Kidney organoids developed from co-culture

Abstract

Disclosed herein are pluripotent stem cell-derived kidney organoids, and methods of producing the same, and methods of transplantation involving said kidney organoids. In particular embodiments, the in vivo kidney organoid includes a collecting duct. Also disclosed are methods of studying or treating a kidney-related disease or symptom using the described kidney organoid.

Description

Attorney Docket No.: CHMC.P0085WO PCTKIDNEY ORGANOIDS DEVELOPED FROM CO-CULTURECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to and benefit of U.S. Application No. 63 / 687,227, entitled “KIDNEY ORGANOIDS DEVELOPED FROM CO-CULTURE,” filed August 26, 2024, and U.S. Application No. 63 / 688,747, entitled “KIDNEY ORGANOIDS DEVELOPED FROM CO-CULTURE,” filed August 29, 2024, the contents of each of which are expressly incorporated herein by reference in their entirety for all purposes.STATEMENT REGARDING FEDERALLY SPONSORED R&D

[0002] This invention was made with government support under Grant No. DK135157 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD

[0003] Aspects of the present disclosure generally relate to kidney organoids, methods of preparation, and compositions including the same, as well as uses thereof.BACKGROUND

[0004] The kidney functions to maintain homeostasis through an array of parallel units termed nephrons, which all originate in development as isolated epithelial structures that later fuse through their distal poles to a system of collecting ducts (CD). This anastomosis is required in the formation of functional nephrons by providing a pathway for excretion of metabolic waste and byproducts.

[0005] Despite advances in current protocols for forming kidney organoids, a persistent limitation has been that organoids lack CDs or any form of a collecting system that would provide a potential structural mechanism for the distal drainage of fluid from these nephrons. This is a fundamental barrier to advancing the maturation of organoids since distaltubular obstruction fundamentally excludes the possibility of renal function. Additionally, the collecting system serves as an important centralized structure providing organization to the otherwise chaotic appealing renal cortex.SUMMARY

[0006] Embodiments of the disclosure relate to a method of preparing a kidney organoid. The method can include: a) mixing one or more ureteric bud (UB) progenitor(s) and one or more nephrogenic mesenchyme (NM) progenitor(s) as a tissue mixture; and b) coculturing the tissue mixture to form a kidney organoid comprising a nephron-like structure and a collecting duct (CD) and / or CD-like structure.

[0007] In some embodiments, the method further includes culturing the organoid in conditions that promote epithelial fusion between a nephron-like structure and a CD and / or CD- like structure.

[0008] In some embodiments, the organoid is capable of drainage of fluid.

[0009] In some embodiments, the UB progenitor is a UB spheroid derived from a first stem cell and / or wherein the NM progenitor is derived from a second stem cell.

[0010] In some embodiments, the first or second stem cell is a pluripotent stem cell, optionally a human pluripotent stem cell.

[0011] In some embodiments, the UB spheroid is a UB spheroid from day 3, 4, 5, 6, 7, 8, 9, 10, I I , 12, 13, or 14 of differentiation, optionally a spheroid between about day 4-8 of differentiation, optionally a spheroid from about day 6 of differentiation.

[0012] In some embodiments, the UB spheroid is a selected UB spheroid, wherein the selected UB spheroid is selected for comprising a tip-like progenitor marker, or comprising cells exhibiting gene expression characteristics analogous to the UB progenitor cells present in the branching tips of a developing kidney in vivo. In some embodiments, the tip-like progenitor marker is one or more of RET, GATA3, PAX2, ETV4, ETV5, WNT11, and / or SOX9.

[0013] In some embodiments, the method further includes disassociating the NM progenitors prior to the mixing step.

[0014] In some embodiments, the NM progenitor is a selected at day 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of differentiation, optionally between about days 6-10 of differentiation, optionally at day 8 of differentiation.

[0015] In some embodiments, the NM progenitor is a selected NM, wherein the selected NM is selected for comprising one or more undifferentiated nephron progenitor cell (NPC) marker. In some embodiments, the marker is SIX2, SIX1, CITED 1, and / or WT1.

[0016] In some embodiments, the ratio of the NM progenitors to UB progenitors used in the mixing step ranges between about 1.0 x 102-1.0 x 105NM progenitors for every UB progenitor spheroid or between about 1.0 x 102-1.0 x 107NM progenitors for every UB progenitor spheroid.

[0017] In some embodiments, the mixture of NM progenitors to UB spheroids is used to generate kidney organoids comprising between about 1.0 x 103-1.0 x 107aggregated NM progenitor cells and between about 10-1.0 x 104UB progenitor spheroids, optionally between about 0.2 x 106- 1.0 x 106NM progenitors are aggregated with about 20-100 UB progenitor spheroids.

[0018] In some embodiments, the co-culturing step comprises inhibiting a rho-kinase (ROCK) pathway in the tissue mixture for a period of time of ROCK inhibition.

[0019] In some embodiments, the ROCK pathway is inhibited with a ROCK inhibitor. In some embodiments, the one or more ROCK inhibitor is selected from Y-27632, and / or Thiazovivin.

[0020] In some embodiments, the ROCK pathway is inhibited starting at the mixing step, optionally within 1 hour of the mixing step.

[0021] In some embodiments, the period of time of ROCK inhibition is for about 1- 24 hours.

[0022] In some embodiments, the period of time of ROCK inhibition is for at least about the first hour of the mixing step.

[0023] In some embodiments, the period of time of ROCK inhibition is for about the first 5 hours of the mixing step.

[0024] In some embodiments, the concentration of the ROCK inhibitor is about 0.1- 200 uM, optionally 10 uM.

[0025] In some embodiments, the co-culturing step comprises inhibiting a BMP signaling pathway in the tissue mixture for a period of time for BMP inhibition.

[0026] In some embodiments, the BMP pathway is inhibited with one or more BMP inhibitor selected from LDN193189, Dorsomorphin, and / or DMH-1.

[0027] In some embodiments, the period of time for BMP inhibition begins about 0- 48 hours after the mixing step for about 1-4 days.

[0028] In some embodiments, the the period of time for BMP inhibition is for at least about the first day of the mixing step.

[0029] In some embodiments, the period of time for BMP inhibition is for about the first 2 days of the mixing step.

[0030] In some embodiments, the concentration of the BMP inhibitor is about 50- 1,000 nM, optionally about 200 nM.

[0031] In some embodiments, the co-culturing step comprises inhibiting a NOTCH signaling pathway in the tissue mixture for a period of time for NOTCH inhibition.

[0032] In some embodiments, the NOTCH pathway is inhibited with one or more NOTCH inhibitor selected from a gamma secretase inhibitor, and / or RBPJ inhibitor.

[0033] In some embodiments, the gamma secretase inhibitor is DAPT, Compound E, DBZ, LY450139 and / or BMP299897.

[0034] In some embodiments, the period of time for NOTCH inhibition is for about 1-4 days and begins about 0-7 days after the mixing step.

[0035] In some embodiments, the period of time for NOTCH inhibition is for at least about 1 day and begins on at least about 1 day after the mixing step.

[0036] In some embodiments, the period of time for NOTCH inhibition is for about 2 days and begins on about day 4 after the mixing step.

[0037] In some embodiments, the concentration of the NOTCH inhibitor is about is about 0.1-200 uM, optionally 10 uM.

[0038] In some embodiments, the co-culturing step comprises activating a WNT signaling pathway for a period of time for WNT activation.

[0039] In some embodiments, the method is for a developing kidney organoid, wherein the period of time for WNT activation is for at least about 2 days and begins at least about 2 days of the mixing step.

[0040] In some embodiments, the period of time for WNT activation is for about 2-6 days and begins about 2-8 days of the mixing step.

[0041] In some embodiments, the period of time for WNT activation is for about 4 days and begins about 2-6 days of the mixing step.

[0042] In some embodiments, the WNT signaling pathway is activated by a small molecule activator or by inducible genetic expression.

[0043] In some embodiments, the inducible genetic expression is of a WNT ligand

[0044] In some embodiments, the WNT ligand is expressed by the UB progenitor.

[0045] In some embodiments, the small molecule is a WNT activator.

[0046] In some embodiments, the co-culturing step comprises inhibiting a WNT, TGFB, and / or FGF / RTK9 signaling pathway in the tissue mixture for a period of time for WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition.

[0047] In some embodiments, the period of time for WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition begins about 0-14 days after the mixing step for about 1-7 days.

[0048] In some embodiments, the period of time for WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition begins at least about 1 day of the mixing step for at least about 1 day.

[0049] In some embodiments, the period of time of WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition begins on day 10 after mixing for about 4 days.

[0050] In some embodiments, the co-culturing step comprises budding and branching of the UB progenitor; elongation of tubules of the UB; increase in expression of genes associated with UB stalk fate; formation of CD-like tubule and / or CD; formation of CD-like tubule and / or CD that are interconnected and spanned throughout the organoid; decrease in expression of progenitor marker(s) of the UB progenitor and NM progenitor; formation of renal vesicles by the NM progenitor; polarization of NM; increase in expression of marker(s) of nephron segment differentiation; formation of nephron, nephron segment, nephron like segment, and / or nephronlike tubule; differentiation of podocytes, proximal tubules, distal tubules and / or the like; polarization of nephrons; increased expression of distal tubule marker(s); increased expression of UB stalk fate marker(s) or CD marker(s) ; expansion of a stromal compartment; direct connection of nephron, nephron segment, nephron like segment, and / or nephron-like tubule to aCD-like tubule and / or CD; formation of anastomoses between nephrons, nephron segments, nephron like segments, and / or nephron like tubules and CD-like tubule or CD; fusion of a nephron distal tubule to a UB duct; fusion of a distal tubule to a AQP2+ CD; formation of uninterrupted epithelial structure across tubules; formation of continuous luminal membrane across the junctions of tubules; and / or the like.

[0051] In some embodiments, the marker of nephron segment differentiation is selected from JAG1, CDH6, CDH1, WT1, POU3F3, MECOM, HNF4A, GATA3, and HNF1B.

[0052] In some embodiments, the distal tubule marker is selected from GATA3, TFAP2A, TFAP2B, SOX9, EGR5, CAEB1 and / or CDH1.

[0053] In some embodiments, the marker of CD is selected from EEF5, SCNN1B, SCNN1G, KCNJ1, AVPR2, and / or AQP2.

[0054] In some embodiments, the co-culturing step comprises a fusion event between a NM-derived epithelium and UB-derived epithelium, wherein the NM-derived component comprises one or more nephron, nephron segment, nephron like segment, and / or nephron-like tubule, and the UB-derived structure comprises one or more CD-like tubule, CD and / or UB duct.

[0055] In some embodiments, the fusion event occurs with a distal tubule and the UB-derived structure.

[0056] In some embodiments, the co-culturing step comprises transferring the kidney organoid to hormone medium comprising a hormone after a period of time, optionally comprising inhibitors of WNT, TGFB, and / or FGF / RTK pathways.

[0057] In some embodiments, the hormone is selected from arginine vasopressin, aldosterone, and / or DDAVP.

[0058] In some embodiments, the hormone medium is used transiently, optionally for 1, 2, 3, 4, 5, 6, or more days in a 5, 6, 7, 8, 9, 10, 11, 12, 13, or more day organoid after the mixing step

[0059] In some embodiments, the kidney organoid has at least 10-40 or more epithelial connections between a NM-derived structure and a UB-derived structure.In some embodiments, the kidney organoid has at least 50 (range 50-10,000) nephron-like structures; has at least 10 (range 10-200) CDs; is about 3-6 (range 0.5-12) mm in size (diameter); and / or self assembles

[0060] In some embodiments, the kidney organoid is functional, optionally wherein the kidney organoid comprises segmented nephrons and there is the capability of drainage of fluids from a nephron into a collecting system.

[0061] In some embodiments, the kidney organoid, UB progenitor, and / or NM progenitor is labeled with a label.

[0062] In some embodiments, the label is a fluorescent protein.

[0063] In some embodiments, the co-culturing step comprises culturing the tissue mixture on a membrane, optionally a permeable membrane.

[0064] In some embodiments, the co-culturing step comprises air-liquid cultures.

[0065] In some embodiments, the kidney organoid is embedded in a basement membrane or extracellular matrix.

[0066] Some embodiments of the disclosure relate to a method for inducing fusion of one or more nephron(s), nephron segment(s), nephron-like segment(s), and / or nephron-like tubule(s), and one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid. The method can include: culturing the tissue or organoid in a medium and inhibiting NOTCH signaling for a period of time.

[0067] In some embodiments, the NOTCH signaling is inhibited by a NOTCH inhibitor.

[0068] In some embodiments, the NOTCH inhibitor is a gamma secretase inhibitor and / or RBPJ inhibitor.

[0069] In some embodiments, the gamma secretase inhibitor is DAPT, Compound E, DBZ, LY450139 and / or BMP299897.

[0070] In some embodiments, the period of time is for about 1-5 days.

[0071] In some embodiments, the period of time is for about 3 days.

[0072] In some embodiments, the method is for a developing kidney organoid, and aNOTCH pathway is inhibited from about day 0-7 after mixing one or more UB progenitor and one or more NM progenitor for about 1-4 days.

[0073] In some embodiments, the method is for a developing kidney organoid, and a NOTCH pathway is inhibited from at least about day 0-7 after mixing one or more UB progenitor and one or more NM progenitor for at least about 1 day.

[0074] In some embodiments, the method is for a developing kidney organoid, and a NOTCH pathway is inhibited from about day 4-6 after mixing one or more UB progenitor and one or more NM progenitor.

[0075] In some embodiments, a number of fusion events is increased by at least 1% compared to a tissue or organoid cultured without NOTCH inhibition.

[0076] In some embodiments, distal nephron formation of the organoid or tissue is increased by at least 1% compared to a compared to a tissue or organoid without NOTCH inhibition.

[0077] In some embodiments, expression of a distal nephron marker is increased by at least 1% compared to a tissue or organoid without NOTCH inhibition.

[0078] In some embodiments, the distal nephron marker is GATA3, POU3F3, MECOM, TFAP2A, TFAP2B and / or SOX9.

[0079] In some embodiments, a ratio of distal segmentation : proximal segmentation in the organoid or tissue is increased by at least 1% compared to a compared to a tissue or organoid without NOTCH inhibition.

[0080] In some embodiments, the concentration of the inhibitor is between l-30uM.

[0081] Some embodiments of the disclosure relate to a method for inducing terminal maturation of one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid. The method can include: culturing the tissue or organoid in a medium and inhibiting WNT, TGFB, and / or FGF / RTK signaling for a period of time.

[0082] In some embodiments, the Wnt signaling is inhibited by a Wnt inhibitor, the TGFB signaling is inhibited by a TGFB inhibitor, and / or the FGF / RTK signaling is inhibited by a FGF / RTK inhibitor.

[0083] In some embodiments, the period of time is for about 1-7 days.

[0084] In some embodiments, the period of time is for about 4 days.

[0085] In some embodiments, the method is for a developing kidney organoid, and aWNT, TGFB, and FGF / RTK signaling pathway is inhibited from at least about day 7 of mixing one or more UB progenitor and one or more NM progenitor for at least 1 day.

[0086] In some embodiments, the method is for a developing kidney organoid, and a WNT, TGFB, and FGF / RTK signaling pathway is inhibited from about day 7-21 after mixing one or more UB progenitor and one or more NM progenitor.

[0087] In some embodiments, the method is for a developing kidney organoid, and a WNT, TGFB, and FGF / RTK signaling pathway is inhibited from about day 10-14 after mixing one or more UB progenitor and one or more NM progenitor.

[0088] In some embodiments, the WNT inhibitor is selected from XAV939, Wnt- C59, IWR-1, IWP-2, IWP-3, and IWP-4, optionally at a concentration of about 0.1-10 uM.

[0089] In some embodiments, the TGFB inhibitor is selected from A83-01, SB43, and SIS3, optionally at a concentration of about 0.1-10 uM.

[0090] In some embodiments, the FGF / RTK inhibitor is selected from U0126, SU5402, PD98059, and PD0325901, optionally at a concentration of about 1-50 uM.

[0091] In some embodiments, terminal maturation of one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid is increased by at least 1% compared to a compared to a tissue or organoid without WNT, TGFB, and / or FGF / RTK inhibition during development.

[0092] In some embodiments, expression of a CD marker marker is increased by at least 1% compared to a tissue or organoid without WNT, TGFB, and / or FGF / RTK inhibition.

[0093] In some embodiments, the marker is AQP2, SCNN1G, and / or ELF.

[0094] Some embodiments of the disclosure relate to a method for increasing distal nephron tubules and / or improving the frequency of fusion events in a kidney tissue or organoid in a kidney tissue or organoid. The method can include culturing the tissue or organoid in a medium and activating WNT for a period of time.

[0095] In some embodiments, the WNT signaling pathway is activated by a small molecule activator or by inducible genetic expression.

[0096] In some embodiments, the inducible genetic expression is of a WNT ligand.

[0097] In some embodiments, the WNT ligand is expressed by the UB progenitor.

[0098] In some embodiments, the small molecule is a WNT activator.

[0099] In some embodiments, the WNT activator is CHIR99021, BIO, optionally at a concentration of 1-15 uM.

[0100] In some embodiments, the method is for a developing kidney organoid, wherein the period of time for WNT activation is for at least about 2 days and begins at least about 2 days of the mixing step.

[0101] In some embodiments, the method is for a developing kidney organoid, wherein the period of time for WNT activation is for about 2-6 days and begins about 2-8 days of the mixing step.

[0102] In some embodiments, the method is for a developing kidney organoid, wherein the period of time for WNT activation is for about 4 days and begins about 2-6 days of the mixing step.

[0103] In some embodiments, a distal nephron tubules and / or improving the frequency of fusion events in a kidney tissue or organoid is increased by at least 1% compared to a compared to a tissue or organoid without WNT activation during development.

[0104] Some embodiments of the disclosure relate to an in vitro kidney organoid derived from stem cells, comprising one or more collecting duct (CD)-like structure, CD-like tubule, and / or CD.

[0105] Some embodiments of the disclosure relate to an in vitro kidney organoid prepared by the any method disclosed herein, comprising one or more collecting duct (CD)-like structure, CD-like tubule, and / or CD.

[0106] In some embodiments, the organoid comprises a population of cells derived from one or more NM progenitor and a population of cells derived from one or more UB progenitor.

[0107] In some embodiments, the population of cells derived from NM express NPHS1, NPHS2, HNF4A, SLC12A1, GATA3, and / or the like.

[0108] In some embodiments, the population of cells derived from UB express GATA3, ELF5, CALB1, AQP2, SCNN1B, and / or the like.

[0109] In some embodiments, the organoid comprises one or more NM-derived structure(s) and one or more UB-derived structure(s).

[0110] In some embodiments, the NM-derived structure comprises one or more nephron, nephron-like structure, nephron-like segment, nephron-like tubules, and / or the like.

[0111] In some embodiments, the organoid comprises nephron, ureteric, stromal, and endothelial lineages.

[0112] In some embodiments, the organoid comprises an expansion of a stromal compartment.

[0113] In some embodiments, the organoid comprises direct connection of nephron tubules to CD-like tubule or CD.

[0114] In some embodiments, the nephron tubule is a distal tubule.

[0115] In some embodiments, the organoid comprises anastomoses between nephron and / or nephron segments and CD-like tubule or CD.

[0116] In some embodiments, the organoid comprises nephron segments comprising podocyte, proximal tubule, and / or thick ascending limb.

[0117] In some embodiments, the organoid comprises uninterrupted epithelial structure across one or more tubules.

[0118] In some embodiments, the organoid comprises continuous luminal membrane across the junctions of two or more tubules.

[0119] In some embodiments, the organoid is functional and / or self-assembles.

[0120] In some embodiments, the organoid is capable of carrying out drainage of fluids from a nephron.

[0121] In some embodiments, the n vitro kidney organoid is derived from a coculture of one or more NM progenitor and one or more UB progenitor.

[0122] In some embodiments, the NM progenitor and the UB progenitor are each derived from pluripotent stem cells.

[0123] In some embodiments, the pluripotent stem cells comprise embryonic stem cells or induced pluripotent stem cells.

[0124] In some embodiments, the in vitro kidney organoid is embedded in a basement membrane matrix.

[0125] In some embodiments, the in vitro kidney organoid is in suspension culture

[0126] In some embodiments, the in vitro kidney organoid is an artificial kidney organoid and / or is generated in vitro.

[0127] In some embodiments, the in vitro kidney organoid is three-dimensional.

[0128] In some embodiments, the in vitro kidney organoid has matured to comprise epithelial structures representing nephron segments, optionally wherein the nephron segments comprise podocytes, proximal tubules, loops of Henle, and / or distal tubules.

[0129] In some embodiments, the distal tubules comprise thick ascending limb (TAL) of the loop of Henle (LOH) and a short connecting segment (CNT)

[0130] In some embodiments, the organoid comprises at least 33% nephron epithelial cells.

[0131] In some embodiments, the organoid comprises, at least about 3%-20.1% ureteric epithelium (UrEp).

[0132] In some embodiments, the organoid comprises less than 47% stroma cells.

[0133] In some embodiments, the organoid comprises less than 1.5% NPC-like cells.

[0134] In some embodiments, the organoid comprises between 0.01% - 0.37% endothelial cells.

[0135] In some embodiments, the organoid comprises, within a epithelial cell population, at least about at least 9.60% podocytes.

[0136] In some embodiments, the organoid comprises, within a epithelial cell population, at least about at least 17.13% proximal tubule cells.

[0137] In some embodiments, the organoid comprises, within a epithelial cell population, at least about at least 8.5% distal tubule cells.

[0138] In some embodiments, the organoid comprises, within a epithelial cell population, about 1.78% - 5.13% LOH / TAL cells.

[0139] In some embodiments, the organoid comprises, within a epithelial cell population, about 1.35%- 17.17% collecting duct cells

[0140] Some embodiments of the disclosure relate to an in vitro composition comprising any of the in vitro kidney organoids disclosed here.

[0141] Some embodiments of the disclosure relate to any of the in vitro kidney organoids or the compositions disclosed herein for use in a method of treating a kidney-related disease or disorder or symptom, a method of scaling up in bioprocess manufacturing, a method of screening for therapeutic efficacy, a method for screening for kidney toxicity, a method of modeling human kidney development and / or disease, a method of diagnosing a kidney-relateddisease or disorder, and / or the manufacture of a medicament for treating a kidney-related disease or disorder.

[0142] Some embodiment of the disclosure relate to a use of y of the in vitro kidney organoids or the compositions disclosed herein in a method of treating a kidney -related disease or disorder or symptom, a method of scaling up in bioprocess manufacturing, a method of screening for therapeutic efficacy, a method for screening for kidney toxicity, a method of modeling human kidney development and / or disease, a method of diagnosing a kidney-related disease or disorder, or the manufacture of a medicament for treating a kidney-related disease or disorder or symptom.

[0143] Some embodiments of the disclosure relate to a method comprising administering the in vitro kidney organoid or composition to a subject in need thereof.

[0144] Some embodiments of the disclosure relate to a method of treating a kidney- related disease or disorder in a subject in need thereof, the method comprising administering the in vitro kidney organoid or the composition to the subject.

[0145] In some embodiments, administering comprises transplanting the in vitro kidney organoid of any one of claims 92-127, or the composition of claim 128, into the subject.

[0146] In some embodiments, the subject is a mammal.

[0147] In some embodiments, the subject is a mouse, rat, or a human.

[0148] In some embodiments, the in vitro kidney organoid is transplanted after culturing for 1 day, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days to 60 days, or longer, in vitro, in step e).

[0149] In some embodiments, the in vitro kidney organoid is transplanted after 3 days after the mixing step according to claim 1.

[0150] In some embodiments, the in vitro kidney organoid, following transplant, engrafts under the kidney capsule of the subject.

[0151] In some embodiments, transplanting the in vitro kidney organoid to the subject comprises organoid engraftment, tissue growth, and / or improved tissue and / or organ function.

[0152] In some embodiments, the in vitro kidney organoid, following transplant, matures in vivo.

[0153] In some embodiments, the in vitro kidney organoid, following transplant, comprises fusion events between one or more NM-dcrivcd cell and one or more UB-dcrivcd cell, wherein the NM-derived cell comprises one or more nephron, nephron segment, nephron like segment, and / or nephron-like tubule, and the UB-derived structure comprises one or more CD- like tubule, CD, and / or UB duct.

[0154] In some embodiments, the in vitro kidney organoid, following transplant, comprises an increase of anastomoses between a nephron, nephron segment, nephron like segment, and / or nephron-like tubule and a CD-like tubule, CD and / or UB duct.

[0155] In some embodiments, the increase is by at least 1% after about 6-30 days of growth.

[0156] In some embodiments, the in vitro kidney organoid, following transplant, is functional, optionally wherein the organoid is capable of drainage.

[0157] In some embodiments, the subject has a kidney -related disease or disorder.

[0158] In some embodiments, the kidney -related disease or disorder is selected from one or more of chronic kidney disease, primary kidney disease, non-diamerulonephritis, glomerulonephritis, interstitial nephritis, diabetic kidney disease, diabetic nephritis, thread. Glomerulonephritis, rapidly progressive glomerulonephritis, renal fibrosis, Alport syndrome, insulin-dependent diabetic (IDDM) nephritis, mesangium proliferative glomerulonephritis, membuloproliferative glomerulonephritis, meniclimatogenic glomerulo nephritis, Interstitial nephritis, Focal segmental glomerulonephritis, Membranenephritis, Microvariant nephrosis syndrome, pauci-immune type rapidly progressive glomerulonephritis, IgA nephritis, Multiple cystic kidney, Dent disease , Nephritistinosis, Hayman nephritis, autosomal dominant (adult) multiple cystic kidneys, autosomal recessive (pediatric) multiple cystic kidneys, acute nephropathy, nephrosis syndrome, renal ischemitis, podocyte disease or disorder , Glomerulonephritis, glomerulonephritis, medullomerulonephritis, focal segmental glomerulonephritis, preplonephritis, glomerulonephritis, kidney lesions, glomerulonephritis, benign orthostatic (positional) glomerulonephritis, IgM kidney Disease, medulronephritis, sarcoidosis, diabetes, drug-induced kidney damage, Fabry's disease, amino aciduria, Fanconi syndrome, hypertensive nephritis, interstitial nephritis, sickle erythema, hemoglobinuria, myoglobinuri Disease, Wegenerulonephritis, Type 1 glomerulonephritis, Chronic kidney disease,Chronic renal failure, low glomerulonephritis (GFR), renal vascular sclerosis, lupus nephritis, ANCA-positivc pauci-immunc type glomerulonephritis Glomerulonephritis, Chronic transplant nephropathy, Nephritis, Kidney injury, Glomerulonephritis and tubule damage, Renal dysfunction, Nephritis syndrome, Acute renal failure, Chronic renal failure, Proximal tubule dysfunction, Acute kidney transplant rejection, chronic kidney transplant rejection, non-IgA mesangial proliferative glomerulonephritis, post-infectious glomerulonephritis, vasitis with any type of nephropathy, any hereditary kidney disease, any interstitial Nephritis, kidney transplant failure, kidney cancer, kidney disease with other symptoms (eg, hypertension, diabetes, and autoimmune disease), dent disease, nephropathy, Hayman nephritis, primary kidney disease, collapse Glomerulonephritis, dense deposit disease, cryoglomerulonephritis-related glomerulonephritis, Henoch-Schoenlein's disease, post-infectious glomerulonephritis, bacterial endometriitis, micromicroangonephritis, Charg-Strauss syndrome, anti-GBM Antibody-mediated glomerulonephritis, amyloidosis, monoclonal immunoglobulin deposition, fibrillar thread Spheroid nephritis, immunotactoid glomerosis, ischemic tubule injury, drug-induced tubule interstitial nephritis, addictive tubulointerstitial nephritis, infectious tubulointerstitial nephritis, bacterial nephritis, poly Virus-infectious tubulointerstitial nephritis caused by Omavirus or HIV infection, metabolism-induced tubule interstitial disease, mixed connective tissue disease, columnar nephropathy, uric acid crystal or oxalate crystal or drug-induced crystal Crystalline nephropathy due to deposition, neoplastic invasive disease due to acute cellular tubulointerstitial allogeneic transplant rejection, lymphoma or post-transplant lymphoproliferative disorder, obstructive kidney disease, vascular disease, Thrombotic microangiopathy, renal vascular sclerosis, atherosclerotic disease, mixed connective tissue disease, nodular polyarteritis, carcinulin inhibitor-induced vascular disease, acute cellular vascular allogeneic transplant rejection, acute humoral allogeneic Transplant rejection, early renal dysfunction (ERFD), endstage renal disease (ESRD), renal vein thrombosis, acute tubule necrosis, acute interstitial nephritis, existing chronic kidney disease, renal artery stenosis, ischemic Includes nephropathy, urinary toxicosis, drug-induced and toxic-induced chronic tubulointerstitial nephritis, reflux nephropathy, renal stones, Good Pasture syndrome, hydronephropathy, and / or the like.

[0159] In some embodiments, the subject has an increased survival rate following transplantation.

[0160] In some embodiments, the in vitro kidney organoid is produced from pluripotent stem cells derived from the subject.

[0161] Some embodiments of the disclosure relate to a method for screening a compound or composition, wherein the compound or composition to be screened comprises one or more exogenous agent. The method can include: contacting the in vitro kidney organoid of any of claims 92-127 with the compound or composition; culturing the in vitro kidney organoid with the compound or composition for a period of time; and / or assessing one or more effects of the compound or composition on the in vitro kidney organoid, thereby screening the compound or composition.

[0162] In some embodiments, the assessed effect comprises therapeutic efficacy and / or toxicity of the compound or composition.

[0163] Some embodiments of the disclosure relate to a kit comprising means for preparing a kidney organoid, comprising any medium described herein.

[0164] Some embodiments of the disclosure relate to a kit comprising means for preparing a kidney organoid disclosed herein, or for performing any of the methods disclosed herein, comprising any medium described herein.

[0165] Some embodiments of the disclosure relate a kit for screening for therapeutic efficacy of a compound for a kidney-related disease or disorder comprising reagents sufficient for performing an assay for assessing effects of the compound, comprising a kidney organoid disclosed herein.

[0166] Some embodiments of the disclosure relate to a kit for screening for nephrotoxicity of a compound comprising reagents sufficient for performing an assay for at least one nephrotoxicity marker comprising a kidney organoid disclosed herein.

[0167] In some embodiments, the kit components are provided in separate vials.

[0168] In some embodiments, one or more of the kit components are pre-loaded onto one or more assay platform.

[0169] In some embodiments, one or more of the kit components are pre-frozen.BRIEF DESCRIPTION OF THE DRAWINGS

[0170] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0171] FIG 1 Overview of formation of kidney organoids according to the present disclosure.

[0172] FIG. 2. Assembly of UB and NM progenitor cells into integrated kidney organoids. A. Schematized protocol for assembling UB and NM into kidney organoids. B. Dissociated NM condensed around embedded GFP+UB spheroids within 5 hours. C. By days 2- 4, the NM was induced into epithelialized renal vesicle-like structures, while the GFP+UBs grew as elongating tubular epithelia. Insets show the isolated GFP channel. D. Organoids exhibited progressive loss of NM progenitor markers SIX 1 / 2 with concomitant nearly uniform induction of renal vesicle markers LHX1 and JAG1. The GFP+UBs retained patchy expression of tip progenitor gene RET through day 4. E. UMAP embedding of recombinant kidney organoids between days 0-14. F. The UB lineage clusters were distinct from the NM with nearly exclusive expression of GATA3 and GFP. G. The cells largely segregated by their stage of differentiation, with stepwise progression through NM and UB differentiation. Scale bars, 500 pm (B-C), 200 pm (D).

[0173] FIG 3. Formation of collecting ducts that fuse to distal nephron tubules. A. Clustering of epithelial populations at day 14 revealed a unique cluster of CD-like cells in Mixed organoids that was absent in the NM Only condition. B. The CD cluster expressed GFP and markers associated with CD principal cells. C. By day 14, GFP+UBs generated extensive networks of CD tubules embedded amongst the nephron epithelia of the organoids. D. Numerous points of epithelial fusion (arrowheads) were observed between the GFP+CDs and unlabeled nephron tubules. E. NM Only organoids had short, blind-ended CALB1+connecting segments (arrows), but in Mixed organoids these segments fused to GFP+CDs (arrowheads). F. Nephron- CD anastomoses exhibited uninterrupted apicobasal polarity with continuity of the apical lumen across the junction. G. GATA3+distal tubule segments were observed fused to GFP+UB tubules, despite their scarcity relative to HNF4A+proximal segments. Quantification revealed that 96% of epithelial connections (arrows) involved a GATA3-expressing nephron tubule. H.The early GATA3+segment specifically interacted with and invaded into nearby GFP+UB epithelia. Arrowheads indicate points of nephron fusion. I. At day 4, the renal vesicles exhibited polarization with coarse segregation into proximal (WT1) and distal (POU3F3) domains, and at day 5, loss of extracellular matrix (Laminin) was observed at future fusion site. J. GATA3+early vesicles was associated with extension of the epithelium and its apical membrane (TJP1) toward the UB, and complete apical connections were observed by day 5. Scale bars, 1,000 pm (C), 200 pm (D, H), 100 pm (E, F, I, J), 500 pm (G).

[0174] FIG. 4. Integrated organoids develop segmented nephrons with proximal- distal polarity. A. Day 7 organoids contained segmented and organized primitive nephrons progressing from WT1+presumptive glomerular’ structures through the distal epithelial fusion with the UB. B-C. By day 14, they developed into larger and more elaborated and segmented nephrons with NPHS1 / PODXL+podocyte (pod)-containing glomeruli, LRP2+proximal tubules (PT), SLC12A1+thick ascending limb (TAL), and a short GATA3+connecting segment (CNT) that fused to CDs. D. scRNA-seq revealed large populations of podocytes (NPHSi ) and PTs SLC3A1), with a smaller proportion of TAL SLC12A1). E. Compared to NM Only, Mixed organoids contained larger populations of proximal and distal tubules with a smaller proportion of podocytes, which could be traced to a slight distal shift of RV polarization at days 3 and 7 (F). G-I. The organoids also contained a population of MEIS1+stromal cells, which were classified by DevKidCC as constituting a mix of cortical (CS), mesangial (MesS), and medullary (MS) stromal cells. Both GFP-negative and positive cells contributed to these stromal populations. Scale bars, 100 pm (A, B, G), 200 pm (C).

[0175] FIG. 5. Fusion of UB and distal nephron following in vivo transplantation. A. Overview of organoid transplantation experiments. B. Two weeks post- engraftment, organoids were visible on the kidney surface with short GATA3+nephron tubules that were connected to larger GFP+duct-like structures (black arrows). GFP+epithelial structure is outlined in yellow in right panel. C. The engrafted tissue comprised numerous NM-derived proximal (HNF4A) and distal (CDH1) tubules with large UB organoid-derived duct structures and interstitial cells. D. In vivo growth enabled vascularization and maturation of organoid glomerular structures that comprised an organized arrangement of podocytes (NPHS1), endothelial cells (PECAM1), and mesangial cells (PDGFRB, GATA3). Apparent perfusion ofthe glomerular tufts was indicated by the presence of erythrocytes (arrows). E. Segmented arrangement of nephrons in the graft was confirmed with sequential progression of podocytes (NPHS1), proximal tubule (HNF4A), thick ascending limb (SLC12A1), and connecting tubule (GATA3). F. The epithelial and interstitial components were largely human-derived, while most endothelial cells were host-derived. G. GFP+UBs formed large and elongated duct- like networks within the grafts. H-J. Fusion of nephron tubules to these GFP+ducts was observed in both sections (H-I) and wholemount staining (J), and it was restricted to the CDH1 / GATA3+distal segments. K. At 5 weeks post-transplant, the UB-derived CDs were massively dilated and more dysplastic appearing, suggestive of an obstructive phenotype. Scale bars, 1,000 pm (B), 500 pm (C, G, K), 100 pm (D-F), 200 pm (H-I), 300 pm (J).

[0176] FIG. 6. NOTCH inhibition augments distal nephron specification and fusion efficiency. A. Schematized strategy for testing NOTCH signaling. B-C. NOTCH inhibition (DAPT) led to time-dependent reduction of proximal (HNF4A) and increase in distal (GATA3) nephron specification. n=4 independent biological replicates per condition; ****P <0.0001, ***P = 0.0005, **P =0.0024 (control vs. day 4-6), **P = 0.0037 (control vs. day 2-6) and *P = 0.016 (control vs. day 3-6). D. Day 14 nephron epithelia displayed disorganized morphology in organoids treated with 3-4 days of DAPT with widespread GATA3 expression and loss of HNF4A+proximal tubules, whereas shorter treatment (days 4-6) led to increased GATA3+distal tubules but with preserved overall morphology and maintenance of proximal segments. E. scRNA-seq at day 14 confirmed the distal shift of nephron identity in response to DAPT (day 4-6). These organoids retained normal structural composition of proximal segments, but with increased GATA3+distal segments shown by (F) reporter activity, (G) scRNA-seq, and (H) flow cytometry. n=3 independent biological replicates per condition; **P = 0.001. I. This led to significantly increased frequency of nephron-UB fusion events (n=6 independent organoids per condition; *P = 0.045), which (J) still exhibited complete anastomosis of the apical membranes across the junctions. Scale bars, 1,000 pm (B, D), 200 pm (F, J). Column and error bars represent mean and standard deviation, respectively.

[0177] FIG. 7. WNT promotes distal specification and fusion through regulation of GATA3. A. WNT promoted distal nephron GATA3) specification in day 14 NM Only organoids. B. Transient WNT inhibition (XAV) led to reduced nephron fusion in Mixedorganoids. n=4 independent biological replicates per condition; **P = 0.0055. C. Mixed Organoids were generated using UBs with inducible WNT9B to generate a morphogen gradient. Dox activation led to increased GATA3 expression in the NM lineage (C-D), as well as significantly more nephron-CD connections by day 14 (E-F). n=8 (D) and 3 (E) independent biological replicates per condition; column and error bars represent mean and standard deviation, respectively; *P = 0.0392 in D and *P = 0.0485 in E. G-H. Mixed organoids were generated from NM with an inducible GATA3 transgene. In WNT inhibited organoids, Dox activation led to heterogenous activation of GATA3 in the NM (GFP‘) lineage to rescue the otherwise low expression levels. n=4 independent biological replicates per condition; column and error bars represent mean and standard deviation, respectively; **P = 0.0041 (Control) and 0.0082 (XAV). I. GATA3 rescue was sufficient to increase nephron-CD fusion events quantified at day 14. n=4 independent biological replicates per condition; column and error bars represent mean and standard deviation, respectively; **P = 0.0076. Scale bars, 1,000 pm (A, C), 200 pm (B, F, G).

[0178] FIG. 8 Induction of CD maturation in recombinant organoids. A. Reclustering the UB lineage (from Fig. IF) showed a stepwise temporal progression of developmental stages from days 0-14. B. Tip progenitor markers RET, WNT11) were expressed highly at days 0-3 but then extinguished and gave rise to stalk progenitor genes (CALB1, WNT9B) between days 3-7. Differentiated principal cell markers (ELF5) were induced by days 10-14, although AQP2 was activated at relatively low levels. C. Transition of Mixed organoids to CDM with A83, U0126, and XAV (AUX) led to a marked increase in AQP2 expression measured through both a genetically encoded reporter and wholemount IF staining. D-E. scRNA-seq analyses of these conditions at day 14 confirmed that CDM+AUX induced increased expression of differentiated markers AQP2, SCNN1G, ELF) in the CD clusters with loss of progenitor genes CALB1, WNT9B, and SOX9. F. This condition led to segmented nephrons with distal fusions to AQP2+CDs. G. Transcriptomic integration and comparison to three published organoid datasets showed similar cell types but with different distribution across lineages and nephron segments. H. Expression of functional nephron markers was at least as high in these organoids as in published datasets, with apparently higher expression of both proximal tubule and CD markers. Scale bars, 500 pm (C), 100 pm (F).

[0179] FIG. 9. Differentiation strategies for generating NM and UB progenitor cells, Related to FIG. 2. A. NM was induced in monolayer format and used to make organoids at day 8. B. The cultures expressed key nephron progenitor markers including SIX2, SIX1, and PAX2. C. UB spheroids were generated through aggregation of pronephric intermediate mesoderm progenitors at day 3 of differentiation, and the spheroids were used to assemble organoids at day 6. D. The spheroids at day 7 comprised both UB and stromal progenitor populations as indicated in scRNA-seq analysis, with the former exhibiting high expression of the tip markers RET, WNT11, and ETV4 / 5. Scale bar-, 200 pm (B).

[0180] FIG. 10. Optimization of growth conditions for recombinant kidney organoids, Related to FIG. 2. A. Addition of ROCK inhibitor Y-27632 for the first 5 hours post-mixing promoted efficient aggregation of progenitor cells and more consistent induction and epithelialization of the NM by day 4. B. Transient BMP inhibition (with LDN) between days 0-2 led to improved efficiency of NM induction and UB growth. C. qPCR analyses confirmed loss of undifferentiated NPC markers SIX2 and CITED1 from day 0 to day 4 and reduction of UB tip progenitor markers RET and WNT11. n=3 organoid replicates per timepoint. D. Organoids generated from UBs harboring a GATAd-mScarlet reporter allele mixed with unlabeled (Hl -derived) NM enabled visualization of the growth of the UB epithelia without seeing the UB spheroid-derived stroma. E. Whole-mount staining of organoids at days 0, 2, and 4 indicated that the presence of UB progenitors did not affect the rapid induction of JAG1 or the gradual extinction of SIX1 expression. F. Neither addition of FGF2 nor GDNF altered renal vesicle formation or UB branching by day 4, and they did not affect the differentiation of organoids by day 14. Scale bars, 500 pm (A, D), 1,000 pm (B, F), 200 pm (E).

[0181] FIG. 11. Single cell profiling of kidney organoid development, Related to FIG 2. A-B. UMAP embedding identified 28 cell clusters spanning days 0, 3, 7, 10, and 14 of differentiation. C-D. Integrating both supervised and unsupervised annotation showed the organoids comprised multiple lineages, including NPC and Nephron, Ureteric, Stromal, and off- target neural-like cells with enriched expression of SOX2 and MAP2. E. Feature plot showing unsupervised DevKidCC lineage prediction scores for Ureteric (UrEp), NPC, Nephron, and Stroma. F. Canonical marker expression was used to corroborate DevKidCC lineage assignments. G. Reference mapping of the organoid cells (from days 0-14) to a human fetalkidney reference dataset (Hochane, M., van den Berg, P.R., Fan, X., Berenger-Currias, N., Adcgccst, E., Bialccka, M., Nicvccn, M., Mcnschaart, M., Chuva de Sousa Lopes, S.M., and Semrau, S. (2019). Single-cell transcriptomics reveals gene expression dynamics of human fetal kidney development. PLoS Biol 17, e3000152. 10.1371 / journal.pbio.3000152.) showed general agreement in annotation of both nephron / epithelial and stromal cell types.

[0182] FIG. 12 Reclustering and analysis of nephron and ureteric lineages, Related to FIG. 3. A. 19 clusters were identified to represent NM and UB lineage differentiation across 14 days of differentiation. B. Expression of GFP was specific to clusters 7, 9, and 13, which were annotated as UB lineage in FIG 2F. C. DevKidCC was used to assign unsupervised annotations across this dataset, with prediction scores shown for NPC, early nephron (EN), early podocyte (EPod), podocyte, parietal epithelial cell (PEC), early proximal tubule (EPT), early distal tubule (EDT), loop of Henle (LOH), distal tubule (DT), and ureteric epithelium (UrEp). D. Expression of representative genes identifying early stages of NM lineage differentiation. E. Violin plot showing expression of anchor genes associated with each cell type shown in FIG. 2E.

[0183] FIG. 13. Formation of collecting ducts in Mixed organoids, Related to FIG. 3. A. Expression of CD markers were either enriched (GATA3) or exclusive (CALBl . ELF 5, AQP2, SCNNIG) to Mixed organoids made with UB progenitors compared to NM Only organoids. These genes were found in the CD cluster shown in FIG. 3A. B. Similarly, these cells were identified as ureteric epithelium (UrEp) by DevKidCC, whereas the remaining cells and all of those in NM organoids were identified as Nephron-derived. C. Wholemount staining demonstrated the continuous luminal connection across the junction of the GFP+ CD and GFP- nephron tubule. D. HNF4A+ proximal tubules represented most NM-derived epithelial tissue in the organoids, while GATA3+ (GFP-) distal nephrons were far less abundant at day 14. E. GATA3-mScarlet expression in the nephron lineage was first weakly detected as early as day 5 in small domains of renal vesicles (arrows), and by day 7 it was strongly expressed in the presumptive distal segments of nascent nephrons. By day 14, the distal tubules were frequently fused to the GFP+ CDs. F. IF staining for GATA3 and TJP1 revealed that more than one GATA3+ distal tubules connected into a single GFP+ ureteric tubule by day 7. Scale bars, 100 pm (C, F), 1,000 pm (D, E).

[0184] FIG. 14. Analysis of proximal nephron and stromal components of organoids, Related to FIG 4. A-B. Annotated cell types of the epithelial components of both Mixed and NM organoids (combined) at day 14 closely aligned with both unsupervised DevKidCC segment assignment scoring (A) and canonical 57 anchor gene expression (B). C. Functional transport assay demonstrated that organoid proximal tubules uptake (secrete) 6- carboxyfluorescein following 1 hour incubation. D. A higher number of GATA3-expressing connecting segment cells were observed in the NM-derived distal tubule (CD cluster removed from plots) in the Mixed organoids compared to NM only. E. Overall, there were no marked qualitative differences in marker gene expression associated with nephron segments in Mixed vs. NM Only organoids, although most of LOH / TAL genes were consistently more highly expressed in the Mixed organoids. Neither condition exhibited SLC12A3 expression in the distal tubule clusters. F. Comparison of interstitial cell gene expression in the GFP+ vs GFP- cells in the stromal cluster (FIG. 4H) revealed no substantive differences, supporting that comparable stromal populations arise from both the NM and UB differentiations. Scale bar, 1,000 pm (C).

[0185] FIG. 15. NOTCH inhibition enhances distal nephron development and fusion, Related to FIG. 6. A. Exposure to DAPT from days 2-6 or 3-6 led to expansion of GATA3 expressing tubules and nearly complete repression of podocytes (NPHS1) by day 14, whereas treatment from days 4-6 increased the distal nephron specification but maintained similar' levels of proximal structures such as podocytes. B. The GATA3+ segments in DAPT- treated organoids formed normal patent anastomoses with the UB-derived CDs, and they frequently expressed the connecting segment marker CALB1. Scale bars, 1,000 pm (A), 200 pm (B).

[0186] FIG. 16. Testing WNT and GATA3 in nephron segmentation and fusion, Related to FIG. 7. A. Quantification of GATA3-mScarlet+ area (from Fig. 6A) revealed a dosedependent WNT response, where activation (CHIR) and inhibition (XAV) led to significant increase and decrease in GATA3 expression in the NM lineage, respectively, n-3 independent biological replicates per condition; column and error bars represent mean and standard deviation, respectively; **P = 0.0056, ****P < 0.001. B. Expression analysis of day 14 organoids by qPCR showed that proximal segment markers (HNF4A, NPHS1, NPHS2) exhibited the opposite pattern, with suppression by CHIR and variable increase induced by XAV. The more distalnephron markers CALB1 and SLC12A1 were increased by WNT activation. n=3 independent biological replicates per condition; column and error bars represent mean and standard deviation, respectively; *P < 0.05, ***P < 0.001. C. The dox-inducible WNT9B cassette was stably introduced to hPSCs using the p!nducer20 lentivirus. In the undifferentiated cells, addition of doxycycline led to significant activation of WNT9B measured by qPCR. n-3 independent biological replicates per condition; column and error bars represent mean and standard deviation, respectively; *P =0.0236. D. Wholemount staining of control and Dox-treated organoids showed that UB-derived WNT9B activation led to increased GATA3 expression in the NM lineage and more fusion events (as quantified in Fig. 6D-E). E. The dox inducible GATA3 cassette was similarly introduced to hPSCs through the p!nducer20 lentivirus. Exposure to doxycycline for 24 hours induced mosaic expression of GATA3 in the undifferentiated hPSCs. F. Wholemount staining of GATA3 in the NM lineage with UB expression digitally subtracted based on overlap with expression of the GFP reporter. Addition of Dox led to mosaic and sometimes patchy expression of GATA3 within the organoids. XAV treated (WNT inhibited) organoids exhibited markedly reduced GATA3 expression in the NM lineage, which was rescued by transgene activation. Scale bars, 1,000 pm (D, F), 200 pm (E).

[0187] FIG. 17. Interrogating CD maturation in UB-derived epithelia, Related to FIG. 8. A. Violin plot expression of UB lineage markers across the differentiation from days 0- 14, as shown in feature plots in FIG. 8B. More differentiated principal cell markers were induced by days 10-14, but expression of AQP2 remained low. B. The expression of AQP2 was induced in UB epithelia grown either in isolation or in recombinant organoids 100 with NM when cultured in previously identified conditions to grow UB organoids (UB Medium), but not when grown in the minimal ‘Mix’ media. C. Schematic representation of methods for growing UB organoids in isolation in 3D culture and their differentiation to AQP2+ cells following exposure to a minimal ‘CD Medium.’ Following transition to CD Medium, activation of either the WNT (CHIR99021), FGF / GDNF, or TGFb (Activin A) pathways was sufficient to repress activation of the AQP2 reporter allele, while RA and BMP4 had no appreciable effect. D. CD Medium (CDM) induced higher expression of AQP2, ELF 5. and SCNN1G in Mixed organoids at day 14, and they were significantly further augmented by the addition of A83, U0126, and XAV. n=3 independent biological replicates per condition; column and error bars represent mean and standard deviation,respectively; P-values shown in figure. E. AQP2 was induced by AUX specifically within the GFP+ UB-dcrivcd CDs. F. The overall morphology and architecture of organoids at day 14 was unaffected by transition to CD Medium (CDM) or CDM + AUX (A83, U0126, XAV939) culture medium, and the formation of UB -derived CD-like tubules and nephron fusion via GATA3+ segments were preserved. G. UMAP embedding of epithelial components of both Mixed (including Control, CDM, and CDM+AUX conditions) and UB Only (CDM+AUX condition) organoids at day 14. H. The CD-like cells from UB Only organoids clustered distinctly from those 113 in Mixed organoids. I. Expression of CD principal cell maturation markers was higher in CD cells from Mixed organoids than UB Only organoids. Scale bars, 500 pm (B), 200 pm (C, E), 1,000 pm (F).

[0188] FIG. 18. Single cell profiling of organoid maturation, Related to FIG. 8. A. Single cell profiling at day 14 revealed similar nephron segment distribution among organoids grown in control (Mix Media), CDM, and CDM + AUX conditions from days 10-14. B. NM lineage differentiation was largely unaffected by the transition of organoids to CDM or CDM+AUX conditions, with overall similar expression of genes associated with podocyte proximal tubule, LOH / TAL, and distal tubule clusters. C. One exception, though, was that CDM+AUX induced a higher level of expression of some genes associated with proximal tubule maturation, such as SLC34A1. D. 123 Expression of CD principal cell gene expression was highest in the Shi and Uchimura datasets and largely absent in the Vanslambrouck and Phipson organoids. E. Markers of intercalated cells were not observed in any of the four single cell datasets.

[0189] The terms “Shi (this paper)” and “Mixed organoids” refers to the disclosed organoids.DETAILED DESCRIPTION

[0190] In the following detailed description, reference is made to the accompanying drawings, which form a pail hereof. In the drawings, similar symbols typically identify similar components, unless context dictates otherwise. The illustrative embodiments described in the detailed description, drawings, and claims are not meant to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects of the presentdisclosure, as generally described herein, and illustrated in the Figures, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are explicitly contemplated herein.

[0191] The following description of various embodiments is exemplary and explanatory only and is not to be construed as limiting or restrictive in any way. Other embodiments, features, objects, and advantages of the present teachings will be apparent from the description and accompanying drawings, and from the claims.

[0192] The in vitro kidney organoids described herein may comprise, consist of, or consist essentially of the elements of the organoids as described herein, as well as any additional or optional element described herein or otherwise useful in an in vitro kidney organoid. The methods described herein may comprise, consist of, or consist essentially of the elements of the methods as described herein, as well as any additional or optional element described herein or otherwise useful in a method 1) of preparing a kidney organoid, 2) for inducing terminal maturation of one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid, 3) for inducing fusion of one or more nephron(s), nephron segment(s), nephron-like segment(s), and / or nephron-like tubule(s), and one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid, 4) for increasing distal nephron tubules and / or improving the frequency of fusion events in a kidney tissue or organoid in a kidney tissue or organoid, and / or 5) for screening a compound or composition. The kits described herein may comprise, consist of, or consist essentially of the elements of the kits as described herein, as well as any additional or optional element described herein or otherwise useful in kits 1) comprising means for preparing a kidney organoid, 2) for screening for therapeutic efficacy of a compound for a kidney-related disease or disorder comprising reagents sufficient for performing an assay for assessing effects of the compound, and / or 3) for screening for nephrotoxicity of a compound comprising reagents sufficient for performing an assay for at least one nephrotoxicity marker.

[0193] The disclosure herein uses affirmative language to describe the numerous embodiments. The disclosure also includes embodiments in which subject matter is excluded, in full or in part, such as substances or materials, method steps and conditions, protocols, or procedures.

[0194] It should be understood that any use of subheadings herein are for organizational purposes, and should not be read to limit the application of those subheaded features to the various embodiments herein. Each and every feature described herein is applicable and usable in all the various embodiments discussed herein and that all features described herein can be used in any contemplated combination, regardless of the specific example embodiments that are described herein. It should further be noted that exemplary description of specific features are used, largely for informational purposes, and not in any way to limit the design, subfeature, and functionality of the specifically described feature.Overview

[0195] Generating tissues from human pluripotent stem cells (hPSCs) capable of replicating the diverse and complex physiology of the mammalian kidney includes recapitulating key structural features that are established during organogenesis. Each nephron (of up to 1-2 million in the human kidney) comprises a stereotyped series of specialized tubules that eventually reaches the collecting duct (CD) system, which transports putative urine through the corticomedullary axis to the ureter for excretion. Although nephrons and their collecting system are seamlessly connected to work in concert with one another in the adult kidney, they originate in the embryo from two distinct epithelial populations derived from separate progenitor pools: nephron progenitor cells (NPCs) and the ureteric bud (UB), respectively. At an early stage of nephrogenesis, the separate epithelia are permanently connected via an anastomosis that establishes a patent luminal conduit and reinforces the proximal-distal polarity of the future nephron, and this fusion process is thus among the most critical developmental determinants of kidney function.

[0196] Current protocols for differentiating kidney organoids from hPSCs rely on directed specification of nephrogenic mesenchyme (NM), which includes nephron progenitor cells (NPCs) that can be induced to epithelialize and form nephron-like structures comprising podocytes, proximal tubules, and distal-like tubules. Despite advances in these methodologies, a persistent limitation has been that organoids lack CDs or any form of a collecting system that would provide a potential structural mechanism for the distal drainage of fluid from their nephrons. This is a fundamental barrier to advancing the maturation of organoids since distal tubular obstruction excludes the possibility of renal function. Additionally, the collecting systemserves as an important centralized structure providing organization to the otherwise chaotic- appcaring renal cortex. Though nephrons arc densely and seemingly randomly arranged with respect to one another, they all connect to CDs through their distal ends to generate a uniform directionality and tubular axis that maximizes the function of the kidney. The nephrons within organoids are similarly disordered but do not contain CDs to choreograph their orientation or collective action. The absence of a collecting system in kidney organoids is therefore a critical limitation and resolving this issue will be an essential step toward de novo production of physiologically competent human kidney tissue.

[0197] The UB generates the collecting system of the kidney, and it arises from an anatomically distinct region of the embryo compared to the NM in the metanephric mesenchyme. UB progenitors are thus not induced in standard kidney organoid protocols, so separate strategies for differentiation of this population are needed. Proof-of-concept studies using mouse embryonic stem cells showed that combinations of induced UB and NM could reproduce key developmental interactions from the nephrogenic niche and generate remarkably well-patterned collecting systems in vitro. However, attempts to combine hPSC derivatives have not yielded comparable results. Mixing dissociated single cells from NPC and UB-like lineages led to rare chimeric epithelial structures, but neither organized nephron-UB fusion nor the formation of CD- like tubules that could potentially drain organoid nephrons have been achieved. The present disclosure relates to the novel development of a strategy and culture conditions to co-culture hPSC-derived UB progenitor cells with hPSC-derived NM progenitors to generate kidney organoids with connected nephrons and CDs. Disclosed herein is a system for assembly of these UB progenitors with NM to incorporate CD-like drainage tubules into kidney organoids, and this system robustly recapitulates epithelial fusion between distal nephron and CD that parallels the process observed during in vivo development.Definitions of Terms

[0198] Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. For purposes of the present disclosure, the following terms are explained below.

[0199] As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising,” the words “a” or“an” may mean one or more than one. Some embodiments of the disclosure may consist of or consist essentially of one or more elements, method steps, and / or methods of the disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein and that different embodiments may be combined.

[0200] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.” For example, “x, y, and / or z” can refer to “x” alone, “y” alone, “z” alone, “x, y, and z,” “(x and y) or z,” “x or (y and z),” or “x or y or z.” It is specifically contemplated that x, y, or z may be specifically excluded from an embodiment. As used herein “another” may mean at least a second or more.

[0201] The term “ones” means more than one.

[0202] As used herein, the term “plurality” may be 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.

[0203] As used herein, the term “set of’ means one or more. For example, a set of items includes one or more items.

[0204] As used herein, the phrase “at least one of,” when used with a list of items, means different combinations of one or more of the listed items may be used and only one of the items in the list may be needed. The item may be a particular object, thing, step, operation, process, or category. In other words, “at least one of’ means any combination of items or number of items may be used from the list, but not all of the items in the list may be required. For example, without limitation, “at least one of item A, item B, or item C” means item A; item A and item B; item B; item A, item B, and item C; item B and item C; or item A and C. In some cases, “at least one of item A, item B, or item C” means, but is not limited to, two of item A, one of item B, and ten of item C; four of item B and seven of item C; or some other suitable combination.

[0205] As used herein, “substantially” means sufficient to work for the intended purpose. The term “substantially” thus allows for minor, insignificant variations from an absolute or perfect state, dimension, measurement, result, or the like such as would be expected by a person of ordinary skill in the field but that do not appreciably affect overall performance.When used with respect to numerical values or parameters or characteristics that can be expressed as numerical values, “substantially” means within ten percent.

[0206] Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of’ is meant including, and limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of’ indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of’ is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of’ indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

[0207] Reference throughout this specification to “one embodiment,” “an embodiment,” “a particular’ embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “a further embodiment” or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in various embodiments.

[0208] As used herein, the terms “treatment,” “treating,” “treat,” and the like, with respect to a disease or condition, can refer to obtaining a desired pharmacologic and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. For example, a treatment can include executing a protocol, which may include administering one or more drugs to a patient, in an effort to alleviate signs or symptoms of the disease. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, andremission or improved prognosis. Alleviation can occur prior to signs or symptoms of the disease or condition appearing, as well as after their appearance. Thus, “treating” or “treatment” may include “preventing” or “prevention” of disease or undesirable condition. In addition, “treating” or “treatment” does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols that have only a marginal effect on the patient.

[0209] “Treatment,” as used herein, thus can cover any treatment of a disease in a subject, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease and / or relieving one or more disease symptoms. “Treatment” can also encompass delivery of an agent or administration of a therapy in order to provide for a pharmacologic effect, even in the absence of a disease or condition.

[0210] The term “therapeutically effective” or “therapeutically effective amount” as used throughout this application can refer to an amount effective to achieve a desired and / or beneficial effect, and / or anything that promotes or enhances the well-being of the subject with respect to the medical treatment of a condition. This includes, but is not limited to, a reduction in the frequency or severity of one or more signs or symptoms of a disease. An effective amount can be administered in one or more administrations. In the methods, a therapeutically effective amount is an amount appropriate to treat an indication. By treating an indication is meant achieving any desirable effect, such as one or more of palliate, ameliorate, stabilize, reverse, slow, or delay disease progression, increase the quality of life, or to prolong life. Such achievement can be measured by any suitable method, such as measurement of tumor size or blood cell count, or any other suitable measurement.

[0211] The terms “effective amount” or “effective dose” as used herein have their plain and ordinary meaning as understood in light of the specification, and can refer to that amount of a recited composition or compound that, results in an observable effect. Actual dosage levels of active ingredients in an active composition of the presently disclosed subject matter can be varied so as to administer an amount of the active composition or compound that, is effective to achieve the desired response for a particular’ subject and / or application. The selected dosage level wall depend upon a variety of factors including, but not limited to, the activity of thecomposition, formulation, route of administration, combination with other drugs or treatments, severity of the condition being treated, and the physical condition and prior medical history of the subject being treated. In some embodiments, a minimal dose is administered, and dose is escalated in the absence of dose-limiting toxicity to a minimally effective amount. Determination and adjustment of an effective dose, as well as evaluation of when and how to make such adjustments, are contemplated herein.

[0212] The term “disease state” as used herein, can generally refer to a condition that affects the structure or function of an organism. Disease states can include, for example, stages of a disease progression.

[0213] As used herein, the term “assessing” can include any form of measurement, and includes determining if an element is present or not. The terms “determining,” “measuring,” “evaluating,” “assessing” and “assaying” can be used interchangeably and can include quantitative and / or qualitative determinations.

[0214] As used herein, the terms “modulated” or “modulation,” or “regulated” or “regulation” and “differentially regulated” can refer to both up regulation (z.e., activation or stimulation, e.g., by agonizing or potentiating) and down regulation (i.e., inhibition or suppression, e.g., by antagonizing, decreasing or inhibiting), unless otherwise specified or clear from the context of a specific usage.

[0215] As used herein, the term “subject” can refer to any member of the animal kingdom. In some embodiments, a subject is a human patient.

[0216] As used herein, the term “marker” or “biomarker” can refer to any measurable substance taken as a sample from a subject whose presence is indicative of some phenomenon. Non-limiting examples of such phenomenon can include a disease state, a condition, or exposure to a compound or environmental condition. In various embodiments described herein, biomarkers may be used for diagnostic purposes e.g., to diagnose a disease state, a health state, an asymptomatic state, a symptomatic state, etc.). The term “biomarker” may be used interchangeably with the term “marker”. The term “marker” or “biomarker” can include a biological molecule, such as, for example, a nucleic acid, peptide, protein, hormone, and the like, whose presence or concentration can be detected and correlated with a known condition, such as a disease state. It can also be used to refer to a differentially expressed gene whose expressionpattem can be utilized as part of a predictive, prognostic or diagnostic process in healthy conditions or a disease state, or which, alternatively, can be used in methods for identifying a useful treatment or prevention therapy.

[0217] As used herein, the term “cellular phenotype” can refer to any determinable, observable, and / or measurable characteristic associated with a cell population.

[0218] As used herein, a “model” can include one or more in vitro or in vivo disease models; a model can also include algorithms, one or more mathematical techniques, one or more machine learning algorithms, or a combination thereof. A model can be used in a process and / or applied to an assay, in accordance with various embodiments as disclosed herein.

[0219] As used herein, a “process” can include one or more steps involving one or more features of one or more model as disclosed herein.

[0220] The terms “function” and “functional” as used herein have their plain and ordinary meaning as understood in light of the specification, and can refer to a biological, enzymatic, or therapeutic function.

[0221] The term “inhibit” as used herein has its plain and ordinary meaning as understood in light of the specification, and can refer to the reduction or prevention of a biological activity. The reduction can be by a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or an amount that is within a range defined by any two of the aforementioned values. As used herein, the term “delay” has its plain and ordinary meaning as understood in light of the specification, and refers to a slowing, postponement, or deferment of a biological event, to a time which is later than would otherwise be expected. The delay can be a delay of a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or an amount within a range defined by any two of the aforementioned values. The terms inhibit and delay may not necessarily indicate a 100% inhibition or delay, A partial inhibition or delay may be realized.

[0222] As used herein, the term “isolated” has its plain and ordinary meaning as understood in light of the specification, and can refer to a substance and / or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and / or in an experimental setting), and / or (2) produced, prepared,and / or manufactured by the hand of man. Isolated substances and / or entities may be separated from equal to, about, at least, at least about, not more than, or not more than about, 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, substantially 100%, or 100% of the other components with which they were initially associated (or ranges including and / or spanning the aforementioned values). In some embodiments, isolated agents are, are about, are at least, are at least about, are not more than, or are not more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, substantially 100%, or 100% pure (or ranges including and / or spanning the aforementioned values). As used herein, a substance that is “isolated” may be “pure” (e.g., substantially free of other components). As used herein, the term “isolated cell” can refer to a cell not contained in a multi - cellular organism or tissue.

[0223] As used herein, “zn vivo” is given its plain and ordinary meaning as understood in light of the specification and can refer to the performance of a method inside living organisms, usually animals, mammals, including humans, and plants, as opposed to a tissue extract or dead organism.

[0224] As used herein, “ex vivo” is given its plain and ordinary meaning as understood in light of the specification and can refer to the performance of a method outside a living organism with little alteration of natural conditions.

[0225] As used herein, “m vitro” is given its plain and ordinary' meaning as understood in light of the specification and can refer to the performance of a method outside of biological conditions, e.g., in a petri dish or test tube.

[0226] The terms “nucleic acid” or “nucleic acid molecule” as used herein have their plain and ordinary meaning as understood in light of the specification, and can refer to polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), oligonucleotides, those that appear in a cell naturally, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action. Nucleic acid molecules can be composed of monomers that are naturally-occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring nucleotides (e.g., enantiomeric forms of naturally-occurring nucleotides), or a combination ofboth. Modified nucleotides can have alterations in sugar moieties and / or in pyrimidine or purine base moieties. Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters. Moreover, the entire sugar moiety can be replaced with statically and electronically similar structures, such as aza- sugar’s and carbocyclic sugar’ analogs. Examples of modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoramlidate, or phosphoramidate. The term “nucleic acid molecule” also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded. “Oligonucleotide” can be used interchangeable with nucleic acid and can refer to either double stranded or single stranded DNA or RNA. A nucleic acid or nucleic acids can be contained in a nucleic acid vector or nucleic acid construct (e.g. plasmid, virus, retrovirus, lentivirus, bacteriophage, cosmid, fosmid, phagemid, bacterial artificial chromosome (BAG), yeast artificial chromosome (YAC), or human artificial chromosome (HAG)) that can be used for amplification and / or expression of the nucleic acid or nucleic acids in various biological systems. Typically, the vector or construct will also contain elements including but not limited to promoters, enhancers, terminators, inducers, ribosome binding sites, translation initiation sites, start codons, stop codons, polyadenylation signals, origins of replication, cloning sites, multiple cloning sites, restriction enzyme sites, epitopes, reporter genes, selection markers, antibiotic selection markers, targeting sequences, peptide purification tags, or accessory genes, or any combination thereof.

[0227] A nucleic acid or nucleic acid molecule can comprise one or more sequences encoding different peptides, polypeptides, or proteins. These one or more sequences can be joined in the same nucleic acid or nucleic acid molecule adjacently, or with extra nucleic acids in between, e.g. linkers, repeats or restriction enzyme sites, or any other sequence that is, is about, is at least, is at least about, is not more than, or is not more than about, I, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,100, 150, 200, or 300 bases long, or any length in a range defined by any two of the aforementioned lengths. The term “downstream” on a nucleic acid as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a sequence being after the 3 ’-end of a previous sequence, on the strand containing the encoding sequence (sense strand) if the nucleic acid is double stranded. The term “upstream” on a nucleic acid as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a sequence being before the 5’- end of a subsequent sequence, on the strand containing the encoding sequence (sense strand) if the nucleic acid is double stranded. The term “grouped” on a nucleic acid as used herein has its plain and ordinary meaning as understood in light of the specification and refers to two or more sequences that occur in proximity either directly or with extra nucleic acids in between, e.g. linkers, repeats, or restriction enzyme sites, or any other sequence that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases long, or any length in a range defined by any two of the aforementioned lengths, but generally not with a sequence in between that encodes for a functioning or catalytic polypeptide, protein, or protein domain.

[0228] The nucleic acids described herein comprise nucleobases. Primary, canonical, natural, or unmodified bases are adenine, cytosine, guanine, thymine, and uracil. Other nucleobases include but are not limited to purines, pyrimidines, modified nucleobases, 5- methylcytosine, pseudouridine, dihydrouridine, inosine, 7-methylguanosine, hypoxanthine, xanthine, 5,6-dihydrouracil, 5-hydroxymethylcytosine, 5-bromouracil, isoguanine, isocytosine, aminoallyl bases, dye-labeled bases, fluorescent bases, or biotin-labeled bases.

[0229] The terms “peptide”, “polypeptide”, and “protein” as used herein have their plain and ordinary meaning as understood in light of the specification and refer to macromolecules comprised of amino acids linked by peptide bonds. The numerous functions of peptides, polypeptides, and proteins are known in the art, and include but are not limited to enzymes, structure, transport, defense, hormones, or signaling. Peptides, polypeptides, and proteins are often, but not always, produced biologically by a ribosomal complex using a nucleic acid template, although chemical syntheses are also available. By manipulating the nucleic acid template, peptide, polypeptide, and protein mutations such as substitutions, deletions,truncations, additions, duplications, or fusions of more than one peptide, polypeptide, or protein can be performed. These fusions of more than one peptide, polypeptide, or protein can be joined in the same molecule adjacently, or with extra amino acids in between, e.g. linkers, repeats, epitopes, or tags, or any other sequence that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, or 300 bases long, or any length in a range defined by any two of the aforementioned lengths. The term “downstream” on a polypeptide as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a sequence being after the C-terminus of a previous sequence. The term “upstream” on a polypeptide as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a sequence being before the N- terminus of a subsequent sequence.

[0230] The term “purity” of any given substance, compound, or material as used herein has its plain and ordinary meaning as understood in light of the specification and can refer to the actual abundance of the substance, compound, or material relative to the expected abundance. For example, the substance, compound, or material may be at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% pure, including all decimals in between. Purity may be affected by unwanted impurities, including but not limited to nucleic acids, DNA, RNA, nucleotides, proteins, polypeptides, peptides, amino acids, lipids, cell membrane, cell debris, small molecules, degradation products, solvent, carrier, vehicle, or contaminants, or any combination thereof. In some embodiments, the substance, compound, or material is substantially free of host cell proteins, host cell nucleic acids, plasmid DNA, contaminating viruses, proteasomes, host cell culture components, process related components, mycoplasma, pyrogens, bacterial endotoxins, and adventitious agents. Purity' can be measured using technologies including but not limited to electrophoresis, SDS-PAGE, capillary electrophoresis, PCR, rtPCR, qPCR, chromatography, liquid chromatography, gas chromatography, thin layer chromatography, enzyme-linked immunosorbent assay (ELISA), spectroscopy, UV-visible spectrometry, infrared spectrometry, mass spectrometry, nuclear magnetic resonance, gravimetry, or titration, or any combination thereof.

[0231] The term “yield” of any given substance, compound, or material as used herein has its plain and ordinary meaning as understood in light of the specification and can refer to the actual overall amount of the substance, compound, or material relative to the expected overall amount. For example, the yield of the substance, compound, or material is, is about, is at least, is at least about, is not more than, or is not more than about 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the expected overall amount, including ail decimals in between. Yield may be affected by the efficiency of a reaction or process, unwanted side reactions, degradation, quality of the input substances, compounds, or materials, or loss of the desired substance, compound, or material during any step of the production.

[0232] The term “% w / w” or “% wt / wt” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a percentage expressed in terms of the weight of the ingredient or agent over the total weight of the composition multiplied by 100. The term “% v / v” or “% vol / vol” as used herein has its plain and ordinary meaning as understood in the light of the specification and refers to a percentage expressed in terms of the liquid volume of the compound, substance, ingredient, or agent over the total liquid volume of the composition multiplied by 100.

[0233] The term “basement membrane matrix” or “extracellular matrix” as used herein has its plain and ordinary meaning in light of the specification and refers to any biological or synthetic compound, substance, or composition that enhances cell attachment and / or growth. Any extracellular matrix, as well as any mimetic or derivative thereof, known in the art can be used for the methods disclosed herein. Some examples of extracellular matrices, or numerics or derivative thereof, include but are not limited to cell-based feeder layers, polymers, proteins, polypeptides, nucleic acids, sugars, lipids, poly-lysine, poly-ornithine, collagen, gelatin, fibronectin, vitronectin, laminin, elastin, tenascin, heparan sulfate, entactin, osteopontin, basement membrane, Matrigel, hydrogel, PEI, WGA, or hyaluronic acid, or any combination thereof.

[0234] The term “CD-like” or “CD-like tubule” or “CD-like structure” as used herein refers to a tubule or structure of cells that resemble CD in vivo, for example express one or more genes of an in vivo CD and / or comprise one or more structural or functional similarities. The term “UB duct” can be used interchangeably with CD. For example, a CD-like structureexpresses GATA3, ELF5, AQP2, SCNN1G, CALB1 , and / or the like. For example, a CD-like structure is capable of drainage of fluid.

[0235] The term “nephron-like” or “nephron-like tubule” or “nephron-like structure” as used herein refers to tubule or structure of cells that resemble nephrons in vivo, for example express one or more genes of an in vivo nephron or comprise one or more structural or functional similarities, for example segmentation and polarization of a nephron. For example, a nephron-like structure contains podocytes, proximal tubules, and / or distal-like tubules.

[0236] The term “spheroid” as used herein refers to an aggregate or assembly of cells cultured to allow 3D growth, as opposed to growth as a monolayer. The term “spheroids” does not mean that the aggregate is geometrically spherical. Aggregates may be highly organized to have a well-established morphology, or may be an unorganized mass; may contain a single cell type, or two or more. This definition includes organoids and organotypic cultures.

[0237] The term “organoid” as used herein refers to a miniaturized and, in some cases, a simplified version of an organ produced in vitro in three dimensions, which show realistic and anatomically correct micro-anatomy. They are derived from one or more cells from a tissue, embryonic stem cells or induced pluripotent stem cells, which are capable of selforganization in three-dimensional culture owing to, for example, their self-renewal and differentiation capacities. The term “organoid” includes cell clusters formed from spheroids or cell culture suspensions.

[0238] The term “renal vesicle” (RV) as used herein refers to the initial epithelial structure that is formed from NM progenitors during nephron differentiation. It represents an intermediate step in the development of a nephron.

[0239] The following terms can be used interchangeably: nephron progenitor cell (NPC), metanephric mesenchyme (MM), and metanephric progenitor(s). hPSC-Derived Kidney Organoids

[0240] Disclosed herein is an stem cell-derived co-culture system that can recapitulate essential interactions between the NM and UB in development that lead to more advanced and functionally organized human kidney organoids compared to existing methodologies. The stem cells can be hPSCs. In this system, induced NM undergoes a sequence of nephrogenesis that can culminate in fusion of the distal pole to the UB-derived CD,establishing for the first time nephrons that are both properly polarized and connected to CD-like structures. This robust system for establishing the luminal connection can occur both in vitro and following transplantation in vivo. The luminal connection allows for passage of tubular fluid in the nephron into the collecting system. This is a key milestone toward the generation of more functional renal tissues from hPSCs. Further disclosed herein are methods for augmenting the frequency of anastomoses that can modulate the ratio of proximal-distal differentiation in the nephron segments. The induced UB epithelium similarly can develop in a stepwise fashion. Methods to enhance terminal maturation of the integrated CDs within the organoids are also disclosed.

[0241] Previous attempts at producing de novo nephron-like structures from hPSCs have not established a drainage mechanism via controlled epithelial fusion. In addition to its importance to forming functional tissue in vitro, replicating this process can be a strategy to integrate hPSC-derived nephrons into the host collecting system in vivo. The disclosed organoid model provides a solution to this longstanding question and dilemma. The fusogenic properties of the early distal tubule are indeed recapitulated in hPSC-derived nephrons, and the developmental process occurs when provided with appropriately staged UB epithelia. Although dozens of nephrons fuse to the UB in these chimeric organoids, there are many others that do not. The disclosure relates to the discovery of essential criteria, such as the formation of a GATA3+distal domain, which does not occur universally in all the late renal vesicles. Further requirements can include the proper orientation and a minimum proximity of the distal domain relative to the UB. Unlike in vivo, where these variables are reproducible and tightly controlled through spatiotemporally conserved nephron morphogenesis, they are more stochastically regulated during in vitro nephrogenesis.

[0242] The collecting system in vivo is an orderly, radially organized structure comprising one contiguous space and all CDs within a kidney drain into a common direction and ultimately form a single tubule, the ureter. The methods described herein can reproducibly generate in vitro organoids interlaced with extensive CD-like tubules. The pattern of growth and morphogenesis of the UB epithelia can be largely stochastic and lead to random CD configurations. In some embodiments of the disclosure, the UB progenitors adopt a moreconsistent and organized arrangement. In some embodiments, the organoids have a single outlet analogous to the ureter.

[0243] The kidney organoids disclosed herein can be derived from progenitor cells. These include, for example, induced pluripotent stem cells (iPSCs). In some embodiments, the iPSCs can be subject-derived, where the subject can be healthy or having a diseased condition, and are identical in genetic content to the respective patient. They express kidney markers that are expressed in the pre-natal stages of development. Furthermore, they are clonal and therefore react similarly to external stimuli and biochemical perturbations. These kidney organoids can be scalable and tractable, allowing screening approaches to test a vast array of drugs and small molecules.Methods of Producing Kidney Organoids

[0244] Disclosure of kidney organoid compositions and methods of making thereof are applicable to the kidney organoids, for example, human kidney organoids described herein.

[0245] Embodiments of methods for producing a kidney organoid are provided herein. In some embodiments, the method includes mixing a ureteric bud (UB) progenitor(s) and a nephrogenic mesenchyme (NM) progenitor(s); and co-culturing the tissue mixture to form a kidney organoid comprising a CD-like structure or collecting duct.Generating UB spheroids

[0246] The UB progenitors can be UB generated in any method known in the art, for example as described in Shi, M., McCracken, K.W., Patel, A.B., Zhang, W., Ester, L., Valerius, M.T., and Bonventre, J.V. (2023). Human ureteric bud organoids recapitulate branching morphogenesis and differentiate into functional collecting duct cell types. Nat Biotechnol 41, 252-261. 10.1038 / s41587-022-01429-5 and Shi, M., Fu, P., Bonventre, J.V., and McCracken, K.W. (2023), Directed differentiation of ureteric bud and collecting duct organoids from human pluripotent stem cells. Nat Protoc 18, 2485-2508. 10.1038 / s41596-023-00847-2, each of which is hereby expressly incorporated by reference in its entirety.

[0247] In some embodiments, the UB is generated from a stem cell. In some embodiments, the stem cell is contacted with a media comprising CHIR99021 , Activin A, BMP4, and / or FGF2 for a period of time to induce cells into a primitive streak-like fate. In someembodiments, the cell with a primitive streak-like fate is contacted with a media comprising FGF2, A83-01, LDN193189 and / or RA for a second period of time to induce anterior intermediate mesoderm. In some embodiments, the anterior intermediate mesoderm is dissociated and aggregated in a media comprising FGF9 and / or RA for a third period of time. In some embodiments, the aggregated cells are contacted with a media comprising GDNF and RA for a fourth period of time to induce formation of a self-assembling UB spheroid.Generating nephrogenic mesenchyme (NM)

[0248] In some embodiments, the NM is generated from a stem cell. In some embodiments, a Wnt signaling pathway is activated in the stem cell for a first period of time. The Wnt pathway can be activated with a Wnt pathway activator as described herein. For example, the activator can be CHIR. In some embodiments, a Noggin is also used in this first period of time. In some embodiments, after the first period of time, a TGF|3 signaling pathway is activated for a second period of time. The TGF|3 signaling pathway can be activated with a TGF[3 signaling pathway activator as described herein. For example, the TGF|3 activator can be Activin A. In some embodiments after the second period of time, an FGF signaling pathway is activated for a third period of time to induce formation of nephrogenic mesenchyme. The FGF signaling pathway can be activated with a FGF signaling pathway activator as described herein. For example, FGF activator can be FGF9. The Wnt pathway activator can be used at a concentration of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30 pM or more for a first period of time of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days. The TGFP signaling pathway activator can be used at a concentration of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30 ng / mL or more for a second period of time of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days. The FGF signaling pathway activator can be used at a concentration of about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30 ng / mL or more for a third period of time of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days.

[0249] In some embodiments, the NM cells can be cryopreserved. For example, once the cells reach a desired stage, such as the NM stage (days 7-9), they can be cryopreserved through dissociating into single cells, pelleting by centrifugation, and resuspending in a medium, and then frozen. The medium can be any standard cell medium, such as 45% Advanced RPMI1640, 45% Fetal Bovine Serum, and 10% DMSO. The cell suspensions can be then frozen at -80 degrees C, and can later be moved for long-term storage in liquid nitrogen. For use in experiments, the cells can be thawed to room temperature, centrifuged, and then mixed with UB progenitors to form organoids as described below.

[0250] Further details can be found in, for example as described in Morizane, R., Lam, A.Q., Freedman, B.S., Kishi, S., Valerius, M.T., and Bonventre, J.V. (2015). Nephron organoids derived from human pluripotent stem cells model kidney development and injury. Nat Biotechnol 33, 1193-1200. 10.1038 / nbt.3392 and Morizane, R., and Bonventre, J.V. (2017). Generation of nephron progenitor cells and kidney organoids from human pluripotent stem cells. Nat Protoc 12, 195-207. 10.1038 / nprot.2016.170, each of which is hereby expressly incorporated by reference in its entirety.Co-culturing UB progenitors with NM progenitors

[0251] In some embodiments, a UB progenitor(s) is mixed with a NM progenitor(s) to form an aggregated tissue mixture, also referred to herein as a co-culture or tissue mixture or organoid or integrated organoid.

[0252] The UB progenitor is generated as described above. The UB progenitors used for mixing with the NM progenitor can be at, before or after day 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 day UB spheroid, for example, a 4-10 day spheroid, for example, a 6 day spheroid, i.e., 6 days after the start of differentiation. The spheroid can be a selected spheroid, for example a spheroid selected for comprising cells exhibiting gene expression characteristics analogous to the UB progenitor cells present in the branching tips of the developing kidney. For example, spheroid expression one or more “tip-like progenitor markers.” The term tip-like progenitor marker refers to a gene present in the branching tips of a development kidney. The tip-like progenitor marker can include, but is not limited to RET, ETV4, ETV5, WNT11 , SOX9 and or the like. In some embodiments, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or more of the selected spheroids comprise a tip-like progenitor marker. Optionally, the UB progenitor cells for mixing can undergo quality control testing prior to mixing, for example at days 3 and 6. The quality control step can include, for example, assessment of the correct gene expression patternsat day 3 (GATA3, PAX2) or day 6 (GATA3, PAX2, RET, WNT1 1 , ETV4, ETV5) by either IF staining or qPCR or the like.

[0253] The NM progenitor is generated as described above. Prior to mixing, the NM progenitor(s) used for mixing with the UB progenitor(s) can be dissociated at, before or after day 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 after formation of the NM, or of differentiation. The NM can be a selected NM for example a NM selected for comprising an undifferentiated NPC marker such as SIX2, S1X1, CITED 1 , WT1, and / or the like. The ratio of NM progenitors to UB spheroids used in the mixing step can be about 1.0 x 103-1.0 x 106NM progenitors for every UB progenitor spheroid. For example, about 5.0 x 105NM progenitors to about 50 UB spheroids. For example about 3.0-6.0 x 106NM cells to about 300-600 spheroid to make 6-12 organoids. The mixture of NM progenitors to UB spheroids can used to generate kidney organoids comprising between 1.0 x 104-1.0 x 107NM progenitors and the corresponding number of UB progenitor spheroids according to the ratio above. The cell / spheroid mixture can be used to make organoids of varying size.

[0254] The tissue mixture can be cultured on a membrane, such as a permeable membrane, such as a membrane including polycarbonate, polyester (PET), and collagen-coated polytetrafluoroethylene (PTFE). Aggregation techniques can be used, for example, those described in Gupta, A.K., Ivancic, D.Z., Naved, B.A., Wertheim, J.A., and Oxburgh, E. (2021). An efficient method to generate kidney organoids at the air-liquid interface. J Biol Methods 8, el50. 10.14440 / jbm.2021.357, which is fully incorporated by reference herein. The method can use air-liquid interface cultures. For example, media is added only to a lower chamber of a transwell filter membrane. The tissue mixture can be cultured in media, such as standard differentiating media. Different media can be used depending on the stage of the organoid as will be described below.

[0255] In some embodiments, a rho-kinase (ROCK) pathway is inhibited in the tissue mixture for a period of time. The ROCK pathway can be inhibited by contact with a media comprising a ROCK inhibitor. ROCK inhibitors can include, but are not limited to Y-27632, Thiazovivin, and / or the like. The period of time can be transient. The period of time can be, for example, about, at least, or less than 0.25, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or more hours after mixing or about 2-8 hours, or for about 5 hoursafter mixing (e.g., upon mixing and until 5 hours later). In some embodiments, the ROCK inhibitor is used at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, at least, or less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30uM, or any concentration within a range defined by any two of the aforementioned concentrations, including l-20uM, In some embodiments, the ROCK inhibitor is used at a concentration of lOpM.

[0256] In some embodiments, a BMP signaling pathway is inhibited in the tissue mixture for a period of time. The BMP signaling pathway can be inhibited by a BMP inhibitor. BMP inhibitors can include, but are not limited to LDN193189, Dorsomorphin, DMH-1, and / or the like. The period of time can be transient. The period of time can start, for example, at about, at least, or less than 0, 4, 8, 12, 16, 20, 24, 28, 32, 36, 42, or 48 or more hours after mixing. The period of time can be a period of time sufficient to allow formation of a renal vesicle. The period of time can be a period of time sufficient to induce formation of a nephron. Nephron induction can be characterized by, for example, formation of epithelialized vesicles or expression of genes such as LHX1 and JAG1. For example, the period of time of BMP pathway inhibition can be for about 1, 2, 3, 4, 5, 6 or more days. For example, a BMP inhibitor can be added from about days 0-2. The concentration of the BMP inhibitor can be about 50-1,000 nM, optionally about 200 nM.

[0257] In some embodiments, the cultured tissue mixture comprises less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1% undifferentiated progenitors, after a period of time after mixing, for example, 1, 2, 3, 4, 5 days after the mixing step, for example about 4 days after mixing.

[0258] In some embodiments, GSK3[3 is not inhibited in the tissue mixture by, for example, a GSK3|3 inhibitor. In some embodiments, Wnt pathways are not activated in the tissue mixture by, for example, a Wnt activator.Terms

[0259] Stem cell — > NM progenitorNM-derived cellsNM-derived structures.The NM-derived structures include nephron-like structure or nephron. “Nephron-like” meansexpression of one or more genes of an in vivo nephron or presence of one or more structural similarities.

[0260] Stem cell — > UB progenitor / UB spheroid — > UB-derived cells — > UB-derived structure. The UB-derived structure can include a CD-like structure or a CD. “CD-like” means expression of one or more genes of an in vivo CD or presence of one or more structural similarities.Culturing recombinant organoids

[0261] In some embodiments of the method, the organoid is cultured for a period of time to induce formation of various structures. This can be part of, or a continuation of, the coculturing step. For example, organoid can grow and form a network of tubules interwoven amongst the nascent nephrons throughout the organoid. For illustrative purposes, the methods described herein and the formation of the organoid can be divided into at least three stages: early nephrogenesis, fusion, and maturation. In the disclosed method, early stages begin from the point of mixing the NM progenitor with the UB spheroid and involve the formation of renal vesicles from NM and the initial budding and branching from the UB spheroids. Budding can be defined as the formation of 2-10 processes that grow out from each spheroid. The early nephrogenesis stage can be about 1, 2, 3, 4, 5, or days depending on rate of growth. For example, the early stage can be about 0-2 or 0-3 or 0-4 days after mixing. In the early stage, NM derived cells begin to form renal vesicles (pretubular aggregate (PTA), renal vesicle (RV)) and the UB derived cells arc enriched for tip-like progenitor genes including RET, GATA3, PAX2, ETV4, ETV5, WNT11, and / or SOX9.

[0262] In the later fusion stage, which can be for 1, 2, 3, 4, 5, 6, 7, 8, or more days after the early stage, for example days 4-8 and beyond. At the beginning of this stage, there is a paucity of progenitor genes expressed and the NM-derived renal vesicles exhibit evidence of polarization. Polarization is a term used to describe the spatial separation of cells expressing early markers of the proximal (e.g. WT1, HNF4A) versus distal (e.g. POU3F3, GATA3, CDH1) nephron. At this stage, the UB spheroids form network of tubules, which entails formation of elongated duct-like epithelium that can extend to a length of 100 um or more. As this stage progresses, NM cells segregate into proximal, distal, and podocyte-like progenitor populationsanalogous to those found in the S-shaped body (SSB). In UB-derived cells, expression of genes associated with UB stalk fate arc increased (c.g., CALB1, WNT9B, and / or the like). In the disclosed method, fusion events between the NM-derived structures (nephron like-tubules) and the UB-derived structures (CD-like tubules or CD) occur. A fusion event can occur between a NM-derived epithelium and UB-derived epithelium, wherein a NM-derived component comprises one or more nephron, nephron segment, nephron like segment, and / or nephron-like tubule, and the UB-derived structure comprises one or more CD-like tubule, CD and / or UB duct.

[0263] In the maturation stage, which can be for 1, 2, 3, 4, 5, 6, 7, 8, or more days after the early stage, for example days 4-14 and beyond, both the NM-derived nephron segments and the UB-derived CD epithelium undergo further development and maturation. During this stage, more differentiated markers arc observed that are associated with podocyte (NPHS1, NPHS2, MAFB, PODXL), proximal tubule (HNF4A, LRP2, LTL, SLC34A1, SLC3A1), loop of Henle (SLC12A1, KCNJ1, CASR), distal tubule (GATA3, CALB1), and collecting duct (GATA3, AQP2, ELF5).

[0024] In some embodiments of the method, signaling pathway can be manipulated to induce fusion events and / or induce terminal maturation and / or CD maturation as will be described in further detail below. Towards the end of the later stage, most fusion events are complete.

[0265] Some embodiments of the method can further include the step of transient inhibition of WNT, TGFB, and / or FGF / RTK9 in the organoid. This inhibition can be for 1, 2, 3, 4, 5, 6, 7 or more days. For example for about 4 days. This step can start in the later or mature stage, for example at day 10. This embodiment can include increased expression of CD makers, for example, but not limited to, ELF 5, SCNN1B, AQP2, SCNN1G, KCNJ1, AVPR2, and / or the like.

[0266] In some embodiments, the organoids can be grown for a period of time, for example for about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more days. The period of time can be sufficient for one or more of the following characteristics to occur or be present in the organoid: a) elongation of tubules of the UB, b)increase in expression of genes associated with UB stalk fate;c)formation of CD-like tubule and / or CD; d)formation of CD-like tubule and / or CD that arc interconnected and spanned throughout the organoid; e)decrease in expression of progenitor markers of the UB progenitor and NM progenitor; f) formation of renal vesicles by the NM progenitor; g)polarization of NM; h)increase in expression of markers of nephron segment differentiation; i) formation of nephron, nephron segment, nephron like segment, and / or nephron-like tubule; j) differentiation of podocytes, proximal tubules, distal tubules and / or the like; polarization of nephrons; k)increased expression of distal tubule markers; increased expression of UB stalk fate markers or CD markers; l) expansion of a stromal compartment; direct connection of nephron, nephron segment, nephron like segment, and / or nephron-like tubule to a CD-like tubule and / or CD; m)formation of anastomoses between nephrons, nephron segments, nephron like segments, and / or nephron like tubules and CD-like tubule or CD; n)fusion of a nephron distal tubule to a UB duct; o)formation of uninterrupted epithelial structure across tubules; formation of continuous luminal membrane across the junctions of tubules; p)and / or the like.

[0267] Markers of nephron segment differentiation can include, but are not limited to, JAG1, CDH6, CDH1, WT1, POU3F3, MECOM, HNF4A, GATA3, and / or HNF1B.

[0268] Distal tubule markers can include, but are not limited to GATA3, TFAP2A, TFAP2B, SOX9, EGR5, CAEB1 and / or CDH1.

[0269] Markers of CD can include, but are not limited to EEF5, SCNN1B, SCNN1G, KCNJ1, AVPR2, and / or AQP2.

[0270] The nephron tubules are formed from the NM progenitors and the CDs are formed from the UB progenitors.

[0271] In some embodiments, the organoid produced by the methods of the disclosure can have about 5-10 epithelial connections between a nephron and UB, for example, about 5, 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, or more epithelial connections between a nephron and UB, for example at least 20 connections by day 14.

[0272] In some embodiments, an organoid produced by the methods of the disclosure can have at least about 20 nephron-like structures, for example about 50-10,000 or more nephron-like structures. In some embodiments, an organoid produced by the methods of the disclosure can have at least about 5 CDs, for example about 10-200 CDs. In some embodiments, the size of the organoid can range from about 0.5mm- 12mm, for example, about 3-6mm in diameter.

[0273] In some embodiments, a mature organoid is produced. A mature kidney organoid can be described as an organoid that has matured to comprise epithelial structures representing various nephron segments including podocytes, proximal tubules, loops of Henle, and / or distal tubules. In other embodiments, a mature organoid can be defined as having functionality, the organoid produced by the methods of the disclosure is functional. The term functional can refer to the organoid being capable of carrying out a functional mechanism of a kidney in vivo, for example, the drainage of fluid, for example, distal drainage of fluid from nephrons.

[0274] In some embodiments, the organoid is grown on a membrane, such as a basement membrane. In some embodiments, the basement membrane matrix is Matrigel.

[0275] The tissue mixture can be cultured in media, such as standard differentiating media. Different media can be used depending on the stage of the organoid. In some embodiments, a first medium comprising, for example, Advanced RPMI 1640, 1% GlutaMAX1M(stable alternative to L-glutamine) is used in the early stages and / or part of the later stages. In some embodiments a second medium comprising hormones is used at part of the later stages and / or the mature stage. The hormones can include, but are not limited to, arginine vasopressin, aldosterone, DDAVP, and / or the like. The hormone can be included at a concentration of 1-1,000 nM, for example, 1, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 nM or more or less. The hormone medium is used transiently, optionally for 1, 2, 3, 4, 5, 6, or more days in a 5, 6, 7, 8, 9, 10, 11, 12, 13, or more day organoid after the mixing step. The second medium can bedevoid of growth factors. Embodiments of the disclosure include any cell media described herein.

[0276] The organoid, or progenitor cells used to make the organoid, can be labeled by any method known in the art, for example with a fluorophore.Method for induing anastomoses

[0277] Other methods of the disclosure relate to induction of the formation of anastomoses between a nephron(s), nephron segment(s), nephron-like segment(s), and / or nephron-like tubule(s) and a CD-like tubule(s), CD(s), or UB duct(s) in kidney cells, a kidney spheroid and / or a kidney organoid.. In these methods, NOTCH signaling can be inhibited in the organoid to induce formation of anastomoses for a period of time. NOTCH inhibition can be inhibited with a NOTCH inhibitor for a period of time. The NOTCH inhibitor can be gamma secretase inhibitor, a RBPJ inhibitor, and / or the like. The gamma secretase inhibitor can be, for example, DAPT, Compound E, DBZ, LY450139, BMP299897, and / or the like. The period of time can be, for example, for about, at least, or less than 0.5, 1, 1.5, 2, 2.5, 3, 3.5 days. The period of time can star! on about, on at least or by day 0, 1, 2, 3, 4, 5, 6, 7 after mixing, for example, on days 4-6. In these methods, anastomoses is increased by at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% or more compared to cells, a spheroid or an organoid grown without NOTCH inhibition at the period of time used. In some embodiments, the NOTCH inhibitor is used at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30uM, or any concentration within a range defined by any two of the aforementioned concentrations, including l-20uM, In some embodiments, the NOTCH inhibitor is used at a concentration of lOpM.

[0278] In some embodiments, this method for inducing anastomoses is combined with any of the other methods disclosed herein. For example, it is used in the co-culturing step in the method of preparing a kidney organoid.Method for increasing distal nephron tubules and / or fusion events

[0279] Other methods of the disclosure relate to increasing distal nephron tubules and / or improving the frequency of fusion events in kidney cells, kidney tissue, a kidney spheroid and / or a kidney organoid.. Fusion events refer to nephron-UB or nephron-CD fusion. In these methods, a WNT pathway can be activated in the organoid for a period of time. Wnt activation can be done either by small molecule activators (e.g. CHIR99021) or by inducible genetic expression of Wnt ligands (e.g. Wnt9b). For the latter, the Wnt ligand can be specifically expressed by the UB progenitors to create a WNT gradient and activate distal nephron fate in the tubules nearest the UB. The period of time can be, for example, for about, at least, or less than 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9 days. The period of time can start on about, at least on, or by day 0, 1, 2, 3, 4, 5, 6, 7 after mixing, for example, on days 2-6. In these methods, distal nephron tubules are increased by 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% or more compared to cells, a spheroid or an organoid grown without WNT activation at the period of time used. In these methods, fusion events are increased by at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% or more compared to cells, a spheroid or an organoid grown without WNT activation at the period of time used. In some embodiments, the WNT activator is used at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30uM, or any concentration within a range defined by any two of the aforementioned concentrations, including l-20uM, In some embodiments, the WNT activator is used at a concentration of lOpM.

[0280] In some embodiments, this method is combined with any of the other methods disclosed herein. For example, it is used in the co-culturing step in the method of preparing a kidney organoid.Method for inducing terminal maturation

[0281] Terminal maturation describes the induction of more mature or functional markers in the CD epithelium, which would be associated with potentially more advanced functional capability of the tissue.

[0282] Other methods of the disclosure relate to induction of terminal maturation in a nephron(s), nephron segment(s), nephron-like segment(s), and / or nephron-like tubule(s) inkidney cells, a kidney spheroid and / or a kidney organoid. In these methods, WNT, TGFB, and FGF / RTK signaling can be inhibited in the organoid to induce terminal maturation. WNT, TGFB, and FGF / RTK signaling can be inhibited with a WNT, TGFB, and / or FGF / RTK inhibitor for a period of time. The period of time can be, for example, for about, at least, or less than 0.5, 1, 1.5, 2, 2.5, 3, 3.5 days. The period of time can start on about, at least, or by day 0, 1, 2, 3, 4, 5, 6, 7 after mixing, for example, on days 4-6. In these methods, terminal maturation is increased by at least about 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60% or more compared to an organoid grown without WNT, TGFB, and / or FGF / RTK inhibition at the period of time used. In some embodiments, the WNT, TGFB, and / or FGF / RTK inhibitor is used at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30uM, or any concentration within a range defined by any two of the aforementioned concentrations, including l-20uM.

[0283] In some embodiments, this method for inducing terminal maturation is combined with any of the other methods disclosed herein. For example, it is used in the coculturing step in the method of preparing a kidney organoid.Comparison to Other Organoids in the Art

[0284] Disclosed herein is the first human kidney organoid system that contains segmented nephrons with distal tubules directly fused to AQP2+CDs. The disclosed organoids can contain at least 33% nephron epithelial cells, for example at least 30%, 33%, 35%, 40%, 45%, 50%, 55%, 60% or 62.1% or more, or any derivable range in between. The disclosed organoids can include at least about 3%-20.1% ureteric epithelium (UrEp), for example 3%, 4%, 4.4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 20.1% of any derivable range in between. The disclosed organoids can include less than about 47% stroma cells, for example, 47%, 47.76%, 45%, 40%, 35%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22.38% or any derivable range in between. The disclosed organoids can contain less than 1.5% NPC-like cells, for example less than 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, or any derivable range in between. The disclosed organoids can contain between 0.01% - 0.37% endothelial cells, for example about 0.01% - 0.37%, 0.01%-0.3%, 0.01%-0.2%,0.01 %-0.2% or about 1.5%, 1.4%, 1.3%, 1.2%, 1.1 %, 1.0%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, or any derivable range in between.

[0285] Among the epithelial cell types, the disclosed organoids can contain at least 9.60% podocytes, for example at least about 9.6%, 10%, 15%, 20%, 21%, 22% or more or any derivable range in between. Among the epithelial cell types, the disclosed organoids can contain at least 17.13% prox tubule cells, for example at least about 17.13%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 23.77% or more or any derivable range in between. Among the epithelial cell types, the disclosed organoids can contain at least 8.5% distal tubule cells, for example at least about 8.5%, 9.0%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.36% or more or any derivable range in between. Among the epithelial cell types, the disclosed organoids can contain between about 1.78% - 5.13% LOH / TAL cells. Among the epithelial cell types, the disclosed organoids can contain between about 1.35%- 17.17% collecting duct cells.

[0286] Expression of functional markers of segment differentiation is higher than other organoids known in the art. Notably, the proximal tubule marker SEC34A1 can be robustly expressed in the disclosed organoids and either absent or modest in others. Expression of principal cell markers, such as AQP2, SCNN1G, and NR3C2, in the CDs is highest in the disclosed organoids.Markers

[0287] Various markers are applicable to the methods described herein.

[0288] One or more NM progenitor markers can be used. Such markers include, but are not limited to, SIX1, SIX2. CITED1, WT1 and / or any other marker that indicates that cells will differentiate into nephron segments including podocytes, proximal tubules, loops of Henle, and distal tubules.

[0289] One or more UB tip progenitor markers can be used. These markers mark cells destined to become distal tubules. Such markers include, but are not limited to, RET, GAT A3, PAX2, ETV4, ETV5, WNTI I, SOX9, and / or any other marker that mark cells that will form UB tubules, UB stalks and / or CDs.

[0290] One or more markers of nephron induction can be used. Such markers include, but arc not limited to, LHX1, JAG1, PAX8 and / or the like.

[0291] One or more markers for nephron segmentation can be used. Such markers include, but are not limited to, NPHS1 (podocyte marker), NPHS2 (podocyte marker), HNF4A (marker for proximal tubules), SLC12A1 (marker for loop of Henle segments) and / or the like.,

[0292] One or more markers for distal domain / tubules of nephrons can be used. Such markers include, but are not limited to, GATA3, TFAP2A, TFAP2B, SOX9, LGR5, CALB1, CDH1, and / or any other marker that indicates that cells will fuse to UB ducts / CDs.

[0293] One or more markers of a proximal domain / tubules can be used. Such markers include, but are not limited to, HNF4A, CDH6, WT1, LRP2, LTL, SLC34A1, SLC3A1 and / or the like.

[0294] One or more stalk progenitor markers can be used. Such markers include, but are not limited to, WNT9B, HNF1B, CALB1, and / or any other marker that mark cells destined to become CDs.

[0295] One or more CD markers can be used. These markers indicate formation of a CD. Such markers include, but are not limited to, ELF5 (transcription factor), CALB1, AQP2 (water channel) and SCNN1B (sodium channel subunit), and / or the like.Media

[0296] Various media are applicable to the methods described herein.

[0297] A basic differentiation media (BDM)can be used. This media typically includes any cell culture medium commondly used to culture mammalian cells. For example, RPMI supplemented with GlutaMAX (e.g., Advanced RPMI 1640, 1% GlutaMAX). Such media can be used at any time throughout the methods disclosed herein.

[0298] A “mix media” can include BDM and supplemental proteins and growth factors to support cell growth. As an example, a mix media can include BDM and fetal bovine serum, Knockout Serum Replacement, and / or the like. For example, BDM and 10% FBS or knockout serum replacement. Such media can be used from days 0-10 of the methods disclosed herein, and optional days 10-14 and beyond.

[0299] A “UB media” can be optionally used. This media can include BDM, GDNF, FGF10, A83-01, LDN193189, Retinoic acid (RA), and / or CHIR99021. This media is optionally used at about days 0-10 of the methods disclosed herein.

[0300] A “CD media” can be used to induce CD maturation. The media can include BDM and any hormone that can induce CD maturation, for example, but not limited to arginine vasopressin and / or aldosterone. This can be used at about days 10-14 of the methods disclosed herein or at any terminal timepoint where induction of CD maturation is desired.

[0301] An “CD + AUX media” can be used. The media can include the “CD media” plus any inhibitor of WNT, TGFB, and / or FGF / RTK signaling pathways. For example the CD media and A83-01, U0126, and XAV939. This media can include at least one inhibitor of each of WNT, TGFB, and FGF / RTK signaling pathways. This can be used at about days 10-14 of the methods disclosed herein or at any terminal timepoint where induction of CD maturation is desired.Inhibitors and Activators

[0302] Various activators and inhibitors are applicable to the methods described herein. Pathways can be inhibited or activated by small molecules and / or inducible genetic expression. Non-limiting examples of small molecules are provided in the following table. Methods of inducible genetic expression are known in the art.Table 1

[0303] One or more FGF / RTK signaling pathway activators can be used. The FGF signaling pathway activator can be selected from the group consisting of FGF1, FGF2, FGF3, FGF4, FGF4, FGF 5, FGF6, FGF7, FGF8, FGF8, FGF9, FGF 10, FGF 11, FGF 12, FGF13, FGF 14, FGF 15, FGF 16, FGF 17, FGF 18, FGF 19, FGF20, FGF21 , FGF22, and FGF23. in some embodiments, the FGF signaling pathway activator is FGF4. In some embodiments, the FGF signaling pathway activator is contacted at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 ng / mL, or any concentration within a range defined by any two of the aforementioned concentrations, including 100-1000 ng / mL, 100-500 ng / mL, 500-1000 ng / mL, 250-750 ng / mL, or 400-600 ng / mL, In some embodiments, the FGF signaling pathway activator is contacted at a concentration of 500 ng / mL or about 500 ng / mL.

[0304] One or more Wnt signaling pathway activator can be used. The Wnt signaling pathway activator can be selected from the group consisting of Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, WntlOa, WntlOb, Wntl l, Wntl6, BML 284, IQ-1, WAY 262611, CHIR99021, CHIR98014, AZD2858, BIO, AR-A014418, SB 216763, SB 415286, aloisine, indirubin, alsterpaullone, kenpaullone, lithium chloride, TDZD 8, and TWS119. In some embodiments, the Wnt signaling pathway activator is CHIR99021. In some embodiments, the Wnt signaling pathway activator is contacted at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, or 3.5 mM, or any concentration within a range defined by any two of the aforementioned concentrations, including 0.5-3.5 mM, 0.5-2 mM, 2-3.5 mM, 1-3 mM, or 1.5-2.5 mM. In some embodiments, the Wnt signaling pathway activator is contacted at a concentration of 2 mM or about 2 mM.

[0305] One or more RA signaling pathway activator can be used. The RA signaling pathway activator can be selected from the group consisting of retinoic acid, all-trans retinoic acid, 9-eis retinoic acid, CD437, EC23, BS 493, TTNPB, and AMS 80. In some embodiments, the RA signaling pathway activator is RA. In some embodiments, the RA signaling pathway activator is contacted at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.9, or 3 mM, or any concentration within a range defined by any two of the aforementioned concentrations, including 1-3 mM, 1-2 mM, 2-3 mM, or 1.5-2.5 mM. In some embodiments, the RA signaling pathway activator is contacted at a concentration of 2 mM or about 2 mM.

[0306] Also disclosed herein are the kidney organoids produced by the methods provided herein.Characteristic of Kidney Organoids

[0307] Embodiments of the disclosure include kidney organoids derived from progenitor cells. The kidney organoids of the disclosure can one or more of the following characteristics: a) elongation of tubules of the UB, b) increase in expression of genes associated with UB stalk fate; c) formation of CD-like tubule and / or CD; d) formation of CD-like tubule and / or CD that are interconnected and spanned throughout the organoid; e) decrease in expression of progenitor markers of the UB progenitor and NM progenitor; f) formation of renal vesicles by the NM progenitor; g) polarization of NM; h) increase in expression of markers of nephron segment differentiation; i) formation of nephron, nephron segment, nephron like segment, and / or nephron-like tubule;j) differentiation of podocytes, proximal tubules, distal tubules and / or the like; polarization of nephrons; k) increased expression of distal tubule markers; increased expression of UB stalk fate markers or CD markers; l) expansion of a stromal compartment; direct connection of nephron, nephron segment, nephron like segment, and / or nephron-like tubule to a CD-like tubule and / or CD; m) formation of anastomoses between nephrons, nephron segments, nephron like segments, and / or nephron like tubules and CD-like tubule or CD; n) fusion of a nephron distal tubule to a UB duct; o) formation of uninterrupted epithelial structure across tubules; formation of continuous luminal membrane across the junctions of tubules; p) and / or the like.

[0308] Markers of nephron segment differentiation can include, but are not limited to, JAG1, CDH6, CDH1, WT1, POU3F3, MECOM, HNF4A, GATA3, and / or HNF1B.

[0309] Distal tubule markers can include, but are not limited to GATA3, TFAP2A, TFAP2B, SOX9, EGR5, CAEB1 and / or CDH1.

[0310] Markers of CD can include, but are not limited to EEF5, SCNN1B, SCNN1G, KCNJ1, AVPR2, and / or AQP2.

[0311] The nephron tubules arc formed from the NM progenitors and the CDs are formed from the UB progenitors.

[0312] In some embodiments, the organoid produced by the methods of the disclosure can have about 5-10 epithelial connections between a nephron and UB, for example, about 5, 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, or more epithelial connections between a nephron and UB, for example at least 20 connections by day 14.

[0313] In some embodiments, an organoid produced by the methods of the disclosure can have at least about 20 nephron-like structures, for example about 50-10,000 or more nephron-like structures. In some embodiments, an organoid produced by the methods of the disclosure can have at least about 5 CDs, for example about 10-200 CDs. In some embodiments, the size of the organoid can range from about 0.5mm- 12mm, for example, about 3-6mm in diameter.

[0314] In some embodiments, a mature organoid is produced. A mature kidney organoid can be described as an organoid that has matured to comprise epithelial structures representing various nephron segments including podocytes, proximal tubules, loops of Henle, and / or distal tubules. In other embodiments, a mature organoid can be defined as having functionality, the organoid produced by the methods of the disclosure is functional. The term functional can refer to the organoid being capable of carrying out a functional mechanism of a kidney in vivo, for example, the drainage of fluid, for example, distal drainage of fluid from nephrons.Kidney-Related Diseases and Disorders and Symptoms

[0315] The kidney organoids of the disclosure can be used in treatment and / or studying or modeling a kidney-related disease or disorder or symptom, for which their ability to recapitulate a collecting system is particularly advantageous and renders them applicable to a wide range of conditions. In some embodiments, the methods include administering any of the kidney organoids or kidney cell compositions disclosed herein. Also disclosed herein are the kidney organoids or kidney cell compositions disclosed herein for use in the manufacture of a medicament for the treatment of a kidney-related disease or symptom. Also disclosed herein are the kidney organoids or kidney cell compositions disclosed herein for use in the treatment of a kidney -related disease or symptom in a subject in need thereof.

[0316] As used herein, the term “kidney-related disease or disorder or symptom” refers to any disease or symptom that affects the kidney or renal system. Examples of kidney- related diseases include, but are not limited to, chronic kidney disease, primary kidney disease, non-diamerulonephritis, glomerulonephritis, interstitial nephritis, diabetic kidney disease, diabetic nephritis, thread. Glomerulonephritis, rapidly progressive glomerulonephritis, renal fibrosis, Alport syndrome, insulin-dependent diabetic (IDDM) nephritis, mesangium proliferative glomerulonephritis, membuloproliferative glomerulonephritis, meniclimatogenic glomerulonephritis, Interstitial nephritis, Focal segmental glomerulonephritis, Membranenephritis, Microvariant nephrosis syndrome, pauci-immune type rapidly progressive glomerulonephritis, IgA nephritis, Multiple cystic kidney, Dent disease , Nephritistinosis, Hayman nephritis, autosomal dominant (adult) multiple cystic kidneys, autosomal recessive (pediatric) multiple cystic kidneys, acute nephropathy, nephrosis syndrome, renal ischemitis,podocyte disease or disorder , Glomerulonephritis, glomerulonephritis, medullomerulonephritis, focal segmental glomerulonephritis, prcploncphritis, glomerulonephritis, kidney lesions, glomerulonephritis, benign orthostatic (positional) glomerulonephritis, IgM kidney Disease, medulronephritis, sarcoidosis, diabetes, drug-induced kidney damage, Fabry's disease, amino aciduria, Fanconi syndrome, hypertensive nephritis, interstitial nephritis, sickle erythema, hemoglobinuria, myoglobinuri Disease, Wegenerulonephritis, Type 1 glomerulonephritis, Chronic kidney disease, Chronic renal failure, low glomerulonephritis (GFR), renal vascular sclerosis, lupus nephritis, ANCA-positive pauci-immune type glomerulonephritis Glomerulonephritis, Chronic transplant nephropathy, Nephritisitis, Nephritisitis, Nephritisitis, Kidney injury, Glomerulonephritis and tubule damage, Renal dysfunction, Nephritis syndrome, Acute renal failure, Chronic renal failure, Proximal tubule dysfunction, Acute kidney transplant rejection, chronic kidney transplant rejection, non-IgA mesangial proliferative glomerulonephritis, post-infectious glomerulonephritis, vasitis with any type of nephropathy, any hereditary kidney disease, any interstitial Nephritis, kidney transplant failure, kidney cancer, kidney disease with other symptoms (eg, hypertension, diabetes, and autoimmune disease), dent disease, nephropathy, Hayman nephritis, primary kidney disease, collapse Glomerulonephritis, dense deposit disease, cryoglomerulonephritis-related glomerulonephritis, Henoch-Schoenlein's disease, post-infectious glomerulonephritis, bacterial endometriitis, micromicroangonephritis, Charg-Strauss syndrome, anti-GBM Antibody -mediated glomerulonephritis, amyloidosis, monoclonal immunoglobulin deposition, fibrillar thread Spheroid nephritis, immunotactoid glomerosis, ischemic tubule injury, drug-induced tubule interstitial nephritis, addictive tubulointerstitial nephritis, infectious tubulointerstitial nephritis, bacterial nephritis, poly Virus- infectious tubulointerstitial nephritis caused by Omavirus or HIV infection, metabolism-induced tubule interstitial disease, mixed connective tissue disease, columnar nephropathy, uric acid crystal or oxalate crystal or drug-induced crystal Crystalline nephropathy due to deposition, neoplastic invasive disease due to acute cellular tubulointerstitial allogeneic transplant rejection, lymphoma or post-transplant lymphoproliferative disorder, obstructive kidney disease, vascular disease, Thrombotic microangiopathy, renal vascular sclerosis, atherosclerotic disease, mixed connective tissue disease, nodular polyarteritis, carcinulin inhibitor-induced vascular disease, acute cellular vascular allogeneic transplant rejection, acute humoral allogeneic Transplantrejection, early renal dysfunction (ERFD), end-stage renal disease (ESRD), renal vein thrombosis, acute tubule necrosis, acute interstitial nephritis, existing chronic kidney disease, renal artery stenosis, ischemic Includes nephropathy, urinary toxicosis, drug-induced and toxic- induced chronic tubulointerstitial nephritis, reflux nephropathy, renal stones, Good Pasture syndrome, and hydronephropathy. One skilled in the art will appreciate other kidney -related diseases and conditions for which the kidney organoids or kidney cell compositions disclosed herein could have relevance.

[0317] For example, the kidney organoid can be transplanted into a subject having kidney dysfunction and / or failure, where the transplanted kidney organoids engraft onto the kidney of the subject. The organoid can be transplanted beneath the kidney capsule in a subject. Following transplantation, the subject can have increased survival rate and or alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of a disorder or disease, stabilization of state of disease, prevention of development of a disorder or disease, prevention of spread of a disorder or disease, delay or slowing of disorder or disease progression, delay or slowing of onset of a disorder or disease, amelioration or delay of a disorder or disease state, and remission (whether partial or total). The transplanted organoid can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more day organoid. For example, a day 3 organoid as described in the methods herein (3 days after the mixing step) can be used. The engrafted organoid can exhibit one or more of the following characteristics after a period of time such as about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days following transplantation: a) development of complex tissues comprising both renal parenchyma and an expanded stromal compartment; b) dense and robust growth of nephron tubules c) maturation of the glomeruli at the proximal end of the nephron d) well-organized glomerular structures including arrayed podocytes, interstitial or mesangial cells, and endothelial cells that form capillaries containing erythrocytes e) segmentation of nephrons, e.g., proximal tubules, loop of Henle segments, and distal connecting tubules; f) distal tubules connecting with CDs; g) and / or the like

[0318] In another aspect, the disclosure provides a method of making an artificial biological kidney device, the method comprising seeding the device with an organoid of the disclosure.

[0319] In another aspect, the disclosure provides a method of treating a kidney- related disease in a subject, the method comprising externally attaching an artificial biological kidney device comprising an organoid of the disclosure.

[0320] In another aspect, the disclosure provides for the use of an artificial biological kidney device comprising an organoid of the disclosure for treating a kidney-related disease in a subject in need thereof.

[0321] In another aspect, the disclosure provides the use of an organoid of the disclosure in the manufacture of an artificial biological kidney device for treating a kidney- related disease in a subject in need thereof.

[0322] In some embodiments of the methods and uses, the kidney-related disease comprises acute kidney injury, chronic kidney disease, end-stage kidney disease, renal disease (nephropathiy), diabetic nephropathy, nephropathy (nephrosis), breitz's disease, renal insufficiency, glomerulonephritis, glomerulosclerosis, or nephritis.

[0323] For example, these kidney organoids can be used an in vitro human model system for studying kidney cell function and developmental divergence, studying kidney-related disease, identifying and / or screening for therapeutic targets, identifying and / or screening for agents associated with kidney toxicity, and / or identifying therapeutic compounds and / or compositions effective in treating a kidney -related disease or disorder. Accordingly, the kidney organoids of the disclosure can allow for new developments in kidney disease treatment and study.Stem Cells

[0324] The term “totipotent stem cells” (also known as omnipotent stem cells) as used herein has its plain and ordinary meaning as understood in light of the specification and are stem cells that can differentiate into embryonic and extra-embryonic cell types. Such cells can construct a complete, viable organism. These cells are produced from the fusion of an egg and sperm cell. Cells produced by the first few divisions of the fertilized egg are also totipotent.

[0325] The term “embryonic stem cells (ESCs),” also commonly abbreviated as ES cells, as used herein has its plain and ordinary meaning as understood in light of the specification and refers to cells that are pluripotent and derived from the inner cell mass of the blastocyst, an early- stage embryo. For purpose of the present disclosure, the term "ESCs" is used broadly sometimes to encompass the embryonic germ cells as well.

[0326] The term “pluripotent stem cells (PSCs)” as used herein has its plain and ordinary' meaning as understood in light of the specification and encompasses any cells that can differentiate into nearly all cell types of the body, i.e., cells derived from any of the three germ layers (germinal epithelium), including endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), and ectoderm (epidermal tissues and nervous system), PSCs can be the descendants of inner cell mass cells of the preimplantation blastocyst or obtained through induction of a non-pluripotent cell, such as an adult somatic cell, by forcing the expression of certain genes. Pluripotent stem cells can be derived from any suitable source. Examples of sources of pluripotent stem cells include mammalian sources, including human, rodent, porcine, and bovine.

[0327] The term “induced pluripotent stem cells (iPSCs),” also commonly abbreviated as iPS cells, as used herein has its plain and ordinary meaning as understood in light of the specification and refers to a type of pluripotent stem cells artificially derived from a normally non-pluripotent cell, such as an adult somatic cell, by inducing a "forced" expression of certain genes. hiPSC refers to human iPSCs. In some methods known in the art, iPSCs may be derived by transfection of certain stem cell-associated genes into non-pluripotent cells, such as adult fibroblasts. Transfection may be achieved through viral transduction using viruses such as retroviruses or lentiviruses. Transfected genes may include the master transcriptional regulators Oct-3 / 4 (PUU5F1) and Sox2, although other genes may enhance the efficiency of induction. After 3-4 weeks, small numbers of transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and are typically isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. As used herein, iPSCs include first generation iPSCs, second generation iPSCs in mice, and human induced pluripotent stem cells. In some methods, a retroviral system is used to transform human fibroblasts into pluripotent stem cells using four pivotal genes: Oct3 / 4, Sox2, Klf4, and c-Myc.In other methods, a lentiviral system is used to transform somatic cells with GCT4, SOX2, NANOG, and LIN28. Genes whose expression arc induced in iPSCs include but arc not limited to Oct-3 / 4 (POU5F1); certain members of the Sox gene family (e.g., Soxl, Sox2, Sox3, and Soxl5); certain members of the Klf family (e.g., Klfl, Klf2, Klf4, and Klf5), certain members of the Mye family (e.g., C-myc, L-myc, and N- myc), Nanog, LIN28, Tert, Fbxl5, ERas, EC ATI 5- 1, ECAT15-2, Tell, b-Catenm, EC ATI, Esgi, Dnmt3L, EC ATS, Gdf3, FthlU, Sall4, Rexl, UTF1, Stella, Stat3, Grb2, Prdml4, Nr5al, Nr5a2, or E-cadherin, or any combination thereof.

[0328] The term “precursor cell” as used herein has its plain and ordinary meaning as understood in light of the specification and encompasses any cells that can be used in methods described herein, through which one or more precursor cells acquire the ability to renew itself or differentiate into one or more specialized cell types. In some embodiments, a precursor cell is pluripotent or has the capacity to becoming pluripotent. In some embodiments, the precursor cells are subjected to the treatment of external factors (e.g., growth factors) to acquire pluripotency. In some embodiments, a precursor cell can be a totipotent (or omnipotent) stem cell; a pluripotent stem cell (induced or non-induced); a multipotent stem cell; an oligopotent stem cells and a unipotent stem cell. In some embodiments, a precursor cell can be from an embryo, an infant, a child, or an adult. In some embodiments, a precursor cell can be a somatic cell subject to treatment such that pluripotency is conferred via genetic manipulation or protein / peptide treatment. Precursor cells include embryonic stem cells (ESC), embryonic carcinoma cells (ECs), and epiblast stem cells (EpiSC).

[0329] The term “progenitor” as used herein has its plain and ordinary meaning as understood in light of the specification and encompasses any cell that can differentiate into a specific cell type. Progenitor cells can be identified, for example, with markers.

[0330] In some embodiments, one step can include obtaining stem cells that are pluripotent or can be induced to become pluripotent. In some embodiments, pluripotent stem cells are derived from embryonic stem cells, which are in turn derived from totipotent cells of the early mammalian embryo and are capable of unlimited, undifferentiated proliferation in vitro. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of the blastocyst, an early-stage embryo. Methods for deriving embryonic stem cells from blastocytesare well known in the art. It would be understood by one of skill in the art that the methods and systems described herein arc applicable to any stem cells.

[0331] Additional stem cells that can be used in embodiments in accordance with the present disclosure include but are not limited to those provided by or described in the database hosted by the National Stem Cell Bank (NSCB), Human Embryonic Stem Cell Research Center at the University of California, San Francisco (UCSF); WISC cell Bank at the Wi Cell Research Institute; the University of Wisconsin Stem Cell and Regenerative Medicine Center (IJW- SCRMC); Novocell, Inc. (San Diego, Calif.); Cellartis AB (Goteborg, Sweden); ES Cell International Pte Etd (Singapore); Techmon at the Israel Institute of Technology (Haifa, Israel); and the Stem Cell Database hosted by Princeton University and the University of Pennsylvania. Exemplary embryonic stem cells that can be used in embodiments in accordance with the present disclosure include but are not limited to SA01 (SA001); SA02 (SA002); ESDI (HES-1); ES02 (HES-2); ES03 (HES-3); ES04 (HES-4); ES05 (HES-5); ES06 (HES-6); BG01 (BGN-01); BG02 (BGN-02); BG03 (BGN-03); TE03 (13); TE04 (14); TE06 (16); UCO1 (HSF1); UC06 (HSF6); WA01 (HI); WA07 (H7); WA09 (H9); WA13 (HI 3); WA14 (HI 4). Exemplary human pluripotent cell lines include but are not limited to TkDA3-4, 1231 A3, 317-D6, 317-A4, CDH1, 5-T-3, 3-34- 1, NAFLD27, NAFLD77, NAFLD150, WD90, WD91, WD92, 1.20012. C213, 1383D6, FF, or 317-12 cells.

[0332] In developmental biology, cellular differentiation is the process by which a less specialized cell becomes a more specialized cell type. As used herein, the term “directed differentiation” describes a process through which a less specialized cell becomes a particular specialized target cell type. The particularity of the specialized target cell type can be determined by any applicable methods that can be used to define or alter the destiny of the initial cell Exemplary methods include but are not limited to genetic manipulation, chemical treatment, protein treatment, and nucleic acid treatment.

[0333] In some embodiments, an adenovirus can be used to transport the requisite four genes, resulting in iPSCs substantially identical to embryonic stem cells. Since the adenovirus does not combine any of its own genes with the targeted host, the danger of creating tumors is eliminated, in some embodiments, non-viral based technologies are employed to generate iPSCs. In some embodiments, reprogramming can be accomplished via plasmid withoutany virus transfection system at all, although at very low efficiencies. In other embodiments, direct delivery of proteins is used to generate iPSCs, thus eliminating the need for viruses or genetic modification. In some embodiment, generation of mouse iPSCs is possible using a similar methodology: a repeated treatment of the cells with certain proteins channeled into the cells via poly-arginine anchors was sufficient to induce pluripotency. In some embodiments, the expression of pluripotency induction genes can also be increased by treating somatic cells with FGF2 under low oxygen conditions.

[0334] The term “feeder cell” as used herein has its plain and ordinary meaning as understood in light of the specification and refers to cells that support the growth of pluripotent stem cells, such as by secreting growth factors into the medium or displaying on the cell surface. Feeder cells are generally adherent cells and may be growth arrested. For example, feeder cells are growth-arrested by irradiation (e.g. gamma rays), mitomycin-C treatment, electric pulses, or mild chemical fixation (e.g. with formaldehyde or glutaraldehyde). However, feeder cells do not necessarily have to be growth arrested. Feeder cells may serve purposes such as secreting growth factors, displaying growth factors on the cell surface, detoxifying the culture medium, or synthesizing extracellular matrix proteins. In some embodiments, the feeder cells are allogeneic or xenogeneic to the supported target stem cell, which may have implications m downstream applications. In some embodiments, the feeder cells are mouse cells. In some embodiments, the feeder cells are human cells. In some embodiments, the feeder cells are mouse fibroblasts, mouse embryonic fibroblasts, mouse STO cells, mouse 3T3 cells, mouse SNL 76 / 7 cells, human fibroblasts, human foreskin fibroblasts, human dermal fibroblasts, human adipose mesenchymal cells, human bone marrow mesenchymal cells, human amniotic mesenchymal cells, human amniotic epithelial cells, human umbilical cord mesenchymal cells, human fetal muscle cells, human fetal fibroblasts, or human adult fallopian tube epithelial cells. In some embodiments, conditioned medium prepared from feeder cells is used in lieu of feeder cell co-culture or in combination with feeder cell co-culture. In some embodiments, feeder cells are not used during the proliferation of the target stem cells.Differentiation of PSCs

[0335] Known methods for producing UB progenitor(s) and NM progenitor(s) from pluripotent cells (e.g., iPSCs or ESCs) are applicable to the methods described herein. In someembodiments, pluripotent cells are derived from a morula. In some embodiments, pluripotent stem cells arc stem cells. Stem cells used in these methods can include, but arc not limited to, embryonic stem cells or induced pluripotent stem cells. Embryonic stem cells can be derived from the embryonic inner cell mass or from the embryonic gonadal ridges. Embryonic stem cells or germ cells can originate from a variety of animal species including, but not limited to, various mammalian species including humans. In some embodiments, human embryonic stem cells are used to produce UB progenitor(s) and NM progenitor(s). In some embodiments, human embryonic germ cells are used to produce UB progenitor(s) and NM progenitor(s). In some embodiments, iPSCs are used to produce UB progenitor(s) and NM progenitor(s). in some embodiments, human iPSCs (hiPSCs) are used to produce UB progenitor(s) and NM progenitor(s).

[0336] In some embodiments, PSCs, such as ESCs and iPSCs, undergo directed differentiation into embryonic germ layer cells, organ tissue progenitor cells, and then into tissue such as kidney tissue or any other biological tissue. In some embodiments, the directed differentiation is done in a stepwise manner to obtain each of the differentiated cell types where molecules (e.g. growth factors, ligands, agonists, antagonists) are added sequentially as differentiation progresses. In some embodiments, the directed differentiation is done in a nonstepwise manner where molecules (e.g. growth factors, ligands, agonists, antagonists) are added at the same time. In some embodiments, directed differentiation is achieved by selectively activating certain signaling pathways in the PSCs or any downstream cells.

[0337] In some embodiments, the embryonic stem cells or germ cells or iPSCs are treated with one or more small molecule compounds, activators, inhibitors, or growth factors for a time that is, is about, is at least, is at least about, is not more than, or is not more than about, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 84 hours, 96 hours, 120 hours, 150 hours, 180 hours, 240 hours, 300 hours or any time within a range defined by any two of the aforementioned times, for example 6 hours to 300 hours, 24 hours to 120 hours, 48 hours to 96 hours, 6 hours to 72 hours, or 24 hours to 300 hours, in some embodiments, more than one small molecule compounds, activators, inhibitors, or growth factors are added. In these cases, the more than one small molecule compounds, activators, inhibitors, or growth factors can be added simultaneously or separately.

[0338] In some embodiments, the embryonic stem cells or germ cells or iPSCs are treated with one or more small molecule compounds, activators, inhibitors, or growth factors at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 10 ng / mL, 20 ng / mL, 50 ng / mL, 75 ng / mL, 100 ng / mL, 120 ng / mL, 150 ng / mL, 200 ng / mL, 500 ng / mL, 1000 ng / mL, 1200 ng / mL, 1500 ng / mL, 2000 ng / mL, 5000 ng / mL, 7000 ng / niL, 10000 ng / mL, or 15000 ng / mL, or any concentration that is within a range defined by any two of the aforementioned concentrations, for example, 10 ng / mL to 15000 ng / mL, 100 ng / mL to 5000 ng / mL, 500 ng / mL to 2000 ng / mL, 10 ng / mL to 2000 ng / mL, or 1000 ng / mL to 15000 ng / mL. In some embodiments, concentration of the one or more small molecule compounds, activators, inhibitors, or growth factors is maintained at a constant level throughout the treatment. In some embodiments, concentration of the one or more small molecule compounds, activators, inhibitors, or growth factors is varied during the course of the treatment. In some embodiments, more than one small molecule compounds, activators, inhibitors, or growth factors are added. In these cases, the more than one small molecule compounds, activators, inhibitors, or growth factors can differ in concentrations.

[0339] In some embodiments, the ESCs or iPSCs, or the ESCs, germ cells, or iPSCs are cultured in growth media that supports the growth of stem cells. In some embodiments, the ESCs or iPSCs, or the ESCs, germ cells, or iPSCs, are cultured in stem cell growth media. In some embodiments, the stem cell growth media is RPMI 1640, DMEM, DMEM / F12, or Advanced DMEM / F12. In some embodiments, the stem cell growth media comprises fetal bovine serum (FBS). In some embodiments, the stem cell growth media comprises FBS at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0,6%, 0.7%, 0.8%, 0,9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%, or any percentage within a range defined by any two of the aforementioned concentrations, for example 0% to 20%, 0.2% to 10%, 2% to 5%, 0% to 5%, or 2% to 20%. In some embodiments, the stem cell growth media does not contain xenogeneic components. In some embodiments, the growth media comprises one or more small molecule compounds, activators, inhibitors, or growth factors.

[0340] In some embodiments, pluripotent stem cells are prepared from somatic cells. In some embodiments, pluripotent stem cells arc prepared from biological tissue obtained from a biopsy. In some embodiments, the pluripotent stem cells are cryopreserved. In some embodiments, the somatic cells are cryopreserved. In some embodiments, pluripotent stem cells are prepared from PBMCs. In some embodiments, human PSCs are prepared from human PBMCs. In some embodiments, pluripotent stem cells are prepared from cryopreserved PBMCs. In some embodiments, PBMCs are grown on a feeder cell substrate. In some embodiments, PBMCs are grown on a mouse embryonic fibroblast (MEF) feeder cell substrate. In some embodiments, PBMCs are grown on an irradiated MEF feeder cell substrate.

[0341] In some embodiments, stem cells are treated with one or more growth factors to differentiate to a primitive streak-like fate, anterior intermediate mesoderm, downstream kidney cell types, UB spheroids, or NM. Such growth factors can include growth factors from the TGF-beta superfamily. In some embodiments, the one or more growth factors comprise the Nodal / Activin and / or the BMP subgroups of the TGF-beta superfamily of growth factors. In some embodiments, the one or more growth factors are selected from the group consisting of Nodal, Activin A, Activin B, BMP4, Wnt3a or combinations of any of these growth factors. In some embodiments, the stem cells are contacted with Activin A. In some embodiments, the stem cells are contacted with Activin A and BMP4.

[0342] It will be understood by one of skill in the ait that altering the concentration, expression or function of one or more Wnt signaling proteins in combination with altering the concentration, expression, or function of one or more FGF proteins can give rise to directed differentiation in accordance with the present disclosure. In some embodiments, cellular constituents associated with the FGF, Wnt, or retinoic acid (RA) signaling pathways, or with the FGF, Wnt, BMP, or retinoic acid (RA) signaling pathways, for example, natural inhibitors, antagonists, activators, or agonists of the pathways can be used to result in inhibition or activation of the FGF, Wnt, or retinoic acid signaling pathways, or of the FGF, Wnt, BMP, or retinoic acid signaling pathways. In some embodiments, siRNA and / or shRNA targeting cellular constituents associated with the FGF, Wnt, or retinoic acid signaling pathways, or the FGF, Wnt, BMP, or retinoic acid signaling pathways, are used to inhibit or activate these pathways.

[0343] In some embodiments, pluripotent stem cells, pluripotent stem cells, cells with primitive strcak-likc fate, anterior intermediate mesoderm, downstream kidney cell types, UB spheroids, or NM are contacted with a Wnt signaling pathway activator or Wnt signaling pathway inhibitor. In some embodiments, the Wnt signaling pathway activator comprises a Wnt protein, in some embodiments, the Wnt protein comprises a recombinant Wnt protein. In some embodiments, the Wnt signaling pathway activator comprises Wntl, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, WntSa, WntSb, Wnt6, Wnt7a, Wnt7b, Wnt8a, WntSb, Wnt9a, Wnt9b, WntlOa, WntlOb, Wntl l Wntl6, BML 284, IQ-1, WAY 262611, or any combination thereof. In some embodiments, the Wnt signaling pathway activator comprises a GSK3 signaling pathway inhibitor. In some embodiments, the Wnt signaling pathway activator comprises CHIR99Q21, CfflR 98014, AZD2858, BIO, AR-A014418, SB 216763, SB 415286, aloisine, indirubin, alsterpaullone, kenpauilone, lithium chloride, TDZD 8, or TWS119, or any combination thereof. In some embodiments, the Wnt signaling pathway inhibitor comprises C59, PNU 74654, KY- 02111, PRI-724, FH-535, DIF-1, or XAV939, or any combination thereof. In some embodiments, the cells are not treated with a Wnt signaling pathway activator or Wnt signaling pathway inhibitor. The Wnt signaling pathway activator or Wnt signaling pathway inhibitor provided herein may be used in combination with any of the other growth factors, signaling pathway activators, or signaling pathway inhibitors provided herein.

[0344] In some embodiments, pluripotent stem cells, cells with primitive streak- like fate, anterior intermediate mesoderm, downstream kidney cell types, UB spheroids, or NM are contacted with an FGF signaling pathway activator. In some embodiments, the FGF signaling pathway activator comprises an FGF protein. In some embodiments, the FGF protein comprises a recombinant FGF protein. In some embodiments, the FGF signaling pathway activator comprises one or more of FGF1 , FGF2, FGF3, FGF4, FGF4, FGF 5, FGF6, FGF7, FGF 8, FGF8, FGF9, FGF 10, FGF11, FGF 12, FGF 13, FGF 14, FGF 15 (FGF 19, FGF15 / FGF19), FGF 16, FGF 17, FGF 18, FGF20, FGF21, FGF22, or FGF23. In some embodiments, the cells are not treated with an FGF signaling pathway activator. The FGF signaling pathway activator provided herein may be used in combination with any of the other growth factors, signaling pathway activators, or signaling pathway inhibitors provided herein.

[0345] In some embodiments, pluripotent stem cells, cells with primitive streak-like fate, anterior intermediate mesoderm, downstream kidney cell types, UB spheroids, or NM arc contacted with a retinoic acid signaling pathway activator or retinoic acid signaling pathway inhibitor. In some embodiments, the retinoic acid signaling pathway activator comprises retinoic acid, all-trans retinoic acid, 9-cis retinoic acid, CD437, EC23, BS 493, TTNPB, or AM580, or any combination thereof, in some embodiments, the retinoic acid signaling pathway inhibitor comprises guggulsterone. In some embodiments, the cells are not treated with a retinoic acid signaling pathway activator or retinoic acid signaling pathway inhibitor. The retinoic acid signaling pathway activator or retinoic acid signaling pathway inhibitor provided herein may be used in combination with any of the other growth factors, signaling pathway activators, or signaling pathway inhibitors provided herein.

[0346] In some embodiments, iPSCs are expanded in cell culture. In some embodiments, pluripotent stem cells are expanded in a basement membrane matrix. In some embodiments, iPSCs are expanded in Matrigel, In some embodiments, the iPSCs are expanded in cell culture comprising a ROCK inhibitor (e.g. Y-27632) prior to differentiation.

[0347] In some embodiments, the iPSCs are differentiated into a primitive streak-like fate by contacting the iPSCs with CHIR, Activin A, BMP4, FGF2, and / or the like. In some embodiments, the iPSCs are contacted with a concentration of CHIR that is, is about, is at least, is at least about, is not more than, or is not more than about, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration of CHIR within a range defined by any two of the aforementioned concentrations, for example, 1 to 200 ng / mL, 1 to 150 ng / mL, 5 to 100 ng / mL, or 10 to 100 ng / mL. In some embodiments, the pluripotent stem cells are contacted with CHIR at a concentration of 50 ng / mL or about 50 ng / mL. In some embodiments, the iPSCs are contacted with a concentration of Activin A that is, is about, is at least, is at least about, is not more than, or is not more than about, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration of Activin A within a range defined by any two of the aforementioned concentrations, for example, 1 to 200 ng / mL, 2 to 150 ng / mL, 5 to 100 ng / mL, or 5 to 50 ng / mL. In some embodiments, the pluripotent stem cells are contacted with Activin A at a concentration of 25 ng / mL or about 25 ng / mL. In some embodiments, the iPSCs are contacted with aconcentration of BMP4 that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration of BMP4 within a range defined by any two of the aforementioned concentrations, for example, 1 to 200 ng / mL, 2 to 150 ng / mL, 5 to 100 ng / mL, or 5 to 50 ng / mL. In some embodiments, the pluripotent stem cells are contacted with BMP4 at a concentration of 25 ng / mL or about 25 ng / mL. In some embodiments, the iPSCs are contacted with a concentration of FGF that is, is about, is at least, is at least about, is not more than, or is not more than about, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 ng / mL, or any concentration of FGF within a range defined by any two of the aforementioned concentrations, for example, 1 to 200 ng / mL, 2 to 150 ng / mL, 5 to 100 ng / mL, or 5 to 50 ng / mL. In some embodiments, the pluripotent stem cells are contacted with FGF at a concentration of 25 ng / mL or about 25 ng / mL.

[0348] In some embodiments, the PSCs differentiated into a primitive streak-like fate are differentiated into anterior intermediate mesoderm by contacting the PSCs with FGF2, LDN193189, RA, and / or the like. In some embodiments, the anterior mesoderm is differentiated into a UB spheroid(s) by contacting the anterior mesoderm with FGF9 and RA.

[0349] In some embodiments, the PSCs are differentiated into nephrogenic mesenchyme by contacting the PSCs with CHIR, Noggin, and / or the like for a first period of time and then Activin A, FGF9, and / or the like for a second period of time. The cells can be disassociated before and / or after differentiation.

[0350] In some embodiments, any of the cells disclosed herein may be cryopreserved for later use. The cells can be cryoprcscrvcd according to methods generally known in the art, optionally including one or more cryoprotectants.

[0351] Cryoprotectants are cell composition additives to improve efficiency and yield of low temperature cryopreservation by preventing formation of large ice crystals. Cryoprotectants include but are not limited to DMSO, ethylene glycol, glycerol, propylene glycol, trehalose, formamide, methyl-formamide, dimethyl-formamide, glycerol 3 -phosphate, proline, sorbitol, diethyl glycol, sucrose, triethylene glycol, polyvinyl alcohol, polyethylene glycol, or hydroxy ethyl starch. Cryoprotectants can be used as part of a cryopreservation medium, which include other components such as nutrients (e.g. albumin, serum, bovine serum,fetal calf serum (FCS)) to enhance post-thawing survivability of the cells, in these cry opreservation media, at least one cryoprotectant may be found at a concentration that is, is about, is at least, is at least about, is not more than, or is not more than about, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or any percentage within a range defined by any two of the aforementioned numbers.Gene Editing

[0352] Embodiments of the disclosure can include PSCs, iPSCs, UB progenitor cells, NM progenitor cells, NM spheroids, or organoids which have been or which can be genetically modified or edited according to methods known in the art. For example, gene editing using CRISPR nucleases such as Cas9 are explored in PCT Publications WO 2013 / 176772, WO 2014 / 093595, WO 2014 / 093622, WO 2014 / 093655, WO 2014 / 093712, WO 2014 / 093661, WO 2014 / 204728, WO 2014 / 204729, WO 2015 / 071474, WO 2016 / 115326, WO 2016 / 141224, WO 2017 / 023803, and WO 2017 / 070633, each of which is hereby expressly incorporated by reference in its entirety.Pharmaceutical Compositions

[0353] Embodiments of the disclosure can include pharmaceutical compositions. Such pharmaceutical compositions can include one or more additional pharmaceutically acceptable components, which can include carriers, excipients, and / or stabilizers that are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed or that have an acceptable level of toxicity. A “pharmaceutically acceptable” “diluent,” “excipient,” and / or “carrier” as used herein have their plain and ordinary meaning as understood in light of the specification and are intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with administration to humans, cats, dogs, or other vertebrate hosts. Typically, a pharmaceutically acceptable diluent, excipient, and / or carrier is a diluent, excipient, and / or earner approved by a regulatory agency of a Federal, a state government, or other regulatory agency, or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, including humans as well as non-human mammals, such as cats and dogs. The term diluent, excipient, and / or “carrier” can refer to a diluent, adjuvant, excipient,or vehicle with which the pharmaceutical composition is administered. Such pharmaceutical diluent, excipient, and / or earners can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin. Water, saline solutions and aqueous dextrose and glycerol solutions can be employed as liquid diluents, excipients, and / or carriers, particularly for injectable solutions. Suitable pharmaceutical diluents and / or excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. A non-limiting example of a physiologically acceptable carrier is an aqueous pH buffered solution. The physiologically acceptable carrier may also comprise one or more of the following: antioxidants, such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin, gelatin, immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, ammo acids, carbohydrates such as glucose, mannose, or dextrins, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, saltforming counterions such as sodium, and nonionic surfactants such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®. The composition, if desired, can also contain minor amounts of wetting, bulking, emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, sustained release formulations and the like. The formulation should suit the mode of administration.

[0354] Additional excipients with desirable properties include but are not limited to preservatives, adjuvants, stabilizers, solvents, buffers, diluents, solubilizing agents, detergents, surfactants, chelating agents, antioxidants, alcohols, ketones, aldehydes, ethylenediaminetetraacetic acid (EDTA), citric acid, salts, sodium chloride, sodium bicarbonate, sodium phosphate, sodium borate, sodium citrate, potassium chloride, potassium phosphate, magnesium sulfate sugars, dextrose, fructose, mannose, lactose, galactose, sucrose, sorbitol, cellulose, serum, amino acids, polysorbate 20, polysorbate 80, sodium deoxycholate, sodium taurodeoxycholate, magnesium stearate, octylphenol ethoxylate, benzethonium chloride, thimerosal, gelatin, esters, ethers, 2-phenoxyethanol, urea, or vitamins, or any combination thereof. Some excipients may be in residual amounts or contaminants from the process of manufacturing, including but not limited to serum, albumin, ovalbumin, antibiotics, inactivating agents, formaldehyde, glutaraldehyde, b-propiolactone, gelatin, cell debris, nucleic acids,peptides, ammo acids, or growth medium components or any combination thereof. The amount of the excipient may be found in composition at a percentage that is, is about, is at least, is at least about, is not more than, or is not more than about, 0%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% w / w or any percentage by weight in a range defined by any two of the aforementioned numbers.

[0355] Pharmaceutical compositions can include one or more “pharmaceu tic ally acceptable salts”, which can include relatively non-toxic, inorganic and organic acid, or base addition salts of compositions or excipients, including without limitation, analgesic agents, therapeutic agents, other materials, and the like. Examples of pharmaceutically acceptable salts include those derived from mineral acids, such as hydrochloric acid and sulfuric acid, and those derived from organic acids, such as ethanesulfonic acid, benzenesulfonic acid, p- toluenesulfonic acid, and the like. Examples of suitable inorganic bases for the formation of salts include the hydroxides, carbonates, and bicarbonates of ammonia, sodium, lithium, potassium, calcium, magnesium, aluminum, zinc, and the like. Salts may also be formed with suitable organic bases, including those that are non-toxic and strong enough to form such salts. For example, the class of such organic bases may include but are not limited to mono-, di-, and trialkylamines, including methylamine, dimethylamine, and triethylamine; mono-, di-, or trihydroxyalkylamines including mono-, di-, and triethanolamine; ammo acids, including glycine, arginine and lysine; guanidine; N-methylglucosamine; N-methylglucamine; L-glutamine; N-methylpiperazine; morpholine; ethylenediamine; N-benzylphenethylamine; trihydroxymethyl ammoethane.

[0356] Proper formulation is dependent upon the route of administration chosen. Techniques for formulation and administration of the compounds described herein are known to those skilled in the ait. Multiple techniques of administering a compound exist in the ait including, but not limited to, enteral, oral, rectal, topical, sublingual, buccal, intraaural, epidural, epicutaneous, aerosol, parenteral delivery, including intramuscular, subcutaneous, intra-arterial, intravenous, intraportal, intra-articular, intradermal, peritoneal, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal or intraocular injections. Pharmaceutical compositions will generally be tailored to the specific intended route of administration.

[0357] As used herein, a “carrier” has its plain and ordinary meaning as understood in light of the specification and can refer to a compound, particle, solid, semi- solid, liquid, or diluent that facilitates the passage, delivery and / or incorporation of a compound to cells, tissues and / or bodily organs.

[0358] As used herein, a “diluent” has its plain and ordinary meaning as understood in light of the specification and can refer to an ingredient in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desirable. For example, a diluent may be used to increase the bulk of a potent drug whose mass is too small for manufacture and / or administration. It may also be a liquid for the dissolution of a drug to be administered by injection, ingestion or inhalation. A common form of diluent in the ail is a buffered aqueous solution such as, without limitation, phosphate buffered saline that mimics the composition of human blood.Dosage and Administration Routes

[0359] Embodiments of the disclosure can include methods of administering or treating an animal, which can involve administering an amount of at least one treatment, that is effective to treat the disease, condition, or disorder that the organism has, or is suspected of having, or is susceptible to, or to bring about a desired physiological effect. In some embodiments, the disease, condition, or disorder can be a kidney-related disease or disorder.

[0360] In some embodiments, at least one treatment can include a composition or pharmaceutical composition, which can be administered to an animal (e.g., mammals, primates, monkeys, or humans) in an amount of about 0.005 to about 50 mg / kg body weight, about 0.01 to about 15 mg / kg body weight, about 0.1 to about 10 mg / kg body weight, about 0.5 to about 7 mg / kg body weight, about 0.005 mg / kg, about 0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 3 mg / kg, about 5 mg / kg, about 5.5 mg / kg, about 6 mg / kg, about 6.5 mg / kg, about 7 mg / kg, about 7.5 mg / kg, about 8 mg / kg, about 10 mg / kg, about 12 mg / kg, or about 15 mg / kg. In regard to some conditions, the dosage can be about 0.5 mg / kg human body weight or about 6.5 mg / kg human body weight. In some instances, some subjects (e.g., mammals, mice, rabbits, feline, porcine, or canine) can be administered a dosage of about 0.005 to about 50 mg / kg body weight, about 0.01 to about 15 mg / kg body weight, about 0.1 to about 10 mg / kg body weight, about 0.5 to about 7 mg / kg body weight, about 0.005 mg / kg, about0.01 mg / kg, about 0.05 mg / kg, about 0.1 mg / kg, about 1 mg / kg, about 5 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, about 50 mg / kg, about 80 mg / kg, about 100 mg / kg, or about 150 mg / kg. Of course, those skilled in the ait will appreciate that it is possible to employ many concentrations in the methods of the present disclosure, and using, in part, the guidance provided herein, will be able to adjust and test any number of concentrations in order to find one that achieves the desired result in a given circumstance. In some embodiments, a dose or a therapeutically effective dose of a compound disclosed herein will be that which is sufficient to achieve a plasma concentration of the compound or its active metabolite(s) within a range set forth herein, e.g., about 1-10 nM, 10-100 nM, 0.1-1 pM, 1-10 pM, 10-100 pM, 100-200 pM, 200-500 pM, or even 500-1000 pM, preferably about 1-10 nM, 10-100 nM, or 0.1-1 pM.

[0361] In other embodiments, a treatment can be administered in combination with one or more other therapeutic agents for a given disease, condition, or disorder.

[0032] The compounds and pharmaceutical compositions are preferably prepared and administered in dose units. Solid dose units are tablets, capsules and suppositories. For treatment of a subject, depending on activity of the compound, manner of administration, nature and severity of the disease or disorder, age and body weight of the subject, different daily doses can be used.

[0363] Under certain circumstances, however, higher or lower daily doses can be appropriate. The administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administrations of subdivided doses at specific intervals.

[0364] A treatment can be administered locally or systemically in a therapeutically effective dose. Amounts effective for this use will, of course, depend on the severity of the disease or disorder and the weight and general state of the subject. Typically, dosages used in vitro can provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models can be used to determine effective dosages for treatment of particular disorders.

[0365] Various considerations are described, e. g. , in Langer, 1990, Science, 249: 1527; Goodman and Gilman's (eds.), 1990, Id., each of which is herein incorporated by reference and for all purposes. Dosages for parenteral administration of active pharmaceutical agents canbe converted into corresponding dosages for oral administration by multiplying parenteral dosages by appropriate conversion factors. As to general applications, the parenteral dosage in mg / mL times 1.8 = the corresponding oral dosage in milligrams (“mg”). As to oncology applications, the parenteral dosage in mg / mL times 1.6 = the corresponding oral dosage in mg. An average adult weighs about 70 kg. See e.g., Miller-Keane, 1992, Encyclopedia & Dictionary of Medicine, Nursing & Allied Health, Sth Ed., (W. B. Saunders Co.), pp.1708 and 1651.

[0366] It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.

[0367] In some embodiments, the administration can include a unit dose of one or more treatments in combination with a pharmaceutically acceptable carrier and, in addition, can include other medicinal agents, pharmaceutical agents, carriers, adjuvants, diluents, and excipients. In certain embodiments, the carrier, vehicle or excipient can facilitate administration, delivery and / or improve preservation of the composition. In other embodiments, the one or more carriers, include but are not limited to, saline solutions such as normal saline, Ringer's solution, PBS (phosphate-buffered saline), and generally mixtures of various salts including potassium and phosphate salts with or without sugar additives such as glucose. Carriers can include aqueous and non-aqueous sterile injection solutions that can contain antioxidants, buffers, bacteriostats, bactericidal antibiotics, and solutes that render the formulation isotonic with the bodily fluids of the intended recipient; and aqueous and non-aqueous sterile suspensions, which can include suspending agents and thickening agents. In other embodiments, the one or more excipients can include, but are not limited to water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. Nontoxic auxiliary substances, such as wetting agents, buffers, or emulsifiers may also be added to the composition. Oral formulations can include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate.

[0275] The quantity of active component in a unit dose preparation can be varied or adjusted from 0.1 mg to 10000 mg, more typically 1.0 mg to 1000 mg, most typically 10 mg to 500 mg, according to theparticular application and the potency of the active component. The composition can, if desired, also contain other compatible therapeutic agents.

[0368] A treatment can be administered to subjects by any number of suitable administration routes or formulations. The treatment, such as an immunotherapy, can also be used to treat subjects for a variety of diseases. Subjects include but are not limited to mammals, primates, monkeys (e.g., macaque, rhesus macaque, or pig tail macaque), humans, canine, feline, bovine, porcine, avian (e.g., chicken), mice, rabbits, and rats. In particular embodiments described herein, the subject is a human.

[0369] The route of administration of the compounds of the treatments described herein can be of any suitable route. Administration routes can be, but are not limited to the oral route, the parenteral route, the cutaneous route, the nasal route, the rectal route, the vaginal route, and the ocular route. In other embodiments, administration routes can be parenteral administration, a mucosal administration, intravenous administration, subcutaneous administration, topical administration, intradermal administration, oral administration, sublingual administration, intranasal administration, or intramuscular administration. The choice of administration route can depend on the compound identity (e.g., the physical and chemical properties of the compound) as well as the age and weight of the animal, the particular disease (e.g., type of cancer), and the severity of the disease (e.g., stage or severity of cancer). Of course, combinations of administration routes can be administered, as desired.

[0370] Some embodiments of the disclosure include a method for providing a subject with a treatment which comprises one or more administrations of one or more compositions; the compositions may be the same or different if there is more than one administration.Toxicity

[0371] The ratio between toxicity and therapeutic effect for a particular treatment is its therapeutic index and can be expressed as the ratio between LD50 (the amount of compound lethal in 50% of the population) and ED50 (the amount of compound effective in 50% of the population). Compounds that exhibit high therapeutic indices are preferred. Therapeutic index data obtained from in vitro assays, cell culture assays and / or animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds preferably lies within a range of plasma concentrations that include the ED50 with little or no toxicity. Thedosage can vary within this range depending upon the dosage form employed and the route of administration utilized. Sec, c.g. Fingl ct al.. In: THE PHARMACOLOGICAL BASIS OF THERAPEUTICS, Ch.l, p.l, 1975. The exact formulation, route of administration, and dosage can be chosen by the individual practitioner in view of the patient’s condition and the particular method in which the compound is used. For in vitro formulations, the exact formulation and dosage can be chosen by the individual practitioner in view of the patient’s condition and the particular method in which the compound is used.

[0372] Having described the disclosure in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.EXAMPLES

[0373] The following non-limiting examples are provided to further illustrate embodiments of the disclosure disclosed herein. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches that have been found to function well in the practice of the disclosure, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar’ result without departing from the spirit and scope of the disclosure.EXAMPLE 1Materials and MethodsHuman PSC lines and cultureCell lines

[0374] hPSC lines used in a study included H9 (WA09; obtained from WiCell), Hl (WA01; obtained from WiCell), and iPSC72-3 (generated and supplied by the Pluripotent Stem Cell Facility at Cincinnati Children’s Hospital Medical Center). The GATA3-mScarlet hESC line was made in H9 cells as previously described!6, and the HNF4A-mScarlet reporter cell linewas similarly created in H9 cells (methods below). The constitutively GFP-expressing cells used for the majority of UB differentiations were iPSC72-3 cells with a CAG-GFP construct inserted in the AAVS1 locus38. The AQP2-mScarlet line was generated in the parental 1PSC72-3 line per the methods described below.Maintenance culture

[0375] The hPSCs were maintained in feeder-free conditions on Cultrex Stem Cell Qualified Reduced Growth Factor Basement Membrane Extract (Bio-techne, 3434-010-02) in mTeSRl media (STEMCELL Technologies, 05850) using six-well tissue culture plates (Falcon, 353046) in a 37 °C incubator with 5% CO2. The hPSCs were routinely passaged in small colonies by Gentle Cell Dissociation Reagent (STEMCELL Technologies, 07174) at a 1:8 split ratio every 4-5 days. Studies involving hESCs were reviewed and approved by the CCHMC Institutional Biosafety Committee (IBC2022-0067) and Embryonic Stem Cell Research Oversight committee (EIP220147).Generation of HNF 4 A-mScarlet reporter cell line

[0376] To construct a donor template plasmid, left (981 bp) and right (961 bp) homology arms flanking the HNF4A stop codon were amplified by PCR (iProof, BioRad) from human genomic DNA isolated from H9 undifferentiated hESCs. The forward and reverse primers for the left homology arm were 5’- aaagcttggtaccggatccgGAAGCCATTGTTGGGATGAG-3’ (SEQ ID No. 1) and 5’- acagggagaagttagtggcgccGATAACTTCCTGCTTGGTGATG-3’(SEQ ID No. 2), with the highlighted portion representing plasmid homologous sequence used in subsequent HIFI cloning. The left and right primers for the right homology am were 5- attatacgaagttatgagctCAAGCCGCTGGGGCTTG-3’ (SEQ ID No. 3) and 5’- gccatggcctgcagggagctATCATCCCTCTCCCACACCA-3’ (SEQ ID No. 4). The PCR fragments were purified and cloned into pUC57 vector flanking a P2A-mScarlet and PGK-HygroR cassettes. The pX458 plasmid (Addgene 48138, kindly provided by Feng Zhang) was used to deliver Cas9 and guide RNA (gRNA) targeting the 3’ side of the HNF4A stop codon. To introduce the gRNA, the forward and reverse oligonucleotides (5’-CACCGAGTTATCTAGCAAGCCGCTG-3’ (SEQ ID No. 5) and 5’- aaacCAGCGGCTTGCTAGATAACTC-3’ (SEQ ID No. 6), respectively) were annealed and ligated into Bbsl-digested pX458 plasmid. Plasmid sequences were verified using Sanger sequencing.

[0377] The donor template and Cas9 / gRNA plasmids were reverse transfected into H9 hESCs using TransIT-LTl (Mirus) according to manufacturer recommendations. Prior to transfection, H9 cells were dissociated with Accutase (Stem Cell Technologies) and plated into 6-well plates in mTeSRl with ROCK inhibitor Y-27632 (10 pM; Cayman Chemical) at a concentration of 1.0 x 106 cells per well. Beginning the following day, the medium was replaced with fresh mTeSRl (without ROCK inhibitor) daily until cells were ready for passage. Two days following passage with Gentle Cell Dissociation Reagent, the cells were exposed to Hygromycin (50 pg ml-1) for selection. Resistant clones emerged and were identified as healthy and normalappearing colonies that were growing in Hygromycin more than 5 days after starting selection. The individual clones were then expanded, genotyped, and tested in kidney organoid differentiation.Generation of AQP2-mScarlet reporter cell line

[0378] The donor template plasmid for AQP2 was synthesized (Genewiz) to contain left (826 bp) and right (875 bp) homology arms surrounding the endogenous stop codon that flanked the P2A-mScarlet and PGK-HygroR cassettes in the pUC57 vector. Forward and reverse oligonucleotides (5’-CACCGAGCGTCCGTCGGGGCCGTAG-3’ (SEQ ID No. 7) and 5’- aaacCTACGGCCCCGACGGACGCTC-3’ (SEQ ID No. 8), respectively) were similarly annealed and ligated into Bbsl-digested pX458 to produce the Cas9 / gRNA vector. Transfection, selection, and clonal expansion was performed as described above for the HNF4A cell line.Generation of UB spheroids from hPSCsDirected differentiation protocol

[0379] hPSCs were differentiated into UBs using published methods. (Morizane, R., Lam, A.Q., Freedman, B.S., Kishi, S., Valerius, M.T., and Bonventre, J.V. (2015). Nephron organoids derived from human pluripotent stem cells model kidney development and injury. NatBiotechnol 33, 1193-1200 and Morizane, Ryuji, and Joseph V Bonventre. “Generation of nephron progenitor cells and kidney organoids from human pluripotent stem cells.” Nature protocols vol. 12,1 (2017): 195-207. doi:10.1038 / nprot.2016.170) In brief, cells were dissociated with Accutase (STEMCELL Technologies, 07920) and plated onto Cultrex-coated 24-well or 6- well plates in mTeSRl with ROCK inhibitor (Y-27632; 10 pM). On the next day (day 0), cells were induced into a primitive streak-like fate in basic differentiation medium, consisting of Advanced RPMI 1640 (Thermo Scientific, 12633020) and lx L-GlutaMAX (Thermo Scientific, 35050-061), supplemented with 5 pM CHIR99021 (CHIR, Cayman Chemical), 50 ng ml-1 of Activin A (PeproTech), 25 ng ml-1 of BMP4 (PeproTech), and 25 ng ml-1 of FGF2 (PeproTech). On day 1, after 25 to 30 hours depending on the rate of differentiation, the media were replaced with basic differentiation medium containing 25 ng ml-1 FGF2, 1 pM A83-01 (Cayman Chemical), 0.1 pM LDN193189 (LDN; Cayman Chemical) and 0.1 pM RA (Sigma- Aldrich) for 2 days to induce anterior intermediate mesoderm on day 3. Media were changed daily.

[0380] On day 3, cells were dissociated with Accutase and aggregated in AggreWelL 400 24-well plate (STEMCELL Technologies, 34411) in Basic Differentiation Medium supplemented with 50 ng ml-1 of FGF9 (R&D Systems) and 0.1 pM RA. At day 5, half-medium change was performed with medium containing 100 ng ml-1 GDNF (PeproTech) and 0.1 pM RA. By day 6, the UB spheroids exhibited typical morphology and were collected to mix with NM.Cry opreservation of progenitor cells

[0381] To facilitate more flexible coordination of the two differentiation protocols, methods were developed to cryopreserve UB progenitor cells at day 3. The cells were dissociated with Accutase as described above and pelleted through centrifugation at 300 x g for 3 minutes. The supernatant was then aspirated and the cells were re-suspended in freezing medium comprising 45% Basic Differentiation Medium, 45% Fetal Bovine Serum (FBS; Thermo Scientific, 10437-028), and 10% Dimethyl Sulfoxide (DMSO; Fisher BioReagents, BP231-100). This suspension was dispensed into cryovials in 1 mL aliquots containing 1.5-3.0 x 106cells,which is enough to seed two wells of the AggreWell plates upon thawing. The vials were frozen in Mr. Frosty freezing containers with isopropyl alcohol at -80°C, and they were transferred to liquid nitrogen storage in the subsequent 1-5 days. To generate spheroids, frozen cells were rapidly thawed, centrifuged, resuspended in medium and plated into AggreWell plates as described above. To date, frozen cells have been used for >9 months with no observable difference in survival or differentiation outcomes.Formation of branching 3D UB organoids

[0382] To test signaling pathways that might inhibit maturation of CD epithelial cells, three-dimensional UB / CD organoids were grown as previously described (Shi, M., McCracken, K.W., Patel, A.B., Zhang, W., Ester, L., Valerius, M.T., and Bonventre, J.V. (2023). Human ureteric bud organoids recapitulate branching morphogenesis and differentiate into functional collecting duct cell types. Nat Biotechnol 41, 252-261. 10.1038 / s41587-022-01429-5; and Shi, M., Fu, P., Bonventre, J.V., and McCracken, K.W. (2023), Directed differentiation of ureteric bud and collecting duct organoids from human pluripotent stem cells. Nat Protoc 18, 2485-2508. 10.1038 / s41596-023-00847-2) In brief, day 6 UB spheroids were collected and embedded into 100% Matrigel Matrix (Coming, 354234) by spotting 45-pl droplets in 24-well plates (Thermo Fisher Scientific, 142475). Typically, the spheroids (-1,200) from one well of the AggreWell were used to generate 12-24 wells of UB organoids. The plate was placed in 37°C incubator for 60 minutes to solidify the Matrigel and then overlaid with basic differentiation medium containing 50 ng ml-1 of GDNF (PeproTech), 50 ng ml-1 of FGF10 (PeproTech), 2 pM CHIR, 0.1 pM LDN, 1 pM A83-01, 0.1 pM RA and 10 pM Y27632 (Cayman Chemical) for 7 days. The medium was changed after 3-4 days. On day 13, the medium was switched to CD differentiation medium that comprised the same basic differentiation medium supplement with 10 nM arginine vasopressin (Sigma-Aldrich) and 10 nM aldosterone (Sigma-Aldrich) to induce CD maturation. For inhibiting maturation assay, the following growth factors were added: 50 ng ml-1 Activin A, 50 ng ml-1 BMP4, 50 ng ml-1 FGF7 (PeproTech), 50 ng ml-1 FGF10, 50 ng ml-1 GDNF, 3 pM CHIR and 0.1 pM RA.Generation of nephrogenic mesenchyme from hPSCsDirected differentiation protocol

[0383] hPSCs were differentiated into NM using methods adapted from published protocols (Morizane, R., Lam, A.Q., Freedman, B.S., Kishi, S., Valerius, M.T., and Bonventre, J.V. (2015). Nephron organoids derived from human pluripotent stem cells model kidney development and injury. Nat Biotechnol 33, 1193-1200. 10.1038 / nbt.3392 and Morizane, R., and Bonventre, J.V. (2017). Generation of nephron progenitor cells and kidney organoids from human pluripotent stem cells. Nat Protoc 12, 195-207. 10.1038 / nprot.2016.170). Briefly, cells were dissociated with Accutase (STEMCELL Technologies, 07920) and plated onto Cultrex- coated 6-well plates. Differentiation was started on the following day (day 0), with the same basal medium used at all steps. Cells were exposed to 8 M CHIR (with 5 ng ml-1Noggin if necessary) from days 0-4, followed by 10 ng ml-1Activin A on days 4-7, and 10 ng ml-1FGF9 from day 7-8. Media were changed daily. At day 8, the cells were dissociated with Accutase, and collected to mix in aggregates with UBs or cryopreserved in liquid nitrogen (details are shown below).Cryopreservation of progenitor cells

[0384] NM progenitors at day 8 were cryopreserved using similar methods as described above for UB progenitors. Cells were dissociated with Accutase, pelleted by centrifugation, and resuspended in the same freezing medium. The cell suspension was aliquoted into cryovials at concentrations between 5-15 x 106cells ml-1, placed in a Mr. Frosty freezing container and stored at -80°C overnight. The next day, cryovials were moved into liquid nitrogen for long-term storage. To thaw cells, For thawing cells, cryovials were warmed by hand until the ice was almost completely thawed. The suspension was then transferred to a 15 ml conical tube containing 5 ml DMEM (Thermo Scientific, 11965092) and centrifuged at 300 x g for 3 minutes. NM pellets were directly used to mix with UBs and form organoids after aspirating supernatant. To date, frozen NM cells have been used for >8 months with no observable loss of differentiation efficiency.Assembling progenitor cells into kidney organoids

[0385] To generate kidney organoids, NM was aggregated with or without UB spheroids at high density on transwell filter membranes using previously described aggregation techniques with modifications (Gupta, A.K., Ivancic, D.Z., Naved, B.A., Wertheim, J.A., and Oxburgh, L. (2021). An efficient method to generate kidney organoids at the air-liquid interface. J Biol Methods 8, e!50. 10.14440 / jbm.2021.357). On day 0, intact day 6 UB spheroids were collected from AggreWell plate with a P1000 micropipette and transferred to a 1.7 ml Posi-Click Microcentrifuge Tube (Denville Scientific Inc., C2170). Day 8 NM progenitors (either freshly differentiated and dissociated or, more commonly, thawed cells) were collected via centrifugation and added to the same microcentrifuge tube at a ratio of 5.0 x 105NM progenitors per -50 UB spheroids to generate one organoid. For best aggregation results, enough NM cells (3.0-6.0 x 106) and UB spheroids (300-600; corresponding to *4 to Yi of a single AggreWell well) were mixed to make 6-12 organoids in a single tube. The mixture was centrifuged at 450 x g for 4 minutes, and the supernatant was carefully aspirated with a micropipette to remove as much medium as possible. The pellet was gently resuspended at 3.75 x 105NM cells pl"1in basic differentiation medium and the dense suspension was spotted in 1.33 pl drops onto a transparent PET transwell insert membrane (Falcon, 353090, 0.4 pm pore size). Up to 6 organoids could be spatially arranged on each filter. Differentiation medium was added only to the lower chamber of the well to create air-liquid interface cultures. At the time of aggregation, 1.3 ml media consisting of 90% basic differentiation media, 10% FBS, and supplemented with 0.2 pM UDN193189 and 10 pM Y27632 (Cayman Chemical) was added into the lower compartment. After 5 hours, the medium was replaced with 1.3 ml medium containing 10% FBS with 0.2 pM UDN193189 but without Y27632. From day 2-14, the medium only contained basic differentiation medium with 10% FBS. Media were changed daily from days 0-4 (with 1.3 ml) and every 2 days (with 1.6 ml) afterward.

[0386] For NM-only organoids without UB, the same protocol was used but with 6.0 x 105cells / organoid to account for the estimated cell number in the UB spheroids. For UB-only air-liquid interface cultures, day 6 UB spheroids were pelleted, resuspended at -200 spheroids / pl in basic differentiation medium and spotted at 1.5 pl each onto the Transparent PET Membrane.

[0387] For the Notch inhibition experiments, 10 pM DAPT (Cayman Chemical) was added to the above culture medium for varying lengths of time between days 2-6. For WNT manipulation during nephron segmentation, the inhibitor XAV939 (2 pM; Cayman Chemical) was added between days 2-8 or the activator CHIR99021 (5 pM) was added between days 2-6. To improve the terminal maturation of CD epithelia assay, at day 10 the organoid medium was changed to basic differentiation medium supplemented with 10 nM arginine vasopressin (Sigma- Aldrich), 10 nM aldosterone (Sigma- Aldrich), 3 pM A83-O1, 5 pM U0126 (Cayman Chemical) and 1 pM XAV939. The organoids were then cultured to day 14 for analysis.Doxycycline inducible gene expression

[0388] For transgenic expression of WNT9B and GATA3, stable hPSC lines were generated using lentiviral transduction as previously described (Shi, M., et al. (2023) Nat Biotechnol 41, 252-261 and McCracken, K.W., et al. Nature 516, 400-404. Gateway entry vectors containing human WNT9B (plasmid #35882, a gift from Marian Waterman) and GATA3 (plasmid #81902, a gift from Jesse Boehm & William Hahn & David Root) were obtained from Addgene, which were then shuttled into p!nducer20-Blast (Addgene #109334, a gift from Jean Cook) using Gateway BP Clonase II Enzyme Mix (Thermo Fisher). The lentiviral transfer plasmids were co-transfected with packaging plasmids (psPAX2, pMD2.G) into 293T / 17 cells (ATCC), and lentiviral particles were harvest 48 and 72 hours post-transfection and concentrated using Amicon Ultra 100 kD centrifugal filters (Millipore). Stable hPSC lines were generated through lentiviral transduction for 6 hours, followed by selection with Blasticidin-S (10 pg ml-1; Invivogen) for 3-4 days starting 48 hours after transduction. From this point, cell lines were maintained and differentiated according to normal protocols. For transgene activation, differentiating cells or organoids, doxycycline (0.5 pg ml-1; Sigma) was added to the culture medium.RNA isolation and qRT-PCR

[0389] Total RNA was isolated using NucleoSpin RNA Plus kit (Macherey-Nagel, 740984), and reverse-transcribed using iScript cDNA synthesis kit (Bio-Rad, 1708841). qRT- PCR was performed on QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) usingiTaq Universal SYBR Green Supermix (Bio-Rad, 1725124). Relative mRNA expression levels were normalized to GAPDH or PPIA gene expression by the A ACT method. Primer sequences are listed in Table 2.Immunofluorescent staining and histology

[0390] For whole-mount staining, cultured organoids were directly fixed on the transwell in 4% paraformaldehyde (in PBS) for 1 hour at room temperature, and transplanted organoids were dissected from under the renal capsule and fixed in 4% paraformaldehyde (in PBS) for 2 hours at room temperature. Following fixation, organoids were washed thoroughly in PBS for three times for five minutes. For staining, the organoids were incubated in blocking buffer (0.5% Triton X-100 and 5% normal donkey serum in PBS) for 1 hour at room temperature and incubated with primary antibodies overnight at 4°C in blocking buffer. The following day, the organoids were washed with PBS three times and incubated with secondary antibodies and DAPI (Sigma- Aldrich) for 4 hours at room temperature. After washing three times with PBS, organoids from the transwell were transferred to glass slides, mounted with Fluoromount G(Invitrogen), coverslipped and imaged by confocal microscopy (Nikon AIR inverted confocal microscope). For transplanted organoids, which were larger, imaging was performed directly in PBS without mounting. Primary and secondary antibodies used are listed in Table 3.

[0391] Table 3. Resources

[0392] For frozen sectioning, transplanted tissues were fixed in 4% paraformaldehyde, washed by PBS thoroughly and incubated with 25% sucrose (in PBS) overnight at 4 °C. Then the samples were mounted in OCT compound (Thermo Fisher Scientific), frozen in blocks overnight, cut into 7-pm sections by cryostat and placed on slides. For staining, sections were incubated in blocking buffer (0.1% Triton X-100 and 5% normal donkey serum in PBS) for 1 hour at room temperature and incubated with primary antibodies inblocking buffer overnight at 4 °C. Then slides were washed by PBS, incubated with secondary antibodies and DAPI for 1 hour at room temperature and washed by PBS. Slides were mounted with Fluoromount G and coverslipped.

[0393] For histology, implanted organoids were fixed in 4% paraformaldehyde at room temperature and subjected to overnight processing followed by paraffin embedding. The blocks were cut into 5 pm sections by a microtome. Hematoxylin and Eosin (H&E) staining was performed following the manufacturer’s directions. Histological images were captured by widefield microscopy (Nikon 90i upright widefield microscope).6-Carboxyfluorescein transport assay

[0394] For proximal tubule functional studies, their ability to transport the organic anion 6-carboxyfluorescein (6-CF; Thermo Fisher #C1360) in organoids made from the HNF4A-mScarlet reporter cell line was assessed. At day 14, 1 pM 6-CF was added to the medium and organoids were incubated for one hour. Widefield fluorescent microscopy was performed at baseline and at one hour to determine the extent of 6-CF uptake into the proximal tubules. Prior to imaging post-incubation, organoids were rinsed with three times PBS and then fresh medium was added.Image analysis and quantification

[0395] To examine and quantify nephron-UB fusion events, 3D projections of confocal z-stacks of wholemount-stained organoids were examined using Imaris. All continuous luminal connections were identified and quantified manually using TJP1, GFP, and Dapi staining in day 14 organoids. The number of fused epithelia that expressed GATA3 on the GFP" end of the junction were further quantified. To adjust for the varying density of UB-derived CDs in the organoids, the frequency of connections was normalized to the GFP+area (mm2), as measured in Imaris software. To quantify proximal and distal specification in the DAPT-treated organoids, organoids generated from fflVF4A-mScarlet and GA7A5-mScarlet cell lines, respectively, were used. The percentage of reporter-positive area within the organoid was measured using General Analysis methods in Nikon NIS Elements software.Flow cytometry

[0396] Organoids were dissociated with TrypLE Express Enzyme (Thermo Scientific, 12605010) for 12 minutes at 37°C, followed by gentle pipetting. To fully dissociate tissue into single cells, organoids was placed back into 37 °C for incubating 3-5 more minutes and pipetted gently. Then the cells were pelleted and incubated with 200 pl LIVE / DEAD™ Fixable Blue Stain buffer (dilution 1:1000 in PBS; Invitrogen, L23105) for staining 30 min on ice. After LIVE / DEAD staining, cells were washed once with cold PBS and fixed in 1% paraformaldehyde for 1 hour on ice. Cells were then transferred into a Polystyrene Test Tube (Falcon, 352235) though the cell strainer snap cap and performed analysis using a flow cytometry (LSR Fortessa, BD Biosciences). Organoids without mScarlet and GFP reporters were used as negative controls to establish gating parameters. Data were analyzed using FlowJo software.In vivo transplantation of kidney organoids

[0397] Kidney organoids were transplanted beneath the kidney capsule of NSG (NOD scid gamma) mice. The NSG mouse colony was housed and maintained in the vivarium at Cincinnati Children’s Hospital Medical Center (CCHMC). The facility is on a 14-hour / 10-hour light / dark cycle and maintained at a temperature of 22°C. The veterinary facilities at CCHMC are accredited by AAALAC (000492), and all animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC2021-0060 and IACUC2021-0054).

[0398] All mice used for transplantation were male and between 8-16 weeks old. Kidney organoids on day 3 following integration of NM and UB spheroids were manually removed from the transwell and transplanted into the left renal subcapsular space as described previously (Pode-Shakked, N., Slack, M., Sundaram, N., Schreiber, R., McCracken, K.W., Dekel, B., Helmrath, M., and Kopan, R. (2023). R A AS -deficient organoids indicate delayed angiogenesis as a possible cause for autosomal recessive renal tubular dysgenesis. Nat Commun 14, 8159. 10.1038 / s41467-023-43795-x and Watson, C.L., Mahe, M.M., Munera, J., Howell, J.C., Sundaram, N., Poling, H.M., Schweitzer, J. I., Vallance, J.E., Mayhew, C.N., Sun, Y., et al. (2014). An in vivo model of human small intestine using pluripotent stem cells. Nat Med 20, 1310-1314. 10.1038 / nm.3737.) Briefly, the mouse was anesthetized using 2% inhaled isoflurane(Butler Schein). The left flank was prepared and cleansed with isopropyl alcohol and povidone- iodinc, and a 1 cm vertical incision was made in the left paraspinal area. The left kidney was exposed through the incision, and the capsule was gently dissected with a probe and forceps to create a subcapsular space or pocket to hold the organoid. Two organoids were then inserted to fit snugly in the pocket, and the kidney was returned to the retroperitoneal space. An intraperitoneal injection of piperacillin-tazobactam (100 mg kg-1) was administered for antimicrobial prophylaxis, and the surgical incision was sutured closed. Postoperatively, mice received subcutaneous Buprenex (0.05 mg kg'1) for analgesia. Transplanted mice were sacrificed using CO2 two weeks later, and the kidneys were harvested for fixing, histology, and immunofluorescent staining.Single cell capture, library preparation, and sequencing

[0399] For the scRNA-seq analyses, a multiplexed single cell library was generated using the Chromium Flex Fixed RNA Human Transcriptome Kit (vl, 16 reactions, 10X Genomics), comprising single cell suspensions from organoids made from different lineage compositions, grown in various conditions, and at different timepoints (summarized in Table 4). The organoids were dissociated by incubating with Accumax (Stem Cell Technologies) for 4-15 minutes at 37 °C with intermittent trituration using a P1000 pipette until the organoids were largely dissociated into single cells. DMEM was added at a 2:1 volume ratio to the cell suspension, which was then mixed, transferred to a 15 ml conical tube, and centrifuged at 300 x g for 3 minutes. The cell pellet was resuspended in PBS with 0.04% bovine serum albumin (BSA; Thermo Fisher Scientific), filtered through the cell strainer snap cap tube, and transferred to a 1.7 ml Posi-Click Microcentrifuge Tube. From there, the single cell suspensions were fixed, permeabilized, and quenched with the Chromium Next GEM Single Cell Fixed RNA Sample Preparation Kit (10X Genomics, #1000414) using strict adherence to manufacturer’s protocols, and then they were stored at -80°C until library preparation. The frozen cell suspensions were then directly delivered to the Single Cell Genomics Facility at CCHMC for quality control and library preparation, including addition of custom probes to detect expression of GFP (LHS 1, GGTAGTGGTCGGCGAGCTGCACGCT (SEQ ID No. 41); RHS 1,GCCGTCCTCGATGTTGTGGCGGATC (SEQ ID No. 42); LHS 2,AGGGTGTCGCCCTCGAACTTCACCT (SEQ ID No. 43); RHS 2CGGCGCGGGTCTTGTAGTTGCCGTC (SEQ ID No. 44); LHS 3ATGGTGCGCTCCTGGACGTAGCCTT (SEQ ID No. 45); RHS 3CGGGCATGGCGGACTTGAAGAAGTC (SEQ ID No. 46). A single library was created from the multiplexed samples and sequenced on a NovaSeq X Plus (Illumina).Table 4 Conditions and cell counts for scRNA-seq experiments.scRNA-seq data analysis

[0400] Cell Ranger v8.0.1 (10X Genomics) with the command ‘cellranger multi’ was used to align and demultiplex 10X samples. The reference used was GRCh38, with sequences of GFP probes appended to the human FASTA and GTF files prior to running ‘cellranger mkref’. Raw counts were passed through SoupX to remove ambient RNA, followed by an initial round of processing in Seurat v5.0.1 to remove low-quality cells, normalize with SCTransform, and cluster. The resulting objects are filtered further using DoubletFinder to remove putative doublets, and a final round of processing is performed. As all samples were prepared as a single 10X library, they were demultiplexed and then merged and integrated into separate experiments (Table 4) in Seurat (Hao, Y., Stuart, T., Kowalski, M.H., Choudhary, S., Hoffman, P., Hartman, A., Srivastava, A., Molla, G., Madad, S., Fernandez-Granda, C., and Satija, R. (2024). Dictionary learning for integrative, multimodal and scalable single-cell analysis. Nat Biotechnol 42, 293- 304. 10.1038 / s41587-023-01767-y.) and visualized in Mona. For comparative analyses, datasets of human fetal kidney (GSE114530)22and human kidney organoids (GSE184928 (Vanslambrouck, J.M., Wilson, S.B., Tan, K.S., Groenewegen, E., Rudraraju, R., Neil, J., Lawlor, K.T., Mah, S., Scurr, M., Howden, S.E., et al. (2022). Enhanced metanephric specification to functional proximal tubule enables toxicity screening and infectious disease modelling in kidney organoids. Nat Commun 13, 5943. 10.1038 / s41467-022-33623-z.), GSE114802 (Phipson, B., Er, P.X., Combes, A.N., Forbes, T.A., Howden, S.E., Zappia, L., Yen, H.J., Lawlor, K.T., Hale, L.J., Sun, J., et al. (2019). Evaluation of variability in human kidney organoids. Nat Methods 16, 79-87. 10.1038 / s41592-018-0253-2) and GSE131086 (Uchimura, K., Wu, H., Yoshimura, Y., and Humphreys, B.D. (2020). Human Pluripotent Stem Cell-Derived Kidney Organoids with Improved Collecting Duct Maturation and Injury Modeling. Cell Rep 33, 108514. 10.1016 / j.celrep.2020.108514) were downloaded from the Gene Expression Omnibus (GEO) and integrated using Seurat. Figures and data visualization were generated using Seurat and the package scCustomize (Marsh, S.E. (2021). scCustomize: Custom Visualizations &Functions for Streamlined Analyses of Single Cell Sequencing. https: / / doi.org / 10.5281 / zcnodo.5706430). (v2.1.2).Statistical analysis.

[0401] No statistical methods were used to predetermine sample size. Values are presented as mean ± s.d. Replicates represent biologically independent samples. All statistical analyses were performed using Prism 8 (GraphPad Software). Statistical analyses between two groups were performed by using unpaired Student's / -test if the variations were equal and unpaired Welch's Atest if the variations were unequal. Statistical analyses between multiple groups (more than two groups) were performed using one-way ANOVA followed by post-hoc Tukey’s multiple comparison test. Differences with values of P < 0.05 were considered statistically significant. All P values are displayed in the figure legends. The exact n (sample size), P values and the statistical test used for each panel are shown in Table 5.Table 5. Statistical tests and p- values. Related to STAR Methods.EXAMPLE 2Progenitor dynamics of assembled UB and NM progenitors

[0402] To introduce a collecting system in kidney organoids, it was sought to reconstruct the nephrogenic niche through combination of UB and NM progenitors induced from parallel hPSC directed differentiation protocols (summarized in FIG. 2A and FIG. 9A-C). To distinguish the distinct lineages, hPSCs constitutively expressing GFP were used to generate UBs combined with unlabeled NM. Dissociated SIX2-expressing NM at day 8 (FIG 9B) were mixed with intact day 6 UB spheroids comprising RET+ tip-like progenitors (FIG. 9D), and the aggregated tissue mixtures were cultured on transwell membranes. Given the temporal dyssynchrony, the timeline was reset to day 0 on the day of aggregation, which will be used for all subsequent reference to staging. A protocol was used to promote tissue interactions while still supporting the differentiation of NM and UB lineages, which consisted of transient exposure to ROCK inhibitor (Y-27632) for the first 5 hours (FIG. 2B and FIG 10A) and BMP inhibition (LDN193189) from days 0-2 to further improve the differentiation as indicated by renal vesicle formation at day 4 (FIG. 10B).

[0403] Following aggregation, the GFP+ UB spheroids embedded within NM progenitors expressing uninduced markers such as SIX 1 / 2 (FIG. 2D), reminiscent of the cortical nephrogenic niche in developing kidneys. Within 48 hours widespread nephron induction characterized by formation of epithelialized renal vesicles (RVs) expressing LHX1 and JAG1 was observed, and by day 4 NPCs were largely undetectable (FIG. 2D and FIG. 10C). Meanwhile, the UBs grew extensively during this period to form a network of tubules interwoven amongst the nascent nephrons throughout the organoids (FIG. 2C). The early stages (days 0-2) of their morphogenesis involved the rapid formation of numerous buds from each individual spheroid that subsequently underwent further sprouting or branching, with later growth (beyond day 3) predominantly consisting of tubular elongation. Similar patterns usingUB organoids derived from multiple different hPSC lines, including GATA3-mScarlet reporter cells (FIG. 10D) was observed.

[0404] The developmental trajectories in the mixed organoids were further analyzed through single cell transcriptomic profiling of >45,000 total cells across five timepoints between days 0-14 (FIG. 11A-B, Table SI), and the resulting 28 clusters were evaluated and annotated through both unsupervised analyses using DevKidCC21 and supervised interrogation of anchor genes, as well as directly mapping to a fetal human kidney 22 reference dataset (FIG. 11G). Each cluster was broadly classified into ureteric (5.8%), NPC (10.3%), nephron (57.2%), and stromal (24.1%) lineages (FIG. 11C-F), as well as a small population (2.6%) of off-target cells representing a likely neural fate. The nephron and ureteric lineages were selected, re-clustered (FIG. 12A), and annotated according to DevKidCC predictions (FIG. 12C), revealing 8 nephron and 2 ureteric cell states across the two weeks of differentiation (FIG. IE and FIG. 12D-E). As expected, the UB lineage label GFP was highly expressed in the ureteric clusters and absent from the nephron lineage (FIG. 2F and FIG. 12B), confinning the lineage fidelity of the distinct progenitor cells. These data further corroborated the rapid epithelialization and exhaustion of NPCs in the organoids in a single wave of differentiation with a stepwise progression of both nephron and UB lineages from progenitor to differentiated cell states (FIG. 2G and FIG. 12D). This pattern of nephron induction in organoids contrasts with the normal iterative process that occurs in vivo, and it was unaffected by the presence of UBs (FIG. 10E) despite the expression of tip progenitor markers, such as RET and WNT11, persisting within the UB epithelia until at least day 4 (FIGs. 2D, 2G, 10C). Further, neither addition of exogenous FGF nor GDNF24,25 was sufficient to promote self-renewal niche interactions (FIG. 10F). Thus, the inclusion of UB spheroids into kidney organoids did not significantly impact the ability of NM to differentiate into nephrons, and it successfully generated an integrated network of UB -derived tubules that can serve as a CD-like drainage system.EXAMPLE 3UB progenitors form CDs that fuse with distal nephrons through a conserved process

[0405] At day 14, the recombinant (‘Mixed’) organoids contained a distinct cluster of CD-like cells that expressed principal cell genes, such as GATA3, ELF5, AQP2, SCNN1G, andCALB1 (FIG. 3A-B and FIG. 13A-B). This population was absent in NM Only organoids and was uniquely positive for GFP, confirming that it derived from UB progenitors. Morphologically, the organoids contained a network of elongated GFP+ CD-like tubules that were largely interconnected and coursed through the GFP- nephron tubules (FIG. 3C). Remarkably, numerous GFP- nephron tubules were directly connected to the GFP+ ducts (FIG. 3D), structurally analogous to the fusion of the nephron connecting tubule to the CD. Indeed, the Mixed organoids contained extended CALB1+ distal nephron segments that connected with GFP+ CDs, while NM Only organoids contained only short CALB1+ segments that terminated blindly (FIG. 3E). Wholemount confocal imaging confirmed the presence of bona fide fusion between nephron segments and CDs, with uninterrupted apical (TJP1 and PRKCZ) and basal (CDH1 and Laminin) polarity markers showing a continuous epithelium and luminal membrane across the GFP junctions (FIG 3F FIG. 13C). Overall, the epithelial fusions were abundant and reproducible, occurring numerous times (typically dozens, as quantified below) in every (>500 thus far) organoid examined.

[0406] The connecting segment in vivo expresses GATA327 and forms adjacent to the UB. Since kidney organoids do not exhibit the same degree of organization and stereotypic spatial relationships, whether fusion would be similarly restricted to the distal segment was explored. Although the GATA3+ population was quite small, especially in comparison to the abundant proximal tubules (FIG. 13D), direct fusion of GATA3 (mScarlet)-expressing tubules to GFP+ UB ducts (FIG. 3G and 13E) was frequently observed, and often multiple GATA3+ tubules were connected to a larger CD (FIGs. 3D, 3G and 13E-F). Quantification of confocal z- stacks showed that organoids contained a mean of 41.8 ± 16.8 (s.d.) epithelial connections between nephron and UB. Astoundingly, 96% of the fused nephron segments expressed GATA3 (FIG. 3G), and connection involving an HNF4A+ proximal tubule has yet to be observed. These data support that there are robust mechanisms that constrain fusion competence of developing renal epithelia that are conserved in the kidney organoids irrespective of the random orientation of nephrons in this system.

[0407] The temporal development of nephron segmentation and fusion using fluorescent reporters was further characterized, which revealed that GATA3 is initiated in the epithelialized primitive nephrons as early as days 4-5 (FIG. 3H and 13E), at which point thevesicles were polarized with WT1 and POU3F3 marking the presumptive proximal and distal domains, respectively (FIG. 31 and Fig. 12D). Between days 5-7, the GATA3+ segment expanded into a short primitive connecting segment that appeared to interact and invade into adjacent GFP+ epithelium (FIG. 3H). This process involved the extension of the GAT A3 domain toward the CD, along with its apical membrane, which then quickly established a continuous apical luminal surface with that of the CD (FIG. 3I-J). Correspondingly, the basement membrane that encapsulated the RVs was broken down at the sites of fusion (FIG. 31). Overall, the process was surprisingly synchronous among the nephrons in the organoids, occurring mostly within a 2- 3 day window, and it was largely completed by day 7.EXAMPLE 5Mixed organoids comprise segmented nephrons with a distal shift in differentiation

[0408] Day 7 organoids contained early-stage polarized nephrons connected to UB- derived CDs (FIG. 4A), and an additional week of differentiation promoted the maturation of segmented nephrons with well-developed proximal structures including NPHS1+ podocytes and prominent HNF4A / LRP2+ proximal tubules (FIG. 4B-C). The distal portion consisted of SLC12A1+ tubules analogous to the thick ascending limb (TAL) of the loop of Henle (LOH) and a short connecting segment (CNT) expressing GATA3 and CALB1 (FIG. 3E, 3G, and 4C). Transcriptomic profiling revealed that podocytes, proximal tubules, and LOH / TAL were well- developed and expressed mature markers associated with epithelial function (FIG. 4D and 14A- B). For example, a large percentage of the proximal tubule cells expressed the transporters SLC3A1, SLC34A1, CUBN, and LRP2, and they exhibited capacity for robust transport of the organic anion 6-carboxyfluorescein (6-CF; FIG. 14C).

[0409] Nephron segment populations were overall similar’ in Mixed and NM Only organoids (FIG. 3A), but the Mixed condition exhibited a subtle shift toward more distal segments (FIG. 4E). Co-culture with UBs led to 39% reduction in podocytes with corresponding 33% and 67% increases in proximal and distal tubule populations, respectively, including more cells expressing the terminal segment marker GATA3 (FIG. 14D). The UB-induced distal shift was evident during the early stages of RV polarization and segmentation at days 3-7 (FIG. 4F), and it can reflect the influence of UB -derived WNT signals. Aside from these changes in celltype distribution, nephron segment differentiation was qualitatively similar in the presence or absence of UBs (FIG. 14E), and both conditions contained underdeveloped distal tubules with no expression of SLC12A3 (FIG. 14E)29.

[0410] The organoids contained a cluster of stromal / interstitial cells expressing MEIS1 and PDGFRA (FIG. 4G-H and FIG. 14F). Unbiased fate scoring revealed cells resembling cortical (CS), medullary (MS), and mesangial-like (MesS) stromal identities (FIG. 41), but these populations were not distinctly clustered from one another, consistent with established difficulties in resolving stromal populations in both kidney organoids and human fetal kidneys (FIG. 11G). Interestingly, the cluster contained a blended mix of GFP- (NM- derived) and GFP+ (UB -derived) cells, indicating that the stromal progenitors from UB differentiation can also generate renal-like interstitial cells that were apparent as a hazy (non- epithelial) GFP signal (FIG. 3C-D and 4A). There were no overt differences in expression of stromal marker genes between these cells and NM-derived stroma (FIG. 41 and 14F).EXAMPLE 6Nephron-UB fusion occurs in vivo following organoid transplantation

[0411] Organoids were transplanted 3 days after aggregation (prior to the in vitro epithelial fusion between days 5-7) and analyzed 2 weeks later (FIG. 5A). Engrafted organoids developed into complex tissues comprising both a stromal compartment and renal parenchyma (FIG. 5B-C) with organized glomerular structures including arrayed podocytes (NPHS1), mesangial cells (PDGFRB, GATA3), and host-derived endothelial cells (PECAM1) that formed capillaries containing erythrocytes (FIG. 5D-F). Distal to the glomeruli, many of the nephrons exhibited appropriate segmentation (FIG. 5E)-> with sequential development of proximal tubules (HNF4A), and LOH / TAL segments (SLC12A1). Transplanted organoids contained numerous GATA3+ distal segments, including many that directly terminated into the GFP+ CDs (FIG. 5B), which frequently extended up to 1-2 mm in length (FIG. 5G). Confocal analyses confirmed that numerous GATA3+ tubules were fused to these prominent UB-derived CDs (FIG. 5H-J), whereas proximal nephrons again did not participate in these anastomoses. Thus, the nephron fusion process followed developmental patterns and can occur both in vitro and in vivo.

[0412] Two weeks post-transplantation, UB-derived epithelia exhibited narrow, elongated morphology similar to normal ducts (FIG. 5G). Interestingly, three weeks later they were expanded into massively dilated and dysplastic-appearing structures (FIG. 5K). Since the glomeruli were perfused (FIG. 5D) and possibly generating an ultrafiltrate, the CD dilatation was supportive of the intriguing possibility that they were dilated through accumulation of fluid that was derived proximally and collected in the distal UBs.EXAMPLE 7Notch inhibition augments tubule fusion via nephron distalization

[0413] To further advance this system, it was sought to improve the efficiency of nephron-UB connectivity based on the observation that fusion was specific to the GATA3 domain and RVs without one seemed incapable of interacting with the UB (Fig. 2G-H). Fusion frequency could be augmented by improving specification of GATA3+ distal segments. Specifically, NOTCH manipulation was applied to modulate the proximakdistal nephron ratio. Organoids were exposed to the NOTCH inhibitor DAPT for varying lengths of time during nephron patterning (FIG. 6A), and prolonged inhibition (days 2-6) induced nearly complete distalization, with >99% reduction in HNF4A+ proximal tubules and a corresponding 39-fold increase in GATA3+ tubules (FIG. 6B-C). By day 14, this led to markedly abnormal-appearing organoids containing mostly amorphous GATA3+ epithelial structures and a paucity of proximal tubules and podocytes (FIG. 6D and Fig. 15A).

[0414] Supporting the dynamic nature of nephrogenesis in organoids, the DAPT- induced distalization was exquisitely sensitive to timing and duration of exposure. Shorter treatment of 3 days (3-6) produced a similar yet less severe phenotype with a 76% decrease and 17-fold increase in HNF4A and GATA3 tubules at day 8, respectively. Further reduction to just a 2-day pulse (4-6) led to only a modest (non-significant) 14% reduction in HNF4A-H- area (FIG. 6B-C), indicating that proximal specification was mostly irreversibly established by day 4. Meanwhile, the 2-day exposure was sufficient to promote a 2.9-fold increase in GATA3 at days 8 (FIG. 6C) and 14 (FIG. 6F-H). Preserved differentiation of podocyte, proximal tubule, and LOH / TAL was confirmed through both scRNA-seq (FIG. 6E) and wholemount imaging (FIG. 6F and 15A).

[0415] Importantly, the increased specification of GATA3+ distal segments corresponded to increased frequency of fusion events with the UB (FIG. 6F and 61). It was confirmed that these epithelial connections exhibited the same properties as previously characterized, including continuity of the apical membrane across the junction and expression of CALB1 in the NM-derived connecting segment (FIG. 6J and FIG. 15B). Collectively, these data support the conclusion that distal nephron specification has a deterministic role in promoting the ability of tubules to fuse to the CD.EXAMPLE 8WNT and GAT A3 promote distal nephron fusion competence

[0416] The distally shifted segment differentiation in Mixed organoids (FIG. 4E) can result from UB-derived WNTs. Indeed, inhibition of the canonical pathway with XAV939 reduced GATA3 and other distal markers while leading to a significant increase in the proximal tubule marker HNF4A (FIG. 7A and FIG. 16A-B). Conversely, WNT activation with CHIR markedly increased distal nephron while suppressing proximal differentiation. Importantly, WNT repression led to significantly fewer nephron-UB fusion events (FIG. 7B), further supporting the requirement of distal segment identity in establishing the epithelial connection.

[0417] In contrast to the uniform WNT activation induced chemically, which caused widespread GATA3 activation and disorganized nephrons (FIG. 7A), RVs in vivo are exposed to a morphogen gradient generated by localized WNT expression from the UB38. To augment WNT activity in more physiologic fashion, an inducible WNT9B transgene in GFP-expressing hPSCs used to generate UB spheroids was engineered (FIG. 7C and FIG. 16C). Forced expression of WNT9B from the UBs was sufficient to induce a significant increase in GATA3+ distal segments (FIG. 7C-D) without resulting in complete distalization of the nephrons as seen with CHIR (FIG. 7A). This also led to a significant, nearly 2-fold increase in the number of nephron-UB fusion events (FIG. 7E-F and 16D).

[0418] GATA3 was found to be transcriptionally driving this fusion behavior. An inducible GATA3 transgenic line was generated, which was mosaic (FIG. 16E) and relatively inefficient in organoids but still led to significant increases in GATA3 (FiG. 7G-H and Fig. 16F). In XAV-treated organoids, which have very few GATA3+ segments at baseline, cells expressingectopic GATA3 appeared to cluster together into short epithelial segments (FIG. 7G). More remarkably, even the low level of transgenic GATA3 was sufficient to partially rescue the repressed fusion frequency observed in the WNT-inhibited organoids (FIG. 71), indicating that GATA3 has a functional role in promoting epithelial connections.EXAMPLE 9Improved maturation of CD epithelia

[0419] The maturation of CDs through transcriptomic analysis of the re-clustered UB lineage was explored, which showed progression from RET / WNT11+ early progenitors (days 0- 3) to CALB 1 / WNT9B+ stalk-like progenitors (days 7-10), and then to ELF5+ CD-like epithelium (FIG. 8A-B and FIG. 17A). However, expression of the canonical principal cell marker AQP2 was inefficient, which was surprising given previous findings (Shi, M., McCracken, K.W., Patel, A.B., Zhang, W., Ester, L., Valerius, M.T., and Bonventre, J.V. (2023). Human ureteric bud organoids recapitulate branching morphogenesis and differentiate into functional collecting duct cell types. Nat Biotechnol 41, 252-261. 10.1038 / s41587-022-01429-5). The inhibitory effect largely derived from the culture medium rather than the co-culture system (FIG. 17B), so it explored whether signaling modifications could rescue principal cell maturation. In a prior study, isolated UB organoids rapidly acquired AQP2 expression when transitioned from progenitor medium (UB Media) to more minimal conditions (CD Medium; FIG. 17C). When the Mixed organoids were switched to CD Medium at day 10, they acquired a faint but appreciable increase in AQP2 (FIG. 8C), supporting that their potential was maintained.

[0420] Developmental pathways in 3D UB organoids were screened to identify mechanisms to further improve CD differentiation, and activation of either WNT, TGFB, or FGF / RTK signaling was sufficient to repress AQP2 activation (FIG. 17C). To rescue CD maturation in Mixed organoids, inhibitors of these three pathways (‘AUX’; A83-01, U0126, and XAV939) were added to CD Medium from days 10-14. Remarkably, this led to robust activation of AQP2 and other CD markers (FIG. 8C and 17D-E). scRNA-seq confirmed that maturation was improved by AUX, and these data further showed a concurrent reduction in progenitor genes (FIG. 8D-E). Notably, the expression of principal cell markers was markedly higher in CD cells in Mixed organoids compared to those in UB Only organoids grown in similar conditions (FIG.17G-I). Reassuringly, these manipulations did not grossly impact overall organoid organization (FIG. 17F), epithelial fusions, or the distribution of NM-dcrivcd nephron cell types (FIG. 18A). Interestingly, AUX also had a positive impact on proximal tubule differentiation with increased expression of SLC34A1 and CUBN (FIG. 18B-C), supporting that this condition can be more generally useful for kidney organoid maturation.

[0421] This was the first human kidney organoid system that contained segmented nephrons with distal tubules directly fused to AQP2+ CDs (FIG. 8F). To compare these organoids to others, the scRNA-seq profiles was integrated with three published datasets: the ‘Phipson’ dataset41 representing an early version of organoids from the Little lab, the ‘Vanslambrouck’ versionlO with enhanced proximal tubule differentiation, and the ‘Uchimura’ datasetl2 containing organoids generated by incorporating dissociated anterior intermediate mesoderm-like cells. Unsupervised lineage classification by DevKidCC showed that the organoids disclosed herein contained the highest percentage of nephron epithelial cells (62.1%), while the Vanslambrouck organoids also had a substantial portion (32.7%) and the others were quite deficient in this lineage (FIG. 8G and Table 6). Ureteric epithelium (UrEp) made up 4.4% of the disclosed organoids and a large proportion (20.1%) of the Uchimura organoids, which was nearly three times more than the Nephron component, and the other two did not contain ureteric populations. All datasets had a similar small proportion (11-15%) of ‘unassigned’ cells representing off-target differentiation. “Shi” refers to the disclosed organoids.Table 6 Comparison of scRNA-seq across organoid datasets. Related to FIG. 8.

[0422] Analysis of nephron differentiation showed comparable numbers of proximal tubule cells in the organoids disclosed herein and the Vanslambrouck organoids, although podocytes were relatively scarce in the latter (FIG. 8G), while proximal nephron segments were severely under-represented in the Uchimura dataset. Expression of functional markers of segment differentiation was generally highest, or at least as high, in the organoids disclosed herein compared to any of the others (FIG. 8H). Notably, the proximal tubule marker SLC34A1 was robustly expressed in the organoids disclosed herein and either absent or modest in theothers. Expression of AQP2 in the CD cluster was similarly high in both ours and the Uchimura organoids but was absent from the others, while other principal cell markers were highest in the disclosed organoids, such as SCNN1G and NR3C2 (FIG. 8H and FIG. 18D). However, other functional genes such as the vasopressin receptor AVPR2 were lacking in all the datasets. Further, no specific cluster or bona fide markers of intercalated cells were identified in any of the organoids (FIG. 18E).EXAMPLE 10

[0423] An efficient hPSC co-culture system to assemble UB progenitors into NM- derived kidney organoids to form a network of CDs that were structurally integrated with nephrons via fusion with the distal tubule was established. Molecular and morphological characterization showed that the organoids comprise the most representative distribution of nephron segments including CDs yet described, and they achieved a high state of maturation across all segments. Structurally, this showed for the first time in human kidney organoids the recapitulation of epithelial fusion between the distal tubule and UB, a key event in forming the polarization and connectivity of nephrons, and the system is robust both in vitro and following transplantation in vivo. From a kidney bioengineering standpoint, establishing a pathway for the requisite movement of tubular fluid from nephron to collecting system is a key milestone toward the generation of more functional renal tissues. Further, this system provides an unprecedented model for investigating basic mechanisms of nephron fusion in human kidney organogenesis.

[0424] The ability to produce de novo nephron-like structures from hPSCs has been replicated in numerous studies over the past decade, but the ability to connect them to a drainage or collecting system had previously never been determined. A landmark study using mouse ESCs successfully engineered key interactions between induced UB and NM progenitors, but similar success in hPSCs has remained elusive. Prior work incorporated UB progenitors to form CD-like cell types in organoids, but they were introduced as dissociated single cells and no fusion was reported in those models. In the organoid model described here, the UB progenitors grew and developed as distinct structures, which enabled recapitulation of in vivo-like nephron fusion to provide a potential solution to the longstanding challenge of draining organoid nephrons. Although this is a robust model where dozens of nephrons fused to CDs, there were many othersthat did not connect. These results indicate that an essential criterion is the GATA3+ distal domain, which docs not develop uniformly in all organoid RVs. Other requirements may include the proper orientation and some minimum proximity of the distal domain relative to the UB.

[0425] The mechanistic understanding of the essential fusion process in kidney development is exceptionally limited. Forced proximalization of nephrons through NOTCH activation in mouse prohibited fusion with the CD4, but there are no other studies investigating the mechanisms underlying this process. The assembled organoids therefore have great potential in addressing these developmental knowledge gaps, and the system can be used to start to unravel key aspects regulating the ability of the distal nephron to fuse. It was shown that NOTCH inhibition was sufficient to promote GATA3+ connecting segments (FIG. 6F-J) while WNT activity was necessary and sufficient for GATA3 expression and fusion activity (FIG. 7A- F). Collectively, these data substantiate a model in which distal specification is a key deterministic event controlling fusion potential, and indeed the connecting segment marker GATA3 was sufficient to promote this behavior (FIG. 7G-I).

[0426] Conditions for augmenting the maturation of integrated UB-derived epithelia into AQP2+ CDs (FIG. 8C-E) through simultaneous inhibition of WNT43, TGFB44, and MEK / MAPK45 pathways were further defined. This approach enhanced many CD gene signatures and even improved maturation of proximal tubules, supporting that it can have a broadly beneficial role in promoting differentiation of kidney organoid epithelia.EXAMPLE 11Cell media

[0427] The following table exemplifies specific cell media that can be used.- Il l -

[0428] The various methods and techniques described above provide a number of ways to carry out the disclosure. Of course, it is to be understood that not necessarily all objectives or advantages described can be achieved in accordance with any particular embodiment described herein. Thus, for example, those skilled in the art will recognize that the methods can be performed in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other objectives or advantages as taught or suggested herein. A variety of alternatives are mentioned herein. It is to be understood that some preferred embodiments specifically include one, another, or several features, while others specifically exclude one, another, or several features, while still others mitigate a particular feature by inclusion of one, another, or several advantageous features.

[0429] Furthermore, the skilled artisan will recognize the applicability of various features from different embodiments. Similarly, the various elements, features and steps discussed above, as well as other known equivalents for each such element, feature or step, can be employed in various combinations by one of ordinary skill in this art to perform methods in accordance with the principles described herein. Among the various elements, features, and steps some will be specifically included and others specifically excluded in diverse embodiments.

[0430] Although the application has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the embodiments of the disclosure extend beyond the specifically disclosed embodiments to other alternative embodiments and / or uses and modifications and equivalents thereof.

[0431] In some embodiments, the numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the application are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon thedesired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the application are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.

[0432] In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment of the application (especially in the context of certain of the following claims) can be construed to cover both the singular’ and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (for example, “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the application and does not pose a limitation on the scope of the application otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the application.

[0433] Preferred embodiments of this application are described herein. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the application can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this application include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the application unless otherwise indicated herein or otherwise clearly contradicted by context.

[0434] All patents, patent applications, publications of patent applications, and other material, such as articles, books, specifications, publications, documents, things, and / or the like,referenced herein are hereby incorporated herein by this reference in their entirety for all purposes, excepting any prosecution file history associated with same, any of same that is inconsistent with or in conflict with the present document, or any of same that may have a limiting affect as to the broadest scope of the claims now or later associated with the present document. By way of example, should there be any inconsistency or conflict between the description, definition, and / or the use of a term associated with any of the incorporated material and that associated with the present document, the description, definition, and / or the use of the term in the present document shall prevail.

[0435] In closing, it is to be understood that the embodiments of the application disclosed herein are illustrative of the principles of the embodiments of the disclosure. Other modifications that can be employed can be within the scope of the application. Thus, by way of example, but not of limitation, alternative configurations of the embodiments of the application can be utilized in accordance with the teachings herein. Accordingly, embodiments of the present application are not limited to that precisely as shown and described.

Claims

CLAIMSWhat is claimed is:

1. A method of preparing a kidney organoid, the method comprising: a) mixing one or more ureteric bud (UB) progenitor(s) and one or more nephrogenic mesenchyme (NM) progenitor(s) as a tissue mixture; and b) co-culturing the tissue mixture to form a kidney organoid comprising a nephron-like structure and a collecting duct (CD) and / or CD-like structure.

2. The method of claim 1, further comprising culturing the organoid in conditions that promote epithelial fusion between a nephron-like structure and a CD and / or CD-like structure.

3. The method of claim 1 or 2, wherein the organoid is capable of drainage of fluid.

4. The method of any one of the preceding claims, wherein the UB progenitor is a UB spheroid derived from a first stem cell and / or wherein the NM progenitor is derived from a second stem cell.

5. The method of claim 4, wherein the first or second stem cell is a pluripotent stem cell, optionally a human pluripotent stem cell.

6. The method of any one of claims 4 or 5, wherein the UB spheroid is a UB spheroid from about day 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 of differentiation, optionally a spheroid between about day 4-8 of differentiation, optionally a spheroid from about day 6 of differentiation..

7. The method of any one of claims 4-6, wherein the UB spheroid is a selected UB spheroid, wherein the selected UB spheroid is selected for comprising a tip-like progenitor marker, or comprising cells exhibiting gene expression characteristics analogous to the UB progenitor cells present in the branching tips of a developing kidney in vivo.

8. The method of claim 7, wherein the tip-like progenitor marker is one or more of RET, GATA3, PAX2, ETV4, ETV5, WNT11, and / or SOX9.

9. The method of any one of the preceding claims, further comprising disassociating the NM progenitors prior to the mixing step.

10. The method of claim 9, wherein the NM progenitor is a selected at day 3, 4, 5, 6, 7, 8, 9, 10,11. 12, 13, or 14 of differentiation, optionally between about days 6-10 of differentiation, optionally at day 8 of differentiation.

11. The method of any one of the preceding claims, wherein the NM progenitor is a selected NM, wherein the selected NM is selected for comprising one or more undifferentiated nephron progenitor cell (NPC) marker.

12. The method of claim 11, wherein the marker is SIX2, SIX1, CITED1, and / or WT1.

13. The method of any one of the preceding claims, wherein the ratio of the NM progenitors to UB progenitors used in the mixing step ranges between about 1.0 x 102-1.0 x 105NM progenitors for every UB progenitor spheroid or between about 1.0 x 102-1.0 x 107NM progenitors for every UB progenitor spheroid.

14. The method of any one of claims 4-12, wherein the mixture of NM progenitors to UB spheroids is used to generate kidney organoids comprising between about 1.0 x 103-1.0 x 107aggregated NM progenitor cells and between about 10-1.0 x 104UB progenitor spheroids, optionally between about 0.2 x 106- 1.0 x 106NM progenitors are aggregated with about 20-100 UB progenitor spheroids.

15. The method of any one of the preceding claims, wherein the co-culturing step comprises inhibiting a rho-kinase (ROCK) pathway in the tissue mixture for a period of time of ROCK inhibition.

16. The method of claim 15, wherein the ROCK pathway is inhibited with one or more ROCK inhibitors.

17. The method of claim 16, wherein the ROCK inhibitor is selected from Y-27632, and / or Thiazovivin.

18. The method of any one of claims 15-17, wherein the ROCK pathway is inhibited starting at the mixing step, optionally within 1 hour of the mixing step.

19. The method of any one of claims 15-16, wherein the period of time of ROCK inhibition is for about 1-24 hours.

20. The method of any one of claims 15-16, wherein the period of time of ROCK inhibition is for at least about the first hour of the mixing step.

21. The method of any one of claims 15-19, wherein the period of time of ROCK inhibition is for about the first 5 hours of the mixing step.

22. The method of any one of claims 15-21, wherein the concentration of the ROCK inhibitor is about 0.1-200 uM, optionally 10 uM.

23. The method any one of the proceeding claims, wherein the co-culturing step comprises inhibiting a BMP signaling pathway in the tissue mixture for a period of time for BMP inhibition.

24. The method of claim 23, wherein the BMP pathway is inhibited with one or more BMP inhibitor selected from LDN193189, Dorsomorphin, and / or DMH-1.

25. The method of any one of claims 23-24, wherein the period of time for BMP inhibition begins about 0-48 hours after the mixing step for about 1-4 days.

26. The method of any one of claims 15-25, wherein the period of time for BMP inhibition is for at least about the first day of the mixing step.

27. The method of any one of claims 23-25, wherein the period of time for BMP inhibition is for about the first 2 days of the mixing step.

28. The method of any one of claims 23-27, wherein the concentration of the BMP inhibitor is about 50-1,000 nM, optionally about 200 nM.

29. The method any one of the preceding claims, wherein the co-culturing step comprises inhibiting a NOTCH signaling pathway in the tissue mixture for a period of time for NOTCH inhibition.

30. The method of claim 29, wherein the NOTCH pathway is inhibited with one or more NOTCH inhibitor selected from a gamma secretase inhibitor, and / or RBPJ inhibitor.

31. The method of claim 30, wherein the gamma secretase inhibitor is DAPT, Compound E, DBZ, LY450139 and / or BMP299897.

32. The method of any one of claims 29-31, wherein the period of time for NOTCH inhibition is for about 1-4 days and begins about 0-7 days after the mixing step.28a. The method of any one of claims 29-32, wherein the period of time for NOTCH inhibition is for at least about 1 day and begins on at least about 1 day after the mixing step.

33. The method of any one of claims 29-32, wherein the period of time for NOTCH inhibition is for about 2 days and begins on about day 4 of the mixing step.

34. The method of any one for claims 29-33, wherein the concentration of the NOTCH inhibitor is about is about 0.1 -200 uM, optionally 10 uM.

35. The method of any one of the preceding claims, wherein the co-culturing step comprises activating a WNT signaling pathway for a period of time for WNT activation.

36. The method of claim 35, wherein the method is for a developing kidney organoid, wherein the period of time for WNT activation is for at least about 2 days and begins at least about 2 days of the mixing step.

37. The method of claim 35 or 35, wherein the period of time for WNT activation is for about 2- 6 days and begins about 2-8 days of the mixing step.

38. The method of claim 35 or 37, wherein the period of time for WNT activation is for about 4 days and begins about 2-6 days of the mixing step.

39. The method of any one of claims 35-38, wherein the WNT signaling pathway is activated by a small molecule activator or by inducible genetic expression.

40. The method of claim 39, wherein the inducible genetic expression is of a WNT ligand.

41. The method of claim 39 or 40, wherein the WNT ligand is expressed by the UB progenitor.

42. The method of claim 39, wherein the small molecule is a WNT activator.

43. The method of any one of the preceding claims, wherein the co-culturing step comprises inhibiting a WNT, TGFB, and / or FGF / RTK9 signaling pathway in the tissue mixture for a period of time for WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition.

44. The method of claim 43, wherein the period of time for WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition begins about 0-14 days after the mixing step for about 1-7 days.

45. The method of claim 43, wherein the period of time for WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition begins at least about 1 day after the mixing step for at least about 1 day.

46. The method of any one of claims 43-44, wherein the period of time of WNT, TGFB, and / or FGF / RTK9 signaling pathway inhibition begins on about day 10 after mixing for about 4 days.

47. The method any one of the preceding claims, wherein the co-culturing step comprises budding and branching of the UB progenitor; elongation of tubules of the UB; increase in expression of genes associated with UB stalk fate; formation of CD-like tubule and / or CD; formation of CD-like tubule and / or CD that are interconnected and spanned throughout the organoid; decrease in expression of progenitor marker(s) of the UB progenitor and NM progenitor; formation of renal vesicles by the NM progenitor; polarization of NM; increase in expression of marker(s) of nephron segment differentiation; formation of nephron, nephron segment, nephron like segment, and / or nephron-like tubule; differentiation of podocytes, proximal tubules, distal tubules and / or the like; polarization of nephrons; increased expression of distal tubule marker! s); increased expression of UB stalk fate marker! s) or CD marker(s) ; expansion of a stromal compartment; direct connection of nephron, nephron segment, nephronlike segment, and / or nephron-like tubule to a CD-like tubule and / or CD; formation of anastomoses between nephrons, nephron segments, nephron like segments, and / or nephron like tubules and CD-like tubule or CD; fusion of a nephron distal tubule to a UB duct; fusion of a distal tubule to a AQP2+ CD; formation of uninterrupted epithelial structure across tubules; formation of continuous luminal membrane across the junctions of tubules; and / or the like.

48. The method of claim 47, wherein the marker of nephron segment differentiation is selected from JAG1, CDH6, CDH1, WT1, POU3F3, MECOM, HNF4A, GATA3, and HNF1B.

49. The method of claim 47 or 48, wherein the distal tubule marker is selected from GATA3, TFAP2A, TFAP2B, SOX9, EGR5, CAEB1 and / or CDH1.

50. The method of claim 47-49, wherein the marker of CD is selected from EEF5, SCNN1B, SCNN1G, KCNJ1, AVPR2, and / or AQP2.

51. The method of any one of the preceding claims, wherein the co-culturing step comprises a fusion event between a NM-derived epithelium and UB -derived epithelium, wherein the NM- derived component comprises one or more nephron, nephron segment, nephron like segment, and / or nephron-like tubule, and the UB -derived structure comprises one or more CD-like tubule, CD and / or UB duct.

52. The method of claim 51, wherein the fusion event occurs with a distal tubule and the UB- derived structure.

53. The method of any one of the preceding claims, wherein the co-culturing step comprises transferring the kidney organoid to hormone medium comprising a hormone after a period of time, optionally comprising inhibitors of WNT, TGFB, and / or FGF / RTK pathways.

54. The method of claim 53, wherein the hormone is selected from arginine vasopressin, aldosterone, and / or DDAVP.

55. The method of any one of claims 53 or 54, wherein the hormone medium is used transiently, optionally for 1, 2, 3, 4, 5, 6, or more days in a 5, 6, 7, 8, 9, 10, 11, 12, 13, or more day organoid after the mixing step.

56. The method of any one of the preceding claims, wherein the kidney organoid has at least 10- 40 or more epithelial connections between a NM-dcrivcd structure and a UB-dcrivcd structure.

57. The method of any one of the preceding claims, wherein the kidney organoid: a) has at least 50 (range 50-10,000) nephron-like structures; b) has at least 10 (range 10-200) CDs; and / or c) is about 3-6 (range 0.5-12) mm in size (diameter) and / or d) self-assembles.

58. The method of any one of the preceding claims, wherein the kidney organoid is functional, optionally wherein the kidney organoid comprises segmented nephrons and there is the capability of drainage of fluids from a nephron into a collecting system.

59. The method of any one of the preceding claims, wherein the kidney organoid, UB progenitor, and / or NM progenitor is labeled with a label.

60. The method of claim 59, wherein the label is a fluorescent protein.

61. The method of any one of the preceding claims, wherein the co-culturing step comprises culturing the tissue mixture on a membrane, optionally a permeable membrane.

62. The method of any one of the preceding claims, wherein the co-culturing step comprises airliquid cultures.

63. The method of any one of the preceding claims, wherein the kidney organoid is embedded in a basement membrane or extracellular matrix.

64. A method for inducing fusion of one or more nephron(s), nephron segment(s), nephron-like segment(s), and / or nephron-like tubule(s), and one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid, the method comprising culturing the tissue or organoid in a medium and inhibiting NOTCH signaling for a period of time.

65. The method of claim 64, wherein the NOTCH signaling is inhibited by a NOTCH inhibitor.

66. The method of claim 65, wherein the NOTCH inhibitor is a gamma secretase inhibitor and / or RBPJ inhibitor.

67. The method of claim 66, wherein the gamma secretase inhibitor is DAPT, Compound E, DBZ, LY450139 and / or BMP299897..

68. The method of any one of claims 64-67, wherein the period of time is for about 1-5 days.

69. The method of any one of claims 64-68, wherein the period of time is for about 3 days.

70. The method of any one of claims 64-69, wherein the method is for a developing kidney organoid, and a NOTCH pathway is inhibited from about day 0-7 after mixing one or more UB progenitor and one or more NM progenitor for about 1-4 days.

71. The method of any one of claims 64-70, wherein the method is for a developing kidney organoid, and a NOTCH pathway is inhibited from at least about day 0-7 after mixing one or more UB progenitor and one or more NM progenitor for at least about 1 day.

72. The method of any one of claims 64-71, wherein the method is for a developing kidney organoid, and a NOTCH pathway is inhibited from day 4-6 of mixing one or more UB progenitor and one or more NM progenitor.

73. The method of any one of claims 64-72, wherein a number of fusion events is increased by at least 1% compared to a tissue or organoid cultured without NOTCH inhibition.

74. The method of any one of claims 64-73, wherein distal nephron formation of the organoid or tissue is increased by at least 1% compared to a compared to a tissue or organoid without NOTCH inhibition.

75. The method of any one of claims 64-74, wherein expression of a distal nephron marker is increased by at least 1% compared to a tissue or organoid without NOTCH inhibition.

76. The method of claims 64-75, wherein the distal nephron marker is GATA3, POU3F3, MECOM, TFAP2A, TFAP2B and / or SOX9.

77. The method of any one of claims 64-76, wherein a ratio of distal segmentation : proximal segmentation in the organoid or tissue is increased by at least 1% compared to a compared to a tissue or organoid without NOTCH inhibition.

78. The method of any one of claims 64-77, wherein the concentration of the inhibitor is between l-30uM.

79. A method for inducing terminal maturation of one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid, the method comprising culturing the tissue or organoid in a medium and inhibiting WNT, TGFB, and / or FGF / RTK signaling for a period of time.

80. The method of claim 79, wherein the Wnt signaling is inhibited by a Wnt inhibitor, the TGFB signaling is inhibited by a TGFB inhibitor, and / or the FGF / RTK signaling is inhibited by a FGF / RTK inhibitor.

81. The method of claim 79 or 80, wherein the period of time is for about 1-7 days.

82. The method of any one of claims 79-81, wherein the period of time is for about 4 days.

83. The method of any one of claims 79-82, wherein the method is for a developing kidney organoid, and a WNT, TGFB, and FGF / RTK signaling pathway is inhibited from at least about day 7 of mixing one or more UB progenitor and one or more NM progenitor for at least 1 day.

84. The method of any one of claims 79-83, wherein the method is for a developing kidney organoid, and a WNT, TGFB, and FGF / RTK signaling pathway is inhibited from about day 7-21 after mixing one or more UB progenitor and one or more NM progenitor.

85. The method of any one of claims 79-84, wherein the method is for a developing kidney organoid, and a WNT, TGFB, and FGF / RTK signaling pathway is inhibited from about day 10- 14 after mixing one or more UB progenitor and one or more NM progenitor.

86. The method of any one of claims 80-85, wherein the WNT inhibitor is selected from XAV939, Wnt-C59, IWR-1, IWP-2, IWP-3, and IWP-4, optionally at a concentration of about 0.1-10 uM.

87. The method of any one of claims 80-86, wherein the TGFB inhibitor is selected from A83- 01, SB43, and SIS3, optionally at a concentration of about 0.1-10 uM.

88. The method of any one of claims 80-87, wherein the FGF / RTK inhibitor is selected from U0126, SU5402, PD98059, and PD0325901, optionally at a concentration of about 1-50 uM.

89. The method of any one of claims 79-88, wherein terminal maturation of one or more CD-like tubule(s), CD(s), and / or UB duct(s)in a kidney tissue or organoid is increased by at least 1% compared to a compared to a tissue or organoid without WNT, TGFB, and / or FGF / RTK inhibition during development.

90. The method of any one of claims 79-89, wherein expression of a CD marker marker is increased by at least 1% compared to a tissue or organoid without WNT, TGFB, and / or FGF / RTK inhibition.91 . The method of claim 90, wherein the marker is AQP2, SCNN1G, and / or ELF.

92. A method for increasing distal nephron tubules and / or improving the frequency of fusion events in a kidney tissue or organoid in a kidney tissue or organoid, the method comprising culturing the tissue or organoid in a medium and activating WNT for a period of time.

93. The method of claim 92, wherein the WNT signaling pathway is activated by a small molecule activator or by inducible genetic expression.

94. The method of claim 93, wherein the inducible genetic expression is of a WNT ligand.

95. The method of claim 94, wherein the WNT ligand is expressed by the UB progenitor.

96. The method of any one of claims 93-95, wherein the small molecule is a WNT activator.

97. The method of claim 96, wherein the WNT activator is CHIR99021 , BIO, optionally at a concentration of 1-15 uM.

98. The method of any one of claims 92-97, wherein the method is for a developing kidney organoid, wherein the period of time for WNT activation is for at least about 2 days and begins at least about 2 days of the mixing step.

99. The method of any one of claims 92-98, wherein the method is for a developing kidney organoid, wherein the period of time for WNT activation is for about 2-6 days and begins about 2-8 days of the mixing step.

100. The method of any one of claims 92-99, wherein the method is for a developing kidney organoid, wherein the period of time for WNT activation is for about 4 days and begins about 2- 6 days of the mixing step.

101. The method of any one of claims 92-100, wherein a distal nephron tubules and / or improving the frequency of fusion events in a kidney tissue or organoid is increased by at least 1% compared to a compared to a tissue or organoid without WNT activation during development.

102. An in vitro kidney organoid derived from stem cells, comprising one or more collecting duct (CD)-like structure, CD-like tubule, and / or CD.

103. An in vitro kidney organoid prepared by the method of any of claims 1-101, comprising one or more collecting duct (CD)-like structure, CD-like tubule, and / or CD.

104. The in vitro kidney organoid of claim 102 or 103, wherein the organoid comprises a population of cells derived from one or more NM progenitor and a population of cells derived from one or more UB progenitor.

105. The in vitro kidney organoid of any one of claims 102-104, wherein the population of cells derived from NM express NPHS1, NPHS2, HNF4A, SLC12A1, GATA3, and / or the like.

106. The in vitro kidney organoid of any one of claims 102-105, wherein the population of cells derived from UB express GATA3, ELF5, CALB1, AQP2, SCNN1B, and / or the like.

107. The in vitro kidney organoid of any one of claims 102-106, wherein the organoid comprises one or more NM-derived structure(s) and one or more UB-derived structure(s).

108. The in vitro kidney organoid of any one of claims 102-107, wherein the NM-derived structure comprises one or more nephron, nephron-like structure, nephron-like segment, nephron-like tubules, and / or the like.

109. The in vitro kidney organoid of any one of claims 102-108, wherein the organoid comprises nephron, ureteric, stromal, and endothelial lineages.

110. The in vitro kidney organoid of any one of claims 102-109, wherein the organoid comprises an expansion of a stromal compartment.

111. The in vitro kidney organoid of any one of claims 102-110, wherein the organoid comprises direct connection of nephron tubules to CD-like tubule or CD.

112. The in vitro kidney organoid of claim 111, wherein the nephron tubule is a distal tubule.

113. The in vitro kidney organoid of any one of claims 102-112, wherein the organoid comprises anastomoses between nephron and / or nephron segments and CD-like tubule or CD.

114. The in vitro kidney organoid of any one of claims 102-113, wherein the organoid comprises nephron segments comprising podocyte, proximal tubule, and / or thick ascending limb.

115. The in vitro kidney organoid of any one of claims 102-114, wherein the organoid comprises uninterrupted epithelial structure across one or more tubules.

116. The in vitro kidney organoid of any one of claims 102-115, wherein the organoid comprises continuous luminal membrane across the junctions of two or more tubules.

117. The in vitro kidney organoid of any one of claims 102-116, wherein the organoid is functional and / or self assembles.

118. The in vitro kidney organoid of any one of claims 102-117, wherein the organoid is capable of carrying out drainage of fluids from a nephron.

119. The in vitro kidney organoid of any one of claims 102-118, wherein the in vitro kidney organoid is derived from a co-culture of one or more NM progenitor and one or more UB progenitor.

120. The in vitro kidney organoid of any one of claims 102-119, wherein the NM progenitor and the UB progenitor are each derived from pluripotent stem cells.

121. The in vitro kidney organoid of any one of claims 102-120, wherein the pluripotent stem cells comprise embryonic stem cells or induced pluripotent stem cells.

122. The in vitro kidney organoid of any one of claims 102-121, wherein the in vitro kidney organoid is embedded in a basement membrane matrix.

123. The in vitro kidney organoid of any one of claims 102-122, wherein the in vitro kidney organoid is in suspension culture.

124. The in vitro kidney organoid of any one of claims 102-123, wherein the in vitro kidney organoid is an artificial kidney organoid and / or is generated in vitro.

125. The in vitro kidney organoid of any one of claims 102-124, wherein the in vitro kidney organoid is three-dimensional.

126. The in vitro kidney organoid of any one of claims 102-125, wherein the in vitro kidney organoid has matured to comprise epithelial structures representing nephron segments, optionally wherein the nephron segments comprise podocytes, proximal tubules, loops of Henle, and / or distal tubules.

127. The in vitro kidney organoid of claim 126, wherein the distal tubules comprise thick ascending limb (TAL) of the loop of Henle (LOH) and a short connecting segment (CNT)128. The in vitro kidney organoid of any one of 92-127, wherein the organoid comprises at least about 33% nephron epithelial cells.

129. The in vitro kidney organoid of any one of 92-128, wherein the organoid comprises, at least about 3%-20.1% ureteric epithelium (UrEp).

130. The in vitro kidney organoid of any one of 92-129, wherein the organoid comprises less than about 47% stroma cells.

131. The in vitro kidney organoid of any one of 92-130, wherein the organoid comprises less than about 1.5% NPC-like cells.

132. The in vitro kidney organoid of any one of 92-131, wherein the organoid comprises between about 0.01% - 0.37% endothelial cells.

133. The in vitro kidney organoid of any one of 92-132, wherein the organoid comprises, within an epithelial cell population, at least about 9.60% podocytes.

134. The in vitro kidney organoid of any one of 92-133, wherein the organoid comprises, within an epithelial cell population, at least about 17.13% proximal tubule cells.

135. The in vitro kidney organoid of any one of 92-134, wherein the organoid comprises, within an epithelial cell population, at least about 8.5% distal tubule cells.

136. The in vitro kidney organoid of any one of 92-135, wherein the organoid comprises, within an epithelial cell population, about 1.78% - 5.13% LOH / TAL cells.

137. The in vitro kidney organoid of any one of 92-136, wherein the organoid comprises, within an epithelial cell population, about 1.35%- 17.17% collecting duct cells138. An in vitro composition comprising the in vitro kidney organoid of any of claims 102-137.

139. The in vitro kidney organoid of any of claims 102-137, or the composition of claim 138, for use in a method of treating a kidney-related disease or disorder or symptom, a method of scaling up in bioprocess manufacturing, a method of screening for therapeutic efficacy, a method forscreening for kidney toxicity, a method of modeling human kidney development and / or disease, a method of diagnosing a kidncy-rclatcd disease or disorder, and / or the manufacture of a medicament for treating a kidney -related disease or disorder.

140. Use of the in vitro kidney organoid of any of claims 102-137, or the composition of claim 138, a method of treating a kidney -related disease or disorder or symptom, a method of scaling up in bioprocess manufacturing, a method of screening for therapeutic efficacy, a method for screening for kidney toxicity, a method of modeling human kidney development and / or disease, a method of diagnosing a kidney-related disease or disorder, or the manufacture of a medicament for treating a kidney-related disease or disorder or symptom.

141. A method comprising administering the in vitro kidney organoid or composition of any one of claims 102-138 to a subject in need thereof.

142. A method of treating a kidney-related disease or disorder in a subject in need thereof, the method comprising administering the in vitro kidney organoid of any one of claims 102-137, or the composition of claim 138, to the subject.

143. The method of claims 142, wherein administering comprises transplanting the in vitro kidney organoid of any one of claims 102-137, or the composition of claim 1 8, into the subject.

144. The method of any one of claims 142-143, wherein the subject is a mammal.

145. The method of any one of claims 142-144, wherein the subject is a mouse, rat, or a human.

146. The method of any one of claims 142-145, wherein the in vitro kidney organoid is transplanted after culturing for 1 day, 2 days, 3, days, 4 days, 5 days, 6 days, 7 days to 60 days, or longer, in vitro, in step e).

147. The method any one of claims 142-146, wherein the in vitro kidney organoid is transplanted after 3 days after the mixing step according to claim 1.

148. The method of any one of claims 142-147, wherein the in vitro kidney organoid, following transplant, engrafts under the kidney capsule of the subject.

149. The method of any one of claims 142-148, wherein transplanting the in vitro kidney organoid to the subject comprises organoid engraftment, tissue growth, and / or improved tissue and / or organ function.

150. The method of any one of claims 142-149, wherein the in vitro kidney organoid, following transplant, matures in vivo.

151. The method of any one of claims 142-150, wherein the in vitro kidney organoid, following transplant, comprises fusion events between one or more NM-derived cell and one or more UB- derived cell, wherein the NM-derived cell comprises one or more nephron, nephron segment, nephron like segment, and / or nephron-like tubule, and the UB-derived structure comprises one or more CD-like tubule, CD, and / or UB duct.

152. The method of any one of claims 142-151, wherein the in vitro kidney organoid, following transplant, comprises an increase of anastomoses between a nephron, nephron segment, nephron like segment, and / or nephron-like tubule and a CD-like tubule, CD and / or UB duct.

153. The method of claim 152, wherein the increase is by at least 1% after about 6-30 days of growth.

154. The method of any one of claims 142-153, wherein the in vitro kidney organoid, following transplant, is functional, optionally wherein the organoid is capable of drainage.

155. The method of any of claims 142-154, wherein the subject has a kidney-related disease or disorder.

156. The method of claim 155, wherein the kidney -related disease or disorder is selected from one or more of chronic kidney disease, primary kidney disease, non-diamerulonephritis, glomerulonephritis, interstitial nephritis, diabetic kidney disease, diabetic nephritis, thread. Glomerulonephritis, rapidly progressive glomerulonephritis, renal fibrosis, Alport syndrome, insulin-dependent diabetic (IDDM) nephritis, mesangium proliferative glomerulonephritis, membuloproliferative glomerulonephritis, meniclimatogenic glomerulonephritis, Interstitial nephritis, Focal segmental glomerulonephritis, Membranenephritis, Microvariant nephrosissyndrome, pauci-immune type rapidly progressive glomerulonephritis, IgA nephritis, Multiple cystic kidney, Dent disease , Ncphritistinosis, Hayman nephritis, autosomal dominant (adult) multiple cystic kidneys, autosomal recessive (pediatric) multiple cystic kidneys, acute nephropathy, nephrosis syndrome, renal ischemitis, podocyte disease or disorder , Glomerulonephritis, glomerulonephritis, medullomerulonephritis, focal segmental glomerulonephritis, preplonephritis, glomerulonephritis, kidney lesions, glomerulonephritis, benign orthostatic (positional) glomerulonephritis, IgM kidney Disease, medulronephritis, sarcoidosis, diabetes, drug-induced kidney damage, Fabry's disease, amino aciduria, Fanconi syndrome, hypertensive nephritis, interstitial nephritis, sickle erythema, hemoglobinuria, myoglobinuri Disease, Wegenerulonephritis, Type 1 glomerulonephritis, Chronic kidney disease, Chronic renal failure, low glomerulonephritis (GFR), renal vascular sclerosis, lupus nephritis, ANCA-positive pauci-immune type glomerulonephritis Glomerulonephritis, Chronic transplant nephropathy, Nephritis, Kidney injury, Glomerulonephritis and tubule damage, Renal dysfunction, Nephritis syndrome, Acute renal failure, Chronic renal failure, Proximal tubule dysfunction, Acute kidney transplant rejection, chronic kidney transplant rejection, non-IgA mesangial proliferative glomerulonephritis, post-infectious glomerulonephritis, vasitis with any type of nephropathy, any hereditary kidney disease, any interstitial Nephritis, kidney transplant failure, kidney cancer, kidney disease with other symptoms (eg, hypertension, diabetes, and autoimmune disease), dent disease, nephropathy, Hayman nephritis, primary kidney disease, collapse Glomerulonephritis, dense deposit disease, cryoglomerulonephritis-related glomerulonephritis, Henoch-Schoenlein's disease, post-infectious glomerulonephritis, bacterial endometriitis, micromicroangonephritis, Charg-Strauss syndrome, anti-GBM Antibody-mediated glomerulonephritis, amyloidosis, monoclonal immunoglobulin deposition, fibrillar thread Spheroid nephritis, immunotactoid glomerosis, ischemic tubule injury, drug-induced tubule interstitial nephritis, addictive tubulointerstitial nephritis, infectious tubulointerstitial nephritis, bacterial nephritis, poly Virus-infectious tubulointerstitial nephritis caused by Omavirus or HIV infection, metabolism-induced tubule interstitial disease, mixed connective tissue disease, columnar nephropathy, uric acid crystal or oxalate crystal or drug-induced crystal Crystalline nephropathy due to deposition, neoplastic invasive disease due to acute cellular tubulointerstitial allogeneic transplant rejection, lymphoma or post-transplant lymphoproliferative disorder,obstructive kidney disease, vascular disease, Thrombotic microangiopathy, renal vascular sclerosis, atherosclerotic disease, mixed connective tissue disease, nodular polyarteritis, carcinulin inhibitor-induced vascular disease, acute cellular vascular- allogeneic transplant rejection, acute humoral allogeneic Transplant rejection, early renal dysfunction (ERFD), endstage renal disease (ESRD), renal vein thrombosis, acute tubule necrosis, acute interstitial nephritis, existing chronic kidney disease, renal artery stenosis, ischemic Includes nephropathy, urinary toxicosis, drug-induced and toxic-induced chronic tubulointerstitial nephritis, reflux nephropathy, renal stones, Good Pasture syndrome, hydronephropathy, and / or the like.

157. The method of any of claims 142-156, wherein the subject has an increased survival rate following transplantation.

158. The method of any of claims 142-157, wherein the in vitro kidney organoid is produced from pluripotent stem cells derived from the subject.

159. A method for screening a compound or composition, wherein the compound or composition to be screened comprises one or more exogenous agent, the method comprising: contacting the in vitro kidney organoid of any of claims 102-137 with the compound or composition of claim 138; culturing the in vitro kidney organoid with the compound or composition for a period of time; and assessing one or more effects of the compound or composition on the in vitro kidney organoid, thereby screening the compound or composition.

160. The method of claim 159, wherein the assessed effect comprises therapeutic efficacy and / or toxicity of the compound or composition.

161. A kit comprising means for preparing a kidney organoid, comprising any medium described herein.

162. A kit comprising means for preparing a kidney organoid according to any one of claims 102-137, or for performing the method according to any one of claims 1-101 or 141-160, comprising any medium described herein.

163. A kit for screening for therapeutic efficacy of a compound for a kidney -related disease or disorder comprising reagents sufficient for performing an assay for assessing effects of the compound, comprising the kidney organoid according to any one of claims 102-137.

164. A kit for screening for nephrotoxicity of a compound comprising reagents sufficient for performing an assay for at least one nephrotoxicity marker comprising the kidney organoid according to any one of claims 102-137.

165. The kit of any of claims 163-164, wherein one or more of the kit components are provided in separate vials.

166. The kit of any of claims 163-165, wherein one or more of the kit components are pre-loaded onto one or more assay platform.

167. The kit of any of claims 163-166, wherein one or more of the kit components are prefrozen.

Images