Anti-aging composition, Anti-inflammatory composition, and method for screening aging amelioration substances

Abstract

The purpose of the present invention is to provide a novel anti-aging composition having excellent effects to control, suppress, and ameliorate aging. The purpose of the present invention is also to provide a novel screening method with which an aging amelioration substance can be efficiently discovered.　An anti-aging composition according to the present invention contains one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p. This anti-aging composition is preferably used for suppressing cell aging, especially for suppressing and ameliorating skin cell aging.

Description

Composition for anti-aging, composition for anti-inflammation, and method for screening aging-improving substances

[0001] The present invention relates to a composition for anti-aging, a composition for anti-inflammation, and a method for screening aging-improving substances.

[0002] Skin aging is a complex biological process combined with endogenous and exogenous factors. As the largest organ in the human body, the skin functions as a major barrier against environmental attacks and plays an important role in aesthetic appearance and self-recognition. One of the important aspects of skin aging is the aging of dermal fibroblasts. These dermal fibroblasts are essential for maintaining the structural integrity and regenerative capacity of the skin.

[0003] Exosomes are extracellular vesicles (EVs) of 30 - 150 nm secreted from most cell types. They play an important role in cell communication by transferring bioactive molecules such as proteins, lipids, and nucleic acids (including miRNAs) to recipient cells. This transfer mechanism of exosomes promotes various physiological and pathological processes such as immune response, cancer progression, and tissue regeneration. Exosomes obtained from adipose tissue-derived mesenchymal stem cells (AdMSCs) (AdMSC-Exos) are considered to have great potential in skin health, but the details are not known.

[0004] When components such as glycogen and tetrapeptide act on adipose-derived mesenchymal stem cells, changes are induced in AdMSC-Exos, which can become exosomes that suppress the expression of β-galactosidase, an indicator of cell aging, and improve aging characteristics in fibroblasts and the like. Furthermore, it is known that the secretion of this AdMSC-Exos is promoted (Patent Document 1), but this mechanism has not been clarified.

[0005] JP 2021 - 187787

[0006] An object of the present invention is to provide a novel composition for anti-aging, which is excellent in the effects of controlling, suppressing, and improving aging. Another object is to provide a novel screening method capable of efficiently finding aging-improving substances.

[0007] The inventors had previously discovered that AdMSC-Exos, derived from adipose-derived mesenchymal stem cells treated with glycogen and a specific tetrapeptide, exhibits excellent anti-aging effects, but the mechanism by which this excellent anti-aging effect is achieved was unknown (Patent Document 1). As a result of diligent research, the inventors discovered for the first time miRNAs whose expression is increased in the aforementioned AdMSC-Exos. Furthermore, they found that these miRNAs regulate the expression of aging-related genes in dermal fibroblasts, promoting cell proliferation, suppressing aging-related secretory phenotypes (SASP), and promoting the production of extracellular matrix components. Based on these findings, the inventors have succeeded in developing a novel screening method that can efficiently find novel anti-aging compositions and aging-improving substances that are excellent in controlling, suppressing, and improving aging.

[0008] In other words, the gist of the present invention is as follows: [1] An anti-aging composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p. [2] The anti-aging composition according to [1] for suppressing cellular senescence. [3] The anti-aging composition according to [2], wherein the cellular senescence is skin cell senescence. [4] The anti-aging composition according to [3] for improving skin senescence. [5] An anti-inflammatory composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p. [6] The anti-inflammatory composition according to [5] for suppressing inflammation in skin cells. [7] A method for screening anti-aging substances, characterized by using the change in the amount of one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p in cells before and after treatment with a test substance as an indicator. [8] A method for imparting an anti-aging effect, comprising administering a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p to a test subject. [9] The method according to [8], wherein the anti-aging effect is an effect of suppressing cellular senescence.

[10] The method according to [9], wherein the cellular senescence is skin cell senescence.

[11] A method for treating an inflammatory disease, comprising administering a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p to a test subject.

[12] The method according to

[11] , wherein the inflammatory disease is an inflammatory disease of the skin.

[13] A method for imparting an anti-inflammatory effect, comprising administering to a subject a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p.

[14] The method according to

[13] , wherein the anti-inflammatory effect is an anti-inflammatory effect on the skin.

[0009] The anti-aging composition of the present invention can control the expression of aging-related genes in cells, thereby promoting cell proliferation, suppressing aging-related secretory phenotypes (SASPs), and promoting the production of extracellular matrix components, thereby suppressing and improving cellular aging. Furthermore, the screening method for aging-improving substances of the present invention uses the increase or decrease of miRNAs that can control the expression of aging-related genes as an indicator, making it possible to efficiently find substances that have excellent effects in suppressing and improving cellular aging. The aging-improving substances found by the method of the present invention can control symptoms related to skin aging and are expected to have excellent effects against symptoms that occur as skin aging progresses.

[0010] This figure shows the associated cellular processes of the three selected miRNAs. This figure compares the gene expression of CDKN1A(p21) in NHDF of P2 and P25. This figure shows the effect of transfection of various miRNAs on the gene expression of CDKN1A(p21). This figure compares the β-galactosidase activity in NHDF of P2 and P25. This figure shows the effect of transfection of various miRNAs on β-galactosidase activity. This figure compares the cell proliferation rate in NHDF of P2 and P25. This figure shows the effect of transfection of various miRNAs on the cell proliferation rate. This figure shows the effect of transfection of various miRNAs on the expression of SIRT1. This figure shows the effect of transfection of various miRNAs on the expression of inflammatory cytokine (IL8). This figure shows the effect of transfection of various miRNAs on the expression of inflammatory cytokine (IL6). This figure shows the effect of transfection of miR-520d-3p on the expression of extracellular matrix components (elastin) in NHDF of P25. This figure shows the effect of transfection with miR-520d-3p on the expression of extracellular matrix components (fibrillin) of NHDF in P25. This figure shows the principal component analysis plot of RNA-Seq analysis. This figure shows a heatmap of the top 2000 genes in the RNA-Seq dataset. This Venn diagram shows the overlap of increased and decreased expression genes in DGE analysis datasets between samples. This figure shows the results of pathway analysis (bubble chart of the most relevant Reactome pathway identified from the IPA core analysis function). This figure shows IPA comparative analysis between DGE analysis datasets. This figure shows a heatmap of the top 60 genes related to aging pathways in the RNA-Seq dataset. This figure shows a predictive model of anti-aging mechanisms.

[0011] The embodiments for carrying out the present invention will be described in detail below. However, the present invention is not limited to the following embodiments. Unless otherwise specified, terms used herein shall be interpreted in the sense commonly used in the art.

[0012] <Anti-aging composition> The anti-aging composition of the present invention is characterized by containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p. miR-520d-3p, miR-373-5p, and let-7i-5p can control the expression of aging-related genes in cells and can suppress and improve cellular aging by promoting cell proliferation, suppressing aging-related secretory phenotypes (SASP), and promoting the production of extracellular matrix components. Therefore, the anti-aging composition of the present invention containing these miRNAs exhibits excellent anti-aging and improvement effects on cells. In particular, it exhibits a more excellent effect on skin cell aging. The anti-aging composition of the present invention can be suitably used to improve skin aging.

[0013] miR-520d-3p is a miRNA assigned the accession number MIMAT0002856 in miRBase (http: / / www.mirbase.org / ), and its base sequence is "AAAGUGCUUCUCUUUGGUGGGU" (Sequence ID 1).

[0014] miR-373-5p is a miRNA assigned accession number MIMAT0000725 in miRBase (http: / / www.mirbase.org / ), and its base sequence is "ACUCAAAAAUGGGGGGCCUUUCC" (Sequence ID 2).

[0015] let-7i-5p is a miRNA assigned accession number MIMAT0000415 in miRBase (http: / / www.mirbase.org / ), and its base sequence is "UGAGGUAGUAGUUUUGUGCUGUU" (Sequence ID 3).

[0016] The anti-aging composition of the present invention may contain one of miR-520d-3p, miR-373-5p, or let-7i-5p, or two of these, or all three. While all three miR-520d-3p, miR-373-5p, or let-7i-5p contained in the anti-aging composition of the present invention exhibit excellent anti-aging effects on cells, miR-520d-3p exhibits a particularly superior effect. Therefore, it is preferable that the anti-aging composition of the present invention contains at least miR-520d-3p.

[0017] In the anti-aging composition of the present invention, miR-520d-3p, miR-373-5p, and let-7i-5p may be modified for purposes such as suppressing degradation when administered to a living organism.

[0018] If necessary, miR-520d-3p, miR-373-5p, and let-7i-5p can be encapsulated in microcapsules (such as hydroxymethylcellulose, gelatin, or poly[methylmethacrylate] microcapsules) or incorporated into colloidal drug delivery systems (such as liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules). Furthermore, the formulation-acceptable carrier used is appropriately selected depending on the dosage form.

[0019] The anti-aging composition of the present invention may contain one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p as extracellular vesicles such as exosomes containing these miRNAs.

[0020] The anti-aging composition of the present invention may contain formulation-acceptable materials such as preservatives and stabilizers. Formulation-acceptable means that the material itself may have the above-mentioned anti-aging effect, or it may not have the above-mentioned effect, and is a formulation-acceptable material that can be administered and applied together with the above-mentioned anti-aging composition.

[0021] Examples of materials that are acceptable in formulation include carriers and / or diluents and / or excipients, such as sterile water, physiological saline, preservatives, stabilizers, excipients, buffers, antiseptics, surfactants, chelating agents (EDTA, etc.), and binders.

[0022] When the anti-aging composition of the present invention is prepared as an aqueous solution for injection, it may be used in combination with, for example, physiological saline, an isotonic solution containing glucose or other adjuvants (e.g., D-sorbitol, D-mannose, D-mannitol, sodium chloride), a suitable solubilizer, such as alcohol (ethanol, etc.), polyalcohol (propylene glycol, PEG, etc.), or a nonionic surfactant (polysorbate 80, HCO-50). It may also contain diluents, solubilizers, pH adjusters, analgesics, sulfur-containing reducing agents, antioxidants, etc.

[0023] The anti-aging composition of the present invention can be applied in the form of pharmaceuticals, quasi-drugs, cosmetics, etc., and can be applied orally or parenterally, systemically or topically. Furthermore, it may be applied by methods such as transfection to efficiently introduce it into tissues or cells.

[0024] The anti-aging composition of the present invention may also be in the form of a kit used for anti-aging, comprising separately one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p, and reagents for transfection.

[0025] <Anti-inflammatory composition> The anti-inflammatory composition of the present invention is characterized by containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p. It is known that when cells age, they enter a chronic inflammatory state (inflammatory aging), and the anti-inflammatory composition of the present invention, which has an anti-inflammatory effect, can suppress inflammation in cells such as skin cells, and is therefore thought to be able to improve and suppress cellular aging, especially skin cell aging.

[0026] Since the composition of the anti-inflammatory composition of the present invention is the same as that of the anti-aging composition described above, the description in the section on the anti-aging composition can be applied directly.

[0027] <Method for imparting anti-aging effects> The method for imparting anti-aging effects according to the present invention is a method for administering to a subject a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p. According to the method of the present invention, it is possible to control the expression of aging-related genes in the subject's cells, particularly skin cells, and to suppress and improve cellular senescence by promoting cell proliferation, suppressing senescence-related secretory phenotype (SASP), and promoting the production of extracellular matrix components.

[0028] Since the composition of a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p is the same as that of the anti-aging composition described above, the description in the section on anti-aging compositions can be applied directly.

[0029] <Method for treating inflammatory diseases and method for imparting anti-inflammatory effects> The method for treating inflammatory diseases and the method for imparting anti-inflammatory effects according to the present invention are methods comprising administering a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p to a subject. It is known that when cells age, they enter a chronic inflammatory state (inflammatory senescence), and according to the method of the present invention, inflammation in cells such as skin cells can be suppressed, an anti-inflammatory effect can be imparted to the subject, and inflammatory diseases can be treated. Furthermore, it is thought that cellular senescence, especially skin cell senescence, can be improved and suppressed.

[0030] The composition of a composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p is the same as that of the anti-aging composition and anti-inflammatory composition described above; therefore, the descriptions in the sections on anti-aging composition and anti-inflammatory composition can be applied directly.

[0031] <Screening Method for Anti-Aging Substances> The present invention's screening method for anti-aging substances is characterized by using the change in the amount of one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p in the cells before and after treating the cells with the test substance as an indicator.

[0032] The screening method for aging-improving substances according to this embodiment includes: (i) a step of treating cells with a test substance or a negative control substance; (ii) a step of measuring the amount of one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p in the cells treated in step (i); and (iii) a step of comparing the measured values ​​of cells treated with the test substance obtained in step (ii) with those of cells treated with the negative control substance, and determining that the test substance is an aging-improving substance if the measured value of cells treated with the test substance is higher than the measured value of cells treated with the negative control substance.

[0033] In step (i) above, when processing the cells, other components other than the test substance or negative target substance may be added during processing. Examples of such other components include glycogen and / or tetrapeptides, and the tetrapeptide of Sequence ID No. 4 is preferred.

[0034] Mesenchymal stem cells are preferred as the cells, and adipose-derived mesenchymal stem cells are more preferred. As for the method of measuring the amount of miRNA in step (ii), a method known to those skilled in the art can be used. For example, miRNA can be extracted from the cells treated in step (i), and the amount of miR-520d-3p, miR-373-5p, or let-7i-5p can be measured. The qRT-PCR method can be used to measure the amount of miR-520d-3p, miR-373-5p, or let-7i-5p.

[0035] According to the method of the present invention, it is possible to find health care materials, pharmaceutical materials, cosmetic materials, etc. that improve and prevent aging, suppress the progression of aging, or promote the reversal (rejuvenation) of aging. In addition, the miRNA measured in the method corresponds to the miRNA contained in the anti-aging composition of the present invention described above, and the specific description in the section of the anti-aging composition can be applied.

[0036] Hereinafter, the present invention will be specifically described based on test examples, but the present invention is not limited thereto. In addition, the blending amounts in the following test examples and the like indicate mass% unless otherwise specified.

[0037] In the present example, the materials and methods described below were used unless otherwise specified in each test example.

[0038] <Materials and Methods> 1. Cell culture (1) Fibroblast culture: KF-4009 (Kurabo, Osaka, Japan) was used as normal human skin fibroblasts (NHDFs). Passage 2 (P2) was used and regularly passaged up to passage 25 (P25) to induce replicative senescence. Regarding the cell viability, it was evaluated using 0.4% Trypan Blue (Thermo Fisher Scientific, 15250-061), and only cells with a viability of 95% or more were used in the tests described below.

[0039] (2) Medium: Dulbecco's Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum and 1% antibiotics and antifungal agents was used.

[0040] (3) Cell culture conditions: Cultured at 37 °C in a ２ 5% CO incubator.

[0041] 2. Exosome recovery and miRNA microarray (1) Medium: Dulbecco's Modified Eagle Medium F12 (DMEM F12) (Gibco, 11330-032) supplemented with 10% exosome-depleted FBS (Gibco, A2720801) was used.

[0042] (2) Cells: Human adipose-derived mesenchymal stem cells (AdMSC) (Lifeline Cell Technology, FC-0034) were used. After subculturing up to passage 4 (P4), cells induced for exosome production were used.

[0043] (3) Pre-culture: Cells were seeded at a density of 5000 cells / cm 2 in a CellBIND (registered trademark) 75 cm 2 flask (Corning, 3290), and cultured for 4 days in a humidified environment at 37 °C and 5% CO ２ .

[0044] (4) Treatment: Cells were cultured for 48 hours in a medium supplemented with 0.01% tetrapeptide-5 and 1% glycogen under the same culture conditions as pre-culture.

[0045] (5) Exosome recovery: The medium was centrifuged at 2000 g for 10 minutes to recover the supernatant. The recovered supernatant was concentrated using an Amicon Ultra-15 centrifugal filter unit (Merck, C7715) and adjusted with 1.5 mL of D-PBS (-) (Kojin Bio, 16220015).

[0046] (6) Exosome extraction and counting: Exosomes were extracted using EVSecond L70 (GL Sciences, 5010-21395) and counted using NanoSight NS300 (Quantum Design, NS300).

[0047] (7) RNA extraction: Total RNA containing miRNA was extracted using an Exosomal RNA Isolation Kit (Norgen Biotek, 58000). After confirming the quantity and quality of the extracted RNA using a NanoDrop One micro-spectrophotometer (Thermo Fisher Scientific), microarray analysis was performed.

[0048] 3. Transfection (1) Pre-culture: Normal human dermal fibroblasts (NHDF) were seeded at 2222 cells / cm 2 in a T75 flask (Corning, 430641U) and cultured until 80% confluent.

[0049] (2) Cell washing and seeding: The cells were washed with D-PBS (-) (Kojin Bio, 16220015), treated with 0.05% trypsin-EDTA (Gibco, 25200072), and seeded at a rate of 15,800 cells / cm² on a Costar® 24-Well Cell Culture Plate (Corning Incorporated, 3526). 2 The seeds were sown in this manner.

[0050] (3) Transfection: After culturing the cells for 24 hours, transfection was performed using the Lipofectamine® RNAiMAX Transfection Reagent kit (Thermo Fisher Scientific, 13778075). The miR-373-5p, miR-520d-3p, let-7i-5p, and scrambled miRNAs (Thermo Fisher Scientific) used for transfection were prepared in antibiotic-free culture medium to a final concentration of 50 nM.

[0051] 4. Gene Expression Analysis (1) Cell Lysis and RNA Extraction: Cell lysis was performed 48 and 72 hours after transfection, and total RNA was extracted using Maxwell® RSC simplyRNA Tissue Kit (Promega, AS1340) and Maxwell® RSC 48 (Promega, AS8500). The quantity and quality of the extracted RNA were confirmed using a NanoDrop One micro-spectrophotometer (Thermo Fisher Scientific).

[0052] (2) qPCR: cDNA synthesis was performed using 250 ng of total RNA with ReverTra Ace® qPCR RT Master Mix with gDNA Remover (Toyobo, FSQ-301). The qPCR reaction was performed using QuantStudio® 7 Flex Real-Time PCR System (Thermo Fisher Scientific, 4485701) with THUNDERBIRD® SYBR® qPCR Mix (Toyobo, QPS-201). The PCR conditions were 94°C for 20 seconds, 95°C for 2 seconds, 60°C for 5 seconds, and 72°C for 30 seconds for 45 cycles. A melt curve was drawn after each run to control the quality of the qPCR reaction. Gene expression levels were normalized to GAPDH, and relative expression levels were calculated using the 2^(-ΔΔCT) method.

[0053] (3) RNA-seq: A library was prepared from 50 ng of total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (Illumina). Sequencing was performed using NovaSeq 6000 (Illumina), generating 150 bp paired-end reads. Raw reads were processed using fastp (version 0.23.4) to remove adapters and low-quality sequences. After quality checks, the reads were aligned to the human genome (GRCh38) using the STAR aligner (version 2.7.11a). Gene expression levels were quantified using featureCounts from the Subread package, and differential expression analysis was performed using edgeR. Differential expression between groups was tested using edgeR, and genes with an adjusted p-value < 0.05 were considered to be significantly differentially expressed. All statistical analyses were performed using R (version 4.3.2). Heatmaps and other visual data were created using iDEP 2.01.

[0054] 5. Senescence-related β-galactosidase assay and cell count assay (1) Senescence-related β-galactosidase assay: 48 hours after transfection, cell count was measured using the WST-8 assay with Cell Counting Kit-8 (Dojindo, CK04), and formazan product was measured using SpectraMax ABS (Molecular devices). The cells were then washed twice with PBS and fixed in 4% paraformaldehyde phosphate buffer (Fujifilm, 163-20145) at room temperature for 5 minutes. Senescence-related β-galactosidase staining was performed using Cellular Senescence Plate Assay Kit-SPiDER-βGal (Dojindo, SG05) to evaluate cellular senescence.

[0055] 6. Pathway Analysis (Ingenuity Pathway Analysis (IPA)) (1) QIAGEN Ingenuity Pathway Analysis: To elucidate the biological significance of differentially expressed genes and miRNAs, pathway analysis was performed using QIAGEN's Ingenuity Pathway Analysis (IPA) software. The core analysis function was performed on the DGE dataset with the Expr Log Ratio cutoff set to -0.7 and 0.7, and the FDR cutoff set to 0.05. The most relevant Reactome pathway was displayed in a bubble chart. The differences in trends among the many related pathways obtained in the core analysis were compared using the comparative analysis function.

[0056] <Example Tests> [Example Test 1] Identification of miRNAs whose expression was enhanced in AdMSC-Exos by tetrapeptide treatment (miRNA microarray analysis) Whole-genome miRNA expression analysis was performed using microarray technology on adipose-derived human mesenchymal stem cells (AdMSCs) cultured in a medium supplemented with 0.01% tetrapeptide-5 (SEQ ID NO: 4) and 1% glycogen. A control prepared under the same conditions, except for culture in a medium without tetrapeptide-5 and glycogen, was used for comparison. As a result, treatment with tetrapeptide-5 and glycogen increased the expression of 136 miRNAs and decreased the expression of 26 miRNAs. Analysis of the miRNA dataset for the 136 miRNAs whose expression was increased revealed that many of them are miRNAs involved in biological processes related to aging and cellular function, such as aging, cell proliferation, epidermal growth factor receptor (EGFR) signaling, cellular response to stress, promotion of cell proliferation, and UV response. Therefore, using Agilent data analysis, we investigated the involvement of miRNAs with increased expression in regulating the expression of major extracellular matrix (ECM) components such as COL1A1, COL4A1, MMP1, TIMP1, and MMP12. After an extensive literature review, we selected hsa-miR-373-5p (MIMAT0000725), hsa-miR-520d-3p (MIMAT0002856), and hsa-let-7i-5p (MIMAT0000415) as miRNAs deeply involved in the aging pathway (Figure 1).

[0057] [Test Example 2] Examination of the cellular senescence inhibitory effect of the miRNA selected in Test Example 1. Normal human fibroblasts (NHDF) in passage 2 (P2) or passage 25 (P25) were transfected with miR-373-5p, miR-520d-3p, let-7i-5p, and scrambled miRNA. CDKN1A gene expression (encoding p21CIP1), senescence-related β-galactosidase activity, cell proliferation rate, and SIRT1 expression were evaluated. The results are shown in Figures 2A-G. The "mock" in the figures represents the control transfected with scrambled miRNA.

[0058] As shown in Figure 2A, the CDKN1A gene (p21), a cell cycle regulator associated with aging, showed higher expression in P25 NHDF compared to P2 NHDF. As shown in Figure 2B, CDKN1A gene (p21) expression was reduced in P25 NHDF transfected with miR-373-5p, miR-520d-3p, and let-7i-5p compared to mock P25 NHDF.

[0059] As shown in Figure 2C, β-galactosidase activity, an indicator of cellular senescence, was higher in P25 NHDF compared to P2 NHDF. As shown in Figure 2D, β-galactosidase activity was decreased in P25 NHDF transfected with miR-373-5p, miR-520d-3p, and let-7i-5p compared to mock P25 NHDF.

[0060] As shown in Figure 2E, the cell proliferation rate, which decreases more significantly in aging cells, was lower in P25 NHDF compared to P2 NHDF. As shown in Figure 2F, the cell proliferation rate was increased in P25 NHDF transfected with miR-373-5p, miR-520d-3p, and let-7i-5p compared to a mock P25 NHDF.

[0061] As shown in Figure 2G, SIRT1 expression, which decreases in aged mice, was increased in P25 NHDF transfected with miR-520d-3p and let-7i-5p compared to mock P25 NHDF.

[0062] Based on these results, it can be said that miR-373-5p, miR-520d-3p, and let-7i-5p exhibit excellent anti-aging effects on cells. In particular, miR-520d-3p shows even better anti-aging effects.

[0063] [Test Example 3] Examination of the inhibitory effect of miRNAs selected in Test Example 1 on inflammatory cytokine gene expression. Normal human dermal fibroblasts (NHDF) in passage 2 (P2) or passage 25 (P25) were transfected with miR-373-5p, miR-520d-3p, let-7i-5p, and scrambled miRNA, and the gene expression levels of interleukin-8 (IL8) and interleukin-6 (IL6) were evaluated by qPCR analysis. The results are shown in Figures 3A and 3B, respectively. In the figures, "mock" represents the control transfected with scrambled miRNA.

[0064] Compared to mock P25 NHDF, IL8 (Figure 3A) and IL6 (Figure 3B) expression was suppressed in P25 NHDF transfected with miR-373-5p, miR-520d-3p, and let-7i-5p. These results indicate that miR-373-5p, miR-520d-3p, and let-7i-5p have anti-inflammatory effects on cells. It is known that cells enter a chronic inflammatory state as they age (inflammatory senescence), and it is thought that miR-373-5p, miR-520d-3p, and let-7i-5p, which have anti-inflammatory effects, can improve or suppress cellular senescence.

[0065] [Test Example 4] Investigation of the effect of miR-520d-3p on enhancing the expression of extracellular matrix (ECM) component genes. Normal human dermal fibroblasts (NHDF) in passage 25 (P25) were transfected with miR-520d-3p and scrambled miRNA, and the expression levels of elastin (ELN) and fibrillin-1 (FBN1) were evaluated by qPCR analysis. The results are shown in Figures 4A and 4B, respectively. In the figures, "mock" represents the control transfected with scrambled miRNA.

[0066] Compared to the mock, NHDF transfected with miR-520d-3p showed increased elastin expression (Figure 4A) and increased fibrillin-1 expression (Figure 4B). These results indicate that miR-520d-3p has the effect of promoting the expression of extracellular matrix (ECM) components that are degraded in senescent cells.

[0067] [Test Example 5] Target Analysis of Aging Inhibition by miR-520d-3p (Transcriptome Analysis, Pathway Analysis) Normal human dermal fibroblasts (NHDF) at passage 25 (P25) were transfected with miR-520d-3p (P25_miR), and RNA sequencing was performed. For comparison, scrambled miRNA was transfected into NHDF at passage 2 (P2) or passage 25 (P25) (P2_mock, P25_mock).

[0068] Principal component analysis (PCA) clearly clustered the three sample groups, revealing distinct gene expression profiles (Figure 5A). Next, heatmaps of the top 2000 genes from the RNA-seq dataset were created, and significant transcriptomics variations were observed in the three sample groups (Figure 5B). Therefore, for two combinations, P25_mock and P2_mock, and P25_miR and P25_mock, the number of genes with increased (Up) or decreased (Down) expression in the differential gene expression (DGE) analysis dataset for each group was examined (Figure 5C).

[0069] Next, pathway analysis using QIAGEN Ingenuity Pathway Analysis (IPA) revealed that many pathways whose expression was downregulated in P25_mock were related to the cell cycle and DNA repair (Figure 6A). These pathways were increased in expression in P25_miR, and further comparison of these two DGE datasets showed a reversal in the z-score trends of cell cycle and aging-related pathways. Therefore, it was suggested that miR-520d-3p suppresses and improves phenomena caused by the progression of aging (Figure 6B).

[0070] Next, heatmaps were created for the expression patterns of the top 60 genes associated with aging in the RNA-seq dataset for three sample groups. In P25_miR, the expression of aging-related genes, including CDKN1A, CDKN2B, RBL2, and their upstream regulator TGFBR2, was significantly suppressed (Figure 7A). TGFBR2, which showed the most significant decrease in expression, is a major regulator of cyclin-dependent kinase inhibitors (CDKIs), suggesting that it is a major target of the anti-aging effect of miR-520d-3p. Furthermore, since PI3CA promotes CDKN1A expression by activating TP53 as a component of the PI3K / AKT signaling pathway, the decrease in PI3CA and CDKN1A expression in P25_miR in this study is consistent, suggesting that PI3CA is a major target of miR-520d-3p (Figure 7B). These findings suggest that miR-520d-3p suppresses cellular senescence through direct and indirect inhibition of CDKIs and Rb proteins via the TGF-β and PI3K / AKT signaling pathways.

[0071] The anti-aging composition of the present invention can control the expression of aging-related genes in cells, thereby suppressing and improving cellular aging by promoting cell proliferation, inhibiting aging-related secretory phenotypes (SASP), and promoting the production of extracellular matrix components. Furthermore, the screening method for aging-improving substances of the present invention uses the increase or decrease of miRNAs that can control the expression of aging-related genes as an indicator, making it possible to efficiently find substances that have excellent effects in suppressing and improving cellular aging. The aging-improving substances found by the method of the present invention can control symptoms related to skin aging and are expected to have excellent effects against symptoms that occur as skin aging progresses.

Claims

1. An anti-aging composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p.

2. The anti-aging composition according to claim 1 for suppressing cellular senescence.

3. The anti-aging composition according to claim 2, wherein the cellular senescence is skin cell senescence.

4. The anti-aging composition according to claim 3 for improving skin aging.

5. An anti-inflammatory composition containing one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p.

6. The anti-inflammatory composition according to claim 5 for suppressing inflammation in skin cells.

7. A screening method for anti-aging substances, characterized by using the change in the amount of one or more miRNAs selected from the group consisting of miR-520d-3p, miR-373-5p, and let-7i-5p in the cells before and after treatment with the test substance as an indicator.

Images