Improvement to methods for enriching and detecting a target polynucleotide in a sample
A PCR-based method with a blocking oligonucleotide and controlled temperature changes enriches and detects low-concentration mutant DNA, addressing sensitivity and specificity issues in cancer diagnostics, enhancing cancer diagnosis and treatment.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-08
- Publication Date
- 2026-03-12
AI Technical Summary
Existing methods for detecting genetic mutations in a sample with a low concentration of mutant DNA relative to wild-type DNA lack adequate sensitivity and specificity, leading to inaccurate cancer diagnosis and treatment decisions.
A method involving a polymerase chain reaction (PCR) with a blocking oligonucleotide that selectively hybridizes to the reference polynucleotide, followed by controlled temperature changes to enrich the target polynucleotide, allowing for its selective amplification and detection even at low concentrations.
The method achieves a remarkable enrichment of the target polynucleotide to greater than 99% of the amplification product, enabling sensitive and specific detection of genetic alterations, particularly in liquid biopsies, improving cancer diagnosis and treatment strategies.
Smart Images

Figure 00000079_0000 
Figure 00000079_0001 
Figure 00000079_0002
Abstract
Description
[0001] 17038.003W01
[0002] IMPROVEMENT TO METHODS FOR ENRICHING AND DETECTING A TARGET
[0003] POLYNUCLEOTIDE IN A SAMPLE
[0004] CROSS-REFERENCE TO RELATED APPLICATION
[0005] This application claims priority to United States Provisional Application Number 63 / 692,347 that was filed on September 9, 2024. The entire content of the applications referenced above is hereby incorporated by reference herein.
[0006] FIELD
[0007] The field of the invention relates to methods for detecting a target polynucleotide in a sample comprising a mixture of the target polynucleotide and a reference (non-target) polynucleotide. In particular, the field of the invention relates to methods for detecting a target polynucleotide that comprises a genetic alteration relative to a reference polynucleotide in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, where the target polynucleotide represents a relatively small percentage of the mixture. The methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the genetic alteration.
[0008] BACKGROUND
[0009] Genetic mutations and epigenetic modifications are known to be associated with cancer and other diseases. The ability to detect genetic mutations epigenetic modifications in cell-free DNA using a minimally invasive sample can be used in many different diagnostic areas, such as companion diagnostics, monitoring minimum residual disease, monitoring cancer recurrence, or as a prospective aid in diagnosing cancer.
[0010] Early diagnosis of cancer, cancer recurrence or treatment resistant mutations can improve patient outcomes. Low sensitivity is important for early diagnosis, because mutant DNA represents a small percentage of DNA in biological sample relatively to wild-type DNA. High specificity is also important because of the negative impacts on patient health when a patient undergoes unnecessary cancer treatment, such as chemotherapy based on a false positive diagnosis. One challenge to genetic diagnostics remains accurately determining the presence or absence of a mutation, when the mutant DNA can be present at very low concentrations compared to the wild-type DNA in a sample comprising a mixture of the mutant DNA and wild-type DNA. 17038.003W01
[0011] Improving accuracy encompasses both specificity (reducing false-positives), and sensitivity (reducing false-negatives). A threshold is used to define the barrier between a negative sample in which a mutation is absent and a positive sample where a mutation is present. This threshold is used to calculate the specificity and sensitivity of the method being used to detect the mutation. Similarly, the signal to noise ratio can be used to assess the accuracy of a method, where the signal represents the result when the mutation is present, and the noise represents the result when a mutation is absent. A method is more accurate as the separation between the signal and the noise becomes greater. A method cannot be more sensitive than the noise of the method. Therefore, the noise of a method can be viewed as the limit of detection for that method. Improving the limit of detection can enable new utility of a test, particularly for early cancer detection.
[0012] One approach to increasing the sensitivity of a method is to reduce the noise of the method. Reducing the noise involves understanding how noise is created and how changes to the method impact the total noise of the system based on upstream and downstream steps. One approach to increasing the signal to noise ratio is to enrich the sample for the mutant. Enrichment may involve preferentially inhibiting or preventing the replication of wild type DNA relative to mutant DNA during polymerase chain reaction (PCR). In such enrichment, each cycle of PCR results in the mutant being present at a higher percentage compared to the previous cycle. Many methods have been developed, with some examples being allelespecific PCR, peptide nucleic acid (PNA) clamping, locked nucleic acid (LNA) blocking, and Co-amplification at lower denaturation temperature PCR (COLD-PCR). However, no enrichment methods to date have been able to achieve adequate sensitivity and specificity.
[0013] As such, there remains a need for reducing the noise in the molecular diagnostics. This would benefit patients, particular regarding cancer diagnosis, by using liquid biopsy to determine the presence or absence of certain mutations associated with cancer. This could be applied to the various cancer diagnostic areas, such as companion diagnostics, molecular residual disease, minimum residual disease, cancer recurrence, treatment response monitoring, treatment resistance monitoring, or screening.
[0014] SUMMARY
[0015] One approach to reducing the noise in molecular tests is to enrich the rare mutant, or cancer DNA, prior to detection step. If the percentage of the rare mutant is increased during the replication step, and it is increased above the noise of the detection step, then the noise 17038.003W01 from the detection step is no longer relevant to the noise of the method. In this case, the noise of the replication step represents the noise of the system.
[0016] The previously known enrichment methods are effective at increasing the percentage of mutant DNA. However, these methods have limited commercial utility because they do not replicate wildtype DNA. This means that the previously known methods cannot distinguish between a sample that is 100% wildtype DNA and a process failure. An example of a process failure would be where a technician neglects to add the sample, which contains the DNA, to the reaction. In this situation, there is no internal control to confirm the presence of any DNA. There is a specific need for a method that can both enrich a sample for mutant DNA and still replicate normal DNA to ensure the process was successfully completed.
[0017] In certain embodiments, the present invention provides a method for enriching a target polynucleotide in a sample comprising a mixture of the target polynucleotide and a non-target polynucleotide, where the target polynucleotide represents a relatively small percentage of the mixture. In certain embodiments, the method is used to selectively enrich a target polynucleotide via amplification relative to the non-target polynucleotide. In certain embodiments the method is used to accurately detect the target polynucleotide via sequencing when the target polynucleotide is present at a copy number lower than 10, and / or when the target polynucleotide represents less than about 0.05% of the mixture comprising the target polynucleotide and the non-target polynucleotide. In some embodiments, the present method achieves an enrichment in which the target polynucleotide represents greater than about 99% of the amplification product (i.e., greater than about 99% of sequencing reads). In certain embodiments, the present method achieves an enrichment of greater than 1800-fold the target polynucleotide. In some embodiments, the disclosed methods are performed to detect a target polynucleotide containing genetic alteration relative to a reference polynucleotide in a sample. In certain embodiments, the sample comprises a mixture of the target polynucleotide and the reference polynucleotide. As used herein, a “reference polynucleotide” is a non- target polynucleotide (e.g., non-cancer or wildtype of the polynucleotide). In certain embodiments the methods are used to detect with high sensitivity and high selectivity a target polynucleotide in a mixture of the target polynucleotide and the reference polynucleotide where the target polynucleotide is present at a relatively low concentration in the sample (e.g., less than about 10 copies) and the target polynucleotide represents a low percentage of the mixture comprising the target polynucleotide and the reference polynucleotide (e.g., less than about 0.05% of the mixture). In certain embodiments the methods are adapted for 17038.003W01 diagnosing, prognosing, and treating subjects having a disease or disorder associated with a detected genetic alteration.
[0018] In some embodiments, provided herein is a method for enriching a target polynucleotide if present in a sample, the method comprising the steps of:
[0019] (a) preparing a reaction mixture comprising:
[0020] (1) the sample, wherein the sample possibly comprises a target polynucleotide having a genetic alteration, and comprises a reference polynucleotide lacking the genetic alteration;
[0021] (2) a polymerase;
[0022] (3) one or more primer oligonucleotides; and
[0023] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide;
[0024] (b) increasing the temperature of the reaction mixture above the melting temperature of the reference polynucleotide and the target polynucleotide if present;
[0025] (c) reducing the temperature of the reaction mixture to a temperature below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but above the melting temperature of the one or more primer oligonucleotides, wherein the one or more primer oligonucleotides hybridize to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0026] (d) reducing the temperature of the reaction mixture to allow the one or more primers to hybridize to the reference polynucleotide or target polynucleotide if present;
[0027] (e) extending the one or more primers hybridized to the reference polynucleotide or target polynucleotide if present;
[0028] (f) repeating steps (b) through (e) for two or more cycles to enrich target polynucleotide if present; and
[0029] (g) repeating steps (b), (d) and (e) for two or more cycles to replicate both the reference polynucleotide and the target polynucleotide if present.
[0030] In some embodiments, provided herein is a method for enriching a target polynucleotide having a genetic alteration in a sample, the method comprising the steps of:
[0031] (a) preparing a reaction mixture comprising: 17038.003W01
[0032] (1) the sample, wherein the sample possibly comprises a target polynucleotide having a genetic alteration, and comprises a reference polynucleotide lacking the genetic alteration;
[0033] (2) a polymerase;
[0034] (3) one or more primers; and
[0035] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration;
[0036] (b) subjecting the reaction mixture to a temperature or a set of temperatures wherein the reference polynucleotide hybridizes to the blocking oligonucleotide prior to the one or more primers extending the reference polynucleotide;
[0037] (c) subjecting the reaction mixture to a temperature or a set of temperatures wherein the amount or percentage of reference polynucleotides that are hybridized to the blocking oligonucleotides prior to the primers extending the reference polynucleotides is reduced.
[0038] Polynucleotide hybridization is a dynamic process which can be altered by changing time or temperature of the reaction. Polynucleotide hybridization is impacted by the concentration of the primer and the concentration of the target polynucleotide or the reference polynucleotide. Polynucleotide hybridization is impacted by the ratio between the primer and the target polynucleotide or the reference polynucleotide. The ratio of the primer to the target polynucleotide or the reference polynucleotide changes during amplification reaction. Polynucleotide hybridization is also impacted by the rate of temperature change. Polynucleotide hybridization is also impacted by the volume of the reaction.
[0039] In some embodiments, the amount or concentration of primer is high compared to the amount or concentration of the blocker. In some embodiments, this enables to primer to hybridize to the reference polynucleotide or the target polynucleotide prior to the blocker. In some embodiments, this improves the reduction in preferential amplification of the target polynucleotide compared to the reference polynucleotide.
[0040] In some embodiments, the blocker annealing temperature is step is removed or skipped to reduce the preferential amplification of the target polynucleotide compared to the reference polynucleotide. 17038.003W01
[0041] In some embodiments, the amount of time between the polynucleotide denaturing step and the primer annealing step is decreased to reduce the preferential amplification of the target polynucleotide compared to the reference polynucleotide.
[0042] In some embodiments, the rate at which the temperature of the reaction is increased or decreases is altered. In some embodiments, increasing or decreasing the rate at which the temperature of the reaction is increased or decreased will either increase or reduce the preferential replication of the target polynucleotide compared to the reference polynucleotide.
[0043] In some embodiments, the PCR parameters of one or more of temperature, time or ramp rate replicate the target polynucleotide which preventing the replication of the reference polynucleotide. In some embodiments, the PCR parameters of one or more of temperature, time, or ramp rate, are changed to increase the replication of the reference polynucleotide.
[0044] In some embodiments, the PCR is an isothermal PCR.
[0045] In some embodiments, there are one or more blocking oligonucleotides.
[0046] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses a switch-blocker.
[0047] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses Blocker Displacement Amplification.
[0048] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses a Xenonucleic Acid (XNA).
[0049] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses the COLD-PCR method.
[0050] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses the ice COLD-PCR method.
[0051] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses the full COLD-PCR method.
[0052] In some embodiments, the preferential amplification of the target polynucleotide compared to the reference polynucleotide uses PNA Clamping.
[0053] In some embodiments, a detection step is used after the method. In some embodiments, the detection step is a quantitative PCR. In some embodiments, the detection step is a digital PCR. In some embodiments, the detection step is droplet digital PCR. In some embodiments, the detection step is DNA sequencing. In some embodiments, the detection step is Sanger sequencing. In some embodiments, the detection step is nextgeneration sequencing. 17038.003W01
[0054] In some embodiments, another PCR reaction occurs after the method. In some embodiment this PCR reaction contains one or more primers, which are partially or full nested. Partially or fully nested primer or primers increase the sensitivity and / or the specificity of the method.
[0055] In some embodiments, a touch down PCR is used in the method. In some embodiments, a touch down PCR increases the sensitivity and / or the specificity of the method.
[0056] In certain embodiments, the disclosed method includes performing a polymerase chain reaction (PCR) amplification, where the product is subsequently sequenced to detect the target polynucleotide. In certain embodiments, the PCR reaction includes: (1) the sample or a fraction of the sample; (2) a thermostable DNA polymerase that lacks 5 '- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity (i.e., 3 '- 5' proofreading activity) and preferably has an error rate that is less than about 1 O’6(i.e., a high fidelity DNA polymerase); (3) a pair of primers that flank the genetic alteration to be detected in the method; and (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex (where the reference polynucleotide is a nontarget polynucleotide) at a hybridization site that does not overlap with the hybridization sites for the pair of primers, thereby selective blocking amplification of the reference polynucleotide and enriching amplification of the target polynucleotide. In certain embodiments, the blocker hybridizes at hybridization site that is located at a position that is greater than 5, 10, 15, 20, 25, 30, 40, 50, 60, or 70 base pairs from the terminal nucleotide of the oligonucleotide that is being extended. In certain embodiments, after PCR amplification, the amplification product thereby obtained is subjected to sequencing to detect the target polynucleotide. In certain embodiments, the disclosed methods achieve a remarkable level of enrichment where the target polynucleotide represents greater than 99% of sequenced amplification product (i.e., greater than about 99% of sequencing reads), representing a greater than 700-fold enrichment.
[0057] In certain embodiments, the blocking oligonucleotide hybridizes selectively to the reference polynucleotide (which lacks the genetic alteration) as compared to the target nucleotide. Selective nucleic acid hybridization is a molecular biology technique that allows a single-stranded nucleic acid sequence to bind specifically to a complementary sequence, forming a stable double-stranded molecule. This process is controlled by 17038.003W01 stringency conditions, such as temperature and ionic strength, which are adjusted to favor binding with the desired target while minimizing non-specific binding to other sequences.
[0058] In certain embodiments the PCR reaction allows for the blocking oligonucleotide to hybridize to the reference oligonucleotide or target oligonucleotide at a temperature above the melting temperature of the primer oligonucleotide. In certain embodiments, after PCR amplification, the amplification product thereby obtained is subjected to sequencing to detect the target polynucleotide. In certain embodiments, the disclosed methods achieve a remarkable level of enrichment where the target polynucleotide represents greater than 99% of sequenced amplification product (i.e., greater than about 99% of sequencing reads), representing a > 700-fold enrichment.
[0059] In certain embodiments the PCR reaction preferentially replicates the target polynucleotide compared to the reference polynucleotide. In certain embodiments the PCR reaction then reduce the preferential replication of the target polynucleotide compared to the reference polynucleotide.
[0060] In certain embodiments, the blocking oligonucleotide comprises one or more modified nucleotides that enhance selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.
[0061] In certain embodiments, the blocking oligonucleotide has a length of between 8 and 20 nucleotides.
[0062] In certain embodiments, the blocking oligonucleotide has a length of between 10 and 15 nucleotides.
[0063] In certain embodiments, the genetic alteration comprises a substitution.
[0064] In certain embodiments, the genetic alteration comprises a deletion.
[0065] In certain embodiments, the genetic alteration comprises an insertion.
[0066] In certain embodiments, the sample is a liquid biopsy (LB).
[0067] In certain embodiments, the sample is a biological fluid.
[0068] In certain embodiments, provided herein is a method for enriching in a sample a double-stranded target polynucleotide having a genetic alteration to obtain an amplification product, the method comprising the steps of:
[0069] (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: 17038.003W01
[0070] (1) the sample or a fraction of the sample, and a reference polynucleotide lacking the genetic alteration;
[0071] (2) a DNA polymerase;
[0072] (3) a pair of primers that flank the genetic alteration; and
[0073] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0074] (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0075] (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0076] (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide but above the melting temperature of one or both of the primers;
[0077] (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0078] (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide; and
[0079] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide.
[0080] In certain embodiments, the method further comprises:
[0081] (h) performing a PCR amplification of the enriched reaction mixture to obtain a further amplification product, the reaction mixture comprising: (1) the enriched reaction mixture; (2) a DNA polymerase (3) a second pair of primers that flank the genetic alteration, wherein one or both of the primers hybridize to the reference polynucleotide and the target polynucleotide interior to the first set of primers; 17038.003W01
[0082] (i) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0083] (j) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0084] (k) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide;
[0085] (l) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0086] (m) repeating steps (i) through (1) in order for two or more cycles so as to enrich target polynucleotide; and
[0087] (n) repeating steps (i), (k) and (1) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate a further enriched reaction mixture.
[0088] In certain embodiments provided herein is a method for enriching in a sample a double-stranded target polynucleotide having a genetic alteration to obtain an amplification product, the method comprising the steps of:
[0089] (a) performing a first PCR amplification in a reaction mixture, the reaction mixture comprising:
[0090] (1) the sample or a fraction of the sample, and a reference polynucleotide lacking the genetic alteration;
[0091] (2) a DNA polymerase;
[0092] (3) a first pair of primers that flank the genetic alteration; and
[0093] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0094] (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide; 17038.003W01
[0095] (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0096] (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide;
[0097] (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0098] (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide;
[0099] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate an enriched reaction mixture;
[0100] (h) performing a PCR amplification of the enriched reaction mixture to obtain a further amplification product, the reaction mixture comprising: (1) the enriched reaction mixture; (2) a DNA polymerase (3) a second pair of primers that flank the genetic alteration, wherein one or both of the primers hybridize to the reference polynucleotide and the target polynucleotide interior to the first set of primers;
[0101] (i) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0102] (j) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0103] (k) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide;
[0104] (l) extending the primers hybridized to the reference polynucleotide or target polynucleotide; 17038.003W01
[0105] (m) repeating steps (i) through (1) in order for two or more cycles so as to enrich target polynucleotide; and
[0106] (n) repeating steps (i), (k) and (1) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate a further enriched reaction mixture.
[0107] Also disclosed herein are kits for performing the disclosed methods. The disclosed kits may comprise one or more components for performing the disclosed methods selected from: (1) a thermostable DNA polymerase that lacks 5 '- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity (i.e., 3 '- 5' proofreading activity) and preferably has an error rate that is less than about 1 O’6(i.e., a high fidelity DNA polymerase); (2) a pair of primers that flank a genetic alteration to be detected in the methods; and (3) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex (where the reference polynucleotide is a non-target polynucleotide), thereby selective blocking amplification of the reference polynucleotide and enriching amplification of the target polynucleotide.
[0108] The disclosed methods and kits may be utilized for diagnosing, prognosing, and treating a subject in need thereof, such as a subject having or suspected of having a disease or disorder. In particular, the disclosed methods and kits may be utilized for diagnosing, prognosing, and treating a subject having cancer or suspected of having cancer. Suitable subjects for the disclosed methods may include cancer patients that currently are in remission.
[0109] BRIEF DESCRIPTION OF THE DRAWINGS
[0110] Figures 1A-1C. Serially diluted Sample of KRAS G12C in a mixture with 50 ng of KRAS WT. FIG. 1A illustrates the results of the agarose gel. Sample 1 through 6 and in lanes 1 to 6 respectively. FIG. IB illustrates the results of the Sanger sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C. FIG. 1C illustrates the results of the Amplicon EZ sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.
[0111] Figures 2A-2C. Serially diluted Sample of KRAS G13D in a mixture with 50 ng of KRAS WT. FIG. 2A illustrates the results of the agarose gel. Sample 7 through 12 and in lanes 1 to 6 respectively. FIG. 2B illustrates the results of the Sanger sequencing run for 17038.003W01
[0112] Sample 10, which contained approximately 0.005% KRAS G13D. FIG. 2C illustrates the results of the Amplicon EZ sequencing run for Sample 9, which contained approximately 0.05% KRAS G13D.
[0113] Figures 3A-3C. Serially diluted Sample of KRAS G12C in a mixture with 50 ng of KRAS WT Extended PCR Protocol. FIG. 3 A illustrates the results of the agarose gel. Sample 13 through 18 and in lanes 1 to 6 respectively. FIG. 3B illustrates Sample 13 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 3C illustrates Sample 15 Sanger sequencing results, which contains approximately 0.05% KRAS G12C.
[0114] Figures 4A-4C. Serially diluted Sample of KRAS G13D in a mixture with 50 ng of KRAS WT Extended PCR Protocol. FIG. 4 A illustrates the results of the agarose gel. Samples 19 through 24 and in lanes 1 to 6 respectively. FIG. 4B illustrates Sample 19 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 4C illustrates Sample 21 Sanger sequencing results, which contains approximately 0.05% KRAS G13D.
[0115] Figure 5 illustrates Sample 25 Sanger sequencing results, which contains approximately 0.0125% KRAS G12C.
[0116] Figures 6A-6D. The Sanger sequencing results of a sample containing approximately 0.025% KRAS G12D where the enrichment PCR protocol contained different amount of time at the blocker annealing temperature. FIG. 6A illustrates Sample 26 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 2.9%. FIG. 6B illustrates Sample 28 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 11.8%. FIG. 6C illustrates Sample 30 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 60.8%. FIG. 6D illustrates Sample 32 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 80.7%.
[0117] Figures 7A-7D. The Sanger sequencing results of a sample containing 100% wildtype KRAS where the enrichment PCR protocol contained different amount of time at the blocker annealing temperature. FIG. 7A illustrates Sample 27 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 0.3%. FIG. 7B illustrates Sample 29 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 0.0%. FIG. 7C illustrates Sample 31 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 1.2%. FIG. 7D illustrates Sample 33 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 2.2%. 17038.003W01
[0118] Figures 8A-8D. The Sanger sequencing results of a sample containing approximately 0.025% KRAS G12D where the enrichment PCR protocol contained different amount of time at the primer annealing temperature. FIG. 8A illustrates Sample 34 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 9.3%. FIG. 8B illustrates Sample 36 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 64.8%. FIG. 8C illustrates Sample 38 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 63.2%. FIG. 8D illustrates Sample 40 Sanger sequencing results, which contains approximately 0.025% KRAS G12D enriched to 19.4%.
[0119] Figures 9A-9D. The Sanger sequencing results of a sample containing 100% wildtype KRAS where the enrichment PCR protocol contained different amount of time at the primer annealing temperature. FIG. 9A illustrates Sample 35 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 5.0%. FIG. 9B illustrates Sample 37 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 5.4%. FIG. 9C illustrates Sample 39 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 4.0%. FIG. 9D illustrates Sample 41 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12D mutation result of 1.8%.
[0120] Figures 10A-10D. The Sanger sequencing results of a sample containing approximately 0.025% KRAS G12R where the enrichment PCR protocol contained different blocker annealing temperature. FIG. 10A illustrates Sample 42 Sanger sequencing results, which contains approximately 0.025% KRAS G12R enriched to 58.5%. FIG. 10B illustrates Sample 44 Sanger sequencing results, which contains approximately 0.025% KRAS G12R enriched to 80.8%. FIG. 10C illustrates Sample 46 Sanger sequencing results, which contains approximately 0.025% KRAS G12R enriched to 14.5%. FIG. 10D illustrates Sample 48 Sanger sequencing results, which contains approximately 0.025% KRAS G12R enriched to 52.6%.
[0121] Figure 11A-11D. The Sanger sequencing results of a sample containing 100% wildtype KRAS where the enrichment PCR protocol contained different blocker annealing temperature FIG. 11A illustrates Sample 43 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12R mutation result of 1.9%. FIG. 11B illustrates Sample 45 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12R mutation result of 0.1%. FIG. 11C illustrates Sample 47 Sanger sequencing results, 17038.003W01 which contains approximately 100% KRAS WT, with a G12R mutation result of 0.1%. FIG. 11D illustrates Sample 49 Sanger sequencing results, which contains approximately 100% KRAS WT, with a G12R mutation result of 0.0%.
[0122] DETAILED DESCRIPTION
[0123] The present invention is described herein using several definitions, as set forth below and throughout the application.
[0124] As used herein, a “reference polynucleotide” is a polynucleotide that encodes a standard “normal” non-mutated (i.e., non-pathogenic or “wildtype”) allele of a genetic sequence. As used herein, a “reference polynucleotide” can also be called a “non-targef ’ polynucleotide.
[0125] As used herein, a “target polynucleotide sequence” is a polynucleotide that encodes a variant or mutant allele of the reference polynucleotide. For example, a “target polynucleotide” encodes a sequence that is causative of is associated with a cancer.
[0126] As used herein, an “ off-target’ ’ or “non-specific” polynucleotide is a polynucleotide that is not an allele of the target or reference polynucleotide. An “off-target” polynucleotide is not related to the “target polynucleotide” but instead is a completely different region of the polynucleotide.
[0127] Molecular profiling of tumors obtained from individual patients improves the selection of personalized cancer treatment therapies, patient responses, detection of drug resistance, and monitoring of tumor relapse. Profiling tumors generally involves obtaining resected tumor samples by invasive surgeries. The limitations to such invasive procedures include difficulty in acquiring tumor samples for both tumor quantity and quality. Another drawback is that acquiring biopsy samples by invasive methods throughout treatment to monitor tumor response and relapse pose major challenges in tumor profiling. A further limitation to invasive sampling methods is the heterogeneity of resected tumor samples as a whole. Further, in the case of metastasis, where tumors have spread and constantly evolve both spatially and temporally in response to treatment over time, multiple biopsies may be required. These challenges make it difficult to obtain a holistic image of a tumor.
[0128] Recently, new non-invasive techniques are being developed to address these limitations, such as liquid biopsy (LB). Liquid biopsies consist of isolating tumor-derived entities like circulating tumor cells, circulating tumor DNA, tumor extracellular vesicles, etc., present in the body fluids of patients with cancer, followed by an analysis of genomic and 17038.003W01 proteomic data contained within them. Liquid biopsies methods permit continuous monitoring by repeated sampling. Further, LB provides enhanced sensitivity in diagnosis and ease of repeated sampling throughout treatment much more conveniently and non-invasively.
[0129] The term "biological fluid" herein refers to a liquid taken from a biological source and includes, for example, blood, serum, plasma, sputum, lavage fluid, cerebrospinal fluid, urine, semen, sweat, tears, saliva, and the like. As used herein, the terms "blood," "plasma" and "serum" expressly encompass fractions or processed portions thereof. Similarly, where a sample is taken from a biopsy, swab, smear, etc., the "sample" expressly encompasses a processed fraction or portion derived from the biopsy, swab, smear, etc.
[0130] In addition to circulatory fluids like plasma or serum, other body fluids such as saliva and urine can be used as liquid biopsies. Saliva offers practical advantages with regard to ease of access, non-invasiveness, and cost effectiveness in sampling, even more so than plasma or serum. Novel electrochemical sensor-based technologies like an electric field- induced release and measurement (EFIRM) have been shown to detect EGFR mutations (tyrosine kinase domain) from bodily fluids like saliva in patients. Similar EFIRM based technologies have been used in developing salivary biomarkers.
[0131] The completely non-invasive nature of urine sampling, relative to tissue or even blood, makes it a quite useful candidate in LBs, particularly in cases where repeated sampling is required to monitor tumor progression and therapeutic outcomes.
[0132] Circulating tumor cells (CTCs) are initially released from primary tumors in the tissue, travel through the circulatory system and account for the development of metastatic (or secondary) tumors at distant sites in the body. The percentage in the blood is quite low, with nearly one CTC found per million leukocytes. Various technologies have been used to selectively detect viable CTCs to obtain information regarding tumors. One example is the EPISPOT (EPitheliallmmunoSPOT) assay that detects circulating tumor cells up to a single cell. The assay involves the use of membrane-bound antibodies against the epithelial cell adhesion molecule (EpCAM, or CD326) present on tumor cells and their subsequent culturing / expansion in both in vivo and in vivo conditions. Another positive selection / enrichment technology for CTCs obtained from LB samples is the CellSearch system. This technology uses antibody-labeled magnetic beads to pull down CTCs with epithelial lineage markers (like EpCAM). Another immunomagnetic-based enrichment assay of CTCs from LBs is the AdnaTest. In addition to the EpCAM-labeled ferromagnetic beads 17038.003W01 used in the CellSearch system, AdnaTest includes a polymerase chain reaction (PCR) step to detect tumor-specific mRNA transcripts.
[0133] Alternative approaches include microfluidic devices used to select CTCs in various types of cancers. Devices like the “CTC-Chip,” which contains thousands of small antibody- labeled microposts, have been used to capture CTCs bearing specific tumor antigens from LB blood samples. Certain designs of “CTC-Chips” have been demonstrated to employ patterns of microgrooves, which seem to increase the contact time between antibody-labeled microposts and CTCs, improving cellular entrapment. CTCs filtered off from LB samples by the chip are then imaged and analyzed.
[0134] Functional assays like the Metastasis-Initiating-Cells (MIC) assay analyze the invasive properties of CTCs obtained from LB into the surrounding matrix in vivo, assisting in their further characterization. These analyses aid in providing a detailed picture of tumor staging / subtypes and in designing novel personalized therapeutic drugs against tumors. In addition to general nuclear and surface-specific markers targeting CTCs, counterstain markers that target cells in exclusion to CTCs such as white blood cells (WBCs), platelets, red blood cells (RBCs), etc., can also be used to enrich CTCs from blood samples. The prominent markers selected for counterstains include CD45 / CD66b (granulocytes), CD235a (RBCs), CD41 / CD61 (platelets), CD4 / CD8 (lymphocytes), CDl lb / CD14 (macrophages) and CD34 (hematopoietic progenitors / endothelial cells). Technologies like the EasySep Depletion Kit (StemCell Technologies) use CD45 -labeled magnetic beads to negatively select WBCs, depleting them from the LB samples. Other examples, like the RosetteSep (StemCell Technologies) method, use an additional density gradient centrifugation step for further CTC enrichment.
[0135] Post-enrichment technologies, such as the DEP Array™ System, have also been demonstrated to successfully isolate and recover single CTCs from LB samples of whole blood. Next-generation sequencing (NGS) analysis can be carried out directly on CTCs using technologies such as the Ion Torrent PGM™ system, composed of the Ion AmpliSeq™ Cancer Hotspot Panel, which provides enhanced mutational analysis and avoids the use of error-prone methods like whole genome amplification (WGA), thus improving screening accuracy. In certain embodiments, circulating tumor cells are present in the liquid biopsy; i.e., whole tumor cells are present, and not just DNA fragments.
[0136] In certain embodiments, circulating tumor DNA (ctDNA) is present in the liquid biopsy. Over time, fragments of RNA from the tumor cells can enter a patient’s bloodstream, 17038.003W01 and this RNA is called circulating tumor RNA (ctRNA). This ctRNA can be from dying tumor cells or as the cancer cells turnover. Circulating tumor RNA (ctRNA) is single- or double-stranded RNA released by the tumor cells into the blood and it thus harbors the mutations of the original tumor. Circulating tumor RNA (ctRNA) is distinguishable from cell-free RNA (cfRNA), in that RNA fragments shed from non-tumor cells are cfRNA, whereas RNA fragments shed from tumors are ctRNA. ctRNA accounts for about 0.01-10% of the total circulating cell-free RNA (cfRNA). ctRNA levels in plasma, however, can vary depending on tumor load, tumor stage, and therapeutic response.
[0137] In certain embodiments, circulating tumor DNA (ctDNA) is present in the liquid biopsy. Over time, fragments of DNA from the tumor cells can enter a patient’s bloodstream, and this DNA is called circulating tumor DNA (ctDNA). This ctDNA can be from dying tumor cells or as the cancer cells turnover. Circulating tumor DNA (ctDNA) is single- or double-stranded DNA released by the tumor cells into the blood and it thus harbors the mutations of the original tumor. Circulating tumor DNA (ctDNA) is distinguishable from cell-free DNA (cfDNA), in that DNA fragments shed from non-tumor cells are cfDNA, whereas DNA fragments shed from tumors are ctDNA. ctDNA accounts for about 0.01-10% of the total circulating cell-free DNA (cfDNA). ctDNA levels in plasma, however, can vary depending on tumor load, tumor stage, and therapeutic response.
[0138] Two major types of approaches have been considered for ctDNA analysis: targeted approaches that focus on specific gene rearrangements or gene mutations in particular genomic regions that act as “hotspots” for variation in a given tumor type, or untargeted approaches that offer a broader analysis and monitoring of the tumor genome, providing information on nucleotide alterations, copy number aberrations, chromosomal alterations, etc., independent of any prior data on molecular alterations.
[0139] Targeted approaches include methods such as droplet digital PCR, quantitative PCR, BEAMing, digital PCR, Sanger sequencing, Illumina sequencing and many other. These methods use different detection techniques to determine the nucleotide sequence of a strand of DNA. These detection techniques rely on Watson-Crick base pairing to infer the nucleotide sequence of a strand. An example of Watson-Crick base pairing is that adenine (A) pairs with thymine (T) in DNA and guanine (G) pairs with cytosine (C) in DNA. In Illumina sequencing the nucleotides (A), (T), (G) and (C) are tagged with a fluorescence marker and whichever fluorescence is observed is used to infer the nucleotide sequence of the DNA strand in the sample. In quantitative PCR, a probe is tagged with a fluorescence marker. 17038.003W01
[0140] A probe is a polynucleotide, instead of a single nucleotide that is used in Illumina sequencing. Still, Watson-Crick base pairing is used to infer the nucleotide sequence of the DNA strand in the sample.
[0141] The noise of the Illumina sequencing method and quantitative PCR is the percentage that non-Watson-Crick base pairing occurs. For Illumina sequencing, this percentage is estimated to be >0.5% (1 in 200 nucleotides), based on the mean error rate plus three standard deviations. For quantitative PCR the percentage of error is dependent on the probe, but is generally >2% (1 in 50 nucleotides) based on the IDT OligoAnalyzer tool. The error rate of these methods is similar to the limit of detection of these methods. Detecting rare mutant DNA below the error rate results in increasing the number of false positives. Creating a trade-off between false positives and false negatives.
[0142] Blocking PCR is a technique to move the error rate from the detection step, to the amplification step. The major advantage of changing the error rate to the amplification step, is the ability to incorporate a proof-reading DNA polymerase. A proof-reading DNA polymerase still relies on Watson-Crick base pairing, but has the ability to correct mismatch nucleotide hybridization. Methods that use the detection step to determine the nucleotide sequence do not have the ability to correct mismatch nucleotide hybridization. A proofreading DNA polymerase has an error rate of 0.000056% (1 in 1,800,000). This represents a potential improvement of 9000x over Illumina sequencing.
[0143] In comparison, the error rate of Sanger sequencing is greater than 5%.
[0144] Previous blocking methods have been peptide nucleic acids (PNAs) Clamps, LNA locked nucleic acids (LNAs) Blocking, co-amplification at lower denaturation temperature PCR (COLD-PCR), blocker displacement amplification (BDA), and Switch-blockers. These blocking methods have successfully moved the error rate from the detection step to the replication step. Not all of these methods have incorporated a proof-reading DNA polymerase. Some of these methods have been able to achieve high sensitivity (<0.2% target polynucleotide). However, achieving high sensitivity relies on high effective blocking, where the blocker prevents the reference polynucleotide from exponential replication during polymerase chain reaction (PCR). The problem with high effective blocking, is that the reference polynucleotide is not replicated enough be detected in the method. This means that a sample containing only the reference polynucleotide cannot be distinguished from a sample lacking DNA. 17038.003W01
[0145] Unless otherwise specified or indicated by context, the terms "a", "an", and "the" mean "one or more." For example, "a target nucleic acid" should be interpreted to mean "one or more target nucleic acids."
[0146] As used herein, "about," "approximately," "substantially," and "significantly" will be understood by persons of ordinary skill in the art and will vary to some extent on the context in which they are used. If there are uses of these terms which are not clear to persons of ordinary skill in the art given the context in which they are used, "about" and "approximately" will mean plus or minus <10% of the particular term and "substantially" and "significantly" will mean plus or minus >10% of the particular term.
[0147] As used herein, the terms "include" and "including" have the same meaning as the terms "comprise" and "comprising." For example, "a method that includes a step" should be interpreted to mean "a method that comprises a step." The terms "comprise" and "comprising" should be interpreted as being "open" transitional terms that permit the inclusion of additional components further to those components recited in the claims. The terms "consist" and "consisting of' should be interpreted as being "closed" transitional terms that do not permit the inclusion of additional components other than the components recited in the claims. The term "consisting essentially of' should be interpreted to be partially closed and permitting the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.
[0148] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.
[0149] The modal verb "may" refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb "may" refers to an affirmative act regarding how to make or use an aspect of a described embodiment or feature contained in the same, or a definitive decision to use a specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb "may" has the same meaning and connotation as the auxiliary verb "can."
[0150] As used herein, the term "subject," which may be used interchangeably with the terms "patient" or "individual," refers to one who receives medical care, attention or treatment and 17038.003W01 may encompass a human subject. As used herein, the term "subject" is meant to encompass a person having and / or at risk for developing a disease or disorder characterized by a nucleic acid alteration in one or more genetic loci that are associated with the disease or disorder, such as a mutation in a gene that is associated with the disease or disorder. The term "subject" is meant to encompass a person having and / or at risk for developing a cell proliferative disease or disorder such as cancer. The term "subject" is meant to encompass a person having been diagnosed with cancer and currently diagnosed as being in remission, that results in methylation status of one or more genes associated with the disease or disorder or characterized by genetic mutations associated with the disease or disorder. The "methylation status" of a gene may include the "methylation status" of the promoter of the gene, for example, relative to a control gene.
[0151] As used herein, a subject in need thereof may include a subject having or at risk for developing a disease or disorder including, but not limited to, a cell proliferative disease or disorder (e.g., cancers such as breast cancer, prostate cancer, colon cancer, lung cancer, gall bladder cancer, brain cancer, uterine cancer, ovarian cancer, head and neck cancer, gastric cancer, liver cancer, leukemias, and lymphomas), a neurodegenerative disease or disorder (e.g., Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease), a psychiatric disease or disorder (e.g., schizophrenia and depression), a metabolic disease or disorder (e.g., type 1 or type 2 diabetes), a cardiovascular disease or disorder (e.g, myocardial infarction or stroke), inflammatory diseases or disorders (e.g. arthritis), and immune diseases or disorders. In some embodiments, the subject has been diagnosed with a cancer and currently is diagnosed as being in remission.
[0152] The disclosed methods may be utilized to diagnose or prognose a subject in need thereof based on detecting an alteration in one or more genetic loci associated with the disease or disorder in a sample obtained from the subject. As used herein the terms "diagnose" or "diagnosis" or "diagnosing" refer to distinguishing or identifying a disease, syndrome or condition or distinguishing or identifying a subject having or at risk for developing a particular disease, syndrome or condition. As used herein the terms "prognose" or "prognosis" or "prognosing" refer to predicting an outcome of a disease, syndrome, condition, or treatment regimen in a subject.
[0153] The disclosed methods may be utilized to treat a subject in need thereof. For example, the disclosed methods may be utilized to diagnose or prognose a subject in need thereof based on methylation status of the promoter region of one or more genes associated 17038.003W01 with the disease or disorder or characterized by one or more mutations associated with the disease or disorder. Subsequently to the diagnosis or prognosis, the subject may be administered a suitable treatment based on the diagnosis or prognosis of the disease or disorder.
[0154] The disclosed methods may be utilized to characterized nucleic acid in a subject sample. The term "sample" or "subject sample" is meant to include biological samples such as tissues (e.g., tissues obtained from biopsies) and bodily fluids. "Bodily fluids" may include, but are not limited to, blood, serum, plasma, saliva, cerebral spinal fluid, pleural fluid, tears, lactal duct fluid, lymph, sputum, and semen. A sample may include nucleic acid, protein, or both.
[0155] The methods disclosed herein may be applied when performing DNA amplification of a nucleotide sample. In particular, the methods disclosed herein may be applied when performing DNA amplification of a sample comprising a mixture of a “target polynucleotide” that comprises a genetic alteration and a “reference polynucleotide” that lacks the genetic alteration present in the “target polynucleotide” (i.e., where the reference polynucleotide is a non-target polynucleotide). In certain embodiments the sample that are analyzed in the disclosed amplification methods include a mixture comprising a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (e.g., deletions, substitutions, and / or insertions in the nucleic acid sequence of the polynucleotide).
[0156] The methods disclosed herein may be applied when performing DNA sequence analysis of a nucleotide sample. In particular, the methods disclosed herein may be applied when performing DNA sequence analysis of a sample comprising a mixture of a target polynucleotide comprising a genetic alteration and a reference polynucleotide lacking the genetic alteration (where the reference polynucleotide is a non-target polynucleotide). Samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wild-type polynucleotide is a non-target polynucleotide).
[0157] The methods disclosed herein may be applied when performing methylation analysis. For example, the methods disclosed herein may be applied when amplifying and sequencing a polynucleotide sample after the sample has been treated with an agent that selectively modifies unmethylated cytosine residues and not methylated cytosine residues, such as a 17038.003W01 bisulfite agent. Bisulfite treatment commonly is performed to convert unmethylated cytosine residues to uracil residues in a polynucleotide sample. The treated polynucleotide sample then can be utilized as a template for DNA synthesis (e.g., in a PCR amplification or in a sequencing reaction) where uracil residues ultimately are converted to thymidine residues. By performing sequencing of the treated polynucleotide sample, detection of a thymidine residue at a given position versus a cytosine residue will be indicative of an unmethylated cytosine in the original sample or a methylated cytosine in the original sample, respectively. As such, samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having a C or T / U at one or more positions as compared to a non-target polynucleotide having a T / U or C at one or more respective positions.
[0158] The methods disclosed herein may be applied to a wide variety of sequencing methods. Sequencing methods may include high-throughput or ultra-high-throughput sequencing methods. DNA sequencing processes suitable or adaptable for the disclosed methods may include, but are not limited to, sequencing by synthesis, single-molecule realtime sequencing, ion semiconductor sequencing, pyrosequencing, sequencing by ligation, chain termination sequencing, massively parallel signature sequencing, Polony sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, Nanopore DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, and microscopy-based sequencing techniques. As such, the disclosed methods may be applied to tradition DNA sequencing methods based on the Sanger sequencing method or the Maxam and Gilbert sequencing method, so-called "first- generation" DNA sequencing techniques, as well as methods that are more amenable to high- throughput analysis, so-called "second generation" and "third generation" DNA sequencing techniques." See, e.g., Mardis, Ann. Rev. Genomics and Human Genetics, Vol. 9: 387-402 (2008); Metzker, Genome Research, (2005) 15: 1767-1776; Moorthie et al., Hugo J. v. 5(1-4), Dec. (2011); and Schadt et al., Human Molecular, Genetics, Vol. 19, No. R2, pp. R227-2490, September 21, 2010; and Shendure et al., Nature Biotechnology 26, 1135-1145 (2008)).
[0159] The disclosed technology relates to nucleic acid and the use of nucleic acid for diagnosing, prognosing, and / or treating diseases and disorders. The terms "nucleic acid" and "oligonucleotide," and "polynucleotide" as used herein, refer to polydeoxyribonucleotides (containing 2-deoxy-ribose), polyribonucleotides (containing ribose), and to any other type of polynucleotide that is an N glycoside of a purine or pyrimidine base. As used herein, the 17038.003W01 terms "A," "T," "C," "G" and "U" refer to adenine, thymine, cytosine, guanine, uracil as a nucleotide base, respectively. There is no intended distinction in length between the terms "nucleic acid," "oligonucleotide," and "polynucleotide," and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. For use in the present invention, an oligonucleotide also can comprise nucleotide analogs in which the base, sugar or phosphate backbone is modified as well as non-purine or nonpyrimidine nucleotide analogs.
[0160] Oligonucleotides utilized in the disclosed methods may include one or more modified nucleotides. Nucleotide modifications may include, but are not limited to, locked nucleic acids (LNAs) or bridged nucleic acids (BNAs), peptide nucleic acids, glycol nucleic acids, and threose nucleic acids.
[0161] As used herein, a "fragment" of a polynucleotide is a portion of a polynucleotide sequence which is identical in sequence to but shorter in length than a reference sequence. A fragment may comprise up to the entire length of the reference sequence, minus at least one nucleotide. For example, a fragment may comprise from 5 to 1000 contiguous nucleotides of a reference polynucleotide. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide; in other embodiments a fragment may comprise no more than 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide; in further embodiments a fragment may comprise a range of contiguous nucleotides of a reference polynucleotide bounded by any of the foregoing values (e.g., a fragment comprising 20-50 contiguous nucleotides of a reference polynucleotide). Fragments may be preferentially selected from certain regions of a molecule. The term "at least a fragment" encompasses the full-length polynucleotide. A "variant," "mutant," or "derivative" of a reference polynucleotide sequence may include a fragment of the reference polynucleotide sequence.
[0162] A fragment of a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide) may be generated via a PCR amplification reaction. An amplification product may comprise amplified fragments of a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide). An amplification product may comprise a mixture of amplified fragments of a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide). 17038.003W01
[0163] Regarding polynucleotide sequences, "alteration," "variant," "mutant," or "derivative" may be defined as a nucleic acid sequence having a different nucleic acid sequence relative to a reference sequence, which may include a wild-type sequence. An "alteration," "variant," "mutant," or "derivative" may include a substitution of one or more nucleotides (e.g., a G~>t transversion), a deletion of one or more nucleotides, and / or an insertion of one or more nucleotides.
[0164] A target polynucleotide may comprise an alteration relative to a reference sequence, which is a non-target polynucleotide. For example, a target polynucleotide may comprise a mutation relative to a wild-type reference sequence. In the disclosed methods, the target polynucleotide selectively is amplified and detected relative to non-target polynucleotide, which may be a wild-type reference polynucleotide.
[0165] The nucleic acids disclosed herein may be "substantially isolated or purified." The term "substantially isolated or purified" refers to a nucleic acid that is removed from its natural environment, and is at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which it is naturally associated. In some embodiments, the samples utilized in the disclosed methods may comprise a nucleic acid sample that has been substantially isolated or purified.
[0166] The disclosed methods may utilize a sample comprising nucleic acid from any source, including a source from an animal and / or a source from the environment. In some embodiments, the polynucleotide sample comprises genomic DNA. In further embodiments, the genomic DNA is treated prior to sequencing with a reagent that selectively modifies nonmethylated cytosine residues in the DNA to produce detectable modified residues, but which does not modify methylated cytosine residues. In even further embodiments, the nucleotide at the nucleotide position of the polynucleotide sample is a methylated cytosine or a modified residue and the set of polynucleotide fragments comprises two or more different polynucleotide fragments having a cytosine or a thymine at the nucleotide position of the polynucleotide sample.
[0167] The disclosed methods may utilize primers that are complementary to a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide). The disclosed methods also may utilize a blocking oligonucleotide that is complementary to a non-target polynucleotide and which is not complementary to a target polynucleotide at one or more nucleotide positions. As used herein, the term "complementary" in reference to a 17038.003W01 first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence will base-pair exactly with the second polynucleotide sequence throughout a stretch of nucleotides without mismatch. The term "cognate" may in reference to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence will base-pair with the second polynucleotide sequence throughout a stretch of nucleotides but may include one or more mismatches within the stretch of nucleotides. As used herein, the term "complementary" may refer to the ability of a first polynucleotide to hybridize with a second polynucleotide due to base-pair interactions between the nucleotide pairs of the first polynucleotide and the second polynucleotide (e.g., A:T, A:U, C:G, G:C, G:U, T:A, U:A, and U:G).
[0168] A “blocking oligonucleotide” as utilized herein may hybridize to a target polynucleotide and / or a non-target polynucleotide and may prevent the extension of a polymerase to replicate a strand of the target polynucleotide and / or a non-target polynucleotide. In some embodiment the blocking oligonucleotide is a non-extendable oligonucleotide.
[0169] The term "hybridization," as used herein, refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between "substantially complementary" nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as "stringent hybridization conditions" or "sequence-specific hybridization conditions." Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3 / 4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference). Those skilled in the art of nucleic acid technology can determine melting temperature for duplexes. 17038.003W01
[0170] Methods for Enriching a Target Polynucleotide in a Mixed Sample
[0171] This method described below provides both sensitivity and a high signal to noise ratio. In some embodiments, the sensitivity is as low as 0.005% with the sample enriched to >99%. In some embodiments the signal to noise ratio is high because a 100% reference sample does not result in a measurable signal.
[0172] The disclosed subject matter relates to methods for enriching a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide lacking the genetic alteration in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, for example, where the reference polynucleotide is a non-target polynucleotide in the sample. The methods may be utilized for detecting with high sensitivity and high specificity the target polynucleotide in the mixture of the reference polynucleotide and the target polynucleotide in which the target polynucleotide is present at a low copy number (e.g., less than about 10 copies) and the target polynucleotide represents a low percentage of the mixture of the target polynucleotide and the reference polynucleotide (e.g., less than about 0.05%). The methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the detected genetic alteration.
[0173] The disclosed methods typically include an amplification step that produces an amplification product, such as a polymerase chain reaction (PCR) amplification. The PCR amplification typically is configured to selectively amplify a genetic alteration present in a target polynucleotide relative to a reference polynucleotide lacking the genetic alteration, where the reference polynucleotide is a non-target polynucleotide. The disclosed methods also typically include a sequencing step in which the amplification product is sequenced, and the genetic alteration of the target polynucleotide is identified.
[0174] In some embodiments, the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (1) the sample or a fraction of the sample; (2) a DNA polymerase that lacks 5 '- 3 ' nuclease activity and that comprises proofreading activity such as 3 '- 5' nuclease activity, preferably where the DNA polymerase is a high fidelity polymerase (e.g., a polymerase having an error rate of less than about 1 O’6); (3) a pair of primers that flank the genetic alteration that does not overlap with the blocking oligonucleotide; and (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample; (b) increasing the temperature of the reaction 17038.003W01 mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide; (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide; (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide; (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide; (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide. The reaction mixture further may comprise additional components for performing a PCR amplification (e.g., buffer, NTP's, divalent cation, and the like).
[0175] DNA polymerase 5'- 3 ' nuclease activity is commonly used is diagnostic assays for generating signal through the cleavage of a fluorophore. A DNA polymerase lacking this feature may have less diagnostic utility. However, 5 '->3 ' nuclease activity could also cleave or otherwise remove the blocking oligonucleotide. Removing this feature may increases the effectiveness of the blocking oligonucleotide. Adding 3 '- 5' nuclease activity increases the fidelity of the polymerase, which can also increase the signal to noise ratio in highly sensitive diagnostics assays.
[0176] In some embodiments of this method, the primer and blocker do not overlap. Not having the primer and blocker overlap improves blocking efficiency through a variety of mechanisms, such as the blocker (RNA, or RNA-like) nucleotide and the target (DNA) hybridizing in A-form, while the primer (DNA) and target (DNA) hybridize in B-form. In B- form the nucleotides are in the center of the helix, while in A-form the nucleotides are displaced away from the helix. This creates a competing conformation situation. Also, the primer and blocker are not competing exclusively, the polymerase is bound to the primer as well. The binding of the polymerase may dislodge the blocker in a variety of mechanisms, such as (1) increasing the stability of the primer and target DNA duplex above the blocker and target DNA duplex (2) using the finger and thumb domains to force the DNA into a B- form conformation (3) strand displacement ability of DNA polymerase, which is separate and distinct from the nuclease activity. Increasing the nucleotide separation between the primer and blocker may also allow more time for the blocker to hybridize and prevent the extension of the primer. 17038.003W01
[0177] In certain embodiments, the temperature of the PCR reaction mixture is increased to melt the target polynucleotide and reference polynucleotide in order to form single-stranded DNA. Reducing the temperature of the reaction mixture to the “blocker annealing temperature”, which is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide. Further reducing the temperature of the reaction mixture to the “primer annealing temperature” allows the primer pair to hybridize to the reference polynucleotide or target polynucleotide. The blocker annealing temperature allows time for the hybridization reaction to approach equilibrium. Melting temperature is commonly used in PCR, but melting temperature describes the hybridization equilibrium. At the melting temperature of a primer, the primer binds 50% of the reference polynucleotides and the blocker binds to >99% of the reference polynucleotides. However, both reactions still occur at a rate that allows for the primer to bind before the blocker on some reference polynucleotides. A primer that binds before the blocker can be extended prevents blocking from occurring. Having the PCR reaction with two annealing steps, first the blocker annealing and then the primer annealing, allows the blocker to approach a hybridization equilibrium for a sufficient percentage of reference polynucleotides and ensure a higher increase in blocking efficiency.
[0178] Combining a proof-reading DNA polymerase, with a blocker that does not overlap with the primer and a blocker annealing step results in a method with can enrich from 0.05% to >99.8, which is a 1996-fold improvement with the 100% reference sample being undetectable see, FIG. 1 and FIG. 2)
[0179] In certain embodiments, the disclosed methods are performed in order to detect a target polynucleotide that represents no more than about 3%, 2%, 1%, 0.5%, 0.25%, 0.125%, or less of the mixture of the target polynucleotide and the reference polynucleotide in the sample. In some embodiments of the disclosed methods, the target polynucleotide represents no more than about 0.05% of the mixture of the target polynucleotide and the reference polynucleotide in the sample.
[0180] In certain embodiments, the disclosed methods utilize a polymerase that has a relatively low error rate. In some embodiments, the polymerase has an error rate which is less than about 10'5, 10'6, or 10'7.
[0181] In certain embodiments, the disclosed methods typically include an amplification step comprising a number of amplification cycles. In some embodiments of the disclosed 17038.003W01 methods, the methods include a PCR amplification step in which PCR amplification is performed for more than 30, 40, 50, or 60 cycles.
[0182] In certain embodiments, the genetic alteration of the target nucleotide is selectively amplified or enriched. In some embodiments of the disclosed methods, the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the sequenced amplified product. In some embodiments of the disclosed methods, the amplification product is sequenced from multiple reads and the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the multiple reads.
[0183] In the disclosed methods, the genetic alteration of the target polynucleotide is selectively enriched and detected. In some embodiments of the disclosed methods, the target polynucleotide comprising the generic alteration represents no more than about 0.05% of the mixture of the target polynucleotide and the reference polynucleotide lacking the genetic alteration in the sample. After the disclosed methods have been performed, in some embodiments the amplification product is sequenced from multiple reads and the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the multiple reads, representing an enrichment of at least about 1800-fold (z.e., 99% / 0.05% = 1800).
[0184] The disclosed methods typically include sequencing an amplification product. In some embodiments of the disclosed methods, the blocking oligonucleotide is removed from the amplification product prior to sequencing the amplification product.
[0185] In certain embodiments, the method detects a target nucleotide that is present in a mixed sample comprising the target nucleotide and a reference polynucleotide. In some embodiments, the disclosed methods include a step of determining the minimum number of PCR cycles necessary for detecting the target polynucleotide when the target polynucleotide is present in the mixture at a relative low percentage (e.g., when the target polynucleotide is present in the mixture at a percentage of no more than 0.1%, 0.05%, 0.02%, or 0.01%).
[0186] In certain embodiments, the target polynucleotide may be present at a relative low concentration in the sample. In some embodiments, the target nucleotide may be present in a sample at a copy number of less than about 10000, 1000, 100, 10 or less. In some embodiments, the disclosed methods include a step of determining the minimum number of PCR cycles necessary for detecting the target polynucleotide when the target polynucleotide is present in the sample at a copy number of less than about 10000, 1000, 100, 10 or less.
[0187] In the disclosed methods, the genetic alteration of the target nucleotide is selectively amplified or enriched. The genetic alteration may be selectively amplified or enriched by 17038.003W01 configuring the PCR amplification reaction to include a blocking oligonucleotide that selectively hybridizes to the reference polynucleotide to form a blocking duplex, where the reference polynucleotide lacks the generic alteration, and the reference polynucleotide is a non-target polynucleotide. In some embodiments, the blocking oligonucleotide comprises one or more modified nucleotides that enhance the stability of the duplex formed by the blocking oligonucleotide and the reference polynucleotide. In some embodiments the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.
[0188] In certain embodiments, the blocking oligonucleotide forms a first duplex with the reference polynucleotide lacking the genetic alteration (i.e., where the reference polynucleotide is a non-target polynucleotide), where the first duplex has a first melting temperature Tl. The blocking oligonucleotide may form a second duplex with the target polynucleotide comprising the genetic alteration, where the second duplex has a first melting temperature T2. In certain embodiments, Tl > T2. In some embodiments, the blocking oligonucleotide is configured such that Tl is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 °C higher than T2 (i.e., Tl - T2 > than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 °C).
[0189] In the disclosed methods, the blocking oligonucleotide may comprise or consist of modified nucleotides. Modified nucleotides may include but are not limited to locked nucleic acids (LNAs) or bridge nucleic acids (BNAs), peptide nucleic acids, glycol nucleic acids, and threose nucleic acids. The presence of modified nucleotides in the blocking oligonucleotide may alter Tl or T2. In certain embodiments, the presence of modified nucleotides in the blocking oligonucleotide increases Tl. In certain embodiments, the presence of modified nucleotides in the blocking oligonucleotide increases the difference between Tl and T2.
[0190] In certain embodiments, extension during amplification is performed at a temperature at which the blocking oligonucleotide is hybridized to a relatively high percentage of the reference polynucleotide (which is a non-target polynucleotide) in the sample, such as a temperature at which the blocking oligonucleotide is hybridized to greater than about 50%, 60%, 70%, 80%, 90%, 95%, or greater of the reference polynucleotide (which is a non-target polynucleotide) in the sample. In certain embodiments, the extension during amplification is performed at a temperature at which the blocking oligonucleotide is hybridized to a relatively low percentage of the target polynucleotide in the sample, such as a temperature at which the 17038.003W01 blocking oligonucleotide is hybridized to less than about 50%, 40%, 30%, 30%, or lower of the target polynucleotide in the sample.
[0191] The blocking oligonucleotides include locked nucleic acid (LNA), also known as bridged nucleic acid (BNA). An LNA is a modified nucleotide in which the sugar moiety (e.g., ribose) is modified with a bridge connecting the 2' oxygen and 4' carbon (i.e., where the 2'-0 and 4'-C are conjugated via a bridging moiety). The bridge "locks" the sugar moiety in the 3'-endo (North) conformation, which is often found in A-form duplexes. This structure provides for increased stability against enzymatic degradation, and also offers improved specificity and affinity in base-pairing as a constituent of an oligonucleotide. LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide. Bridging moi eties of LNA may include alkylene moi eties (e.g., a methylene bridging moiety) and amino alkylene moi eties (e.g., amino methylene bridging moiety). An LNA may be referred to with the following designation: +A, +G, +C, or +T. In some embodiments of the blocking oligonucleotides, all of the nucleotides of the blocking oligonucleotide are LNAs, i.e., the nucleotides of the blocking oligonucleotides may consist of LNAs.
[0192] In certain embodiments, the methods utilize a blocking oligonucleotide that is relatively short in length. In some embodiments, the blocking oligonucleotide has a length that is no more than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides.
[0193] In certain embodiments, the method is performed to detect a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide, where the reference polynucleotide is a non-target polynucleotide. The genetic alteration may include a mutation relative to a wild-type sequence, for example, where the target polynucleotide comprises the mutation and the reference polynucleotide comprises the wild-type sequence and the reference polynucleotide is a non-target wild-type polynucleotide. Genetic alterations that are detected in the disclosed methods may include substitutions, deletions, insertions, or a combination thereof.
[0194] In certain embodiments, the genetic alterations detected in the disclosed methods are present at selected genetic loci. In some embodiments, the genetic alteration is present in a genetic locus selected from one or more of PIK3CA, KRAS, APC, FAT4, KMT2D, KMT2C, and BRAF.
[0195] In some embodiments of the disclosed methods, the methods utilize an additional pair of primers that amplify a control sequence as an internal control. An internal control may be utilized to demonstrate that steps of the disclosed methods are occurring as intended and / or if 17038.003W01 a blocking oligonucleotide is blocking exponential amplification of the reference polynucleotide as intended.
[0196] The disclosed methods may be configured in order to detect multiple target polynucleotides comprising different genetic alterations relative to a reference polynucleotide. In some embodiments, the disclosed methods are configured for performing a multiplex analysis.
[0197] Improvements for Methods for Modulating the Enrichment of a Target Polynucleotide
[0198] Enriching a low-frequency target mutation is needed for diagnosing cancer. Various enrichment methods have focused on improving replication efficiency difference between the target and the non -target polynucleotide. However, a major shortcoming of previous methods is not accounting for non-specific DNA replication. Detecting low-frequency target mutation through enrichment can be improved by reducing the deleterious impact of non-specific DNA replication.
[0199] Non-specific polynucleotide (e.g., DNA) replication occurs when primers hybridize to non-target polynucleotides and are extended by a polymerase (e.g., a DNA polymerase), causing the non-target polynucleotide to be amplified (i.e., “non-specific amplification”). Non-specific polynucleotide amplification can be deleterious to a method for enriching a target polynucleotide because of the increased production of the non-specific polynucleotide. Non-specific polynucleotide amplification increases as the temperature of a reaction mixture is lowered because the primers will hybridize to DNA regions which are not an exact compliment to the primer. This increased non-specific amplification shifts resource usage from amplification of the target region to amplification of a non-specific region. This shifting of resources results in the reduction of the enrichment efficiency of the reaction.
[0200] The shape of a melting curve of a nucleic acid duplex is generally sigmoidal. Thus, the impact of a change to the reaction temperature on the percent of primer hybridized will vary depending on where the temperature is located along the melting curve. The “melting temperature” of a duplex is the mid-point on the sigmoidal melting curve (i.e., where 50% of the target polynucleotide is hybridized with a primer). In a standard PCR reaction, the primer annealing temperature is at or near the melting temperature of the primers. In a PCR reaction, maintaining the temperature of a reaction mixture of a polynucleotide and a primer above the melting temperature of the polynucleotide / primer duplex reduces the efficiency of the PCR 17038.003W01 reaction. Maintaining the reaction temperature above the melting temperature, however, reduces the amount of primer hybridized to undesired non-specific regions, decreasing the amount of non-specific polynucleotide amplification. Thus, maintaining the reaction temperature above the melting temperature allows for an increase in the specificity of an amplification.
[0201] Another mechanism to reduce the impact of non-specific amplification is the use of a second PCR reaction where one or both primers is partially or completely “nested.” A nested PCR reaction is where at least two PCR reactions are performed, where one or both of the primers for the second PCR reaction selectively hybridize interior of the target region as compared to one or both of the primers from the first PCR reaction. For example, a polynucleotide is 200 nucleotide long and the first set of primers hybridize to nucleotides 1- 20 and 180-200. If the second PCR reaction was fully nested, the second set of “nested” primers hybridize to nucleotides 21-40 and 160-180 of the polynucleotide. If just one primer was partially nested, the second set of “nested” primers may hybridize to nucleotides 2 - 21 and 180-200. This process reduces the amount of non-specific amplification from the first PCR reaction in the second PCR reaction. In certain embodiments, this process increases the quality of results from sequencing methods, such as Sanger sequencing. Sanger sequencing is very sensitive to interference from non-specific amplification.
[0202] Another major shortcoming of previous blocking PCR methods is the inability to do both preferential replication of the target polynucleotide compared to the reference polynucleotide and to reduce the preferential replication of the target polynucleotide compared to the reference polynucleotide. Preferential replication of the target polynucleotide is required to increase the percentage of the target polynucleotide compared to the reference polynucleotide. A blocker is used to achieve preferential replication through hybridizing to the reference polynucleotide to prevent one or more polynucleotide strands from replicating. The higher the preferential replication the more sensitive and accurate the method can be for detecting the target polynucleotide. Higher preferential replication can be achieved through increases the percentage of reference polynucleotides which are blocked from replicating. The major problem with high preferential replication is that the reference polynucleotide is not sufficiently replicated to the threshold where the method produces a result, or signal, for a sample containing only reference polynucleotides. This limitation can be overcome by reducing the preferential replication of the target polynucleotide compared to the reference polynucleotide. Reduction in preferential replication increases the replication of 17038.003W01 the reference polynucleotide, which allows for the sufficient replication of the reference polynucleotide to the threshold where the method produces a result, or signal, for a sample containing only reference polynucleotides.
[0203] The term “preferential replication” as utilized herein means a higher percentage of the target polynucleotide strands were replicated compared to the percentage of reference polynucleotide strands. In some embodiments, the target polynucleotide strands were replicated 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% 100% more compare the reference polynucleotide strands.
[0204] The term “reducing the preferential replication” as utilized herein means the reference polynucleotide is replicated at a more similar percentage to the target polynucleotide compared to the rates of replication during preferential replication. In some embodiments, the amount of reduction of the preferential replication is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%.
[0205] The term “blocker annealing temperature” as utilized herein means a temperature where the blocker hybridizes to the reference polynucleotide at a greater percentage compared to the target polynucleotide to enable preferential replication.
[0206] The term “blocking PCR” as utilized herein means replicating reference polynucleotides or target polynucleotides using polymerase chain reaction (PCR) wherein the reaction mixture contains one or more blocking polynucleotides.
[0207] In some embodiments, the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (1) the sample or a fraction of the sample; (2) a DNA polymerase; (3) a primer or a pair of primers; and (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration; (b) increasing the temperature of the reaction mixture above the melting temperature of the reference polynucleotide and the target polynucleotide; (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide; (d) reducing the temperature of the reaction mixture to allow the primer or primers to hybridize to the reference polynucleotide or target polynucleotide; (e) extending the primer or primers hybridized to the reference polynucleotide or target polynucleotide; (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target 17038.003W01 polynucleotide; and (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide. The reaction mixture further may comprise additional components for performing a PCR amplification (e.g., buffer, NTP's, divalent cation, and the like).
[0208] In some embodiments, the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (1) the sample or a fraction of the sample; (2) a DNA polymerase; (3) a primer or a pair of primers; and (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration; (b) Preferentially replicating the target polynucleotide compared to the reference polynucleotide; (c) Reducing the preferential replication of the target polynucleotide compared to the reference polynucleotide. The reaction mixture further may comprise additional components for performing a PCR amplification (e.g., buffer, NTP's, divalent cation, and the like).
[0209] In some embodiments, the disclosed methods comprise: (a) performing a first PCR amplification in a reaction mixture, the reaction mixture comprising: (1) the sample or a fraction of the sample; (2) a DNA polymerase; (3) a first pair of primers that flank the genetic alteration; and (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample; (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide; (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide; (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide; (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide; (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide; (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate an enriched reaction mixture; (h) performing a PCR amplification of the enriched reaction mixture to obtain a further amplification product, the reaction mixture comprising: (1) the enriched reaction mixture; (2) a DNA polymerase (3) a second pair of primers that flank the genetic alteration, wherein one or both of the primers hybridize 17038.003W01 to the reference polynucleotide and the target polynucleotide interior to the first set of primers; (i) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide; (j) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide; (k) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide; (1) extending the primers hybridized to the reference polynucleotide or target polynucleotide; (m) repeating steps (i) through (1) in order for two or more cycles so as to enrich target polynucleotide; (n) repeating steps (i), (k) and (1) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate a further enriched reaction mixture. The reaction mixture further may comprise additional components for performing a PCR amplification (e.g., buffer, NTP's, divalent cation, and the like).
[0210] In certain embodiments, the temperature of the PCR reaction mixture is increased to melt the target polynucleotide and reference polynucleotide in order to form single-stranded DNA. The temperature then is lowered to the point where the blocking oligonucleotide hybridizes to the reference polynucleotide selectively because the blocking oligonucleotide is configured to have a lower melting temperature when hybridized to the target polynucleotide. As such, a higher percentage of reference polynucleotides are hybridized with the blocking oligonucleotide as compared to the percentage of target polynucleotides. Primer oligonucleotides that flank the position where the blocking oligonucleotide hybridizes then are used to amplify the target oligonucleotide and the reference oligonucleotide. During the PCR amplification, the hybridization of the blocking oligonucleotide to the reference polynucleotide inhibits the extension of the polymerase. Therefore, it is crucial the blocking oligonucleotide hybridizes to the reference polynucleotide prior to the primer hybridizing to the reference polynucleotide. To increase the efficiency of the blocking, the PCR cycle contains a step below the melting temperature of the blocking oligonucleotide and above the primer melting temperature. Holding at this temperature allows the blocking oligonucleotide to approach hybridization equilibrium. As a result, if a target polynucleotide is present, the target polynucleotide is amplified to a higher extent as compared to the reference 17038.003W01 polynucleotide. As a consequence, after each PCR cycle the amplification product of the target polynucleotide is enriched. Multiple PCR cycles may be performed to increase the total number of copies of the amplification product of the target polynucleotide to a point where sequencing may be performed in order to detect the genetic alteration of the target polynucleotide. High efficiency blocking will reduce the overall efficiency of the PCR for replication of the target and non-target polynucleotide. Preventing the blocking oligonucleotide from hybridizing before the primer will reduce the preferential replication of the target polynucleotide compared to the reference polynucleotide. In some embodiments, the blocking oligonucleotide is prevented from hybridizing before the primer by not holding the reaction at the temperature below the melting temperature of the blocking oligonucleotide and above the primer melting temperature.
[0211] In certain embodiments, the time the primer can hybridize to the reference polynucleotide or the target polynucleotide is increased. In some embodiments, the time the primer can be extended after hybridizing to the reference polynucleotide or the target polynucleotide is increased. The primer hybridization and / or extension can be thought of as a terminal reaction, wherein the blocker hybridization can be thought of as a transient reaction. Once the primer is extended and the single-stranded polynucleotide becomes double-stranded the blocker can no longer hybridize, hence the terminal nature of the reaction. The blocker can hybridize to the reference polynucleotide or target polynucleotide, prevent the initial extension of the polymerase, but disassociate from the reference or target polynucleotide, which would allow the continued extension of the reference polynucleotide or target polynucleotide.
[0212] In certain embodiments, the blocking oligonucleotide is resistant to displacement or exonuclease activity of the polymerase. In certain embodiments, increasing the time of the extension of the primer allows for blocker to be not prevent the extension of the polymerase because of displacement or exonuclease activity. In certain embodiments increasing the time of the extension of the primer results in the reduction of preferential replication of the target polynucleotide compared to the reference polynucleotide.
[0213] In certain embodiments, the disclosed methods are performed to detect a target polynucleotide in a sample. In certain embodiments, the samples include, but are not limited to, biological samples or environmental samples.
[0214] In some embodiments, the sample is a blood sample or a blood product sample (e.g., plasma or serum). In some embodiments, the sample is a cell-free sample, such as a cell-free 17038.003W01 blood sample, for example, wherein the blood sample has been treated to remove cells prior to performing the disclosed methods.
[0215] In certain embodiments, the disclosed methods are performed in order to detect a genetic alteration in a target polynucleotide relative to a reference polynucleotide. In some embodiments, the disclosed methods are performed in order to detect methylation in a target polynucleotide relative to a reference polynucleotide. In some embodiments of the disclosed methods, prior to the methods being performed the sample is treated with a reagent that selectively modifies non-methylated cytosine residues to produce detectable modified residues (e.g., uracil residues) but which does not modify methylated cytosine residues, such as a bisulfite reagent. In some methods, the target polynucleotide and the reference polynucleotide differ based on the presence of a detectable modified residue (e.g., uracil or thymidine) versus a methylated cytosine residue.
[0216] In certain embodiments, the disclosed methods are performed in order to detect a genetic alteration in a target polynucleotide relative to a reference polynucleotide. In some embodiments, the genetic alteration is associated with cancer in a subject, such as a mutation associated with cancer in a subject. In some embodiments, prior to performing the initial step of the disclosed methods, the methods comprise sequencing a cancer sample from the subject and detecting the genetic alteration in the cancer sample and determining that the cancer is associated with the genetic alteration. In certain embodiments, the disclosed methods then are performed in order to monitor the presence of the genetic alteration in the subject, where the presence of the genetic alteration indicates the progression of cancer in the subject.
[0217] In some embodiments of the disclosed methods, the sample is obtained from a subject that has cancer or is at risk for developing cancer. In some embodiments of the disclosed methods, the subject has been diagnosed with cancer and currently is in remission, for example, after the subject has been treated for the diagnosed cancer. In certain embodiments, the disclosed methods are performed in order to monitor for cancer recurrence in a subject, where detection of the genetic alteration in the subject indicates that the cancer has recurred.
[0218] In certain embodiments, the disclosed methods and kits are utilized for diagnosing, prognosing, and treating a subject in need thereof, such as a subject having or suspected of having a disease or disorder. In certain embodiments, the disclosed methods include diagnosing and / or prognosing a subject in need thereof and further may include subsequently administering treatment to the subject in need thereof after diagnosing and / or prognosing the subject. In certain embodiments, the methods herein include: (a) requesting an analysis that 17038.003W01 detects a target polynucleotide comprising a genetic alteration; and (b) subsequently administering a treatment to a subject based on the results of the analysis.
[0219] In certain embodiments, provided herein is a method for enriching a target polynucleotide if present in a sample, the method comprising the steps of:
[0220] (a) preparing a reaction mixture comprising:
[0221] (1) the sample, wherein the sample possibly comprises a target polynucleotide having a genetic alteration, and comprises a reference polynucleotide lacking the genetic alteration;
[0222] (2) a polymerase;
[0223] (3) one or more primer oligonucleotides; and
[0224] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide;
[0225] (b) increasing the temperature of the reaction mixture above the melting temperature of the reference polynucleotide and the target polynucleotide if present;
[0226] (c) reducing the temperature of the reaction mixture to a temperature below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but above the melting temperature of the one or more primer oligonucleotides, wherein the one or more primer oligonucleotides hybridize to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0227] (d) reducing the temperature of the reaction mixture to allow the one or more primers to hybridize to the reference polynucleotide or target polynucleotide if present;
[0228] (e) extending the one or more primers hybridized to the reference polynucleotide or target polynucleotide if present;
[0229] (f) repeating steps (b) through (e) for two or more cycles to enrich target polynucleotide if present; and
[0230] (g) repeating steps (b), (d) and (e) for two or more cycles to replicate both the reference polynucleotide and the target polynucleotide if present.
[0231] In certain embodiments, provided herein is a method for enriching a target polynucleotide having a genetic alteration in a sample, the method comprising the steps of:
[0232] (a) preparing a reaction mixture comprising: 17038.003W01
[0233] (1) the sample, wherein the sample may comprise a target polynucleotide having a genetic alteration, and comprises a reference polynucleotide lacking the genetic alteration;
[0234] (2) a polymerase;
[0235] (3) one or more primers; and
[0236] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration;
[0237] (b) subjecting the reaction mixture to an amplification process, wherein the amplification process comprises:
[0238] (1) subjecting the reaction mixture to a temperature or a set of temperatures wherein the blocking oligonucleotide hybridizes to the reference polynucleotide;
[0239] (2) subjecting the reaction mixture to a temperature or a set of temperatures wherein one or more primers hybridize to the reference polynucleotide or target polynucleotide if present;
[0240] (3) extending the one or more primers hybridized to the reference polynucleotide or target polynucleotide if present;
[0241] (c) subjecting the reaction mixture to an amplification process, wherein the amount of reference polynucleotides or percentage of reference polynucleotide compared to target polynucleotides extended by one or more primers is increased compared to step (b).
[0242] In certain embodiments, the polynucleotide is RNA.
[0243] In certain embodiments, the polynucleotide is DNA.
[0244] In certain embodiments, the target polynucleotide is different from the reference polynucleotide by a genetic alteration, wherein the generic alteration is a substitution of one or more nucleotides, and / or an insertion of one or more nucleotides, and / or a deletion of one or more nucleotides, and / or the addition of a methyl group to one or more nucleotides, and / or the removal of a methyl group to one or more nucleotides.
[0245] In certain embodiments, the primer pair hybridizes to a position flanking the target mutation. In certain embodiments, the primer pair has the same affinity to the target and the 17038.003W01 reference polynucleotide because the primers hybridize to a region where the target and the reference have 100% homology.
[0246] In certain embodiments, the only the blocking oligonucleotide hybridizes to the region where the target and reference are different.
[0247] In certain embodiments, the DNA polymerase is a high-fidelity DNA polymerase that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity.
[0248] In certain embodiments, the DNA polymerase has an error rate of less than 10‘5, less than 10‘6, or less than 10‘7.
[0249] In certain embodiments, the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.
[0250] In certain embodiments, the blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group. In certain embodiments, tall of the nucleotides of the blocking oligonucleotide are LNAs.
[0251] In certain embodiments, the blocking oligonucleotide has a length of between 8 and 20 nucleotides, such as 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.
[0252] In certain embodiments, the blocking oligonucleotide has a length of between 10 and 15 nucleotides. An optimal range is the shortest blocking oligonucleotide with a melting temperature of more than 10°C above the primer melting temperature. A shorter blocking oligonucleotide will give a larger melting temperature difference between the target oligonucleotide and the reference oligonucleotide. This in turn gives the blocking oligonucleotide a maximum efficiency, because a lower percentage of target oligonucleotide is hybridized when the reference oligonucleotide is greater than 90% hybridized. The blocking oligonucleotide melting temperature is optimally more than 10°C above the melting temperature of the primers. In certain embodiments the blocking oligonucleotide is designed to have an annealing temperature at the mid-point. For example, a blocking oligonucleotide is designed to have a Tm of 70°C and the primer a Tm of 60°C. In this example, at 65°C the primer does not significantly bind (<1%) but the blocking oligonucleotide does bind (>90%). It is desired to have the blocking oligonucleotide annealing temperature to optimally be 5°C above the primer melting temperature, and to have the blocking oligonucleotide annealing temperature to be 5°C below the blocking oligonucleotide melting temperature. 17038.003W01
[0253] In certain embodiments, the genetic alteration comprises a substitution, a deletion, and / or an insertion.
[0254] In certain embodiments, the sample is a liquid biopsy (LB). In certain embodiments, the liquid biopsy is a biological fluid.
[0255] In certain embodiments, contacting the target polynucleotide with a detection agent.
[0256] In certain embodiments, the detection agent is a DNA binding fluorophore or a probe.
[0257] In certain embodiments, provided herein is a method for detecting a double-stranded target polynucleotide in a sample, the method comprising the steps of:
[0258] (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising:
[0259] (1) the sample or a fraction of the sample;
[0260] (2) a DNA polymerase;
[0261] (3) a pair of primers that flank the genetic alteration; and
[0262] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0263] (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0264] (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0265] (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide but above the melting temperature of one or both of the primers;
[0266] (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0267] (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide;
[0268] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide; and 17038.003W01
[0269] (h) contacting the target polynucleotide with a detection agent.
[0270] In certain embodiments, provided herein is a method for detecting a double-stranded target polynucleotide in a sample, the method comprising the steps of:
[0271] (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising:
[0272] (1) the sample or a fraction of the sample;
[0273] (2) a DNA polymerase;
[0274] (3) a pair of primers that flank the genetic alteration; and
[0275] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0276] (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0277] (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0278] (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide but above the melting temperature of one or both of the primers;
[0279] (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0280] (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide;
[0281] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide;
[0282] (h) performing a PCR amplification of the enriched reaction mixture to obtain a further amplification product, the reaction mixture comprising: (1) the enriched reaction mixture; (2) a DNA polymerase (3) a second pair of primers that flank the genetic alteration, wherein one or both of the primers hybridize 17038.003W01 to the reference polynucleotide and the target polynucleotide interior to the first set of primers;
[0283] (i) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0284] (j) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0285] (k) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide;
[0286] (l) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0287] (m) repeating steps (i) through (1) in order for two or more cycles so as to enrich target polynucleotide;
[0288] (n) repeating steps (i), (k) and (1) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate a further enriched reaction mixture; and
[0289] (o) contacting the target polynucleotide with a detection agent.
[0290] In certain embodiments, wherein the detection agent is a DNA binding fluorophore or a probe. In certain embodiments, the DNA binding fluorophore is sybr green. In certain embodiments, the detection agent is a probe.
[0291] In certain embodiments provided herein is a kit for enriching a double-stranded target polynucleotide comprising a genetic alteration in a sample, comprising:
[0292] (A) a DNA polymerase that lacks 5 '->3 ' nuclease activity;
[0293] (B) a blocking oligonucleotide that hybridizes selectively to a reference polynucleotide and not to the target polynucleotide;
[0294] (C) a pair of primers that flank the genetic alteration and does not overlap with the blocking oligonucleotide;
[0295] (D) instructions that include the steps comprising: 17038.003W01
[0296] (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising:
[0297] (1) the sample or a fraction of the sample;
[0298] (2) a DNA polymerase;
[0299] (3) a pair of primers that flank the genetic alteration; and
[0300] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0301] (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0302] (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0303] (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide but above the melting temperature of one or both of the primers;
[0304] (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0305] (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide; and
[0306] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide.
[0307] In certain embodiments provided herein is a kit for enriching a double-stranded target polynucleotide comprising a genetic alteration in a sample, comprising:
[0308] (A) a DNA polymerase that lacks 5 '->3 ' nuclease activity;
[0309] (B) a blocking oligonucleotide that hybridizes selectively to a reference polynucleotide and not to the target polynucleotide; 17038.003W01
[0310] (C) a pair of primers that flank the genetic alteration and does not overlap with the blocking oligonucleotide;
[0311] (D) instructions that include the steps comprising:
[0312] (a) performing a first PCR amplification in a reaction mixture, the reaction mixture comprising:
[0313] (1) the sample or a fraction of the sample;
[0314] (2) a DNA polymerase;
[0315] (3) a first pair of primers that flank the genetic alteration; and
[0316] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0317] (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0318] (c) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0319] (d) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide;
[0320] (e) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0321] (f) repeating steps (b) through (e) in order for two or more cycles so as to enrich target polynucleotide;
[0322] (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate an enriched reaction mixture;
[0323] (h) performing a PCR amplification of the enriched reaction mixture to obtain a further amplification product, the reaction mixture comprising: (1) the enriched reaction mixture; (2) a DNA polymerase (3) a second pair of primers that flank the genetic alteration, wherein one or both of the primers hybridize 17038.003W01 to the reference polynucleotide and the target polynucleotide interior to the first set of primers;
[0324] (i) increasing the temperature of the reaction mixture above the melting temperature of the double stranded reference polynucleotide and the double strand target polynucleotide;
[0325] (j) reducing the temperature of the reaction mixture to below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide;
[0326] (k) reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide;
[0327] (l) extending the primers hybridized to the reference polynucleotide or target polynucleotide;
[0328] (m) repeating steps (i) through (1) in order for two or more cycles so as to enrich target polynucleotide; and
[0329] (n) repeating steps (i), (k) and (1) in order for two or more cycles so as to replicate both the reference polynucleotide and the target polynucleotide to generate a further enriched reaction mixture.
[0330] In certain embodiments, two or more different PCR cycling conditions are used without adding or removing anything from the sample. In certain embodiments two different sets of PCR cycling conditions are used. In certain embodiments a PCR condition consists of one or more cycles of different temperatures. In certain embodiments, the first PCR cycling condition allow for the preferential replication of the target polynucleotide compared to the reference polynucleotide. The second PCR cycling condition reduce the preferential replication of the target polynucleotide compared to the reference polynucleotide. In certain embodiments the two PCR conditions have different cycling temperatures. In certain embodiments the two PCR cycling conditions have different amount of time at a cycling step.
[0331] In certain embodiments, different PCR conditions have different DNA replication efficiencies for the target polynucleotide. In certain embodiments, different PCR conditions have different DNA replication efficiencies for the reference polynucleotide. In certain embodiments, different PCR conditions have different blocking efficiencies. In certain 17038.003W01 embodiments, different PCR conditions result in different enrichment efficiencies for the target polynucleotides relative to the reference polynucleotide. In certain embodiments, the temperature parameter is different between the different PCR conditions. In certain embodiments, the time parameter is different between the different PCR conditions. In certain embodiments, the first PCR condition contains a step wherein the blocker hybridizes to the reference polynucleotide prior to the primers hybridizing to the reference polynucleotide, and a second PCR condition does not contain a step wherein the blocker hybridizes to the reference polynucleotide prior to the primers. In certain embodiments, the amount of time during which the primer can hybridize with the target or reference polynucleotide is different between the first PCR condition and the second PCR condition. In certain embodiments, the amount of time during which the primer can hybridize with the target or reference polynucleotide is longer during the second PCR condition.
[0332] In certain embodiments, isothermal PCR replication is used instead of PCR cycling.
[0333] In certain embodiments, provided herein is a method for detecting a double-stranded target polynucleotide in a sample, the method comprising the steps of:
[0334] (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising:
[0335] (1) the sample or a fraction of the sample;
[0336] (2) a DNA polymerase;
[0337] (3) a pair of primers that flank the genetic alteration; and
[0338] (4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
[0339] (b) using two or more different sets of polymerase chain reaction amplification conditions without adding or removing anything from the sample.
[0340] The invention will now be illustrated by the following non-limiting Examples.
[0341] EXAMPLE 1
[0342] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers. 17038.003W01
[0343] DNA for KRAS wild-type (catalog HD710) and KRAS G12C (catalog HD269) were purchased from Horizon Discovery. KRAS G12C (catalog HD269) is heterozygous for the KRAS G12C mutation, so only 50% of the DNA copies contain the KRAS G12C mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).
[0344] The KRAS wild-type sequence is provided by SEQ ID NO: 1 :
[0345] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO: 1)
[0346] The KRAS G12C sequence is provided by SEQ ID NO:2 and includes a G~>t transversion:
[0347] GACTGAATATAAACTTGTGGTAGTTGGAGCTtGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO:2)
[0348] Primers were designed as follows:
[0349] 1stForward Primer (SEQ ID NO:3): GACTGAATATAAACTTGTGGTAG
[0350] 1stReverse Primer (SEQ ID NO:4): GTTGGATCATATTCGTCCAC
[0351] The oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:
[0352] Oligonucleotide Blocker (SEQ ID NO:5):
[0353] +A+C+G+C+C+A+C+C+A+G+C+T
[0354] The total reaction volume of 50 pl was prepared as follows:
[0355] 1stForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0356] 1stReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0357] Blocker: 0.1 pM (working concentration (1 pl of 5 pM stock)
[0358] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0359] Water (20 pl)
[0360] Sample (2 pl) 17038.003W01
[0361] Sample 1 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 1 was 100% KRAS wild-type.
[0362] Sample 2 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G12C (catalog HD269). Sample 2 was approximately 0.5% KRAS G12C.
[0363] Sample 3 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G12C (catalog HD269). Sample 3 was approximately 0.05% KRAS G12C.
[0364] Sample 4 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G12C (catalog HD269). Sample 4 was approximately 0.005% KRAS G12C.
[0365] Sample 5 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G12C (catalog HD269). Sample 5 was approximately 0.0005% KRAS G12C.
[0366] Sample 6 contained 2 pl of water.
[0367] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 72 °C for 60 seconds.
[0368] The PCR product was run on a 1.5% agarose gel (Sigma A5093) (FIG. 1A). 10 pl of PCR product was mixed with 3 pl of NEB loading dye (catalog B7024S).
[0369] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0370] Samples 1, 4, 5 and 6 contained less than the lower limit of DNA quantification using the Qubit 4 lx dsDNA BR (catalog Q33262).
[0371] Samples 2 and 3 contained enough DNA for quantification using Qubit 4 lx dsDNA BR (catalog Q33262).
[0372] A second PCR was performed on the amplified first PCR product.
[0373] 2ndForward Primer (SEQ ID NO:6):
[0374] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0375] GGTAG
[0376] 2ndReverse Primer (SEQ ID NO:7):
[0377] GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTTGGATCATATTCGTCCA C 17038.003W01
[0378] The total reaction volume of 50 pl was prepared as follows:
[0379] 2ndForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0380] 2ndReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0381] Purified PCR product (2 pl)
[0382] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0383] Water (21 pl)
[0384] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0385] Sample 3 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. IB).
[0386] Sample 3 was sequenced using Azenta Genewiz Amplicon EZ and analysis was performed with CRISPResso2 (FIG. 1C).
[0387] FIG. 1A illustrates the results of the agarose gel. Samples 1 to 6 were in lanes 1 to 6 respectively. FIG. IB illustrates the results of the Sanger sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C. FIG. 1C illustrates the results of the Amplicon EZ sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.
[0388] EXAMPLE 2
[0389] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant was the KRAS G13D mutation, known to be associated with or present in some cancers.
[0390] DNA for KRAS wild-type (catalog HD710) and KRAS G13D (catalog HD270) were purchased from Horizon Discovery. KRAS G13D (catalog HD270) is heterozygous for the KRAS G13D mutation, so only 50% of the DNA copies contain the KRAS G13D mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).
[0391] The KRAS wild-type sequence is provided by SEQ ID NO: 1.
[0392] The KRAS G13D sequence is provided by SEQ ID NO:8 and includes a G- a transition:
[0393] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGaCGTAGGCAAGAGTG
[0394] CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA
[0395] AC (SEQ ID NO: 8) 17038.003W01
[0396] The total reaction volume of 50 pl was prepared as follows:
[0397] 1stForward primer (SEQ ID NO:3): 0.1 pM working concentration (1 pl of 5 pM stock) 1stReverse primer (SEQ ID NO:4): 0.1 pM working concentration (1 pl of 5 pM stock) Oligonucleotide Blocker (SEQ ID NO:5): 0.1 pM (working concentration (1 pl of 5 pM stock)
[0398] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0399] Water (20 pl)
[0400] Sample (2 pl)
[0401] Sample 7 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 7 contained 100% KRAS wild-type.
[0402] Sample 8 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G13D (catalog HD270). Sample 8 was approximately 0.5% KRAS G13D.
[0403] Sample 9 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G13D (catalog HD270). Sample 9 was approximately 0.05% KRAS G13D.
[0404] Sample 10 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G13D (catalog HD270). Sample 10 was approximately 0.005% KRAS G13D.
[0405] Sample 11 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G13D (catalog HD270). Sample 11 was approximately 0.0005% KRAS G13D.
[0406] Sample 12 contained 2 pl of water.
[0407] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 72 °C for 60 seconds.
[0408] The PCR product was run on a 1.5% agarose gel (Sigma A5093) (FIG. 2A). 10 pl of PCR product was mixed with 3 pl of NEB loading dye (catalog B7024S).
[0409] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0410] Samples 7, 11 and 12 contained less than the lower limit of DNA quantification using the Qubit 4 lx dsDNA BR (catalog Q33262).
[0411] Samples 8, 9 and 10 contained enough DNA for quantification using Qubit 4 lx dsDNA BR (catalog Q33262). 17038.003W01
[0412] A second PCR was performed on the amplified first PCR product. The total reaction volume of 50 pl was prepared as follows:
[0413] 2ndForward primer (SEQ ID NO:6): 0.1 pM working concentration (1 pl of 5 pM stock)
[0414] 2ndReverse primer (SEQ ID NO:7): 0.1 pM working concentration (1 pl of 5 pM stock)
[0415] Purified PCR product (2 pl)
[0416] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0417] Water (21 pl)
[0418] Sample 10 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 2B).
[0419] Sample 9 was sequenced using Azenta Genewiz Amplicon EZ and analysis was performed with CRISPResso2 (FIG. 2C).
[0420] FIG. 2A illustrates the results of the agarose gel. Samples 7 to 12 were in lanes 1 to 6 respectively. FIG. 2B illustrates the results of the Sanger sequencing run for Sample 10, which contained approximately 0.005% KRAS G13D. FIG. 2C illustrates the results of the Amplicon EZ sequencing run for Sample 9, which contained approximately 0.05% KRAS G13D.
[0421] EXAMPLE 3
[0422] This example describes how altering the PCR protocol allowed a sample containing only reference DNA (KRAS wild-type) to be amplified enough to allow for sequencing while still maintaining high enrichment of a low frequency variant (KRAS G12C). In this example the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers.
[0423] The setup was the same as described in Example 1, with only a modification to the first PCR protocol.
[0424] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 15 cycles of (95 °C for 10 seconds, and 55 °C for 20 seconds), 72 °C for 60 seconds.
[0425] Sample 13 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 13 was 100% KRAS wild-type. 17038.003W01
[0426] Sample 14 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G12C (catalog HD269). Sample 14 was approximately 0.5% KRAS G12C.
[0427] Sample 15 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G12C (catalog HD269). Sample 15 was approximately 0.05% KRAS G12C.
[0428] Sample 16 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G12C (catalog HD269). Sample 16 was approximately 0.005% KRAS G12C.
[0429] Sample 17 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G12C (catalog HD269). Sample 17 was approximately 0.0005% KRAS G12C.
[0430] Sample 18 contained 2 pl of water.
[0431] Samples 13, 14, 15, 16 and 17 contained enough DNA for Sanger sequencing.
[0432] Samples 13, 16 and 17 contained the wild-type sequence. Samples 14 and 15 contained the target KRAS G12C sequence.
[0433] FIG. 3A illustrates the results of the agarose gel. Sample 13 to 18 were in lanes 1 to 6 respectively. FIG. 3B illustrates Sample 13 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 3C illustrates Sample 15 Sanger sequencing results, which contains approximately 0.05% KRAS G12C.
[0434] EXAMPLE 4
[0435] This example describes how altering the PCR protocol allowed a sample containing only reference DNA (KRAS wild-type) to be amplified enough to allow for sequencing while still maintaining high enrichment of a low frequency variant (KRAS G13D). In this example the low frequency variant is the KRAS G13D mutation, known to be associated with or present in some cancers.
[0436] The setup was the same as described in Example 2, with only a modification to the first PCR protocol.
[0437] A PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 15 cycles of (95 °C for 10 seconds, and 55 °C for 20 seconds), 72 °C for 60 seconds. 17038.003W01
[0438] Sample 19 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 19 contained 100% KRAS wild-type.
[0439] Sample 20 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng / pl KRAS G13D (catalog HD270). Sample 20 was approximately 0.5% KRAS G13D.
[0440] Sample 21 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng / pl KRAS G13D (catalog HD270). Sample 21 was approximately 0.05% KRAS G13D.
[0441] Sample 22 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng / pl KRAS G13D (catalog HD270). Sample 22 was approximately 0.005% KRAS G13D.
[0442] Sample 23 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng / pl KRAS G13D (catalog HD270). Sample 23 was approximately 0.0005% KRAS G13D.
[0443] Sample 24 contained 2 pl of water.
[0444] Samples 19, 20, 21, 22 and 23 contained enough DNA for Sanger sequencing.
[0445] Samples 19, 22 and 23 contained the wild-type sequence. Samples 20 and 21 contained the target KRAS G13D sequence.
[0446] FIG. 4A illustrates the results of the agarose gel. Samples 19 to 24 were in lanes 1 to 6 respectively. FIG. 4B illustrates Sample 19 Sanger sequencing results, which contains 100% KRAS wild-type. FIG. 4C illustrates Sample 21 Sanger sequencing results, which contains approximately 0.05% KRAS G13D.
[0447] EXAMPLE 5
[0448] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers.
[0449] DNA for KRAS wild-type (catalog HD710) and KRAS G12C (catalog HD269) were purchased from Horizon Discovery. KRAS G12C (catalog HD269) is heterozygous for the KRAS G12C mutation, so only 50% of the DNA copies contain the KRAS G12C mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S). 17038.003W01
[0450] The KRAS wild-type sequence is provided by SEQ ID NO: 1 :
[0451] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO: 1)
[0452] The KRAS G12C sequence is provided by SEQ ID NO:2 and includes a G~>t transversion:
[0453] GACTGAATATAAACTTGTGGTAGTTGGAGCTtGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO:2)
[0454] Primers were designed as follows:
[0455] 1stForward Primer (SEQ ID NO:3): GACTGAATATAAACTTGTGGTAG
[0456] 1stReverse Primer (SEQ ID NO:4): GTTGGATCATATTCGTCCAC
[0457] The oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:
[0458] Oligonucleotide Blocker (SEQ ID NO:5):
[0459] +A+C+G+C+C+A+C+C+A+G+C+T
[0460] The total reaction volume of 25 pl was prepared as follows:
[0461] 1stForward primer: 0.1 pM working concentration (0.5 pl of 5 pM stock)
[0462] 1stReverse primer: 0.1 pM working concentration (0.5 pl of 5 pM stock)
[0463] Blocker: 0.1 pM (working concentration (0.5 pl of 5 pM stock)
[0464] 2x Q5 Master Mix: lx working concentration (12.5 pl of 2x Master Mix)
[0465] Water (9 pl)
[0466] Sample (2 pl)
[0467] Sample 25 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.0125 ng / pl KRAS G12C (catalog HD269). Sample 3 was approximately 0.0125% KRAS G12C. 17038.003W01
[0468] A PCR protocol was performed as follows: 95 °C for 30 seconds, 35 cycles of (95 °C for 10 seconds, 80 °C for 20 seconds, and 60 °C for 15 seconds), 30 cycles of (95 °C for 10 seconds, 56 °C for 20 seconds), 72 °C for 30 seconds.
[0469] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0470] A second PCR was performed on the amplified first PCR product.
[0471] 2ndForward Primer (SEQ ID NO:6):
[0472] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0473] GGTAG
[0474] 2ndReverse Primer (SEQ ID NO: 8):
[0475] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG ATTCTG
[0476] The total reaction volume of 25 pl was prepared as follows:
[0477] 2ndForward primer: 0.1 pM working concentration (0.5 pl of 5 pM stock)
[0478] 2ndReverse primer: 0.1 pM working concentration (0.5 pl of 5 pM stock)
[0479] Purified 1st PCR product (1.5 pl)
[0480] 2x Q5 Master Mix: lx working concentration (12.5 pl of 2x Master Mix)
[0481] Water (10 pl)
[0482] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 20 seconds), 72 °C for 30 seconds.
[0483] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0484] Sample 25 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 5).
[0485] FIG. 5 illustrates the results of the Sanger sequencing of Sample 25.
[0486] EXAMPLE 6
[0487] This example describes how a low frequency variant was enriched and detected. Briefly, it should be noted that the low frequency variant was able to be enriched and detected without needing to touch or modify the sample. External factors, like temperature and time, were used to create high or low blocking efficiency. This example also describes how samples containing only reference polynucleotide, or wild-type DNA, were processed using the same method and were detected. 17038.003W01
[0488] This example shows that increasing the time of the blocker annealing step results in higher blocking. (Figs. 6A-6D). Equilibrium was not achieved because the blocker annealing step was too short. Figs. 7A-7D shows that the process still produced a result with 100% WT DNA.
[0489] In this example the low frequency variant is the KRAS G12D mutation, known to be associated with or present in some cancers. DNA for KRAS wild-type (catalog HD710) and KRAS G12D (catalog HD272) were purchased from Horizon Discovery. KRAS G12D (catalog HD272) is heterozygous for the KRAS G12D mutation, so only 50% of the DNA copies contain the KRAS G12D mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).
[0490] The KRAS wild-type sequence is provided by (SEQ ID NO: 1):
[0491] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO: 1)
[0492] The KRAS G12D sequence is provided by SEQ ID NO:9 and includes a G~>a transition:
[0493] GACTGAATATAAACTTGTGGTAGTTGGAGCTGaTGGCGTAGGCAAGAGTG
[0494] CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA
[0495] AC (SEQ ID NO: 9)
[0496] Primers were designed as follows:
[0497] 1stForward Primer (SEQ ID NO:3): GACTGAATATAAACTTGTGGTAG
[0498] 1stReverse Primer (SEQ ID NO:4): GTTGGATCATATTCGTCCAC
[0499] The oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:
[0500] Oligonucleotide Blocker (SEQ ID NO:5):
[0501] +A+C+G+C+C+A+C+C+A+G+C+T
[0502] The total reaction volume of 50 pl was prepared as follows: 17038.003W01
[0503] 1stForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0504] 1stReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0505] Blocker: 0.05 pM working concentration (1 pl of 2.5 pM stock)
[0506] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0507] Water (20 pl)
[0508] Sample (2 pl)
[0509] Sample 26 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.025 ng / pl KRAS G12D (catalog HD272).
[0510] Sample 27 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water.
[0511] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 25 seconds, and 60 °C for 45 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0512] A second PCR was performed on the amplified first PCR product.
[0513] 2ndForward Primer (SEQ ID NO:6):
[0514] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0515] GGTAG
[0516] 2ndReverse Primer (SEQ ID NO: 8):
[0517] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG ATTCTG
[0518] The total reaction volume of 20 pl was prepared as follows:
[0519] 2ndForward primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0520] 2ndReverse primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0521] Unpurified 1st PCR product (2.0 pl)
[0522] 2x Q5 Master Mix: lx working concentration (10 pl of 2x Master Mix)
[0523] Water (6 pl)
[0524] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 30 seconds), 72 °C for 30 seconds. 17038.003W01
[0525] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0526] Sample 26 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 6A).
[0527] FIG. 6A illustrates the results of the Sanger sequencing of Sample 26.
[0528] Sample 27 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 7A).
[0529] FIG. 7A illustrates the results of the Sanger sequencing of Sample 27.
[0530] Sample 28 and Sample 29 were the same as Sample 26 and Sample 27 (respectively), but the first PCR cycling conditions were changed.
[0531] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 60 seconds, and 60 °C for 45 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0532] Sample 28 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 6B).
[0533] FIG. 6B illustrates the results of the Sanger sequencing of Sample 28.
[0534] Sample 29 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 7B).
[0535] FIG. 7B illustrates the results of the Sanger sequencing of Sample 29.
[0536] Sample 30 and Sample 31 were the same as Sample 26 and Sample 27 (respectively), but the first PCR cycling conditions were changed.
[0537] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 120 seconds, and 60 °C for 45 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0538] Sample 30 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 6C).
[0539] FIG. 6C illustrates the results of the Sanger sequencing of Sample 30.
[0540] Sample 31 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 7C).
[0541] FIG. 7C illustrates the results of the Sanger sequencing of Sample 31. 17038.003W01
[0542] Sample 32 and Sample 33 were the same as Sample 26 and Sample 27 (respectively), but the first PCR cycling conditions were changed.
[0543] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 240 seconds, and 60 °C for 45 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0544] Sample 32 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 6D).
[0545] FIG. 6D illustrates the results of the Sanger sequencing of Sample 32.
[0546] Sample 33 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 7D).
[0547] FIG. 7D illustrates the results of the Sanger sequencing of Sample 33.
[0548] EXAMPLE 7
[0549] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant is the KRAS G12D mutation, known to be associated with or present in some cancers. This example also describes how samples containing only reference polynucleotide, or wild-type DNA, were processed using the same method and were detected.
[0550] Figs. 8A-8D shows how the changing the time for the primer annealing step can increase or decrease the efficiency of the blocking. Figs. 9A-9D were the same reaction conditions, but with 100% wildtype DNA.
[0551] DNA for KRAS wild-type (catalog HD710) and KRAS G12D (catalog HD272) were purchased from Horizon Discovery. KRAS G12D (catalog HD272) is heterozygous for the KRAS G12D mutation, so only 50% of the DNA copies contain the KRAS G12D mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).
[0552] The KRAS wild-type sequence is provided by (SEQ ID NO: 1):
[0553] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO: 1) 17038.003W01
[0554] The KRAS G12D sequence is provided by SEQ ID NO:9 and includes a G~>a transition:
[0555] GACTGAATATAAACTTGTGGTAGTTGGAGCTGaTGGCGTAGGCAAGAGTG
[0556] CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA
[0557] AC (SEQ ID NO: 9)
[0558] Primers were designed as follows:
[0559] 1stForward Primer (SEQ ID NO:3): GACTGAATATAAACTTGTGGTAG
[0560] 1stReverse Primer (SEQ ID NO:4): GTTGGATCATATTCGTCCAC
[0561] The oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:
[0562] Oligonucleotide Blocker (SEQ ID NO:5):
[0563] +A+C+G+C+C+A+C+C+A+G+C+T
[0564] The total reaction volume of 50 pl was prepared as follows:
[0565] 1stForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0566] 1stReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0567] Blocker: 0.05 pM working concentration (1 pl of 2.5 pM stock)
[0568] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0569] Water (20 pl)
[0570] Sample (2 pl)
[0571] Sample 34 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.025 ng / pl KRAS G12D (catalog HD272).
[0572] Sample 35 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water.
[0573] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 120 seconds, and 60 °C for 25 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0574] A second PCR was performed on the amplified first PCR product.
[0575] 2ndForward Primer (SEQ ID NO:6): 17038.003W01
[0576] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0577] GGTAG
[0578] 2ndReverse Primer (SEQ ID NO: 8):
[0579] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG
[0580] ATTCTG
[0581] The total reaction volume of 20 pl was prepared as follows:
[0582] 2ndForward primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0583] 2ndReverse primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0584] Unpurified 1st PCR product (2.0 pl)
[0585] 2x Q5 Master Mix: lx working concentration (10 pl of 2x Master Mix)
[0586] Water (6 pl)
[0587] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 30 seconds), 72 °C for 30 seconds.
[0588] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0589] Sample 34 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 8A).
[0590] FIG. 8A illustrates the results of the Sanger sequencing of Sample 34.
[0591] Sample 35 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 9A).
[0592] FIG. 9A illustrates the results of the Sanger sequencing of Sample 35.
[0593] Sample 36 and Sample 37 were the same as Sample 34 and Sample 35 (respectively), but the first PCR cycling conditions were changed.
[0594] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 120 seconds, and 60 °C for 45 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0595] Sample 36 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 8B).
[0596] FIG. 8B illustrates the results of the Sanger sequencing of Sample 36. 17038.003W01
[0597] Sample 37 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 9B).
[0598] FIG. 9B illustrates the results of the Sanger sequencing of Sample 37.
[0599] Sample 38 and Sample 39 were the same as Sample 34 and Sample 35 (respectively), but the first PCR cycling conditions were changed.
[0600] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 120 seconds, and 60 °C for 60 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0601] Sample 38 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 8C).
[0602] FIG. 8C illustrates the results of the Sanger sequencing of Sample 38.
[0603] Sample 39 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 9C).
[0604] FIG. 9C illustrates the results of the Sanger sequencing of Sample 39.
[0605] Sample 40 and Sample 41 were the same as Sample 34 and Sample 35 (respectively), but the first PCR cycling conditions were changed.
[0606] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 73 °C for 120 seconds, and 60 °C for 120 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0607] Sample 40 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 8D).
[0608] FIG. 8D illustrates the results of the Sanger sequencing of Sample 40.
[0609] Sample 41 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 9D).
[0610] FIG. 9D illustrates the results of the Sanger sequencing of Sample 41.
[0611] EXAMPLE 8
[0612] This example describes how a low frequency variant was enriched and detected. In this example the low frequency variant is the KRAS G12R mutation, known to be associated with or present in some cancers. This example also describes how samples containing only reference polynucleotide, or wild-type DNA, were processed using the same method and were detected. 17038.003W01
[0613] Figs. 10A-10D shows that changing the blocker annealing temperature, which increased the efficiency of the blocking. This was done at two different concentrations of blocker and two different blocker annealing temperatures. Basically, lowering the blocker annealing temperature allowed a higher percentage of normal DNA to hybridize with the blocker. Figs. 11A-11D were the same reaction conditions, but with 100% WT DNA.
[0614] DNA for KRAS wild-type (catalog HD710) and KRAS G12R (catalog HD287) were purchased from Horizon Discovery. KRAS G12R (catalog HD287) is heterozygous for the KRAS G12R mutation, so only 50% of the DNA copies contain the KRAS G12R mutation. Oligonucleotides, including the primers and the blocker, were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (catalog M0492S).
[0615] The KRAS wild-type sequence is provided by (SEQ ID NO: 1):
[0616] GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTG CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO: 1)
[0617] The KRAS G12R sequence is provided by SEQ ID NO: 10 and includes a G~>c transversion:
[0618] GACTGAATATAAACTTGTGGTAGTTGGAGCTcGTGGCGTAGGCAAGAGTG
[0619] CCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCA AC (SEQ ID NO: 10)
[0620] Primers were designed as follows:
[0621] 1stForward Primer (SEQ ID NO:3): GACTGAATATAAACTTGTGGTAG
[0622] 1stReverse Primer (SEQ ID NO:4): GTTGGATCATATTCGTCCAC
[0623] The oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:
[0624] Oligonucleotide Blocker (SEQ ID NO:5):
[0625] +A+C+G+C+C+A+C+C+A+G+C+T
[0626] The total reaction volume of 50 pl was prepared as follows: 17038.003W01
[0627] 1stForward primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0628] 1stReverse primer: 0.1 pM working concentration (1 pl of 5 pM stock)
[0629] Blocker: 0.2 pM working concentration (1 pl of 10 pM stock)
[0630] 2x Q5 Master Mix: lx working concentration (25 pl of 2x Master Mix)
[0631] Water (20 pl)
[0632] Sample (2 pl)
[0633] Sample 42 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.025 ng / pl KRAS G12R (catalog HD287).
[0634] Sample 43 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water.
[0635] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 80 °C for 120 seconds, and 60 °C for 25 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0636] A second PCR was performed on the amplified first PCR product.
[0637] 2ndForward Primer (SEQ ID NO:6):
[0638] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0639] GGTAG
[0640] 2ndReverse Primer (SEQ ID NO: 8):
[0641] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG ATTCTG
[0642] The total reaction volume of 20 pl was prepared as follows:
[0643] 2ndForward primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0644] 2ndReverse primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0645] Unpurified 1st PCR product (2.0 pl)
[0646] 2x Q5 Master Mix: lx working concentration (10 pl of 2x Master Mix)
[0647] Water (6 pl)
[0648] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 30 seconds), 72 °C for 30 seconds. 17038.003W01
[0649] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0650] Sample 42 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 10A).
[0651] FIG. 10A illustrates the results of the Sanger sequencing of Sample 42.
[0652] Sample 43 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 11 A).
[0653] FIG. 11A illustrates the results of the Sanger sequencing of Sample 43.
[0654] Sample 44 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.025 ng / pl KRAS G12R (catalog HD287).
[0655] Sample 45 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water.
[0656] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 76 °C for 120 seconds, and 60 °C for 25 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0657] A second PCR was performed on the amplified first PCR product.
[0658] 2ndForward Primer (SEQ ID NO:6):
[0659] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0660] GGTAG
[0661] 2ndReverse Primer (SEQ ID NO: 8):
[0662] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG ATTCTG
[0663] The total reaction volume of 20 pl was prepared as follows:
[0664] 2ndForward primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0665] 2ndReverse primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0666] Unpurified 1st PCR product (2.0 pl)
[0667] 2x Q5 Master Mix: lx working concentration (10 pl of 2x Master Mix)
[0668] Water (6 pl)
[0669] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 30 seconds), 72 °C for 30 seconds. 17038.003W01
[0670] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0671] Sample 44 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 10B).
[0672] FIG. 10B illustrates the results of the Sanger sequencing of Sample 44.
[0673] Sample 45 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 11B).
[0674] FIG. 11B illustrates the results of the Sanger sequencing of Sample 45.
[0675] Sample 46, Sample 47, Sample 48 and Sample 49 had a different blocker concentration. The blocker concentration was 0.1 pM working concentration (1 pl of 5 pM stock).
[0676] Sample 46 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.025 ng / pl KRAS G12R (catalog HD287).
[0677] Sample 47 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water.
[0678] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 80 °C for 120 seconds, and 60 °C for 25 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0679] A second PCR was performed on the amplified first PCR product.
[0680] 2ndForward Primer (SEQ ID NO:6):
[0681] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0682] GGTAG
[0683] 2ndReverse Primer (SEQ ID NO: 8):
[0684] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG ATTCTG
[0685] The total reaction volume of 20 pl was prepared as follows:
[0686] 2ndForward primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0687] 2ndReverse primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0688] Unpurified 1st PCR product (2.0 pl)
[0689] 2x Q5 Master Mix: lx working concentration (10 pl of 2x Master Mix)
[0690] Water (6 pl) 17038.003W01
[0691] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 30 seconds), 72 °C for 30 seconds.
[0692] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0693] Sample 46 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 10C).
[0694] FIG. 10C illustrates the results of the Sanger sequencing of Sample 46.
[0695] Sample 47 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 11C).
[0696] FIG. 11C illustrates the results of the Sanger sequencing of Sample 47.
[0697] Sample 48 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of 0.025 ng / pl KRAS G12R (catalog HD287).
[0698] Sample 49 contained 1 pl of 50 ng / pl KRAS wild-type (catalog HD710) and 1 pl of water.
[0699] A PCR protocol was performed as follows: 95 °C for 30 seconds, 25 cycles of (95 °C for 10 seconds, 76 °C for 120 seconds, and 60 °C for 25 seconds), 30 cycles of (95 °C for 10 seconds, 60 °C for 60 seconds), 72 °C for 30 seconds.
[0700] A second PCR was performed on the amplified first PCR product.
[0701] 2ndForward Primer (SEQ ID NO:6):
[0702] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGACTGAATATAAACTTGT
[0703] GGTAG
[0704] 2ndReverse Primer (SEQ ID NO: 8):
[0705] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATTCGTCCACAAAATG ATTCTG
[0706] The total reaction volume of 20 pl was prepared as follows:
[0707] 2ndForward primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0708] 2ndReverse primer: 0.125 pM working concentration (1.0 pl of 2.5 pM stock)
[0709] Unpurified 1st PCR product (2.0 pl)
[0710] 2x Q5 Master Mix: lx working concentration (10 pl of 2x Master Mix)
[0711] Water (6 pl) 17038.003W01
[0712] A PCR protocol was performed as follows: 95 °C for 30 seconds, 30 cycles of (95 °C for 10 seconds, and 56 °C for 30 seconds), 72 °C for 30 seconds.
[0713] The PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
[0714] Sample 48 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 10C). FIG. 10C illustrates the results of the Sanger sequencing of Sample 48.
[0715] Sample 49 was sequenced using Azenta Genewiz Sanger Sequencing (FIG. 11C). FIG. 11C illustrates the results of the Sanger sequencing of Sample 49.
[0716] Although the foregoing specification and examples fully disclose and enable the present invention, they are not intended to limit the scope of the invention, which is defined by the claims appended hereto.
[0717] All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.
[0718] The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No 17038.003W01 language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0719] When used in this specification and the claims as an adverb rather than a preposition, "about" means "approximately" and comprises the stated value and every non-negative value within 10% of that value; in other words, "about 100%" includes 90% and 110% and every value in between.
[0720] Unless stated otherwise, every range or interval includes both endpoints and every value in between.
[0721] The invention has been described as “comprising” certain steps and / or elements, which those of skill in the art also “consist of’ or “consist essentially of’ those steps and / or elements. As used herein, the transitional term “comprising” is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. Where the invention is intended to be more narrowly defined, the terms “consisting of’ or “consisting essentially of’ also are used to describe the invention. As used herein, the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of’ limits the scope of a claim to the specified elements or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. As used herein, a claim reciting “consisting essentially of’ occupies a middle ground between closed claims reciting a “consisting of’ format and fully open claims that recite “comprising.”
[0722] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
Claims
1. CLAIMSWHAT IS CLAIMED IS:
1. A method for enriching a target polynucleotide if present in a sample, the method comprising the steps of:(a) preparing a reaction mixture comprising:(1) the sample, wherein the sample possibly comprises a target polynucleotide having a genetic alteration, and comprises a reference polynucleotide lacking the genetic alteration;(2) a polymerase;(3) one or more primer oligonucleotides; and(4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide;(b) subjecting the reaction mixture to an amplification process, wherein the amplification process comprises:(1) increasing the temperature of the reaction mixture above the melting temperature of the reference polynucleotide and the target polynucleotide if present;(2) reducing the temperature of the reaction mixture to a temperature below the melting temperature of the blocking oligonucleotide to the reference polynucleotide but above the melting temperature of the one or more primer oligonucleotides, wherein the one or more primer oligonucleotides hybridize to the same strand of the reference polynucleotide as the blocking oligonucleotide;(3) reducing the temperature of the reaction mixture to allow the one or more primers to hybridize to the reference polynucleotide or target polynucleotide if present;(4) extending the one or more primers hybridized to the reference polynucleotide or target polynucleotide if present;(5) repeating steps (1) through (4) for two or more cycles to enrich target polynucleotide if present; and(6) repeating steps (1), (3) and (4) for two or more cycles to replicate both the reference polynucleotide and the target polynucleotide if present to generate amplified target polynucleotides and amplified reference polynucleotides.
2. A method for enriching a target polynucleotide having a genetic alteration in a sample, the method comprising the steps of:(a) preparing a reaction mixture comprising:(1) the sample, wherein the sample may comprise a target polynucleotide having a genetic alteration, and comprises a reference polynucleotide lacking the genetic alteration;(2) a polymerase;(3) one or more primers; and(4) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration;(b) subjecting the reaction mixture to an amplification process, wherein the amplification process comprises:(1) subjecting the reaction mixture to a temperature or a set of temperatures wherein the blocking oligonucleotide hybridizes to the reference polynucleotide(2) subjecting the reaction mixture to a temperature or a set of temperatures wherein one or more primers hybridize to the reference polynucleotide or target polynucleotide if present;(3) extending the one or more primers hybridized to the reference polynucleotide or target polynucleotide if present;(c) subjecting the reaction mixture to an amplification process, wherein the amount of reference polynucleotides or percentage of reference polynucleotide compared to target polynucleotides extended by one or more primers is increased compared to step (b).17038.003W013. The method of claim 1 or 2, wherein the amount or concentration of primer is high compared to the amount or concentration of the blocker.
4. The method of any one of claims 1-3, wherein the amount of time between the polynucleotide denaturing step and the primer hybridizing step is decreased to reduce the preferential amplification of the target polynucleotide compared to the reference polynucleotide.
5. The method of any one of claims 1-4, wherein the rate at which the temperature of the reaction is increased or decreased.
6. The method of any one of claims 1-5, wherein one or more parameters of temperature, time or ramp rate prevent replication of the reference polynucleotide.
7. The method of any one of claims 1-5, wherein one or more of temperature, time, or ramp rate, are changed to increase the replication of the reference polynucleotide.
8. The method of any one of claims 1-7, wherein the amplification process is PCR.
9. The method of claim 8, wherein the PCR is an isothermal PCR.
10. The method of claim 8, wherein the PCR is COLD-PCR.
11. The method of claim 8, wherein the PCR is ice COLD-PCR.
12. The method of claim 8, wherein the PCR is full COLD-PCR.
13. The method of any one of claims 1-12, wherein one or more blocking oligonucleotides are used.17038.003W0114. The method of any one of claims 1-13, wherein the target polynucleotide compared to the reference polynucleotide uses a switch-blocker.
15. The method of any one of claims 1-13, wherein the target polynucleotide compared to the reference polynucleotide uses Blocker Displacement Amplification.
16. The method of any one of claims 1-13, wherein the target polynucleotide compared to the reference polynucleotide uses a Xenonucleic Acid (XNA).
17. The method of any one of claims 1-13, wherein the target polynucleotide compared to the reference polynucleotide uses PNA Clamping.
18. The method of any one of claims 1-17, further comprising detecting the amplified target polynucleotides.
19. The method of claim 18, wherein the detecting is by quantitative PCR.
20. The method of claim 18, wherein the detecting is by digital PCR.
21. The method of claim 18, wherein the detecting is by droplet digital PCR.
22. The method of claim 18, wherein the detecting is by DNA sequencing.
23. The method of claim 22, wherein the DNA sequencing is by Sanger sequencing.
24. The method of claim 22, wherein the DNA sequencing is by next-generation sequencing.
25. The method of any one of claims 1-24, further comprising a further PCR reaction.17038.003W0126. The method of claim 25, wherein in the further PCR reaction one or more primers that are partially or full nested are used.
27. The method of claim 25, wherein the further PCR reaction is touch down PCR.
28. The method of any one of claims 1-27, wherein the sample is a liquid biopsy (LB).
29. The method of any one of claims 1-27, wherein the sample is a biological fluid.
30. The method of any one of claims 1-29, wherein the polymerase is a DNA polymerase.
31. The method of claim 30, wherein the DNA polymerase is a high-fidelity DNA polymerase that lacks 5 '- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity.
32. The method of claim 30 or 31, wherein the DNA polymerase has an error rate of less than 10‘5.
33. The method of claim 30 or 31, wherein the DNA polymerase has an error rate of less than 10‘6.
34. The method of claim 30 or 31, wherein the DNA polymerase has an error rate of less than 10‘7.
35. The method of any one of claims 1-34, wherein the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.17038.003W0136. The method of any one of claims 1-35, wherein the blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group.
37. The method of claim 36, wherein all of the nucleotides of the blocking oligonucleotide are LNAs.
38. The method of any one of claims 1-37, wherein the blocking oligonucleotide has a length of between 8 and 20 nucleotides.
39. The method of any one of claims 1-37, wherein the blocking oligonucleotide has a length of between 10 and 15 nucleotides.
40. The method of any one of claims 1-39, wherein the target polynucleotide is contacted with a detection agent.
41. The method of claim 40, wherein the detection agent is a probe or a DNA binding fluor ophore.
42. The method of claim 41, wherein the detection agent is a probe.