Acceleration of drug release from poly(ester urea)s using additives
Electrospun poly(ester urea) nanofibers with sodium bicarbonate enhance drug delivery, addressing systemic limitations of analgesics by providing rapid, localized pain relief and sustained drug concentrations for acute pain management.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2026-03-19
AI Technical Summary
Current pain management strategies for acute pain, such as postoperative pain, are inadequate due to limitations in systemic administration of analgesics, including NSAIDs, local anesthetics, and opioids, which result in off-target effects, limited bioavailability, and systemic toxicity, necessitating a more effective and localized drug delivery system.
A drug delivery system using electrospun poly(ester urea) nanofibers loaded with analgesics or NSAIDs, enhanced by sodium bicarbonate as an additive during electrospinning, to increase porosity and surface-to-volume ratio, allowing for tunable drug release kinetics.
The system provides rapid, localized pain relief, preserves patient mobility, and reduces central sensitization risk by achieving sustained drug delivery exceeding three days with enhanced drug concentrations at the site of injury.
Smart Images

Figure US2025037137_19032026_PF_FP_ABST
Abstract
Description
ACCELERATION OFDRUGRELEASE FROM POLY(ESTER UREA)S USING ADDITIVES STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT SUPPORT
[0001] This invention was made with government support under W81XWH-15-1-0718 awarded by the U.S. Department of Defense (DOD). The government has certain rights in the invention. CROSS REFERENCE TO RELATED APPLICATIONS
[0002] This application claims the benefit of U.S. provisional patent application serial number 63 / 693,530 entitled “Acceleration of Drug Release from Poly(Ester Urea)S Using Additives,” filed September 11, 2024, and incorporated herein by reference in its entirety. SEQUENCE LISTING
[0003] The Sequence Listing file entitled “DUK.P.WO0013_Sequence_Listing” having a size of 8,843 bytes and creation date of July 2, 2025, that was electronically filed with the patent application is incorporated herein by reference in its entirety. FIELD OF THE INVENTION
[0004] One or more embodiments of the present invention relates to a drug delivery. In certain embodiments, the present invention is directed to an effective, tunable, and local drug delivery system using electrospun poly(ester urea) nanofibers. BACKGROUND OF THE INVENTION
[0005] Deployment of acute pain management to casualty combat care battlefield environments remains extremely challenging given the varied pain management needs, as well as the limited availability of medical professionals to administer analgesics. Despite wholistic advances in understanding molecular interactions and available pharmaceuticals, postoperative pain management remains challenging. More than 80% of patients who undergo surgery reportexperiencing acute pain following the procedure with less than half reporting adequate postoperative analgesia.
[0006] Current clinical pain management strategies are reliant on the systemic administration of analgesics, including non-steroidal anti-inflammatory drugs (NSAIDs), acetaminophen, local anesthetics, and opioids. However, each class has significant limitations: NSAIDs and acetaminophen generally lack sufficient potency for moderate to severe pain, locally administered anesthetics are constrained by their short half-lives, and opioids possess substantial risks of adverse effects, including respiratory depression, tolerance, diversion and addiction. Alternative pain management approaches that offer extended pain relief with minimal long-term systemic toxicity and dependency risks are needed.
[0007] The current standard of care for postoperative analgesia, for example, is the prescription of orally dosed medication that patients take on an as-needed basis. While convenient, economical and compliant to existing distribution and reimbursement models, this practice requires the patient to determine the frequency of dosing for comfort and healing and can lead to diversion. Additionally, oral administration of any active pharmaceutical ingredient (API) results in systemic biodistribution, impacting not only the injured or target tissues, but also all other healthy tissues in the body and is an inefficient use of drug. Moreover, systemically administered drugs go through the gastrointestinal tract and undergo first-pass hepatic metabolism, which significantly reduces bioavailability. (See, e.g., Antimisiaris SG, Marazioti A, Kannavou M, Natsaridis E, Gkartziou F, Kogkos G, et al. Overcoming barriers by local drug delivery with liposomes. Advanced Drug Delivery Reviews. 2021;174:53-86 and Magill E, Demartis S, Gavini E, Permana AD, Thakur RRS, Adrianto MF, et al. Solid implantable devices for sustained drug delivery. Advanced Drug Delivery Reviews. 2023;199:114950, the disclosures of which are incorporated herein by reference in their entirety). The off-target effects of potent APIs for pain management, especially when misused, are detrimental to patient health and can have significant lasting effects.
[0008] Localized drug delivery can be leveraged to enhance the therapeutic performance of agents typically considered suboptimal for moderate to severe pain (e.g., NSAIDs) to achieve superior pain management. It is a desirable alternative to systemic drug delivery (e.g., oral, intravenous) as it enables greater drug concentration at the site of actions due to reduced systemic exposure metabolism and clearance. (See, e.g., Antimisiaris SG, Marazioti A, Kannavou M,Natsaridis E, Gkartziou F, Kogkos G, et al. Overcoming barriers by local drug delivery with liposomes. Advanced Drug Delivery Reviews. 2021;174:53-86 and Magill E, Demartis S, Gavini E, Permana AD, Thakur RRS, Adrianto MF, et al. Solid implantable devices for sustained drug delivery. Advanced Drug Delivery Reviews. 2023;199:114950, the disclosures of which are incorporated herein by reference in their entirety). Specialized polymers and excipients are key to any localized delivery strategy.
[0009] One promising solution to postoperative pain management is to encapsulate analgesics or anesthetics into implantable, biodegradable controlled delivery matrices such that the API could be provided locally for a pre-programmed amount of time as a precision medicine. Precise modulation of the drug release kinetics is crucial to achieving therapeutic efficacy, especially in pain management applications. (See, e.g., Brigham NC, Ji RR, Becker ML. Degradable polymeric vehicles for postoperative pain management. Nat Commun. 2021;12:1367, the disclosure of which is incorporated herein by reference in its entirety).The release profiles of most APIs can be tuned with variations in the polymer composition, architecture (e.g., end groups, branching, crosslinking), or chain length. Additionally, polymers can be fabricated into a wide range of morphologies such as thin films, fibers, particles, hydrogels, and 3D-printed scaffolds; this allows for delivery platforms tailored to the specific clinical needs. (See, e.g., Pei Y, Wang J, Khaliq NU, Meng F, Oucherif KA, Xue J, et al. Development of poly(lactide-co-glycolide) microparticles for sustained delivery of meloxicam. Journal of Controlled Release.2023;353:823- 31; Cheng H-T, Huang H-C, Lee T-Y, Liao Y-H, Sheng Y-H, Jin P-R, et al. Delivery of sorafenib by myofibroblast-targeted nanoparticles for the treatment of renal fibrosis. Journal of Controlled Release.2022;346:169-79; Wang H, Monroe MK, Wang F, Sun M, Flexner C, Cui H. Constructing Antiretroviral Supramolecular Polymers as Long-Acting Injectables through Rational Design of Drug Amphiphiles with Alternating Antiretroviral-Based and Hydrophobic Residues. Journal of the American Chemical Society. 2023;145:21293-302; and Dahl DK, Srinivasan P, Janusziewicz R, King JL, Shrivastava R, Zhang J, et al. Next-generation 3D printed multipurpose prevention intravaginal ring for prevention of HIV, HSV-2, and unintended pregnancy. Journal of Controlled Release. 2024;376:1209-24, the disclosures of which are incorporated herein by reference in their entirety). Thereafter, the device would degrade and be resorbed by the host and a secondary procedure for removal would not be necessary.
[0010] Using this approach, many of the common adverse effects of pain medication (e.g., gastrointestinal issues of NSAIDs, diversion) would be limited as the API would only be exposed to the implantation tissue and the vasculature in its path to metabolic excretion. In order to properly design such a device, it is important to consider the biological processes that will be aided or impeded, and to ensure that no additional harm or complications will be brought on by the device. These requirements will be contingent upon the (i) polymer used, (ii) API for targeting biological processes, and (iii) overall matrix design.
[0011] Polymers used for long-term delivery applications should degrade into non-toxic, byproducts to ensure safety and minimize adverse biological responses. (See, e.g., Brigham NC, Ji RR, Becker ML. Degradable polymeric vehicles for postoperative pain management. Nat Commun.2021;12:1367, the disclosure of which is incorporated herein by reference in its entirety). Both synthetic polymers such as poly(lactic-co-glycolic) acid (PLGA) (See, e.g., Pei Y, Wang J, Khaliq NU, Meng F, Oucherif KA, Xue J, et al. Development of poly(lactide-co-glycolide) microparticles for sustained delivery of meloxicam. Journal of Controlled Release.2023;353:823- 31, the disclosures of which are incorporated herein by reference in their entirety); polylactic acid (PLLA) (See, e.g., Zhang J, Read JE, Mittal G, Poston RN, Reilly J, Howling G, et al. Injectable biodegradable microchamber array films for long-term delivery of glucocorticoids. Journal of Controlled Release. 2025;381:113590, the disclosures of which are incorporated herein by reference in their entirety); polyglycolic acid (PGA); polyethylene glycol (PEG) (See, e.g., Ibrahim M, Ramadan E, Elsadek NE, Emam SE, Shimizu T, Ando H, et al. Polyethylene glycol (PEG): The nature, immunogenicity, and role in the hypersensitivity of PEGylated products. Journal of Controlled Release. 2022;351:215-30, the disclosures of which are incorporated herein by reference in their entirety); polycaprolactone (PCL) (See, e.g., Dash TK, Konkimalla VB. Poly-є- caprolactone based formulations for drug delivery and tissue engineering: A review. Journal of Controlled Release.2012;158:15-33, the disclosures of which are incorporated herein by reference in their entirety) and their copolymers, as well as natural polymers such as chitosan, alginate, hyaluronic acid, and dextran (See, e.g., Dartora VFC, Passos JS, Osorio B, Hung R-C, Nguyen M, Wang A, et al. Chitosan hydrogels with MK2 inhibitor peptide-loaded nanoparticles to treat atopic dermatitis. Journal of Controlled Release. 2023;362:591-605 and Hogan KJ, Perez MR, Mikos AG. Extracellular matrix component-derived nanoparticles for drug delivery and tissueengineering. Journal of Controlled Release. 2023;360:888-912, the disclosures of which are incorporated herein by reference in their entirety) have been used widely in delivery applications.
[0012] Polymers are routinely fabricated into a wide range of morphologies such as thin films, fibers, particles, hydrogels, and 3D-printed devices; that afford delivery platforms tailored to the specific clinical needs. Recent work on the use of polymers as the vehicle for pain management therapeutics has centered on microneedles which are traditionally limited to external application sites (see, e.g., Bahnick AJ, Dziewior CS, Li Y, Chou A, Segal M, Augustine EK, Ji RR, Becker ML. Controlled Transdermal Delivery of Dexamethasone for Pain Management via Photochemically 3D-Printed Bioresorbable Microneedle Arrays. Adv Healthc Mater. 2024;13(31):e2402113. Epub 20240812. doi: 10.1002 / adhm.202402113. PubMed PMID: 39132866; Yuan J, Yang H, Liu C, Shao L, Zhang H, Lu K, Wang J, Wang Y, Yu Q, Zhang Y, Yu Y, Shen Z. Microneedle Patch Loaded with Exosomes Containing MicroRNA-29b Prevents Cardiac Fibrosis after Myocardial Infarction. Adv Healthc Mater. 2023;12(13):e2202959. Epub 20230205. doi: 10.1002 / adhm.202202959. PubMed PMID: 36739582; and Yin M, Xiao L, Liu Q, Kwon S-Y, Zhang Y, Sharma PR, Jin L, Li X, Xu B. 3D Printed Microheater Sensor-Integrated, Drug-Encapsulated Microneedle Patch System for Pain Management. Advanced Healthcare Materials. 2019;8(23):1901170. doi: https: / / doi.org / 10.1002 / adhm.201901170, the disclosures of which are incorporated herein by reference in their entirety) flat substrates (e.g., thin films, nanofiber mats) which can be brittle and exhibit low drug release (see, e.g., Brigham NC, Nofsinger R, Luo X, Dreger NZ, Abel AK, Gustafson TP, Forster SP, Hermans A, Ji RR, Becker ML. Controlled release of etoricoxib from poly(ester urea) films for post-operative pain management. J Control Release. 2021;329:316-27. Epub 20201203. doi: 10.1016 / j.jconrel.2020.11.052. PubMed PMID: 33278481; Stinson NC, Matsuoka Y, Agarwal A, Dziewior CS, McDonald SM, Li Y, Godwin K, Ji RR, Becker ML. Pre-Clinical Assessment of Bupivacaine-Loaded Poly(ester urea) Thin Films for Controlled Drug Release and Effective Pain Management After Surgery. Adv Healthc Mater. 2025;14(3):e2402800. Epub 20241212. doi: 10.1002 / adhm.202402800. PubMed PMID: 39668463; and Slowik KM, Edmans JG, Harrison S, Edwards SM, Bolt R, Spain SG, Hatton PV, Murdoch C, Colley HE. Controlled dual drug release from adhesive electrospun patches for prevention and treatment of alveolar osteitis. Journal of Controlled Release. 2024;376:253-65. doi: https: / / doi.org / 10.1016 / j.jconrel.2024.09.048, the disclosures of which are incorporated herein by reference in their entirety), and injectables (e.g.,hydrogels, particles, in situ forming implants) which face manufacturing challenges due to solvent conditions and drug loading limitations (see, e.g., Pei Y, Wang J, Khaliq NU, Meng F, Oucherif KA, Xue J, Horava SD, Cox AL, Richard CA, Swinney MR, Park K, Yeo Y. Development of poly(lactide-co-glycolide) microparticles for sustained delivery of meloxicam. Journal of Controlled Release. 2023;353:823-31. doi: https: / / doi.org / 10.1016 / j.jconrel.2022.12.019; Grindy S, Gil D, Suhardi J, Fan Y, Moore K, Hugard S, Leape C, Randolph M, Asik MD, Muratoglu O, Oral E. Hydrogel device for analgesic drugs with in-situ loading and polymerization. Journal of Controlled Release. 2023;361:20-8. doi: https: / / doi.org / 10.1016 / j.jconrel.2023.07.022; and Xie J, Xiao D, Zhao J, Hu N, Bao Q, Jiang L, Yu L. Mesoporous Silica Particles as a Multifunctional Delivery System for Pain Relief in Experimental Neuropathy. Advanced Healthcare Materials. 2016;5(10):1213-21. doi: https: / / doi.org / 10.1002 / adhm.201500996, the disclosures of which are incorporated herein by reference in their entirety). A clinical need remains for a delivery system that is tunable, biodegradable, and possesses release behavior necessary to effectively treat acute pain.
[0013] Another promising class of polymers of particular interest for drug delivery are amino- acid based poly(ester urea)s (PEU)s. (See, e.g., Dziewior CS, Godwin K, Judge NG, Dreger NZ, Becker ML. Poly(ester urea)s: Synthesis, material properties, and biomedical applications. Progress in Polymer Science. 2024;156:101866, the disclosures of which are incorporated herein by reference in their entirety). Poly(ester urea)s (PEU)s are a class of polymers well suited for biomaterial and drug delivery applications because of their attractive properties including degradation into metabolic components, tunable mechanical and degradation properties, wide range of functionality and nontoxicity in vitro and in vivo. PEUs have been preclinically proven in several different structures, morphologies, and applications including drug delivery, adhesives, bone regeneration, hernia repair, radiopaque implants, and vascular grafts.
[0014] These PEU polymers are amorphous, highly tunable, and biocompatible. PEUs are traditionally tuned by changing the amino acid group, diol chain length, and copolymer stoichiometry. (See, e.g., Dziewior CS, Godwin K, Judge NG, Dreger NZ, Becker ML. Poly(ester urea)s: Synthesis, material properties, and biomedical applications. Progress in Polymer Science. 2024;156:101866, the disclosures of which are incorporated herein by reference in their entirety). PEU polymers are semi-crystalline depending on the amino acid precursors. Significantly, PEUs are synthetically flexible in that there are 20 kinds of naturally occurring amino acids and a numberof non-natural amino acids derivatives have been successfully used in a number of applications. These amino acids, along with the various diols commercially available, permit the synthesis of PEUs having vastly different properties. Additionally, the hydrogen bonding in the urea groups imparts the polymers with strong mechanical properties and the ester and urea bonds allow for both hydrolytic and enzymatic degradation. This structural tunability enables access to a broad range of thermal, mechanical, degradation, and release properties. This structural tunability is especially advantageous for sustained pain management where controlled release kinetics are critical.
[0015] PEUs degrade into naturally occurring byproducts. (See, e.g., Dziewior CS, Godwin K, Judge NG, Dreger NZ, Becker ML. Poly(ester urea)s: Synthesis, material properties, and biomedical applications. Progress in Polymer Science.2024;156:101866, the disclosures of which are incorporated herein by reference in their entirety). The final degradation byproducts are amino acids, small diol segments and CO2, which can be readily metabolized and / or removed by the body. Further, unlike the acidic degradation byproducts of polyesters, the carboxyl group in PEU is buffered by the urea linkages at each repeat unit. Their degradation properties further contribute to the minimal inflammatory responses that has been observed across several preclinical studies. (See, e.g., Stinson NC, Matsuoka Y, Agarwal A, Dziewior CS, McDonald SM, Li Y, et al. Pre- Clinical Assessment of Bupivacaine-Loaded Poly(ester urea) Thin Films for Controlled Drug Release and Effective Pain Management After Surgery. Adv Healthc Mater. 2025;14:e2402800; Dreger NZ, Zander ZK, Hsu YH, Luong D, Chen P, Le N, et al. Zwitterionic amino acid-based Poly(ester urea)s suppress adhesion formation in a rat intra-abdominal cecal abrasion model. Biomaterials. 2019;221:119399; Gao Y, Childers EP, Becker ML. l-Leucine-Based Poly(ester urea)s for Vascular Tissue Engineering. ACS Biomater Sci Eng. 2015;1:795-804; Brigham NC, Nofsinger R, Luo X, Dreger NZ, Abel AK, Gustafson TP, et al. Controlled release of etoricoxib from poly(ester urea) films for post-operative pain management. J Control Release.2021;329:316- 27; Abel AK, Dreger NZ, Nettleton K, Gustafson TP, Forster SP, Becker ML. Amino Acid-Based Poly(ester urea)s as a Matrix for Extended Release of Entecavir. Biomacromolecules. 2020;21:946-54; Dreger NZ, Fan Z, Zander ZK, Tantisuwanno C, Haines MC, Waggoner M, et al. Amino acid-based Poly(ester urea) copolymer films for hernia-repair applications. Biomaterials.2018;182:44-57; and Dreger NZ, Wandel MB, Robinson LL, Luong D, Sondergaard CS, Hiles M, et al. Preclinical in Vitro and in Vivo Assessment of Linear and Branched l-Valine-Based Poly(ester urea)s for Soft Tissue Applications. ACS Biomater Sci Eng.2018;4:1346-56, the disclosures of which are incorporated herein by reference in their entirety).It is believed, therefore, that the lack of inflammation found in vivo with PEU polymers is due, at least in part, to the absence of localized acidification during and after PEU degradation. Histological analysis of PEUs has shown that they are nontoxic and are therefore excellent candidates for tissue engineering constructs.
[0016] Several PEUs compositions in a number of form factors have shown promise in drug delivery, adhesives, bone regeneration, hernia repair, radiopaque implants, and vascular graft applications. Drug delivery efforts using PEUs has primarily focused on delivery of anesthetics and NSAIDs from thin films; however, thin films traditionally have limited drug loading and release due to processing conditions and low surface area. (See, e.g., Brigham NC, Nofsinger R, Luo X, Dreger NZ, Abel AK, Gustafson TP, Forster SP, Hermans A, Ji RR, Becker ML. Controlled release of etoricoxib from poly(ester urea) films for post-operative pain management. J Control Release. 2021;329:316-27. Epub 20201203. doi: 10.1016 / j.jconrel.2020.11.052. PubMed PMID: 33278481; Stinson NC, Matsuoka Y, Agarwal A, Dziewior CS, McDonald SM, Li Y, Godwin K, Ji RR, Becker ML. Pre-Clinical Assessment of Bupivacaine-Loaded Poly(ester urea) Thin Films for Controlled Drug Release and Effective Pain Management After Surgery. Adv Healthc Mater. 2025;14(3):e2402800. Epub 20241212. doi: 10.1002 / adhm.202402800. PubMed PMID: 39668463; and Williams-Pavlantos K, Brigham-Stinson NC, Becker ML, Wesdemiotis C. Application of surface-layer matrix-assisted laser desorption / ionization mass spectrometry imaging to pharmaceutical-loaded poly(ester urea) films. Anal Chim Acta. 2023;1283:341963. Epub 20231028. doi: 10.1016 / j.aca.2023.341963. PubMed PMID: 37977787; PMCID: PMC10657383, the disclosures of which are incorporated herein by reference in their entirety).
[0017] Accordingly, there is a need in the art for a system for rapid, local analgesia which provides acute pain relief, preserves patient mobility, and reduces risk of central sensitization. SUMMARY OF THE INVENTION
[0018] In one or more embodiments, the present invention provides an effective, tunable, and local drug delivery system that uses electrospun poly(ester urea) nanofibers to rapidly deliver local pain killers, NSAIDs and / or other local analgesics to injury sites. These drug-loaded poly(ester urea) (PEU) nanofibers provides acute pain relief, preserves patient mobility, and reduces risk ofcentral sensitization. Importantly, the drug-loaded poly(ester urea) (PEU) nanofibers are made using sodium bicarbonate as an additive during the electrospinning process, thereby increasing the porosity, and with it the surface-to-volume ratio of the spun nanofibers. It has been found, unexpectedly, that use of the sodium bicarbonate additive can double or even triple the amount of the drug that can be delivered. Further, it has been found that by controlling the molecular weight of the PEU polymer, the diameter of the nanofibers, and the type and / or amount of additive being used, the drug release kinetics can be tuned.
[0019] In one or more embodiments, the local analgesics used in the electrospun poly(ester urea) nanofibers of the present invention is meloxicam. These nanofibers have a high surface area which enables faster water uptake and degradation, thereby increasing meloxicam release. Meloxicam was used to demonstrate effective, local, pain management using an NSAID, which are typically limited by their maximum tolerated systemic dose. Meloxicam is a cyclooxygenase- 2 inhibitor currently used in US military combat wound medication packs for treatment of minor to moderate pain. In various embodiments, meloxicam-loaded nanofibers were fabricated from poly(ester urea) poly[(1-Phe-6)30-co-(1-Val-8)70] by electrospinning, using sodium bicarbonate as an additive.
[0020] The meloxicam release behavior was altered by changing polymer molecular mass, additive identity, additive load, and nanofiber mat thickness. Nanofibers possessing 10% sodium bicarbonate were implanted in a murine tibial fracture model to assess pain management in complex orthopedic trauma. Nanofiber implants resulted in greater serum and tissue concentrations of meloxicam at extended timepoints and more extensive suppression of the COX- 2 encoding gene than intraperitoneal and intramuscular meloxicam injections. These nanofiber implants were able to control pain for more than three days and significantly longer than either meloxicam treatment alone.
[0021] In various embodiments, these meloxicam-loaded nanofibers have been found to allow for quick, on target, and local delivery of meloxicam due to high surface-to-volume ratio of nanofibers. In various embodiments, the drug-loaded nanofiber implants of the present invention resulted in greater serum and tissue concentrations of meloxicam at later timepoints, and superior suppression of the COX-2 encoding gene than intraperitoneal and intramuscular meloxicam. Consequently, these nanofiber implants demonstrated superior and sustained pain management for more than three days.
[0022] In a first aspect, the present invention is directed to a drug-loaded poly(ester urea) polymer system for localized drug delivery comprising: a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units; a locally active pharmaceutical compound; and a bicarbonate additive. In some embodiments, the drug- loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said valine-based diester units comprise two valine residues separated by C2- C20 alkyl group. In certain embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said phenylalanine-based diester units comprise two phenylalanine residues separated by C2-C20alkyl group.
[0023] In one or more embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery comprises a plurality of electrospun nanofibers. In one or more embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said electrospun nanofibers have a mean diameter of from about 50 nm to about 1000 nm, preferably from about 50 nm to about 500 nm, and more preferably from about 50 nm to about 150 nm.
[0024] In various embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said poly(ester urea) polymer has the formula: y where a and bwhere x+y=1. In some embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said poly(ester urea) polymer has the formula:O O O 0.7.
[0025] In c system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof In one or more embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof.
[0026] In some embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof. In one or more embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof. In certain embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said locally active pharmaceutical compound is meloxicam.
[0027] In one or more embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said bicarbonate additive is selected from the group consisting of sodium bicarbonate, potassium bicarbonate, ammoniumbicarbonate, and combinations thereof. In certain embodiments, the drug-loaded poly(ester urea) polymer system for localized drug delivery of the present invention includes any one or more of the above referenced embodiments of the first aspect of the present invention, wherein said bicarbonate additive is sodium bicarbonate.
[0028] In a second aspect, the present invention is directed to a drug-loaded electrospun PEU nanofiber comprising: a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units; a locally active pharmaceutical compound; and a bicarbonate additive. In one or more of these embodiments, the valine-based diester units comprise two valine residues separated by C2-C20 alkyl group. In one or more of these embodiments, the phenylalanine-based diester units comprise two phenylalanine residues separated by C2-C20alkyl group.
[0029] In various embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said poly(ester urea) polymer has the formula: y where a and bwhere x+y=1. In some embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said poly(ester urea) polymer has the formula: 0.7.
[0030] In certain embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof. In one or more embodiments, the drug-loaded electrospun PEUnanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof.
[0031] In some embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof. In one or more embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof. In certain embodiments, the drug- loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said locally active pharmaceutical compound is meloxicam.
[0032] In various embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said bicarbonate additive is selected from the group consisting of sodium bicarbonate, potassium bicarbonate, ammonium bicarbonate, and combinations thereof. In certain embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention, wherein said bicarbonate additive is sodium bicarbonate.
[0033] In some embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention having a mean diameter of from about 50 nm to about 1000 nm, preferably from about 50 nm to about 500 nm, and more preferably from about 50 nm to about 150 nm.
[0034] In one or more embodiments, the drug-loaded electrospun PEU nanofibers of the present invention includes any one or more of the above referenced embodiments of the second aspect of the present invention having lease rate at least 1.5 times higher than a comparable drug- loaded electrospun PEU nanofiber not comprising said bicarbonate additive.
[0035] In a third aspect, the present invention is directed to a method of making drug-loaded electrospun PEU nanofiber described above comprising: dissolving a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units in a solvent suitable for electrospinning; adding a locally active pharmaceutical compound, or a pharmaceutically acceptable salt thereof, and a bicarbonate additive to the solution; mixing the solution so that the locally active pharmaceutical compound and bicarbonate additive are either dissolved or suspended in the solution; and loading the mixture into an electrospinning apparatus and electrospinning the solution into drug-loaded electrospun PEU nanofibers. In one or more of these embodiments, the solvent suitable for electrospinning is 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP), methyl ethyl ketone, acetone, or a combination thereof. In certain of these embodiments, the solvent suitable for electrospinning is HFIP.
[0036] In one or more embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the poly(ester urea) polymer has the formula: y where a and bwhere x+y=1. In some embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the poly(ester urea) polymer has the formula: 0.7.
[0037] In some embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof. In one or more embodiments, the method of makingdrug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof. In some embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof. In certain embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein said locally active pharmaceutical compound is meloxicam. In one or more embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof.
[0038] In one or more embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the initial solution comprises from about 2 % to about 20% of said poly(ester urea) polymer by weight. In certain embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the solution comprises from about 5 % to about 10% of said poly(ester urea) polymer by weight.
[0039] In various embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the weight of said analgesic compound is from about 1% to about 40% of the combined weight of said poly(ester urea) polymer and bicarbonate additive. In some embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the weight of said analgesic compound is about 20 % of the combined weight of said poly(ester urea) polymer and bicarbonate additive.
[0040] In one or more embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein said bicarbonate additive is sodium bicarbonate, potassium bicarbonate, ammonium bicarbonate, or a combination thereof. In certain embodiments, the bicarbonate additive is sodium bicarbonate.
[0041] In various embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the weight of said bicarbonate additive is from about 0.1% to about 30%, preferably from about 1% to about 25%, and more preferably from about 1% to about 20%, of the combined weight of said poly(ester urea) polymer and analgesic compound. In some embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the weight of said bicarbonate additive is from about 0.01% to about 10% of the combined weight of said poly(ester urea) polymer and analgesic compound.
[0042] In one or more embodiments, the method of making drug-loaded electrospun PEU nanofiber of the present invention includes any one or more of the above referenced embodiments of the third aspect of the present invention, wherein the mixture is mixed at a speed of from about 250 RPM to about 400 RPM for from about 4 hours to about 24 hours.
[0043] In a fourth aspect, the present invention is directed to a method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers comprising: preparing a solution comprising a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units and a solvent suitable for electrospinning; adding a locally active pharmaceutical compound to the solution; adding sodium bicarbonate and mixing until the locally active pharmaceutical compound and the sodium bicarbonate are either dissolved or suspended in the polymer solution; and loading the mixture into an electrospinning apparatus and electrospinning the solution into drug-loaded electrospun PEU nanofibers having a mean diameter of from about 400 nm to about 1500 nm. In one or more of these embodiments, the method further comprised inserting said drug-loaded electrospun PEU nanofibers into the body or a patient.
[0044] In one or more embodiments, the method for accelerating local drug release from drug- loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein said drug-loaded electrospun PEU nanofibers have an increased rate release of said analgesic compound compared to comparable drug-loaded electrospun PEU nanofiber made without sodium bicarbonate.
[0045] In some embodiments, the method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof.
[0046] In one or more embodiments, the method for accelerating local drug release from drug- loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof. In some embodiments, the method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof. In one or more embodiments, the method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof. In certain embodiments, the method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein said locally active pharmaceutical compound is meloxicam.
[0047] In various embodiments, the method for accelerating local drug release from drug- loaded poly(ester urea) nanofibers of the present invention includes any one or more of the above referenced embodiments of the fourth aspect of the present invention, wherein the weight of saidsodium bicarbonate additive is from about 0.1% to about 30%, preferably from about 1% to about 25%, and more preferably from about 1% to about 20%, of the combined weight of said poly(ester urea) polymer and analgesic compound. BRIEF DESCRIPTION OF THE DRAWINGS
[0048] For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures in which:
[0049] FIG. 1 is a schematic showing a route for synthesis of monomers 1-Phe-6 and 1-Val- 8 by a Fischer esterification and for synthesis of poly(ester urea) poly[(1-Phe-6)30-co-(1-Val-8)70] by interfacial polymerization of the 1-Phe-6 and 1-Val-8 monomers.
[0050] FIG. 2 show the chemical formula for poly(ester urea) (PEU) poly[(1-Phe-6)30-co-(1- Val-8)70] and meloxicam.
[0051] FIGS. 3A-B are graphs characterizing poly(ester urea) poly[(1-Phe-6)30-co(1-Val- 8)70] batches 200805-C01 (Mn= 8 kDa), 220921 (Mn= 12 kDa), and D135-114 (Mn= 44kDa) where FIG. 3A is a comparison of size-exclusion chromatography (SEC) chromatograms of poly[(1-Phe-6)30-co-(1-Val-8)70] in THF against polystyrene standards (n = 1); and FIG. 3B is a comparison of differential scanning calorimetry (DSC) thermograms of the second heating cycle of poly[(1-Phe-6)30-co-(1-Val-8)70] used to determine glass transition temperature (Tg) (n = 1).
[0052] FIGS. 4A-C are scanning electron microscopy (SEM) images showing the nanofiber morphology fabricated using different molecular weights of poly[(1-Phe-6)30-co-(1-Val-8)70] having a number average molecular mass (Mn) of 8kDa (FIG. 4A), 12 kDa (FIG. 4B), and 44 kDa (FIG. 4C). Scale bar = 5 µm.
[0053] FIGS. 5A-C are graphs reflecting the results of a batch to batch release study to observe any possible variations across identically electrospun nanofiber mats (70 µm thick) of poly(ester urea) poly[(1-Phe-6)30-co-(1-Val-8)70] (Mn = 8 kDa) containing meloxicam (20% w / w) where FIG.5A is a Violin plot of fiber diameter distributions for each nanofiber mat with an inset representative SEM image of nanofiber mat (scale bar = 10 µm); FIG. 5B is a comparison of cumulative meloxicam released (%) over seven days; and FIG. 5C shows the total meloxicam released (%) at day seven. Statistical analysis was conducted using a one-way ANOVA and Tukey HSD test. Data is reported as mean ± standard error (n = 5), ns is p > 0.05.
[0054] FIGS. 6A-E are images and graphs showing results of a release study of electrospun nanofiber mats (70 µm thick) of poly[(1-Phe-6)30-co-(1-Val-8)70] (PEU), poly(L-lactic acid) (PLLA), or poly(lactic-co-glycolic acid) (PLGA) containing meloxicam (20% w / w), where FIG. 6A is a comparison of scanning electron microscopy images of PEU, PLLA, and PLGA nanofibers (scale bar = 5 µm); FIG. 6B is a violin plot of fiber diameter distributions for each nanofiber mat (n ≥ 30); FIG.6C is a graph showing dose per day of meloxicam (µg) over seven days; FIG.6D is a graph showing cumulative meloxicam released (%) over seven days; and FIG. 6E is a graph showing total meloxicam released (%) by day seven for each polymer mat. Statistical analysis was conducted using a one-way ANOVA and Tukey HSD test. Data is reported as mean ± standard error (n = 6 unless otherwise noted, n = 5 for PEU), * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
[0055] FIGS. 7A-C are graphs showing the meloxicam release (37 °C, 1X PBS) from nanofiber mats containing poly[(1-Phe-6)30-co-(1-Val-8)70] poly(ester urea) at different molecular weights (Mn= 8, 12, 44 kDa) or poly(L-lactic-co-glycolic acid) (Mw= 30-60 kDa) and meloxicam (20% w / w) was measured over five days where FIG. 7A is a graph showing meloxicam release (µg) per day over five days; FIG. 7B is a graph showing cumulative meloxicam release (%) over five days; and FIG. 7C is a graph showing total meloxicam released (µg) by day five. Statistical analysis was conducted using a one-way ANOVA followed by Turkey’s post-hoc test and the student’s t-test. Data is reported as mean ± standard error, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
[0056] FIGS.8A-B are graphs showing normalized data of molecular weight release study of identically prepared electrospun nanofiber mats (70 µm thick) of poly(ester urea) poly[(1-Phe- 6)30-co-(1-Val-8)70] at three different molecular weights (8 kDa, 12 kDa, 44 kDa) containing meloxicam (20% w / w) where FIG. 8A is a graph showing cumulative meloxicam released (%) normalized to maximum release at day five; and FIG. 8B is a graph showing cumulative meloxicam released (%) normalized to maximum release at day 49. N = 3 for 8 kDa, n = 5 for 12 kDa, n = 4 for 44 kDa. The differences in n were due to sample loss over duration of release study. Statistical analysis was conducted using a two-way ANOVA and subdivided two-way ANOVA. Data is reported as mean ± standard error (n = 4 except for 8 kDa n =3), ns is p > 0.05. * p < 0.05, ** p < 0.01.
[0057] FIGS. 9A-C are graphs showing extended data of molecular weight release study of identically prepared electrospun nanofiber mats (70 µm thick) of poly(ester urea) poly[(1-Phe- 6)30-co-(1-Val-8)70] at three different molecular weights (8 kDa, 12 kDa, 44 kDa) containing meloxicam (20% w / w) where FIG. 9A is a violin plot of fiber diameter distributions for each nanofiber mat (n=50); FIG.9B is a graph of cumulative meloxicam released (%) over 49 days; and FIG. 9C is a graph of total meloxicam released (%) at day 49. N = 3 for 8 kDa, n = 5 for 12 kDa, n = 4 for 44 kDa. The differences in n were due to sample loss over the duration of release study. Statistical analysis was conducted using a two-way ANOVA and Tukey HSD test. Data is reported as mean ± standard error, * p < 0.05, ** p < 0.01.
[0058] FIGS. 10A-D are graphs and images showing additive loaded electrospun nanofiber mats (70 µm thick) of poly[(1-Phe-6)30-co-(1-Val-8)70] (Mn = 44kDa) containing meloxicam (20% w / w) and sodium bicarbonate or trehalose (0%, 5%, 10%), where FIG. 10A are comparative scanning electron microscopy images of PEU, PLLA, and PLGA nanofibers (scale bar = 5 µm); FIG. 10B is a violin plot of fiber diameter distributions for each nanofiber mat (n ≥ 30); FIG. 10C is a graph showing cumulative meloxicam released (%) over 49 days; and FIG. 10D is a graph showing total meloxicam released (%) by day 49. Statistical analysis was conducted using a one- way ANOVA and Tukey HSD test. Data is reported as mean ± standard error (n = 6 unless otherwise noted, n = 4 for 0% additive, n = 5 for 5% trehalose), * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
[0059] FIGS. 11A-C are graphs showing normalized cumulative meloxicam release (%) data from extended meloxicam release study of poly[(1-Phe-6)-30-co-(1-Val-8)70] (Mn = 44kDa) nanofibers containing meloxicam (20% w / w) and trehalose or sodium bicarbonate (0%, 5%, 10%). (FIG.11A) All additive release (%) normalized to the same mean at 49 days including no additive, trehalose (5%, 10%), and sodium bicarbonate (5%, 10%). (FIG. 11B) Normalized cumulative meloxicam release (%) data subdivided to trehalose additive (0%, 5%, 10%). (FIG. 11C) Normalized cumulative meloxicam release (%) data subdivided to sodium bicarbonate additive (0%, 5%, 10%). Statistical analysis was conducted using a two-way ANOVA and subdivided two- way ANOVA. Data is reported as mean ± standard error (n = 6 unless otherwise noted, n = 4 for 0% additive, n = 5 for 5% trehalose), * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
[0060] FIGS. 12 are graphs of electrospun meloxicam-loaded (20% w / w) poly[(1-Phe-6)30- co-(1-Val-8)70] nanofibers fabricated with trehalose or sodium bicarbonate (0%, 5%, or 10% w / w)at 70 µm thick, where the nanofibers were submerged above sink conditions in 1X phosphate buffered saline at constant agitation for 7 days at 37ºC showing meloxicam released per day for days 1-7 in a dose per day perspective (FIG.12A), cumulative meloxicam released (%) calculated for total meloxicam load in sample (FIG.12B), and total meloxicam released by day 5 (FIG.12C).
[0061] FIGS. 13A-D are SEM images of electrospun nanofibers of poly(ester urea) poly[(1- Phe-6)30-co(1-Val-8)70] containing meloxicam (20 % w / w) at mat thicknesses of 70 µm (FIGS. 13A, 13C) and 140 µm (FIGS. 13B, 13D ) with (FIGS. 13C-D) and without (FIGS. 13A-B) sodium bicarbonate.
[0062] FIG. 14 are images showing the results of a release study to assess impact of electron beam exposure on identically electrospun nanofiber mats of poly[(1-Phe-6)30-co-(1-Val-8)70] (Mn= kDa) containing meloxicam (20% w / w) and sodium bicarbonate (0%, 10% w / w) before and after electron beam exposure. Scale bar = 5 µm;
[0063] FIGS. 15 are graphs of electrospun meloxicam-loaded (20% w / w) poly[(1-Phe-6)30- co-(1-Val-8)70] nanofibers fabricated with no additive and sodium bicarbonate (10% w / w) at 70 µm and 140 µm thick substrates showing: meloxicam released per day for days 1-7 in a dose per day perspective (FIG. 15A); cumulative meloxicam released (%) calculated for total meloxicam load in sample (FIG. 15B); and total meloxicam released by day 5 (FIG. 15C). The nanofibers were sterilized by electron beam. The samples were submerged above sink conditions in 1X phosphate buffered saline at constant agitation for 7 days at 37ºC, as described further below.
[0064] FIGS. 16A-B are schematic diagrams showing the in vivo assessment of meloxicam implants where FIG.16A is a murine tibial fracture model schematic with placement of meloxicam loaded implants over muscle and under skin at fracture site; and FIG. 16B is a diagram showing treatment groups and experimental timeline for behavioral testing and sample collection.
[0065] FIGS. 17A-D are graphs showing the results of in vivo assessments of meloxicam implants where FIG.17A is a graph of mechanical allodynia behavioral data measured using Von Frey filaments and FIG. 17B is a graph of cold allodynia behavioral data (n = 10 per group per timepoint for timepoints 0-1 days, n = 5 per group per timepoint for 2-5 days); FIG. is a graph showing concentration of meloxicam in serum after treatment (n = 5 per timepoint per group) (inset is an enlarged view of meloxicam concentration in serum at 24 h); and FIG.17Dis a graph showing the concentration of meloxicam in muscle at fracture site at two days after treatment. Statistical analysis was conducted using a one-way ANOVA followed by Tukey’s post-hoc test. The data isreported as mean ± standard error, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. * Symbols used for intraperitoneal – 10% sodium bicarbonate comparisons. # used for 0% additive – 10% sodium bicarbonate comparison.
[0066] FIGS. 18 A-B are graphs reflecting the results of an analysis of sex based differences in behavioral testing of meloxicam murine tibial fracture study. Data was separated into male (squares, opaque bars) and female (circles, transparent bars). (FIG. 18A) Mechanical allodynia behavioral data measured using Von Frey filaments. (FIG. 18B) Cold allodynia behavioral data measured using acetone spray. Statistical analysis was conducted using a one-way ANOVA followed by Tukey’s post-hoc test. Data is reported as mean ± standard error (n = 5 unless noted otherwise, n = 4 for 10% additive), * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
[0067] FIGS.19A-Bare graphs reflecting qPCR gene expression experiments for interleukin- 1 beta (IL-1β) expression (FIG. 19A) and prostaglandin-endoperoxide synthase 2 mRNA (Ptgs2) expression (FIG.19B) measured 24 hours after treatment demonstrating significant suppression of Ptgs2 gene expression of the meloxicam-loaded PEU relative to the controls. Statistical analysis was conducted using a one-way ANOVA followed by Tukey’s post-hoc test. Data is reported as mean ± standard error, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
[0068] FIG.19C in an image (with insert) representative histology of implant capsule adjacent to fracture site and an enlarged view of capsule formation. Scale bar = 20 µm. Star denotes location of polymer implant. * Denotes polymer implant location.
[0069] FIG. 20 is a comparison of the differential scanning calorimetry thermograms of poly[(1-Phe-6)30-co-(1-Val-8)70] nanofibers containing meloxicam (20% w / w) and trehalose or sodium bicarbonate (0%, 5%, or 10% w / w) that were used to determine the glass transition temperatures of the referenced nanofibers.
[0070] FIGS. 21A-D are scanning electron microscopy images of meloxicam-loaded (20% w / w) poly[(1-Phe-6)30-co-(1-Val-8)70] nanofibers with sodium bicarbonate (FIGS. 21A, C) and trehalose (FIGS. 21B, D) having 5% w / w (FIGS. 21A-B) or 10% w / w (FIGS. 21C-D) of the trehalose or sodium bicarbonate additive and having a thickness of 70 µm (N=50 per group; scale bar of 5 µm).
[0071] FIG.22 is a violin plot showing fiber diameter distribution of meloxicam-loaded (20% w / w) poly[(1-Phe-6)30-co-(1-Val-8)70] nanofibers with trehalose or sodium bicarbonate (0%, 5%, or 10% w / w) that are 70 µm thick (N=50 per group).
[0072] FIGS. 23 are scanning electron microscopy images of 0% (FIGS. 23A, C) and 10% (FIGS.23B, D) sodium bicarbonate samples at 70 µm (FIGS.23A-B) and 140 µm (FIGS.23C-D) substrate thickness after electron beam sterilization (scale bar of 1 µm).
[0073] FIG.24 is a violin plot showing fiber diameter distribution of meloxicam-loaded (20% w / w) poly[(1-Phe-6)30-co-(1-Val-8)70] nanofibers with sodium bicarbonate (0% or 10% w / w) at 70 and 140 µm thick and before and after electron beam sterilization (N=50 per group).
[0074] FIGS. 25 are graphs of electrospun meloxicam-loaded (20% w / w) poly[(1-Phe-6)30- co-(1-Val-8)70] nanofibers fabricated with no additive and with sodium bicarbonate (10% w / w) at 70 µm thick showing: meloxicam released per day for days 1-7 in a dose per day perspective (FIG. 25A); cumulative meloxicam released (%) calculated for total meloxicam load in sample (FIG. 25B); and total meloxicam released by day 5 (FIG. 25C). The nanofibers were sterilized by electron beam and used in a release study to compare stability before and after the electron beam. The nanofibers were submerged above sink conditions in 1X phosphate buffered saline at constant agitation for 7 days at 37ºC, as described further below.
[0075] FIG. 26 is an annotated1H NMR spectra (DMSO‑d6, 500 MHz) of poly[(1-Phe-6)30- co-(1-Val-8)70].1H NMR (500 MHz, DMSO-d6): δ = 0.80-0.87 (m, 12H, -CH(CH3)2), 1.92-1.99 (m,(CH2Ph)C(O)O-), 4.33-4.42 (m, 2H, -NHCH(CH2Ph) C(O)O-), 6.31-6.41 (d, JH-H = 9.2 Hz, 2H, -NHCH(CH(CH3)2)C(O)O-), 6.46-6.52 (d,3JH-H = 8.9 Hz, 2H, -C(O)NHC(CH2Ph)HC(O)-), 7.13-7.31 (m, 10H, -C6H5), 1.14- 1.30, 1.41-1.58, 3.91-4.08 (all remaining diol protons) ppm.
[0076] FIGS. 27A-B are graphs showing the results of release studies using bupivacaine- loaded of poly[(1-Phe-6)30-co-(1-Val-8)70] films and nanofibers formed with and without 10% NaHCO3 additive where FIG.27A is a graph showing daily bupivacaine release over a 7 day period and FIG. 27B is a graph showing cumulative bupivacaine release over a 5 day period.
[0077] FIG. 28 is a graph showing total meloxicam release results from u meloxicam-loaded of poly[(1-Phe-6)30-co-(1-Val-8)70] films and nanofibers formed with and without 10% NaHCO3 additive. Data is reported as mean ± standard error, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.DETAILED DESCRIPTION OF THE ILLUSTRATIVE EMBODIMENTS
[0078] The following is a detailed description of the disclosure provided to aid those skilled in the art in practicing the present disclosure. Those of ordinary skill in the art may make modifications and variations in the embodiments described herein without departing from the spirit or scope of the present disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The terminology used in the description of the disclosure herein is for describing particular embodiments only and is not intended to be limiting of the disclosure.
[0079] In one or more embodiments, the present invention provides an effective, tunable, and local drug delivery system that uses electrospun poly(ester urea) nanofibers to rapidly deliver local active pharmaceuticals such as pain killers, antibiotics, NSAIDs and / or other local analgesics to injury sites. In various embodiments, the local active pharmaceutical may be bupivacaine, ropivacaine, tobramyacin, rifampin, minocycline, or a combination thereof. In some embodiments, the local active pharmaceutical may be an analgesic such as meloxicam, bupivacaine, ropivacaine, or combinations thereof. In some other embodiments, the local active pharmaceutical may be an antibiotic such as tobramyacin, rifampin, and minocycline, or combinations thereof. These drug- loaded poly(ester urea) (PEU) nanofibers provide acute pain relief, preserve patient mobility, and reduce risk of central sensitization. As set forth above, the drug-loaded poly(ester urea) (PEU) nanofibers are made using sodium bicarbonate as an additive during the electrospinning process, thereby increase the porosity, and with it the surface-to-volume ratio, of the spun nanofibers. This has been unexpectedly found to greatly increase the amount of drug that is delivered by the drug- loaded PEU nanofibers. Accordingly, it has been found that by controlling the molecular weight of the PEU polymer, the diameter of the nanofibers, and the type and / or amount of additive being used, the drug release kinetics can be tuned.
[0080] In one or more embodiments, the local analgesics using in the electrospun poly(ester urea) nanofibers of the present invention is meloxicam. Meloxicam is a cyclooxygenase-2 inhibitor currently used in US military combat wound medication packs for treatment of minor to moderate pain. The analgesic benefit of meloxicam in US military combat wound medication packs is limited by its systemic delivery as an oral tablet and systemic dosage limit. Meloxicam-loaded polymer nanofibers are a way of addressing this unmet need by allowing for quick, on target, and local delivery of meloxicam due to high surface-to-volume ratio of nanofibers. In variousembodiments, meloxicam-loaded nanofibers were fabricated from poly(ester urea) poly[(1-Phe- 6)30-co-(1-Val-8)70] by electrospinning, using sodium bicarbonate as an additive.
[0081] The polymer molecular weight was used to control meloxicam release kinetics. The release rate of meloxicam was further tuned using sodium bicarbonate to increase porosity and consequently nanofiber surface area. While other bicarbonate compounds may be used, sodium bicarbonate is preferred. In one or more embodiments, these meloxicam-loaded nanofibers have been found to allow for quick, on target, and local delivery of meloxicam due to high surface-to- volume ratio of nanofibers. Pharmacokinetics and pharmacodynamics of meloxicam-loaded nanofibers were studied in a murine tibial fracture model. It is believed that the drug loaded electrospun poly(ester urea) nanofibers of the present invention provide an effective, tunable, and local drug delivery system.
[0082] The following terms may have meanings ascribed to them below, unless specified otherwise. As used herein, the terms "comprising" "to comprise" and the like do not exclude the presence of further elements or steps in addition to those listed in a claim. Similarly, the terms “a,” “an” or “the” before an element or feature does not exclude the presence of a plurality of these elements or features, unless the context clearly dictates otherwise.
[0083] Unless specifically stated or obvious from context, as used herein, the term "about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. "About" can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein in the specification and the claim can be modified by the term "about."
[0084] It should be also understood that the ranges provided herein are a shorthand for all of the values within the range and, further, that the individual range values presented herein can be combined to form additional non-disclosed ranges. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.
[0085] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, which means that they should be read and considered by the reader as part of this text. That the document, reference, patent application, orpatent cited in this text is not repeated in this text is merely for reasons of conciseness. In the case of conflict, the present disclosure, including definitions, will control. All technical and scientific terms used herein have the same meaning, unless otherwise indicated.
[0086] Further, any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein. The fact that given features, elements or components are cited in different dependent claims does not exclude that at least some of these features, elements or components maybe used in combination together.
[0087] In a first aspect, the present invention is directed to a drug-loaded electrospun PEU nanofiber comprising: an amino acid-based poly(ester urea) polymer comprising a plurality of phenylalanine-based diester units and a plurality of valine-based diester units; an analgesic compound; and, importantly, a bicarbonate additive. In various embodiments, phenylalanine- based diester units comprise two phenylalanine residues separated by C2-C20 alkyl group and will have the formula: where a is an integer from 2 toIn various embodiments, valine-based diester units comprise two valine residues separated by C2-C20alkyl group and will have the formula: O where b is an integer from 2 to
[0088] In one or more embodiments, the poly(ester urea) polymer used to form the drug- loaded electrospun PEU nanofiber of the present invention has the formula: y where a and bwhere x+y=1.
[0089] In some embodiments, a is an integer from 3 to 20, in other embodiments, from about 4 to about 12, in other embodiments, from about 4 to about 10, and in other embodiments, from about 4 to about 8. In some of these embodiments, a is 6 and b is 8.
[0090] In some embodiments, x is a mole fraction from about 1 to about 50, in other embodiments, from about 1 to about 40, in other embodiments, from about 10 to about 35, in other embodiments, from about 10, to about 30, in other embodiments, from about 20 to about 30, in other embodiments. In some of these embodiments, x is 0.3 and y is 0.7.
[0091] In one or more embodiments, the poly(ester urea) polymer used to form the drug- loaded electrospun PEU nanofiber of the present invention will have a number average molecular mass (Mn) of from about 5,000 Da to about 150,000 Da. In some embodiments, poly(ester urea) polymer will have an Mn of from about 10,000 to about 100,000, in other embodiments, from about 10,000 Da to about 80,000 Da, in other embodiments, from about 10,000 Da to about 70,000 Da, in other embodiments, from about 10,000 Da to about 60,000 Da, in other embodiments Da, from about 20,000 Da to about 50,000 Da.
[0092] In various embodiments, the poly(ester urea) polymer used to form the drug-loaded electrospun PEU nanofiber of the present invention will have a weight average molecular mass (Mw) of from about 10,000 Da to about 300,000 Da. In some embodiments, poly(ester urea) polymer will have an Mw of from about 10,000 Da to about 280,000 Da, in other embodiments, from about 20,000 to about 200,000, in other embodiments, from about 20,000 Da to about 160,000 Da, in other embodiments, from about 20,000 Da to about 140,000 Da, in other embodiments, from about 20,000 Da to about 120,000 Da, in other embodiments Da, from about 40,000 Da to about 100,000 Da.
[0093] On one or more of these embodiments, the poly(ester urea) polymer used to form the drug-loaded electrospun PEU nanofiber of the present invention has the formula: 0.7.
[0094] As set forth above, the drug-loaded electrospun PEU nanofiber of the present invention further comprises an analgesic compound for local drug delivery. In various embodiments, theanalgesic compound may be meloxicam, bupivacaine, lidocaine, ropivacaine, etoricoxib, or a combination. In some of these embodiments, the analgesic compound may be meloxicam. While this embodiment of the present inventions envisions localize delivery of analgesic compounds, the invention is not to be so limited and other pharmaceutical compounds that require localized delivery may be used in other embodiments.
[0095] As set forth above, it has unexpectedly been found that use of a bicarbonate additive, such as sodium bicarbonate can double or even triple the amount of the drug that can be delivered. While not wishing to be bound by theory, it is believed that the presence of the bicarbonate additive significantly increases the porosity of the nanofibers, thereby increasing the rate of the localized release of the drug. In some embodiments, the drug-loaded electrospun PEU nanofiber will have a release rate at least 1.5 times higher than a comparable drug-loaded electrospun PEU nanofiber not comprising said bicarbonate additive. In other embodiments, the drug-loaded electrospun PEU nanofiber will have a release rate at least 2.0 times higher than a comparable drug-loaded electrospun PEU nanofiber not comprising said bicarbonate additive. In still other embodiments, the drug-loaded electrospun PEU nanofiber will have a release rate at least 2.5 times higher than a comparable drug-loaded electrospun PEU nanofiber not comprising said bicarbonate additive. In one or more of these embodiments, the bicarbonate additive is sodium bicarbonate.
[0096] Further, it has been found that by controlling the molecular weight of the PEU polymer, the diameter of the nanofibers, and the type and / or amount of additive being used, the drug release kinetics can be tuned.
[0097] In various embodiments, the drug-loaded electrospun PEU nanofiber will have a mean diameter of from about 30 nm to about 3000 nm, preferably from about 30 nm to about 2000 nm, and more preferably from about 30 nm to about 1000 nm. In some embodiments, the drug-loaded electrospun PEU nanofiber of the present invention will have a mean diameter of from about 50 nm to about 500 nm, in other embodiments, from about 50 nm to about 250 nm, in other embodiments, from about 50 nm to about 150 nm. In some embodiments, the drug-loaded electrospun PEU nanofiber will have a mean diameter of about 70 nm. In some other embodiments, the drug-loaded electrospun PEU nanofiber will have a mean diameter of about 140 nm.
[0098] In a second aspect, the present invention is directed to a method of making the drug- loaded electrospun PEU nanofiber described above. In various embodiments, the first step in themethod will be formation of the amino acid-based poly(ester urea) polymer. In one or more embodiments, amino acid-based poly(ester urea) polymer may be formed as shown in Scheme 1, below. Scheme 1 O H2N CO OH O In oney are mole fractions (x+y=1).
[0099] As set forth above, the PEU polymers will comprise a plurality of phenylalanine-based diester units and a plurality of valine-based diester units. As will be apparent, plurality of phenylalanine-based diester units are the residues of the phenylalanine-based diester monomers used to form the polymer and the plurality of valine-based diester units are residues of the valine- based diester monomers used to form the PEU polymer. The residues of the phenylalanine-based diester monomers and the residues of the valine-based diester monomers are joined by urea bonds introduced by one or more PEU forming compounds, as discussed in more detail below.
[0100] As will be apparent to those of skill in the art, steps must be taken to protect the amine groups on these monomers to prevent transamidation. Accordingly, the amine groups of both the valine-based diester monomers and the phenylalanine-based diester monomers will be counter ionprotected. One of ordinary skill in the art will be able to select a suitable counter-ion without undue experimentation. Materials capable of producing suitable protecting counter-ions may include without limitation, p-toluene sulfonic acid monohydrate, chlorides, bromides, acetates. trifluoroacetate, or combinations thereof. In some embodiments, the phenylalanine-based monomer may be the di-p-toluene sulfonic acid salt of bis-L-phenylalanine-1,6-hexanediol-diester (1-Phe-6 monomer) and the valine-based monomer di-p-toluenesulfonic acid salts of bis(L-valine)- octane 1,8-diester (1-Val-8). In some embodiments, the solvent used may be toluene.
[0101] In various embodiments, phenylalanine-based diester monomer will comprise two phenylalanine residues separated by a C2-C20 alkyl group and have the formula: OH O S O O S where a is an integer6.
[0102] Similarly, in one or more embodiments the valine-based diester monomers will comprise two valine residues separated by a C2-C20 alkyl group and have the formula: O O O where a is an integer from 2is 8.
[0103] In various embodiments, the di-p-toluenesulfonic acid salts of bis(L-valine)-octane 1,8-diester (1-Val-8) may be synthesized following previously published procedures. See, e.g., Yu, J.; Lin, F.; Lin, P.; Gao, Y.; Becker, M. L. “Phenylalanine-based poly(ester urea): Synthesis, characterization, and in vitro degradation.” Macromolecules 2014 DOI: 10.1021 / ma401752b, the disclosure of which is incorporated herein by reference. In one or more of these embodiments, the amino acid based diester monomer segments may be formed as set forth in U. S. Patent Nos. 9,745,414, 9,988,492, 10,280,261, 10,414,864, 10,537,660, 11,103,613, and 11,771,543; U.S.Published Application No, 2020 / 368164; and International Application Publication No. WO 2020 / 226646, the disclosures of which are incorporated herein by reference in their entirety.
[0104] In one or more embodiments, the di-p-toluenesulfonic acid salts valine diol monomer (1-Val-8) may be formed as shown in Scheme 2 below. Scheme 2 SO3O O NH3, , monohydrate (2.4 eq.), and toluene are added to a 3-neck round bottom flask or other suitable reaction vessel and the contents are then mixed, preferably with overhead stirring. In some embodiments, the reaction vessel may be purged with nitrogen or other inert gas. As will be apparent, the TsOH acidifies the solution conditions preventing the amidation of the carboxylic acids. In one or more of these embodiments, a Dean Stark trap is used to collect the water biproducts, thereby increasing the yield of the reaction. In these embodiments, Dean-Stark Trap is attached to the reaction vessel and the reaction is heated to a reflux temperature (≈110 °C) for from about 1 h to about 48 h to form the 1-Val-8 monomer. In some embodiments, the reaction vessel and reaction are heated to a reflux temperature (≈110 °C) for about 20 h to form the 1-Val-8 monomer. In some embodiments, to the reaction vessel and the reaction is heated to a reflux temperature (≈110 °C) for about 24 h to form the 1-Val-8 monomer.
[0105] The 1-Val-8 monomer may be isolated and purified using conventional methods. In some of these embodiments, the reaction is cooled to ambient temperature, and the resulting white precipitate isolated by vacuum filtration using a Buchner funnel. In these embodiments, the product is then recrystallized by dissolving in boiling water (2 L), vacuum filtering hot, and cooled to room temperature to afford a white solid precipitate, which is then collected via filtration. In some of these embodiments, the recrystallization process may be performed three or more times for purity.1H NMR (300 MHz, DMSO-d6): δ = 0.95-0.99 (m, 12H, -CH(CH3)2), 1.24-1.35 (s, 8H, -COOCH2CH2(CH2)4-), 1.55-1.65 (m, 4H, -COOCH2CH2(CH2)4CH2-), 2.06-2.22 (m, 2H,(CH3)2CH-), 2.26-2.31 (s, 6H, -CH3Ar-), 2.50 (m, DMSO), 3.33-3.38 (s, H2O), 3.88-3.90 (d, J = 4.3 Hz, 2H,+NH3CHCOO-), 4.08-4.24 (m, 4H, -COOCH2CH2(CH2)4-), 7.10-7.14 (d, J = 8.2 Hz, 4H, aromatic H ), 7.48-7.50 (d, J = 8.1 Hz, 4H, aromatic H), 8.25-8.33 (br, 6H, -NH3+).
[0118] In various embodiments, di-p-toluene sulfonic acid salts of bis-L-phenylalanine-diol- diester monomers (1-Phe-6 monomers) were prepared using previously published procedures, (See, Yu, J.; Lin, F.; Lin, P.; Gao, Y.; Becker, M. L. Macromolecules 2014, 47, 121; Lin, F.; Yu, J.; Tang, W.; Zheng, J.; Xie, S.; Becker, M. L. Macromolecules 2013, 46, 9515; and Pang, X.; Chu, C.-C. Biomaterials 2010, 31, 3745, the disclosure of which are incorporated herein by reference.), and as shown in Scheme 3, below. Scheme 3 -sulfonic acid monohydrate (TsOH) (2.4 equiv.), and toluene (200mL) were mixed in a 500mL 2- neck round bottom flask or other suitable reaction vessel equipped with Dean-Stark trap and a magnetic stir bar. As set forth above, the TsOH acidifies the solution conditions preventing the amidation of the carboxylic acids and a Dean Stark trap was used to collect the water biproducts, thereby increasing the yield of the reaction. In these embodiments, the system is then heated to reflux (≈110 °C) and purged with nitrogen for from about 2 h to about 48 h to form the 1-Phe-6 monomer. In some embodiments, to the reaction vessel and the reaction is heated to a reflux temperature for about 20 h to form the 1-Phe-6 monomer. In some embodiments, to the reaction vessel and the reaction is heated to a reflux temperature (≈110 °C) for about 24 h to form the 1- Phe-6 monomer.
[0120] The 1-Phe-6 monomer may be isolated and purified using conventional methods. In some embodiments, the reaction mixture is cooled to ambient temperature and the product was filtered with diethyl ether. In one or more of these embodiments, the solid product was dissolved in hot water and decolored using activated carbon black (2.0g) for 2-3 minutes and the decolorized hot liquid obtained by vacuum filtration. When the decolorized hot liquid is cooled to roomtemperature, the di-p-toluene sulfonic acid salt of bis-L-phenylalanine-1, 6-hexanediol-diester (1- PHE-6 monomer) forms precipitates as white solid product, which is then collected by vacuum filtration and purified. In various embodiments, the white solid product may next be recrystallized 3 or more times, again using hot water to yield the di-p-toluene sulfonic acid salt of bis-L- phenylalanine-1, 6-hexanediol-diester (1-Phe-6 monomer) as a white powder. The compound produced was characterized by1H NMR ((300MHz, DMSO-d6): 1.04-1.13 (m, 4H, - COOCH2CH2CH2-) 1.38-1.44 (m, 4H, -COOCH2CH2CH2-) 2.27 (s, 6H, CH3Ar-) 2.50 (DMSO) 2.98-3.19 (m, 4H, -CHCH2-Ar-) 3.89-4.03 (m, 4H, -COOCH2CH2-) 4.25-4.32 (m, 2H,+NH3CHCOO-) 7.09-7.13 (d, 4 H, aromatic H) 7.21-7.34 (m, 10H, aromatic H) 7.47-7.50 (d, 4H, aromatic H) 8.36 (s, 6H,+NH3-)) and by13C-NMR ((75 MHz, DMSO-d6): 20.75, 24.66, 27.62, 35.97, 38.80-40.28 (DMSO-d6), 53.07, 65.46, 125.39, 127.14, 127.95, 128.49, 129.30, 134.69, 137.78, 145.33, 169.03).
[0121] Once the monomers have been formed, they are reacted with a PEU forming group such as triphosgene to form a poly(ester urea) as shown in Scheme 1, above. As set forth above and in Scheme 1, the amino acid-based PEU polymers are formed by interfacial polymerization of the counter ion protected monomers described above with a PEU forming compound and a suitable base, such as sodium carbonate, potassium carbonate, sodium bicarbonate, or potassium bicarbonate. As used herein, the terms “PEU forming compound” and “PEU forming material” are used interchangeably to refer to a material capable of placing a carboxyl group between two amine groups, thereby forming a urea bond. Suitable PEU forming material may include, without limitation, triphosgene, diphosgene, or phosgene. It should be noted that, diphosgene (a liquid) and triphosgene (a solid crystal) are understood to be more suitable than phosgene, as they are generally known as safer substitutes for phosgene, which is a toxic gas. As used herein, the term “interfacial polymerization” refers to polymerization that takes place at or near the interfacial boundary of two immiscible fluids. In some embodiments, the interfacial polymerization reaction is a polycondensation reaction. The reaction of the counter-ion protected amino acid-based polyester monomer or monomers with triphosgene, diphosgene or phosgene to create an amino acid-based PEU may be achieved as described below or in any number of ways generally known to those of skill in the art.
[0122] Briefly, in one or more embodiments, the 1-Phe-6 monomer and 1-Val-8 monomer are combined with a first fraction of a suitable base such as sodium carbonate, potassiumcarbonate, sodium bicarbonate, or potassium bicarbonate, and dissolved in water using mechanical stirring and a warm water bath (approximately 35°C). As will be apparent, 1-Phe-6 monomer and 1-Val-8 monomer are added at a molar ratio that will produce desired mole fractions of 1-Phe monomer units and 1-Val-8 monomer units.
[0123] The reaction is then cooled to a temperature of about -10°C to about 2°C and an additional fraction of base is dissolved in water and added to the reaction mixture. Next, a first fraction of a PEU forming compound is dissolved in a suitable solvent and added to the reaction mixture. One of ordinary skill will be able to select a suitable solvent for the PEU forming compound without undue experimentation. Selection of a suitable solvent for the PEU forming compound will, of course, depend upon the particular compound chosen, but may include, without limitation, distilled chloroform, dichloromethane, or dioxane. After a period of from about 2 to about 60 minutes, a second fraction of the PEU forming compound is dissolved in a suitable solvent, such as distilled chloroform or dichloromethane, and added dropwise to the reaction mixture over a period of from about 0.5 to about 12 hours to produce a crude homopolymer containing both iodine functionalized and non-iodine functionalized amino acid residues. The crude product may be purified using any means known in the art for that purpose. In some embodiments, the crude homopolymer product may be purified by transferring it into a separatory funnel and precipitating it into boiling water.
[0124] In some embodiments, the amino acid-based poly(ester urea) polymer or copolymer may be prepared as set forth in U.S. Patent Nos. 9,745,414, 9,988,492, 10,280,261, 10,414,864, 10,537,660, 11,103,613, 11,771,543, US Published Application No. 2020 / 368164, International Patent Publication No. WO 2020 / 226646, the disclosures of which are incorporated herein by reference in their entireties.
[0125] In various embodiments, the poly(ester urea) polymer used to form the drug-loaded electrospun PEU nanofibers of the present invention will have the formula: orO O O 0.7where a and b are here x+y=1.
[0126] Once the amino-acid-based poly(ester urea) polymer has been obtained, it is used to produce an electrospinning fluid that will produce the drug-loaded electrospun PEU nanofibers of the present invention. To do this, the PEU polymer is first dissolved in a solvent suitable for electrospinning. In various embodiments, the solvent suitable for electrospinning is selected from 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP), acetone, and combinations thereof. In some of these embodiments, the solvent suitable for electrospinning is HFIP. One of ordinary skill in the art will be able to arrive at a solvent suitable for electrospinning without undue experimentation.
[0127] In various embodiments, the electrospinning fluid will comprise from about 2% to about 30% (w / w) amino-acid-based PEU polymer. In some embodiments, the electrospinning fluid will comprise from about 2% to about 25% (w / w), in other embodiments, from about 2% to about 20% (w / w), in other embodiments, from about 2% to about 15% (w / w). In some of these embodiments, the electrospinning fluid will comprise from about 5% to about 10% (w / w) amino- acid-based PEU polymer.
[0128] Next, the analgesic compound, or a pharmaceutically acceptable salt thereof, and a bicarbonate additive to the polymer solution. In one or more embodiments, the analgesic compound is selected from the group consisting of meloxicam, bupivacaine, lidocaine, ropivacaine, etoricoxib, and combinations thereof. In some embodiments, the analgesic compound is meloxicam.
[0129] In various embodiments, the weight of said analgesic compound is from about 2% to about 40% of the combined weight of said PEU polymer and bicarbonate additive. In some embodiments, the weight of said analgesic compound is from about 2% to about 30% (w / w), in other embodiments, from about 2% to about 25% (w / w). In some of these embodiments, the weight of said analgesic compound is about 20% (w / w) of the combined weight of said poly(ester urea) polymer and bicarbonate additive.
[0130] In one or more embodiments, the bicarbonate additive is sodium bicarbonate. In some of these embodiments, the bicarbonate additive is sodium bicarbonate. In various embodiments, the weight of said bicarbonate additive is from about 0.1% to about 30% (w / w), preferably from about 1% to about 25% (w / w), and more preferably from about 1% to about 20% (w / w), of the combined weight of said PEU polymer and analgesic compound. In some embodiments, the weight of said bicarbonate additive is from about 1% to about 15% (w / w). In some embodiments, the weight of said bicarbonate additive is from about 0.01% to about 10% (w / w) of the combined weight of said poly(ester urea) polymer and analgesic compound.
[0131] The mixture / solution is then vigorously mixed so that the analgesic compound and bicarbonate additive are either dissolved or fully suspended in the polymer solution. In some embodiments, mixture / solution is mixed at a speed of from about 250 RPM to about 400 RPM for from about 4 hours to about 24 hours to ensure that the analgesic compound and bicarbonate additive are either dissolved or fully suspended in the polymer solution. This is the electrospinning solution that will be used to form the drug-loaded electrospun PEU nanofibers of the present invention.
[0132] Finally, the drug-loaded electrospinning solution described above are loaded into an electrospinning apparatus and spun into drug-loaded electrospun PEU nanofibers. Methods for electrospinning polymers into fibers are well known in the art and will be discussed here only to the degree necessary to understand the present invention. One advantage of using electrospun fibers is that the physical and dimensional properties of fiber matrices can be tuned precisely. As those of skill in the art will appreciate, fiber diameter, alignment, surface-to-volume ratio, and porosity can be controlled in the electrospinning process using known methods.
[0133] In some embodiments, once thoroughly mixed and additives suspended in solution, solutions are loaded into syringes. In one or more of these embodiments, electrospinning was completed using a Matregenix Electrospinning Machine SS-150 equipped with a flat collector, although any suitable electrospinning apparatus can be used. The syringes were placed in the syringe pump of the apparatus and connected by tubing to a 18G, or other suitable electrospinning needle. In some embodiments, the nanofibers were formed using a pump rate was 1 mL / hr, a needle tip to collector distance of 100 mm, a voltage of 15 kV, with ventilation on, and at ambient temperature. Solutions were electrospun to 70 and 140 µm thick substrates nanofibers.
[0134] In a third aspect, the present invention is directed to a method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers comprising: preparing a solution comprising a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units and a solvent suitable for electrospinning; adding an analgesic compound to the solution; adding sodium bicarbonate and mixing until the analgesic compound and the sodium bicarbonate are either dissolved or suspended in the polymer solution; and loading the mixture into an electrospinning apparatus and electrospinning the solution into drug-loaded electrospun PEU nanofibers having a diameter of from about 100 nm to about 2000 nm. In some embodiments, the drug-loaded electrospun PEU nanofibers will have a mean diameter from about 400 nm to about 1600 nm, in other embodiments, from about 500 nm to about 1500 nm, in other embodiments, from about 500 nm to about 1250 nm, in other embodiments, from about 500 nm to about 1000 nm, in other embodiments, from about 500 nm to about 750 nm, in other embodiments, from about 750 nm to about 1500 nm, in other embodiments, from about 1000 nm to about 1500 nm, and in other embodiments, from about 1250 nm to about 1500 nm.
[0135] In some embodiments, the analgesic compound will be meloxicam, bupivacaine, lidocaine, ropivacaine, etoricoxib, or combinations thereof. In some of these embodiments, the analgesic compound is meloxicam. In various embodiments, the bicarbonate additive may be sodium bicarbonate, or combinations thereof. In some of these embodiments, the bicarbonate additive is sodium bicarbonate and the weight of the sodium bicarbonate additive used is from about 0.1% to about 30% (w / w), preferably from about 1% to about 25% (w / w), and more preferably from about 1% to about 20% (w / w), of the combined weight of said poly(ester urea) polymer and analgesic compound.
[0136] In one or more of these embodiments, the drug-loaded electrospun PEU nanofibers of the present invention are inserted into the body of a patient. As set forth above and in the Examples, it has been unexpectedly found that the drug-loaded electrospun PEU nanofibers of the present invention have an increased rate release of said analgesic compound compared to comparable drug-loaded electrospun PEU nanofiber made without sodium bicarbonate. EXPERIMENTAL
[0137] To more fully illustrate and reduce the invention to practice, drug loaded nanofibers of the present invention were synthesized as set forth above and the meloxicam release behaviorwas extensively explored by changing polymer molecular weight, additive identity, additive load, and nanofiber mat thickness. Optimized nanofibers were implanted in a murine tibial fracture model to assess pain management in complex orthopedic trauma. Nanofiber implants resulted in greater serum and tissue concentrations of meloxicam at later timepoints and superior suppression of the COX-2 encoding gene than intraperitoneal and intramuscular meloxicam. As such, the nanofiber implants were found to demonstrate both superior and sustained pain management for more than three days. 1.1. Materials
[0138] All chemicals were used without further purification unless stated otherwise. 1,6- hexanediol (99%), 1,8-octanediol (98%), p-toluenesulfonic acid monohydrate (98%), sodium carbonate (99.5%), and triphosgene (98%) were purchased from Sigma Aldrich (Milwaukee, WI). L-valine (99%) and L-phenylalanine (98.5+%) were purchased from Acros (Pittsburgh, PA). Poly(ester urea) poly[(1-Val-8)30-co-(1-Phe-6)70] was provided by Viamer Biosciences (Durham, NC). Toluene, chloroform, acetone, water (HPLC grade), acetonitrile (ACS grade), and sodium bicarbonate (ACS grade) were purchased from Fischer Scientific International, Inc. (Pittsburgh, PA). Meloxicam (≥97%), anhydrous D-trehalose (99%), and ethyl alcohol (HPLC grade) were purchased from Thermo Fisher Scientific (Waltham, MA). 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP) (99.5%) was purchased from Oakwood Products, Inc. (Estill, SC). Phosphate buffered saline (PBS) was purchased from VWR International (Radnor, PA). Poly(D,L-lactide-co- glycolide) (Mw = 30-60 kDa) was purchased from Sigma Aldrich (St. Louis, MO). Polylactic acid (Mw= 40-80 kDa) was purchased from BIOSYNTH International, Inc. (Louisville, KY). 1.2. Electrospinning of Poly(ester urea) Nanofibers
[0139] Polymer solutions were prepared by dissolving the solid material in HFIP (4-13% w / w of polymer in solvent). Meloxicam (20% w / w of drug to polymer and additive) and additives trehalose or sodium bicarbonate (0%, 5% or 10% w / w additive to polymer and drug) were added. The solution was stirred (300 rpm) until homogeneous with meloxicam dissolved and additives suspended in solution. Meloxicam-loaded polymer nanofibers were fabricated using a Matregenix Electrospinning Machine SS-150 in a vertical approach with a needle facing upwards at a flat collector wrapped in non-stick aluminum foil. Syringes were loaded with the solution containing polymer, meloxicam, and additive, placed in a syringe pump, and connected by tubing to an 18gauge needle. Conditions included a pump rate of 1 mL / hr, needle tip to collector distance was 100 mm, voltage was 15 kV, with ventilation on. Electrospinning was performed at ambient temperature and humidity. Solutions were electrospun into thick nanofiber mats (70 or 140 µm). Mat thickness was measured using calipers for each sample. 1.3. Fiber Imaging and Characterization using Scanning Electron Microsopy
[0140] Biopsy punches (8 mm diameter) were used to collect circular samples which were adhered to scanning electron microscopy (SEM) stubs by carbon tape. A Denton Desk V sputter coater was used to sputter coat samples with gold (5 nm thick). A Thermo Fisher Scientific Aprea S SEM was used to image sputter coated samples. Fiber diameter was measured using SEM images and ImageJ software. 1.4. Meloxicam Content Quantification by HPLC
[0141] Meloxicam content was quantified using an Agilent 1290 Infinity II Ultra-High Pressure Liquid Chromatography (HPLC) system (Agilent Inc, MA, USA). Separation was performed using an Agilent Poroshell 120 EC-C18 column (2.1 x 50 mm, 1.9 µm) with an Agilent EC-C18 guard column (2.1 x 5 mm, 1.9 µm) maintained at a column temperature of 40 °C with a sample injection volume of 30 µL. Mobile phase A was 0.1% phosphoric acid in water and mobile phase B was acetonitrile. An isocratic method of 50:50 (A:B) was used at a flow rate of 0.15 mL / min for 3.25 min. The meloxicam retention time was 2.5 min. The meloxicam was quantified using a diode array detector (λ = 354 nm). The meloxicam content was quantified using the slope of a meloxicam standard calibration curve generated over 2 ng / mL (5.7 nM) to 24,000 ng / mL (68 µM). 1.5. Meloxicam Loading Efficiency
[0142] The meloxicam loading efficiency for nanofiber mats with varying molecular weights and additives is set forth in Table 1, below. For each sample. the nanofibers were dissolved in a mixture of acetonitrile and ethanol (50:50) and analyzed by HPLC for meloxicam content. Theoretical values were determined by the weight of the film and the drug loading. The amount of meloxicam detected from dissolved nanofibers was used to calculate the actual drug mass values. The loading efficiency was calculated by the actual meloxicam mass divided by the theoretical meloxicam mass. All values in Table 1 are reported as mean ± standard error (n = 5).Table 1 Meloxicam loading efficiency in nanofiber mats. Theoretical Actual Drug load Weight of the Loading Group meloxicam meloxicam (wt. %) fibers (mg) efficiency (%) mass (µg) mass (µg) 200805-C01 (8 kDa) 20 1.18 ± 0.05 236.6 ± 9.4 292.6 ± 13.3 124.6 ± 7.1 220921-B01 (11 kDa) 20 1.26 ± 0.08 252.3 ± 16.8 235.2 ± 16.3 93.1 ± 1.3 D-135-114 (44 kDa) 20 1.52 ± 0.07 303.6 ± 13.5 223.1 ± 10.7 74.2 ± 5.0 5% NaHCO3(44 kDa) 20 1.06 ± 0.02 213.9 ± 4.2 222.3 ± 5.5 103.9 ± 1.0 10% NaHCO3(44 kDa) 20 0.95 ± 0.03 190.8 ± 5.6 178.4 ± 5.0 93.6 ± 0.9 5% trehalose (44 kDa) 20 1.71 ± 0.06 341.4 ± 12.5 331.1 ± 10.8 97.1 ± 1.6 10% trehalose (44 kDa) 20 1.32 ± 0.06 263.3 ± 11.4 252.9 ± 11.8 96.0 ± 0.8 1.6. In vitro Meloxicam Release
[0143] Meloxicam release experiments were conducted using circular samples (8 mm diameter) of nanofiber mats at the desired thickness (70 µm or 140 µm). The mass of each sample was measured by an analytical balance and the thickness was measured using calipers. The meloxicam-loaded substrates were placed in glass scintillation vials and submerged with 1X PBS in an incubator on a shaker (37 °C, 100 rpm). The 1X PBS volume was varied to maintain sink conditions (three times meloxicam solubility in 1X PBS). Samples were transferred to vials containing fresh 1X PBS and returned to the incubator to continue the experiment at different time points (1, 6, 8, 10, 12 hours, and 1-7, 9, 11, 14, 16, 21, 24, 28, 35, 42, and 49 days). The solution in the original vials was used to quantify meloxicam content at each time point using HPLC the HPLC method described in section 1.4 above. 1.7. In vivo Murine Tibial Fracture Model
[0144] All procedures were conducted in accordance with protocols approved (A240-12-23) by the Institutional Animal Care and Use Committee (IACUC) of Duke University. Adult mice (8–16 weeks old, CD1, male and female, Charles River Laboratories) were used in all experiments unless otherwise specified. Animals were housed under approved conditions in the Duke University Animal Facility. Mice were utilized for behavioral and biochemical assessments. Mice were habituated to the testing environment for at least two consecutive days prior to baseline behavioral testing. Mechanical sensitivity was evaluated using a series of von Frey filaments(0.02–2.56 g; Stoelting) with logarithmically increasing stiffness. During testing, mice were placed in individual chambers on an elevated metal mesh floor, and the central plantar surface of the hind paw was stimulated perpendicularly. The 50% paw withdrawal threshold was determined using Dixon’s up-down method. (See, e.g., Chen G, Park CK, Xie RG, Ji RR. Intrathecal bone marrow stromal cells inhibit neuropathic pain via TGF-β secretion. J Clin Invest. 2015;125:3226-40, the disclosure of which is incorporated herein by reference in its entirety). Cold allodynia was assessed using the acetone drop method. A 20-μL droplet of acetone was gently applied to the plantar surface of the hind paw, and the animal’s nocifensive behavior was monitored for 60 seconds post- application. The cumulative duration of paw licking and flicking was recorded as a measure of cold sensitivity. (See, e.g., Chen G, Xie RG, Gao YJ, Xu ZZ, Zhao LX, Bang S, et al. β-arrestin- 2 regulates NMDA receptor function in spinal lamina II neurons and duration of persistent pain. Nat Commun. 2016;7:12531, the disclosure of which is incorporated herein by reference in its entirety).
[0145] After establishing baseline mechanical and cold allodynia levels, mice were randomly assigned to five experimental groups: 1X PBS injection (negative control), intraperitoneal meloxicam (5 mg / kg), intramuscular meloxicam (60 µg, to muscle over fracture site), meloxicam nanofiber mat, and meloxicam nanofiber mat with 10% NaHCO3. A tibial fracture model was used to induce postoperative pain, following previously established protocols. (See, e.g., Zhang L, Terrando N, Xu ZZ, Bang S, Jordt SE, Maixner W, et al. Distinct Analgesic Actions of DHA and DHA-Derived Specialized Pro-Resolving Mediators on Post-operative Pain After Bone Fracture in Mice. Front Pharmacol.2018;9:412, the disclosure of which is incorporated herein by reference in its entirety). Briefly, under isoflurane anesthesia, an incision was made on the left hind paw to expose the underlying muscle, which was then carefully separated. A 0.38-mm stainless steel pin was inserted into the tibia intramedullary canal, followed by the osteotomy. The incision was closed using 6-0 non-absorbable silk sutures.
[0146] The nanofibers were placed over the muscle at the fracture site prior to suturing the incision closed. The other treatments groups were administered after suturing the incision closed. Behavioral testing was performed at 0 h, 4 h, 8 h, and 1 D in male mice and 0 h, 4 h, 8 h, and 1 D- 7 D in female mice. Blood samples were taken at 4 h, 8 h, and 1 D and tissue samples were taken at 1 D in male mice. Blood samples were taken by puncturing the medial canthal vein at 4 h and 8 h; blood samples were taken by cardiac puncture at the 1 D terminal time point. Following the 1D blood sample, male mice were retired from the study and tissue samples were taken from the muscle adjacent to the fracture site. All mice were sacrificed by isoflurane euthanasia. Whole blood was processed to isolate serum by transferring to Eppendorf tubes, leaving at room temperature for 120 min to clot, centrifuging (3500 rpm, 15 min, 4 °C), and transferring the supernatant to Eppendorf tubes. Serum and tissue samples were stored at -80 ºC until analyzed. 1.8. Meloxicam Extraction from Serum and Tissue
[0147] Stock solutions of meloxicam and an internal standard were prepared in acetonitrile. Standards of meloxicam in serum were prepared by spiking naïve mouse serum (20 µL) with the internal standard (2.5 µL, 196 nM) and varying concentrations of meloxicam (2.5 µL) in centrifuge tubes. The mixtures were diluted with acetonitrile (75 µL), vortexed to mix, and centrifuged (5000 RPM, 8 min). The supernatants were recovered and transferred to HPLC vials with total recovery inserts. The same method was used for serum sample preparation. Serum sample (20.5 µL), internal standard (2.5 µL), and acetonitrile (77.5 µL) were combined in a centrifuge tube. The mixture was vortexed to mix and centrifuged (5000 RPM, 8 min). The supernatants were transferred to total recovery HPLC vials. Standards and experimental samples of MXM in serum were prepared fresh on the day of analysis, and the standards ranged from 0.8 ng / mL (2.28 nM) to 600 ng / mL (1710 nM) MXM.
[0148] Tissue standards and experimental samples were prepared by taking biopsy punches (2 mm) of mouse muscle, weighing, and digesting in a collagenase in 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) buffer solution (250 µL of 5 mg / mL) at 37 °C overnight. The standards were prepared by adding meloxicam standard (5 µL), internal standard (5 µL), and acetonitrile (250 µL) to digested naïve mouse tissue. The experimental samples were prepared by adding internal standard (5 µL, 196 nM) and acetonitrile (255 µL) to experiment mouse tissue. All samples were then homogenized (10,000 RPM, 25 sec) and centrifuged (5000 RPM, 8 min). The supernatants were recovered and transferred to HPLC vials with total recovery inserts. The standards and samples were prepared fresh on the day of analysis, and the standards ranged from 0.8 (2.28 nM) to 600 ng / mL (1710 nM) meloxicam. 1.9. Meloxicam Content Quantification by LC-MS / MS
[0149] Meloxicam concentration in serum and tissue was quantified by liquid chromatography – tandem mass spectrometry (LC-MS / MS) on an Agilent 1260 high-performanceliquid chromatography – mass spectrometry instrument equipped with a 6460 Agilent triple- quadrupole mass spectrometer with an electrospray ionization source (Agilent Inc, MA, USA). Separation was performed on an Agilent Zorbax XDB-C18 column (2.1 mm x 50 mm, 3.5 µm) maintained at a column temperature of 40 °C. The sample injection volume was 2 µL. Mobile phase A was a water-acetonitrile-formic acid solution (100:3:0.3) and mobile phase B was an acetonitrile-water-formic acid solution (100:3:0.3) with a flow rate of 0.5 mL / min. The gradient method was as follows: 0-0.5 min, 20% B; 0.5-4.5 min, 20-90% B; 4.5-6 min, 90% B; 6-6.1 min, 90-20% B; 6.1-8 min, 20% B. The meloxicam retention time was 4.4 min and the internal standard (bupivacaine) retention time was 3.6 min.
[0150] Meloxicam was quantified using electrospray in the positive mode with a capillary voltage of 3500 V and nozzle voltage of 500 V. The gas was nitrogen with a gas temperature of 300 °C, gas flow of 5 L / min, nebulizer pressure of 45 psi, sheath gas temperature of 250 °C, and sheath gas flow of 11 L / min.26Quantification was performed using the precursor ion to product ion transitions of 352 ^ 115 m / z for meloxicam and 289 ^ 140 for internal standard. The fragmentor voltage (V), collision energy (eV), dwell time, and cell accelerator voltage (V) were 145, 26, 200, and 4 for meloxicam and 94, 65, 200, and 4 for internal standard. 1.10. Quantitative Real-Time Polymerase Chain Reaction
[0151] Total RNA was extracted from the muscle sample using the Direct-zol RNA MiniPrep Kit (Zymo Research). RNA (0.5 µg) was reverse transcribed into cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). Specific primers, including those for the GAPDH control, were designed with IDT SciTools Real-Time PCR software. Gene-specific mRNA expression analyses were conducted using the MiniOpticon Real-Time PCR System (Bio-Rad). Quantitative PCR reactions were prepared with equal amounts of cDNA, containing 2× iQ SYBR Green Mix (Bio-Rad) (7.5 µL) and 300 nM of each forward and reverse primer, in a final volume of 15 μL. Primer sequences are provided below. Primer efficiencies were determined from standard curves and incorporated into the calculation of relative gene expression, which was normalized based on the real-time PCR threshold cycle (Ct) values of the target transcripts. The primer sequences (5’ to 3’) are as follows: Interleukin-1 beta (IL-1β) : forward – TGGACCTTCCAGGATGAGGACA (SEQ ID NO 1), reverse – GTTCATCTCGGAGCCTGTAGTG (SEQ. ID NO 2);Prostaglandin-endoperoxide synthase 2 (PTGS2): forward – GCGACATACTCAAGCAGGAGCA (SEQ ID NO 3), reverse – AGTGGTAACCGCTCAGGTGTTG (SEQ ID NO 4); glyceraldehyde-3-phosphate dehydrogenase (GAPDH): forward – AGGTCGGTGTGAACGGATTTG (SEQ ID NO 5), reverse – GGGGTCGTTGATGGCAACA (SEQ. ID NO 6). 1.11. Histology
[0152] Extraneous tissue and bone above and below the tibia fracture were removed. Samples were fixed in paraformaldehyde (4%) at 4 °C overnight, washed with 1X PBS, and stored in sucrose (30%) (>48h, 4 °C). Samples were embedded in peel-away histology molds with optimal cutting temperature (OCT) compound for cryosectioning. Samples were cryosectioned and stained with hematoxylin and eosin. Samples were imaged optically with a Keyence BZ-X710. 1.12. Statistical Analysis
[0153] All data is expressed as mean ± standard error. Statistical analysis was performed on JMP 17.2 (JMP Statistical Discovery, LLC). Data was analyzed by one-way ANOVA or two-way ANOVA followed by Tukey’s post hoc test. In some cases, the student’s t-test was used for pairwise analysis. The threshold for statistical significance was defined as follows: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. 2. Results and discussion 2.1. Meloxicam-loaded poly(ester urea) fiber fabrication
[0154] Di-p-toluenesulfonic acid monomer salts bis(L-phenylalanine-hexane-1,6-diester) (1- Phe-6) and bis(L-valine-octane-1,8-diester) (1-Val-8) were synthesized by Fischer esterification of the requisite amino acids and diols in the presence of p-toluenesulfonic acid. (See, FIG. 1) The stoichiometric ratio of the recrystallized di-p-toluenesulfonic acid monomer salts 1-Phe-6 and 1- Val-8 were controlled and polymerized in an interfacial reaction with triphosgene to yield poly(ester urea) (PEU) poly[(1-Phe-6)30-co-(1-Val-8)70] (FIG. 1, 2). Three different molecular masses of PEU were synthesized (Mn = 8 kDa, 12 kDa, 44 kDa) (FIGS. 3A-B, 4A-C), Table 2). PEUs at each molecular mass were combined with meloxicam (20% w / w) (FIG. 2) in a miscible solvent for electrospinning. The polymer concentration was varied for each molecular mass solution to produce uniform fibers when electrospinning at consistent parameters (15 kV, 100 mmdistance, 1 mL / hr feed rate). The required PEU concentration in solution decreased with increasing molecular mass due to increased viscosity with the greater polymer chain length. Table 2 Poly(ester urea) (PEU) poly[(1-Phe-6)30-co-(1-Val-8)70] characterization including number average molecular mass (Mn), weight average molecular mass (Mw), molar mass distribution (Đ), glass transition temperature (Tg), and degradation temperature (Td). Polymer lot Mn (g / mol) Mw (g / mol) Đ Tg (ºC) Td (ºC) 200805-C01 8,000 12,000 1.5 45 323 220921 12,000 22,000 1.8 -- -- D135-114 44,000 96,000 2.2 42 323
[0155] Polymer at a given molecular weight was combined with meloxicam (20% w / w) (FIG. 2) in a miscible solvent for electrospinning. The polymer concentration was varied for each molecular weight solution to produce uniform fibers when electrospinning at consistent parameters (15 kV, 100 mm distance, 1 mL / hr feed rate). The needed polymer concentration in solution decreased with increasing polymer molecular weight due to increased viscosity with the greater polymer chain length.
[0156] Reproducibility of the electrospinning process with PEU poly[(1-Phe-6)30-co-(1-Val- 8)70] (8 kDa) and meloxicam (20% w / w) was tested using identical solutions and electrospinning parameters (15 kV, 100 mm distance, 1 mL / hr feed rate). Nanofiber morphology and diameters were characterized by SEM (FIGS. 4A-C, 5A, 13A-D). A release study in 1X PBS for seven days was conducted to probe any batch-to-batch variations. (FIG. 5B-C) Meloxicam release was measured by removing the media for analysis by HPLC and replacing with fresh media. No significant differences in release kinetics or total meloxicam release were found among the nanofiber mats (n=5) indicating adequate reproducibility of the electrospinning process for the forthcoming work (FIG. 5B-C). 2.2. PEUs as a Suitable Meloxicam Vehicle
[0157] PEUs were chosen as the meloxicam carrier due to their synthetic versatility, biodegradability, and extensive prior work in drug delivery applications. To demonstrate the suitability of PEUs, poly[(1-Phe-6)30-co-(1-Val-8)70] was compared to poly(lactic-co-glycolic) acid (PLGA), a degradable, bulk eroding polymer commonly used in FDA-approved devices and drug formulations. Solutions containing meloxicam (20% w / w) and PLGA or PEU poly[(1-Phe- 6)30-co-(1-Val-8)70] were electrospun to the same thickness (70 µm) (FIG. 6A-E). Samples wereused in a release study (1X PBS, 37 ºC), and meloxicam release was monitored by HPLC. The PEUs performed similarly to PLGA with comparable release kinetics and total meloxicam released over the course of the release study (FIGS. 7A-C, 8A-B). The similarities in release behavior demonstrated that poly[(1-Phe-6)30-co-(1-Val-8)70] serves as a suitable polymer carrier alternative for drug delivery. Future work could explore the use of PEUs with different amino acids or diol chain lengths to alter drug release profiles. 2.3. Effect of Molecular Mass on Meloxicam Release Profiles
[0158] The impact of poly[(1-Phe-6)30-co-(1-Val-8)70]’s molecular mass on meloxicam release was assessed in electrospun nanofibers (70 µm) made from different molecular mass batches of the polymer (Mn = 8 kDa, 12 kDa, 44 kDa). Nanofiber morphology was assessed by SEM to confirm uniform fibers were formed for all three groups (FIG. 4A-C). Meloxicam release was assessed in a release study out to 49 days (1X PBS, 37 ºC).
[0159] Each of the molecular mass formulations exhibited a burst release behavior with at least half of the meloxicam release occurring in the first day (FIG.7A). The lower molecular mass groups (8 kDa, 12 kDa) exhibited the most burst release behavior with minimal meloxicam release after one day whereas the higher molecular mass group (44 kDa) continued to slowly release meloxicam past day one (FIG. 7C). In an extended release study to 49 days (FIG. 9A-C), the 44 kDa group continuously released meloxicam to 15 days before plateauing to minimal meloxicam release. The 8 kDa group and 12 kDa formulations released minimal amounts of meloxicam after day two and one respectively. The difference in the release behavior was further assessed by normalizing to the same magnitude of total meloxicam released (%) (FIG. 8A-B). The 44 kDa group’s sustained meloxicam release was significant compared to 8 kDa and 12 kDa formulations. This indicates that polymer molecular mass plays a notable role in release kinetics. The role of polymer molecular weight is speculated to impact release kinetics due to differences in glass transition temperature (FIG.3A-B) and increased number of hydrogen bonds per chain with longer chain lengths. High molecular mass resulted in sustained, long-term release; low molecular mass generally resulted in burst release. The slower and more continuous release of meloxicam at 44 kDa was desirable for extended release applications over multiple days.
[0160] The magnitude of total meloxicam release (%) was also assessed to identify if molecular weight impacted the quantity of meloxicam released. There were minor differences in the total meloxicam released (%) between the 8 kDa group and the other two molecular weightsby day five (FIG. 7B). While there were statistically significant variations in total meloxicam released by day five, the differences in magnitude were not considered to be biologically meaningful as they attributed to a maximum difference of 10% meloxicam released (8 kDa: 26.9% ± 0.7, 12 kDa: 17.9% ± 0.8, 44 kDa: 18.1% ± 0.7) (FIG. 7C). Additionally, the total meloxicam released was well below the total theoretical meloxicam loading. Data measured at 49 days demonstrated further release (See, FIGS. 9A-C). However, the rate of meloxicam release beyond four days was slow and not expected to be biologically meaningful. The 44 kDa group’s sustained release over days one through five was desirable for non-acute pain management applications. Poly[(1-Phe-6)30-co-(1-Val-8)70] (44 kDa) was chosen as the optimized polymer molecular mass and used in further work aimed at augmenting the total release. 2.4. Effect of fiber composition on meloxicam release profiles
[0161] Altering the molecular mass changed the release kinetics and had a minor impact on the total meloxicam released; however, more than 70% of meloxicam remained trapped in the nanofibers, even with extended release out to 49 days (FIG. 9A-C). The use of additives was investigated in an attempt to amplify the meloxicam release. Additives are expected to increase the porosity of the nanofibers due to fast dissolution, allowing for greater media penetration and consequently greater meloxicam release. The additives also impact the ability of meloxicam to hydrogen bond with the urea groups in the PEU. Sodium bicarbonate and trehalose were separately added into meloxicam (20% w / w)–PEU poly[(1-Phe-6)30-co-(1-Val-8)70] (44 kDa) solutions at varying concentrations (5%, 10% w / w additive to polymer and meloxicam). Due to solubility limitations, additives were not fully dissolved but remained suspended in the solution during the electrospinning process. All groups were electrospun using the same parameters (15 kV, 100 mm distance, 1 mL / hr feed rate) to the same thickness (70 µm) (FIG. 11A-B). Meloxicam release in a release study (1X PBS, 37 °C) was monitored by HPLC.
[0162] The use of sodium bicarbonate in the nanofibers had a significant impact on the meloxicam release. The 10% NaHCO3 formulations released significantly more meloxicam per day (day 1: 57 ± 6 µg; day 2: 23 ± 4 µg; day 3: 12 ± 1 µg) than the 0% additive group over days one through three day 1: 30 ± 6 µg; day 2: 15 ± 2 µg; day 3: 4.1 ± 0.4 µg) (FIG. 12A-C). Additionally, the sodium bicarbonate groups (5%, 10% w / w) exhibited similar sustained release kinetics over days one through five as the 0% additive (44 kDa) (FIG. 12A-B). The total meloxicam released (%) by day five was one and a half-fold greater with the presence of 5%sodium bicarbonate compared to 0% additive; the 10% NaHCO3group had a two-fold increase in total meloxicam released (%) by day five compared to 0% additive. (FIG. 12C) The increase in meloxicam release is notable for both the increase in meloxicam delivered and the decrease in meloxicam remaining trapped and unusable in the fibers.
[0163] In an extended release study out to 49 days, the sustained release behavior in sodium bicarbonate containing nanofibers continued until they maxed out at 80% cumulative meloxicam release (FIG. 11C). Interestingly, NaHCO3formulations (5%, 10% w / w) converged at 80% cumulative release at 49 days while 0% additive release maxed out at 25%. The use of NaHCO3 was essential to achieving high meloxicam release by 49 days and the higher sodium bicarbonate resulted in a faster meloxicam release (FIG. 10A-D). The 10% NaHCO3group was identified as an optimized formulation due to its greater release over days one through five as well as the greater total meloxicam released compared to 0% and 5% NaHCO3. (FIG. 11A-C, 11A-D, 24)
[0164] Trehalose did not have a significant impact on meloxicam over five days. Trehalose (5%, 10% w / w) achieved similar daily meloxicam release, release kinetics, and total release as 0% additive over five days. (FIG. 12A-C) However, in an extended release study out to 49 days, trehalose did surpass the 0% additive group due to meloxicam released over five to 21 days (FIG. 10C). Notably, 5% and 10% trehalose converged to the same total meloxicam released by 49 days of 58% similarly to how sodium bicarbonate converged to the same end point (FIG.10C). For both trehalose and sodium bicarbonate, the quantity of additive impacted the rate of release but not the total release by 49 days (FIG. 10D). While trehalose did not impact the rate of meloxicam release (FIG. 11A-C), it did more than double the total meloxicam released by 49 days (FIG. 10D). This is likely due to an increase in surface area as the trehalose dissolves from the fibers. However, there was no difference in the release curves or the total meloxicam released over the first five days with the use of trehalose. 2.5. Effect of Mat Thickness on Meloxicam Release Profiles
[0165] In order to increase the total dose of meloxicam delivered from implants, the thickness of the nanofiber mat was doubled (70 µm, 140 µm) (FIG. 13A-D), which should roughly double the surface area and amount of meloxicam in the substrates. Samples were subjected to electron beam exposure (18 kGy) for sterilization. E-beam sterilization did not impact nanofiber morphology or release behavior (FIG. 14). The release characteristics at the two thicknesses were evaluated to probe changes in dose per day, release curve, and total release of meloxicam from thenanofibers in 1X PBS over five days. The increase in thickness only significantly changed the dose per day at day 2 for 10% NaHCO3 (FIG. 15A). This was not concerning considering the lack of change in release curves (FIG. 15B) and total meloxicam released at day five (FIG. 15C). Increasing nanofiber mat thickness is an effective way of controlling the meloxicam delivered without substantially altering the release behavior. The 0% additive and 10% NaHCO3 groups with electron beam exposure and at 140 µm thick sample size were used in all further studies. 2.6. Murine tibial fracture model
[0166] The efficacy of meloxicam loaded nanofibers was evaluated using a murine tibial fracture model (FIG. 16A). This mouse model is an orthopedic trauma model involving complex muscle, bone, nerve, and connective tissue damage and is representative of similar orthopedic injuries in humans. The murine tibial fracture model induces mechanical allodynia for up to five weeks post injury. Treatment was administered directly after fracture. Meloxicam-loaded PEU nanofibers (0% or 10% w / w sodium bicarbonate, 20% w / w meloxicam, 44 kDa PEU, 140 µm) were implanted between the subcutaneous tissue and muscle layers over the fracture site and the incision was closed with sutures. NaHCO3(10% w / w) was chosen because it increased meloxicam release compared to trehalose and 5% w / w NaHCO3 over 5 days. The 140 µm sample thickness was chosen in order to deliver a larger therapeutic dose of meloxicam. The two nanofiber implant groups were compared with three control groups: a intraperitoneal (I.P.) injection of PBS (negative control), an I.P. (5 mg / kg) injection of meloxicam (systemic positive control), and an intramuscular (I.M.) (60 µg) injection (local positive control). Behavioral testing, blood samples, and tissue samples were taken at specific time points (FIG. 16B). Mechanical allodynia behavioral data was collected using Von Frey filaments and measuring the paw withdrawal threshold. Cold allodynia behavioral data was collected using an acetone test and measuring nocifensive behavior (i.e., lifting or licking response). (See, e.g., Chen G, Park CK, Xie RG, Ji RR. Intrathecal bone marrow stromal cells inhibit neuropathic pain via TGF-β secretion. J Clin Invest. 2015;125:3226-40 and Chen G, Xie RG, Gao YJ, Xu ZZ, Zhao LX, Bang S, et al. β-arrestin-2 regulates NMDA receptor function in spinal lamina II neurons and duration of persistent pain. Nat Commun. 2016;7:12531, the disclosures of which are incorporated herein by reference in their entirety). Only male mice were used for blood (4 h, 8 h, 1D) and tissue samples (1D). Behavioral testing after 1 D was collected with only female mice. Behavioral testing completed with both male and female mice(BL, 0 h, 4 h, 8 h, 1 D) and were assessed for possible sex-based differences (FIG. 18A-B). No sex-based differences were observed in mechanical or cold allodynia. (See, FIG. 17C-D)
[0167] In the mechanical allodynia behavioral testing, all positive control and implant groups demonstrated similar paw withdrawal thresholds at 0 h and 4 h (FIG. 17A-B). After these initial timepoint, the implants induced high paw withdrawal thresholds for a longer period of time than the positive control groups. The I.M. and I.P. groups converged to low paw withdrawal threshold scores by 2 D indicating minimal pain relief. The I.M. and I.P. were not effective treatment methods for longer pain relief than 1 D due to the rapid clearance and one-time delivery of meloxicam. The 10% NaHCO3 achieved the greatest sustained paw withdrawal thresholds as observed at 2 D with a greater paw withdrawal than all other groups including 0% NaHCO3(p < 0.01). The superior pain relief performance from the implants was also observed in the cold allodynia (FIG. 17B). The I.M. and I.P. groups had similar nocifensive response as the PBS injection by 1D while the implants had reduced nocifensive behavior (p < 0.0001). The marked decrease in nocifensive behavior was sustained for three days before converging at day four with the positive and negative control groups. Behavioral testing demonstrated that the implants were an effective pain management strategy for sustained periods of time out to 3 D. The implants achieved greater and longer pain relief than I.M. and I.P. delivery, and 10% NaHCO3performed better than 0% NaHCO3 in mechanical allodynia. Meloxicam-loaded nanofiber implants are a superior alternative to current clinical standards of daily meloxicam delivery for short term pain management. 2.7. In vivo Pharmacokinetics
[0168] Meloxicam content in serum and tissue was collected by extracting meloxicam from samples and quantifying by liquid chromatography – tandem mass spectrometry (LC-MS / MS). The implants (0%, 10% NaHCO3) performed similarly in serum as in vitro with the greatest meloxicam content at 4 h (i.e., ≈ 7 µM) and decreasing at 8 h (i.e., ≈ 4 µM) until a negligible amount was detected at 24 h (i.e., ≈ 0.1 µM) (FIG.17C, Table 3). The lack of significant difference in serum levels between the two implant groups was accounted to the limited time points; additional timepoints would be expected to demonstrate measurable differences in release with greater meloxicam levels from the 10% NaHCO3 group. For comparison implants to another local meloxicam treatment, a group of mice received meloxicam I.M. (60 µg). Meloxicam serum concentrations from implant groups were significantly higher at all measured time points than I.M.treatment. The greater systemic circulation of meloxicam from implants than I.M. was expected due to the greater amount of meloxicam present in the implants (FIGS. 12A-C, 15A-C, Table 3). Additionally, the implants were placed below the subcutaneous tissue layer where meloxicam can more readily enter systemic circulation than I.M. injections. Comparison of implants to systemic meloxicam delivery was achieved with a group of mice that received meloxicam I.P. (5 mg / kg). Meloxicam serum concentrations from I.P. delivery compared to the implants were two-fold higher at 4 h and nearly three-fold lower by 8 h. The implants achieved a more sustained level of meloxicam than I.P. injections which were rapidly cleared. The meloxicam content in muscle was measured at 1D from muscle samples taken at the fracture site. The implants had a greater average magnitude of meloxicam in muscle in tissue than the controls (FIG. 17C), Table 3). The greater local concentration of meloxicam in implant groups with the sustained analgesic effect suggests the implants had sustained release and the local levels were sufficient enough to inhibit pain. Table 3 Pharmacokinetic data from murine tibial fracture model of meloxicam delivery by intraperitoneal (I.P.) injection, intramuscular (I.M.) injection, or meloxicam-loaded PEU nanofiber implant (0%, 10% NaHCO3). Treatment Theoretical Experimental C4hserum C8hserum C1DC1Dmuscle meloxicam meloxicam (nM)a)(nM)a)serum (ng / g loading (µg) loading (µg) (nM)a)muscle)b)I.P. (5 mg kg-1) – 150-240 11100 ± 790 1450 ± 170 568 ± 250 3.6 ± 0.5 I.M. (60 µg) – 60 1130 ± 460 499 ± 52 6.1 ± 0.7 5.6 ± 2.4 Implant 304 ± 13.5c)223 ± 10.7d)6990 ± 340 4210 ± 310 156 ± 26 55.9 ± 26 (0% NaHCO3) Implant 190 ± 5.6c)179 ± 5.0d)6500 ± 340 4380 ± 130 98.1 ± 9.2 41.6 ± 18 (10% NaHCO3) a)Concentration of meloxicam in serum at specific time points;b)concentration of meloxicam in muscle taken at
[0169] Two key genes were identified to potentially be impacted by meloxicam delivery: interleukin-1 beta (IL-1β) and prostaglandin-endoperoxide synthase 2 (PTGS2). IL-1β is a pro- inflammatory cytokine that is produced in response to stimuli (i.e., fractures, infection, etc.). High IL-1β expression is expected at the onset of an injury and should decrease with decreasing inflammation stimuli. (See, e.g., Lange J, Sapozhnikova A, Lu C, Hu D, Li X, Miclau T, 3rd, et al. Action of IL-1beta during fracture healing. J Orthop Res. 2010;28:778-84, the disclosure ofwhich is incorporated herein by reference in its entirety). The PTGS2 gene expression was assessed because its gene encodes prostaglandin-endoperoxide synthase, also known as COX-2, which converts arachidonic acid to prostaglandins in response to inflammation. (See, e.g., Jang Y, Kim M, Hwang SW. Molecular mechanisms underlying the actions of arachidonic acid-derived prostaglandins on peripheral nociception. Journal of Neuroinflammation. 2020;17:30, the disclosure of which is incorporated herein by reference in its entirety). Increased prostaglandin production triggers PTGS2 to encode more COX-2 as a feedback loop. (See, e.g., Martín-Vázquez E, Cobo-Vuilleumier N, López-Noriega L, Lorenzo PI, Gauthier BR. The PTGS2 / COX2-PGE(2) signaling cascade in inflammation: Pro or anti? A case study with type 1 diabetes mellitus. Int J Biol Sci. 2023;19:4157-65, the disclosure of which is incorporated herein by reference in its entirety). Meloxicam, as a COX-2 inhibitor, is expected to reduce PTGS2 expression by inhibiting prostaglandin synthesis. Both IL-1β and PTGS2 expression were assessed by qPCR of muscle at one day after treatment. All meloxicam treatment groups exhibited down regulated IL-1β relative to the negative control (1X PBS) (FIG. 19A). This indicated that meloxicam was inhibiting inflammation as expected of an NSAID and COX-2 inhibitor. All meloxicam treatment groups had reduced PTGS2 expression relative to the negative control (FIG. 19B). There was a greater reduction in PTGS2 expression from the implant groups; this indicated greater COX-2 inhibition and consequently reduced inflammation. The reduced PTGS2 expression from implants is corroborated by the greater average meloxicam content in muscle. Together, the reduced PTGS2 expression and greater local levels of meloxicam further validate the behavioral data’s conclusions that the implants were more effective at inhibiting pain than I.P. or I.M. injections of meloxicam. 2.9. Histopathological assessment
[0170] The nanofiber implants (20% meloxicam; 0%, 10% NaHCO3) in the murine tibial fracture model were assessed for inflammatory response (FIG. 19C). No visual signs of inflammation or non-healing wounds were observed in mice out to seven days. H&E-stained sections at one day post implantation showed no major biocompatibility issues. A thin biofilm formed around the implant, as expected, however no foreign-body giant cells or fibrous capsules surrounding the capsule were observed. The implants with and without NaHCO3exhibited no histopathological differences.3. Conclusion
[0171] Electrospun PEU nanofibers were optimized to controllably release meloxicam over a five-day time frame of interest for acute pain management. Higher PEU molecular mass resulted in a prolonged release out to five days. The use of additives increased the total meloxicam release with a more than two-fold increase in meloxicam released by day five with sodium bicarbonate (10% w / w). The total dose of meloxicam delivered could be further tuned by increasing the mat dimensions, size or thickness. Nanofibers were used in a murine tibial fracture model to assess acute pain management performance in comparison to I.P. and I.M. delivery of meloxicam. The nanofibers outperformed traditional delivery methods with reduced mechanical and cold allodynia for up to three days from a one-time implant. Additionally, the sodium bicarbonate loaded implants had superior pain inhibition compared to 0% additive implants. Reduced Ptgs2 expression, higher tissue concentrations, and expected continual meloxicam release from the implants were all factors in the reduction of inflammation over time. Future work will assess the impact of alternative PEU formulations and additives on release properties and further explore the controlled release behavior of drugs from PEU nanofiber implants in vivo. The use of the implants could be further assessed in more advanced clinical pain models to assess their efficacy in treating open or cavity wounds such as burns or gunshot injuries. EXAMPLES
[0172] The following examples are offered to more fully illustrate the invention, but are not to be construed as limiting the scope thereof. Further, while some of examples may include conclusions about the way the invention may function, the inventor do not intend to be bound by those conclusions, but put them forth only as possible explanations. Moreover, unless noted by use of past tense, presentation of an example does not imply that an experiment or procedure was, or was not, conducted, or that results were, or were not actually obtained. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature), but some experimental errors and deviations may be present. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
[0173] Various amino acid based monomers were synthesized (see Scheme 1, above) and characterized using1H-NMR. In particular, 1,6-hexanediol and 1,8-octanediol were coupled to thecarboxylic acid of L-phenylalanine and L-valine, respectively, through an esterification using p- toluenesulfonic acid to prevent the amine moiety. The resulting monomers were named based on their diol chain length and amino acid; (1-Val-8) formed from 1,8-octanediol andL-valine, (1-Phe- 6) formed from 1,6-hexanediol and L-phenylalanine. Materials and Methods Materials for Examples 1 to 8
[0174] Poly(ester urea) poly[(1-Val-8)30-co-(1-Phe-6)70] was provided by Viamer. Meloxicam, anhydrous D-trehalose (99%), and ethyl alcohol (HPLC grade) were purchased from Thermo Fisher Scientific (Waltham, MA). 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP) was purchased from Oakwood Products, Inc. (Estill, SC). Phosphate buffered saline (PBS) was purchased from VWR International (Radnor, PA). Sodium bicarbonate (ACS grade), water (HPLC grade), and acetonitrile (HPLC grade) were purchased from Fisher Scientific International, Inc. (Pittsburgh, PA). All chemicals were used without further purification unless otherwise stated. Characterization
[0175] Proton (1H) nuclear magnetic resonance (NMR) spectra were obtained using an Agilent Varian 500 MHz Agilent spectrometer. Chemical shifts are reported in parts per million (ppm). Residual solvent resonances of DMSO‑d6at δ = 2.50 ppm were present.
[0176] Molecular masses were determined by size-exclusion chromatography in tetrahydrofuran using a HLC-8420 GPC (Tosoh Bioscience) with UV and RI detectors.
[0177] Glass transition temperatures (Tg) were determined by differential scanning calorimetry (DSC) on a TA Instruments Discovery DSC 250. Samples were loaded in Tzero hermetic pans and subjected to heat-cool-heat cycles from -10ºC to 140ºC at a ramp rate of 10ºC / min under nitrogen. The Tg values were determined from the midpoint of the second heating cycle curve using TRIOS software. Degradation temperatures were determined by thermogravimetric analysis (TGA) on a TA Instruments Discovery TGA 550. Samples were heated from 30ºC to 700ºC at a ramp rate of 10ºC / min under nitrogen. (See, FIG. 20)Example 1 Synthesis of di-p-toluenesulfonic acid monomer salts
[0178] Synthesis of di-p-toluenesulfonic acid monomer salts of bis(L-valine-octane-1,8- diester) (1-Val-8) and bis(L-phenylalanine-hexane-1,6-diester) (1-Phe-6) was as follows. For each monomer, the diol (1 eq.), amino acid (2.3 eq.), p-toluenesulfonic acid monohydrate (2.4 eq.), and toluene (1000 mL) were added to a 3 L, three-neck round bottom flask equipped with a stir bar. A Dean-Stark trap was attached to the round bottom flask, and the reaction was heated to reflux for 24 h. The reaction was cooled to room temperature, and the white precipitate was isolated by vacuum filtration. The white precipitate was collected by filtration and recrystallized using water three times. (See, FIG. 1) Example 2 Synthesis of poly(ester urea) copolymers
[0179] In these embodiments, the poly[(1-Val-8)30-co-(1-Phe-6)70] PEU polymers were synthesized as shown in Scheme 4, below.(See also, FIG. 1) Scheme 4 O H2N CO OHHOO In theseoctane-1,8- diester) (1-Val-8) and bis(L-phenylalanine-hexane-1,6-diester) (1-Phe-6) were prepared as set forth in Example 1, above and reacted as shown in Scheme 4 to form the poly[(1-Val-8)30-co-(1- Phe-6)70] PEU polymer.Example 3 Electrospinning PEU films
[0180] Solutions were prepared by dissolving poly[(1-Val-8)30-co-(1-Phe-6)70] in HFIP (5- 10% w / w of polymer in solvent). Meloxicam (20% w / w of drug to polymer and additive) and additives trehalose or sodium bicarbonate (0%, 5%, or 10% w / w additive to polymer and drug) were added. The solution was stirred at 300 rpm overnight. Once thoroughly mixed with additives suspended in solution, solutions were loaded into syringes. Electrospinning was completed using a Matregenix Electrospinning Machine SS-150 equipped with a flat collector. Syringes were placed in the syringe pump and connected by tubing to a 18G needle. Pump rate was 1 mL / hr, needle tip to collector distance was 100 mm, voltage was 15 kV, ventilation on, and ambient temperature. Solutions were electrospun to 70 and 140 µm thick substrates of nanofibers. (See, FIG. 21). The substrate thickness for each sample used was measured using calipers. (See, FIGS. 21-25, 12A-C, and 15A-C) Example 4 Scanning Electron Microscopy (SEM)
[0181] Samples were cut into 8 mm diameter circles and adhered to SEM stubs by carbon tape. Samples were sputter coated with gold (5 nm thickness) using a Denton Desk V sputter coater. Samples were imaged using a Thermo Fisher Scientific Aprea S SEM. (See, FIGS. 21A- D) The fiber diameters were measured using the SEM imaging and ImageJ. (See, FIGS. 22, 24) Example 5 Meloxicam content quantification using HPLC
[0182] Meloxicam content was quantified using an Agilent 1290 Infinity II ultra-high pressure liquid chromatography (HPLC) system equipped with a 1290 flexible pump (G7104A), 1290 vialsampler (G7129B), 1260 multicolumn thermostat (G7116A), and 1290 diode array detector FS (G7117A) (Agilent Inc, MA, USA). Separation was performed using an Agilent ZORBAX RRHD Eclipse Plus C18 column (2.1 x 50 mm, 1.8 µm) with an Agilent EC-C18 guard column (2.1 x 5 mm, 1.9 µm) maintained at a column temperature of 40 ºC with a sample injection volume was 20 µL. Mobile phase A was 0.1% phosphoric acid in water and mobile phase B was acetonitrile. The gradient method used a flow rate of 0.7 mL / min as follows: 0-0.5 min: 40-80% B; 0.5-2 min: 80% B. The meloxicam retention time was 1.2 min. The total run time was 2 min plus a post run of 1 min. Meloxicam was quantified at a wavelength of 354 nm. The meloxicamcontent was quantified using the slope of the meloxicam standard calibration curve generated over 0.0001 mg / mL to 0.5 mg / mL. (See, FIGS. 12A-C, 25A-C, 15A-C). Example 6 Effects of electronic beam sterilization
[0183] Nanofiber samples were packaged in well plates in sealed sterilization pouches. Samples were pre-processed by refrigerating for 4 h before electron beam irradiation. Electron beam irradiation was carried out at a target dose of 18 kGy with a dose range of about 16 to about 20 kGy on nanofiber samples packaged inside sealed sterilization pouches. Samples were post- processed by refrigeration for 2 h. The ebeam samples were quantified using by HPLC using experimental protocol set forth in Example 5. The in vitro drug release for these samples was evaluated using the protocols set forth in Example 7, below. The results are shown in FIGS.25A- C. Example 7 In vitro drug release
[0184] Drug release experiments were conducted using 8 mm diameter circles of substrate. The mass of each sample was measured by an analytical balance and the thickness was measured using calipers. The drug-loaded substrates were placed in glass scintillation vials and submerged with 1X PBS (n = 5). The 1X PBS volume was varied to maintain sink conditions (three times drug solubility) and incubated at 37 ºC at 100 rpm. At 1, 2, 3, 4, 5, 6, 8, 10, 12 hours and 1-7 days, the samples were transferred to vials containing fresh solution and returned to the incubator to continue the experiment. The solution in the original vials was used to quantify meloxicam content at each time point using HPLC. (See, FIGS. 12A-C, 15A-C, 25A-C) Example 8 Drug content uniformity
[0185] Samples were taken from different sections of the electrospun substrates at the requisite thickness. The substrates were dissolved in a 7:3 mixture of acetonitrile / ethyl alcohol for 24 h in an incubator (37 ºC, 100 rpm). Samples were diluted in a 9:1 ratio of 1X PBS to organic mixture. Meloxicam content was quantified using HPLC. Meloxicam content was compared to the theoretical value (mass of film multiplied by drug loading) to determine the theoretical accuracy. This process was also used for release study samples upon the completion of the study (n = 5) toverify the accuracy of the cumulative drug release measurements. (See, FIGS. 12A-C, 15A-C, 25A-C) Materials for Examples 9 to 16
[0186] 1,6-hexanediaol, 1,8-octanediol, p-toluenesulfonic acid monohydrate, sodium carbonate, and triphosgene were purchased from Sigma Aldrich (Milwaukee, WI). Toluene, chloroform, and acetone were purchased from Fischer Scientific (Pittsburgh, PA). L-valine and L- phenylalanine were purchased from Acros (Pittsburgh, PA). Polylactic acid was purchased from BIOSYNTH International, Inc. (Louisville, KY). Example 9 Synthesis of toluenesulfonic acid monomer salts.
[0187] Synthesis of di-p-toluenesulfonic acid monomer salts of bis(L-valine-octane-1,8- diester) (1-Val-8) and bis(L-phenylalanine-hexane-1,6-diester) (1-Phe-6) were similar to methods described previously. (See, e.g., Dreger NZ, Fan Z, Zander ZK, Tantisuwanno C, Haines MC, Waggoner M, et al. Amino acid-based Poly(ester urea) copolymer films for hernia-repair applications. Biomaterials. 2018;182:44-57; Gao Y, Childers EP, Becker ML. l-Leucine-Based Poly(ester urea)s for Vascular Tissue Engineering. ACS Biomater Sci Eng. 2015;1:795-804; Childers EP, Peterson GI, Ellenberger AB, Domino K, Seifert GV, Becker ML. Adhesion of Blood Plasma Proteins and Platelet-rich Plasma on l-Valine-Based Poly(ester urea). Biomacromolecules. 2016;17:3396-403; Policastro GM, Lin F, Smith Callahan LA, Esterle A, Graham M, Sloan Stakleff K, et al. OGP Functionalized Phenylalanine-Based Poly(ester urea) for Enhancing Osteoinductive Potential of Human Mesenchymal Stem Cells. Biomacromolecules.2015;16:1358- 71; Stakleff KS, Lin F, Smith Callahan LA, Wade MB, Esterle A, Miller J, et al. Resorbable, amino acid-based poly(ester urea)s crosslinked with osteogenic growth peptide with enhanced mechanical properties and bioactivity. Acta Biomaterialia. 2013;9:5132-42; and Yu J, Lin F, Lin P, Gao Y, Becker ML. Phenylalanine-Based Poly(ester urea): Synthesis, Characterization, and in vitro Degradation. Macromolecules. 2014;47:121-9, the disclosures of which are incorporated herein by reference in their entirety).
[0188] Briefly, the respective diol (1.00 eq.), amino acid (2.30 eq.), p-toluenesulfonic acid monohydrate (2.40 eq.), and toluene (1000 mL) were added to a 3 L, three-neck round bottom flask equipped with a stir bar. A Dean-Stark trap was attached to the round bottom flask, and thereaction was heated to reflux for 24 h. The reaction was cooled to room temperature, and the white precipitate was isolated by vacuum filtration. The white precipitate was collected by filtration and recrystallized in water three times. (See, FIG. 1) Example 10 Synthesis of poly(ester urea) poly[(1-Phe-6)30-co-(1-Val-8)70].
[0189] Poly(ester urea) copolymer poly[(1-Phe-6)30-co-(1-Val-8)70] (F630V870) was synthesized by interfacial polymerization similar to previously described methods. (See, e.g., Dreger NZ, Fan Z, Zander ZK, Tantisuwanno C, Haines MC, Waggoner M, et al. Amino acid- based Poly(ester urea) copolymer films for hernia-repair applications. Biomaterials.2018;182:44- 57; Brigham NC, Nofsinger R, Luo X, Dreger NZ, Abel AK, Gustafson TP, et al. Controlled release of etoricoxib from poly(ester urea) films for post-operative pain management. J Control Release. 2021;329:316-27; Stinson NC, Matsuoka Y, Agarwal A, Dziewior CS, McDonald SM, Li Y, et al. Pre-Clinical Assessment of Bupivacaine-Loaded Poly(ester urea) Thin Films for Controlled Drug Release and Effective Pain Management After Surgery. Adv Healthc Mater. 2025;14:e2402800; and Abel AK, Dreger NZ, Nettleton K, Gustafson TP, Forster SP, Becker ML. Amino Acid-Based Poly(ester urea)s as a Matrix for Extended Release of Entecavir. Biomacromolecules. 2020;21:946-54, the disclosures of which are incorporated herein by reference in their entirety).
[0190] The di-p-toluenesulfonic acid monomer salts were combined in the desired molar equivalents (0.30 eq. of 1-Phe-6 and 0.70 eq. of 1-Val-8) with sodium carbonate (3.10 eq.) in hot distilled water in a 5 L three-neck round-bottom flask. The flask was equipped with an overhead mechanical stir rod. The solution stirred for one hour until the monomers were dissolved. The reaction mixture was placed in an ice bath to cool to 0 ºC. Separately, triphosgene (0.40 eq.) was dissolved in chloroform. The triphosgene and chloroform solution was slowly added to the three- neck round-bottom flask. The resulting mixture was stirred at room temperature for 24 h. The reaction mixture was transferred to a separatory funnel and precipitated into hot water. The polymer was collected, frozen in liquid nitrogen, and dried under reduced pressure to remove residual nitrogen. (See, FIGS. 1, 2)Example 11 Nuclear Magnetic Resonance (NMR) Spectroscopy.
[0191] An Agilent Varian 500 MHz Agilent spectrometer was used to collect proton (1H, 500 MHz) and carbon (13C, 125 MHz) nuclear magnetic resonance (NMR) spectra. Chemical shifts were reported in parts per million (ppm). Residual solvent resonances of DMSO‑d6 at δ = 2.50 ppm were present. (See, FIG. 26). Example 12 Size-Exclusion Chromatography (SEC).
[0192] A TOSOH Bioscience HLC-8320 GPC was used to perform size-exclusion chromatography to determine molecular mass and molecular mass distribution of each polymer sample. Samples (~10 mg) were analyzed on a TOSOH Bioscience HLC-8320 GPC with a TSKgel GMHHR-N mixed bed column and UV and RI detectors in tetrahydrofuran. Samples were prepared by dissolving polymer in HPLC-grade tetrahydrofuran at concentrations of 1-2 mg / mL. A calibration curve created from NIST certified polystyrene standards was used to determine molecular masses of samples. Number average molecular mass (Mn), weight average molecular mass (Mw), and molar mass distribution (Đ) were reported. The GPC traces are shown in FIG. 3A and the average molecular mass (Mn), weight average molecular mass (Mw), and molar mass distribution (Đ) are reported on Table 2. Example 13 Differential Scanning Calorimetry (DSC).
[0193] A TA Instruments Discovery DSC 250 was used to perform thermal analysis. Samples were prepared by loading tzero hermetic pans with ≥5 mg of sample. Samples underwent thermal heat-cool-heat cycles under nitrogen from -10 ºC to 140 ºC at a ramp rate of 10 ºC / min. All measurements were reported against a sealed, empty tzero hermetic reference pan. The midpoint of the transition in the second heating cycle curve was reported as the glass transition temperature (Tg). The DSC results are shown in 3B and reported in Table 2. Example 14 Thermogravimetric Analysis (TGA).
[0194] A TA Instruments Discovery TGA 550 was used to perform thermal analysis. Samples were prepared using platinum TGA pans loaded with polymer (10 mg). Samples were heated undernitrogen from 30 ºC to 700 ºC at a ramp rate of 10 ºC / min. The temperature at 10% mass loss was reported as the degradation temperature (Td). The results are shown on Table 2. Example 15 Scanning Electron Microscopy.
[0195] Biopsy punches (8 mm diameter) were used to collect circular samples which were adhered to SEM stubs by carbon tape. A Denton Desk V sputter coater was used to sputter coat samples with gold (5 nm thickness); a Thermo Fisher Scientific Aprea S SEM was used to image sputter coated samples. The images are shown in FIGS 4A-C, 5A, and 13A-D. Example 16 Diffusion-Ordered NMR Spectroscopy (DOSY).
[0196] DOSY experiments were performed on a Bruker Avance III 700 MHz spectrometer equipped with a Broadband Observe (BBO) probe according to previously reported methods. (See, e.g., Li W, Chung H, Daeffler C, Johnson JA, Grubbs RH. Application of1H DOSY for Facile Measurement of Polymer Molecular Weights. Macromolecules. 2012;45:9595-603; and Agarwal A, Bobay BG, Becker ML. Observation of Dynamic Aggregation Behavior in Thermoresponsive Micro- and Nanoparticles via Diffusion-Ordered NMR Spectroscopy. Journal of the American Chemical Society. 2025;147:9386-95, the disclosures of which are incorporated herein by reference in their entirety). Briefly, samples were diluted (12 mg / mL) in DMSO-d6 and allowed to solvate overnight. Measurements were taken at 25 °C using the TopSpin3.5pl5 ledbpgp2s pulse program. Sine-shaped gradients were linearly ramped over 251H-NMR scans with gradient amplitudes ranging from 2-95%. The gradient duration (P30) was set to 2400 µs for each sample. The diffusion delay (D20) was adjusted for each sample to achieve ≥ 90% signal reduction over the pulse sequence (0.3, 0.3, and 0.8 s for samples 200805-C01, 220921, and D135-114, respectively). Collected spectra were phase-corrected and baseline-corrected prior to analysis using the DOSY Peak Fit Auto Decay Component model on MestReNova (v 14.2.0-26256). Example 17 Drug Content Uniformity
[0197] Samples with the appropriate thickness, measured using calipers, were taken from different sections of the electrospun substrates. The dried substrates were dissolved in acetonitrile and ethanol (50:50) for 24 h in an incubator (37 °C, 100 rpm). Samples were diluted in 1X PBS(9:11X PBS to organic). Meloxicam content was quantified using HPLC as described in section 1.4. Measured meloxicam content was compared to the theoretical meloxicam content to determine the loading efficiency using the following equation: ^^^^^^^ ^^^^^^^^^^ ^%^ =^^^^^^^^ ^^^^^^^^^ ^^^^^^^ ×100^ℎ^^^^^^^^^ ^^^^^^^^^ ^^^^^^^ Example 18 Electrospinning of Bupivacaine-Loaded Poly(ester urea) Nanofibers
[0198] Polymer solutions were prepared by dissolving the solid material in solvent (1:3 acetone:methanol for solutions not containing sodium bicarbonate or tetrahydrofuran for solutions containing sodium bicarbonate) (12-14% w / w of polymer in solvent). Bupivacaine (20% w / w of drug to solids) and sodium bicarbonate (10% w / w additive to solids) were added. The solution was stirred (300 rpm) until homogeneous with bupivacaine dissolved and sodium bicarbonate suspended in solution. Bupivacaine-loaded polymer nanofibers were fabricated using a Matregenix Electrospinning Machine SS-150 in a vertical approach with a needle facing upwards at a flat collector wrapped in non-stick aluminum foil. Syringes were loaded with the solution containing polymer, bupivacaine, and sodium bicarbonate, placed in a syringe pump, and connected by tubing to an 18 gauge needle. Conditions included a pump rate of 1 mL / hr, needle tip to collector distance was 100 mm, voltage was 20 kV, with ventilation on. Electrospinning was performed at ambient temperature and humidity. Solutions were electrospun into thick nanofiber mats (70 µm). Mat thickness was measured using calipers for each sample. Example 19 Fiber imaging of Bupivacaine-Loaded Poly(ester urea) Nanofibers
[0199] SEM images of the bupivacaine-loaded poly(ester urea) nanofibers formed in Example 18 above were taken using the methods described in Example 15 above with respect to the meloxicam-loaded fibers. No significant difference between the appearance of the bupivacaine- loaded fibers and the appearance of the meloxicam-loaded fibers was found.Example 20 Release study of Bupivacaine-Loaded Poly(ester urea) Nanofibers
[0200] Release studies were conducted on the bupivacaine-loaded poly(ester urea) nanofibers formed in Example using the protocols set forth in sections 1.6 above with respect to the meloxicam-loaded fibers. The results of these release studies are shown in FIGS. 27A-B and 28. Example 21 Bupivacaine Content Quantification by HPLC
[0201] Bupivacaine content of the and electrospun nanofibersformed in Example 18 was quantified using an Ultra-High Pressure Liquid Chromatography (HPLC) system (Agilent Inc, MA, USA). Separation was performed using an Agilent Poroshell 120 EC-C18 column (2.1 x 50 mm, 1.9 µm) maintained at a column temperature of 40 °C with a sample injection volume of 10 µL. Mobile phase A was 0.1% phosphoric acid in water and mobile phase B was acetonitrile. A gradient method was used as follows: 0-0.5 min, 20% B; 0.5-3.5 min, 20-50% B; 3.5-3.6 min, 50-20% B; 3.6-5 min, 20% B. The flow rate was 0.4 mL / min. The bupivacaine retention time was 2.0 min. Bupivacaine was quantified using a diode array detector (λ = 210 nm). The bupivacaine content was quantified using the slope of a bupivacaine standard calibration curve generated over 100 µg / mL to 0.3 µg / mL (68 µM). (See, FIGS. 27A-B). Example 22 Comparison of Meloxicam-Loaded Nanofibers and Films, With and Without NaHCO3 Additive
[0202] The total bupivacaine release was evaluated for the bupivacaine-loaded PEU films and electrospun nanofibers formed with 0% NaHCO3or 10% NaHCO3additive in Example 18, above. The addition of the NaHCO3 additive to the PEU films was found to produce a relatively modest increase in bupivacaine release. (See, FIG. 28). Surprisingly, however, addition of the NaHCO3 additive to the bupivacaine -loaded PEU nanofibers vastly increased bupivacaine release. As can be seen in FIG. 28, addition of 10% NaHCO3additive resulted in a more than doubling of the meloxicam release relative to the 10% NaHCO3 containing film and more than tripling the bupivacaine release relative to the electrospun fibers made without the NaHCO3additive. (See, FIG.28). This vast improvement in release from the electrospun fibers was completely unexpectedgiven the modest effect the 10% NaHCO3additive for the bupivacaine -loaded PEU films. (See, FIG. 28).
[0203] In light of the foregoing, it should be appreciated that the present invention significantly advances the art by providing a drug loaded electrospun poly(ester urea) nanofiber drug delivery system that is structurally and functionally improved in a number of ways. While particular embodiments of the invention have been disclosed in detail herein, it should be appreciated that the invention is not limited thereto or thereby inasmuch as variations on the invention herein will be readily appreciated by those of ordinary skill in the art. The scope of the invention shall be appreciated from the claims that follow.
Claims
CLAIMS What is claimed is:
1. A drug-loaded poly(ester urea) polymer system for localized drug delivery comprising: a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units; a locally active pharmaceutical compound; and a bicarbonate additive.
2. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said drug-loaded poly(ester urea) polymer system for localized drug delivery comprises a plurality of electrospun nanofibers.
3. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said electrospun nanofibers have a mean diameter of from about 50 nm to about 1000 nm, preferably from about 50 nm to about 500 nm, and more preferably from about 50 nm to about 150 nm.
4. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said valine-based diester units comprise two valine residues separated by C2-C20 alkyl group.
5. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said phenylalanine- based diester units comprise two phenylalanine residues separated by C2-C20alkyl group.
6. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said poly(ester urea) polymer has the formula: y where a and bwhere x+y=1.
7. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said poly(ester urea) polymer has the formula:O O O 0.
7.
8. The drug-lo id locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof 9. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof.
10. The drug-loaded poly(ester urea) polymer system of claim 8 wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof.
11. The drug-loaded poly(ester urea) polymer system of claim 8 wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof.
12. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said locally active pharmaceutical compound is meloxicam.
13. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said bicarbonate additive is selected from the group consisting of sodium bicarbonate, potassium bicarbonate, ammonium bicarbonate, and combinations thereof.
14. The drug-loaded poly(ester urea) polymer system of claim 1 wherein said bicarbonate additive is sodium bicarbonate.
15. A drug-loaded electrospun PEU nanofiber comprising: a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units; a locally active pharmaceutical compound; and a bicarbonate additive.
16. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said valine-based diester units comprise two valine residues separated by C2-C20 alkyl group.
17. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said phenylalanine-based diester units comprise two phenylalanine residues separated by C2-C20alkyl group.
18. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said poly(ester urea) polymer has the formula: y where a and b where x+y=1.
19. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said poly(ester urea) polymer has the formula: 0.7.
20. The drug- locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof 21. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof.
22. The drug-loaded electrospun PEU nanofiber of claim 20 wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof.
23. The drug-loaded electrospun PEU nanofiber of claim 20 wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof.
24. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said locally active pharmaceutical compound is meloxicam.
25. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said bicarbonate additive is selected from the group consisting of sodium bicarbonate, potassium bicarbonate, ammonium bicarbonate, and combinations thereof.
26. The drug-loaded electrospun PEU nanofiber of claim 15 wherein said bicarbonate additive is sodium bicarbonate.
27. The drug-loaded electrospun PEU nanofiber of claim 15 having a mean diameter of from about 50 nm to about 1000 nm, preferably from about 50 nm to about 500 nm, and more preferably from about 50 nm to about 150 nm.
28. The drug-loaded electrospun PEU nanofiber of claim 15 having lease rate at least 1.5 times higher than a comparable drug-loaded electrospun PEU nanofiber not comprising said bicarbonate additive.
29. A method of making drug-loaded electrospun PEU nanofiber of claim 15 comprising: A) dissolving a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units in a solvent suitable for electrospinning; B) adding a locally active pharmaceutical compound, or a pharmaceutically acceptable salt thereof, and a bicarbonate additive to the solution of step A; C) mixing the solution of step B so that the locally active pharmaceutical compound and bicarbonate additive are either dissolved or suspended in the solution; and D) loading the mixture of step C into an electrospinning apparatus and electrospinning the solution of step C into drug-loaded electrospun PEU nanofibers.
30. The method of claim 29, wherein the solvent suitable for electrospinning is selected from 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP), methyl ethyl ketone, acetone, and combinations thereof.
31. The method of claim 29, wherein the solvent suitable for electrospinning is HFIP.
32. The method of claim 29, wherein the poly(ester urea) polymer in step A has the formula: y where a and where x+y=1.
33. The method of claim 29, wherein the poly(ester urea) polymer in step A has the formula: 0.7 34. Thecompound is an analgesic, antibiotic, or combination thereof 35. The method of claim 34, wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof.
36. The method of claim 34, wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof.
37. The method of claim 29, wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof.
38. The method of claim 29, wherein said locally active pharmaceutical compound is meloxicam.
39. The method of claim 29, wherein the solution of step A comprises from about 2 % to about 20% of said poly(ester urea) polymer by weight.
40. The method of claim 29, wherein the solution of step A comprises from about 5 % to about 10% of said poly(ester urea) polymer by weight.
41. The method of claim 29, wherein the weight of said analgesic compound is from about 1% to about 40% of the combined weight of said poly(ester urea) polymer and bicarbonate additive.
42. The method of claim 29, wherein the weight of said analgesic compound is about 20 % of the combined weight of said poly(ester urea) polymer and bicarbonate additive.
43. The method of claim 29 wherein said bicarbonate additive is selected from the group consisting of sodium bicarbonate, potassium bicarbonate, ammonium bicarbonate, and combinations thereof.
44. The method of claim 29 wherein said bicarbonate additive is sodium bicarbonate.
45. The method of claim 29 or 44, wherein the weight of said bicarbonate additive is from about 0.1% to about 30%, preferably from about 1% to about 25%, and more preferably from about 1% to about 20%, of the combined weight of said poly(ester urea) polymer and analgesic compound.
46. The method of claim 29 or 44, wherein the weight of said bicarbonate additive is from about 0.01% to about 10% of the combined weight of said poly(ester urea) polymer and analgesic compound.
47. The method of claim 29 wherein the mixture of step C is mixed at a speed of from about 250 RPM to about 400 RPM for from about 4 hours to about 24 hours.
48. A method for accelerating local drug release from drug-loaded poly(ester urea) nanofibers comprising: A) preparing a solution comprising a poly(ester urea) polymer comprising a plurality of valine-based diester units and a plurality of phenylalanine-based diester units and a solvent suitable for electrospinning; B) adding a locally active pharmaceutical compound to the solution of Step A; C) adding sodium bicarbonate and mixing until the locally active pharmaceutical compound and the sodium bicarbonate are either dissolved or suspended in the polymer solution; andD) loading the mixture of step C into an electrospinning apparatus and electrospinning the solution of step C into drug-loaded electrospun PEU nanofibers having a mean diameter of from about 400 nm to about 1500 nm.
49. The method of claim 48 further comprising: E) inserting said drug-loaded electrospun PEU nanofibers into the body or a patient.
50. The method of claim 39 wherein said drug-loaded electrospun PEU nanofibers have an increased rate release of said analgesic compound compared to comparable drug-loaded electrospun PEU nanofiber made without sodium bicarbonate.
51. The method of claim 48, wherein said locally active pharmaceutical compound is an analgesic, antibiotic, or combination thereof 52. The method of claim 48, wherein said locally active pharmaceutical compound is selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, tobramyacin, rifampin, minocycline and combinations thereof.
53. The method of claim 51, wherein said locally active pharmaceutical compound is an analgesic compound selected from the group consisting of meloxicam, bupivacaine, ropivacaine, lidocaine, etoricoxib, and combinations thereof.
54. The method of claim 51, wherein said locally active pharmaceutical compound is an antibiotic compound selected from the group consisting of tobramyacin, rifampin, minocycline, and combinations thereof.
55. The method of claim 48, wherein said locally active pharmaceutical compound is meloxicam.
56. The method of claim 48, wherein the weight of said sodium bicarbonate additive is from about 0.1% to about 30%, preferably from about 1% to about 25%, and more preferably from about 1% to about 20%, of the combined weight of said poly(ester urea) polymer and analgesic compound.