Short chain fatty acid analogues for targeted mucosal function

Abstract

Aspects of the present disclosure generally relate to a new class of compounds, and compositions thereof, for treating a mucosal disease or symptom thereof in a patient. Aspects of the present disclosure also generally relate to methods of treating a mucosal disease or symptom thereof in a patient using the new class of compounds and compositions thereof. In an aspect, a composition for treating a mucosal disease or symptom thereof in a patient is provided. The composition includes a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

Description

PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)Title: Short Chain Fatty Acid Analogues for Targeted Mucosal FunctionInventors: Sean P. Colgan; Alfredo Ornelas SanchezCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of and priority to United States Patent Application No. 63 / 692,689, filed on September 9, 2024, which is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under 346578 awarded by Crohn’s & Colitis Foundation (CCFA), and under DK 104713 and DK50189 both awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD

[0003] Aspects of the present disclosure generally relate to a new class of compounds, and compositions thereof, for treating a mucosal disease or symptom thereof in a patient. Aspects of the present disclosure also generally relate to methods of treating a mucosal disease or symptom thereof in a patient using the new class of compounds and compositions thereof.BACKGROUND

[0004] Inflammatory bowel disease (IBD) is a group of disorders involving chronic inflammation of tissues in the digestive tract. Two types of IBD include ulcerative colitis and Crohn’s disease. Ulcerative colitis involves inflammation and ulcers along the lining of the large intestine (colon) and rectum. Crohn’s disease is characterized by inflammation of the lining of the digestive tract, which involves the deeper layers of the digestive tract. Crohn’s disease most commonly affects the small intestine. However, it may also affect the large intestine and uncommonly, the upper gastrointestinal tract. Several different factors may contribute to IBD. More than 200 genetic mutations have been associated with IBD, including how the body responds to infections and inflammation. Beyond genetics, common causes may be changes in bacteria population of the digestive tract, the environment a patient lives in, diet and smoking. IBD may occur when the immune system overreacts to perceived threats and attacks the digestive system.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0005] Tight junctions are a determinant of barrier function in various epithelial cell types. In the intestine, tight junction disruption may cause the leaky gut that is known to be associated with pathogenesis and progression of gastrointestinal diseases.

[0006] A major microbiota-derived metabolite is butyrate, a short-chain fatty acid (SCFA) produced in the colon through fermentation of insoluble fibers. Butyrate has multiple functions in the intestine. Butyrate maintains intestinal barrier integrity and contributes to wound healing and repair. Butyrate is also a histone deacetylase (HDAC) inhibitor that regulates a plethora of intestinal genes. In addition, butyrate has been shown to specifically regulate a beneficial protein called hypoxia-inducible factor that promotes metabolism and barrier function. Decreases in buty rate-producing bacteria and butyrate are hallmarks of the dysbiosis seen in intestinal diseases. Despite these functionalities, butyrate is limited primarily to its use as an energy source. Up to 95% of butyrate is used as an energy source by the mucosa. There would be benefits of targeting select functions in the mucosa. For example, targeting only mucosal healing would represent a significant advancement. However, given these multiple functions of naturally occurring butyrate, it does not target select functions of butyrate in the mucosa.

[0007] There is a need for new therapeutic approaches for treating a mucosal disease or symptom thereof in a patient.SUMMARY

[0008] Aspects of the present disclosure generally relate to a new class of compounds, and compositions thereof, for treating a mucosal disease or symptom thereof in a patient. Aspects of the present disclosure also generally relate to methods of treating a mucosal disease or symptom thereof in a patient using the new class of compounds and compositions thereof. As described herein, the inventors found that certain short chain fatty acids may act to significantly increase intestinal epithelial barrier formation and promote wound healing. The discovered short chain fatty acids may be able to mimic naturally occurring compounds produced by microbiota of the intestinal tract and may be utilized for intestinal barrier formation and wound healing. For example, the inventors discovered that certain butyrate (BA) analogues such as 3 -chlorobutyrate (3 -Cl BA) regulate specific biological pathways distinct from the parent compound butyrate, with the therapeutic advantage of not being metabolized as an energy source. The inventors found that 3-C1 BA may be protective inPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) mouse models of colitis and contributes to intestinal barrier repair and recovery from intestinal tissue damage. The inventors also found that that 3-C1 BA may be administered as a potent small molecule HDAC inhibitor and may be utilized to treat patients with diseases such as inflammatory mucosal diseases.

[0009] In an aspect, a composition for treating a mucosal disease or symptom thereof in a patient is provided. The composition includes a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0010] In another aspect, a composition for treating an intestinal disease or symptom thereof in a patient is provided. The composition includes a short chain fatty acid represented by formula (I-A), or an anion, salt, ester, or prodrug thereof:Owherein R1of formula (I-A) is represented by formula (II-B), formula (II-C), or formula (II-D):, , , alogen, amine, thiol, ketone, phenyl, or azide.

[0011] In another aspect, a composition for treating abdominal pain or gastrointestinal pain in a patient is provided. The composition includes a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0012] In another aspect, a composition for inhibiting HDAC activity in vitro or in vivo is provided. The composition includes a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0013] In another aspect, a composition for intestinal barrier formation, intestinal barrier repair, wound healing, or combinations thereof in a patient is provided. The composition includes a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0014] In another aspect, a method of treating a mucosal disease or symptom thereof in a patient. The method includes administering to a patient a composition described herein.

[0015] In another aspect, a method of treating abdominal pain or gastrointestinal pain in a patient. The method includes administering to a patient a composition described herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] So that the manner in which the above recited features of the present disclosure may be understood in detail, a more particular description of the disclosure, briefly summarized above, may be had by reference to aspects, some of which are illustrated in the appended drawings. It is to be noted, however, that the appended drawings illustrate only exemplary aspects and are therefore not to be considered limiting of its scope, may admit to other equally effective aspects.

[0017] FIGS. 1A-1E shows non-limiting data indicating the influence of 3- chlorobutyrate (3-C1 BA) in barrier formation, permeability, and wound healing: FIG. 1 A) Representative panel of screened butyrate (BA) analogues. FIG. IB) Epithelial barrier formation over time in monolayers of T84 cells exposed to various BA analogues (all at 5 mM, Veh = phosphate buffered saline (PBS)), (n = 3-4; error bars: Standard error of the mean (SEM), **p < 0.01, ***p < 0.001, ****p < 0.0001 by Two-way ANOVA with the Geisser-Greenhouse correction, Dunnett’s multiple comparisons test) (TEER refers to transepithelial electrical resistance). FIG. 1C) Cell layer permeability flux rate assay using 4-kDa fluorescein isothiocyanate-dextran (FITC-dextran) in T84 cells treated with 5 mM BA, 3-C1 BA or PBS. Data presented as relative FITC-dextran flux normalized to vehicle treated cells, (n = 3; error bars: SEM, *p < 0.05, **p < 0.01 by One-way ANOVA, Fisher’s multiple comparison). FIG. ID) Scratch wound healing monitored over time by relative wound closure percentage in T84 cells treated with BA, 3-C1 BA, 4-C1 BA (all at 5 mM), or PBS. (n = 3; error bars: SEM, ****p < 0.0001 by Two-way ANOVA with the Geisser- Greenhouse correction, Dunnett’s multiple comparisons test). FIG. IE) Live cell images ofPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) scratch wound healing (0 h and 36 h) in T84 cells vehicle (PBS) control cells and cells treated with 5 mM butyrate or 3 -Cl BA (dotted line, cell migration / wound edge). (Scale bar: 400 pm).

[0018] FIGS. 2A-2F shows non-limiting data indicating that 3 -Cl BA does not stabilize HIF or consume oxygen in lECs, but it is a potent HD AC inhibitor. FIG: 2A) Representative immunoblots of hypoxia-inducible factor 1 subunit alpha (HIF-la) and hypoxia-inducible factor 2 subunit alpha (HIF-2a) protein levels in T84 cells exposed to 5 mM BA, 3-C1 BA, or PBS for 6 h in normal oxygenation conditions. FIG. 2B) HIF-la and HIF-2a were quantified using actin-normalized densitometry, (n = 3; error bars: SEM, *p < 0.05, **p < 0.01 by One-way ANOVA, Fisher’s multiple comparison). FIG. 2C) Rates of oxygen consumption were calculated from linear regression of oxygen saturation data in Caco-2 monolayers on inserts treated with 5 mM BA, 3-C1 BA, or PBS; (n = 9 inserts from 3 independent experiments and presented as floating bars with line at median and analyzed by ordinary One-way ANOVA, Fisher’s multiple comparison, *p < 0.05, **p < 0.01.) FIG. 2D) Percentage HDAC inhibition in nuclear extracts of Caco-2 cells exposed to BA or 3-C1 BA (5 mM), Veh (PBS), or positive control (trichostatin A (TSA)) at 1 pM. (n = 4; error bars: SEM, ****p < 0.0001 by One-way ANOVA, Fisher’s multiple comparison). FIG. 2E) Immunoblot of acetylated histone H3 (AcH3), Histone H3, and actin protein levels in Caco- 2 cells exposed to BA or 3-C1 BA (5 mM, 24h). FIG. 2F) quantification of acetylation of histone H3 (AcH3) by actin-normalized densitometry of both H3 and AcH3, followed by relative densitometry of AcH3 to H3. (n = 3; error bars: SEM, **p < 0.01 by One-way ANOVA, Fisher’s multiple comparison).

[0019] FIGS. 3A-3G shows non-limiting data indicating that butyrate and 3-C1 BA potently downregulate the “leaky claudin” CLDN2 and upregulate OCLN in intestinal epithelial cells (lECs): FIG. 3A) CLDN2 mRNA expression and FIG. 3B) CLND2 protein levels in Caco-2 cells treated with 5 mM BA or 3-C1 BA. TSA used as positive control at 1 pM and Veh is PBS. Cells were exposed to treatments for 18 h. FIG. 3C) Quantification of CLDN2 protein was performed using actin-normalized densitometry, (n = 3; error bars: SEM, ****p < 0.0001 by One-way ANOVA, Fisher’s multiple comparison). FIG. 3D) CLDN2 protein levels in time course immunoblot of Caco-2 cells exposed to BA, 3-C1 BA (5 mM), or Veh (PBS) for 24 h or 48 h. FIG. 3E) Quantification of CLDN2 protein in timePCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) course experiment was performed using actin-normalized densitometry, (n = 3; error bars: SEM, **p < 0.01, ***p < 0.001, ****p < 0.0001 by One-way ANOVA, Fisher’s multiple comparison). FIG. 3F) CLDN2 and OCLN mRNA expression in T84 cells treated with 5 mM butyrate, 3-C1 BA, or Veh (PBS) for 18 h. (n = 3; error bars: SEM, *p < 0.05, ****p < 0.0001 by One-way ANOVA, Fisher’s multiple comparison). FIG. 3G) HeLa cells were transfected with an empty vector control and an OCLN promoter reporter occludin- luciferase (OCLN-luc) (RLU is relative light units, a measure of gene activity). After 24 h, cells were treated with PBS, 5 mM BA or 3-C1 BA for another 24 h and luciferase activity was quantified, (n = 3; error bars: SEM, ***p < 0.001, ****p < 0.0001 by One-way ANOVA, Fisher’s multiple comparison).

[0020] FIGS. 4A-4H shows non-limiting data indicating that 3-C1 BA but not butyrate is protective in a mouse model of colitis: C57BL / 6 mice were exposed to 2.5% dextran sodium sulfate (DSS) + / - BA (50 mM) or 3-C1 BA (50 mM) in their drinking water for 5 days. After day 5, DSS was removed but mice continued to drink BA or 3-C1 BA for two more days. FIG. 4A) disease activity index score combining weight loss, stool consistency and bleeding and FIG. 4B) % weight over time, (n = 5-9; error bars: SEM, *p < 0.05, **p < 0.01, ***p < 0.001 by Two-way ANOVA with the Geisser-Greenhouse correction, Fisher’s multiple comparison). FIG. 4C) Colon length to body mass ratios, (n = 5-9; error bars: SEM, *p < 0.05 by One-way ANOVA, Fisher’s multiple comparison). FIG. 4D) Serum 4-kDa FITC-dextran from mice subjected to DSS + / - BA or 3-C1 BA (n = 4-5, error bars: SEM, *p < 0.05, **p < 0.01 by One-way ANOVA, Fisher’s multiple comparison). FIG. 4E) CLDN2 protein levels in distal colon tissue from mice exposed to different treatments and FIG. 4F) quantification of CLDN2 protein using actin-normalized densitometry (n = 4-5, error bars: SEM, *p < 0.05 by One-way ANOVA, Fisher’s multiple comparison). FIG. 4G) Histological scoring of colon tissue from mice exposed to DSS + / - BA or 3-C1 BA, maximum histological score of 40 (n = 5, error bars: SEM, *p < 0.05, ***p < 0.001 by Oneway ANOVA, Fisher’s multiple comparison). FIG. 4H) Representative histology images showing healthy colon tissue (top left), the extent of colon tissue damage in mice subjected to DSS only (top right), DSS + BA (bottom left), and 3-C1 BA + DSS (bottom right).

[0021] FIGS. 5A-5C shows non-limiting data indicating the influence of 3-C1 BA and BA in mouse-derived colonoids: FIG. 5A) Stem colonoids (approximately 30,000PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) cells / well) were plated in semipermeable membranes and allowed to incubate for 24 h. Cells were then exposed to BA (1 mM), 3-C1 BA (1 mM), IOX4 (10 pM) or 1% H2O in maturation media. Barrier analysis by TEERs over time was conducted as previously described. Data is presented as relative TEER % normalized to vehicle treated cells at 72 h (100% TEERs) (n = 8 inserts from 3 independent experiments'; error bars: SD, **p < 0.01, ****p < 0.000 by Two-way ANOVA with the Geisser-Greenhouse correction. FIG. 5B) Stem colonoids exposed to BA (1 mM), 3 -Cl BA (1 mM) or 1% H2O were evaluated by flow cytometry for proliferation and apoptosis using Ki67 and CCaspase3 staining respectively. Frequency of Ki67 and CCaspase3 -positive live cells is plotted. Data analyzed using FlowJo software (n = 6-7 wells from 2 independent experiments; error bars: SD, **p < 0.01, One-way ANOVA, Fisher’s multiple comparison. FIG. 5C) ALPI mRNA expression in stem and mature WT and HIF-la KO colonoids to evaluate absorptive intestinal epithelial cell differentiation, (n = 3; error bars: SEM, ***p < 0.001, ****p < 0.0001 by Two-way ANOVA, Tukey’s multiple comparison).

[0022] FIG. 6 shows non-limiting data indicating the influence of butyrate and BA- mimicking compounds (analogues) in Caco-2 IEC barrier formation. Epithelial barrier formation over time in monolayers of Caco-2 cells exposed to BA, 3-C1 BA, and 3-OH BA (all at 5 mM, Veh = PBS), (n = 3; error bars: SEM, ****p < 0.0001 by Two-way ANOVA with the Geisser-Greenhouse correction, Dunnett’s multiple comparisons test).

[0023] FIGS. 7A and 7B shows non-limiting data indicating the proliferation and cytotoxicity studies in T84s exposed to BA or 3-C1 BA: FIG. 7A) Cell proliferation in T84 cells exposed to BA or 3-C1 BA over 24 h. Data presented as absorbance relative to cell proliferation (n = 8 wells from 3 independent experiments; error bars: SD, ***p < 0.001 by One-way ANOVA, Fisher’s multiple comparison). FIG. 7B) Percent cytotoxicity observed after exposing T84 cells to 5 mM BA or 3-C1 BA (24 h). (n = 6-9 wells from 3 independent experiments; error bars: SD, ***p < 0.001 by One-way ANOVA, Fisher’s multiple comparison).

[0024] FIG. 8 is a 'H NMR spectrum of 3-C1 BA in deuterated water (D2O).JH NMR (Bruker NMR 400 MHz, 295 K, D2O) 5 4.79 (H2O residual peak), 4.45 (m, 1 H, 2), 2.88- 2.80 (dd, 2 H, 1), 1.56 (d, 3 H, 3). The proton in the COOH group is not visible due to a rapid exchange with deuterium from D2O causing the signal to be undetectable.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0025] FIG. 9 is a comparison of 3 -Cl BA 'H NMR spectra over 24 h to establish stability of 3-C1 BA in water. 3-C1 BA (25 mg) was dissolved in ~0.4 mL of D2O and aJH NMR was immediately taken (0 h in D2O). 3-C1 BA was allowed to incubate at 37°C for 24 h followed by anotherJH NMR experiment (24 h in D2O). As shown, there was no change in the integrity of 3-C1 BA over this time period.

[0026] FIG. 10 is a13C NMR spectrum of 3-C1 BA in D2O.13C NMR (Bruker NMR 100 MHz, 295 K, D2O) 5 174.9 (1), 53.9 (3), 44.5 (2), 24.2 (4).

[0027] FIG. 11 is a comparison of 3 -Cl BA13C NMR spectra over 24 h. Following the same conditions described with respect to FIG. 9,13C NMR spectra were compared demonstrating no change in the integrity of the compound over 24 h.

[0028] FIGS. 12A-12C shows non-limiting data indicating tight junction profiles in lECs exposed to butyrate or 3-C1 BA. FIG. 12A) CLDN2 protein levels in T84 cells treated with 5 mM BA, 3-C1 BA, or Veh (PBS). Cells were exposed to treatments for 24 h. FIG. 12B) Quantification of CLDN2 protein was performed using actin-normalized densitometry, (n = 3; error bars: SEM, **p < 0.01 by One-way ANOVA, Fisher’s multiple comparison). FIG. 12C) CLDN4, CGN, and SYNPO mRNA expression in Caco-2 cells exposed to 5 mM butyrate (BA), 3-C1 BA, or Veh (PBS) for 18 h. (n = 3; error bars: SEM, *p < 0.05, **p < 0.01, ***p < 0.001 by One-way ANOVA, Fisher’s multiple comparison).

[0029] FIG. 13 shows non-limiting data indicating the influence of BA and 3 -Cl BA on barrier formation of mouse colonoids. Mouse-derived colonoids were plated in semipermeable membranes and exposed to BA (1 mM), 3-C1 BA (1 mM) or 1% H2O in maturation media. Shown here is a measure of flux rate of 4-KDa FITC-dextran measured in monolayers of colonoids exposed to different treatments, (n = 5 error bars: SD, / > = 0.07 by student’s t-test.

[0030] To facilitate understanding, identical reference numerals have been used, where possible, to designate identical elements that are common to the figures. It is contemplated that elements and features of one aspect may be beneficially incorporated in other aspects without further recitation.DETAILED DESCRIPTION

[0031] Aspects described herein generally relate to a new class of compounds, and compositions thereof, for treating a mucosal disease or symptom thereof in a patient.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)Aspects described herein also generally relate to methods of treating a mucosal disease or symptom thereof in a patient using the new class of compounds and compositions thereof.

[0032] Gut microbiota homeostasis is a symbiotic relationship between the gut microbiota and the host immune system to maintain intestinal health. This is achieved through a complex microbial cross-talk with the mucosal immune system that involves signaling pathways and gene regulatory networks. This communication occurs through the production of metabolites, small organic molecules that affect many biological pathways. A major microbiota-derived metabolite is butyrate (BA), a short-chain fatty acid (SCFA) produced in the colon through fermentation of insoluble fibers. BA has multiple functions in the intestine. Up to 95% of BA is used as an energy source by the mucosa. BA maintains intestinal barrier integrity and contributes to wound healing and repair, it limits pro- inflammatory factors, and inhibits cancer development. BA also functions as a histone deacetylases (HDACs) inhibitor and many of its barrier-protective effects are attributed to this pathway. A limitation of some beneficial BA functions is its use as a primary energy source. There would be benefits of targeting select functions in the mucosa. For example, targeting only mucosal healing would represent a significant advancement. However, given these multiple functions of naturally occurring BA, it does not target select functions of BA in the mucosa.

[0033] There is a need for new compositions and compounds that may be used to target specific mucosal functions. There is also a need for new therapeutic approaches for treating patients presenting with mucosal diseases and / or symptoms thereof. Such therapeutic approaches may include compositions and methods for treating, preventing, and / or alleviating mucosal diseases and / or symptoms thereof in a patient.

[0034] To this end, the inventors found, for example, BA analogues that may be used to target specific mucosal functions. The inventors discovered small organic molecules structurally related to BA that possess specific biological properties. One example BA analogue identified was 3 -chlorobutyrate (3 -Cl BA). As described herein, 3 -Cl BA does not function as an energy metabolite but significantly increases intestinal epithelial barrier formation and promotes wound healing in vitro. Unlike native BA, 3-C1 BA is not rapidly metabolized and possesses a superior toxicity profile at high concentrations in vitro. Studies performed ex vivo using mouse colonoids demonstrated that 3 -Cl BA but not BAPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) significantly improved barrier formation. Using a mouse model of colitis, the inventors demonstrated that 3-C1 BA is protective by limiting the severity of the disease and improving recovery. Studies described herein support, for example, 3-C1 BA as an attractive alternative for the treatment of inflammatory diseases mimicking natural metabolites. Other BA analogues are described herein and may be used to target specific mucosal functions.

[0035] Aspects described herein may be utilized to treat, prevent, and / or alleviate a mucosal disease or symptom thereof in a patient, such as an epithelial disease or symptom thereof in a patient, such as an intestinal disease or symptom thereof in a patient. Mucosal disease generally refers to a disease or condition that affects the mucous membrane or mucosa of a patient. Examples of mucosa may include intestinal mucosa, gastric mucosa, endometrium mucosa, nasal mucosal, oral mucosal, among other mucosa. The mucosa forms a physical barrier that protects the body ’ s internal environment from harmful external pathogens. Mucosa is composed of an epithelial layer, a middle layer of loose connective tissue (lamina propria), and a layer of smooth muscle cells (muscularis mucosae). Epithelial disease generally refers to a disease or condition that affects epithelial tissue of a patient. Epithelial tissue, or epithelium, is generally a layer of cells. Epithelial diseases range from inflammatory and autoimmune diseases (such as those related to gastrointestinal, respiratory, and skin conditions) to cancers. Intestinal disease generally refers to a disease or condition that affects the intestine of a patient. Illustrative, but non-limiting, examples of intestinal diseases may include Crohn’s disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal cancer, infectious colitis, enteritis, or combinations thereof. Crohn’s disease and ulcerative colitis are two main types of inflammatory bowel disease (IBD). Crohn’s disease and ulcerative colitis, may be referred to herein collectively as IBD. The mucosal disease may include an inflammatory mucosal disease. The epithelial disease may include an inflammatory epithelial disease. The intestinal disease may include an inflammatory intestinal disease.

[0036] Aspects described herein may be utilized to treat, prevent, and / or alleviate abdominal pain or gastrointestinal pain in a patient. The term “patient” refers to a vertebrate, such as a mammal. Mammals may include, but are not limited to, humans, nonhuman primates, rodents such as rats or mice, to domestic animals such as dogs and cats, horses, cows, among other animals.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0037] The use of headings is for purposes of convenience only and does not limit the scope of the present disclosure. Aspects described herein may be combined with other aspects.Compositions

[0038] Aspects of the present disclosure generally relate to new compositions that include a short chain fatty acid (SCFA), an ion thereof, a salt thereof, or combinations thereof. The SCFA may include a butyric acid analogue. As used herein, a “composition” may include component(s) of the composition, reaction product(s) of two or more components of the composition, a remainder balance of remaining starting component(s), or combinations thereof.

[0039] SCFAs of the present disclosure are fatty acids that have 6 or fewer carbon atoms along the main carbon chain of the fatty acid including the carbon atom of the carboxylic acid group, such as from 2 to 6 carbon atoms, such as from 3 to 5 carbon atoms, such as about 4 carbon atoms. SCFAs may include acetic acid (C2), propionic acid (C3), butyric acid (C4), valeric acid (C5), caproic acid (C6), isobutyric acid (C4), isovaleric acid (C5), analogues thereof, or combinations thereof.

[0040] Short chain fatty acids of the present disclosure may include a fatty acid or fatty acid analogue represented by formula (I-A):

[0041] R1of formula (I-A) comprises the main carbon chain of the short chain fatty acid. In some aspects, which may be combined with other aspects, at least one hydrogen of R1is substituted with at least one heteroatom or heteroatom-containing group, such as one or more elements from Group 13-17 of the periodic table of the elements, such as a halogen (F, Cl, Br, or I), O, N, Se, Te, P, As, Sb, S, B, Si, Ge, Sn, Pb, and the like, such as C(O)R*, C(C)NR*2, C(O)OR*, NR*2, OR*, SeR*, TeR*, PR*2, AsR*2, SbR*2, SR*, SOx (where x = 2 or 3), BR*2, SiR*3, GeR*3, SnR*3, PbR*3, and the like, where R* is, independently, hydrogen or hydrocarbyl.

[0042] R1of formula (I-A) may be a hydrocarbyl group. “Hydrocarbon” refers to a compound containing only carbon and hydrogen. The term “hydrocarbyl group” is used herein in accordance with the definition specified by IUPAC: a univalent group formed byPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) removing a hydrogen atom from a hydrocarbon (that is, a group containing only carbon and hydrogen). Hydrocarbyl groups, also referred to herein as “hydrocarbyl” may be linear or branched, saturated or unsaturated, cyclic or acyclic, aromatic or non-aromatic. Regarding saturation, hydrocarbyl groups may be fully saturated, partially unsaturated, or fully unsaturated.

[0043] A group or groups may be referred to herein as “unsubstituted” or by equivalent terms such as “non-substituted,” which refers to the original group (e.g., a hydrocarbyl, an R group, a ring, or other group) in which a non-hydrogen moiety does not replace a hydrogen within that group. For example, an unsubstituted R group refers to an R group that consists of hydrogen and carbon atoms only. “Unsubstituted hydrocarbyl” includes groups that may be linear or branched, acyclic or cyclic, saturated or unsaturated. When cyclic, the unsubstituted hydrocarbyl may be aromatic or non-aromatic. Regarding saturation, the unsubstituted hydrocarbyl may be fully saturated, partially unsaturated, or fully unsaturated. Examples of unsubstituted hydrocarbyl groups may include alkyl, alkenyl, aryl, and aralkyl groups, amongst other groups. Non-limiting examples of unsubstituted hydrocarbyl include a group having from 1 to 20 carbon atoms, such as from 1 to 7 carbon atoms, such as from 1 to 6 carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, iso-butyl, sec-butyl, and tert-butyl, pentyl, and hexyl.

[0044] The term “substituted” when used to describe a group (e.g., a hydrocarbyl, an R group), for example, when referring to a substituted analog of a particular group, is intended to describe any non-hydrogen moiety that formally replaces a hydrogen in that group, and is intended to be non-limiting. Unless otherwise specified, “substituted” is intended to be non-limiting and include inorganic substituents or organic substituents as understood by one of ordinary skill in the art. For example, a substituted R group or substituted hydrocarbyl refers to a group where at least one hydrogen of the R group or the unsubstituted hydrocarbyl has been substituted with at least one heteroatom or heteroatom-containing group, such as one or more elements from Group 13-17 of the periodic table of the elements, such as a halogen (F, Cl, Br, or I), O, N, Se, Te, P, As, Sb, S, B, Si, Ge, Sn, Pb, and the like, such as C(O)R*, C(C)NR*2, C(O)OR*, NR*2, OR*, SeR*, TeR*, PR*2, AsR*2, SbR*2, SR*, SOx (where x = 2 or 3), BR*2, SiR*3, GeR*3, SnR*3, PbR*3, and the like, where R* is, independently, hydrogen or hydrocarbyl, or where at least one heteroatom has been insertedPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) within the R group or the unsubstituted hydrocarbyl. Substituted hydrocarbyl groups may be linear or branched, saturated or unsaturated, cyclic or acyclic, aromatic or non-aromatic. Regarding saturation, substituted hydrocarbyl groups may be fully saturated, partially unsaturated, or fully unsaturated.

[0045] Referring back to formula (I-A), R1of formula (I-A) may be an unsubstituted hydrocarbyl or a substituted hydrocarbyl. R1of formula (I-A) may be linear or branched, saturated or unsaturated, cyclic or acyclic, aromatic or non-aromatic. Regarding saturation, R1of formula (I-A) may be fully saturated, partially unsaturated, or fully unsaturated. When partially unsaturated, R1of formula (I-A) may have one or more C=C double bonds. A C=C double bond is also referred to as an olefin.

[0046] R1of formula (I-A) may be a C2-C20 unsubstituted hydrocarbyl, such as a C2- C12 unsubstituted hydrocarbyl, such as a C2-C6 unsubstituted hydrocarbyl, such as a C3- C5 unsubstituted hydrocarbyl, such as a C4 unsubstituted hydrocarbyl.

[0047] R1of formula (I-A) may be a C2-C20 substituted hydrocarbyl, such as a C2-C12 substituted hydrocarbyl, such as a C2-C6 substituted hydrocarbyl, such as a C3-C5 substituted hydrocarbyl, such as a C4 substituted hydrocarbyl.

[0048] In some aspects, which may be combined with other aspects, R1of formula (I- A) may be substituted with, for example, a halogen (e.g., Cl, Br, F, or I), an amine, a thiol, a hydroxyl, a ketone, a phenyl, an azide, or combinations thereof at any suitable position of the fatty acid, such as a chlorine atom, a bromine atom, an amine, a hydroxyl, or combinations thereof, such as a chlorine atom. For example, R1may be represented by formula (II-A), formula (II-B), formula (II-C), or formula (II-D):

[0049] The wavy bond in formula (II-A), formula (II-B), formula (II-C), and formula (II-D) represents a connection to the carboxylic acid carbon atom. Generally, when R1isPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) represented by formula (II-A), the fatty acid is an analogue of propionic acid. Generally, when R1is represented by formula (II-B), the fatty acid analogue is an analogue of butyric acid. Generally, when R1is represented by formula (II-C), the fatty acid analogue is an analogue of valeric acid. Generally, when R1is represented by formula (II-D), the fatty acid analogue is an analogue of caproic acid.

[0050] Each of Y^Y32of formulas (II-A)-(II-D) may be, independently, hydrogen, halogen (such as Cl, Br, F, or I), heteroaryl (such as indole), aryl (such as phenyl or naphthyl), hydroxyl (OH), thiol (SH), azide (Ns), amine (NR*2, where each R* is, independently, a hydrogen or a C1-C6 hydrocarbyl), thioether (SR*, where R* is a C1-C6 hydrocarbyl), ether (OR*, where R* is a C1-C6 hydrocarbyl), or ketone (C(O)R*, where R* is a C1-C6 hydrocarbyl), such as hydrogen, indole, chlorine, bromine, fluorine, amine, or hydroxyl, such as hydrogen or chlorine.

[0051] In some aspects, which may be combined with other aspects, each of Y3-Y5(formula (II-A)), Y10-Y12(formula (II-B)), Y19-Y21(formula (II-C)), and Y30-Y32(formula (II-D)) is not alkyl (such as not methyl). That is, and in some aspects, methyl may only be present as a branch from the carbon chain.

[0052] In some aspects, which may be combined with other aspects, at least one of Y1- Y32of formulas (II-A)-(II-D) is not hydrogen. Alternatively, and in some aspects which may be combined with other aspects, each of Y^Y32of formulas (II-A)-(II-D) is hydrogen.

[0053] In some aspects, which may be combined with other aspects, at least one of Y1or Y2of formula (II-A) may be methyl. For example, Y1may be methyl such that the fatty acid analogue is an analogue of isobutyric acid. In some aspects, which may be combined with other aspects, at least one of Y6, Y7, Y8, Y9of formula (II-B) is methyl. For example, Y8may be methyl such that the fatty acid analogue is an analogue of isovaleric acid.

[0054] In some aspects, which may be combined with other aspects, at least one of Y1, Y2Y6Y7Y8Y9Y13Y14Y15Y16Y17Y18Y22Y23Y24Y25Y25Y26Y27Y28or Y29of formulas (II-A)-(II-D) may be methyl.

[0055] Referring back to formula (I-A), illustrative, but non-limiting, examples of suitable fatty acids represented by formula (I-A) may include: 3 -chlorobutyric acid (compound I-A-l); 4-chlorobutyric acid (compound I-A-2); gamma-amino butyric acid (also referred to as GABA, compound I-A-3); crotonic acid (compound I-A-4); 3-PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) hydroxybutyric acid (compound I-A-5); 2-bromobutyric acid (compound LA-6); 4- mercaptobutyric acid (compound LA-7); 3 -phenylbutyric acid (compound LA-8); 2- phenylbutyric acid (compound LA-9); 4-azidobutyric acid (compound LA- 10); 4- acetylbutyric acid (compound LA-11); butyric acid (compound LA-12); or combinations thereof (Ph = phenyl):12).

[0056] As described above, anions of fatty acids represented by formula (I-A) may be utilized in compositions of the present disclosure. Such anions (conjugate bases of the carboxylic acid) of fatty acids may include an anion represented by formula (I-B):

[0057] R1of formula (I-B) may be any suitable R1discussed herein with respect to formula (I-A). Illustrative, but non-limiting, examples of anions of fatty acids represented by formula (I-B) may include 3 -chlorobutyric acid anion (also referred to as 3- chlorobutyrate and 3-C1 BA (compound LB-1)); 4-chlorobutyric acid anion (also referred to as 4-chlorobutyrate and 4-C1 BA (compound LB-2)); gamma-amino butyric acid anion (also referred to as gamma-aminobutyrate and GABA (compound LB-3)); crotonic acid anion (also referred to as crotonate (compound LB-4)); 3 -hydroxybutyric acid anion (also referred to as 3 -hydroxybutyrate and 3 -OH BA (compound I-B-5); 2-bromobutyric acidPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) anion (also referred to as 2-bromobutyrate (compound I-B-6)); 4-mercaptobutyric acid anion (also referred to as 4-mercaptobutyrate (compound I-B-7)); 3 -phenylbutyric acid anion (also referred to as 3 -phenylbutyrate (compound I-B-8)); 2-phenylbutyric acid anion (also referred to as 2-phenylbutyrate (compound I-B-9)); 4-azidobutyric acid anion (also referred to as 4-azidobutyrate (compound I-B-10)); 4-acetylbutyric acid anion (also referred to as 4-acetylbutyrate (compound I-B-l l)); butyric acid anion (also referred to as butyrate and BA (compound I-B-12)); or combinations thereof.12).

[0058] As described above, a salt of a fatty acid represented by formula (I-A) may be utilized in compositions of the present disclosure. Such salts may include those represented by formula (I-C):

[0059] R1of formula (I-C) may be any suitable R1discussed herein with respect to formula (I-A) or formula (I-B). X of formula (I-C) is a cation. Any suitable cation may be utilized. Suitable cations may include, but are not limited to, a group 1 metal of the periodic table of the elements (for example, Li, Na, K, Rb, Cs), a group 2 metal of the periodic table of the elements (Be, Mg, Ca, Sr, Ba), ammonium (NHC, where each R* is, independentlyPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)H or hydrocarbyl), pyridinium, arginine cation, glutamine cation, or combinations thereof, among other suitable cations.

[0060] Illustrative, but non-limiting, examples of anions of fatty acids represented by formula (I-B) may include a 3 -chlorobutyrate salt (represented by formula (I-C-l)); a 4- chlorobutyrate salt (represented by formula (I-C-2)); a gamma-amino butyrate salt (represented by formula (I-C-3)); a crotonate salt (represented by formula (I-C-4)); a 3- hydroxybutyrate salt (represented by formula (I-C-5)); a 2-bromobutyrate salt (represented by formula (I-C-6)); a 4-mercaptobutyrate salt (represented by formula (I-C-7)); a 3- phenylbutyrate salt (represented by formula (I-C-8)); a 2-phenylbutyrate salt (represented by formula (I-C-9)); a 4-azidobutyrate salt (represented by formula (I-C-10)); a 4- acetylbutyrate salt (represented by formula (I-C-l 1)); a butyrate salt (represented by formula (I-C-12)).12).

[0061] Compounds (e.g., SCFAs, anions thereof, and / or salts thereof) present in compositions described herein may include asymmetrically substituted carbon atoms. Such asymmetrically substituted carbon atoms may result in compounds of the present disclosure existing in enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, such as in (R)- or (S)- forms. As a result, all such possible isomers, individual stereoisomers in their optically pure forms, mixtures thereof, racemic mixtures (or “racemates”), mixtures of diastereomers, as well as singlePCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) diastereomers of the SCFAs, anions thereof, and salts thereof are included in the present disclosure.

[0062] In some aspects, which may be combined with other aspects, the SCFA and / or anion thereof is not metabolized, or not substantially metabolized, by mucosa as an energy source. “Not substantially metabolized” means that less than 2%, such as less than 1% of the SCFA and / or anion thereof is not metabolized by mucosa as an energy source.

[0063] Compositions described herein may include compounds where the carboxylic acid functional group of the SCFA is modified. For example, the carboxylic acid of the SCFA may be modified to form a derivative such as an amide, an ester, an anhydride, a mixed anhydride, or combinations thereof. That is, the amide analogue, ester analogue, or the anhydride analogue of the SCFA may be utilized in compositions.

[0064] Adducts or reaction products of the SCFA with one or more materials may be utilized in compositions of the present disclosure. For example, the carboxylic acid of the SCFA may be chemically modified by covalent attachment to a glycerol to form an SCFA glyceride. Compositions described herein may include one or more SCFA glycerides. As another example, the carboxylic acid of the SCFA may be in the form of an amide analogue formed from reaction of the SCFA carboxylic acid and an amine functionality of an amino acid such as aspartic acid, glutamic acid, or another amino acid. Compositions described herein may include such short chain fatty acid-amino acid (“SCFA-AA”) analogues.

[0065] An adduct or reaction product of the carboxylic acid of the SCFA may be chemically modified by covalent attachment to an oligosaccharide such as alphacyclodextrin or beta-cyclodextrin

[0066] Compositions described herein may include an ester form of an SCFA described herein. That is, compositions of the present disclosure may include an ester of an SCFA described herein. An ester of an SCFA refers to the carboxylic acid group of the SCFA being in the form of an ester. The ester may be a pharmaceutically acceptable ester. A “pharmaceutically acceptable ester” refers to esters, which hydrolyze in vivo and include those that break down readily in the human body to leave the parent compound or a salt thereof. Suitable ester groups may include, for example, those derived from pharmaceutically acceptable aliphatic carboxylic acids, particularly alkanoic, alkenoic, cycloalkanoic and alkanedioic acids, in which each alkyl or alkenyl moiety may have 6 orPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) fewer carbon atoms. Examples of esters include formates, acetates, propionates, butyrates, acrylates and ethylsuccinates.

[0067] Compositions described herein may include a prodrug form of an SCFA described herein. That is, compositions of the present disclosure may include a prodrug of an SCFA described herein. The term “prodrug” refers to a compound that is rapidly transformed in vivo to yield the parent compound, for example by hydrolysis in blood or modification in the intestine. The prodrug of the SCFA may be a pharmaceutically acceptable prodrug. A “pharmaceutically acceptable prodrug” as refers to those prodrugs of SCFAs described herein which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds of the present disclosure.

[0068] It will be apparent to those skilled in the art that compounds described herein, including the compounds of formulas (I- A), (I-B), (I-C), as well as esters, prodrugs, or other derivatives of any of them, may be processed in vivo through metabolism in a human or animal body or cell to produce pharmacologically active metabolites that retain activity as inhibitors. The active metabolites of a compound of the present disclosure may be identified using routine techniques known in the art. See, e.g., Bertolini, G. et al., J. Med. Chem. 40:2011-2016 (1997); Shan, D. et al., J. Pharm. Sci. 86(7):765-767; Bagshawe K., Z>rwg Dev. Res. 34:220-230 (1995); Bodor, 1A., Advances in Drug Res. 13:224-331 (1984); Bundgaard, H., Design of Prodrugs (Elsevier Press 1985); and Larsen, I. K., Design and Application of Prodrugs, Drug Design and Development (Krogsgaard-Larsen et al., eds., Harwood Academic Publishers, 1991). It should be understood that individual chemical compounds that are active metabolites of a compound of the present disclosure (e.g., an SFCA, anion thereof, salt thereof, amide thereof, ester thereof, prodrug thereof, etc.) are included within the present disclosure.

[0069] Compositions of the present disclosure may be utilized for treating, preventing, and / or alleviating a disease or symptom thereof in a patient. As described herein, diseases and symptoms thereof may include a mucosal disease or symptom thereof, such as an epithelial disease or symptom thereof in a patient, such as an intestinal disease or symptomPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) thereof in a patient. Compositions described herein may be utilized to treat, prevent, and / or alleviate abdominal pain or gastrointestinal pain in a patient.

[0070] Compositions described herein may be used in vitro or in vivo to alleviate a mucosal disease, such as an epithelial disease, such as an intestinal disease. Additionally, or alternatively, compositions of the present disclosure may be used in vitro or in vivo to promote the healing of tissue damaged by a mucosal disease, such as an epithelial disease, such as an intestinal disease. SCFAs (and / or an anion thereof, salt thereof, amide thereof, ester thereof, and / or prodrug thereof, etc.) may bind to receptors on the surface of epithelial cells and / or may be transported in epithelial cells where they bind to proteins inside of cells and provide benefit to the cell / tissue.

[0071] With regard to SCFAs (and / or an anion thereof, salt thereof, amide thereof, ester thereof, and / or prodrug thereof, etc.) binding to a surface, SCFAs may activate specific G- protein-coupled receptors (GPCRs), primarily GPR41 (FFAR3) and GPR43 (FFAR2), which are expressed in intestinal epithelial cells, immune cells, and adipose tissue. Upon binding, these receptors may couple to Gi / o and / or Gq proteins, leading to signaling cascades that modulate immune responses, energy metabolism, gut motility, and hormone secretion (e.g., GLP-1, PYY). SCFAs differ in receptor potency — propionate and butyrate are strong GPR43 agonists, whereas acetate is more selective for GPR43 — and this receptor activation links gut microbial fermentation to host metabolic and inflammatory regulation.

[0072] Compositions described herein may be utilized for intestinal barrier formation, intestinal barrier repair, wound healing, or combinations thereof. Compositions described herein may be utilized as an HD AC inhibitor in vivo or in vitro. For example, 3 -Cl BA may be utilized to regulate specific biological pathways that may be different from the parent compound butyrate, with the therapeutic advantage of not being metabolized as an energy source. Analogues such as 3-C1 BA may be protective in mouse models of colitis and may be utilized for intestinal barrier repair.

[0073] Compositions of the present disclosure may further include a pharmaceutically acceptable carrier, diluent, adjuvant, and / or excipient. For example, an SCFA, an anion thereof, salt thereof, amide thereof, ester thereof, and / or prodrug thereof described herein may be formulated with any suitable pharmaceutically acceptable carrier or diluents as well as any other suitable adjuvant or excipient in accordance with conventional techniques suchPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) as those disclosed in Remington: The Science and Practice of Pharmacy, 19thEdition, Gennaro, Ed., Mack Publishing Co., Easton, Pa., 1995, incorporated herein by reference in its entirety. Suitable pharmaceutically acceptable carriers or excipients include, for example, processing agents and drug delivery modifiers and enhancers, such as, for example, calcium phosphate, magnesium stearate, talc, monosaccharides, di saccharides, starch, gelatin, cellulose, methyl cellulose, sodium carboxymethyl cellulose, dextrose, hydroxypropyl-P- cyclodextrin, polyvinylpyrrolidinone, low melting waxes, ion exchange resins, and the like, as well as combinations of any two or more thereof. Other suitable pharmaceutically acceptable excipients are described in “Remington’s Pharmaceutical Sciences,” Mack Pub. Co., New Jersey (1991), incorporated herein by reference in its entirety.

[0074] Pharmaceutically acceptable carriers may include any suitable solvent, dispersion medium, coating, antibacterial agent, antifungal agent, isotonic delaying agent, and absorption delaying agent, and the like that are physiologically compatible.

[0075] Pharmaceutically acceptable salts may be used. Such salts are those that retain the desired biological activity of the parent compound and does not impart any undesired toxicological effects (see, for example, S. M. Berge, et al., J. Pharm. Sci., 1977, 66, 1-19, incorporated herein by reference in its entirety). Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from nontoxic inorganic acids, such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, phosphorous and the like, as well as from nontoxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxy alkanoic acids, aromatic acids, aliphatic and aromatic sulfonic acids, combinations thereof, and the like. Base addition salts include those derived from alkaline earth metals, such as sodium, potassium, magnesium, calcium and the like, as well as from nontoxic organic amines, such as N,N'- dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, and procaine, combinations thereof, among others. The term “biological activity” refers to any biological activity typically attributed to a nucleic acid or protein by those skilled in the art. Examples of biological activities are enzymatic activity, ability to dimerize, fold or bind another protein or nucleic acid molecule, etc.

[0076] In some aspects, which may be combined with other aspects, the carrier or excipient for use with the composition disclosed herein may include, but is not limited to,PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) maleic acid, tartaric acid, lactic acid, citric acid, acetic acid, sodium bicarbonate, sodium phosphate, histidine, glycine, sodium chloride, potassium chloride, calcium chloride, zinc chloride, water, dextrose, N-methylpyrrolidone, dimethyl sulfoxide, N,N- dimethylacetamide, ethanol, propylene glycol, polyethylene glycol, diethylene glycol monoethyl ether, surfactant polyoxy ethylene-sorbitan monooleate, or combinations thereof.

[0077] Depending on the route of administration, the compound, for example, SCFA, anion thereof, salt thereof, amide thereof, ester thereof, and / or prodrug thereof, may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound. The compound may be a metabolite of the SCFA, anion thereof, salt thereof, amide thereof, ester thereof, prodrug thereof.

[0078] Therapeutically effective amounts of the compound, for example, SCFA, anion thereof, salt thereof, amide thereof, ester thereof, and / or prodrug thereof, generally include a sufficient amount of the active compound to provide the desired level in the bloodstream or at the site of action (for example, intracellularly) in the patient to be treated, and / or to provide a desired physiological, biophysical, biochemical, pharmacological, or therapeutic response, such as amelioration, inhibition, or alleviation of the manifestations of the disease or symptom thereof. Effective amounts of the compound, for example, SCFA, anion thereof, salt thereof, amide thereof, ester thereof, and / or prodrug thereof, may include any amount sufficient to detectably inhibit histone deacetylase (HD AC) activity by any assay described herein (HDAC inhibition assay and Figure 2F), by other HD AC activity assays known to or readily ascertained by those having ordinary skill in the art, or by detecting an inhibition or alleviation of symptoms of the disease.

[0079] The amount of compound to produce a single dosage form will vary from patient to patient and depend on the mode of administration. It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, intended patient use (for example, the number of doses administered per day), rate of excretion, drug combination, and the severity of the particular disease. These factors and considerations may be determined by one skilled in the art. An appropriate “therapeutically effective” amount inPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) any individual case may be determined by one of ordinary skill in the art using routine experimentation, based upon the information provided herein.

[0080] A therapeutically effective amount may generally be a total amount administered to a patient in single or divided amounts that may be in amounts, for example, in a range from about 0.1 to about 10,000 mg / kg body weight daily, such as from about 0.1 to about 10 g / kg body weight daily (as, for example, extrapolated from mouse studies). Other therapeutically effective amounts are contemplated.

[0081] Compounds of the present disclosure (e.g., an SFCA, anion thereof, salt thereof, amide thereof, ester thereof, prodrug thereof) may be administered orally, parenterally, sublingually, by aerosolization or inhalation spray, rectally, or topically in dosage unit formulations containing conventional nontoxic pharmaceutically acceptable carriers, adjuvants, and vehicles as desired. Topical administration may also involve the use of transdermal administration such as transdermal patches or ionophoresis devices. The term parenteral as used herein includes subcutaneous injections, intravenous, intramuscular, intrasternal injection, or infusion techniques.

[0082] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -propanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, for example, any bland fixed oil may be employed including synthetic monoglycerides or diglycerides. In addition, fatty acids such as oleic acid may find use in the preparation of injectables.

[0083] Suppositories for rectal administration of the drug may be prepared by mixing the drug with a suitable nonirritating excipient such as cocoa butter and polyethylene glycols, which are solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum and release the drug.

[0084] Transrectal dosage forms may include rectal suppositories, creams, ointments, and liquid formulations (enemas). The suppository, cream, ointment or liquid formulationPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) for transrectal delivery comprises a therapeutically effective amount of the selected active agent and one or more conventional nontoxic carriers suitable for transrectal drug administration. The transrectal dosage forms of the present invention may be manufactured using conventional processes. The transrectal dosage unit may be fabricated to disintegrate rapidly or over a period of several hours.

[0085] Solid dosage forms for oral administration may include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound may be admixed with at least one inert diluent such as sucrose lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., lubricating agents such as magnesium stearate. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents. Tablets and pills may additionally be prepared with enteric coatings.

[0086] Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art, such as water.

[0087] A patient may take or may be administered the composition in any suitable dosage form, such as a salve, an oil, or an enema. Additional, or alternatively, the dosage form may be oral, intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (for example, by injection or infusion).Methods

[0088] Aspects of the present disclosure also generally relate to methods for the treatment, prevention, and / or alleviation of diseases and / or symptoms thereof in a patient. Such diseases may include mucosal diseases described herein, epithelial diseases described herein, and intestinal diseases described herein. Illustrative, but non-limiting, examples of intestinal diseases may include Crohn’s disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal cancer, infectious colitis, enteritis, or combinations thereof. Methods for the treatment, prevention, and / or alleviation of diseases and / or symptoms thereof in a patient may include administering to the patient a composition described herein or a therapeutically effective amount of a composition described herein.

[0089] Aspects of the present disclosure also generally relate to methods for the treatment, prevention, and / or alleviation of abdominal pain or gastrointestinal pain in aPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) patient. Such methods may include administering to the patient a composition described herein or a therapeutically effective amount of a composition described herein.

[0090] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use aspects of the present disclosure, and are not intended to limit the scope of aspects of the present disclosure. Efforts have been made to ensure accuracy with respect to numbers used but some experimental errors and deviations should be accounted for.Examples

[0091] “BA” refers to butyrate. “Veh” refers to a vehicle acting as a medium for administering a composition. “Tight junctions” refers to intracellular adhesion complexes in epithelia and endothelia that control paracellular permeability. “C57BL / 6 mice” refers to a lab strain of inbred mice. “T84 cells” refers to a colonic adenocarcinoma cell line. “Caco- 2 cells” refers to enterocytes that were isolated from the large intestine of a patient with colorectal adenocarcinoma. “CLDN2” refers to the gene expressing leaky tight junction protein claudin 2. Proteins in the claudin family regulate the tissue-specific physiologic properties of tight junctions. “OCLN” refers to the gene expressing the tight junction protein occludin. “CLDN4” refers to the gene expressing claudin 4. “CGN” refers to the gene expressing cingulin. Cingulin is a cytosolic protein in humans localized at tight junctions (TJs) of vertebrate epithelial and endothelial cells. “SYNPO” refers to the gene expressing the postsynaptic protein synaptopodin. Synaptopodin is an intestinal epithelial tight junction protein that fine-tunes barrier integrity and promotes epithelial restitution following wounding.

[0092] The inventors investigated analogues of butyrate (BA). Various analogues were found to have more potent or selective biological responses relative to BA. For example, the inventors discovered that 3-C1 BA may significantly enhance intestinal epithelial barrier formation and wound healing in vitro. Furthermore, metabolic studies suggested that 3 -Cl BA is not used as an energy source, providing a therapeutic advantage over BA. Furthermore, HDAC inhibition assays in intestinal epithelial cells (lECs) indicated that 3- C1 BA is a potent HDAC inhibitor (similar to BA). Also, 3-C1 BA significantly contributed to wound healing in vitro. As a potential mechanism of action, the inventors discovered that 3-C1 BA may be involved in the regulation of tight junction proteins (TJs) likely throughPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)HD AC inhibition. Cytotoxicity assays in vitro suggested that 3 -Cl BA is less toxic than the natural metabolite BA. Furthermore, the activity of 3 -Cl BA ex-vivo in mouse colonoids was tested. Here, it was found that 3 -Cl BA potently enhanced their barrier formation and prolonged a sustained barrier. Surprisingly, BA exposed colonoids did not form barrier at any point. Lastly, the impact in barrier formation / restoration was investigated using an established colitis mouse model by exposing C57BL / 6 mice to dextran sodium sulfate (DSS) in combination with salts of BA or 3 -Cl BA delivered in drinking water. Mice were treated with DSS + treatment for 5 days, followed by treatments only for 2 days. The investigations revealed that, in contrast to BA, 3-C1 BA is protective especially at the recovery phase (Day 5-7, after DSS removal). These findings are supported by significantly lower disease activity index, accelerated weight recovery, longer colon length and reduced intestinal permeability. Furthermore, histology of colonic tissue revealed that mice exposed to 3-C1 BA + DSS exhibited relatively normal architecture.

[0093] Overall, these findings suggested that 3 -Cl BA regulates specific biological pathways from the parent compound butyrate, with the therapeutic advantage of not being metabolized as an energy source. Studies in vivo strongly support that 3-C1 BA is protective in mouse models of colitis and contributes to intestinal barrier repair and recovery from tissue damage. Overall, the data indicates that 3-C1 BA may be administered as a potent small molecule HDAC inhibitor and may be utilized to treat patients with inflammatory mucosal diseases. Other investigations were performed as described herein.Materials and Methods

[0094] Cell culture, treatments, and chemical reagents. T84 cells (ATCC #CCL-248) were cultured in DMEM / F-12 1 : 1 (Thermo Fisher Scientific) containing Pen / Strep, GlutaMAX, and 10% (v / v) heat-inactivated bovine calf serum (BCS, Hyclone). Clones of Caco-2 cells (Caco-2, ATCC #CRL2102) were grown in IMDM (Corning) containing Pen / Strep and GlutaMAX + 10% BCS. Caco-2 cells are a cell line derived from a colorectal adenocarcinoma patient, and it is widely used as a model for the intestinal epithelium in research. All the cell lines were maintained at 37°C and 5% CO2 in a humidified incubator. Cells were passaged approximately every 7 days with trypsin (Thermo Fisher Scientific). Cells were plated on 6-well or 24-well plates with or without semipermeable inserts, as required. Sodium butyrate, 3 -chlorobutyric acid, 4-chlorobutyric acid, gamma-aminoPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) butyric acid, crotonic acid, 3 -hydroxybutyric acid, and 4-kDa FITC-dextran were acquired from Sigma Aldrich, Trichostatin A (Selleck Chemicals), and PBS (Fischer Scientific). Unless otherwise noted, cells were exposed to a final concentration of 5 mM BA or BA derivatives, previously neutralized with NaOH (sodium salts), by adding appropriate volumes of 50 mM solutions prepared in PBS directly in the media and PBS was used as vehicle treatment control.

[0095] Protein analysis and immunoblotting. For western blotting, cells were immediately placed on ice after treatments and cell lysates were prepared by scraping in a freshly prepared cocktail of ice-cold IX Laemmli buffer (Bio-Rad) containing IX HALT protease inhibitor (Thermo Scientific), 5 mM EDTA, and 100 mM DTT (Sigma Aldrich) in H2O, (450 pL per well in a 6 well-plate). The obtained lysate solutions were sonicated until their viscosity were like that of water. Mouse tissue samples were lysed using radioimmunoprecipitation (500 pL, RIP A) lysis buffer containing IX HALT protease inhibitor and 5 mM EDTA, sonicated and centrifuged. The protein concentration was determined by BCA protein assay (Thermo Fisher Scientific). Iced-cold tissue lysates (63 pL) were mixed with the previously described Laemmli cocktail (37 pL) and equal concentration proteins were resolved. SDS-PAGE samples were run on Mini -PROTEAN TGX precast gels 10% (Bio-Rad) and transferred to 0.2 pm PVDF membranes using a Bio-Rad Transblot Turbo system. Blots were blocked for 1 h at room temperature using blocking buffer 5% milk (BioRad) in Tris-buffered saline (TBST) (25 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20) and then incubated overnight in primary antibody diluted in 5% milk in TBST. The primary antibodies used were anti-P-actin (Abeam #ab8227, 1 :5000), anti-HIFla (BD Biosciences #610959, 1 : 1000), anti-HIF2a (Novus Bio #NB100-122, 1 : 1000), anti-acetyl histone 3 (Active Motif #39139, 1 : 1000), anti-histone 3 (Millipore Sigma #06-942, 1 : 1000), and anti- CLDN2 (Fischer Scientific #51-6100, 1 : 1000). Blots were then washed with TBST (3X, 10 min) and incubated for 1 hour with their corresponding HRP-conjugated secondary antibody diluted in 5% milk (1 / 10000). Blots were washed thoroughly with TBST, developed using Clarity MAX ECL reagent (Bio-Rad), and imaged using a Bio-Rad ChemiDoc MP imager. Densitometry was measured using Image , comparing the bands of interest to the Actin bands.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0096] RNA isolation, cDNA synthesis and qPCR. RNA was isolated from cells using TRIzol reagent (Thermo Scientific) according to the manufacturer’s instructions. Isolated RNA was then reverse transcribed to cDNA using the i Script Supermix reagent (Bio-Rad), and analyzed using Power SYBR Green Master Mix reagent (Thermo Scientific) in a Quant Studio 5 Applied Biosystems Real-Time PCR (Thermo Fisher Scientific). Transcript quantities were calculated using an on-plate standard curve and were normalized to that of P-actin. The following primer sequences were used for real-time PCR analysis:

[0097] hactb, Forward - 5’ - CATGTACGTTGCTATCCAGGC - 3’, Reverse, 5’ - CTCCTTAATGTCACGCACGAT - 3’;

[0098] hcldn2, Forward - 5’ - GCCTCTGGATGGAATGTGCC - 3’, Reverse, 5’ - GCTACCGCCACTCTGTCTTTG - 3’;

[0099] hocln, Forward - 5’ - GTCATCCACGAGGCGAAGTTAAT - 3’, Reverse, 5’ - ACAAGCGGTTTTATCCAGAGTC - 3’;

[0100] hcldn4, Forward - 5’ - GGGGCAAGTGTACCAACTG - 3’, Reverse, 5’ - GACACCGGCACTATCACCA - 3’;

[0101] hcgn, Forward - 5’ - TGGAAAGCTACTCCGTTCCCA - 3’, Reverse, 5’ - AGCAGTGTCAATGGTGCTACC - 3’;

[0102] hsynpo, Forward - 5’ - ATGGAGGGGTACTCAGAGGAG - 3’, Reverse, 5’ - CTCTCGGTTTTGGGACAGGTG - 3’.

[0103] Assessment of epithelial barrier function. Epithelial barrier was measured by transepithelial electrical resistance (TEER) and FITC dextran flux assay. TEER was measured by growing lECs on permeable membranes, 0.4 pm pore, 24 well plate using an epithelial voltmeter (model EV0M2, World Precision Instruments). All treatments (5 mM unless otherwise noted) were applied 24 h after plating the cells and TEER was monitored every 24 h. Raw measurements were converted to Ohm*cm2. 4-kDa FITC-dextran flux was measured when cells were at maximal barrier as measured by TEER. Media was replaced with 1 mL of Hanks+ buffer in the bottom well and the top well was filled with 80 pL of 1.25 pg / pL of 4-kDa FITC-dextran in Hanks+ Buffer. Samples were obtained from the lower chamber every 30 minutes for 2 hours and measured relative to a standard curve. Flux was measured as pg / min / cm2. Colonoid TEER experiments were conducted by dissociating colonoids in Trypsin-EDTA (Fisher Scientific) by vigorous pipetting. Cells were strainedPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) through a 70 um filter, counted and then plated in equal number per condition (approximately 30,000 / well) on collagen coating solution (Sigma-Aldrich, 125-50) pretreated transwells. To collagen coat transwells, 0.4 pm pore, 0.33 cm2transwells were incubated with 100 pL of collagen coating solution for 12-24hrs prior to removal of excess by suction. Cells were grown in L-WRN cell conditioned enteroid media for 24 hours, followed by maturation media (L-WRN media diluted 1 : 10 with T84 media) containing the corresponding treatments: BA and 3-C1 BA (1 mM), IOX4 (10 pM), vehicle = H2O. TEERs were obtained every 24 h. FITC-dextran assay and flux calculation were done as described above without modifications.

[0104] Wound healing assay. T84 cells were plated at 35,000 cells / well on a 96-well ImageLock plate (Essen Bioscience Inc.) and incubated until a confluent cell monolayer formed (~48 h). Precise and reproducible wounds were made in all wells with a WoundMaker (Essen Bioscience Inc.). After wounding, media was aspirated from each well, and each well was gently washed with PBS before 100 pL of control media or media containing treatments (BA or BA derivatives, all at 5 mM) were added. Initial images were taken immediately after wounding at 10X using the IncuCyte live-cell imaging (Essen Bioscience Inc.), and then every 2 h over the course of 36 h. Relative wound closure% was quantified for every image using the relative wound density metric, a measure of cell density in the wound area relative to the cell density outside of the wound area.

[0105] Real-time oxygen consumption. A SensorDish Reader from Applikon Biotechnology and oxodish plates (Precision Sensing) were used as previously described. Briefly, Caco-2 monolayers were grown to confluency on 0.33 cm2transwell inserts with 0.4 pm pore size (Corning). Once fully confluent as observed by maximum barrier formation, the medium was aspirated, and inserts were transferred to a 24-well oxodish plate with an oxygen sensor at the bottom center of each well. One milliliter of medium was added basolaterally and 250 pL to the apical side and allowed to equilibrate in an incubator for 1 h at 37°C. Corresponding treatments were added directly to the media, and the oxodish was immediately placed on the sensordish reader on a rotating platform at 37°C. The plate was not sealed to allow for reoxygenation of the media. The oxygen percentage in the media was continuously measured at 1-min intervals. O2 consumption rates were calculated by linear regression of individual plots.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0106] HDAC inhibition assay. HDAC activity / inhibition were measured using Epigentek kits (P -4034-96) following their protocol without modifications. Briefly, Caco-2 cells were grown to confluency in 6-well plates. Then, nuclear extracts were obtained using a NE-PER extraction kit (Thermo Fisher Scientific) following their protocol without modifications. The obtained protein was quantified using BCA protein assays as described by regular protocols. Nuclear extracts (~4 ug per well) were added to the HDAC assay plate and incubated with treatments: BA and 3-C1 BA (5 mM), TSA (1 pM), vehicle (PBS) and the provided assay buffer. Wells then were washed with provided washing buffer, following by the addition of capture antibody. Washed wells and added detection antibody. Lastly, a color developing solution was added and the absorbance was measured. HDAC activity calculation was performed as instructed by the company.

[0107] Transfection. An occludin-luciferase reporter plasmid and empty vector control (Switch-gear Genomics) were transfected into HeLa cells using Lipofectamine 3000 transfection reagent (Invitrogen) following the manufacturer’s recommended protocol and as previously reported. The day following transfection, cells were treated with 5 mM BA or 3-C1 BA in PBS (24 h). Cells were lysed the day after treatment and luciferase was measured using a dual-luciferase reporter assay (Promega #E1960) and the results were normalized to protein by BCA.

[0108] Colonoid development. Colonoids were developed using colon samples from C57BL / 6 wildtype mice. Cells were isolated and grown as previously described. Briefly, colonic tissue was digested using LP dissociation kit (Miltenyi) with mechanical disruption using the GentleMACS C tube (Miltenyi) on intestine setting. Cells were strained through a 70-pm cell strainer, washed and resuspended in Matrigel Basement Membrane (Corning). L-WRN cell conditioned organoid media (DMEM / F12 supplemented with 1% Pen / Strep, 1% GlutaMAX, 20% FBS) was used to maintain the cells as previously described. Briefly, cells were passaged 2 times per week involving dissociation by vigorous pipetting in the presence of Trypsin and T84 cell media. Cells then underwent 2 rounds of washes with T84 cell media, centrifugation at 200 x g and then were resuspended in Matrigel and plated in spots on tissue culture plates.

[0109] Flow cytometry. Colonoids were cultured as previously described in Matrigel domes in 6-well plates for 48 h. After this time, they were treated with 1 mM BA or 3-C1PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)BA in (1% H2O) for 18 h. To generate single-cell suspensions, cultures were incubated with ice-cold PBS to loosen the Matrigel, followed by mechanical dissociation through repeated pipetting. Dissociated colonoids were collected in ice-cold PBS and centrifuged at 150 * g for 10 minutes at 4°C. After washing to remove residual Matrigel, colonoids were incubated with pre-warmed TrypLE Express for 3 minutes at 37°C, then further dissociated by gentle pipetting. TrypLE was neutralized with MACS buffer supplemented with 5% FBS, and cells were centrifuged at 400 * g for 5 minutes at 4°C. The final pellet was resuspended in MACS buffer + 5% FBS at an approximate concentration of 10 million cells / mL.

[0110] For flow cytometry, cells were first stained with Live / Dead Blue viability dye (1 : 1000 dilution) for 20 minutes on ice in the dark. Samples were washed with MACS buffer + 5% FBS and centrifuged at 400 * g for 5 minutes at 4°C. For intracellular staining, cells were fixed and permeabilized using the fixation / permeabilization solution from BD Biosciences, following the manufacturer’s instructions. After permeabilization for 1 hour at 4°C in the dark, cells were stained with anti-Ki-67 (PE, 1 : 100) and anti-Cleaved Caspase-3 (Alexa Fluor 647, 1 :50) in permeabilization buffer. Following staining, cells were washed and resuspended in IC Fixation Buffer (BD Biosciences) according to the manufacturer’s protocol. Samples were acquired on a Cytek Aurora 5-laser spectral flow cytometer. Data were analyzed using FlowJo software, version 10.10.0.

[0111] Mouse studies. C57BL / 6 mice were purchased from Jackson Laboratories. Animals were maintained and bred in standard housing conditions under 24 h / day, 7 days / week veterinary care at the University of Colorado Anschutz Medical Campus (AMC) animal facility. Animal procedures and care were reviewed and approved by the Institutional Animal Care and Use Committee of AMC.

[0112] DSS-induced colitis. DSS (dextran sodium sulfate) is a compound that disrupts the epithelium of mice and is utilized as an ulcerative colitis model. 8-week-old to 13-week- old mice of similar weight and matched by gender were used in DSS studies. Mice were switched to water bottles in their cages to allow them to become familiarized with this drinking system 24 h before the experiments began. On day 0, the DSS group received drinking water with 2.5% DSS (MW -40,000; Chem Impex), the BA + DSS group received 2.5% DSS + 50 mM BA (sodium salt) in water, and the 3-C1 BA + DSS group received 2.5% DSS + 50 mM 3-C1 BA (sodium salt) in water. Treatments were given for 5 days, andPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) fresh solutions were prepared and replaced every other day. After this time, mice were allowed to recover for 2 days by removing DSS but still treated with either BA or 3-C1 BA in their drinking water. A disease activity index (DAI) score was assessed daily to evaluate the development of colitis based on the parameters of weight loss compared to initial weight, stool consistency, and rectal bleeding. Scores were defined as weight loss: 0 (0%), 1 (1-5%), 2 (5-10%), 3 (11-20%), and 4 (>20%); stool consistency: 0 (well-formed pellets), 2 (pasty, semi-formed pellets), and 4 (liquid stools); and rectal bleeding: 0 (no blood), 2 (hemoccult positive), and 4 (gross bleeding). Maximum DAI possible was 12. Colon lengths were measured at time of sacrifice, and distal colon tissue collected for histology and protein analyses.

[0113] Colon Permeability. Mice were administered 100 pL of 100 mg / mL 4-kDa FITC-dextran (Sigma-Aldrich) by oral gavage, 2 h later blood was collected by heart puncture immediately after sacrifice.

[0114] Histological Scoring. Distal colon samples were fixed in methacarn (methanol: chloroform: acetic acid, 60:30: 10) before preparation for histological analysis and staining with hematoxylin and eosin. Colon tissue from a healthy mouse without any treatments was used as reference and shown in the H2O histology image. All histological quantitation was performed blinded and scored by a pathologist. Each sample was assessed for three independent parameters including severity of inflammation (0-3: none, slight, moderate, severe), depth of injury (0-3: none, mucosal, mucosal and submucosal, transmural), and amount of crypt damage (0-4: none, basal 1 / 3 damaged, basal 2 / 3 damaged, only surface epithelium intact, entire crypt and epithelium lost). Each independent parameter score was then multiplied by a factor reflecting the percentage of tissue involved (xl : 0-25%, x2: 26-50%, x3: 51-75%, x4: 76- 100%) and then totaled. Maximum histological score possible was 40.

[0115] Nuclear magnetic resonance spectroscopy .JH and13C NMR were recorded on a Bruker Avance III HD (400 MHz) NMR instrument. Residual solvent signal was used as internal standard.

[0116] Statistical and graphical presentation of data. Statistical analysis and figure generation were performed using GraphPad Prism 10. Statistical analyses were performedPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) using either One-way or Two-way ANOVA with post-hoc corrections, as indicated in the figures. A p value of less than 0.05 was considered significant.Introduction

[0117] Termed “gut microbiota”, the gastrointestinal tract is home to trillions of microorganisms, where over a thousand diverse bacterial species dominate the microbial population and play a key role in various biological processes in health and disease. A study revealed that in the body, there is a 1 : 1 ratio of human and bacterial cells. In addition, the human microbiota contribute over 150 times more genetic information than that of the entire human genome. Known as the “hidden organ”, the gut microbiota is a primary mediator of homeostasis, regulating nutrient metabolism, barrier integrity, inflammation, defending against pathogens, and immune cell signaling.

[0118] The gut microbiota is responsible for carrying out the vital task of producing beneficial metabolites such as short-chain fatty acids (SCFAs), indole derivatives, amine- containing compounds, secondary bile acids, and vitamins. SCFA are the products of bacterial fermentation of insoluble fiber, primarily in the col one and have been demonstrated play key beneficial roles to maintain gut health. SCFAs are fatty acids containing 2 to 6 carbon atoms and may display various functional groups including amines, alcohols, or branched carbon chains. The three primary SCFAs produced in the intestine are acetate (-60%), propionate (-20%), and butyrate (-20%). Depending on dietary substrates, SCFAs may reach tolerable high concentrations in the colon of up to 150 mM. SCFAs play a role in colon energy supply, gut barrier regulation, influence on immune responses, and playing a signaling role in the gut-brain axis.

[0119] Of the SCFA, butyrate (BA) has been most widely studied for its benefits to the host. BA is involved in cell cycle progression, amelioration of mucosal inflammation, improving wound healing, epithelial barrier formation, and as an antioxidant. As the preferred source of energy in the colon, up to 95% of BA is absorbed by colonocytes and transformed into fuel via P-oxidation and the tricarboxylic acid cycle. The remaining BA is capable of orchestrating the regulation of variety of biological pathways to maintain intestinal barrier homeostasis: It acts as a ligand for G-protein coupled receptors and it has been reported that BA either directly or indirectly activates the aryl hydrocarbon receptor transcription factor. Furthermore, BA stabilizes the hypoxia inducible factor (HIF), a masterPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) transcriptional regulator of many genes involved in intestinal homeostasis. Lastly, BA is a potent histone deacetylase inhibitor (HDACi), making BA one of the more important metabolites generated by the gut microbiota.

[0120] Patients with inflammatory bowel disease (IBD) exhibit significantly decreased levels of BA and BA-producing bacteria, termed dysbiosis. As BA is mostly used as an energy source, such dysbiosis potentially limits its clinical application in activating other biological pathways, especially when BA levels are low. Furthermore, not all intestinal epithelial cells (lECs) metabolize BA equally. For example, it has long known that IEC from patients with IBD show deficient utilization of BA in the conversion to energy. Moreover, it has been shown that undifferentiated colonocytes, such as stem cells at the base of the crypt, prefer glucose over BA as an energy source and thus are susceptible to the downstream effects of increased BA levels.

[0121] Metabolite-mimicry, defined as the creation of synthetic molecules that mimic biological activity of naturally occurring metabolites, is a relatively new and understudied field that may potentially accelerate drug discovery. In theory, biomimicry may lead to potent drug-like molecules similar to naturally occurring metabolites that regulate specific biological pathways. Given the broad biological actions of BA in the gut, butyrate- mimicking compounds (butyrate analogues) that exhibit more specificity or potency towards various biological pathways may be useful. In these efforts, the inventors previously reported a compound (4-mercapto butyrate) that stabilizes HIF more potently and in a prolonged manner compared to the parent compound. In the present studies, and in contrast previous reports, the inventors discovered various butyrate analogues that can be utilized for, e.g., mucosal disease, wound healing responses in the mucosa, HDAC inhibition, inflammation, tight junction profiles, and / or promotion of barrier function. For example, a butyrate analogue, 3 -chlorobutyrate (3 -Cl BA), significantly enhanced IEC barrier formation and wound healing, and functions as a potent HDACi, but possesses no activity on HIF stabilization. Unlike BA, 3 -Cl BA showed significant anti-inflammatory properties a mouse model of colitis. These results contribute to the discovery of tolerable metabolitemimicking drugs that may alleviate mucosal inflammation in diseases such as IBD. HIF stabilization is unrelated to various aspects of the present disclosure. For example, HIF stabilization is unrelated to mucosal disease, wound healing responses in the mucosa,PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)HD AC inhibition, inflammation, tight junction profiles, and promotion of barrier function. HIF stabilization is also unrelated to, for example, treatment of a mucosal disease or symptom thereof in a patient.Non-limiting Results3-C1 BA enhances epithelial barrier function and accelerates IEC wound healing similar to butyrate

[0122] BA is known to enhance intestinal epithelial barrier formation and accelerate wound healing, presumably functioning as an energy source for colonocytes. Based on these studies, a small library of structurally related BA analogues on IEC barrier formation and wound healing was profiled (a panel of BA-mimicking compounds (butyrate analogues) is shown in FIG. 1A). First studied was epithelial barrier formation by monitoring transepithelial electrical resistance (TEERs). IECS T84 (FIG. IB) and Caco-2 (FIG. 6) were grown on semipermeable membranes overnight followed by exposure to various BA derivatives (all sodium salts at 5 mM) or PBS. Monolayers were exposed to compounds on both the basolateral and apical surfaces and TEERs values were monitored every 24 h. Both BA and 3 -Cl BA significantly promoted epithelial barrier formation, with noticeable differences as early as 24 h after treatment and up to a four-fold increase in TEER (FIG. IB). Interestingly, other closely related molecules including the structural isomer 4- chlorobutyrate (4-C1 BA) and a potential hydrolysis byproduct (3 -hydroxybutyrate [3-OH BA]) had no influence in epithelial barrier formation beyond that of vehicle alone. Also evaluated was functional barrier activity through fluorescein isothiocyanate-dextran (FITC- dextran) paracellular flux assays. T84 cells were exposed to BA and 3 -Cl BA (5 mM) and grown to maximum TEER reading prior to FITC-dextran flux assay performed every 30 min for a total of 120 min. By this measure of barrier function, butyrate and 3 -chlorobutyrate were observed to significantly enhance barrier as measured by paracellular flux compared to vehicle (FIG. 1C).

[0123] IEC proliferation and migration demand significant energy expenditure. While not wishing to be bound by any theory, it is believed that butyrate, being a preferred colonocyte energy source, may significantly accelerate wound healing compared to other butyrate analogues. Next explored was wound healing through scratch wound assays. Briefly, T84 cells were grown to confluence in 96-well plates, uniformly scratch woundedPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) and sealing of wounds was monitored by image capture every 2 h for 36 h. The images obtained were evaluated for relative wound density percentage over time. As shown in FIG. ID, butyrate and 3-C1 BA significantly promoted wound healing compared to vehicle controls. Of note, the closely related structural isomer 4-C1 BA did not accelerate wound healing beyond that of controls. FIG. IE depicts representative images of the original wound and the striking wound closure in monolayers of lECs exposed to both butyrate and 3-C1 BA at 36 h.

[0124] Potential effects 3 -Cl BA might exert on lECs was assessed by measuring proliferation and potential cytotoxicity. It was discovered that BA but not 3-C1 BA significantly reduces cell proliferation in T84 cells under the conditions tested (FIG. 7A). Cytotoxicity studies in T84 cells revealed that both the native BA and 3-C1 BA exhibit very mild toxicity levels, although, 3-C1 BA (~5%) was significantly less toxic than butyrate (-15%) in T84 cells (FIG. 7B). Lastly, to establish the stability of 3-C1 BA in aqueous conditions, nuclear magnetic resonance (NMR) studies were performed by dissolving 3-C1 BA in deuterated water and comparing originalJH and13C NMR spectra (0 h) to spectra after 24 h incubation at 37°C. NMR studies revealed there is no change to the structural integrity of 3-C1 BA including no observed hydrolysis (FIGS. 8-11).3-C1 BA exhibits selective biological roles acting as a potent HDAC inhibitor.

[0125] Next investigated was distinguishing mechanistic endpoints between native BA and the 3-C1 BA analogue. Here, HIF stabilization, oxygen consumption, and HDAC inhibition were profiled. As shown in FIGS. 2A and 2B, western blot analysis revealed that BA but not 3-C1 BA (both at 5 mM, 6 h, normoxia) stabilized HIF la and HIF2a protein in T84 cells. Next, assessed was the influence of BA and 3-C1 BA in O2 consumption as a reflection of oxidative phosphorylation. Using oxodish assays, oxygen consumption was monitored in Caco-2 monolayers plated on semipermeable membranes and exposed to PBS, BA (5 mM), or 3-C1 BA (5 mM). As shown in Fig. 2C, the rate of O2 consumption was significantly increased by butyrate over vehicle and 3-C1 BA, suggesting that 3-C1 BA is not used as fuel for energy procurement by IEC. Finally, BA and 3-C1 BA function were compared as inhibitors of several classes of HDACs. Using HDAC activity inhibition assays, the inhibition of these enzymes in nuclear extracts of Caco-2 cells exposed to BA, 3 -Cl BA (5 mM, 24 h) or the bona fide HDACi trichostatin A (TSA, 1 pM, 24 h) werePCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) measured. Indeed, as observed in FIG. 2D, it was discovered that like BA and the HDACi TSA, 3-C1 BA is a potent HDAC inhibitor. To further demonstrate that 3-C1 BA acts as an HD AC inhibitor, lECs were treated with BA and 3-C1 BA (5 mM, 18 h) and assessed histone 3 (H3) acetylation levels as shown by the representative western blots in FIG. 2E and quantified in FIG. 2F. Similar to butyrate, 3-C1 BA significantly increased histone acetylation levels by protein, further suggesting that 3-C1 BA acts as an HDACi in lECs. Taken together, these data suggest that 3 -Cl BA exhibits selective functions of native butyrate, namely HDACi but not HIF stabilization or metabolism, and implies that butyrate analogues such as 3-C1 BA may be directed toward specific biological responses.3-C1 BA regulates proteins involved in barrier function.

[0126] Next investigated was the effect of native butyrate or 3 -Cl BA on molecular endpoints in IEC. The intestinal epithelial barrier is regulated by the expression and localization of tight junctions (TJ) composed of several transmembrane and cytosolic proteins, including occluding (OCLN), claudins (e.g., CLDN2, CLDN4), zonula occludens, and cingulin (CGN). Based on the functional endpoints of promoting barrier formation and accelerated wound healing (FIG. 1), the TJ regulation in several IEC lines were profiled. Interestingly, there was a remarkable transcriptional repression of CLDN2 in Caco-2 cells exposed to butyrate and 3-C1 BA (both at 5 mM, 18 h) as well as the HDACi TSA (1 pM) as demonstrated by qPCR (FIG. 3A). CLDN2 is commonly referred as a “leaky claudin” that diminishes barrier integrity and a key component of a “leaky epithelia”. These observations were extended to assess whether CLDN2 is repressed at a protein level. As shown in FIGS. 3B and 3C, there was a prominent loss of CLDN2 protein in Caco-2 cells exposed to butyrate or 3-C1 BA in PBS (5 mM, 24 h) as well as TSA (1 pM). A time course analysis revealed that butyrate and its analogue 3-C1 BA decreased CLDN2 by as much as 80±3% after 48h of exposure (FIGS. 3D and 3E). These results were confirmed in a different IEC line (T84s), obtaining similar results in downregulation of CLDN2 mRNA (same conditions as previously reported, FIG. 3F) and a significant suppression of protein (FIGS. 12A and 12B).

[0127] These studies were extended to profile other tight junction proteins in IEC. This analysis revealed a significant transcriptional upregulation of CGN in Caco-2 cells (FIG. 12C), a protein localized to the cytoplasmic region of TJs and known to regulate CLDN2PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) expression. CLDN4 is a TJ-sealing claudin that correlates with tight epithelial tissues and competes with CLDN2 for residency within the TJ. A significant upregulation of CLDN4 exclusively in Caco-2 cells treated with 3-C1 BA was observed as shown in FIG. 12C. Furthermore, synaptopodin (SYNPO) is localized to the actin cytoskeleton of intestinal epithelial TJ and is critical for barrier integrity and cell motility. The inventors discovered that SYNPO was upregulated by both butyrate and 3-C1 BA in Caco-2 cells (FIG. 12C). For T84s treated with 3-C1 BA, the inventors observed upregulation of OCLN (FIG. 3F), a TJ involved in barrier formation and that is markedly decreased in intestinal permeability disorders.

[0128] Lastly, whether native butyrate and 3 -Cl BA elicit transcriptional activity was determined. To do this, an OCLN-luciferase reporter construct was transfected in HeLa cells, treated the cells with butyrate or 3 -Cl BA in PBS (5 mM, 24 h), and discovered a ~6- 7 fold increase in OCLN-luciferase reporter activity compared to vehicle, with no significant difference between BA and 3-C1 BA (FIG. 3G). Overall, these results indicated that both BA and its structurally-related analogue 3-C1 BA elicit a TJ phenotype that supports barrier integrity. In this regard, no differences were noted between native butyrate and 3-C1 BA.3-C1 BA but not butyrate is protective in a mouse model of colitis.

[0129] Butyrate and 3 -Cl BA were then investigated in an in vivo model of colitis. To do this, the impact of orally delivered butyrate and 3-C1 BA on colitis in wild-type C57BL / 6 mice was examined. Mice were treated with 2.5% DSS, ±50 mM BA, or ±50 mM 3-C1 BA (both as sodium salts, pH 6-7) in drinking water. After 5 days of treatment, DSS was removed to allow mice to recover while continuing to drink H2O, BA, or 3 -Cl BA solutions for an additional 2 days. As shown in FIG. 4A, disease activity index (DAI) observations encompassing body weight, stool consistency, and bleeding show that all groups exhibited progressive disease while on DSS. Upon removing DSS, mice drinking 3-C1 BA recovered significantly faster than butyrate and water alone. Furthermore, mice exposed to 3 -Cl BA significantly recovered initial weight after DSS removal compared to mice drinking butyrate or H2O (FIG. 4B). Upon sacrifice, 3-C1 BA treated mice exhibited a longer colon compared to the other groups (FIG. 4C). As shown in FIG. 4D, intestinal barrier integrity was assessed at the end of the study via 4-kDa FITC-dextran oral gavages, showing that 3 -Cl BA greatly contributed to promote a stronger intestinal barrier (29.0±8.3 pg / mL) compared to DSS onlyPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)(143.4±43.2 pg / mL). CLDN2 protein levels in distal colon were then assessed. Consistent with in vitro observations, CLDN2 protein was repressed both by BA and 3-C1 BA as demonstrated by the representative western blot (FIG. 4E) and relative CLDN2 densitometry (FIG. 4F). Lastly, histologic features of disease in these cohorts were examined. Strikingly, mice drinking 3-C1 BA exhibited far less tissue damage when compared to those exposed to BA or vehicle. Histology (FIGS. 4G and 4H) revealed a significant protection afforded by 3-C1 BA compared to native butyrate. This analysis showed substantial loss of epithelial architecture, crypt damage, and inflammatory infiltrate both in B A / D SS -treated mice and DSS-only treated mice. By contrast, histologic features of the 3-C1 BA / DSS-treated cohort more closely resembled healthy controls. These in vivo findings distinguish native butyrate and 3-C1 BA at the level of inflammatory protection.Comparison of BA and 3-C1 BA in mouse colonoids

[0130] To understand the dichotomy between BA and 3 Cl-BA in IEC cell lines and in vivo colitis model, colonoids derived from C57BL / 6 mice were investigated. Stem-like mouse colonoids were plated on semipermeable membranes to allow for analysis of barrier formation. After 24h, colonoids were differentiated in maturation media containing BA, 3- C1 BA (both at 1 mM), a bona-fide HIF stabilizer (IOX4 10 pM) or vehicle (1% H2O). TEERs values were recorded every 24 h. As shown in FIG. 5A, this analysis revealed a striking difference in barrier formation between colonoids and transformed cells lines (T84 and Caco-2, see FIG. 1 and FIG. 6). Indeed, 3-C1 BA significantly enhanced barrier formation over vehicle while monolayers exposed to butyrate showed minimal barrier formation compared to vehicle. In addition, 3 -Cl BA trended toward decreased paracellular flux compared to both vehicle and BA exposed cultures (FIG. 13).

[0131] One of the prominent differences between butyrate and 3 -Cl BA was the stabilization of HIF (see FIG. 2 A). Interestingly, like BA, the potent HIF-stabilizing compound IOX4 significantly inhibited barrier formation in mouse colonoids (FIG. 5A), suggesting that HIF stabilization in stem cells may disrupt barrier formation and may explain the observed differences between stem mouse colonoids and transformed cell lines. Furthermore, flow cytometry studies revealed that BA significantly promotes IEC apoptosis as observed by increased cleaved caspase3 levels (CCaspase3) and inhibits proliferation as indicated by reduced Ki67 (FIG. 5B). Thus, the dichotomy between the observations inPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) transformed cell lines and in vivo may be explained by differential responses of IEC stem cells to BA and 3-C1 BA.Non-limiting Discussion

[0132] Microbially-derived metabolite mimicry is a relatively novel and underexplored concept that could accelerate the discovery of new drugs from their naturally-derived moieties. SCFAs, for example, exhibit multiple functions in a location-dependent manner. While it is well-accepted that butyrate functions as a preferred energy source for colonocytes, it also orchestrates transcriptional control of a multitude of genes as an HD AC inhibitor and through the activation of HIF in the mucosa. Given the diverse functions of this relatively simple metabolite, the inventors sought to determine the existence of BA analogues that might regulate specific BA biological pathways as a potential rescue mechanism in disease associated with dysbiosis. Herein, the inventors found a novel BA analogue, namely 3 -Cl BA, that regulates intestinal barrier function and mucosal wound healing selectively through HDACi control of genes involved in TJ formation.

[0133] BA is known to exhibit an overall positive influence on mucosal homeostasis. In part, this has been determined by disease states where dysbiosis of BA-producing microbes strongly correlates with the severity of IBD and other mucosal inflammatory diseases. The impact of BA analogues was assessed and elected to use epithelial barrier formation as a model biological function. Initially, a small library of BA analogues was screened for their influence on epithelial barrier integrity using immortalized cancer cell lines in vitro. The inventors discovered that, similar to native BA, 3-C1 BA selectively increased barrier formation in lECs. Interestingly, other BA analogues (select examples described here) may have no enhancing activity under the conditions investigated, including the closely related structural isomer 4-chlorobutyrate (4-C1 BA). Furthermore, a possible hydrolysis byproduct from 3 -Cl BA, 3 -hydroxybutyrate, does not exhibit barrier promoting activity in vitro under the conditions tested. In parallel, wound healing assays revealed that 3 -Cl BA accelerated wound healing compared to other BA analogues, including 4-C1 BA.

[0134] These promising results led the inventors to investigate the underlying mechanism for this 3-C1 BA selectivity. For these purposes, three of the major functions of BA in the colon were profiled, including as a fuel for oxidative phosphorylation, as an HDAC inhibitor (HDACi) and as a HIF stabilizing agent. This analysis revealed that 3-C1PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)BA is not readily metabolized by oxidative phosphorylation and results in no appreciable HIF stabilization. HDACi assays, however, revealed that similar to BA, 3-C1 BA is a potent HDACi. The installation of a halogen functional group in the third position, such as in 3-C1 BA, may facilitate its position in the binding site resulting in strong HDACi capabilities. Taken together, this evidence suggests that 3-C1 BA is a strong candidate as a selective HDACi in colonocytes.

[0135] The in vivo results comparing administration of native BA and the 3-C1 BA analogue during DSS colitis were surprisingly effective given that native BA showed little impact on colitis. Although all cohorts of mice became ill within 5 days of DSS exposure regardless of treatment, mice exposed to 3 -Cl BA recovered more rapidly, with only minimal histologic evidence of colitis on day 7. By contrast, animals that were administered BA showed strong clinical signs of colitis with histologic evidence of profound inflammation. While surprising, these results are not completely unexpected. The use of native BA for therapeutic purposes is, at best, controversial. Studies in both murine models and in human colitis have revealed that administration of BA may be beneficial, neutral and even detrimental. It is thought that several individual factors may contribute to these outcomes, including dosage, uptake and metabolism of BA during active inflammation. An additional consideration is the impact of native BA on intestinal stem cells. Since stem cell proliferation is essential for effective wound healing, it is notable that BA has been reported to inhibit stem cell proliferation. Based on this evidence, the in vivo experiments were extended to compare BA or 3-C1 BA ex vivo on stem-like mouse colonoids. These studies confirmed previous reports that BA inhibits stem cell proliferation while the 3-C1 BA analogue showed a more favorable response in enhancing the formation of differentiated epithelial monolayers.

[0136] A plausible explanation for the observed differences between BA and 3-C1 BA on colonic stem cells proliferation may lie in the architecture of the intestinal crypt. It has been demonstrated, for instance, that a natural metabolite gradient stemming from the top of the villus to the bottom of the crypt results in the rapid consumption of BA as fuel by differentiated colonocytes, thereby minimizing exposure of the crypt to butyrate. In cryptless organisms (e.g., zebra fish) or intestinal injury (e.g., DSS colitis) this gradient is disrupted by loss of villus architecture and stem cells are unnaturally exposed to metabolitesPCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) such as butyrate. Along these same lines, the intestinal crypt also exhibits a prominent oxygen gradient coined “physiologic hypoxia”. Oxygen concentrations drop precipitously along the crypt-villus axis from the well-oxygenated crypt floor with constant blood flow (pO2 ~85) to the top of the villus where the microbiota and metabolites reside in a hypoxic environment (pO2 <10). It is believed that, as with BA, stem cells at the bottom of the crypt may be maladapted to hypoxic conditions and the regulatory influences of HIF. Based on the observation that BA, but not 3-C1 BA, stabilizes HIF, the influence of HIF on colonoid barrier formation was assessed. Using a pharmacological HIF stabilizing drug IOX4 under normoxic conditions, it was determined that HIF stabilization phenocopied BA by inhibiting stem cell proliferation and blocking barrier formation of colonoids. Interestingly, BA inhibition of stem cell proliferation was attributable to the transcription factor FOXO3. It is notable that HIF-1 may positively and negatively regulate FOXO3 and it is proposed that stem cell HIF stabilization by BA, but not 3-C1 BA, may explain the differences observed.

[0137] Taken together, the inventors demonstrated that it is possible to identify microbial-derived metabolite-mimicking compounds (analogues) with selective functions. Using this rationale, the inventors identified 3-C1 BA, a molecule with selective HDACi properties that lacks other biological properties of native BA. While the exact details of the protection afforded by 3-C1 BA in active inflammation are not known, it is believed that by avoiding the detrimental impact of native BA on stem-cell proliferation, 3 -Cl BA may enhance wound healing responses in vivo.Aspects of the Disclosure

[0138] The present disclosure provides, among others, the following aspects, each of which may be considered as optionally including any alternate aspects:

[0139] Aspect 1. A composition for treating a mucosal disease or symptom thereof in a patient, the composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0140] Aspect 2. The composition according to Aspect 1, wherein the composition comprises the anion of the short chain fatty acid.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0141] Aspect 3. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid comprises a short chain fatty acid represented by formula (I-A):wherein: R1of formula (I-A) comprises the carbon chain; and at least one hydrogen of R1is substituted with at least one heteroatom or heteroatom-containing group.

[0142] Aspect 4. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid comprises a short chain fatty acid represented by formula (I-A):wherein: R1of formula (I-A) comprises the carbon chain; and R1of formula (I-A) comprises one or more olefins.

[0143] Aspect 5. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid comprises a short chain fatty acid represented by formula (I-A):O R’A-OH(I-A)wherein R1of formula (I-A) is represented by formula (II-A), formula (II-B), formula (II- C), or formula (II-D):wherein: each of Y'-Y32of formulas (II-A)-(II-D) is, independently, hydrogen, halogen (such as Cl, Br, F, or I), heteroaryl (such as indole), aryl (such as phenyl or naphthyl),PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) hydroxyl (OH), thiol (SH), azide (N3), amine (NR*2, where each R* is, independently, a hydrogen or a C1-C6 hydrocarbyl), thioether (SR*, where R* is a C1-C6 hydrocarbyl), ether (OR*, where R* is a C1-C6 hydrocarbyl), or ketone (C(O)R*, where R* is a C1-C6 hydrocarbyl), such as hydrogen, indole, chlorine, bromine, fluorine, amine, or hydroxyl, such as hydrogen or chlorine.

[0144] Aspect 6. The composition according to Aspect 5, wherein at least one of Y'-Y32of formulas (II-A)-(II-D) is not hydrogen.

[0145] Aspect 7. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid comprises a short chain fatty acid represented by formula (I-A):wherein R1of formula (I-A) is represented by formula (II-B): wherein at least oneformula (II-B) is, independently, halogen, indole, amine, hydroxyl, thiol, ketone, phenyl, or azide.

[0146] Aspect 8. The composition according to Aspect 7, wherein at least one of Y6, Y7, Y8, Y9, Y10, Y11, or Y12of formula (II-B) is, independently, chlorine, bromine, fluorine, indole, amine, or hydroxyl.

[0147] Aspect 9. The composition according to any one of Aspects 7-8, wherein at least one of Y6, Y7, Y8, Y9, Y10, Y11, and Y12of formula (II-B) is chlorine.

[0148] Aspect 10. The composition according to any one of Aspects 7-9, wherein at least one of Y6, Y7, Y8, or Y9of formula (II-B) is, independently, chlorine, bromine, or fluorine.

[0149] Aspect 11. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid comprises one or more of compounds (I-A-1)-(I-A-12).PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)12).

[0150] Aspect 12. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid comprises compound (LA-1):

[0151] Aspect 13. The composition according to any one of the preceding Aspects, wherein the mucosal disease comprises an epithelial disease.

[0152] Aspect 14. The composition according to any one of the preceding Aspects, wherein the mucosal disease comprises an intestinal disease.

[0153] Aspect 15. The composition according to Aspect 14, wherein the intestinal disease comprises Crohn’s disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal cancer, infectious colitis, enteritis, or combinations thereof.

[0154] Aspect 16. The composition according to any one of the preceding Aspects, wherein the intestinal disease comprises an inflammatory mucosal disease.

[0155] Aspect 17. The composition according to any one of the preceding Aspects, wherein the composition inhibits HDAC activity, promotes intestinal barrier formation, promotes intestinal barrier formation, promotes wound healing, or combinations thereof.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0156] Aspect 18. The composition according to any one of the preceding Aspects, wherein the short chain fatty acid or the anion thereof is not metabolized, or not substantially metabolized (such as less than 1%), by mucosa as an energy source.

[0157] Aspect 19. A composition for treating an intestinal disease or symptom thereof in a patient, the composition comprising: a short chain fatty acid represented by formula (I- A), or an anion, salt, ester, or prodrug thereof:wherein R1of formula (I- A) is represented by formula (II-B), formula (II-C), or formula (II- D):wherein each of Y6-Y32of formulas (II-B)-(II-D) is, independently, hydrogen, halogen (such as Cl, Br, F, or I), heteroaryl (such as indole), aryl (such as phenyl or naphthyl), hydroxyl (OH), thiol (SH), azide (Ns), amine (NR*2, where each R* is, independently, a hydrogen or a C1-C6 hydrocarbyl), thioether (SR*, where R* is a C1-C6 hydrocarbyl), ether (OR*, where R* is a C1-C6 hydrocarbyl), or ketone (C(O)R*, where R* is a C1-C6 hydrocarbyl), such as hydrogen, indole, chlorine, bromine, fluorine, amine, or hydroxyl, such as hydrogen or chlorine.

[0158] Aspect 20. The composition according to Aspect 19, wherein at least one of Y1- Y32of formulas (II-B)-(II-D) is not hydrogen.

[0159] Aspect 21. The composition according to any one of Aspects 19-20, wherein: R1of formula (I- A) is represented by formula (II-B); and at least one of Y6, Y7, Y8, Y9, Y10, Y11, or Y12of formula (II-B) is, independently, halogen, amine, hydroxyl, thiol, ketone, phenyl, naphthyl, indole, or azide, such as chlorine, bromine, fluorine, amine, indole, or hydroxyl.

[0160] Aspect 22. The composition according to any one of Aspects 19-21, wherein: R1of formula (I- A) is represented by formula (II-B); and at least one of Y6, Y7, Y8, Y9, Y10, Y11, or Y12of formula (II-B) is, independently, chlorine, bromine, or fluorine.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0161] Aspect 23. The composition according to any one of Aspects 19-22, wherein at least one of Y6, Y7, Y8, or Y9of formula (II-B) is, independently, chlorine or bromine.

[0162] Aspect 24. The composition according to any one of Aspects 19-23, wherein the short chain fatty acid comprises compound (I-A-l):

[0163] Aspect 25. The composition according to any one of Aspects 19-24, wherein the intestinal disease comprises Crohn’s disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal cancer, infectious colitis, enteritis, or combinations thereof.

[0164] Aspect 26. The composition according to any one of Aspects 19-25, wherein the composition inhibits HDAC activity, promotes intestinal barrier formation, promotes intestinal barrier formation, promotes wound healing, or combinations thereof.

[0165] Aspect 27. The composition according to any one of Aspects 19-26, wherein the short chain fatty acid or the anion thereof is not metabolized, or not substantially metabolized (such as less than 1%), by mucosa as an energy source.

[0166] Aspect 28. A composition for treating abdominal pain or gastrointestinal pain in a patient, the composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0167] Aspect 29. The composition according to Aspect 28, wherein the composition comprises the composition according to any one of Aspects 1-27.

[0168] Aspect 30. A composition for inhibiting HDAC activity in vitro or in vivo, the composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0169] Aspect 31. The composition according to Aspect 30, wherein the composition comprises the composition according to any one of Aspects 1-29.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)

[0170] Aspect 32. A composition for intestinal barrier formation, intestinal barrier repair, wound healing, or combinations thereof in a patient, the composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0171] Aspect 33. The composition according to Aspect 32, wherein the composition comprises the composition according to any one of Aspects 1-31.

[0172] Aspect 34. A method of treating a mucosal disease or symptom thereof in a patient, the method comprising: administering to a patient a composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0173] Aspect 35. The method according to Aspect 34, wherein the composition comprises a composition according to any one of Aspects 1-33.

[0174] Aspect 36. The method according to any one of Aspects 34-35, wherein an amount of the composition administered to the patient is in a range from about 0.1 to about 10,000 mg / kg body weight daily, such as from about 0.1 to about 10 g / kg body weight daily.

[0175] Aspect 37. A method of treating abdominal pain or gastrointestinal pain in a patient, the method comprising: administering to a patient a composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

[0176] Aspect 38. The method according to Aspect 37, wherein the composition comprises a composition according to any one of Aspects 1-33.

[0177] Aspect 39. The method according to any one of Aspects 37-38, wherein an amount of the composition administered to the patient is in a range from about 0.1 to about 10,000 mg / kg body weight daily, such as from about 0.1 to about 10 g / kg body weight daily.

[0178] To define more clearly the terms used herein, the following definitions are provided. Unless otherwise indicated, the following definitions are applicable to this disclosure. If a term is used in this disclosure but is not specifically defined herein, the definition from the IUPAC Compendium of Chemical Terminology, 2nd Ed (1997), may bePCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) applied, as long as that definition does not conflict with any other disclosure or definition applied herein, or render indefinite or non-enabled any claim to which that definition is applied. To the extent that any definition or usage provided by any document incorporated herein by reference conflicts with the definition or usage provided herein, the definition or usage provided herein controls.

[0179] Generally, groups of elements are indicated using the numbering scheme indicated in the version of the periodic table of elements published in Chemical and Engineering News, 63(5), 27, 1985. In some instances, a group of elements may be indicated using a common name assigned to the group; for example, alkali metals for Group 1 elements, alkaline earth metals for Group 2 elements, transition metals for Group 3-12 elements, and halogens or halides for Group 17 elements.

[0180] When a compound is described herein such that a particular isomer, enantiomer, or diastereomer of the compound is not specified, for example, in a formula or in a chemical name, that description is intended to include each isomer and enantiomer of the compound described individual or in any combination. For example, any general structure, formula, or name presented is also intended to encompass all structural isomers, conformational isomers, regioisomers, stereoisomers (such as enantiomers, diastereomers, and other optical isomers whether in enantiomeric or racemic forms, as well as mixtures of stereoisomers, as the context permits or requires) that may arise from a particular set of substituents, unless indicated otherwise. Thus, a general reference to a compound includes all structural isomers unless specified to the contrary or the context clearly indicates otherwise. For example, reference to a hydrocarbon without specifying a particular isomer (such as butyl) expressly discloses all isomers (such as n-butyl, iso-butyl, sec-butyl, and tert-butyl). For example, reference to a C4 hydrocarbon expressly discloses all isomers thereof.

[0181] As is apparent from the foregoing general description and the specific aspects, while forms of the aspects have been illustrated and described, various modifications may be made without departing from the spirit and scope of the present disclosure. Accordingly, it is not intended that the present disclosure be limited thereby. Likewise, the term “comprising” is considered synonymous with the term “including.” Likewise whenever a formulation, a composition, an element or a group of elements is preceded with the transitional phrase “comprising,” it is understood that we also contemplate the samePCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) formulation, composition or group of elements with transitional phrases “consisting essentially of,” “consisting of,” “selected from the group of consisting of,” or “Is” preceding the recitation of the formulation, composition, element, or elements and vice versa, for example, the terms “comprising,” “consisting essentially of,” “consisting of’ also include the product of the combinations of elements listed after the term.

[0182] References cited herein are incorporated by reference herein in their entirety to indicate the state of the art as of their publication or filing date and it is intended that this information may be employed herein, if desired, to exclude specific aspects that are in the prior art.

[0183] For purposes of this present disclosure, and unless otherwise specified, all numerical values within the detailed description and the claims herein are modified by “about” or “approximately” the indicated value, and consider experimental error and variations that would be expected by a person having ordinary skill in the art. It will be further understood that there are a number of values disclosed therein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. Herein experimental error and experimental variations may refer to ±20% of the stated value, ±15% of the stated value, ±10% of the stated value, ±5% of the stated value, ±3% of the stated value, ±2% of the stated value, or ±1% of the stated value.

[0184] For the sake of brevity, only certain ranges are explicitly disclosed herein. However, ranges from any lower limit may be combined with any upper limit to recite a range not explicitly recited, as well as, ranges from any lower limit may be combined with any other lower limit to recite a range not explicitly recited, in the same way, ranges from any upper limit may be combined with any other upper limit to recite a range not explicitly recited. Additionally, within a range includes every point or individual value between its end points even though not explicitly recited. Thus, every point or individual value may serve as its own lower or upper limit combined with any other point or individual value or any other lower or upper limit, to recite a range not explicitly recited. For example, by disclosing a temperature of from 70°C to 80°C, an intent is to recite individually 70°C, 71 °C, 72°C, 73°C, 74°C, 75°C, 76°C, 77°C, 78°C, 79°C, and 80°C, including any sub-ranges and combinations of sub-ranges encompassed therein such that any of the foregoing numbers may be used singly to describe an open-ended range or in combination to describe a close-PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029) ended range. Moreover, all numerical end points of ranges disclosed herein are approximate, unless excluded by proviso. As a representative example, if one or more operations in the processes described herein may be conducted at a temperature in a range from 10°C to 75°C, this range should be interpreted as encompassing temperatures in a range from “about” 10°C to “about” 75°C. As another example, when a chemical moiety having a certain number of carbon atoms is disclosed or claimed, the intent is to disclose or claim individually every possible number that such a range could encompass, consistent with the disclosure herein. For example, the disclosure that a moiety is a C2-C20 hydrocarbyl group, or in alternative language, a hydrocarbyl group having from 2 to 20 carbon atoms, refers to a moiety that may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 carbon atoms, as well as any range between these two numbers (for example, a C1-C8 hydrocarbyl group), and also including any combination of ranges between these two numbers (for example, a C2 to C4 and a C12 to C16 hydrocarbyl group).

[0185] The indefinite article “a” or “an” shall mean “at least one” unless specified to the contrary or the context clearly indicates otherwise. For example, aspects comprising “a short chain fatty acid” include aspects comprising one, two, or more short chain fatty acids, unless specified to the contrary or the context clearly indicates only one short chain fatty acid is included.

[0186] While the foregoing is directed to aspects of the present disclosure, other and further aspects of the disclosure may be devised without departing from the basic scope thereof, and the scope thereof is determined by the claims that follow.

Claims

PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)ClaimsWhat is claimed is:

1. A composition for treating a mucosal disease or symptom thereof in a patient, the composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

2. The composition according to claim 1 , wherein the composition comprises the anion of the short chain fatty acid.

3. The composition according to claim 1, wherein the short chain fatty acid comprises a short chain fatty acid represented by formula (I- A):OR1A>H(i.a)wherein R1of formula (I-A) is represented by formula (II-A), formula (II-B), formula (II- C), or formula (II-D):wherein each of Y'-Y32of formulas (II-A)-(II-D) is, independently, hydrogen, halogen, such as indole, phenyl, naphthyl, hydroxyl, thiol, azide, amine, thioether, ether, or ketone.

4. The composition according to claim 3, wherein at least one of Y'-Y32of formulas (II-A)-(II-D) is not hydrogen.PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)5. The composition according to claim 1, wherein the short chain fatty acid comprises a short chain fatty acid represented by formula (I- A):wherein R1of formula (I-A) is represented by formula (II-B): wherein at least oneformula (II-B) is halogen, amine, hydroxyl, thiol, ketone, phenyl, naphthyl, indole, or azide.

6. The composition according to claim 5, wherein at least one of Y6, Y7, Y8, Y9, Y10, Y11, or Y12of formula (II-B) is chlorine, bromine, fluorine, amine, or hydroxyl.

7. The composition according to claim 5, wherein at least one of Y6, Y7, Y8, Y9, Y10, Y11, and Y12of formula (II-B) is chlorine.

8. The composition according to claim 5, wherein at least one of Y6, Y7, Y8, or Y9of formula (II-B) is, independently, chlorine, bromine, or fluorine.

9. The composition according to claim 1, wherein the short chain fatty acid comprises one or more of compounds (LA-1)-(I-A-12):PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)10. The composition according to claim 1, wherein the short chain fatty acid comprises compound (I-A-l):

11. The composition according to claim 1, wherein the mucosal disease comprises an intestinal disease.

12. The composition according to claim 11, wherein the intestinal disease comprises Crohn’s disease, ulcerative colitis, irritable bowel syndrome, inflammatory bowel disease, gastrointestinal cancer, infectious colitis, enteritis, or combinations thereof.

13. The composition according to claim 1 , wherein the short chain fatty acid or the anion thereof is not metabolized, or not substantially metabolized, by mucosa as an energy source.

14. The composition according to claim 1, wherein the composition inhibits HDAC activity, promotes intestinal barrier formation, promotes intestinal barrier formation, promotes wound healing, or combinations thereof.

15. A composition for treating an intestinal disease or symptom thereof in a patient, the composition comprising: a short chain fatty acid represented by formula (I-A), or an anion, salt, ester, or prodrug thereof:wherein R1of formula (I-A) is represented by formula (II-B), formula (II-C), or formula (II- D):PCT ApplicationAttorney Docket No.: CUBR-0014PC (2025-029)each of Y6-Y32of formulas (II-B)-(II-D) is, independently, hydrogen, halogen, amine, hydroxyl, thiol, ketone, phenyl, naphthyl, indole, or azide.

16. The composition according to claim 15, wherein at least one of Y'-Y32of formulas (II-A)-(II-D) is not hydrogen.

17. The composition according to claim 15, wherein:R1of formula (I-A) is represented by formula (II-B); and at least one of Y6, Y7, Y8, Y9, Y10, Y11, or Y12of formula (II-B) is chlorine, bromine, or fluorine.

18. The composition according to claim 15, wherein: at least one of Y6, Y7, Y8, or Y9of formula (II-B) is, independently, chlorine or bromine.

19. A method of treating a mucosal disease or symptom thereof in a patient, the method comprising: administering to a patient a composition comprising: a short chain fatty acid, or an anion, salt, ester, or prodrug thereof, the short chain fatty acid comprising a carbon chain and a carboxylic acid group, the carbon chain plus the carbon atom of the carboxylic acid group having from 2 carbon atoms to 6 carbon atoms.

20. The method according to claim 19, wherein an amount of the composition administered to the patient is in a range from about 0.1 to about 10,000 mg / kg body weight daily.

Images