H),3.13–3.06(m,2H),2.93(s ,1H),2.78–2.65(m,4H),2.38–2.16(m,5H),2.15–2.05(m,1H),2.00–1.91(m,1H),1.63–1.51(m,1H).

[0369] 1.7.4 Preparation of tert-butyl(R,E)-(2-(2-(2-(4-(4-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazin-1-yl)ethoxy)ethoxy)ethyl)carbamate

[0370] 355 mg of (R,E)-1-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-(piperazin-1-yl)but-2-en-1-one, 247 mg of (2-(2-(2-bromoethoxy)ethoxy)ethyl)carbamate tert-butyl, 110 mg of potassium iodide, and 345 μL of N,N-diisopropylethylamine were dissolved in 6 mL of N,N-dimethylformamide. The mixture was heated to 60 °C and stirred for 5 hours. Heating was then stopped and the mixture was cooled to room temperature. The residue was diluted in 150 mL of ethyl acetate in a separatory funnel and washed successively with water and saturated sodium chloride aqueous solution. The organic phase was collected and dried over anhydrous sodium sulfate. The filtrate was filtered and concentrated. The residue was subjected to column chromatography (dichloromethane:methanol = 98:2, V / V) to give 391 mg of a clear, viscous substance, which was tert-butyl(R,E)-(2-(2-(2-(4-(4-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazin-1-yl)ethoxy)ethoxy)ethyl)carbamate, yield 78%. 1 H NMR(600MHz,DMSO-d6)δ8.26(s,1H),7.70–7.63(m,2H),7.47–7.41(m,2H),7.21–7.17(m,1H),7.17– 7.14(m,2H),7.14–7.10(m,2H),6.74(s,1H),6.69–6.57(m,1H),6.52–6.40(m,1H),4.77–4.64(m,1H) ,4.58–4.48(m,0.5H),4.15–3.99(m,1.5H),3.77–3.71(m,0.5H),3.48(s,9.5H),3.24–3.04(m,5H),2 .93(s,1H),2.48–2.23(m,9H),2.17–2.07(m,1H),2.03–1.89(m,1H),1.64–1.52(m,1H),1.37(s,9H). 13C NMR (151MHz, DMSO-d6) δ164.41,164.36,158.18,157.11,156.30,155.62,155.56,154.01,153. 94,143.27,143.09,141.81,141.18,130.11,130.04,127.94,123.77,122.56,122.51,118.96, 97.39,77.56,69.61,69.45,69.13,68.25,68.25,58.73,58.58,57.18,53.05,52.73,52.66,52 .01,49.39,45.72,45.18,41.63,32.17–28.47(m),28.22,24.87,23.10,22.07,13,92.HRMS(ESI + )m / z calcd for C 41 H 55 N9O6[M+H] + 770.4348; found 770.4410.

[0371] 1.7.5 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1 [3]dioxolane-8b-yl)-2-oxoethyl 4-((2-(2-(2-(4-((E)-4-((R)-3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazin-1-yl)ethoxy)ethoxy)ethyl)amino)-4-oxobutyrate

[0372] Replace tert-butyl(12-oxo-12-(4-((4-(3-(pyridin-3-ylmethyl)thiourea)phenyl)sulfonyl)piperazin-1-yl)dodecyl)carbamate with tert-butyl(R,E)-(2-(2-(2-(4-(4-(3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperazin-1-yl)-4-oxobut-2-en-1-yl)piperazin-1-yl)ethoxy)ethoxy)ethyl)carbamate. The remaining raw materials, reagents, and preparation methods are the same as in 1.3.7. The resulting off-white solid is 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12b S)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 4-((2-(2-(2-(4-((E)-4-((R)-3-(4-amino-3-(4-phenoxyphenyl)-1H-pyrazolo[3,4-d]pyrimidin-1-yl)piperidin-1-yl)-4-oxobut-2-en-1-yl)piperazin-1-yl)ethoxy)ethoxy)ethyl)amino)-4-oxobutyrate, yield 40%. 1H NMR(600MHz,DMSO-d6)δ8.26(d,J=4.9Hz,1H),7.96(s,1H),7.66(s,2H),7.44(t,J=8.0Hz,2H),7.32(d,J=10.1Hz,1H),7.19(t,J=7.4Hz,1H),7.16(d,J=8.6Hz,2H),7.14–7.11(m,2H),6.71–6.43(m,2H),6.16(dd,J=10.1,1.7Hz,1H),5.92(s,1H),5.14(d,J=17.8Hz,1H),4.83(t,J=3.6Hz,2H),4.76–4.65(m,2H),4.53(d,J=10.7Hz,0.5H),4.32–4.28(m,1H),4.16–4.04(m,1.5H),3.78–3.70(m,0.5H),3.55–3.37(m,10H),3.25–3.08(m,4.5H),2.97(s,1H),2.62(t,J=6.7Hz,2H),2.58–2.51(m,5H),2.40(t,J=6.5Hz,2H),2.33–2.23(m,6H),2.17–1.92(m,4H),1.82–1.73(m,2H),1.64–1.44(m,4H),1.38(s,3H),1.35(s,3H),1.12(s,3H),1.07–0.95(m,2H),0.81(s,3H). 13C NMR(151MHz,DMSO-d6)δ203.53,185.09,171.74,170.49,170.08,164.33,164.29,158.17,157.09,156.40,156.28,155.61,154.00,153 .93,143.26,143.08,130.10,130.03,129.61,127.92,127.10,123.76,122.79,121.68,118.94,110.70,97.37,97.22,81.02,69.57,69 .48,69.02,68.15,67.77,66.99,59.72,58.38,56.87,54.84,53.28–51.75(m),49.33,45.73,45.51,45.16,43.64,41.63,40.06,38.60 ,33.75,33.40,31.16,29.90,29.70,29.69–28.74(m),28.60,26.27,25.34,24.87,23.11,22.05,20.77,16.42,14.06,13.91.HRMS (ESI - )m / z calcd for C 64 H 81 N9O 12 [M+Cl] - 1202.5699; found 1202.5687.

[0373] 1.8 Preparation of P1: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)hexanoate

[0374] 1.8.1 Preparation of 2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)nicotinaldehyde

[0375] Under a nitrogen atmosphere, 2 g of 3-hydroxymethyl-2-methylbiphenyl, 1.7 g of 6-chloro-2-methoxy-pyridine-3-carboxaldehyde, 6.4 g of cesium carbonate, 856 mg of 2-di-tert-butylphosphino-2',4',6'-triisopropylbiphenyl, and 168 mg of palladium acetate were suspended in 100 mL of toluene and reacted at 90 °C for 12 hours, then cooled to room temperature. The reaction solution was concentrated, and the residue was subjected to column chromatography (petroleum ether:ethyl acetate = 10:1, V / V) to give 2.6 g of a white solid, 2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)nicotinaldehyde, in 76% yield. 1 H NMR (300MHz, DMSO-d6) δ10.09(s,1H),8.03(d,J=8.3Hz,1H),7.50–7.18(m,8H),6.59(d,J=8.3Hz,1H),5.55(s,2H),4.04(s,3H),2.22(s,3H). 13 C NMR(75MHz,DMSO-d6)δ186.66,165.85,164.27,142.24,141.29,140.60,134.98,134.04,129.84, 129.11(2C),128.52,128.20(2C),126.94,125.53,111.85,103.50,67.27,53.99,15.93.HRMS(ESI + )m / z calcd for C 21 H 19 NO3[M+H] + 334.1438; found 334.1431.

[0376] 1.8.2 Preparation of tert-butyl (2-(hexane-5-acetylamido)ethyl)carbamate

[0377] 2 g of N-tert-butoxycarbonyl-1,2-ethylenediamine and 1.4 g of 5-hexyneic acid were dissolved in 62 mL of dichloromethane. 2.9 g of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, 2.2 g of 1-hydroxybenzotriazole, and 4.4 mL of N,N-diisopropylethylamine were added with stirring at room temperature. After stirring for 5 hours at room temperature, the reaction solution was diluted with 350 mL of dichloromethane and washed successively with water and saturated sodium bicarbonate solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to give 2.9 g of a white solid, tert-butyl (2-(hexyl-5-ynylamido)ethyl)carbamate, in 91% yield. 1H NMR(300MHz,DMSO-d6)δ7.82(br s,1H),6.77(br s,1H),3.10–3.00(m,2H),2.99–2.90(m,2H),2.77(t,J=2.5Hz,1H),2.20–2.10(m,4H),1.73–1.58(m,2H),1.37(s,9H). 13 C NMR(75MHz,DMSO-d6)δ171.55,155.58,84.07,77.58,71.34,39.65,34.15,28.19,24.19,17.36.HRMS(ESI + )m / z calcd for C 13 H 22 N₂O₃[M+Na] + 277.1523; found 277.1511.

[0378] 1.8.3 Preparation of N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)hexyl-5-yneamide

[0379] 1.1 g of tert-butyl (2-(hexamyl-5-acetylamido)ethyl)carbamate was dissolved in 10 mL of a 4 mol / L dioxane solution at room temperature. After stirring for 3 hours at room temperature, the solution was concentrated and then dissolved again in 30 mL of dichloromethane solution. N,N-diisopropylethylamine was added dropwise until no white fumes were produced. 1.7 g of sodium triacetoxyborohydride and 1.1 g of 2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)nicotinaldehyde were added sequentially to the system. After stirring at room temperature for 6 hours, the reaction was quenched with 1 mL of methanol. The reaction solution was diluted with 300 mL of dichloromethane and washed sequentially with water and a saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 96:4, V / V) to give 1.1 g of a white solid as N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)hexyl-5-yneamide, yield 70%. 1H NMR(600MHz,DMSO-d6)δ7.91(t,J=5.5Hz,1H),7.67(d,J=8.0Hz,1H),7.46–7.42(m,3H),7 .40–7.35(m,1H),7.32–7.28(m,2H),7.26(t,J=7.6Hz,1H),7.18(dd,J=7.6,1.2Hz,1H),6 .44(d,J=7.9Hz,1H),5.41(s,2H),3.90(s,3H),3.68(s,2H),3.21–3.17(m,2H),2.78(t,J =2.6Hz,1H),2.62(t,J=6.4Hz,2H),2.21(s,3H),2.18–2.12(m,4H),1.65(p,J=7.2Hz,2H). 13 C NMR(151MHz,DMSO-d6)δ171.67,161.06,159.80,142.15,141.72,141.40,135.90,133.81,129.51,129.14(2C),128.22(2C),1 26.93,125.45,111.67,100.88,84.09,71.45,66.21,53.27,48.59,47.56,45.55,37.74,34.13,24.21,17.38,15.90.HRMS(ESI + )m / z calcd for C 29 H 33 N3O3[M+H] + 472.2595; found 472.2584.

[0380] 1.8.4 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-6-azidohexanoate

[0381] Dissolve 500 mg of desonide and 187 mg of 6-azidohexanoic acid in 12 mL of dichloromethane, then add 242 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide and 30 mg of 4-dimethylaminopyridine sequentially, and stir at room temperature for 3 hours. Dilute the reaction solution with 200 mL of dichloromethane, and wash successively with water and saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to obtain 544 mg of a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate, in 82% yield. 1 H NMR(300MHz,DMSO-d6)δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.5Hz,1H),5.92(s,1H), 5.15(d,J=17.9Hz,1H),4.85(s,1H),4.81(d,J=3.4Hz,1H),4.72(d,J=17.9Hz,1H),4.32(br s,1H),3.35–3.25(m,2H),2.59–2.50(m,1H),2.43(t,J=7.2Hz,2H),2.29(d,J=10.9Hz,1H),2.18–1.92( m,2H),1.79(s,2H),1.67–1.45(m,7H),1.43–1.20(m,8H),1.13(s,3H),1.08–0.93(m,2H),0.83(s,3H). 13 C NMR(75MHz,DMSO-d6)δ203.56,185.07,172.07,170.03,156.36,127.11,121.69,110.69,97.25,81.04,68.16,66.92,54.87 ,50.49,49.35,45.52,43.64,33.77,33.42,32.88,31.18,29.91,27.89,26.28,25.51,25.34,23.94,20.79,16.40.HRMS(ESI + )m / z calcd for C 30 H 41 N3O7[M+H] +556.3017; found 556.3004.

[0382] 1.8.5 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)hexanoate

[0383] 102 mg of N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)hexyl-5-yneamide and 100 mg of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1, 2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indo[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate was dissolved in a mixture of 2 mL tetrahydrofuran and 2 mL water. 95 mg of vitamin C and 37 mg of copper sulfate were added with stirring at room temperature. The reaction solution was concentrated after 4 hours. Extracted with dichloromethane (50 mL × 3), the organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 97:3, V / V) to obtain 85 mg of a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12 12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)hexanoate, yield 46%. 1H NMR(300MHz,DMSO-d6)δ8.17(br s,1H),7.88(s,1H),7.81(d,J=8.0Hz,1H),7.56–7.14(m,9H),6.50(d,J=8.0Hz,1H),6.17(d,J=9.8Hz,1H),5.92(s,1H),5.44(s,2H),5.14(d,J=17.9Hz,1H),4.93–4.81(m,2H),4.71(d,J=17.9Hz,1H),4.38–4.24(m,3H),3.99–3.90(m,5H),3.51–3.35(m,2H),2.96–2.82(m,2H),2.64–2.53(m,3H),2.41(t,J=7.0Hz,2H),2.34–1.92(m,8H),1.87–1.74(m,6H),1.69–1.45(m,5H),1.39(s,3H),1.36(s,3H),1.31–1.22(m,4H),1.20–0.93(m,5H),0.82(s,3H). 13 C NMR(75MHz,DMSO-d6)δ203.63,185.13,172.46,172.10,170.13,162.11,160.31,156.49,146.33,143.37,142.17,141.36,135.68,133.85,129.59,129.13,128.26,128.23,127.10,126.94,125.47,121.73,110.71,107.02,101.30,97.25,81.05,68.12,66.96,66.41,54.89,53.54,49.36,48.98,46.46,45.54,44.42,43.68,35.82,34.73,33.79,33.44,32.82,31.19,29.92,29.35,26.29,25.36,25.25,25.00,24.62,23.78,20.79,16.43,15.92.HRMS(ESI + )m / z calcd for C 59 H 74 N6O 10 [M+H] + 1027.5539;found 1027.5544.

[0384] 1.9 P2: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1 Preparation of 3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionate

[0385] 1.9.1 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentan-8b-yl)-2-oxoethyl 3-(2-(2-azidoethoxy)ethoxy)propionate

[0386] Replacing 6-azidohexanoic acid with 9-azido-4,7-dioxanonanoic acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentan-8b-yl)-2-oxoethyl 3-(2-(2-azidoethoxy)ethoxy)propionate, with a yield of 65%. 1H NMR(600MHz,DMSO-d6)δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),5.16(d,J=17.8Hz,1H),4.84(d,J=4.6Hz,1H),4.82(d,J=3.6Hz,1H),4.73(d,J=17.8Hz,1H),4.33–4.29(m,1H),3.68(t,J=6.3Hz,2H),3.63–3.58(m,2H),3.56–3.50(m,4H),3.40–3.37(m,2H),2.67(t,J=6.3Hz,2H),2.57–2.50(m,1H),2.30(dd,J=13.3,2.6Hz,1H),2.09(qd,J=11.2,4.0Hz,1H),2.02–1.96(m,1H),1.84–1.75(m,2H),1.61–1.43(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.07–0.94(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.46,185.11,170.41,170.11,156.42,127.12,121.69,110.72,97.24,81.05,69.69,69.55,69.24,68.16,67.05,65.80,54.85,49.98,49.34,45.54,43.66,34.17,33.77,33.42,31.18,29.91,26.28,25.34,20.79,16.43.HRMS(ESI + )m / z calcd for C 31 H 43 N3O9[M+Na] + 624.2892;found 624.2871.

[0387] 1.9.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2- d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionate

[0388] 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-6-azidohexanoic acid Ester replacement with 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentan-8b-yl)-2-oxoethyl 3- (2-(2-azidoethoxy)ethoxy)propionate, the remaining raw materials, reagents and preparation methods are the same as in 1.7.4, yielding a white solid 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[ 2',1':4,5]Indo[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionate, yield 41%. 1H NMR(600MHz,DMSO-d6)δ8.25(t,J=5.3Hz,1H),7.87–7.84(m,2H),7.48–7.42(m,3H),7.40–7.32(m,2H),7.30(d,J=7.3Hz,2H),7.27(t,J=7.6Hz,1H),7.19(d,J=7.5Hz,1H),6.53(d,J=8.0Hz,1H),6.17(d,J=10.0Hz,1H),5.92(s,1H),5.45(s,2H),5.16(d,J=17.8Hz,1H),4.91(d,J=3.4Hz,1H),4.84(d,J=4.2Hz,1H),4.73(d,J=17.8Hz,1H),4.46(t,J=5.1Hz,2H),4.32(br s,1H),4.03(s,2H),3.95(s,3H),3.80(t,J=5.1Hz,2H),3.63(t,J=6.2Hz,2H),3.53–3.47(m,4H),3.41–3.38(m,2H),2.95(t,J=6.0Hz,2H),2.65(t,J=6.1Hz,2H),2.61(t,J=7.5Hz,2H),2.55–2.49(m,1H),2.33–2.26(m,1H),2.22(s,3H),2.17(t,J=7.4Hz,2H),2.12–2.04(m,1H),2.01–1.95(m,1H),1.87–1.76(m,4H),1.61–1.43(m,3H),1.38(s,3H),1.36(s,3H),1.12(s,3H),1.07–0.95(m,2H),0.82(s,3H). 13CNMR(151MHz,DMSO-d6)δ203.50,185.15,172.62,170.43,170.16,162.47,160.49,156.53,146.26,143.92,142.19,1 41.36,135.62,133.89,129.64,129.15,128.31,128.25,127.11,126.97,125.50,122.26,121.71,110.73,105.50,10 1.45,97.25,81.05,69.55,69.43,68.77,68.13,67.09,66.49,65.76,54.90,53.65,49.37,49.21,46.08,45.56,44.0 4,43.69,35.19,34.72,34.16,33.79,33.43,31.20,29.93,26.29,25.35,24.97,24.58,20.79,16.44,15.94.HRMS(ESI + )m / z calcd for C 60 H 76 N6O 12 [M+H] + 1073.5594; found 1073.5580.

[0389] 1.10 P3: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2- Preparation of d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)propionate

[0390] 1.10.1 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentan-8b-yl)-2-oxoethyl 3-(2-azidoethoxy)propionate

[0391] Replacing 6-azidohexanoic acid with azido-monoethylene glycol-propionic acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentan-8b-yl)-2-oxoethyl 3-(2-azidoethoxy)propionate, in 82% yield. 1 H NMR (600MHz, DMSO-d6) δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),5.16(d,J=17.8Hz,1H),4.84(d, J=4.6Hz,1H),4.82(d,J=3.7Hz,1H),4.73(d,J=17.8Hz,1H),4.33–4.30(m,1H),3.71(t,J=6.2Hz,2H),3.63–3.57(m,2H),3 .38(dd,J=5.9,4.3Hz,2H),2.69(t,J=6.2Hz,2H),2.57–2.50(m,1H),2.30(dd,J=13.5,2.7Hz,1H),2.13–2.04(m,1H),2.03 –1.95(m,1H),1.83–1.74(m,2H),1.61–1.43(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.07–0.97(m,2H),0.82(s,3H). 13C NMR(151MHz,DMSO-d6)δ203.46,185.15,170.31,170.17,156.46,127.12,121.69,110.75,97.26,81.06,69.14,68.17,67 .08,65.70,54.87,49.85,49.35,45.55,43.67,34.20,33.78,33.43,31.18,29.92,26.29,25.35,20.80,16.44.HRMS(ESI + )m / z calcd for C 29 H 39 N3O8[M+Na] + 580.2629; found 580.2622.

[0392] 1.10.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[ 1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)propionate

[0393] 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-6-ester The aziroxanoate ester was replaced with 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentane-8b-yl)- 2-Oxoethyl 3-(2-azidoethoxy)propionate, with the remaining raw materials, reagents, and preparation method as described in 1.7.4, yields a white solid 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH -Naphtho[2',1':4,5]indo[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(4-(4-((2-(((2-methoxy-6-(((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)propionate, yield 63%. 1H NMR(600MHz,DMSO-d6)δ8.08(t,J=5.4Hz,1H),7.83(s,1H),7.78(d,J=8.0Hz,1H),7.53–7.44(m,3H),7.41–7.37(m,1H),7.36(d,J=10.1Hz,1H),7.34–7.30(m,2H),7.28(t,J=7.6Hz,1H),7.20(dd,J=7.6,1.0Hz,1H),6.50(d,J=8.0Hz,1H),6.18(dd,J=10.1,1.9Hz,1H),5.93(s,1H),5.45(s,2H),5.16(d,J=17.8Hz,1H),4.89(d,J=3.6Hz,1H),4.86(d,J=4.6Hz,1H),4.72(d,J=17.8Hz,1H),4.48(t,J=5.2Hz,2H),4.36–4.31(m,1H),3.94(s,3H),3.90(s,2H),3.80(t,J=5.3Hz,2H),3.69(t,J=6.2Hz,2H),3.32(dd,J=12.1,6.1Hz,2H),2.83(t,J=6.2Hz,2H),2.67(t,J=6.2Hz,2H),2.62(t,J=7.6Hz,2H),2.57–2.52(m,1H),2.32–2.28(m,1H),2.23(s,3H),2.17(t,J=7.5Hz,2H),2.10(ddd,J=14.7,10.8,5.0Hz,1H),2.02–1.96(m,1H),1.89–1.82(m,2H),1.82–1.77(m,2H),1.63–1.46(m,3H),1.40(s,3H),1.38(s,3H),1.14(s,3H),1.08–0.99(m,2H),0.83(s,3H). 13C NMR(151MHz,DMSO-d6)δ203.48,185.12,172.34,170.34,170.11,161.83,160.17,156.46,146.29,142.90,1 42.16,141.37,135.73,133.83,129.55,129.12,128.21,127.09,126.93,125.45,122.20,121.69,110.72,1 01.19,97.24,81.05,68.62,68.13,67.09,66.35,65.56,54.89,53.46,49.36,49.07,46.78,45.55,44.75,4 3.66,34.75,34.01,33.77,33.42,31.18,29.91,26.28,25.34,25.03,24.60,20.78,16.43,15.90.HRMS (ESI + )m / z calcd for C 58 H 72 N6O 11 [M+H] + 1029.5332; found 1029.5327.

[0394] 1.11 P4: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1 Preparation of 2-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)acetate ester]dioxolane-8b-yl)-2-oxoethyl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)acetate

[0395] 1.11.1 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 2-(2-(2-azidoethoxy)ethoxy)acetate

[0396] Replacing 6-azidohexanoic acid with 2-(2-(2-azidoethoxy)ethoxy)acetic acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 2-(2-(2-azidoethoxy)ethoxy)acetic acid ester, with a yield of 41%. 1 H NMR (600MHz, DMSO-d6) δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),5.22(d,J=17.8Hz,1H),4. 85(d,J=4.6Hz,1H),4.81(d,J=3.8Hz,1H),4.78(d,J=17.8Hz,1H),4.34–4.30(m,1H),4.28(s,2H),3.68–3.64(m,2H), 3.62–3.57(m,4H),3.43–3.37(m,2H),2.56–2.51(m,1H),2.30(dd,J=13.3,2.8Hz,1H),2.12–2.05(m,1H),2.02–1.96 (m,1H),1.83–1.75(m,2H),1.62–1.45(m,3H),1.39(s,3H),1.37(s,3H),1.14(s,3H),1.07–0.98(m,2H),0.83(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.34,185.09,170.09,169.53,156.39,127.11,121.68,110.76,97.21,81.08,70.04,69.55,69.17 ,68.14,67.44,67.15,54.84,49.98,49.33,45.56,43.64,33.75,33.41,31.16,29.90,26.26,25.32,20.78,16.42.HRMS (ESI + )m / z calcd for C 30 H 41 N3O9[M+Na] +610.2735; found 610.2743.

[0397] 1.11.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2- [d][1,3]dioxolane-8b-yl)-2-oxoethyl 2-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)acetate

[0398] 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-6-azidohexanoic acid Ester replacement with 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 2-( 2-(2-Azide-ethoxy)ethoxy)acetate, the remaining raw materials, reagents and preparation methods are the same as in 1.7.5, yielding a white solid 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2] ',1':4,5]Indo[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 2-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)acetate, yield 57%. 1H NMR(600MHz,DMSO-d6)δ8.06(t,J=5.3Hz,1H),7.85(s,1H),7.76(d,J=8.0Hz,1H),7.48–7.43(m,3H),7.38(t,J=7.4Hz,1H),7.34(d,J=10.1Hz,1H),7.30(d,J=8.0Hz,2H),7.27(t,J=7.6Hz,1H),7.19(d,J=7.6Hz,1H),6.49(d,J=8.0Hz,1H),6.17(dd,J=10.1,1.6Hz,1H),5.92(s,1H),5.43(s,2H),5.22(d,J=17.8Hz,1H),4.88(d,J=3.7Hz,1H),4.84(d,J=4.5Hz,1H),4.78(d,J=17.9Hz,1H),4.47(t,J=5.3Hz,2H),4.34–4.30(m,1H),4.24(s,2H),3.93(s,3H),3.88(s,2H),3.81(t,J=5.3Hz,2H),3.64–3.60(m,2H),3.59–3.52(m,2H),3.33–3.27(m,2H),2.81(t,J=6.2Hz,2H),2.60(t,J=7.6Hz,2H),2.55–2.51(m,1H),2.32–2.26(m,1H),2.22(s,3H),2.15(t,J=7.5Hz,2H),2.11–2.04(m,1H),2.02–1.96(m,1H),1.85–1.78(m,4H),1.62–1.44(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.06–0.98(m,2H),0.82(s,3H). 13C NMR (151MHz, DMSO-d6) δ203.38,185.12,172.38,170.11,169.53,161.83,160.17,156.46,146.29,142.90,142. 16,141.37,135.73,133.83,129.56,129.13,128.22,127.10,126.94,125.46,122.26,121.70,110.76,101.19, 97.22,81.08,69.90,69.42,68.73,68.12,67.35,67.18,66.35,54.87,53.46,49.35,49.16,46.80,45.57,44.7 6,43.66,36.35,34.75,33.77,33.41,31.18,29.92,26.26,25.32,25.01,24.57,20.78,16.44,15.91.HRMS (ESI + )m / z calcd for C 59 H 74 N6O 12 [M+H] + 1059.5437; found 1059.5437.

[0399] 1.12 P5:2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3] Preparation of dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(2-(4-(4-((2-(((2-methoxy-6-(((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)ethoxy)propionate

[0400] 1.12.1 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)propionate

[0401] Replacing 6-azidohexanoic acid with 3-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)propionic acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentan-8b-yl)-2-oxoethyl 3-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)propionic acid ester, with a yield of 88%. 1 H NMR (600MHz, DMSO-d6) δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.8Hz,1H),5.92(s,1H),5.16(d,J=17.8Hz,1H),4.84(d,J=4.6Hz,1H ),4.81(d,J=3.7Hz,1H),4.73(d,J=17.8Hz,1H),4.34–4.29(m,1H),3.67(t,J=6.3Hz,2H),3.63–3.58(m,2H),3.57–3.54(m,2H),3.54– 3.52(m,2H),3.53–3.50(m,4H),3.42–3.37(m,2H),2.67(t,J=6.3Hz,2H),2.57–2.50(m,1H),2.33–2.26(m,1H),2.09(qd,J=11.1,4.1H z,1H),2.02–1.95(m,1H),1.83–1.76(m,2H),1.62–1.45(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.07–0.98(m,2H),0.82(s,3H). 13C NMR(151MHz,DMSO-d6)δ203.44,185.10,170.41,170.10,156.41,127.11,121.69,110.72,97.24,81.04,69.78,69.70,69.67,69.23 ,68.16,67.03,65.77,54.85,49.98,49.33,45.53,43.65,34.17,33.76,33.41,31.17,29.91,26.27,25.33,20.78,16.42.HRMS(ESI + m / zcalcd for C 33 H 47 N3O 10 [M+Na] + 668.3154; found 668.3148.

[0402] 1.12.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][ [1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)ethoxy)propionate

[0403] Replace 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate with 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentane-8b-yl)-2-oxoethyl 3-(2-(2-( 2-Azide-ethoxy)ethoxy)ethoxy)propionate, the remaining raw materials, reagents and preparation methods are the same as in 1.7.5, to obtain a white solid 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1 ':4,5]Indo[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(2-(4-(4-((2-(((2-methoxy-6-(((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)ethoxy)propionate, yield 45%. 1H NMR(600MHz,DMSO-d6)δ7.89(t,J=5.6Hz,1H),7.82(s,1H),7.67(d,J=8.0Hz,1H),7.47–7.43(m,3H),7.40–7.36(m,1H),7.34–7.29(m,3H),7.26(t,J=7.6Hz,1H),7.18(dd,J=7.6,1.2Hz,1H),6.44(d,J=7.9Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),5.41(s,2H),5.15(d,J=17.8Hz,1H),4.88–4.81(m,2H),4.72(d,J=17.8Hz,1H),4.46(t,J=5.3Hz,2H),4.31(s,1H),3.90(s,3H),3.79(t,J=5.3Hz,2H),3.71(s,2H),3.65(t,J=6.3Hz,2H),3.54–3.43(m,8H),3.21(dd,J=12.2,6.2Hz,2H),2.69–2.62(m,4H),2.59(t,J=7.6Hz,2H),2.55–2.51(m,1H),2.32–2.26(m,1H),2.21(s,3H),2.13(t,J=7.5Hz,2H),2.11–2.03(m,1H),2.02–1.95(m,1H),1.84–1.76(m,4H),1.61–1.44(m,3H),1.38(s,3H),1.35(s,3H),1.12(s,3H),1.06–0.97(m,2H),0.82(s,3H). 13C NMR (151MHz, DMSO-d6) δ203.44,185.11,172.03,170.41,170.11,161.11,159.82,156.43,146.29,142.14,141. 78,141.39,135.87,133.79,129.49,129.12,128.21,127.10,126.92,125.44,122.19,121.69,110.72,100.89, 97.24,81.04,69.63,69.54,68.76,68.15,67.04,66.21,65.76,54.87,53.26,49.34,49.18,47.56,45.53,43.6 5,37.63,34.80,34.15,33.76,33.41,31.17,29.91,26.27,25.33,25.15,24.61,20.78,16.42,15.88.HRMS(ESI + )m / z calcd for C 62 H 80 N6O 13 [M+H] + 1117.5856; found 1117.5871.

[0404] 1.13 P6: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3] Preparation of 1-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)-3,6,9,12-tetraoxapentadecan-15-ester

[0405] 1.13.1 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-1-azido-3,6,9,12-tetraoxapentadecan-15-ester

[0406] Replacing 6-azidohexanoic acid with 1-azido-3,6,9,12-tetraoxapentadecan-15-acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-1-azido-3,6,9,12-tetraoxapentadecan-15-ester, with a yield of 66%. 1 H NMR (600MHz, DMSO-d6) δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.6Hz,1H),5.92(s,1H),5.16(d,J=17.8Hz,1H),4.84(d,J= 4.6Hz,1H),4.80(d,J=3.7Hz,1H),4.73(d,J=17.8Hz,1H),4.34–4.28(m,1H),3.67(t,J=6.3Hz,2H),3.61–3.59(m,2H),3.58–3 .50(m,12H),3.41–3.37(m,2H),2.67(t,J=6.3Hz,2H),2.57–2.51(m,1H),2.34–2.26(m,1H),2.09(qd,J=11.0,4.0Hz,1H),2. 04–1.93(m,1H),1.85–1.73(m,2H),1.63–1.46(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.07–0.96(m,2H),0.82(s,3H). 13C NMR(151MHz,DMSO-d6)δ203.42,185.09,170.40,170.09,156.39,127.10,121.68,110.72,97.24,81.04,69.80,69.78,69.76,69.67,69 .22,68.16,67.02,65.76,54.85,49.98,49.33,45.52,43.64,34.16,33.76,33.41,31.16,29.91,26.27,25.33,20.78,16.41.HRMS(ESI + )m / z calcd for C 35 H 51 N3O 11 [M+Na] + 712.3416; found 712.3401.

[0407] 1.13.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d] [1,3]dioxolane-8b-yl)-2-oxoethyl 1-(4-(4-((2-(((2-methoxy-6-(((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-4-oxobutyl)-1H-1,2,3-triazol-1-yl)-3,6,9,12-tetraoxapentadecan-15-ester

[0408] Replace 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate Replace with 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-1-azido-3, 6,9,12-Tetraoxapentadecan-15-ester, the remaining raw materials, reagents and preparation methods are the same as in 1.7.5, yielding a white solid 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2', 1':4,5]Indo[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(4-(4-((2-(((2-methoxy-6-(((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)-3,6,9,12-tetraoxapentadecan-15-ester, yield 51%. 1H NMR(600MHz,DMSO-d6)δ8.17(t,J=5.4Hz,1H),7.85(s,1H),7.82(d,J=8.1Hz,1H),7.48–7.42(m,3H),7.40–7.36(m,1H),7.35(d,J=10.1Hz,1H),7.30(d,J=7.2Hz,2H),7.27(t,J=7.6Hz,1H),7.19(d,J=7.5Hz,1H),6.51(d,J=8.0Hz,1H),6.17(dd,J=10.1,1.5Hz,1H),5.92(s,1H),5.45(s,2H),5.16(d,J=17.8Hz,1H),4.88(d,J=3.5Hz,1H),4.85(d,J=4.5Hz,1H),4.73(d,J=17.8Hz,1H),4.47(t,J=5.3Hz,2H),4.32(s,1H),3.97(s,2H),3.94(s,3H),3.80(t,J=5.3Hz,2H),3.67(t,J=6.3Hz,2H),3.54–3.45(m,12H),3.39–3.33(m,2H),2.90(t,J=6.2Hz,2H),2.67(t,J=6.3Hz,2H),2.61(t,J=7.6Hz,2H),2.56–2.51(m,1H),2.32–2.26(m,1H),2.22(s,3H),2.17(t,J=7.5Hz,2H),2.13–2.04(m,1H),2.00–1.96(m,1H),1.87–1.78(m,4H),1.61–1.44(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.07–0.94(m,2H),0.83(s,3H). 13C NMR(151MHz,DMSO-d6)δ203.45,185.13,172.50,170.41,170.12,162.19,160.35,156.49,146.25,143.46,142.18,141 .37,135.66,133.85,129.58,129.12,128.26,128.22,127.09,126.93,125.47,122.23,121.69,110.73,101.32,97.25 ,81.05,69.76,69.74,69.67,69.63,69.56,68.77,68.13,67.04,66.42,54.92,53.55,49.38,49.20,46.40,45.54,44. 36,43.68,35.71,34.75,34.17,33.78,33.42,31.19,29.92,26.28,25.35,25.00,24.60,20.78,16.43,15.91.HRMS(ESI + )m / z calcd for C 64 H 84 N6O 14 [M+H] + 1161.6118; found 1161.6111.

[0409] 1.14 P7: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1 Preparation of 3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionate

[0410] 1.14.1 Preparation of tert-butyl (2-(pentan-4-ynylamido)ethyl)carbamate

[0411] Replacing 5-hexynic acid with 4-pentynic acid, and using the same raw materials, reagents, and preparation methods as in 1.7.2, yielded a white solid, tert-butyl (2-(pent-4-ynylamido)ethyl)carbamate, with a yield of 88%. 1H NMR(600MHz,DMSO-d6)δ7.88(br s,1H),6.76(t,J=5.4Hz,1H),3.06(dd,J=12.5,6.3Hz,2H),2.96(dd,J=12.6,6.3Hz,2H) ,2.73(t,J=2.6Hz,1H),2.35(td,J=7.2,2.2Hz,2H),2.25(t,J=7.4Hz,2H),1.38(s,9H). 13 C NMR(151MHz,DMSO-d6)δ170.33,155.58,83.70,77.61,71.18,38.71,34.22,28.20,14.17.HRMS(ESI + )m / z calcd for C 12 H 20 N₂O₃[M+Na] + 263.1366; found 263.1360.

[0412] 1.14.2 Preparation of N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pent-4-yneamide

[0413] Replacing (2-(hexane-5-ynylamido)ethyl)tert-butyl carbamate with (2-(pentan-4-ynylamido)ethyl)butyl carbamate, and using the same raw materials, reagents, and preparation method as in 1.7.3, yielded a white solid, N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pentan-4-ynylamidoamide, with a yield of 63%. 1 H NMR(600MHz,DMSO-d6)δ7.88(t,J=5.5Hz,1H),7.64(d,J=7.9Hz,1H),7.49–7.43(m,3H),7 .38(t,J=7.4Hz,1H),7.31(d,J=7.4Hz,2H),7.27(t,J=7.6Hz,1H),7.18(d,J=7.3Hz,1H),6 .44(d,J=7.9Hz,1H),5.41(s,2H),3.90(s,3H),3.61(s,2H),3.18–3.12(m,2H),2.74(t,J =2.6Hz,1H),2.56(t,J=6.5Hz,2H),2.37–2.33(m,2H),2.27(t,J=7.3Hz,2H),2.22(s,3H). 13C NMR(151MHz,DMSO-d6)δ170.25,160.66,159.60,142.12,141.40,141.13,135.96,133.76,129.44,129.12,128.20 ,128.14,126.90,125.42,100.72,83.75,71.18,66.11,53.14,47.90,45.89,38.45,34.19,15.87,14.22.HRMS(ESI + )m / z calcd for C 28 H 31 N3O3[M+H] + 458.2438; found 458.2442.

[0414] 1.14.3 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2- d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionate

[0415] Replace 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate with 2-((6aR,6bS,7S,8aS,8bS,11aR,12) aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxacyclopentane-8b-yl)-2-oxoethyl 3-(2-(2-azidoethoxy)ethoxy)propionate, with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridine- 3-yl)methyl)amino)ethyl)hexyl-5-yneamide was replaced with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pent-4-yneamide. The remaining raw materials, reagents and preparation methods were the same as in 1.7.5, yielding a white solid 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b ,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 3-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionate, yield 41%. 1H NMR(600MHz,DMSO-d6)δ8.09(t,J=5.4Hz,1H),7.80(s,1H),7.74(d,J=8.0Hz,1H),7.48–7.43(m,3H),7.38(t,J=7.4Hz,1H),7.34(d,J=10.1Hz,1H),7.32–7.29(m,2H),7.27(t,J=7.6Hz,1H),7.18(d,J=7.5Hz,1H),6.48(d,J=8.0Hz,1H),6.17(dd,J=10.1,1.7Hz,1H),5.92(s,1H),5.43(s,2H),5.16(d,J=17.8Hz,1H),4.87(s,1H),4.84(d,J=4.5Hz,1H),4.73(d,J=17.9Hz,1H),4.45(t,J=5.3Hz,2H),4.32(br s,1H),3.93(s,3H),3.83(s,2H),3.78(t,J=5.3Hz,2H),3.64(t,J=6.3Hz,2H),3.53–3.47(m,4H),3.29(dd,J=11.9,6.0Hz,2H),2.86(t,J=7.7Hz,2H),2.76(t,J=6.1Hz,2H),2.66(t,J=6.2Hz,2H),2.55–2.50(m,1H),2.45(t,J=7.7Hz,2H),2.31–2.26(m,1H),2.22(s,3H),2.12–2.04(m,1H),2.00–1.95(m,1H),1.83–1.75(m,2H),1.61–1.45(m,3H),1.39(s,3H),1.36(s,3H),1.12(s,3H),1.06–0.97(m,2H),0.82(s,3H). 13C NMR (151MHz, DMSO-d6) δ203.46,185.12,171.66,170.41,170.11,161.58,160.06,156.45,145.81,142.51,142. 16,141.38,135.78,133.81,129.53,129.12,128.21,127.10,126.92,125.45,122.24,121.69,110.72,101.09, 97.24,81.04,69.53,69.43,68.76,68.14,67.06,66.30,65.75,54.89,53.42,49.36,49.22,47.04,45.54,44.9 9,43.66,36.78,34.86,34.15,33.77,33.41,31.18,29.91,26.27,25.33,21.16,20.78,16.42,15.90.HRMS(ESI + )m / z calcd for C 59 H 74 N6O 12 [M+H] + 1059.5437; found 1059.5436.

[0416] 1.15 P8: Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)-6-oxo-9,12,15-trioxa-2,5-diazaoctadecane-18-ester)

[0417] 1.15.1 Preparation of 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-1,4-dioxo-3,7,10,13-tetraoxahexadecane-16-acid

[0418] Replacing 6-azidohexanoic acid with 3,3'-((oxybis(ethane-2,1-diyl))bis(oxy))dipropionic acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-1,4-dioxo-3,7,10,13-tetraoxahexadecane-16-acid, with a yield of 67%. 1 HNMR(600MHz,DMSO-d6)δ7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.8Hz,1H),5.92(s,1H),5.16(d,J=17.8Hz,1H),4.88 –4.80(m,2H),4.73(d,J=17.8Hz,1H),4.33–4.30(m,1H),3.67(t,J=6.3Hz,2H),3.60(t,J=6.4Hz,2H),3.52–3.46(m,8H), 2.67(t,J=6.3Hz,2H),2.56–2.50(m,1H),2.43(t,J=6.4Hz,2H),2.33–2.25(m,1H),2.09(qd,J=11.1,4.0Hz,1H),2.03–1 .96(m,1H),1.82–1.75(m,2H),1.62–1.43(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.08–0.97(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.45,185.11,172.66,170.42,170.11,156.42,127.11,121.69,110.72,97.24,81.04,69.67,69.65,69.5 8,68.16,67.04,66.31,65.76,49.34,45.53,43.65,34.86,34.16,33.77,33.42,31.17,29.91,26.28,25.34,20.79,16.42.HRMS(ESI + )m / z calcd for C 34 H 48 O 12 [M+Na]+ 671.3038; found 671.3042.

[0419] 1.15.2 Preparation of tert-butyl (2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)carbamate

[0420] 420 mg of 2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)nicotinaldehyde was dissolved in 13 mL of dichloromethane. 222 mg of N-tert-butoxycarbonyl-1,2-ethylenediamine and 534 mg of sodium triacetoxyborohydride were added sequentially with stirring at room temperature. After stirring at room temperature for 5 hours, the reaction was quenched with 1 mL of methanol. The reaction solution was diluted with 200 mL of dichloromethane and washed sequentially with water and saturated sodium bicarbonate solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to obtain 580 mg of a yellow solid, which was tert-butyl (2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)carbamate, yield 96%). 1 HNMR(600MHz,DMSO-d6)δ7.61(d,J=7.9Hz,1H),7.48–7.43(m,3H),7.39–7.3 6(m,1H),7.32–7.28(m,2H),7.26(t,J=7.6Hz,1H),7.17(dd,J=7.6,1.1Hz,1H ),6.73(t,J=5.4Hz,1H),6.42(d,J=7.9Hz,1H),5.40(s,2H),3.89(s,3H),3.5 7(s,2H),3.05–2.99(m,2H),2.52(t,J=6.7Hz,2H),2.21(s,3H),1.37(s,9H). 13 C NMR(151MHz,DMSO-d6)δ160.61,159.58,155.61,142.13,141.42,141.05,135.98,133.77,129.45,129.13,1 28.21,128.16,126.91,125.43,113.57,100.68,77.48,66.11,53.13,48.26,45.98,28.22,15.88.HRMS(ESI + )m / z calcd for C 28 H 35 N3O4[M+H] +478.2700; found 478.2702.

[0421] 1.15.3 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)-6-oxo-9,12,15-trioxa-2,5-diazaoctadecane-18-ester)

[0422] 40 mg of tert-butyl (2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)carbamate was dissolved in 1 mL of 4 mol / L dioxane hydrochloride solution. After reacting for 1 hour, the pH was adjusted to greater than 7 with 2 mol / L sodium carbonate aqueous solution. The mixture was extracted with dichloromethane (50 mL × 3). The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated. The residue, without further purification, was dissolved in 2 mL of dichloromethane, and 50 mg of 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-decathoxy Dihydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-1,4-dioxo-3,7,10,13-tetraoxahexadecane-16-acid, 32 mg 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, 26 mg 1-hydroxybenzotriazole and 40 μL N,N-diisopropylethylamine. After stirring at room temperature for 3 hours, the reaction solution was diluted with 50 mL dichloromethane and washed successively with water and saturated sodium bicarbonate aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (dichloromethane:methanol = 98:2, V / V) to give 55 mg of a white solid, 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,1 2,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)-6-oxo-9,12,15-trioxa-2,5-diazaoctadecane-18-ester, in 65% yield. 1H NMR(600MHz,DMSO-d6)δ 8.22(br s,1H),7.82(d,J=8.0Hz,1H),7.49–7.42(m,3H),7.38(t,J=7.3Hz,1H),7.34(d,J=10.1Hz,1H),7.32–7.29(m,2H),7.27(t,J=7.4Hz,1H),7.19(d,J=7.3Hz,1H),6.52(d,J=8.0Hz,1H),6.17(d,J=10.1Hz,1H),5.92(s,1H),5.45(s,2H),5.16(d,J=17.8Hz,1H),4.88(s,1H),4.84(d,J=3.7Hz,1H),4.73(d,J=17.8Hz,1H),4.32(br s,1H),3.98(s,2H),3.95(s,3H),3.66(t,J=5.5Hz,2H),3.61(t,J=5.7Hz,2H),3.53–3.37(m,10H),2.94–2.87(m,2H),2.67(t,J=5.4Hz,2H),2.56–2.50(m,1H),2.35(t,J=5.6Hz,2H),2.32–2.26(m,1H),2.22(s,3H),2.13–2.04(m,1H),2.01–1.95(m,1H),1.83–1.76(m,2H),1.61–1.44(m,3H),1.38(s,3H),1.36(s,3H),1.12(s,3H),1.06–0.97(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.47,185.13,170.82,170.43,170.13,162.28,160.40,156.49,143.61,142.19,141.36,135.65,133.86,129.60,129.13,128.27,128.23,127.10,126.95,125.48,121.70,110.73,101.37,97.25,81.05,69.66,69.52,68.13,67.06,66.59,66.44,65.77,54.90,53.60,49.36,46.20,45.55,44.27,43.67,36.08,35.53,34.16,33.78,33.42,31.19,29.92,26.29,25.35,20.79,16.44,15.92.HRMS(ESI +)m / z calcd for C 57 H 73 N3O 13 [M+H] + 1008.5216; found 1008.5217.

[0423] 1.16 P9: Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)-6-oxo-9,12,15,18-tetraoxa-2,5-diazaeicosane-21-ester)

[0424] 1.16.1 Preparation of 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-1,4-dioxo-3,7,10,13,16-pentaenodecane-19-acid

[0425] Replacing 6-azidohexanoic acid with 4,7,10,13-tetraoxahexadecanoic acid, and using the same raw materials, reagents, and preparation method as in 1.7.4, yielded a white solid, 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-1,4-dioxo-3,7,10,13,16-pentaenodecanoic acid, with a yield of 32%. 1H NMR(600MHz,DMSO-d6)δ7.34(d,J=10.1Hz,1H),6.16(dd,J=10.1,1.8Hz,1H),5.92(s,1H),5.16(d,J=17.8Hz,1H),4.98–4.78(m,2H),4.73(d,J=17.8Hz,1H),4.36–4.24(m,1H),3.66(t,J=6.3Hz,2H),3.59(t,J=6.4Hz,2H),3.53–3.47(m,12H),2.67(t,J=6.3Hz,2H),2.56–2.51(m,1H),2.42(t,J=6.3Hz,2H),2.32–2.27(m,1H),2.08(qd,J=11.0,4.0Hz,1H),2.03–1.96(m,1H),1.82–1.75(m,2H),1.60–1.45(m,3H),1.39(s,3H),1.36(s,3H),1.13(s,3H),1.07–0.96(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.47,185.14,172.83,170.44,170.15,156.50,127.10,121.70,110.73,97.26,81.05,69.77,69.70,69.67,69.59,68.14,67.06,66.44,65.78,54.90,49.37,45.55,43.68,35.07,34.18,33.79,33.43,31.19,29.93,26.29,25.36,20.80,16.44.HRMS(ESI + )m / z calcd for C 36 H 52 O 13 [M+Na] + 715.3300;found 715.3300.

[0426] 1.16.2 Preparation of 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)-6-oxo-9,12,15,18-tetraoxa-2,5-diazaeicosane-21-ester)

[0427] 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-1,4-dioxo-3, 7,10,13-Tetraoxahexadecane-16-acid is replaced with 1-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3] (dioxolane-8b-yl)-1,4-dioxo-3,7,10,13,16-pentaenodecane-19-acid. The remaining raw materials, reagents, and preparation methods are the same as in 1.14.3. The resulting off-white solid is 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a) ,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 1-(2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)-6-oxo-9,12,15,18-tetraoxa-2,5-diazaeicosane-21-ester, yield 34%. 1HNMR(600MHz,DMSO-d6)δ8.19(s,1H),7.81(d,J=8.0Hz,1H),7.48–7.43(m,3H),7.38(t,J=7.3Hz,1H),7.34(d,J=10.1Hz,1H),7.32–7.29(m,2H),7.27(t,J=7.6Hz,1H),7.19(d,J=7.5Hz,1H),6.52(d,J=8.0Hz,1H),6.17(dd,J=10.1,1.2Hz,1H),5.92(s,1H),5.45(s,2H),5.16(d,J=17.8Hz,1H),4.86(d,J=3.5Hz,1H),4.84(d,J=4.3Hz,1H),4.73(d,J=17.8Hz,1H),4.31(s,1H),3.97(s,2H),3.95(s,3H),3.66(t,J=6.2Hz,2H),3.61(t,J=6.4Hz,2H),3.52–3.44(m,14H),2.89(t,J=6.0Hz,2H),2.66(d,J=6.2Hz,2H),2.55–2.51(m,1H),2.35(t,J=6.4Hz,2H),2.32–2.26(m,1H),2.22(s,3H),2.12–2.05(m,1H),2.04–1.96(m,1H),1.81–1.76(m,2H),1.60–1.44(m,3H),1.38(s,3H),1.36(s,3H),1.12(s,3H),1.07–0.97(m,2H),0.82(s,3H). 13 C NMR(151MHz,DMSO-d6)δ203.44,185.11,170.79,170.40,170.11,162.23,160.36,156.45,143.52,142.17,141.35,135.64,133.83,129.58,129.11,128.25,128.21,127.09,126.93,125.46,121.68,110.72,101.35,97.24,81.04,69.74,69.65,69.51,68.12,67.03,66.58,66.42,65.76,54.88,53.57,49.35,46.24,45.53,44.32,43.65,36.07,35.60,34.15,33.76,33.41,31.17,29.91,26.27,25.34,20.77,16.42,15.90.HRMS(ESI+ )m / z calcd for C 59 H 77 N3O 14 [M+H] + 1052.5478; found 1052.5487.

[0428] 1.17 PB1a: 2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS, Preparation of 11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate

[0429] 1.17.1 Preparation of 2-(2-azidoethoxy)ethyl 4-methylbenzenesulfonate

[0430] 500 mg of 2-(2-azidoethoxy)ethanol was dissolved in 38 mL of dry dichloromethane. Under stirring at room temperature, 1.1 mL of triethylamine, 872 mg of p-toluenesulfonyl chloride, and 93 mg of 4-dimethylaminopyridine were added sequentially. After reacting for 2 hours, the reaction solution was diluted with 250 mL of dichloromethane and washed successively with water and saturated ammonium chloride aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (petroleum ether:ethyl acetate = 9:1, V / V) to give 1.0 g of 2-(2-azidoethoxy)ethyl 4-methylbenzenesulfonate as a white solid, in 95% yield. 1 H NMR(600MHz,DMSO-d6)δ7.79(d,J=8.1Hz,2H),7.48(d,J=8.0Hz,2H),4.16–4.1 0(m,2H),3.64–3.59(m,2H),3.55–3.50(m,2H),3.36–3.31(m,2H),2.42(s,3H). 13 C NMR(151MHz,DMSO-d6)δ144.91,132.35,130.11(2C),127.60(2C),69.84,69.14,67.75,49.86,21.07.HRMS(ESI + )m / z calcd for C11 H 15 N3O4S[M+Na] + 308.0675; found 308.0678.

[0431] 1.17.2 Preparation of 2-(2-azidoethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl 2-oxoacetic acid ester and 2-(2-azidoethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate

[0432] 500 mg of desonide and 515 mg of 2-(2-azidoethoxy)ethyl 4-methylbenzenesulfonate were dissolved in 9 mL of N,N-dimethylformamide, and 498 mg of potassium carbonate and 199 mg of potassium iodide were added. The mixture was heated to 80 °C and stirred for 12 hours. After cooling, the reaction solution was diluted with 200 mL of ethyl acetate and washed successively with water and saturated sodium chloride aqueous solution. The organic phase was dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated, and the residue was separated by column chromatography (petroleum ether:ethyl acetate = 1:1, V / V) to give two white solid products:

[0433] 111 mg of 2-(2-azidoethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate, yield 17%. 1H NMR(600MHz,DMSO-d6)δ7.34–7.27(m,1H),6.17(d,J=10.1Hz,1H),5.92(s,1H),4.85–4.79(m,2H),4.4 3–4.31(m,2H),4.31–4.23(m,1H),3.75–3.65(m,2H),3.61(t,J=4.9Hz,2H),3.43–3.35(m,2H),2.58–2. 50(m,1H),2.34–2.27(m,1H),2.15–2.04(m,2H),2.03–1.98(m,1H),1.73–1.67(m,1H),1.66–1.56(m,2 H),1.55–1.48(m,1H),1.39(s,3H),1.35(s,3H),1.13(s,3H),1.08–0.96(m,2H),0.93(s,3H).HRMS(ESI + )m / z calcd for C 28 H 37 N3O8[M+H] + 544.2653; found 544.2671.

[0434] 184 mg of 2-(2-azidoethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate, 30% yield. 1H NMR (600MHz, DMSO-d6) δ7.32(d,J=10.0Hz,1H),6.16(d,J=10.0Hz,1H),5.92(s,1H),4.99(d,J=4.3Hz,1H),4. 73(s,1H),4.31–4.18(m,3H),3.72–3.67(m,2H),3.67–3.55(m,2H),3.45–3.36(m,2H),2.56–2.48(m,1H),2.3 5–2.26(m,1H),2.12–2.04(m,1H),2.04–1.95(m,1H),1.73(d,J=13.5Hz,1H),1.67(d,J=12.7Hz,1H),1.61–1. 55(m,2H),1.49–1.42(m,1H),1.39(s,3H),1.32(s,3H),1.11(s,3H),1.07–0.93(m,2H),0.90(s,3H).HRMS(ESI + )m / z calcd for C 27 H 37 N3O7[M+H] + 516.2704; found 516.2710.

[0435] 1.17.3 Preparation of 2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl 2-((6aR,6bS,7S,8aS,8) bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate

[0436] Replace 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate with 2-(2-azidoethoxy)ethyl 2-((6aR,6bS, 7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate, with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridine-3 The 2-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pentan-4-yl)acetamide is replaced with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pentan-4-yl)acetamide. The remaining raw materials, reagents and preparation methods are the same as in 1.7.5. The white solid obtained is 2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)methoxy)pyridin-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)methoxy)pyridin-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-yl)methoxy)methoxy)pyridin-3-yl)methoxy)pyridin-3-yl)methoxy)phenyl ... -Oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate, yield 53%. 1H NMR(600MHz,DMSO-d6)δ8.27(t,J=5.4Hz,1H),7.84(d,J=8.1Hz,1H),7.80(s,1H),7.49–7.41(m,3H),7.38(t,J=7.3Hz,1H),7.34(d,J=10.0Hz,1H),7.31–7.29(m,2H),7.27(t,J=7.5Hz,1H),7.19(d,J=7.6Hz,1H),6.53(d,J=8.1Hz,1H),6.16(d,J=10.0Hz,1H),5.92(s,1H),5.45(s,2H),4.88(d,J=3.6Hz,1H),4.82(d,J=4.3Hz,1H),4.46(t,J=5.1Hz,2H),4.38–4.26(m,3H),4.04(s,2H),3.94(d,J=9.7Hz,3H),3.81(t,J=5.2Hz,2H),3.72–3.62(m,2H),3.42–3.36(m,2H),2.96(t,J=6.0Hz,2H),2.86(t,J=7.6Hz,2H),2.55–2.51(m,1H),2.46(t,J=7.7Hz,2H),2.31–2.26(m,1H),2.22(s,3H),2.16–2.04(m,2H),2.03–1.96(m,1H),1.69(d,J=11.2Hz,1H),1.65–1.56(m,2H),1.53–1.45(m,1H),1.39(s,3H),1.34(s,3H),1.08(s,3H),1.06–0.97(m,2H),0.93(s,3H). 13C NMR(151MHz,DMSO-d6)δ197.67,185.13,172.06,170.15,163.80,162.48,160.49,156.51,145.76,143.89,1 42.18,141.34,135.59,133.86,129.61,129.11,128.27,128.22,127.09,126.94,125.47,122.22,121.66,1 11.15,101.44,97.19,82.78,68.68,68.30,67.61,66.47,64.72,54.80,53.63,49.85,49.13,47.30,46.13, 44.08,43.66,35.15,34.80,33.83,33.13,31.18,30.13,26.19,25.49,21.03,20.80,16.89,15.91.HRMS(ESI + )m / z calcd for C 56 H 68 N6O 11 [M+H] + 1001.5019; found 1001.5033.

[0437] 1.18 PB1b: 2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate

[0438] Replace 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate with 2-(2-azidoethoxy)ethyl(6aR,6b S,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate, with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridine-3 The 2-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pentan-4-yl)acetamide is replaced with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pentan-4-yl)acetamide. The remaining raw materials, reagents and preparation methods are the same as in 1.7.5. The white solid obtained is 2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl) (amino)-3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate, 58% yield. 1H NMR(600MHz,DMSO-d6)δ8.24(t,J=5.5Hz,1H),7.84–7.79(m,2H),7.51–7.41(m,3H),7.38(t,J=7.4Hz,1H),7.33(d,J=10.1Hz,1H),7.31–7.29(m,2H),7.27(t,J=7.6Hz,1H),7.19(d,J=7.6Hz,1H),6.53(d,J=8.0Hz,1H),6.16(dd,J=10.0,1.0Hz,1H),5.91(s,1H),5.45(s,2H),4.95(d,J=4.4Hz,1H),4.80(d,J=3.7Hz,1H),4.47(t,J=5.2Hz,2H),4.29–4.27(m,1H),4.26–4.16(m,2H),4.04(s,2H),3.95(s,3H),3.81(t,J=5.2Hz,2H),3.63(t,J=4.6Hz,2H),3.41–3.36(m,2H),2.95(t,J=6.1Hz,2H),2.86(t,J=7.7Hz,2H),2.55–2.50(m,1H),2.46(t,J=7.7Hz,2H),2.32–2.25(m,1H),2.22(s,3H),2.09–2.02(m,1H),2.02–1.94(m,1H),1.74–1.67(m,1H),1.67–1.60(m,1H),1.59–1.51(m,2H),1.50–1.40(m,1H),1.39(s,3H),1.30(s,3H),1.06(s,3H),1.03–0.98(m,1H),0.95(dd,J=10.9,3.3Hz,1H),0.87(s,3H). 13C NMR(151MHz,DMSO-d6)δ185.12,172.06,171.69,170.21,162.45,160.47,156.55,145.73,143.82,142.1 8,141.34,135.59,133.85,129.61,129.12,128.27,128.22,127.06,126.95,125.47,122.28,121.65,11 0.18,101.45,93.70,81.38,68.67,68.19,67.97,66.46,63.45,55.11,53.63,49.21,48.50,46.20,45.5 0,44.16,43.70,34.79,33.82,33.53,31.19,30.08,26.32,25.10,21.04,20.76,16.81,15.91.HRMS(ESI + )m / z calcd for C 55 H 68 N6O 10 [M+H] + 973.5070; found 973.5077.

[0439] 1.19 Preparation of PB2b: 2-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate

[0440] 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxo Ethyl 6-azidohexanoate is replaced with 2-(2-azidoethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2] -d][1,3]dioxolane-8b-carboxylate, the remaining raw materials, reagents and preparation methods are the same as in 1.7.5, yielding a white solid 2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl (6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxylate, 55% yield. 1H NMR(600MHz,DMSO-d6)δ8.18(t,J=4.8Hz,1H),7.84(s,1H),7.82(d,J=8.1Hz,1H),7.48–7.43(m,3H),7.38(t,J=7.4Hz,1H),7.34(d,J=10.1Hz,1H),7.32–7.29(m,2H),7.27(t,J=7.6Hz,1H),7.19(d,J=7.5Hz,1H),6.51(d,J=8.0Hz,1H),6.16(d,J=10.0Hz,1H),5.91(s,1H),5.44(s,2H),4.96(d,J=3.8Hz,1H),4.84(d,J=3.2Hz,1H),4.48(t,J=4.9Hz,2H),4.28(s,1H),4.26–4.17(m,2H),3.99(s,2H),3.94(s,3H),3.82(t,J=5.0Hz,2H),3.64(t,J=4.1Hz,2H),3.40–3.36(m,2H),2.91(t,J=6.0Hz,2H),2.60(t,J=7.5Hz,2H),2.54–2.49(m,1H),2.30–2.26(m,1H),2.22(s,3H),2.16(t,J=7.4Hz,2H),2.12–2.02(m,1H),2.01–1.96(m,1H),1.88–1.78(m,2H),1.72(d,J=13.5Hz,1H),1.65(d,J=11.9Hz,1H),1.60–1.51(m,2H),1.50–1.41(m,1H),1.39(s,3H),1.30(s,3H),1.06(s,3H),1.03–0.93(m,2H),0.88(s,3H). 13C NMR(151MHz,DMSO-d6)δ185.12,172.50,171.70,170.21,162.29,160.39,156.57,146.29,143.61,142.18,1 41.35,135.63,133.85,129.59,129.12,128.26,128.22,127.05,126.93,125.46,122.21,121.65,110.18,1 01.37,93.70,81.39,68.69,68.18,67.99,66.43,63.48,55.15,53.58,49.19,48.52,46.28,45.51,44.25,4 3.71,35.49,34.75,33.83,33.53,31.20,30.09,26.31,25.10,24.96,24.61,20.76,16.81,15.91.HRMS (ESI + )m / z calcd for C 56 H 70 N6O 10 [M+H] + 987.5226; found 987.5233.

[0441] 1.20 PB3a: 2-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)ethyl 2-((6aR,6bS,7S,8aS) ,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate

[0442] 1.20.1 Preparation of 2-(2-(2-azidoethoxy)ethoxy)ethyl 4-methylbenzenesulfonate

[0443] Replacing 2-(2-azidoethoxy)ethanol with 2-[2-(2-azidoethoxy)ethoxy]ethanol, and using the same raw materials, reagents, and preparation method as in 1.16.1, yielded a white solid, 2-(2-(2-azidoethoxy)ethoxy)ethyl 4-methylbenzenesulfonate, with a yield of 92%. 1H NMR (600MHz, DMSO-d6) δ7.79(d,J=7.9Hz,2H),7.48(d,J=7.9Hz,2H),4.14–4.07(m,2H),3. 60–3.58(m,2H),3.56(t,J=4.8Hz,2H),3.51–3.46(m,4H),3.39–3.36(m,2H),2.42(s,3H). 13 C NMR(151MHz,DMSO-d6)δ144.88,132.42,130.11(2C),127.60(2C),69.94,69.71,69.53,69.23,67.90,49.95,21.06.HRMS(ESI + )m / z calcd for C 13 H 19 N3O5S[M+K] + 368.0677; found 368.0672.

[0444] 1.20.2 Preparation of 2-(2-(2-azidoethoxy)ethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate

[0445] Replacing 2-(2-azidoethoxy)ethyl 4-methylbenzenesulfonate with 2-(2-(2-azidoethoxy)ethoxy)ethyl 4-methylbenzenesulfonate, and following the other required raw materials, reagents, and preparation method (1.16.2), a white solid product was isolated as 2-(2-(2-azidoethoxy)ethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate, with a yield of 23%. 1H NMR (600MHz, DMSO-d6) δ7.31(d,J=10.1Hz,1H),6.17(d,J=9.9Hz,1H),5.92(s,1H),4.82(s,2H),4.44–4. 37(m,1H),4.35–4.26(m,2H),3.72–3.63(m,2H),3.61–3.57(m,2H),3.56–3.53(m,4H),3.41–3.35(m,2H) ,2.56–2.48(m,1H),2.31–2.27(m,1H),2.16–2.03(m,2H),2.04–1.91(m,1H),1.70(d,J=11.3Hz,1H),1.6 5–1.57(m,2H),1.55–1.47(m,1H),1.39(s,3H),1.35(s,3H),1.13(s,3H),1.08–0.97(m,2H),0.93(s,3H). 13 C NMR(151MHz,DMSO-d6)δ197.73,185.12,170.15,163.90,156.46,127.11,121.67,111.14,97.19,82.79,69.72,69.65,69.26 ,68.36,67.86,64.89,54.82,49.97,49.84,47.30,43.66,33.85,33.14,31.19,30.13,26.18,25.48,20.82,16.90.HRMS(ESI + )m / z calcd for C 30 H 41 N3O9[M+Na] + 610.2735; found 610.2747.

[0446] 1.20.3 Preparation of 2-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)ethyl 2-((6aR,6bS,7S,8a S,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate

[0447] Replace 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl 6-azidohexanoate with 2-(2-(2-azidoethoxy)ethoxy)ethyl 2-((6aR, 6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate, with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridine-3 The 2-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)pentan-4-yl)acetamide is replaced with N-(2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)pentan-4-yl)acetamide. The remaining raw materials, reagents and preparation methods are the same as in 1.7.5. The white solid obtained is 2-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3- Oxypropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)ethyl 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoacetate, yield 59%. 1H NMR(600MHz,DMSO-d6)δ8.28(br s,1H),7.84(d,J=7.8Hz,1H),7.81(s,1H),7.49–7.43(m,3H),7.41–7.25(m,5H),7.19(d,J=7.2Hz,1H),6.52(d,J=7.8Hz,1H),6.16(d,J=10.0Hz,1H),5.92(s,1H),5.45(s,2H),4.88(s,1H),4.82(s,1H),4.47–4.42(m,2H),4.41–4.26(m,3H),4.02(s,2H),3.95(s,3H),3.81–3.74(m,2H),3.67–3.59(m,2H),3.55–3.49(m,4H),3.40–3.34(m,2H),2.98–2.91(m,2H),2.86(t,J=7.3Hz,2H),2.57–2.49(m,1H),2.46(t,J=7.3Hz,2H),2.33–2.26(m,1H),2.22(s,3H),2.16–2.02(m,2H),2.04–1.94(m,1H),1.74–1.66(m,1H),1.65–1.55(m,2H),1.54–1.46(m,1H),1.39(s,3H),1.34(s,3H),1.11(s,3H),1.06–0.96(m,2H),0.93(s,3H). 13 C NMR(151MHz,DMSO-d6)δ197.73,185.15,172.01,170.18,163.87,162.38,160.45,156.53,145.75,143.76,142.19,141.35,135.62,133.86,129.61,129.12,128.27,128.23,127.09,126.95,125.48,122.26,121.66,111.14,101.40,97.19,82.78,69.54,69.51,68.78,68.32,67.81,66.46,64.88,54.84,53.61,49.85,49.19,47.31,46.20,44.15,43.67,35.31,34.82,33.84,33.14,31.19,30.14,26.18,25.48,21.04,20.81,16.90,15.92.HRMS(ESI + )m / z calcd for C 58 H 72N6O 12 [M+H] + 1045.5281; found 1045.5299.

[0448] 1.21Cpd1: 8-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)octyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxane-8b-carboxylic acid ester

[0449] 1.21.1 2-[(8-bromooctyl)oxy]tetrahydropyran

[0450] At 0 °C, p-toluenesulfonic acid (248 mg, 1.44 mmol) was added to a dry tetrahydrofuran (50 mL) solution of 8-bromooctyl-1-ol (4 g, 19.23 mmol) and 3,4-2H-dihydropyran (2.4 g, 28.85 mmol). The reaction mixture was stirred at room temperature for 3 hours, then quenched with a saturated aqueous sodium bicarbonate solution. The reaction mixture separated into layers, and the organic phase was separated. The aqueous phase was extracted with dichloromethane (50 mL x 3). The combined organic phases were concentrated to give a red oily substance, 2-[(8-bromooctyl)oxy]tetrahydropyran (7.7 g, crude). LC-MS: [M+H] + =279.1.

[0451] 1.21.2 3-(4-{[8-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)octyl]oxy}phenyl)prop-1-ol

[0452] 2-[(8-bromooctyl)oxy]tetrahydropyran (7 g, 23.9 mmol), 4-(3-hydroxypropyl)phenol (1.82 g, 11.95 mmol), potassium carbonate (9.89 g, 71.7 mmol), and potassium iodide (1.82 g, 11.95 mmol) were mixed in acetonitrile. The reaction mixture was stirred at 80 °C for 16 hours and then cooled to room temperature. The reaction mixture was filtered through diatomaceous earth, and the filtrate was concentrated and purified by column chromatography (petroleum ether / ethyl acetate = 86 / 17) to give an oily product 3-(4-{[8-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)octyl]oxy}phenyl)prop-1-ol (2.8 g, yield 32.18%). LC-MS: [M+Na] + =387.3.

[0453] 1.21.3 3-(4-{[8-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)octyl]oxy}phenyl)propanal

[0454] At room temperature, 3-(4-{[8-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)octyl]oxy}phenyl)propan-1-ol (2.8 g, 7.69 mmol) and Dys-Martin oxidant (6.5 g, 15.38 mmol) were mixed in dichloromethane (20 mL) and stirred for 2 hours. The reaction mixture was concentrated and purified by column chromatography (petroleum ether / ethyl acetate = 10 / 1) to give an oily product 3-(4-{[8-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)octyl]oxy}phenyl)propanal (2.5 g, yield 89.93%). LC-MS: [M+H] + =385.3.

[0455] 1.21.4 3-{4-[(8-hydroxyoctyl)oxy]phenyl}propionaldehyde

[0456] At room temperature, 1 g (2.76 mmol) of 3-(4-{[8-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)octyl]oxy}phenyl)propanal and 3 mL of concentrated hydrochloric acid were stirred in a mixture of 3 mL of water and 20 mL of tetrahydrofuran for 2 hours. The reaction mixture was quenched with saturated sodium thiosulfate solution and extracted with 30 mL of ethyl acetate. The organic phase was washed with water and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 10 / 1) to give a yellow oily substance, 3-{4-[(8-hydroxyoctyl)oxy]phenyl}propanal (257 mg, yield 33.51%). LC-MS: [M+H] + =279.1.

[0457] 1.21.5 4-Methylbenzenesulfonic acid-8-{[4-(2-formylethyl)phenyl]oxy}octyl ester

[0458] 3-{4-[(8-hydroxyoctyl)oxy]phenyl}propanal (257 mg, 0.92 mmol), triethylamine (280 mg, 2.76 mmol), and 4-dimethylaminopyridine (56 mg, 0.46 mmol) were mixed in dichloromethane (3 mL). The reaction mixture was cooled to 0 °C, and then p-toluenesulfonyl chloride (439 mg, 2.3 mmol) was added. The reaction mixture was stirred at room temperature for 16 hours, quenched with saturated sodium bicarbonate solution, and extracted with ethyl acetate (10 mL x 4). The organic phases were combined and concentrated, and the crude product was purified by column chromatography (petroleum ether / ethyl acetate = 83 / 17) to give an oily product 4-methylbenzenesulfonic acid-8-{[4-(2-formylethyl)phenyl]oxy}octyl ester (90 mg, yield 22.67%). LC-MS: [M-18] + =415.3.

[0459] 1.21.6(4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-ylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid-8-{[4-(2-formylethyl)phenyl]oxy}octyl ester.

[0460] 4-Methylbenzenesulfonic acid-8-{[4-(2-formylethyl)phenyl]oxy}octyl ester (90 mg, 0.208 mmol), (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,1 2-Dodecyl-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxane-6β-carboxylic acid (19 mg, 0.208 mmol), potassium carbonate (86 mg, 0.624 mmol), and potassium iodide (17 mg, 0.104 mmol) were mixed in N,N-dimethylformamide (2 mL). The reaction mixture was heated to 80 °C and stirred for 16 hours. The reaction mixture was cooled to room temperature, quenched with water, and extracted with ethyl acetate (10 mL x 3). The organic phases were combined and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 86 / 17) to give a white solid (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-8-{[4-(2-formylethyl)phenyl]oxy}octyl ester (66 mg, yield 47.83%). LC-MS: [M+H] + =663.3.

[0461] 1.21.7 8-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)octyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxane-8b-carboxylic acid ester.

[0462] (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid-8-{[4-(2-formylethyl)phenyl]oxy}octyl ester (66 mg, 0.1 mmol) and 1-(thiophene-2-yl)-2-(triphenyl-λ5-methylphosphine)ethyl-1-one (58 mg, 0.15 mmol) were mixed in N,N-dimethylformamide (2 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. The reaction solution was cooled to room temperature and purified by reverse-phase chromatography to give a white solid 8-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)octyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester (38.2 mg, yield 49.61%). LC-MS: [M+H] + =771.3; 1 H NMR(400MHz, CDCl3-d6)δ7.71(dd,J=3.8,1.1Hz,1H),7.64(dd,J=5.0,1.1Hz,1H),7.24–7.06(m,5H),6.8 1(dd,J=18.0,12.0Hz,3H),6.26(dd,J=10.1,1.8Hz,1H),6.02(s,1H),5.14(d,J=5.0Hz,1H),4.48(s,1H) ,4.30–4.09(m,2H),3.93(t,J=6.4Hz,2H),2.78(t,J=7.5Hz,2H),2.58(dt,J=22.7,7.5Hz,3H),2.34(d,J =13.1Hz,1H),2.21–1.94(m,3H),1.80–1.58(m,8H),1.47–1.34(m,13H),1.28–1.07(m,7H),0.99(s,3H).

[0463] 1.22 Cpd2: 10-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)decyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxane-8b-carboxylic acid ester.

[0464] 1.23.1 2-[(10-bromodecyl)oxy]tetrahydropyran

[0465] At room temperature, p-toluenesulfonic acid (95 mg, 0.5 mmol) was added to a solution of 10-bromodecyl-1-ol (2.37 g, 10 mmol) and 3,4-2H-dihydropyran (925 mg, 11 mmol) in dichloromethane (200 mL). After stirring the reaction mixture at room temperature for 3 hours, the mixture was quenched with a saturated sodium bicarbonate aqueous solution (50 mL), the organic phase was separated, washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to obtain a brown liquid, 2-[(10-bromodecyl)oxy]tetrahydropyran (3.2 g, 100% yield). This crude product was used directly in the next reaction step. 1 HNMR: (400MHz, CDCl3)4.95(m,1H),3.90-3.85(m,2H),3.54-3.49(m,2H),3 .42-3.36(m,2H),1.89-1.72(m,6h),1.66-1.51(m,6H),1.38-1.24(m,10H).

[0466] 1.23.2 3-(4-{[10-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)decyl]oxy}phenyl)prop-1-ol

[0467] 2-[(10-bromodecyl)oxy]tetrahydropyran (3.2 g, 10 mmol), 4-(3-hydroxypropyl)phenol (1.52 g, 10 mmol), potassium carbonate (4.145 g, 30 mmol), and potassium iodide (664 mg, 4 mmol) were mixed in acetonitrile. The reaction mixture was heated to 80 °C and stirred for 16 hours. After cooling to room temperature, the mixture was filtered, and the filtrate was concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a colorless oily product 3-(4-{[10-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)decyl]oxy}phenyl)prop-1-ol (3 g, yield 76%). LCMS: Ret: 2.47 min; [M+Na] +=415.3; 94.33% purity at 214nm.

[0468] 1.23.3 3-(4-{[10-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)decyl]oxy}phenyl)propanal

[0469] At 0 °C, 6.48 g (15.3 mmol) of Des Martin oxidant was added to a solution of 3-(4-{[10-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)decyl]oxy}phenyl)propan-1-ol (3 g, 7.6 mmol) in 80 mL of dichloromethane. The reaction mixture was stirred at room temperature for 2 hours, diluted with 150 mL of dichloromethane, quenched with 60 mL of saturated sodium thiosulfate aqueous solution, and separated. The organic phase was washed with 80 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 7 / 1) to give a colorless oily substance, 3-(4-{[10-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)decyl]oxy}phenyl)propanal (2 g, yield 67%). LCMS:Ret: 3.11 min; [M+Na] + =413.2; 96.75% purity at 214nm.

[0470] 1.23.4 3-{4-[(10-hydroxydecyl)oxy]phenyl}propionaldehyde

[0471] At room temperature, hydrochloric acid (6M, 8 mL, 48 mmol) was added to a solution of 3-(4-{[10-(3,4,5,6-tetrahydro-2H-pyran-2-yloxy)decyl]oxy}phenyl)propanal (2 g, 5.1 mmol) in tetrahydrofuran (40 mL). The reaction mixture was stirred at room temperature for 16 hours, then diluted with dichloromethane (150 mL), quenched with water (60 mL), and separated. The organic phase was washed with saturated brine (80 mL), dried, and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a colorless oily product 3-{4-[(10-hydroxydecyl)oxy]phenyl}propanal (1 g, 64% yield). LCMS: Ret: 1.86 min; [M+Na] + =329.3; 100% purity at 214nm.

[0472] 1.23.5 4-Methylbenzenesulfonic acid-10-{[4-(2-formylethyl)phenyl]oxy}decyl ester

[0473] At room temperature, p-toluenesulfonyl chloride (1.24 g, 6.52 mmol) was added to dichloromethane (100 mL) containing 3-{4-[(10-hydroxydecyl)oxy]phenyl}propionaldehyde (1 g, 3.26 mmol), triethylamine (990 mg, 9.78 mmol), and 4-dimethylaminopyridine (399 mg, 3.26 mmol). The reaction mixture was stirred at room temperature for 16 hours, quenched with saturated sodium bicarbonate aqueous solution (50 mL), and separated. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 5 / 1) to give a colorless oil, 4-methylbenzenesulfonic acid-10-{[4-(2-formylethyl)phenyl]oxy}decyl ester (300 mg, yield 20%). LCMS: Ret: 3.31 min; [M+Na] + =478.1; 61.53% purity at214nm.

[0474] 1.23.6(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-10-{[4-(3-formylpropyl)phenyl]oxy}decyl ester

[0475] (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid 100 mg (0.248 mmol), 10-[4-(2-formylethyl)phenyl]oxy}decyl ester (300 mg, 0.651 mmol), potassium carbonate (103 mg, 0.745 mmol), and potassium iodide (16 mg, 0.099 mmol) were mixed in N,N-dimethylformamide (2 mL). The reaction mixture was heated to 80 °C and stirred for 16 hours. After cooling to room temperature, the reaction mixture was quenched with water (50 mL) and extracted with ethyl acetate (40 mL x 3). The combined organic phases were washed successively with water (30 mL x 2) and saturated brine (40 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a white solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-10-{[4-(3-formylpropyl)phenyl]oxy}decyl ester (120 mg, 70% yield). LCMS: Ret: 3.12 min; [M+H] + =691.3; 97.09% purity at 214nm.

[0476] 1.22.7 10-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)decyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester

[0477] (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid-10-{[4-(3-formylpropyl)phenyl]oxy}decyl ester (120 mg, 0.174 mmol) and 1-(thiophene-2-yl)-2-(triphenyl-λ5-methylphosphine)ethyl-1-one (100 mg, 0.259 mmol) were mixed in chloroform (5 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. The reaction solution was concentrated after cooling to room temperature. The crude product was first purified by column chromatography (dichloromethane / methanol = 19 / 1), and then purified by reverse-phase chromatography to obtain a white solid 10-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)decyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester (22 mg, yield 15.8%). LCMS:Ret:3.81min; [M+H] + =799.2; 99.03% purity at 214nm. 1 H NMR (400MHz, CDCl3) δ7.71(m,1H),7.65(m,1H),7.25-7.10(m,5H),6.84-6.76(m,3H),6.27(d d,J1=2.0Hz,J2=10.0Hz,1H),6.02(s,1H),5.14(d,J=4.8Hz,1H),4.49(m,1H),4.24-4.13(m,2 H),3.93(t,J=6.4Hz,2H),2.83-2.76(m,2H),2.61-2.52(m,3H),2.34(m,1H),2.34-1.96(m,3 H),1.78-1.66(m,7H),1.56-1.42(m,9H),1.38-1.27(m,10H),1.22-1.10(m,6H),0.99(s,3H).

[0478] 1.23 Cpd3: 7-O-7-(4-(3-(4-((E)-5-O-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)propyl)piperazin-1-yl)heptyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester

[0479] 1.23.1(4aR,5S,6aS,6bS,9aR)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-ylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid

[0480] At room temperature, a methanol (60 mL) solution of potassium hydroxide (4.04 g, 72 mmol) was added to a methanol (40 mL) solution of (4aR,5S,6aS,6bS,9aR)-5-hydroxy-6b-(2-hydroxyacetyl)-4a,6a,8,8-tetramethyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxane-2-one (10 g, 24 mmol). The reaction mixture was stirred at room temperature for 16 hours, then diluted with water (200 mL) and extracted with dichloromethane (80 mL x 2). The aqueous phase was adjusted to pH 2 with 1 N hydrochloric acid and then extracted with ethyl acetate (200 mL). The ethyl acetate phase was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give a white solid (4aR,5S,6aS,6bS,9aR)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid (8 g, yield 82.8%). This crude product was used directly in the next reaction. LCMS: Ret: 1.51 min; [M+H] + =403.0; 91.37% purity at 214nm.

[0481] 1.23.2(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-7-methoxy-7-oxylidene heptaethyl ester

[0482] (4aR,5S,6aS,6bS,9aR)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid (400 mg, 0.994 mmol), methyl 7-bromoheptanoate (665 mg, 2.181 mmol), potassium carbonate (412 mg, 2.181 mmol), and potassium iodide (66 mg, 0.398 mmol) were mixed in acetonitrile (4 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. After cooling the reaction solution to room temperature, it was quenched with a saturated sodium bicarbonate aqueous solution (50 mL) and extracted with ethyl acetate (100 mL x 4). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 3 / 1) to give a white solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-7-methoxy-7-oxomethylene-heptanyl ester (530 mg, 98% yield). LCMS:Ret:1.77min; [M+H] + =545.2; 100% purity at 214nm.

[0483] 1.23.3 7-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)heptanoic acid

[0484] At room temperature, lithium hydroxide (407 mg, 9.7 mmol) was added to a mixture of (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-7-methoxy-7-oxylidene heptayl ester (530 mg, 0.97 mmol) in methanol (2.5 mL) and water (2.5 mL). The reaction mixture was stirred at room temperature for 16 hours, diluted with water (20 mL), and the pH was adjusted to 2 with hydrochloric acid. The mixture was then extracted with ethyl acetate (20 mL x 3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to give a white solid 7-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)heptanoic acid (396 mg, yield 76%). This crude product was used directly in the next reaction. LCMS: Ret: 1.71 min; [M+H] + =531.3; 96.1% purity at 214nm.

[0485] 1.23.4 1-(thiophen-2-yl)-2-(triphenyl-λ) 5 (-methylphosphine) ethyl-1-one.

[0486] 2-Bromo-1-(thien-2-yl)ethyl-1-one (200 mg, 0.98 mmol), triphenylphosphine (283 mg, 1.08 mmol), and triethylamine (10 mg, 0.1 mmol) were mixed in toluene (5 mL) and stirred for 18 hours at room temperature. The reaction mixture was filtered to give a white solid, which was then mixed with sodium carbonate (115 mg) in dichloromethane (20 mL) and stirred for another 18 hours at room temperature. The reaction mixture was concentrated and purified by column chromatography (petroleum ether / ethyl acetate = 1 / 9) to give a white solid 1-(thien-2-yl)-2-(triphenyl-λ5-methylphosphine)ethyl-1-one (300 mg, 79% yield). LCMS: Ret: 1.68 min; [M+H] + =387.0; 97.04% purity at 254nm.

[0487] 1.23.5 4-(3-{[4-(3-hydroxypropyl)phenyl]oxy}propyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester

[0488] 4-(3-hydroxypropyl)phenol (1.49 g, 9.8 mmol), 4-(3-bromopropyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (3 g, 9.8 mmol), potassium carbonate (4 g, 29.4 mmol), and potassium iodide (650 mg, 3.92 mmol) were mixed in acetonitrile (14 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. After cooling to room temperature, the reaction mixture was quenched with saturated sodium bicarbonate aqueous solution (40 mL) and extracted with ethyl acetate (14 mL x 3). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 3 / 1) to give a white solid 4-(3-{[4-(3-hydroxypropyl)phenyl]oxy}propyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (1.3 g, 35% yield). LCMS:Ret:1.31min; [M+H] + =379.4; 99.77% purity at 214nm.

[0489] 1.23.6 4-(3-{[4-(2-formylethyl)phenyl]oxy}propyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester

[0490] 4-(3-{[4-(3-hydroxypropyl)phenyl]oxy}propyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (600 mg, 1.59 mmol) and 2-iodobenzoic acid (888 mg, 3.17 mmol) were mixed in ethyl acetate (20 mL), and the reaction mixture was heated to 70 °C and stirred for 16 hours. After cooling to room temperature, the mixture was filtered, and the filtrate was concentrated and purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a brown oily product, 4-(3-{[4-(2-formylethyl)phenyl]oxy}propyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (550 mg, yield 91.9%). LCMS: Ret: 1.61 min, 1.68 min and 1.71 min; [M+H] + =377.1; 52.27% purity at 214nm.

[0491] 1.23.7 ​​3-(4-{[3-(piperazin-1-yl)propyl]oxy}phenyl)propanal

[0492] 4-(3-{[4-(2-formylethyl)phenyl]oxy}propyl)piperazin-1-carboxylic acid-2-methylpropyl-2-yl ester (550 mg, 1.46 mmol) was stirred in a mixture of trifluoroacetic acid (8 mL) and dichloromethane (20 mL) at room temperature for 2 hours. The reaction mixture was concentrated to give a brown oily substance, 3-(4-{[3-(piperazin-1-yl)propyl]oxy}phenyl)propionaldehyde (400 mg, 99% yield), which was used directly in the next reaction. LCMS: Ret: 1.27 min and 1.31 min; [M+H] + =277.2; 21.89% purity at 214nm.

[0493] 1.23.8(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-7-[4-(3-{[4-(2-formylethyl)phenyl]oxy}propyl)piperazin-1-yl]-7-oxylideneheptyl ester

[0494] 7-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)heptanoic acid (390 mg, 0 3-(4-{[3-(piperazin-1-yl)propyl]oxy}phenyl)propanal (406 mg, 1.469 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (335 mg, 0.882 mmol), and diisopropylethylamine (285 mg, 2.205 mmol) were mixed in N,N-dimethylformamide (10 mL), and the reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was quenched with water (60 mL) and extracted with ethyl acetate (100 mL x 3). The organic phases were combined and washed successively with water (60 mL x 3) and saturated brine (60 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by column chromatography (dichloromethane / methanol = 19 / 1) to give a brown oily substance (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-7-[4-(3-{[4-(2-formylethyl)phenyl]oxy}propyl)piperazin-1-yl]-7-oxylidene heptayl ester (400 mg, yield 69%). LCMS: Ret: 1.50 min; [M+H] + =789.3; 23.87% purity at 214nm.

[0495] 1.23.9 7-O-7-(4-(3-(4-((E)-5-O-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)propyl)piperazin-1-yl)heptyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester

[0496] The (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b- 7-[4-(3-{[4-(2-formylethyl)phenyl]oxy}propyl)piperazin-1-yl]-7-oxylideneheptyl ester (200 mg, 0.25 mmol) and 1-(thiophen-2-yl)-2-(triphenyl-λ5-methylphosphine)ethyl-1-one (147 mg, 0.38 mmol) were mixed in chloroform (10 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. After the reaction solution was cooled to room temperature, it was concentrated. The crude product was first purified by column chromatography (dichloromethane / methanol = 19 / 1), and then purified by reverse-phase preparative chromatography to obtain a white solid 7-oxo-7-(4-(3-(4-((E)-5-oxo-5-(thien-2-yl)pent-3-en-1-yl)phenoxy)propyl)piperazin-1-yl)heptyl(6aR,6bS,7S,8aS,8bS) ,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxane-8b-carboxylic acid ester (22 mg, 10% yield). LCMS:Ret:1.63 min; [M+H] + =897.3; 99.54% purity at 214nm. 1H NMR (400MHz, CDCl3) δ7.71(m,1H),7.65(m,1H),7.3(m,1H),7.15-7.10(m,4H),6.84-6.77(m,3H),6.27(dd,J1= 2.0Hz, J2=10.0Hz,1H),6.02(s,1H),5.14(d,J=4.8Hz,1H),4.48(m,1H),4.38(m,1H),4.07-3.99(m,3H),3.64(m ,1H),3.50(m,1H),3.03(m,1H),2.81-2.77(m,2H),2.61-2.55(m,5H),2.50-2.44(m,4H),2.37-2.30(m,3H),2.2 1-1.83(m,6H),1.75-1.62(m,8H),1.47(s,3H),1.42-1.31(m,6H),1.21(s,3H),1.15-1.08(m,2H),1.00(s,3H).

[0497] 1.24 Cpd4: 2-(2-(2-(4-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)butyramide)acetamide)ethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester

[0498] 1.24.1(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-2,2-dimethyl-4-oxoyl-5-aza-3,8-dioxadec-10-yl ester

[0499] (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro- 6β-formic acid (800 mg, 2 mmol), ({2-[(2-bromoethyl)oxy]ethyl}amino)methane-2-methylpropyl-2-yl ester (1.594 g, 5.97 mmol), potassium carbonate (825 mg, 5.97 mmol) and potassium iodide (132 mg, 0.796 mmol) were mixed in acetonitrile (8 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. The reaction solution was concentrated and purified by column chromatography (petroleum ether / ethyl acetate = 3 / 1) to give a white solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-2,2-dimethyl-4-oxylidene-5-aza-3,8-dioxadecan-10-yl ester (1 g, 85% yield). LCMS: Rt 1.69 min; [M+H-100] + =490.0; 83.99% purity at 214nm.

[0500] 1.24.2(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester

[0501] At room temperature, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-2,2-dimethyl-4-oxylidene-5-aza-3,8-dioxadec-10-yl ester (500 mg, 0.85 mmol) was stirred in trifluoroacetic acid (6 mL) and dichloromethane (9 mL) for 2 hours. The reaction solution was concentrated to obtain a yellow oily substance (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester (434 mg, crude product). This crude product was used directly in the next step of the reaction. LCMS: Rt 1.33 min; [M+H] + =490.3; 86.92% purity at 214nm.

[0502] 1.24.3 Ethyl 4-{[4-(3-hydroxypropyl)phenyl]oxy}butyrate

[0503] 4-(3-hydroxypropyl)phenol (3 g, 19.7 mmol), ethyl 4-bromobutyrate (1.9 g, 9.9 mmol), potassium carbonate (8.16 g, 59.1 mmol), and potassium iodide (1.31 g, 7.9 mmol) were mixed in acetonitrile (60 mL). The reaction mixture was heated to 80 °C and stirred for 16 hours. After cooling to room temperature, the mixture was filtered, and the filtrate was concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 2 / 1) to give a yellow solid ethyl 4-{[4-(3-hydroxypropyl)phenyl]oxy}butyrate (4 g, yield 76.3%). LCMS: Rt 1.49 min; [M+H] + =267.1; 29.23% purity at 254nm.

[0504] 1.24.4 4-{[4-(3-hydroxypropyl)phenyl]oxy}butyric acid

[0505] At room temperature, lithium hydroxide (1.8 g, 75 mmol) was added to a mixture of ethyl 4-{[4-(3-hydroxypropyl)phenyl]oxy}butyrate (4 g, 15 mmol) in methanol (20 mL) and water (20 mL). The reaction mixture was stirred at room temperature for 2 hours, then the pH was adjusted to 2 with hydrochloric acid, diluted with water (50 mL), and extracted with ethyl acetate (100 mL x 3). The combined organic phases were washed successively with water (20 mL x 3) and saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to give a yellow oily product of 4-{[4-(3-hydroxypropyl)phenyl]oxy}butyric acid (3.37 g, 94% yield). This crude product was used directly in the next reaction. LCMS: Rt 0.90 min; [M-56+H] + =239.00; 56.67% purity at 214nm.

[0506] 1.24.5[(4-{[4-(3-hydroxypropyl)phenyl]oxy}-1-oxoylidenebutyl)amino]acetic acid-2-methylpropyl-2-yl ester

[0507] 4-{[4-(3-hydroxypropyl)phenyl]oxy}butyric acid (3.37 g, 14.2 mmol), glycine tert-butyl ester (1.86 g, 14.2 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (8.1 g, 21.3 mmol), and diisopropylethylamine (5.5 g, 42.6 mmol) were mixed in dichloromethane (30 mL), and the reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was filtered and concentrated. The crude product was purified by column chromatography (petroleum ether / ethyl acetate = 2 / 1) to give a white solid [(4-{[4-(3-hydroxypropyl)phenyl]oxy}-1-oxoylidenebutyl)amino]acetic acid-2-methylpropyl-2-yl ester (2.25 g, 45% yield). LCMS: Rt 1.57 min; [M-56+H] + =296.1; 98.86% purity at 214nm.

[0508] 1.24.6[(4-{[4-(2-formylethyl)phenyl]oxy}-1-oxoylidenebutyl)amino]acetic acid-2-methylpropyl-2-yl ester

[0509] At 0 °C, 5.4 g (12.8 mmol) of Desmond-Martin oxidant was added to a solution of [(4-{[4-(3-hydroxypropyl)phenyl]oxy}-1-oxylidenebutyl)amino]acetic acid-2-methylpropyl-2-yl ester (2.25 g, 6.4 mmol) in 20 mL of dichloromethane. The reaction mixture was stirred at room temperature for 2 hours and then filtered. The filtrate was concentrated and purified by column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a yellow solid of [(4-{[4-(2-formylethyl)phenyl]oxy}-1-oxylidenebutyl)amino]acetic acid-2-methylpropyl-2-yl ester (1.55 g, 69% yield). LCMS: Rt 1.80 min; [M-56+H] + =294.1; 53.64% purity at 254nm.

[0510] 1.24.7 N-(4-{[4-(2-formylethyl)phenyl]oxy}-1-oxoylidenebutyl)glycine

[0511] [(4-{[4-(2-formylethyl)phenyl]oxy}-1-oxylidenebutyl)amino]acetic acid-2-methylpropyl-2-yl ester (1.55 g, 4.4 mmol) was mixed in trifluoroacetic acid (10 mL) and dichloromethane (20 mL), and the reaction mixture was stirred at room temperature for 2 hours. After concentration, a brown oily substance, N-(4-{[4-(2-formylethyl)phenyl]oxy}-1-oxylidenebutyl)glycine (1.2 g, 93% yield), was obtained. This crude product was used directly in the next reaction. LCMS: Rt 1.50 min; [M+H] + =294.0; 45.53% purity at 214nm.

[0512] 1.24.8(4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-13-{[4-(2-formylethyl)phenyl]oxy}-7,10-dioxonyl-6,9-diaza-3-oxatridecane-1-yl ester

[0513] The (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester ( 434 mg (crude product), N-(4-{[4-(2-formylethyl)phenyl]oxy}-1-oxo-methylenebutyl)glycine (500 mg, 1.7 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.94 g, 5.1 mmol) and diisopropylethylamine (658 mg, 5.1 mmol) were mixed in dichloromethane (10 mL), and the reaction mixture was stirred at room temperature for 2 hours. The reaction solution was filtered and concentrated. The crude product was purified by column chromatography (dichloromethane / methanol = 10 / 1) to give a white solid (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-13-{[4-(2-formylethyl)phenyl]oxy}-7,10-dioxonyl-6,9-diaza-3-oxatridecane-1-yl ester (822 mg, yield 56%). LCMS: Rt 1.81min; [M+H] + =765.3; 44.54% purity at 254nm.

[0514] 1.24.9 2-(2-(2-(4-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)butyramide)acetamide)ethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester

[0515] (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid- 13-{[4-(2-formylethyl)phenyl]oxy}-7,10-dioxane-6,9-diaza-3-oxatridecane-1-yl ester (822 mg, 1.1 mmol) and 1-(thiophene-2-yl)-2-(triphenyl-λ5-methylphosphonyl)ethyl-1-one (415 mg, 1.1 mmol) were mixed in chloroform (4 mL), and the reaction mixture was heated to 80 °C and stirred for 16 hours. The reaction solution was concentrated after cooling, and the crude product was purified by reverse-phase reaction to give a white solid 2-(2-(2-(4-(4-((E)-5-oxo-5-(thiophen-2-yl)pent-3-en-1-yl)phenoxy)butyramide)acetamide)ethoxy)ethyl(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indene[1,2-d][1,3]dioxanepentene-8b-carboxylic acid ester (27.3 mg, yield 2.8%). LCMS: Rt 1.82 min; [M+H] + =873.3; 100% purity at 254nm. 1H NMR (400MHz, CDCl3) δ7.75-7.70(m,1H),7.69-7.60(m,1H),7.36(d,J=10.1Hz,1H),7.18-7.05(m,4H),6.85-6.75(m,3H),6.62( s,1H),6.51(s,1H),6.26(d,J=10.1Hz,1H),6.03(s,1H),5.15(d,J=5.0Hz,1H),4.59-4.46(m,2H),4.15(dd,J=12.1,2.7Hz,1H), 4.02-3.84(m,4H),3.75-3.64(m,2H),3.59-3.42(m,4H),2.78(t,J=7.5Hz,2H),2.66-2.42(m,5H),2.34(d,J=10.7Hz,1H),2.21- 1.98(m,5H),1.63(dddd,J=29.4,24.0,13.0,6.2Hz,4H),1.46(s,3H),1.42(s,3H),1.21(s,3H),1.18-1.07(m,2H),1.01(s,3H).

[0516] 1,25(6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-N-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl)-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxamide; and

[0517] N-(2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1 [3] Dioxacyclopenten-8b-yl)-2-oxoethyl)-3-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionamide

[0518] 1.25.1 The synthetic steps of the target compounds P12-P13 are as follows:

[0519] (a) 2-(2-azidoethoxy)ethylamine, 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (HATU), N,N-diisopropylethylamine (DIPEA), N,N-dimethylformamide, reacted at room temperature for 24 hours; (b) Compound 10a, L-ascorbic acid, copper sulfate, tetrahydrofuran / water (volume ratio 1:1), reacted at room temperature for 4 hours; (c) 4-toluenesulfonyl chloride, 4-dimethylaminopyridine (DMAP), dichloromethane, reacted at room temperature for 2 hours; (d) azidotrimethylsilane, fluorinated... Cesium, N,N-dimethylformamide, reacted at 50°C for 18 hours; (e) stannous chloride, ethanol, reacted at 0°C to room temperature for 12 hours; (f) 3-(2-(2-azidoethoxy)ethoxy)propionic acid, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI), 1-hydroxybenzotriazole (HOBt), N,N-diisopropylethylamine (DIPEA), dichloromethane, reacted at room temperature for 2 hours; (g) compound 10a, L-ascorbic acid, copper sulfate, tetrahydrofuran / water (volume ratio 1:1), reacted at room temperature for 4 hours.

[0520] 1.25.2 Compound 32: (6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-N-(2-(2-azidoethoxy)ethyl)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-formamide

[0521] Compound 17 (400 mg, 1.0 mmol, 1.0 eq), 2-(2-azidoethoxy)ethylamine (194 mg, 1.5 mmol, 1.5 eq), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (HATU) (680 mg, 1.8 mmol, 1.8 eq), and N,N-diisopropylethylamine (DIPEA) (0.5 mL, 3.0 mmol, 3.0 eq) were dissolved in N,N-dimethylformamide (10 mL) at room temperature and stirred for 24 hours. After the reaction was complete, the reaction solution was diluted with ethyl acetate and transferred to a separatory funnel. The organic phase was washed successively with water and saturated sodium chloride aqueous solution. The organic phase was collected, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The residue was purified by silica gel column chromatography (dichloromethane / methanol, v / v 98:2) to give compound 32. Yield: 37%. 1 H NMR (600MHz, DMSO-d6) δ7.54(t,J=5.9Hz,1H),7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.91(s,1H),4.93 –4.89(m,1H),4.72(d,J=3.5Hz,1H),4.30–4.25(m,1H),3.62–3.55(m,2H),3.48–3.41(m,2H),3.42–3.37(m,2H),3.39– 3.33(m,1H),3.24–3.15(m,1H),2.57–2.51(m,1H),2.32–2.26(m,1H),2.11–2.02(m,1H),2.02–1.97(m,1H),1.71–1.6 2(m,2H),1.58–1.49(m,2H),1.49–1.40(m,1H),1.39(s,3H),1.33(s,3H),1.12(s,3H),1.06–0.94(m,2H),0.88(s,3H). 13 C NMR(151MHz,DMSO-d6)δ185.12,171.57,170.28,156.57,127.09,121.61,109.72,94.08,80.97,68.87,68.57,68 .32,55.26,50.08,48.91,45.39,43.76,38.14,33.94,33.67,31.23,30.20,26.41,25.01,20.78,16.91.HRMS(ESI + )m / z calcd for C 27 H 38 N4O6[M+H]+ 515.2864; found 515.2853.

[0522] 1.25.3 P12: (6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-N-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethyl)-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-carboxamide

[0523] Compound 10a (156 mg, 0.34 mmol, 1.0 eq), compound 32 (176 mg, 0.34 mmol, 1.0 eq), L-ascorbic acid (181 mg, 1.03 mmol, 3.0 eq), and anhydrous copper sulfate (71 mg, 0.45 mmol, 1.3 eq) were dissolved in a tetrahydrofuran / water mixture (3.5 mL / 3.5 mL = 1:1, v / v). The reaction mixture was stirred at room temperature for 4 hours. After the reaction was complete, the reaction mixture was concentrated, and the residue was purified by silica gel column chromatography (dichloromethane / methanol, v / v 98:2 to 96:4) to finally give compound P12. Yield: 48%. 1H NMR(400MHz,DMSO-d6)δ8.14(t,J=5.5Hz,1H),7.82(s,1H),7.76(d,J=8.0Hz,1H),7.54(t,J=5.9Hz,1H),7.51–7.41(m,3H),7.42–7.22(m,5H),7.18(d,J=7.6Hz,1H),6.49(d,J=8.0Hz,1H),6.16(dd,J=10.0,1.9Hz,1H),5.91(s,1H),5.44(s,2H),4.90(s,1H),4.80(d,J=3.6Hz,1H),4.45(t,J=5.2Hz,2H),4.28(brs,1H),3.93(s,3H),3.87(s,2H),3.76(t,J=5.2Hz,2H),3.45–3.37(m,2H),3.35–3.26(m,3H),3.23–3.12(m,1H),2.86(t,J=7.7Hz,2H),2.80(t,J=6.3Hz,2H),2.58–2.48(m,1H),2.45(t,J=7.8Hz,2H),2.28(d,J=12.9Hz,1H),2.22(s,3H),2.11–1.94(m,2H),1.74–1.59(m,2H),1.57–1.39(m,3H),1.39(s,3H),1.31(s,3H),1.06(s,3H),1.05–0.90(m,2H),0.87(s,3H). 13 C NMR(101MHz,DMSO-d6)δ185.06,171.63,171.52,170.19,161.70,160.09,156.53,145.78,142.70,142.12,141.33,135.69,133.75,129.47,129.05,128.14,127.01,126.85,125.38,122.19,121.56,109.68,101.10,94.05,80.92,68.55,68.36,68.23,66.27,55.27,53.37,49.24,48.89,46.82,45.36,44.76,43.71,39.39,38.06,36.44,34.79,33.89,33.62,31.19,30.16,26.37,24.95,21.12,20.72,16.84,15.83.HRMS(ESI + )m / z calcd for C 55 H 69N7O9[M+H] + 972.5230; found 972.5299.

[0524] 1.25.4 Compound 33: 2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-decahydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl-4-methylbenzenesulfonate

[0525] Desonide (1 g, 2.4 mmol, 1.0 eq) was dissolved in dichloromethane (24 mL). 4-(dimethylamino)pyridine (DMAP) (440 mg, 3.6 mmol, 1.5 eq) and 4-toluenesulfonyl chloride (458 mg, 2.4 mmol, 1.0 eq) were added sequentially to the stirred solution at room temperature for 2 hours. After the reaction was complete, the reaction solution was diluted with dichloromethane and transferred to a separatory funnel, and washed sequentially with distilled water and 0.5 mol / L citric acid solution. The organic phase was collected, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (dichloromethane / methanol volume ratio 99:1 to 96:4) to give compound 33. Yield: 98%. 1 H NMR (600MHz, DMSO-d6) δ7.84(d,J=8.2Hz,2H),7.50(d,J=8.2Hz,2H),7.32(d,J=10.1Hz,1H),6.17(dd,J=10.0,1.9Hz,1H), 5.93–5.90(m,1H),5.17(d,J=17.8Hz,1H),4.82(d,J=4.8Hz,1H),4.77(d,J=3.8Hz,1H),4.73(d,J=17.8Hz,1H),4.32–4.27 (m,1H),2.56–2.51(m,1H),2.43(s,3H),2.32–2.26(m,1H),2.12–2.02(m,1H),2.01–1.95(m,1H),1.75–1.70(m,1H),1.68– 1.63(m,1H),1.59–1.49(m,2H),1.48–1.41(m,1H),1.38(s,3H),1.32(s,3H),1.07–0.99(m,2H),0.98(s,3H),0.76(s,3H). 13CNMR(151MHz,DMSO-d6)δ201.68,185.08,170.03,156.36,145.33,132.29,130.21,127.68,127.12,121.69,110.88,97.12, 81.12,71.29,68.08,54.72,49.24,45.43,43.62,33.70,33.31,31.15,29.88,26.11,24.94,21.10,20.77,16.51.HRMS(ESI + )m / z calcd for C 31 H 38 O8S[M+H] + 571.2360; found 571.2344.

[0526] 1.25.5 Compound 34: (6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-8b-(2-azidoacetyl)-7-hydroxy-6a,8a,10,10-tetramethyl-1,2,6a,6b,7,8,8a,8b,11a,12,12a,12b-dodecano-4H-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-4-one

[0527] Compound 33 (500 mg, 0.88 mmol, 1.0 eq), azidotrimethylsilane (505 mg, 4.38 mmol, 5.0 eq), and cesium fluoride (665 mg, 4.38 mmol, 5.0 eq) were dissolved in N,N-dimethylformamide (18 mL) and stirred at 80 °C for 18 hours. After cooling, the reaction mixture was diluted with ethyl acetate. The organic layer was washed successively with water and saturated sodium chloride solution. The organic phase was collected, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The residue was purified by silica gel column chromatography (petroleum ether / ethyl acetate, v / v ratio 90:10 to 70:30) to finally give compound 34. Yield: 78%. 1H NMR(600MHz,DMSO-d6)δ7.33(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),4.90(d, J=4.8Hz,1H),4.74(d,J=3.7Hz,1H),4.54(d,J=18.6Hz,1H),4.31–4.29(m,1H),4.04(d,J=18.6Hz,1 H),2.57–2.48(m,1H),2.32–2.26(m,1H),2.09(qd,J=11.1,4.1Hz,1H),2.03–1.96(m,1H),1.79–1.6 9(m,2H),1.63–1.45(m,3H),1.38(s,3H),1.35(s,3H),1.09(s,3H),1.07–0.96(m,2H),0.81(s,3H). 13 C NMR(151MHz,DMSO-d6)δ205.98,185.09,170.06,156.40,127.10,121.69,110.62,97.40,80.92,68.18,55 .21,54.85,49.30,45.34,43.63,33.73,33.32,31.17,29.92,26.17,25.10,20.79,20.75,16.70.HRMS(ESI + )m / z calcd for C 24 H 31 N3O5[M+H] + 442.2336; found 442.2322.

[0528] 1.25.6 Compound 35: (6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-8b-glycyl-7-hydroxy-6a,8a,10,10-tetramethyl-1,2,6a,6b,7,8,8a,8b,11a,12,12a,12b-dodecano-4H-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-4-one

[0529] Compound 34 (301 mg, 0.68 mmol, 1.0 eq) was dissolved in ethanol (7 mL) under ice bath conditions, and stannous chloride (259 mg, 1.36 mmol, 2.0 eq) was added with stirring. The reaction mixture was stirred at room temperature for 12 hours. After the reaction was complete, the reaction mixture was diluted with water and extracted with ethyl acetate. The organic phase was collected, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated. The residue was purified by silica gel column chromatography (dichloromethane / methanol, v / v ratio 98:2 to 92:8) to finally give compound 35. Yield: 95%. 1 H NMR (600MHz, DMSO-d6) δ8.50(s,2H),7.38(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.92(s,1H),4. 97(d,J=4.3Hz,1H),4.89(d,J=4.4Hz,1H),4.34–4.31(m,1H),4.18(d,J=18.9Hz,1H),4.12(s,1H),3.63(d ,J=18.9Hz,1H),2.58–2.52(m,1H),2.33–2.27(m,1H),2.09(qd,J=11.1,4.1Hz,1H),2.02–1.97(m,1H),1. 83–1.70(m,2H),1.63–1.46(m,3H),1.39(s,3H),1.37(s,3H),1.11(s,3H),1.09–0.92(m,2H),0.84(s,3H). 13 CNMR(151MHz,DMSO-d6)δ203.85,185.06,170.03,156.45,127.03,121.66,110.90,97.17,81.03,67.96,54 .85,49.38,48.52,45.79,45.66,43.62,33.73,33.36,31.15,29.93,26.20,25.39,20.69,16.43.HRMS(ESI + )m / z calcd for C 24 H 33 NO5[M+H] + 416.2431; found 416.2443.

[0530] 1.25.7 Compound 36: 3-(2-(2-azidoethoxy)ethoxy)-N-(2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecylhydro-8bH-naphtho[2',1':4,5]indeno[1,2-d][1,3]dioxolane-8b-yl)-2-oxoethyl)propionamide

[0531] Compound 35 (240 mg, 0.58 mmol, 1.0 eq), 3-(2-(2-azidoethoxy)ethoxy)propionic acid (133 mg, 0.58 mmol, 1.0 eq), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI) (144 mg, 0.75 mmol, 1.3 eq), 1-hydroxybenzotriazole (HOBT) (117 mg, 0.87 mmol, 1.5 eq), and N,N-diisopropylethylamine (DIPEA) (302 μL, 1.73 mmol, 3.0 eq) were dissolved in dichloromethane (6 mL), and the mixture was stirred at room temperature for 2 hours. After the reaction was complete, the reaction solution was diluted with dichloromethane and transferred to a separatory funnel. The organic phase was washed successively with water and saturated sodium bicarbonate aqueous solution. The organic phase was collected, filtered through anhydrous sodium sulfate, and the filtrate was concentrated. The residue was purified by silica gel column chromatography (dichloromethane / methanol volume ratio 98:2 to 96:4) to give target compound 36. Yield: 66%. 1H NMR(600MHz,DMSO-d6)δ8.10(t,J=5.7Hz,1H),7.32(d,J=10.1Hz,1H),6.17(dd,J=10.1,1.9Hz,1H),5.93–5.90(m,1H),4.86(d,J=4.2Hz,1H),4.84(d,J=4.0Hz,1H),4.38(dd,J=19.2,5.8Hz,1H),4.33–4.30(m,1H),3.87(dd,J=19.2,5.8Hz,1H),3.62(t,J=6.5Hz,2H),3.61–3.58(m,2H),3.57–3.53(m,2H),3.52–3.46(m,2H),3.41–3.36(m,2H),2.56–2.51(m,1H),2.42(t,J=6.5Hz,2H),2.32–2.26(m,1H),2.13–2.03(m,1H),2.04–1.97(m,1H),1.84–1.75(m,2H),1.59–1.45(m,3H),1.38(s,3H),1.36(s,3H),1.09(s,3H),1.08–0.93(m,2H),0.81(s,3H). 13 C NMR(151MHz,DMSO-d6)δ206.08,185.10,170.37,170.15,156.44,127.08,121.66,110.35,97.57,80.86,69.54,69.20,68.16,66.69,54.94,49.97,49.41,46.63,45.33,43.66,35.80,33.80,33.38,31.17,29.89,26.34,25.39,20.78,16.42.HRMS(ESI + )m / z calcd for C 31 H 44 N4O8[M+H] + 601.3232;found 601.3261.

[0532] 1.25.8 P13:N-(2-((6aR,6bS,7S,8aS,8bS,11aR,12aS,12bS)-7-hydroxy-6a,8a,10,10-tetramethyl-4-oxo-1,2,4,6a,6b,7,8,8a,11a,12,12a,12b-dodecano-8bH-naphtho[2',1':4,5]indeno[1,2-d [1,3]dioxolane-8b-yl)-2-oxoethyl)-3-(2-(2-(4-(3-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)-3-oxopropyl)-1H-1,2,3-triazol-1-yl)ethoxy)ethoxy)propionamide

[0533] Compound 10a (151 mg, 0.33 mmol, 1.0 eq), compound 36 (199 mg, 0.33 mmol, 1.0 eq), L-ascorbic acid (175 mg, 0.99 mmol, 3.0 eq), and anhydrous copper(II) sulfate (69 mg, 0.43 mmol, 1.3 eq) were dissolved in a tetrahydrofuran / water mixture (3:1, v / v) and stirred at room temperature for 4 hours. After the reaction was complete, the reaction solution was concentrated, and the residue was purified by silica gel column chromatography (dichloromethane / methanol, v / v 98:2 to 95:5) to finally give compound P13. Yield: 44%. 1H NMR(600MHz,DMSO-d6)δ8.15(t,J=5.7Hz,1H),8.12(t,J=5.5Hz,1H),7.80(s,1H),7.75(d,J=8.0Hz,1H),7.48–7.42(m,3H),7.40–7.36(m,1H),7.34(d,J=10.1Hz,1H),7.32–7.29(m,2H),7.26(t,J=7.6Hz,1H),7.21–7.16(m,1H),6.49(d,J=7.9Hz,1H),6.17(dd,J=10.0,1.9Hz,1H),5.93–5.90(m,1H),5.43(s,2H),4.90(d,J=4.1Hz,1H),4.85(d,J=4.1Hz,1H),4.45(t,J=5.3Hz,2H),4.38(dd,J=19.2,5.8Hz,1H),4.32–4.29(m,1H),3.93(s,3H),3.90–3.83(m,3H),3.78(t,J=5.3Hz,2H),3.59(t,J=6.6Hz,2H),3.52–3.50(m,2H),3.48–3.43(m,2H),3.32–3.28(m,2H),2.86(t,J=7.7Hz,2H),2.79(t,J=6.3Hz,2H),2.58–2.52(m,1H),2.45(t,J=7.7Hz,2H),2.41(t,J=6.5Hz,2H),2.33–2.26(m,1H),2.22(s,3H),2.13–2.02(m,1H),2.03–1.94(m,1H),1.86–1.74(m,2H),1.59–1.44(m,3H),1.38(s,3H),1.35(s,3H),1.08(s,3H),1.07–0.95(m,2H),0.80(s,3H). 13C NMR (151MHz, DMSO-d6) δ206.09,185.11,171.72,170.40,170.14,161.71,160.11,156.48,145.79,142.72,142. 15,141.36,135.74,133.82,129.54,129.12,128.21,127.08,126.92,125.45,122.26,121.67,110.35,101.14, 97.57,80.87,69.43,69.40,68.76,68.13,66.65,66.32,54.96,53.43,49.42,49.21,46.90,46.64,45.34,44.8 4,43.67,36.52,35.79,34.86,33.81,33.39,31.18,29.90,26.34,25.39,21.14,20.78,16.43,15.90.HRMS(ESI + )m / z calcd for C 59 H 75 N7O 11 [M+H] + 1058.5597; found 1058.5674.

[0534] 1.26 Synthesis of Compound E1

[0535] E1: (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-7-{4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxo-ylideneprop-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-yl}-7-oxo-ylideneheptyl ester

[0536] 1.26.1:(4aR,5S,6aS,6bS,9aR)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-ylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid (N231078-044).

[0537] Under stirring at room temperature, a methanol solution (30 mL) of potassium hydroxide (1.68 g, 29.963 mmol) was added to a methanol solution (20 mL) of (4aR,5S,6aS,6bS,9aR)-5-hydroxy-6b-(2-hydroxyacetyl)-4a,6a,8,8-tetramethyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxane-2-one (4.16 g, 9.988 mmol). The reaction mixture was stirred at room temperature for 16 h, quenched with water (60 mL), and extracted with dichloromethane (40 mL x 2). The aqueous phase was adjusted to pH 2 with 1 N hydrochloric acid and extracted with ethyl acetate (60 mL). The organic phase was washed with saturated brine (20 mL), dried over anhydrous sodium sulfate, filtered, and then evaporated to dryness to obtain a white solid (4aR,5S,6aS,6bS,9aR)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid (3.78 g, 7.858 mmol, 78.67%). This crude product was used directly in the next reaction.

[0538] LCMS: Rt=1.76min; [M+H]+=403.3; 83.67% at 254nm.

[0539] 1.26.2:(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-7-methoxy-7-oxomethylene-heptanyl ester (N231078-046).

[0540] At room temperature, methyl 7-bromoheptanoate (665.19 mg, 2.981 mmol), potassium carbonate (412.04 mg, 2.981 mmol), and potassium iodide (0.044 mL, 0.398 mmol) were added to a 6 mL acetonitrile solution of (4aR,5S,6aS,6bS,9aR)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid (400 mg, 0.994 mmol) and added to the solution. The resulting reaction mixture was stirred overnight at 80 °C. After cooling to room temperature, the solution was filtered, and the filtrate was concentrated and purified by normal-phase chromatography (petroleum ether: ethyl acetate = 1:2) to give a white solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-7-methoxy-7-oxomethylene-heptanyl ester (364 mg, 0.668 mmol, 67.24%).

[0541] LCMS: Rt=2.02min; [M+H]+=545.3; 100% at 214nm.

[0542] 1.26.3:7-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-ylide-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)heptanoic acid (N231078-047).

[0543] At room temperature, lithium hydroxide (0.186 mL, 6.680 mmol) was added to a solution of (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-7-methoxy-7-oxylidene heptayl ester (364 mg, 0.668 mmol) in methanol (3.00 mL) and water (3 mL). The reaction mixture was stirred overnight at room temperature, diluted with water (60 mL), and extracted with dichloromethane (40 mL x 2). The aqueous phase was adjusted to pH 2 with 1N hydrochloric acid and then extracted with ethyl acetate (60 mL). The organic phase was washed with saturated brine (20 mL), dried with anhydrous sodium sulfate, filtered, and concentrated to give a yellow solid 7-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)heptanoic acid (291 mg, 0.548 mmol, 82.06%). This crude product was used directly in the next reaction.

[0544] LCMS: Rt=1.82min; [M+H]+=531.7; 100% at 214nm.

[0545] 1.26.4: 4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-nitroquinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (N231078-014).

[0546] Under stirring at 0°C, potassium tert-butoxide (1 M in tetrahydrofuran, 10 mL, 10.000 mmol) was added to a tetrahydrofuran (5 mL) solution of 4-[(3-chloro-4-fluorophenyl)amino]-7-fluoro-6-nitroquinazoline (0.619 mL, 2.970 mmol) and 4-(3-hydroxypropyl)piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (0.80 g, 3.267 mmol). The reaction mixture was stirred overnight at room temperature, diluted with water (100 mL), and extracted with ethyl acetate (100 mL x 3). The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by normal phase chromatography (dichloromethane / methanol = 5 / 1) to give a yellow solid 4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-nitroquinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (1.72 g, 2.776 mmol, 93.27%).

[0547] LCMS: Rt: 1.45min; [M+H]+=561.3; 90.56% at 214nm.

[0548] 1.26.5: 4-[3-({6-amino-4-[(3-chloro-4-fluorophenyl)amino]quinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (N231078-021).

[0549] At 90 °C, 4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-nitroquinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (1 g, 1.782 mmol), iron powder (1.00 g, 17.820 mmol), and ammonium chloride (0.95 g, 17.825 mmol) were stirred overnight in ethanol (12 mL). The reaction solution was cooled to room temperature and filtered. The filtrate was concentrated and purified by normal-phase chromatography (dichloromethane / methanol = 5 / 1) to give a brown solid 4-[3-({6-amino-4-[(3-chloro-4-fluorophenyl)amino]quinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (580.00 mg, 1.092 mmol, 61.05%).

[0550] LCMS: Rt: 1.31 min; [M+H]+=531.3; 100% at 214nm.

[0551] 1.26.6: 4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxoylidene-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (N231078-031).

[0552] At 0°C, acryloyl chloride (119 mg, 1.31 mmol) was added to a solution of 4-[3-({6-amino-4-[(3-chloro-4-fluorophenyl)amino]quinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (0.580 g, 1.092 mmol) and triethylamine (331 mg, 3.276 mmol) in 20 mL of dichloromethane. The reaction mixture was stirred at room temperature for 1 h, diluted with 100 mL of dichloromethane, washed successively with 40 mL of saturated brine (40 mL x 2), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by normal-phase chromatography (dichloromethane / methanol = 5 / 1) to give a yellow solid 4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxoylidene-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazine-1-carboxylic acid-2-methylpropyl-2-yl ester (0.41 g, 0.7 mmol, 64%).

[0553] LCMS: Rt: 1.99min; [M+H]+=585.2; 97.79% at 254nm. 1 H NMR(400MHz,DMSO-d6)δ9.81(s,1H),9.63(s,1H),8.87(s,1H),8.54(s,1H),8.14(dd,J=6.9 ,2.6Hz,1H),7.81(ddd,J=9.1,4.3,2.7Hz,1H),7.43(t,J=9.1Hz,1H),7.29(s,1H),6.72(dd, J=16.9,10.1Hz,1H),6.32(dd,J=17.0,1.9Hz,1H),5.83(dd,J=10.2,1.8Hz,1H),4.27(t,J=6 .2Hz,2H),3.31(s,4H),2.31(d,J=24.8Hz,6H),1.99(d,J=3.2Hz,2H),1.39(d,J=2.1Hz,9H).

[0554] 1.26.7: N-{4-[(3-chloro-4-fluorophenyl)amino]-7-{[3-(piperazin-1-yl)propyl]oxy}quinazolin-6-yl}prop-2-enamide (N231078-049).

[0555] At room temperature, 200 mg (0.342 mmol) of 2-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxoylidene-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-carboxylic acid-2-methylpropyl-2-yl ester was stirred in dichloromethane (8 mL) and trifluoroacetic acid (2 mL, 26.925 mmol) for 2 h. The reaction solution was concentrated to give a yellow solid N-{4-[(3-chloro-4-fluorophenyl)amino]-7-{[3-(piperazin-1-yl)propyl]oxy}quinazolin-6-yl}propyl-2-enamide (160 mg, 0.330 mmol, 94.12%). This crude product was used directly in the next reaction step.

[0556] LCMS: Rt: 1.73min; [M+H]+=485.1; 91.10% at 214nm.

[0557] 1.26.8:(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-7-{4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxylideneprop-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-yl}-7-oxylideneheptyl ester (N231078-054).

[0558] At room temperature, N-{4-[(3-chloro-4-fluorophenyl)amino]-7-{[3-(piperazin-1-yl)propyl]oxy}quinazolin-6-yl}prop-2-enamide (160 mg, 0.330 mmol), 7-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro) -2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentan-6b-yl]carbonyl}oxy)heptanoic acid (192.59 mg, 0.363 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (188.18 mg, 0.495 mmol) were stirred in N,N-dimethylformamide (3 mL) for 0.2 h, followed by the addition of N,N-diisopropylethylamine (0.164 mL, 0.990 mmol). The reaction mixture was stirred at room temperature for 1 h, quenched with water (30 mL), and extracted with ethyl acetate (30 mL x 2). After concentration of the organic phase, purification by reversed-phase chromatography yielded a white solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthroline [1',2':1, 2] Cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-7-{4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxylideneprop-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-yl}-7-oxylideneheptyl ester (27.9 mg, 0.028 mmol, 8.45%).

[0559] LCMS: Rt: 1.77min; [M+H]+=997.2; 100% at 214nm. 1H NMR (400MHz, DMSO-d6) δ9.81(s,1H),9.61(s,1H),8.87(s,1H),8.53(s,1H),8.14(d,J=4.8Hz,1H),7.79(s,1H),7.42(t,J=9.1Hz,1H),7 .30(d,J=10.2Hz,2H),6.72(dd,J=17.0,10.2Hz,1H),6.32(dd,J=17.0,1.8Hz,1H),6.16(dd,J=10.1,1.7Hz,1H),5.91(s,1H),5.82(dd,J =10.2,1.7Hz,1H),4.97(d,J=4.0Hz,1H),4.77(s,1H),4.27(d,J=5.5Hz,3H),4.10(t,J=6.4Hz,2H),3.44(d,J=3.0Hz,4H),2.53(s,1H),2 .39–2.26(m,7H),2.08–1.96(m,4H),1.74–1.30(m,21H),1.09(s,3H),1.01(d,J=13.1Hz,1H),0.94(dd,J=11.1,3.0Hz,1H),0.88(s,3H).

[0560] 13 C NMR(101MHz,DMSO-d6)δ184.52,171.22,169.86,169.62,162.95,156.18,155.93,154.33,153.73,153.39,15 1.31,148.56,131.07,126.64,126.51,126.41,122.88,121.78,121.71,121.05,118.16,117.97,115.94,115. 72,109.57,108.20,106.76,93.20,80.80,67.63,66.42,63.94,54.49,53.45,52.56,51.97,47.94,44.81,44.34,43.11,40.40,33.24,32.94,31.51,30.59,29.49,27.62,27.23,25.77,25.01,24.62,23.99,20.17,16.32.

[0561] 1.27 Synthesis of Compound D1

[0562] D1: (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-6-{4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxo-ylideneprop-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-yl}-6-oxo-ylidenehexyl ester

[0563] 1.27.1:(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-6-methoxy-6-oxoylhexyl ester.

[0564] At 80 °C, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-6b-(2-hydroxyacetyl)-4a,6a,8,8-tetramethyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxane-2-one (833.02 mg, 2 mmol), methyl 6-bromohexanoate (1.271 mL, 8.000 mmol), potassium iodide (132.80 mg, 0.800 mmol) and potassium carbonate (1105.60 mg, 8.000 mmol) were stirred in acetonitrile (50 mL) for 3 days. The reaction solution was concentrated and purified by normal-phase chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a colorless oil (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-6-methoxy-6-oxylidene hexyl ester (1 g, 0.714 mmol, 35.69%).

[0565] LCMS: Rt: 1.76 min; [M+H] +=531.7; 37.88% at 254nm.

[0566] 1.27.2:6-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)hexanoic acid.

[0567] At 20°C, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid-6-methoxy-6-oxylidene hexyl ester (360 mg, 0.257 mmol) and lithium hydroxide (54 mg, 1.285 mmol) were stirred in methanol (5 mL) and water (1 mL) for 18 h. The reaction solution was adjusted to pH 3 with dilute hydrochloric acid and then concentrated. The crude product was purified by reversed-phase chromatography to give a white solid 6-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)hexanoic acid (0.08 g, 0.154 mmol, 59.84%).

[0568] LCMS: Rt: 1.57 min; [M+H] + =517.6; 99.3% at 254nm.

[0569] 1.27.3:(4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-6-{4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxylideneprop-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-yl}-6-oxylidenehexyl ester.

[0570] At room temperature, 6-({[(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-yl]carbonyl}oxy)hexanoic acid (69.73 mg, 0.134 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (58.80 mg, 0.155 mmol) and N,N-diisopropylethylamine (66.50 mg, 0.516 mmol) were stirred in N,N-dimethylformamide (5 mL) for 0.2 h, followed by the addition of N-{4-[(3-chloro-4-fluorophenyl)amino]-7-{[3-(piperazin-1-yl)propyl]oxy}quinazolin-6-yl}prop-2-enamide (50 mg, 0.103 mmol). The reaction mixture was stirred at room temperature for 1 h, quenched with water (30 mL), and extracted with ethyl acetate (30 mL x 2). After concentration of the organic phase, the product was purified by reversed-phase chromatography to obtain a white solid (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-6-{4-[3-({4-[(3-chloro-4-fluorophenyl)amino]-6-[(1-oxylideneprop-2-enyl)amino]quinazolin-7-yl}oxy)propyl]piperazin-1-yl}-6-oxylidenehexyl ester (25.3 mg, 0.026 mmol, 24.95%).

[0571] LCMS: Rt: 1.75 min; [M+H] + =983.1; 100% at 254nm.1 H NMR (400MHz, DMSO-d6) δ9.80(s,1H),9.61(s,1H),8.87(s,1H),8.54(s,1H),8.15(s,1H),7.82(s,1H),7.44(d,J= 9.5Hz,1H),7.30(s,2H),6.70(d,J=12.1Hz,1H),6.32(d,J=17.5Hz,1H),6.16(d,J=10.8Hz,1H),5.91(s,1H),5.8 2(d,J=9.6Hz,1H),4.98(s,1H),4.75(s,1H),4.28(s,3H),4.10(d,J=6.1Hz,2H),3.44(s,4H),2.43–2.22(m,7H), 2.04(d,J=28.2Hz,5H),1.84–1.42(m,10H),1.41–1.16(m,9H),1.09(s,3H),0.95(d,J=12.5Hz,2H),0.88(s,3H).

[0572] 1.28 Synthesis of Compound A1

[0573] A1: (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-20-[(2,4-dinitrophenyl)amino]-7,10-dioxo-6,9-diaza-3,12,15,18-tetraoxaeicosano-1-yl ester

[0574] 1.28.1:({8-[(2,4-dinitrophenyl)amino]-3,6-dioxaoct-1-yl}oxy)acetic acid (N231078-033).

[0575] At room temperature, [(8-amino-3,6-dioxaoct-1-yl)oxy]acetic acid (1.00 g, 4.826 mmol) and sodium bicarbonate (0.13 g, 1.547 mmol) were stirred in water (12 mL) for 5 min, followed by the addition of a acetone (3 mL) solution of 1-chloro-2,4-dinitrobenzene (1.95 g, 9.651 mmol). The reaction mixture was stirred at room temperature for 20 h, diluted with water (100 mL), acidified with 2N hydrochloric acid, and extracted with ethyl acetate (100 mL x 3). The organic phase was washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product was purified by normal-phase chromatography (dichloromethane / methanol = 5 / 1) to give a yellow solid ({8-[(2,4-dinitrophenyl)amino]-3,6-dioxaoct-1-yl}oxy)acetic acid (312 mg, 0.836 mmol, 17.32%).

[0576] LCMS: Rt: 1.58 min; [M+H] + =374.3; 100.00% at 214nm.

[0577] 1.28.2:({11-[(2,4-dinitrophenyl)amino]-1-oxonyl-3,6,9-trioxaundecan-1-yl}amino)acetic acid-2-methylpropyl-2-yl ester (N231078-038).

[0578] At 0 °C, N,N-diisopropylethylamine (0.415 mL, 2.508 mmol) was added to a solution of ({8-[(2,4-dinitrophenyl)amino]-3,6-dioxaoct-1-yl}oxy)acetic acid (312 mg, 0.836 mmol), glycine tert-butyl ester (164.45 mg, 1.254 mmol), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (476.82 mg, 1.254 mmol) in dichloromethane (6 mL). The reaction mixture was stirred at room temperature for 4 h and then concentrated. The crude product was purified by normal phase chromatography (dichloromethane / methanol = 10 / 1) to give a yellow solid ({11-[(2,4-dinitrophenyl)amino]-1-oxonyl-3,6,9-trioxaundecan-1-yl}amino)acetic acid-2-methylpropyl-2-yl ester (695 mg, 0.828 mmol, 98.27%).

[0579] LCMS: Rt = 1.78 min; [M-56+H] + =431.3; 57.97% at 214nm.

[0580] 1.28.3:N-{11-[(2,4-dinitrophenyl)amino]-1-oxonyl-3,6,9-trioxaundecan-1-yl}glycine (N231078-057).

[0581] At room temperature, ({11-[(2,4-dinitrophenyl)amino]-1-oxylidene-3,6,9-trioxaundecan-1-yl}amino)acetic acid-2-methylpropyl-2-yl ester (695 mg, 0.828 mmol) was stirred for 2 h in dichloromethane (6 mL) and trifluoroacetic acid (0.062 mL, 0.828 mmol). The reaction solution was concentrated to give a yellow solid N-{11-[(2,4-dinitrophenyl)amino]-1-oxylidene-3,6,9-trioxaundecan-1-yl}glycine (711 mg, 0.826 mmol, 99.70%). This crude product was used directly in the next reaction step.

[0582] LCMS: Rt: 1.52 min; [M+H] + =431.3; 63.22% at 214nm.

[0583] 1.28.4:(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-2,2-dimethyl-4-oxylidene-5-aza-3,8-dioxadec-10-yl ester (N231078-048).

[0584] At 80 °C, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentanyl-6b-carboxylic acid (1.2 g, 2.981 mmol), potassium iodide (0.20 g, 1.193 mmol), and potassium carbonate (1.24 g, 8.944 mmol) were stirred in acetonitrile (10 mL) for 48 h. The reaction solution was then concentrated after cooling to room temperature. The crude product was purified by normal-phase silica gel column chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a yellow solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-2,2-dimethyl-4-oxylidene-5-aza-3,8-dioxadec-10-yl ester (850 mg, 1.441 mmol, 48.34%).

[0585] LCMS: Rt = 1.75 min; [M-100+H] + =490.6; 93.90% at 214nm.

[0586] 1.28.5:(4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxo-ylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester (N231078-056).

[0587] At room temperature, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-2,2-dimethyl-4-oxylidene-5-aza-3,8-dioxadec-10-yl ester (850 mg, 1.441 mmol) was concentrated in dichloromethane (6 mL) and trifluoroacetic acid (3 mL, 40.388 mmol) after stirring for 2 h. The crude product was purified by normal-phase chromatography (petroleum ether / ethyl acetate = 1 / 2) to give a yellow solid (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentaman-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester (732 mg, 1.032 mmol, 71.62%).

[0588] LCMS: Rt = 1.31 min; [M+H] + =490.6; 77.31% at 214nm.

[0589] 1.28.6:(4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-20-[(2,4-dinitrophenyl)amino]-7,10-dioxonyl-6,9-diaza-3,12,15,18-tetraoxaeicosano-1-yl ester (N231078-059).

[0590] At room temperature, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxoyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester (200 mg, 0.408 mmol) l), N-{11-[(2,4-dinitrophenyl)amino]-1-oxonyl-3,6,9-trioxaundecan-1-yl}glycine (210.96 mg, 0.490 mmol), N,N-diisopropylethylamine (263.48 mg, 2.042 mmol) and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (232.99 mg, 0.613 mmol) were concentrated in N,N-dimethylformamide (3 mL) after stirring for 1 h. The crude product was purified by reversed-phase chromatography to obtain a yellow solid (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxylidene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-20-[(2,4-dinitrophenyl)amino]-7,10-dioxylidene-6,9-diaza-3,12,15,18-tetraoxaeicosano-1-yl ester (26.4 mg, 0.029 mmol, 7.17%).

[0591] LCMS: Rt = 1.56 min; [M+H] + =902.1; 100% at 214nm. 1H NMR(400MHz,DMSO-d6)δ8.86(d,J=2.7Hz,2H),8.26(dd,J=9.6,2.7Hz,1H),7 .96(t,J=5.6Hz,1H),7.79(t,J=5.8Hz,1H),7.30(dd,J=12.0,10.0Hz,2H),6. 15(dd,J=10.1,1.7Hz,1H),5.91(s,1H),4.97(d,J=4.0Hz,1H),4.77(s,1H),4 .23(ddd,J=16.8,11.9,5.7Hz,3H),3.90(s,2H),3.73–3.66(m,6H),3.63–3.5 4(m,11H),3.42(t,J=6.0Hz,2H),3.22(dd,J=11.7,5.9Hz,2H),2.29(d,J=10. 5Hz,1H),2.12–2.04(m,1H),2.00(d,J=17.2Hz,1H),1.70(dd,J=18.8,7.4Hz, 2H),1.59–1.54(m,2H),1.46(dd,J=10.7,6.7Hz,1H),1.38(s,3H),1.31(s,3H ),1.09(s,3H),1.08–1.03(m,1H),0.95(dd,J=11.1,3.2Hz,1H),0.89(s,3H).

[0592] 1.29 Synthesis of Compound A2

[0593] A2: (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-13-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanthro-4-yl]quinoline-6-yl}oxy)-7,10-dioxonyl-6,9-diaza-3-oxatridecane-1-yl ester.

[0594] 1.29.1: Ethyl 4-[(2-chloroquinoline-6-yl)oxy]butyrate.

[0595] At 80 °C, 2-chloroquinoline-6-phenol (0.9 g, 5.011 mmol), potassium carbonate (2.08 g, 15.033 mmol), and ethyl 4-bromobutyrate (0.791 mL, 5.512 mmol) were stirred in N,N-dimethylformamide (10 mL) for 16 h. The reaction mixture was cooled to room temperature and quenched with water (30 mL), then extracted with ethyl acetate (30 mL x 2). The organic phase was concentrated and purified by normal-phase chromatography (petroleum ether / ethyl acetate = 4 / 1) to give ethyl 4-[(2-chloroquinoline-6-yl)oxy]butyrate (1.3 g, 4.426 mmol, 88.31%) as a white solid.

[0596] LCMS: Rt: 1.68 min; [M+H] + =294.1; 100% at 254nm.

[0597] 1.29.2:4-[(2-{[tris(prop-2-yl)methsilyl]ethynyl}quinoline-6-yl)oxy]ethyl butyrate.

[0598] Ethyl 4-[(2-chloroquinoline-6-yl)oxy]butyrate (1.3 g, 4.426 mmol), palladium dichloride (0.34 g, 0.443 mmol), cuprous iodide (0.015 mL, 0.443 mmol), triisopropylsilylacetylene (1.489 mL, 6.638 mmol), and triethylamine (2.461 mL, 17.702 mmol) were reacted in tetrahydrofuran (6 mL) for 18 minutes under nitrogen protection at 80 °C. The reaction mixture was cooled to room temperature and concentrated. The crude product was purified by normal-phase chromatography (petroleum ether / ethyl acetate = 4 / 1) to give ethyl 4-[(2-{[tris(propyl-2-yl)methyl]acetylene}quinoline-6-yl)oxy]butyrate (1.8 g, 4.094 mmol, 92.51%) as a yellow solid.

[0599] LCMS:Rt:2.33min; [M+H] + =440.2; 100% at 254nm.

[0600] 1.29.3: Ethyl 4-[(2-ethynylquinoline-6-yl)oxy]butyrate.

[0601] Ethyl 4-[(2-{[tris(prop-2-yl)methsilyl]ethynyl}quinoline-6-yl)oxy]butyrate (1.8 g, 4.094 mmol) and tetrabutylammonium fluoride (1 M tetrahydrofuran solution, 4.503 mL, 4.503 mmol) were stirred in tetrahydrofuran (10 mL) for 1 h. The reaction mixture was quenched with saturated sodium chloride aqueous solution (20 mL) and extracted with ethyl acetate (20 mL x 2). After concentration of the organic phase, ethyl 4-[(2-ethynylquinoline-6-yl)oxy]butyrate (1.5 g, 3.971 mmol, crude product) was obtained as a yellow solid. This crude product was used directly in the next reaction.

[0602] LCMS: Rt: 1.57 min; [M+H] + =284.0; 98% at 254nm.

[0603] 1.29.4: Ethyl 4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinoline-6-yl}oxy)butyrate.

[0604] Under nitrogen protection at 70 °C, 2-fluoro-4-iodophenol (1.13 g, 4.765 mmol), trans-N,N'-dimethylcyclohexane-1,2-diamine (0.08 g, 0.596 mmol), sodium vitamin C (0.08 g, 0.397 mmol), cuprous iodide (0.08 g, 0.397 mmol), and sodium azide (0.26 g, 3.971 mmol) were stirred in dimethyl sulfoxide (10 mL) for 2 h. Then, ethyl 4-[(2-ethynylquinoline-6-yl)oxy]butyrate (1.5 g, 3.971 mmol) and water (10 mL) were added. The resulting reaction mixture was stirred at 70 °C for 16 h. After cooling to room temperature, the reaction mixture was diluted with water (20 mL) and extracted with ethyl acetate (20 mL x 2). The organic phase was concentrated and purified by normal-phase chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a yellow solid ethyl 4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinolin-6-yl}oxy)butyrate (0.5 g, 1.146 mmol, 28.85%).

[0605] LCMS: Rt: 1.53 min; [M+H] + =436.9; 100% at 254nm.

[0606] 1.29.5: 4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinoline-6-yl}oxy)butyric acid.

[0607] Ethyl 4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinoline-6-yl}oxy)butyrate (0.5 g, 1.146 mmol) and sodium hydroxide (0.46 g, 11.456 mmol) were stirred for 2 h in dioxane (20 mL) and water (6 mL). The reaction mixture was acidified to pH 3 with dilute hydrochloric acid and then extracted with methanol / dichloromethane (1 / 10, 30 mL x 3). After concentration of the organic phase, a yellow solid 4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinoline-6-yl}oxy)butyric acid (0.45 g, 1.080 mmol, 94.26%) was obtained. This crude product was used directly in the next reaction.

[0608] LCMS: Rt: 1.36 min; [M+H] + =409.6; 98% at 254nm.

[0609] 1.29.6:{[4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanyl-4-yl]quinolin-6-yl}oxy)-1-oxo-methylenebutyl]amino}acetic acid-2-methylpropyl-2-yl ester.

[0610] At 20°C, 4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinoline-6-yl}oxy)butyric acid (0.45 g, 1.080 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (0.62 g, 1.620 mmol) and N,N-diisopropylethylamine (0.42 g, 3.240 mmol) were stirred in N,N-dimethylformamide (20 mL) for 0.1 h, followed by the addition of glycine tert-butyl ester (0.21 g, 1.620 mmol). The reaction mixture was stirred at 20°C for 1 h, quenched with water (30 mL), and extracted with ethyl acetate (20 mL x 2). The organic phase was concentrated and purified by normal-phase chromatography (petroleum ether / ethyl acetate = 1 / 1) to give a yellow solid {[4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanyl-4-yl]quinolin-6-yl}oxy)-1-oxo-ylidene-butyl]amino}acetic acid-2-methylpropyl-2-yl ester (0.5 g, 0.959 mmol, 89.29%).

[0611] LCMS: Rt: 1.49 min; [M+H] + =522.7; 100% at 254nm.

[0612] 1.29.7:N-[4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinolin-6-yl}oxy)-1-oxo-methylenebutyl]glycine.

[0613] At 20 °C, {[4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanyl-4-yl]quinoline-6-yl}oxy)-1-oxylidenebutyl]amino}acetic acid-2-methylpropyl-2-yl ester (0.2 g, 0.383 mmol) was stirred for 1 h in dichloromethane (6 mL) and trifluoroacetic acid (2 mL). The reaction solution was concentrated to give a yellow solid N-[4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanyl-4-yl]quinoline-6-yl}oxy)-1-oxylidenebutyl]glycine (0.2 g, 0.365 mmol, 95.25%). This crude product was used directly in the next reaction step.

[0614] LCMS: Rt: 1.26 min; [M+H] + =466.6; 85% at 254nm.

[0615] 1.29.8:(4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthro[1',2':1,2]cyclopenta[3,4-d][1,3]dioxacyclopentanthro-6b-carboxylic acid-13-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanthro-4-yl]quinoline-6-yl}oxy)-7,10-dioxonyl-6,9-diaza-3-oxatridecane-1-yl ester.

[0616] At 20°C, N-[4-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentanyl-4-yl]quinoline-6-yl}oxy)-1-oxylidenebutyl]glycine (0.2 g, 0.365 mmol), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (0.21 g, 0.548 mmol) and N,N-diisopropylethylamine (0.24 g, 1.826 mmol) were stirred in N,N-dimethylformamide (20 mL) for 0 minutes. After 1 hour, (4aR,4bS,5S,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxonyl-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecylhydro-2H-phenanthro[1',2':1,2]cyclopentano[3,4-d][1,3]dioxacyclopentano-6b-carboxylic acid-2-[(2-aminoethyl)oxy]ethyl ester (0.27 g, 0.438 mmol) was added. The reaction mixture was stirred at 20 °C for 1 hour, quenched with water (30 mL), and extracted with ethyl acetate (30 mL x 2). The organic phase was concentrated and purified by reversed-phase chromatography to obtain a white solid (4aR,4bS,6aS,6bS,9aR,10aS,10bS)-5-hydroxy-4a,6a,8,8-tetramethyl-2-oxomethylene-4a,4b,5,6,6a,6b,9a,10,10a,10b,11,12-dodecano-2H-phenanthroline [1',2':1,2] Cyclopenta[3,4-d][1,3]dioxacyclopentan-6b-carboxylic acid-13-({2-[1-(3-fluoro-4-hydroxyphenyl)-1,2,3-triazacyclopentan-4-yl]quinolin-6-yl}oxy)-7,10-dioxane-6,9-diaza-3-oxatridecane-1-yl ester (0.028 g, 0.030 mmol, 8.18%).

[0617] LCMS: Rt: 1.45 min; [M+H] + =937.1; 100% purity at 254nm. 1H NMR (400MHz, DMSO-d6) δ10.39(s,1H),9.29(s,1H),8.37(d,J=8.7Hz,1H),8.22(d,J=8 .6Hz,1H),8.14(t,J=5.8Hz,1H),7.97–7.85(m,3H),7.71(d,J=10.1Hz,1H),7.44(dd, J=7.0,2.7Hz,2H),7.31(d,J=10.1Hz,1H),7.14(t,J=9.1Hz,1H),6.15(dd,J=10.1,1. 7Hz,1H),5.90(s,1H),4.97(d,J=4.1Hz,1H),4.75(s,1H),4.30–4.20(m,3H),4.15(t, J=6.4Hz,2H),3.69(d,J=5.8Hz,2H),3.62(t,J=4.7Hz,2H),3.43(t,J=6.0Hz,2H),3.2 3(dd,J=11.8,5.9Hz,2H),2.53(s,1H),2.38(t,J=7.3Hz,2H),2.27(d,J=10.7Hz,1H), 2.10–1.94(m,4H),1.69(dd,J=25.8,11.1Hz,2H),1.56(d,J=16.4Hz,2H),1.46(dd,J= 11.1, 6.8Hz, 1H), 1.34 (d, J = 26.9Hz, 6H), 1.09 (s, 3H), 1.04–0.91 (m, 2H), 0.88 (s, 3H).

[0618] 1.30 Synthesis of negative control compound P10

[0619] Reagents and reaction conditions: (a) EDCI, DIPEA, DMAP, dichloromethane, room temperature, 5 hours; (b) L-ascorbic acid, copper sulfate, THF / H2O (volume ratio 1:1), room temperature, 4 hours.

[0620] 1.30.1 Compound 21: ((8S,9S,10R,11S,13S,14S,17R)-11,17-dihydroxy-10,13-dimethyl-3-oxo-6,7,8,9,10,11,12,13,14,15,16,17-dodecylhydro-3H-cyclopenta[a]phenanthrene-17-yl)-2-oxoethyl 3-(2-azidoethoxy)propionate

[0621] Prednisolone (20) (300 mg, 0.8 mmol, 1.0 eq), carboxylic acid intermediate 13a (127 mg, 0.8 mmol, 1.0 eq), 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCI) (192 mg, 1.0 mmol, 1.3 eq), N,N-diisopropylethylamine (DIPEA) (278 μL, 1.6 mmol, 2.0 eq), and 4-(dimethylamino)pyridine (DMAP) (20 mg, 0.16 mmol, 0.2 eq) were dissolved in dichloromethane (8 mL) and stirred at room temperature for 5 hours. After the reaction was complete, the reaction solution was partitioned into water and dichloromethane. The organic layer was separated, washed successively with water and saturated brine, dried over anhydrous sodium sulfate, and the filtrate was concentrated after filtration. The residue was purified by silica gel column chromatography (dichloromethane / methanol, v / v ratio 99:1 to 98:2) to give compound 21. Yield: 67%. 1 HNMR (400MHz, DMSO-d6) δ7.32(d,J=10.1Hz,1H),6.16(dd,J=10.1,1.5Hz,1H),5.91(t,J=1.5Hz,1H),5.41(s,1H),5.09(d,J=17. 6Hz,1H),4.77(d,J=17.6Hz,1H),4.72(d,J=3.9Hz,1H),4.31–4.26(m,1H),3.69(d,J=6.2Hz,2H),3.63–3.56(m,2H),3.41–3.34(m ,2H),2.66(t,J=6.3Hz,2H),2.55–2.43(m,2H),2.29(dd,J=13.4,4.2Hz,1H),2.06–2.00(m,2H),1.89(dd,J=13.7,3.6Hz,1H),1. 69–1.57(m,3H),1.50–1.40(m,1H),1.39(s,3H),1.36–1.21(m,1H),1.08–0.94(m,1H),0.89(dd,J=11.0,3.4Hz,1H),0.79(s,3H). 13 C NMR(101MHz,DMSO-d6)δ205.09,185.14,170.47,170.36,156.67,127.04,121.57,88.62,69.14,68.30,67.5 8,65.78,55.35,51.04,49.84,47.04,43.75,38.67,34.32,33.96,33.06,31.31,30.90,23.49,20.86,16.48.

[0622] 1.30.2 Compound P10: 2-((8S,9S,10R,11S,13S,14S,17R)-11,17-dihydroxy-10,13-dimethyl-3-oxo-6,7,8,9,10,11,12,13,14,15,16,17-dodecylhydro-3H-cyclopenta[a]phenanthrene-17-yl)-2-oxoethyl 3-(2-(4-(4-((2-(((2-methoxy-6-((2-methyl-[1,1'-biphenyl]-3-yl)methoxy)pyridin-3-yl)methyl)amino)ethyl)amino)4-oxobutyl)-1H-1,2,3-triazol-1-yl)ethoxy)propionate

[0623] Compound 10b (130 mg, 0.28 mmol, 1.0 eq), compound 21 (141 mg, 0.28 mmol, 1.0 eq), L-ascorbic acid (146 mg, 0.83 mmol, 3.0 eq), and anhydrous copper(II) sulfate (57 mg, 0.36 mmol, 1.3 eq) were dissolved in a tetrahydrofuran / water mixture (3:3 v / v). The reaction mixture was stirred at room temperature for 4 hours. After the reaction was complete, the reaction mixture was concentrated, and the residue was purified by silica gel column chromatography (dichloromethane / methanol, 98:2 to 92:8 v / v) to give compound P10. Yield: 28%. 1H NMR(400MHz,DMSO-d6)δ8.12(t,J=5.7Hz,1H),7.81(s,1H),7.79(d,J=8.0Hz,1H),7.50–7.42(m,3H),7.41–7.23(m,5H),7.21–7.15(m,1H),6.50(d,J=8.0Hz,1H),6.15(dd,J=10.1,1.9Hz,1H),5.91(s,1H),5.47(s,1H),5.44(s,2H),5.08(d,J=17.6Hz,1H),4.77(s,1H),4.74(d,J=17.6Hz,1H),4.45(t,J=5.2Hz,2H),4.31–4.26(m,1H),3.96(s,2H),3.93(s,3H),3.78(t,J=5.2Hz,2H),3.66(t,J=6.2Hz,2H),3.46–3.35(m,2H),2.89(t,J=6.4Hz,2H),2.65–2.55(m,4H),2.52–2.42(m,2H),2.28(d,J=12.9Hz,1H),2.21(s,3H),2.16(t,J=7.5Hz,2H),2.05–1.99(m,2H),1.92–1.76(m,3H),1.68–1.61(m,3H),1.49–1.40(m,1H),1.38(s,3H),1.35–1.21(m,1H),1.03–0.96(m,1H),0.92–0.84(m,1H),0.78(s,3H). 13 C NMR(101MHz,DMSO-d6)δ205.16,185.16,172.59,170.51,170.44,162.22,160.36,156.73,146.29,143.48,142.18,141.36,135.66,133.87,129.62,129.15,128.29,128.25,127.02,126.97,125.49,122.25,121.56,101.36,88.62,68.62,68.27,67.64,66.44,65.64,55.37,53.59,51.04,49.09,47.07,46.41,44.41,43.76,38.68,35.68,34.74,34.15,33.97,33.06,31.31,30.91,25.00,24.59,23.50,20.85,16.48,15.94.HRMS(ESI + )m / z calcd for C55 H 68 N6O 10 [M+H] + 973.5070; found 973.5105.

[0624] 1.31 Synthesis of negative control compound P2-ΔS: Same as in Example 1.8.4.

[0625] 1.32 Synthesis of negative control compound P2-ΔT: Same as in Example 1.9.1.

[0626] Example 2: SYVN1-based compound screening

[0627] This invention screens a compound library consisting of 4000 FDA-approved drugs and some other compounds. First, the compounds are spotted onto a small molecule microarray substrate using a chip spotting instrument. The compound concentration is 10 mM, with a volume of 5 μL per well. The substrate is modified to contain reactive chemical groups, which allows the compounds to couple onto the substrate after spotting. Then, Streptavidin-Alexa488 is spotted along the substrate border for coordinate calibration. The compounds are then reacted with the SYVN1 protein to screen for small molecules that specifically bind to SYVN1. The chip with the spotted small molecules reacts with the SYVN1 protein, which is tagged with a fluorescent protein. The resulting scan is performed using a fluorescence scanner; bright spots indicate that the small molecule compound may bind to the SYVN1 protein. By excluding autofluorescent small molecules from those that may bind to SYVN1, small molecules that specifically bind to SYVN1 are selected.

[0628] Fluorescence scanning revealed that desonide (1B3 in Figure 1), deisobutylcyclosone (3A22 in Figure 1), budesonide (13J6 in Figure 1), and 5,7,4′-trimethoxyflavone (3O16 in Figure 1) can specifically bind to the SYVN1 protein (Figure 1-Figure 2).

[0629] Example 3: Identification of SYVN1-binding compounds

[0630] 3.1 Micro-thermophoresis (MST) was used to detect the interaction between candidate compounds and SYVN1.

[0631] The purified protein SYVN1 was labeled according to the operating procedure of the Protein Labeling Kit RED-NHS (Nanotemper, catalog number #L001). Desonide was diluted in SEC buffer (containing 150 mM sodium chloride (Sigma), 20 mM HEPES (pH 7.5, Sigma), 0.01% LMNG + 0.002% CHS, 0.5 mM TCEP) to a final dimethyl sulfoxide (DMSO) concentration of 2.5%. The labeled protein was mixed with different concentrations of the compound in the reaction buffer. Micro-thermophoresis (MST) experiments were performed using a Monolith X instrument (NanoTemper Technologies). The data were analyzed using Nanotemper analysis software (v.2.6.3), and the dissociation constant (Kd) was determined. The proportion of protein bound to the compound (bound state / total protein) was calculated based on the MST signal. Each graph is labeled with the fitted curve and the dissociation constant (Kd value) calculated by Nanotemper analysis software. Alone α-synuclein-MBP fusion protein (α-synuclein-MBP) was used as a control protein.

[0632] The interaction between desonide analogues deisobutylcyclosone, budesonide, prednisolone and SYVN1 was detected using the same MST method. No control protein was set up in this experiment.

[0633] As shown in Figures 3 and 4, desinede, budesonide, and desisobutylcyclosone interact with SYVN1, while prednisolone does not. The structural differences are highlighted in blue, suggesting that the 1,3-dioxolane structure may be essential for the binding interaction.

[0634] 3.2 Isothermal titration calorimetry (ITC) experiment to detect the interaction between candidate compounds and SYVN1

[0635] 280 μL of purified protein SYVN1 at a concentration of 10 μM (dissolved in ITC buffer containing 20 mM HEPES pH 7.0, 100 mM NaCl, and 0.2% DMSO) was injected into the sample cell. Then, a candidate compound (200 μM) dissolved in the same buffer was injected 20 times (0.4 μL for the first drop, 2 μL for drops 2-20). Injection intervals were 180 seconds. The experiment was conducted at a constant temperature of 25 °C, and the heat (H) released by the binding reaction was recorded in real time. Titration experiments were repeated. The heat released or absorbed by molecular binding is directly proportional to the number of bound molecules. When the system reaches saturation, only the heat of dilution is observed. Data were analyzed using a one-site binding model with Origin software, and the data from the last 5 injections were used as a baseline.

[0636] As shown in Figure 5, desonide, budesonide, and desisobutylcyclosone interact with SYVN1, while prednisolone does not. Subsequent examples use desonide as a representative compound for further verification.

[0637] Example 4: Validation of desonide as a SYVN1 binding compound

[0638] This invention identifies a potential SYVN1-binding compound, desonide, as a degrader of the mutant HTT protein (mHTT) that causes Huntington's disease. Studies have shown that desonide induces polyubiquitination of the mutant Huntington's protein (mHTT poly-Ub) to enhance its degradation.

[0639] 4.1 SYVN1 knockdown eliminates the degradation effect of desonide on mHTT

[0640] To further elucidate the molecular mechanism by which desonide mediates mHTT poly-Ub, this invention investigated the potential involvement of polyubiquitination (poly-Ub)-related enzymes that may interact directly with mHTT via siRNA knockdown. Small interfering RNA (siRNA) was reverse-transfected into HEK293T cells using a Lipofectamine 3000 (Thermo Fisher Scientific, catalog number: L3000075). All transfection procedures were performed according to the manufacturer's protocol. Cells were collected after siRNA transfection for Western blot and homogeneous time-resolved fluorescence (HTRF) detection. The target sequence and / or ordering information for the siRNA are as follows: Negative control siRNA (Neg siRNA): Non-targeting siRNA (General Biosystems, Inc., catalog number: RX028810). The results showed that knockdown of SYVN1 completely eliminated the reduction in mHTT levels caused by desonide treatment, indicating that SYVN1 is involved. Further testing of mHTT's poly-Ub confirmed that mHTT's poly-Ub was enhanced by desonide treatment, while knocking down SYVN1 largely blocked this effect (Figure 6).

[0641] 4.2 Immunoprecipitation revealed enhanced Lys6-dependent mHTT-SYVN1 binding and ubiquitination.

[0642] SYVN1 and HTT plasmids were transfected into HEK293T cells using Lipofectamine 3000. After 24 hours, the specified compound or dimethyl sulfoxide (DMSO) control was added to the culture medium, and the cells were incubated for 3 hours. The cell pellet was collected and lysed on ice with 500 μL of NP-40 lysis buffer (Beyotime, catalog number: P0013F) + 1× complete protease inhibitor for at least 1 hour. The lysis buffer was centrifuged at 4°C and greater than 20,000×g for 20 minutes, and the supernatant was transferred to a new centrifuge tube, reserving 30 μL of supernatant as an input control (used to verify the presence and concentration of the target protein in the sample before immunoprecipitation). 10 μL of equilibrated tagged monoclonal antibody magnetic beads were added to each remaining 470 μL of lysis buffer. The mixture was incubated overnight at 4°C. The magnetic beads were washed four times with lysis buffer, then resuspended in 120 μL of 1×LDS-DTT loading buffer and eluted by boiling. The samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot. The results showed that desonide enhanced the interaction between mHTT and SYVN1, which exhibited a relatively low baseline interaction. The enhancement of both mHTT poly-Ub and mHTT-SYVN1 interactions by desonide was dependent on the Lys 6 residue, indicating that Lys 6 is essential for the action of desonide on mHTT (Figure 6).

[0643] 4.3 KEAP1 negative control

[0644] A375 cells were used with TrypLE at 37°C. TMCells were digested for 3 minutes using Express (Thermo Fisher Scientific, cat#12605028), followed by centrifugation at 850 rpm for 5 minutes to collect the cells, and the supernatant was discarded. Cells were lysed on ice for 40 minutes using RIPA buffer (Beyotime, catalog #P0013B) containing a protease inhibitor mixture (Roche, cat#04693132001). Protein concentration was quantified using a BCA kit. Equal volumes of sample lysates were separated by SDS-PAGE and then transferred to a PVDF membrane (Millipore, cat#ISEQ00010). The membrane was blocked at room temperature for 1 hour using protein-free rapid blocking buffer (EpiZyme, cat#PS108P). The membrane was incubated with primary antibody overnight at 4°C, followed by incubation with secondary antibody at room temperature for 1 hour. The signal on the membrane was then imaged using a Tanon-5200 fully automated chemiluminescence imaging system. The intensity of the protein blot bands was quantified using ImageJ software. The results showed that, as a control, desonide did not interact with kelch-like ECH-associated protein 1 (KEAP1), which is a component of the cullin 3E3 ligase (Figure 7).

[0645] In summary, desonide was identified as a small molecule compound that interacts with SYVN1.

[0646] Example 5: Desonide-based ERADECS reduces PD-L1 protein levels

[0647] As previously mentioned, SYVN1 is a major ER-E3 that can be hijacked via ERAD to target and degrade membrane targets. This invention links it to a known ligand / inhibitor of a transmembrane protein target for proof-of-concept. Comparing the structures of desonide and other GR agonists with retained or eliminated SYVN1, the 21-hydroxyl group may not be essential for SYVN1 binding and could be used to link linkers to synthesize chimeric compounds, potentially serving as ERADECs. Therefore, such ERADECs were generated by linking desonide to the PD-L1 ligand BMS-202, and their effects on PD-L1 levels were tested in A375 and MDA-MB-231 cell systems.

[0648] 1. A375 cell test

[0649] A375 cells were used with TrypLE at 37°C. TMCells were digested for 3 minutes using Express (Thermo Fisher Scientific, cat#12605028), followed by centrifugation at 850 rpm for 5 minutes to collect the cells, and the supernatant was discarded. Cells were lysed on ice for 40 minutes using RIPA buffer (Beyotime, catalog #P0013B) containing a protease inhibitor mixture (Roche, cat#04693132001). Protein concentration was quantified using a BCA kit. Equal volumes of sample lysates were separated by SDS-PAGE and then transferred to a PVDF membrane (Millipore, cat#ISEQ00010). The membrane was blocked at room temperature for 1 hour using protein-free rapid blocking buffer (EpiZyme, cat#PS108P). The membrane was incubated with primary antibody overnight at 4°C, followed by incubation with secondary antibody at room temperature for 1 hour. The signal on the membrane was then imaged using a Tanon-5200 fully automated chemiluminescence imaging system. The intensity of the protein blot bands was quantified using ImageJ software.

[0650] 2. MDA-MB-231 cell assay

[0651] MDA-MB-231 cells were used at 37°C using TrypLE TM Cells were digested for 3 minutes using Express (Thermo Fisher Scientific, cat#12605028), followed by centrifugation at 850 rpm for 5 minutes to collect the cells, and the supernatant was discarded. Cells were lysed on ice for 40 minutes using RIPA buffer (Beyotime, catalog #P0013B) containing a protease inhibitor mixture (Roche, cat#04693132001). Protein concentration was quantified using a BCA kit. Equal volumes of sample lysates were separated by SDS-PAGE and then transferred to a PVDF membrane (Millipore, cat#ISEQ00010). The membrane was blocked at room temperature for 1 hour using protein-free rapid blocking buffer (EpiZyme, cat#PS108P). The membrane was incubated with primary antibody overnight at 4°C, followed by incubation with secondary antibody at room temperature for 1 hour. The signal on the membrane was then imaged using a Tanon-5200 fully automated chemiluminescence imaging system. The intensity of the protein blot bands was quantified using ImageJ software.

[0652] The results showed that various different ERADECs (P2, P3, P5, P7, PB-1a, PB-1b, PB-2b, PB-3a, P12, P13) significantly reduced PD-L1 levels in MDA-MB-231 and A375 cells in the sub-nM to nM concentration range (Figures 8-10).

[0653] Furthermore, this invention also confirmed the reduction in PD-L1 levels in the cytoplasmic membrane of intact A375 cells by flow cytometry (FACS) analysis.

[0654] Example 6: ERADECs reduce PD-L1 protein levels via SYVN1 and ERAD

[0655] This embodiment investigates the potential mechanism of ERADEC by verifying the dependency between SYVN1 and ERAD.

[0656] 6.1 Cellular validation of SYVN1 knockdown

[0657] Small interfering RNA (siRNA) was reverse-transfected into MDA-MB-231 cells using Lipofectamine 3000 (Thermo Fisher Scientific, catalog number: L3000075). All transfection procedures were performed according to the manufacturer's protocol. Cells were collected after siRNA transfection for Western blotting. The target sequence and / or ordering information for the siRNA are as follows: Negative control siRNA (Neg siRNA): Non-targeting siRNA (General Biosystems, catalog number: RX028810)

[0658] The results showed that knocking down SYVN1 in MDA-MB-231 cells largely eliminated the PD-L1 reduction in ERADECs P3, confirming the dependence of SYVN1 (Figure 11A).

[0659] 6.2 Cellular validation of SYVN1 knockout

[0660] U-251MG cells were used to further generate SYVN1 knockout cell lines. Compared with other cancer cell lines, SYVN1 knockout had a lower lethality score, thus providing a better chance of obtaining knockout clones in these cells. Gene knockout was confirmed by gene sequencing and Western blotting.

[0661] Experimental Procedure: CRISPR-Cas9-mediated SYVN1 gene knockout was achieved using a CRISPR-Cas9 ribonucleoprotein complex (RNP, provided by Haixing Biotechnology) containing a humanized SpCas9 (hSpCas9) and a chimeric guide RNA expression cassette. To target exons 1-16 of the SYVN1 gene, two guide RNA sequences were selected using http: / / crispr.mit.edu: CCAGGAGTTGCGGGCGTCGC AGG and TGACTCCGCACATACAAGTA GGG. Following the manufacturer's (Thermo Fisher Scientific) instructions, plasmids containing the guide RNA sequences were electrotransfected into cells using the Neon electrotransfection system. Two days after transfection, single-clone cells were transferred to 96-well plates for culture. To detect the presence of insertion or deletion mutations (indels) in the SYVN1 gene-targeted clones, genomic DNA was extracted using the Quick-DNA Micro-Extraction Kit (Zymo Research), and PCR amplification of the flanking regions of the SYVN1 gene exons was performed using 2×Taq Master Mix (with dye, Vazyme, catalog number: P112). The primer sequences used are as follows: Forward primer: 5'-AGTGTTGTTAACCGGAGGGG-3'; Reverse primer: 5'-CACTTGGGAACGGGAGCTAA-3'. Plasmids were extracted from 8–10 monoclonal cells and sequenced using Sanger sequencing (GENEWIZ, China). Clones with mutations in both biallelic alleles of the SYVN1 gene were screened for subsequent experimental studies. All clones were cultured under the same conditions as the parental cells.

[0662] The results showed that the PD-L1 reduction effect of ERADEC PB1b treatment was present in parental U-251MG cells, but not in SYVN1 knockout cells, further confirming the SYVN1 dependence (Figure 11B).

[0663] 6.3 Further validation of the mechanism using negative control compounds

[0664] As shown in Figure 12, the control compounds with either the PD-L1 ligand removed (P2-ΔT, i.e., the SYVN1 ligand) or the SYVN1 ligand removed (P2-ΔS, i.e., the PD-L1 ligand) failed to induce PD-L1 degradation, indicating the need to link two ligands in the same compound (Figure 12A). A negative control compound, P10, was further designed by linking the PD-L1 ligand BMS-202 to prednisolone, a GR agonist similar to desonide but not binding to SYVN1. This control compound also failed to reduce PD-L1, providing a more specific negative control (Figure 12B).

[0665] 6.4 The proteasome inhibitor MG132 specifically blocks ERADEC-mediated PD-L1 degradation and enhances its polyubiquitination.

[0666] Since ERADECs ultimately degrade their substrates via the proteasome, this example used the proteasome inhibitor MG132 to treat MDA-MB-231 cells: cells were seeded in culture plates, and treatment began when confluence reached 50–70%. Proteasome inhibition: MG132 (2 μM) was added. Autophagy inhibition control: Chloroquine (CQ) (25 μM) was added. It was observed that only the proteasome inhibitor significantly blocked the action of ERADEC P2, while the autophagy inhibitor chloroquine (CQ) had no such effect. It was also confirmed that ERADECs enhanced the poly-Ub of PD-L1 in cells treated with the proteasome inhibitor MG132 in a SYVN1-dependent manner. Therefore, ERADECs can enhance SYVN1-mediated poly-Ub degradation of PD-L1 via the proteasome (Figure 13A).

[0667] 6.5 ERAD-dependent degradation of PD-L1 was verified by specifically inhibiting the p97 / VCP pathway.

[0668] MDA-MB-231 cells with high PD-L1 expression were cultured in DMEM medium containing 10% fetal bovine serum (37℃, 5% CO2). The p97 / VCP inhibitor CB5083 was used, and the control group used an equal volume of DMSO as the solvent. The gene knockdown group used Lipofectamine 3000 (Thermo Fisher Scientific, catalog number: L3000075) as the p97 / VCP-specific siRNA transfection reagent. Cell intervention was performed first: CB5083 was added to the inhibitor group when cell confluence reached 70%, while an equal volume of DMSO was added to the control group simultaneously. The gene knockdown group was treated according to the transfection reagent instructions, with drug treatment occurring 24 hours after transfection. Protein samples were extracted using cell lysis buffer and quantified using the BCA method. Equal volumes of protein were subjected to SDS-PAGE electrophoresis and transferred to a membrane for Western blotting. After chemiluminescence imaging, the band gray values ​​were quantified using Image Lab software.

[0669] The results showed that, unlike the traditional UPS pathway (which does not require p97 / VCP), treatment of cells with p97 / VCP inhibitors or p97 / VCP knockdown completely blocked the effect of ERADECs on PD-L1, confirming a specific dependence on ERAD (Figures 13B and 13C).

[0670] Example 7: Confirmation of the binding of ERADEC and SYVN1

[0671] 7.1 Confirmation of the binding of ERADECs to SYVN1 by real-time oblique incidence reflectivity difference (OI-RD)

[0672] To determine the binding kinetics between the target protein and the compound, this embodiment prepared novel small molecule microarrays (SMMs) composed of desine and ERADECs (compounds PB1b, PB2b, PB1a, and PB3a). Six identical microarrays were printed on each glass slide, with each compound printed in triplicate within a single microarray. The printed microarrays were then assembled into fluid cartridges, with each microarray independently housed in a chamber.

[0673] Before the binding reaction began, the slide was washed in situ with flowing PBS to remove excess unbound sample, followed by blocking with PBS solution containing 7600 nM BSA for 30 minutes. For binding kinetics determination, PBS was first allowed to flow through the reaction chamber for 5 minutes; then the PBS was replaced with probe solution for 35 minutes to allow the binding phase of the reaction; subsequently, the probe solution was replaced with PBS again to allow the probe to dissociate for 30 minutes.

[0674] The binding reaction of the target protein was repeated on separate, fresh microarrays at three different concentrations, and the binding curves of the compound and the target protein were recorded using scanning optical interference reflection microscopy (OI-RD). Finally, a 1:1 Langmuir reaction model was used to globally fit the binding curves, thereby extracting the reaction kinetic rate constant.

[0675] As shown in Figure 14, the ERADECs represented by compounds PB1b, PB2b, PB1a, and PB3a can bind to SYVN1.

[0676] 7.2 Microthermophoresis (MST) experiments confirmed the binding of ERADECs to SYVN1.

[0677] The purified protein SYVN1 was labeled according to the operating procedure of the Protein Labeling Kit RED-NHS (Nanotemper, catalog number #L001). Compounds (P7, PB2b, PB3a) were diluted in SEC buffer (containing 150 mM sodium chloride (Sigma), 20 mM HEPES (pH 7.5, Sigma), 0.01% LMNG + 0.002% CHS, 0.5 mM TCEP) to a final dimethyl sulfoxide (DMSO) concentration of 2.5%. The labeled protein was mixed with different concentrations of candidate compounds in the reaction buffer. Microthermophoresis (MST) experiments were performed using a Monolith X instrument (NanoTemper Technologies). Data were analyzed using Nanotemper analysis software (v.2.6.3), and the dissociation constant (Kd) was determined.

[0678] The proportion of protein bound to the compound (bound state / total protein) was calculated based on the MST signal. Each figure is labeled with the fitted curve and the dissociation constant (Kd value) calculated by Nanotemper analysis software.

[0679] As shown in Figure 15, ERADECs represented by compounds P7, PB2b, and PB3a can bind to SYVN1.

[0680] Example 8: Specificity of PD-L1 ERADECs

[0681] To test the specificity of targeted degradation, proteomic analysis was performed on A375 cells treated with a specified concentration of PD-L1 ERADEC P7.

[0682] A375 cells were seeded into 12-well plates at a density of 50,000–100,000 cells per well and treated with DMSO or P7 for 48 hours. The treated cell...

Claims

A protein degradation complex or a pharmaceutically acceptable salt thereof, said complex having the structure: BLA, wherein, B is the target protein ligand, L is the linker, and A is the SYVN1 binding compound. The protein degradation complex according to claim 1, characterized in that, The BLA is TBM is the target protein binding region, which can bind to the target protein; L is the linker; SBM is the SYNV1 binding region, which can bind to the SYVN1 protein. Where A corresponds to SBM and B corresponds to TBM. The protein degradation complex according to claim 1 or 2, characterized in that, The SYVN1 binding compound is selected from the group consisting of: desonide, deisobutylcyclosone, budesonide, and 5,7,4′-trimethoxyflavone. The protein degradation complex according to claim 2, characterized in that, The SBM is R1 and R2 are each independently selected from H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C6 cycloalkyl, and 4-8 membered heterocyclic groups. The protein degradation complex according to claim 1 or 2, characterized in that, The L linker is selected from the following structures and any combination thereof: substituted or unsubstituted amino, carbonyl, halogen, cyano, C1-C4 alkyl, C3-C6 cycloalkyl, alkane chain, PEG chain, alkyne, olefin, 6-10 aryl, 5-10 heteroaryl, 3-10 heterocyclic alkane, 3-10 spirocyclic heterocycle and / or 3-10 bridged heterocycle; wherein the 5-10 heteroaryl, 3-10 heterocyclic alkane, 3-10 spirocyclic heterocycle and 3-10 bridged heterocycle contain 1-3 heteroatoms selected from N, O and / or S. The protein degradation complex according to claim 1 or 2, characterized in that, The L connector is -L1-L2-L3-L4-L5-L6-L7-L8-; Wherein, L1 is selected from the following group: none, C1-C4 alkylene, C2-C4 alkenyl, -(CH2CH2O) n CH2CH2-; L2 is selected from the following group: none, -NHCO-, -CONH-, -CO-, 4-8 membered heterocyclic alkylene groups; L3 is selected from the following group: none, C1-C15 alkylene, C2-C15 alkenylene, -(CH2CH2O) n CH2CH2-; L4 is selected from the following group: none, -NHCO-, -CONH-, -CO-, 5-8 quinone heteroaryl; L5 is selected from the following group: C1-C15 alkylene, C2-C15 alkenylene, -(CH2CH2O) n CH2CH2-、-(CH2CH2O) n CH2-, -(CH2CH2O) n -; L6 is selected from the following groups: none, -COO-, -CONH-, -NHCO-, -CO-; L7 is selected from the following group: none, C1-C4 alkylene, C2-C4 alkenylene, -NH-, -O-; L8 is -CO-. The protein degradation complex according to claim 1 or 2, characterized in that, The target protein ligands are selected from the following group: bromodomain protein 4 (BRD4) ligand, nicotinamide phosphoribosyltransferase (NAMPT) ligand, cyclin-dependent protein kinase 2 (CDK2) ligand, Bruton's tyrosine kinase (BTK) ligand, programmed cell death receptor ligand 1 (PD-L1) ligand, epidermal growth factor receptor (EGFR) ligand, macrophage migration inhibitory factor (MIF) ligand, and ligands of orphan G protein-coupled receptor (GPR52) protein. The protein degradation complex according to any one of claims 1-7, characterized in that, When B is a bromodomain protein 4 (BRD4) ligand, the structure of the protein degradation complex is as follows: When B is a ligand for nicotinamide phosphoribosyltransferase (NAMPT), the structural formula of the protein degradation complex is: When B is a cyclin-dependent protein kinase 2 (CDK2) ligand, the structure of the protein degradation complex is as follows: When B is a Bruton's tyrosine kinase (BTK) ligand, the structure of the protein degradation complex is as follows: When B is a ligand for programmed cell death receptor 1 (PD-L1), the structural formula of the protein degradation complex is: When B is an epidermal growth factor receptor (EGFR) ligand, the structural formula of the protein degradation complex is: When B is a macrophage migration inhibitory factor (MIF) ligand, the structure of the protein degradation complex is as follows: When B is an orphan G protein-coupled receptor (GPR52) ligand, the structure of the protein degradation complex is as follows: A targeted protein degradation method, characterized in that, In this method, the chemical ligands interact with the main ER-E3SYVN1, hijacking ERAD for targeted degradation; the method targets and degrades transmembrane proteins, secretory proteins, and other proteins. A screening method, characterized in that, Including the following steps: (a) Provide a molecule, said molecule having structure, TBM is the target protein binding region, which can bind to the target protein; L is the linker; SBM is the SYVN1 binding region, which may bind to SYVN1. (b) Contact the molecule with a system in which the levels of target proteins or target gene expression are abnormally elevated. (c) Detect the level of target protein or target gene expression in the system; (d) Output results: If the target protein level or target gene expression level is significantly reduced, the molecule can be used as a protein degradation complex to degrade the target protein. If the target protein level or target gene expression level is not significantly reduced, the molecule cannot be used as a protein degradation complex to degrade the target protein. A method for degrading a target protein includes the steps of: contacting a protein degradation complex or a pharmaceutically acceptable salt thereof with the target protein, wherein the SBM portion of the protein degradation complex interacts with the major ER-E3 SYVN1 to perform targeted degradation by hijacking ERAD; in, The protein degradation complex has structure, TBM is the target protein binding region, which can bind to the target protein; L is the linker; SBM is the SYVN1 binding region, which can bind to SYVN1. A protein-degrading pharmaceutical composition comprising the protein-degrading complex of any one of claims 1-8 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. Use of the protein degradation complex of any one of claims 1-8 or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 12, in the preparation of a medicament for the prevention and / or treatment of diseases related to the activity or expression level of a target protein. The use as described in claim 13, characterized in that, When the protein degradation complex contains a bromodomain protein 4 (BRD4) ligand, the pharmaceutical composition is used to treat diseases such as solid tumors, hematologic malignancies, and fibrosis; when the protein degradation complex contains a nicotinamide phosphoribosyltransferase (NAMPT) ligand, the pharmaceutical composition is used to treat tumors, cardiovascular and cerebrovascular diseases, diabetes, and autoimmune diseases; when the protein degradation complex contains a cyclin-dependent protein kinase 2 (CDK2) ligand, the pharmaceutical composition is used to treat tumors, viral infections, immune diseases, and infertility; when the protein degradation complex contains a Bruton's tyrosine kinase (BTK) ligand, the pharmaceutical composition is used to treat autoimmune diseases and inflammatory diseases; when the protein degradation complex contains... When the protein degradation complex contains programmed cell death receptor ligand 1 (PD-L1), the pharmaceutical composition is used to treat tumor-related diseases; when the protein degradation complex contains epidermal growth factor receptor (EGFR) ligand, the pharmaceutical composition is used to treat tumor-related diseases; when the protein degradation complex contains macrophage migration inhibitory factor (MIF) ligand, the pharmaceutical composition is used to treat inflammatory bone diseases, sepsis, glomerulonephritis, pancreatitis, immune myocarditis, colitis, chronic inflammatory diseases, cancer, Gram-negative and Gram-positive sepsis, etc.; when the protein degradation complex contains orphan G protein-coupled receptor (GPR52) ligand, the pharmaceutical composition is used to treat Huntington's disease, schizophrenia, cognitive impairment, brain malformations, and ADHD, etc. The use as described in claim 13, characterized in that, When the protein degradation complex contains a bromodomain protein 4 (BRD4) ligand, i.e., when the protein degradation complex targets BRD4, the pharmaceutical composition is used to treat or prevent diseases associated with the BRD4 pathway, selected from the following group: Malignant tumors, including one or more of the following: acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, diffuse large B-cell lymphoma, multiple myeloma, neuroblastoma, Ewing's sarcoma, melanoma, breast cancer, prostate cancer, ovarian cancer, lung cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, colorectal cancer, and glioma. Inflammatory and autoimmune diseases, including one or more of the following: rheumatoid arthritis, systemic lupus erythematosus, psoriasis, atopic dermatitis, inflammatory bowel disease, asthma, Sjögren's syndrome, and multiple sclerosis; Cardiovascular and metabolic diseases, including one or more of the following: atherosclerosis, heart failure, hypertrophic cardiomyopathy, diabetes and its complications, and fatty liver disease; Fibrosis-related diseases, including one or more of pulmonary fibrosis, liver fibrosis, kidney fibrosis, and myocardial fibrosis; Viral infectious diseases, including one or more of HIV infection, hepatitis B virus-related diseases, hepatitis C virus-related diseases, and human papillomavirus-related diseases; Alternatively, when the protein degradation complex contains a nicotinamide phosphoribosyltransferase (NAMPT) ligand, i.e., when the protein degradation complex targets NAMPT, the pharmaceutical composition is used to treat or prevent diseases associated with the NAMPT pathway, selected from the group consisting of: Malignant tumors, including one or more of the following: acute myeloid leukemia, acute lymphoblastic leukemia, chronic myeloid leukemia, non-small cell lung cancer, small cell lung cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, gastric cancer, colorectal cancer, hepatocellular carcinoma, melanoma, glioblastoma, and multiple myeloma; Metabolic diseases, including one or more of the following: type 2 diabetes, obesity, non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, metabolic syndrome, and insulin resistance-related diseases; Cardiovascular diseases, including one or more of the following: atherosclerosis, coronary heart disease, myocardial ischemia-reperfusion injury, heart failure, and pulmonary hypertension; Inflammatory and autoimmune diseases, including one or more of the following: rheumatoid arthritis, psoriasis, inflammatory bowel disease, systemic lupus erythematosus, multiple sclerosis, and Sjögren's syndrome; Neurological disorders, including one or more of Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis; Acute injury and ischemia-reperfusion related diseases, including one or more of acute kidney injury, acute lung injury, stroke, myocardial infarction, and ischemia-reperfusion injury; Alternatively, when the protein degradation complex contains a cyclin-dependent protein kinase 2 (CDK2) ligand, i.e., when the protein degradation complex targets CDK2, the pharmaceutical composition is used to treat or prevent diseases related to the CDK2 pathway, selected from the following group: Malignant tumors, including one or more of the following: breast cancer, ovarian cancer, endometrial cancer, prostate cancer, non-small cell lung cancer, small cell lung cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, colorectal cancer, melanoma, glioma, osteosarcoma, neuroblastoma, acute myeloid leukemia, acute lymphoblastic leukemia, and multiple myeloma. Proliferation-related diseases and tissue abnormalities, including one or more of the following: psoriasis, atopic dermatitis, chronic obstructive pulmonary disease-related proliferative abnormalities, and fibrotic diseases; Female reproductive system-related diseases, including one or more of polycystic ovary syndrome (PCOS), premature ovarian failure, ovulation disorders, and hormone-dependent diseases; Neurological disorders, including one or more of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and neurodegenerative diseases associated with abnormal activation of the cell cycle; Cardiovascular diseases, including one or more of atherosclerosis, heart failure, myocardial hypertrophy, and myocardial ischemia-reperfusion injury; Alternatively, when the protein degradation complex contains a Bruton's tyrosine kinase (BTK) ligand, i.e., when the protein degradation complex targets BTK, the pharmaceutical composition is used to treat or prevent diseases associated with the BTK pathway, selected from the group consisting of: Hematologic malignancies, including chronic lymphocytic leukemia, mantle cell lymphoma, Waldenström macroglobulinemia, marginal zone lymphoma, diffuse large B-cell lymphoma, Hodgkin lymphoma, non-Hodgkin lymphoma, multiple myeloma, and one or more other B-cell malignancies; Autoimmune diseases, including one or more of the following: systemic lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, multiple sclerosis, myasthenia gravis, thrombocytopenic purpura, and autoimmune hemolytic anemia; Inflammatory diseases, including one or more of the following: asthma, chronic obstructive pulmonary disease, allergic rhinitis, atopic dermatitis, psoriasis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), polyangiitis, and chronic inflammatory diseases; Transplant-related diseases, including graft-versus-host disease (GVHD), organ transplant rejection, or one or more of these. Alternatively, when the protein degradation complex contains programmed death receptor ligand 1 (PD-L1), i.e., when the protein degradation complex targets PD-L1, the pharmaceutical composition is used to treat or prevent diseases associated with the PD-L1 pathway, selected from the group consisting of: Malignant tumors, including one or more of the following: non-small cell lung cancer, small cell lung cancer, melanoma, renal cell carcinoma, hepatocellular carcinoma, gastric cancer, gastroesophageal junction adenocarcinoma, colorectal cancer, esophageal squamous cell carcinoma, esophageal adenocarcinoma, head and neck squamous cell carcinoma, bladder cancer / urothelial carcinoma, biliary tract cancer, pancreatic cancer, ovarian cancer, cervical cancer, endometrial cancer, breast cancer, prostate cancer, soft tissue sarcoma, mesothelioma, and neuroblastoma; Hematologic malignancies, including one or more of the following: Hodgkin's lymphoma, primary mediastinal large B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, peripheral T-cell lymphoma, anaplastic large cell lymphoma, NK / T-cell lymphoma, and multiple myeloma. Chronic viral infectious diseases, including one or more of chronic hepatitis B, chronic hepatitis C, human immunodeficiency virus infection, EB virus-related diseases, and HPV-related diseases; Immune-related diseases and transplant rejection, including one or more of organ transplant rejection and hematopoietic stem cell transplant rejection; Alternatively, when the protein degradation complex contains an epidermal growth factor receptor (EGFR) ligand, i.e., when the protein degradation complex targets EGFR, the pharmaceutical composition is used to treat or prevent diseases associated with the EGFR pathway, selected from the group consisting of: Malignant tumors, including one or more of the following: non-small cell lung cancer, small cell lung cancer, glioblastoma, melanoma, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, prostate cancer, bladder cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, esophageal cancer, colorectal cancer, head and neck squamous cell carcinoma, biliary tract cancer, nasopharyngeal carcinoma, and thyroid cancer. Benign or proliferative diseases, including one or more of the following: psoriasis, atopic dermatitis, chronic obstructive pulmonary disease-related proliferative disorders, pulmonary fibrosis, liver fibrosis, and kidney fibrosis; Ophthalmic diseases, including one or more of corneal neovascularization, macular degeneration, and diabetic retinopathy; Cardiovascular and metabolic diseases, including one or more of the following: atherosclerosis, pulmonary hypertension, myocardial hypertrophy, diabetic complications, and metabolic syndrome-related lesions; Alternatively, when the protein degradation complex contains a macrophage migration inhibitory factor (MIF) ligand, i.e., when the protein degradation complex targets MIF, the pharmaceutical composition is used to treat or prevent diseases associated with the MIF pathway, selected from the group consisting of: Malignant tumors, including one or more of the following: non-small cell lung cancer, small cell lung cancer, breast cancer, ovarian cancer, cervical cancer, endometrial cancer, prostate cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, colorectal cancer, esophageal cancer, head and neck squamous cell carcinoma, melanoma, glioblastoma, multiple myeloma, acute myeloid leukemia, and diffuse large B-cell lymphoma. Inflammatory diseases, including inflammatory bowel disease, rheumatoid arthritis, psoriasis, systemic lupus erythematosus, asthma, chronic obstructive pulmonary disease, atopic dermatitis, and one or more chronic inflammation-related diseases; Metabolic and cardiovascular diseases, including one or more of the following: obesity, type 2 diabetes, metabolic syndrome, non-alcoholic fatty liver disease, atherosclerosis, myocardial ischemia-reperfusion injury, heart failure, and pulmonary hypertension. Neurological disorders, including one or more of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, stroke, and ischemia / inflammation-related neurodegenerative diseases; Acute injury and transplant-related diseases, including one or more of acute kidney injury, acute lung injury, graft-versus-host disease, and organ transplant rejection; Alternatively, when the protein degradation complex contains an orphan G protein-coupled receptor (GPR52) ligand, i.e., when the protein degradation complex targets GPR52, the pharmaceutical composition is used to treat or prevent diseases associated with the GPR52 pathway, selected from the group consisting of: Neuropsychiatric disorders, including one or more of schizophrenia, bipolar disorder, depression, anxiety disorder, obsessive-compulsive disorder, and schizophrenia-related cognitive impairment; Neurodegenerative diseases, including one or more of Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, spinocerebellar ataxia, and neurodegenerative diseases associated with imbalances in dopamine and glutamate signaling pathways; Drug dependence and addiction, including one or more of methamphetamine addiction, cocaine addiction, alcohol dependence, and nicotine dependence; Metabolic diseases, including obesity, type 2 diabetes, metabolic syndrome, non-alcoholic fatty liver disease, and one or more diseases related to abnormal regulation of energy metabolism by the central nervous system. Use of desonide in the preparation of protein degradation complexes or pharmaceutically acceptable salts thereof, wherein desonide is bound to SYVN1. A method for preparing the protein degradation complex or a pharmaceutically acceptable salt thereof as described in any one of claims 1-8, wherein the method comprises any one of the following: The S1.SYVN1-interacting compound undergoes esterification with succinic anhydride, and is then coupled with the corresponding target protein ligand via a linker to obtain the target product. Compounds that interact with S2.SYVN1 undergo esterification with carboxyl-containing linkers and are linked to the corresponding target protein ligands. Compounds interacting with S3.SYVN1 and linkers containing hydroxyl groups can generate two types of esters via a one-pot process under weakly basic conditions, which are then linked to the corresponding target protein ligands. Compounds interacting with S4.SYVN1 are first degraded into carboxylic acids under strongly alkaline conditions, and then coupled with the corresponding target protein ligands via linkers to obtain the target product. A testing method, characterized in that, Includes the following steps: (a) Provide one molecule; (b) React the molecule with the SYVN1 protein and detect the degree of interaction between the molecule and SYVN1; (c) Output results: When the molecule interacts strongly with SYVN1, it can hijack ERAD for targeted degradation by interacting with the main ER-E3 SYVN1, thereby degrading the target protein. When the interaction between the molecule and SYVN1 is weak, it cannot hijack ERAD for targeted degradation by interacting with the main ER-E3 SYVN1, thus failing to degrade the target protein.

Citation Information

Patent Citations

  • Novel PD-1 inhibitor and application thereof

    CN108727453A