Gene perturbation in human monocyte-derived dendritic cells

Abstract

A method of producing a pool of human monocyte-derived dendritic cells (MDDCs) that are genetically engineered for a variety of genomic perturbations, by infecting the monocytes with lentiviruses to consecutively deliver an RNA-guided programmable nuclease (RPN) and an gRNA library comprising a repertoire of guide RNAs (gRNAs) that covers a variety of target genomic sequences of the MDDCs, wherein the monocytes are infected with lentiviruses in the presence of at least one MDDC differentiating factor and an inactivator of the cellular SAM domain HD domain-containing protein 1 (SAMHD1).

Description

[0001] AE007P

[0002] -1-

[0003] GENE PERTURBATION IN HUMAN MONOCYTE-DERIVED DENDRITIC CELLS

[0004] FIELD OF THE INVENTION

[0005] The invention relates to a method of gene perturbation in a human monocyte- derived dendritic cells (MDDCs). Such method can be used to produce libraries of MDDCs, with a diversity of specific mutations such as knockout or deletion of one or more genes, or specific genetic activation or interference, which are invaluable tools to study single gene or epistatic effects in MDDCs, to screen for targets for the development a drug, cellular vaccines, a cell therapy, or gene therapy, or to engineer MDDCs for developing dendritic cell vaccines.

[0006] BACKGROUND OF THE INVENTION

[0007] Monocytes and dendritic cells (DCs) are white blood cells that both play a central role in the immune system. Monocytes circulate in the bloodstream and are responsible for ingesting and destroying pathogens and debris. When migrating to specific tissues, they differentiate into macrophages or DCs. This process depends on the signals they receive from the tissue environment or surrounding immune cells. In addition to their phagocytic activity, monocytes can present antigens to T cells, thereby contributing to the immune response. They are also involved in inflammation and tissue repair. DCs are antigen-presenting cells that capture antigens from pathogens or damaged cells, process them, and present them on their surface to T cells to initiate an adaptive immune response. They are found in tissues that are in contact with the external environment, such as the skin (where they are known as Langerhans cells) and the lining of the nose, lungs, stomach and intestines. They also circulate in the blood in an immature state. By activating T cells and stimulating antibody production by B cells, DCs are critical to the development of immunity. Together, DCs and monocytes are essential components of the body's defense mechanism, bridging innate and adaptive immunity. Understanding the mechanisms and factors that control the activation of primary monocytes and their differentiation into DCs or macrophages is of great importance in unravelling the complexities of immune regulation and in developing therapeutic strategies for various immune-related diseases.

[0008] CRISPR has become a popular and modular tool for biological research in a wide range of applications. The CRISPR-Cas9 system consists of a guide RNA (gRNA) and the Cas9 effector protein, which together form a ribonucleoprotein (RNP) complex for genomic manipulation. Nucleofection of CRISPR-Cas9 RNP complexes was previously used for gene editing in human monocytes (Hiatt et al., 2021). This approach is suitable AE007P

[0009] -2- for an arrayed CRISPR screen, where the effect of a single predefined gene knockout can be studied in individual wells using different phenotypic readouts. However, this strategy ultimately lacks the scalability to study complex molecular mechanisms such as the differentiation of DCs from monocytes.

[0010] In contrast, in a pooled CRISPR screen, each individual cell is perturbed according to the gRNA it receives, allowing the parallel investigation of the function of thousands of genes in a single experiment. In such screens, gRNAs are typically delivered by lentiviral transduction and integrated into the DNA of the target cells. Lentiviruses can infect both dividing and postmitotic cells and are therefore widely used in CRISPR experiments.

[0011] Lentiviral delivery of CRIPSR tools into primary monocytes and monocyte-derived cells, however, remains very challenging. This failure of transduction is orchestrated by the cellular restriction factor SAM domain HD domain-containing protein 1 (SAMHD1), a dNTPase that regulates intracellular dNTP pools, and thus, limits reverse transcription of viruses in host cells. Viruses such as HIV-2 and SIV, on the other hand, have evolved mechanisms to counteract such restriction factors by utilizing antagonistic accessory proteins such as the viral protein X (Vpx). Vpx is a component of cullin4A-RING E3 ubiquitin ligase (CRL4), which targets SAMHD1 for proteasomal degradation, thus rendering the otherwise refractory host cells permissive to lentiviral infection.

[0012] Berger et al., 2011 describe a method to genetically modify human monocyte- derived dendritic cells (MDDCs) with HIV-1-derived lentiviral vectors to improve the overall efficacy of LV-mediated gene transfer in MDDC. The method involves the simultaneous addition of noninfectious Vpx-VLPs and of the LV of interest onto MDDCs.

[0013] Berger et al., 2009 describe that the transduction efficiency of dendritic cells with nonintegrative HIV-1 vectors can be improved via Vpx-VLPs that promote the accumulation of complete and episomal viral DNA. In this setting, Vpx increases both the number of transduced cells and the levels of transgene expression.

[0014] Hrecka et al., 2011 disclose that Vpx relieves inhibition of HIV-1 infection of macrophages mediated by the SAMHD1 protein.

[0015] Liu et al., 2020, describe an approach to target a single gene for CRISPRi in primary human monocytes.

[0016] WO2021 / 064655A1 discloses high throughput genetic screening and an immune cell comprising a CRISPR system comprising a genome-targeted nuclease and / or a guide RNA that hybridizes to a sequence of a DNA molecules in the cell. AE007P

[0017] -3-

[0018] US2013 / 183334 discloses a chimeric vector comprising HIV-1 nucleic acid sequences and SIVmac239 nucleic acid sequences, wherein the SIVmac239 nucleic acid sequences encode an SIVmac239 amino acid sequence consisting of a minimal Vpx packaging motif that confers Vpx packaging activity to the chimeric vector.

[0019] Bobadilla et al. (Gene Therapy 2013, 20(5): 514-520) discloses transduction of myeloid cells by a lentiviral vector that packages the Vpx accessory protein.

[0020] Goujon et al. (Gene Therapy 2006, 13(12): 991-994) discloses increasing HIV transduction of monocyte-derived dendritic cells with virion-like particles of SlVMac.

[0021] However, no pooled CRISPR screen in MDDCs targeting more than one gene has been published to date. There is a need for an improved CRISPR screen in MDDCs.

[0022] SUMMARY OF THE INVENTION

[0023] It is the objective to provide an improved method of CRISPR screening that overcomes the limitation of transduction efficiency in monocyte-derived dendritic cells (MDDCs). It is a particular objective to produce repertoires of diverse MDDCs by lentiviral delivery of the CRISPR machinery, alongside the lentiviral delivery of a library of sgRNAs, such as to allow performing pooled CRISPR screens in MDDCs.

[0024] The object is solved by the subject matter as claimed and as further described herein.

[0025] The invention provides for a method of producing a pool of human monocyte- derived dendritic cells (MDDCs) that are genetically engineered for a variety of genomic perturbations, by infecting the monocytes with lentiviruses to consecutively deliver an RNA-guided programmable nuclease (RPN) and an gRNA library comprising a repertoire of guide RNAs (gRNAs) that covers a variety of target genomic sequences of the MDDCs, wherein the monocytes are infected with lentiviruses in the presence of at least one MDDC differentiating factor and an inactivator of the cellular SAM domain HD domain-containing protein 1 (SAMHD1).

[0026] Specifically, the lentiviruses are replication-deficient.

[0027] Specifically, the lentiviruses are integrative lentiviruses.

[0028] Specifically, the lentiviruses are integrative and replication-deficient.

[0029] Specifically, the monocytes are primary monocytes. Specific examples are blood leukocytes, in particular of peripheral blood mononuclear cells (PBMC). Monocytes can be freshly prepared from a donor, or obtained from a cryopreserved source.

[0030] Specifically, primary monocytes are infected with the lentiviruses to deliver the RPN and the gRNA library ( / .e. the CRISPR tools). In particular, delivery of the RPN is AE007P

[0031] -4- herein understood as lentivirus transduction of an RPN coding sequence or an RPN expression cassette.

[0032] Specifically, infection with the lentiviruses is of primary monocytes in the presence of at least one MDDC differentiating factor to allow differentiation of the primary monocytes into MDDCs while being transduced by the lentiviruses.

[0033] Specifically, the method produces MDDCs which are immature DCs and / or mature DCs. Specifically, the MDDCs are antigen-presenting MDDCs. The method described herein may further comprise a step of method exposing cultured MDDCs exogenously and endogenously to an antigen, thereby loading the MDDC with the respective epitopes of the antigen.

[0034] It is herein understood that the method described herein provides for lentiviral delivery to the monocytes while being differentiated into MDDCs, meaning that lentiviral delivery is to primary monocytes and nascent MDDCs during differentiation, and optionally to differentiated MDDCs once differentiation is completed. Therefore, when describing monocytes to be infected with lentiviruses as described herein, such monocytes are understood to include primary monocytes and nascent MDDCs, respectively, in a differentiation phase, and optionally to MDDCs once differentiation is completed.

[0035] Specifically, the primary monocytes are treated for transduction and differentiation in one pool ( / .e. in a mixture), in particular wherein transduction and differentiation occur simultaneously or in parallel.

[0036] Specifically, the primary monocytes are differentiated into MDDCs in situ while being transduced with the lentiviruses for delivery of the CRISPR tools. In particular, the lentivirus transduction is during the differentiation phase i.e., while nascent MDDCs are present.

[0037] Specifically, the MDDCs are monocytes that are fully differentiated into MDDCs. Fully differentiated MDDCs are specifically characterized by morphological characteristics or functional tests like antigen presentation and lymphocyte activation.

[0038] Specifically, the MDDCs are immature and / or mature MDDCs.

[0039] Specifically, in the method described herein, the monocytes are not cotransduced with lentiviruses delivering the RPN and gRNA library CRISPR tools.

[0040] Specifically, lentiviral delivery of the CRISPR tools is consecutively, meaning that the monocytes are consecutively (i.e., sequentially) infected with lentiviruses, to allow a staged process of lentiviral infection and transduction. Specifically, there is a first AE007P

[0041] -5- lentiviral delivery for the transduction of the cells with one of the CRISPR tools, namely one of the RPN or gRNA library, and a second lentiviral delivery for the transduction of the cells with the other one of the CRISPR tools. In particular, there is a recovery time between the first lentiviral delivery and the second lentiviral delivery to the monocytes.

[0042] According to a specific aspect, a) the monocytes are first delivered with said RPN, and following a recovery time, the monocytes are delivered with said gRNA library; or b) the monocytes are first delivered with said gRNA library, and following a recovery time, the monocytes are delivered with said RPN; preferably wherein the recovery time is at least one day.

[0043] Specifically, the recovery time is at least 1 day, preferably any one of at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 days.

[0044] This allows effective recovery of the primary monocytes and the nascent MDDCs, respectively, after the first lentiviral delivery before being further delivered by lentiviruses with the other one of the CRISPR tools.

[0045] Considering such consecutive delivery and an optional recovery time, the cellular fitness and yield of MDDCs turned out to be surprisingly increased. Cellular fitness is a special prerequisite for a successful pooled CRISPR screen.

[0046] Specifically, each of the lentiviral deliveries is in the presence of the SAMHD1 inactivator as further described herein.

[0047] By the method described herein, it was for the first time demonstrated that large- scale pooled CRISPR screens are enabled to identify factors contributing to the complex regulation of monocyte and dendritic cell biology. Importantly, the present strategy enables surprisingly efficient delivery of the complete CRISPR machinery through lentiviral vectors into nascent MDDCs, thereby obtaining perturbed MDDCs with a higher efficiency compared to such lentiviral delivery into fully differentiated MDDCs. This highlights the possibility of performing pooled CRISPR screens such as CRISPR interference (CRISPRi) screens in MDDCs. Furthermore, this is the first report demonstrating a CRISPRi approach in both activated ( / .e., stimulated and polarized) and inactive MDDCs. The method described herein makes it feasible to study the mechanisms underlying almost any dendritic cell phenotype and thereby unravel molecular bases driving the functional versatility of monocyte-derived cells.

[0048] According to a specific aspect, the inactivation of SAMHD1 is by the introduction of any one of: AE007P

[0049] -6- a) a lentiviral accessory protein that induces degradation of SAMHD1 , preferably Vpx of simian immunodeficiency virus (SIV) or of human immunodeficiency virus 2 (HIV- 2), or a lentivirus paralog of Vpx, preferably using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs); b) an inhibitor that targets said SAMHD1 , preferably an siRNA, antisense oligonucleotide or small molecule inhibitor; c) a SAMHD1 inactivating CRISPR tool comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

[0050] Specifically, SAMHD1 is a native protein that is endogenous to MDDCs.

[0051] SAMHD1 is e.g., specified in the NCBI database as NM_015474.4(SAMHD1), or NM_01 5474.4(SAMHD1 ):c.1324C>T (p.Arg442Ter).

[0052] Specifically, human SAMHD1 comprises or consists of the amino acid sequence SEQ ID NO:1. Specifically, the gene encoding human SAMHD1 comprises or consists of SEQ ID NO:2

[0053] Specifically, the lentiviral accessory protein originates from primate lentiviruses such as the simian immunodeficiency virus (SIV), the human immunodeficiency virus, type 2 (HIV-2), or the human immunodeficiency virus, type 1 (HIV-1), or is a lentivirus paralog of Vpx.

[0054] A suitable lentiviral accessory protein is Vpx that originates from certain SIVs, in particular Vpx of SIVsm (sooty mangabeys (SM), SEQ ID NO:3), or Vpx of SIVagm (African green monkeys (AGM), SEQ ID NO:4) or Vpx of SlVmac (Rhesus Macaque), SEQ ID NO:5, or of HIV-2 (SEQ ID NO:6).

[0055] Specifically, a lentivirus paralog of Vpx can be suitably used.

[0056] The respective lentiviral accessory protein that originates from HIV-1 is the Vpu protein (SEQ ID NO:7).

[0057] Further lentivirus paralogs of Vpx such as Vpr can be used e.g., as originating from SIV-cpz (Chimpanzee immunodeficiency virus) SEQ ID NO:8, SIV-md (SIV mandrill) SEQ ID NO:9, SIV-sm (Sooty managabey): SEQ ID NO: 10, SIV-mac (Rhesus macaque) SEQ ID NO:11.

[0058] Any of the foregoing lentiviral accessory proteins are understood as wild-type proteins such as naturally occurring or expressed by the respective lentiviruses.

[0059] It is understood that any suitable variant of any of the foregoing lentiviral accessory proteins can be used which is functional as lentiviral accessory protein that AE007P

[0060] -7- induces degradation of SAMHD1 , preferably wherein the variant comprises at least any one of 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100% sequence identity to the respective wild-type protein sequence, for example comprising one or more point mutations e.g., only 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 point mutations in the amino acid sequence.

[0061] Specifically, the lentiviral accessory protein is functional in degrading SAMHD1 by recruiting a cullin4A-RING E3 ubiquitin ligase (CRL4) that targets SAMHD1 for proteasomal degradation.

[0062] According to a specific aspect, the lentiviral accessory protein is introduced into the MDDCs using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle (VLP) bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs).

[0063] Alternatively, the VLP comprises the lentiviral accessory protein. Specific VLPs can be used as a carrier to introduce the lentiviral accessory protein into the MDDCs.

[0064] Specifically, the lentivirus vector comprises an expression cassette which comprises the nucleic acid sequence encoding the lentiviral accessory protein and regulatory sequences such as expression control sequences to express the coding nucleic acid sequence in the MDDCs following delivery of the lentivirus vector.

[0065] Specifically, the lentivirus vector is in the form of a VLP. Specifically, the VLP is an intact replication-defective virion, in particular a lentiviral virion. Lentivirus-based VLPs can be suitably engineered as protein (in particular the lentiviral accessory protein) delivery tool using well-known techniques.

[0066] Specifically, the VLP is based on a lentivirus that originate from primate lentiviruses such as the simian immunodeficiency virus (SIV), the human immunodeficiency virus, type 2 (HIV-2), or the human immunodeficiency virus, type 1 (HIV-1). Further suitable VLPs are based on lentiviruses such as Moloney leukemia Virus (MLV), Human Papilloma Virus (HPV), Friend Murine Leukemia Virus (FMLV), FIV (Feline Immunodeficiency Virus), BIV (Bovine Immunodeficiency Virus), EIAV (Equine Infectious Anemia Virus), Visna-Maedi Virus (VMV).

[0067] Specifically, the VLP comprises a viral envelope surface glycoprotein which originates from any of the lentiviruses listed above. Specifically, the viral surface envelope glycoprotein is expressed on the surface of the VLP. Specifically, the VLP comprises envelope proteins from another virus, specifically VSV-G. AE007P

[0068] -8-

[0069] Specifically, the VLP comprises the following components: Gag and Pol retroviral proteins and an envelope glycoprotein, but not comprising any virus-derived genetic information.

[0070] Specifically, the VLP-components originate from the same lentivirus, but may as well originate from different lentiviruses. Variants of one or more of the VLP components may be used to produce a hybrid lentiviral VLP.

[0071] Specifically, the VLP expressing the lentiviral accessory protein comprises the lentiviral accessory protein (e.g., the Vpx protein), Gag and Pol lentiviral proteins and an envelope glycoprotein. The Gag and Pol lentiviral proteins preferably originate from the same lentivirus, but may as well originate from different lentiviruses.

[0072] The origin of the Gag and Pol genes gives its name to the virus-like particle. For instance, the “SIVsm VLP” usually indicates that the Gag and Pol genes are those of SIVsm (sooty mangabeys), or are variant Gag and Pol genes from SIVsm.

[0073] Specifically, the SIVsm Gag protein comprises or consists of SEQ ID NO: 12.

[0074] Specifically, the SIVsm Pol protein comprises or consists of SEQ ID NO:13.

[0075] The envelope glycoprotein may be an envelope glycoprotein G or H.

[0076] The envelope glycoprotein is for example the envelope glycoprotein G from Vesicular Stomatitis Virus (VSV) SEQ ID NO:14

[0077] A preferred VLP according to the invention for example comprises or consists of products from the Gag, Pol, and Vpx genes from SIV (in particular, SIVsm) and the envelope glycoprotein G from VSV.

[0078] It is understood that any suitable variant of the wild-type VLP components that are functional to produce a lentiviral VLP can be used, preferably wherein the variant comprises at least any one of 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, up to 100% sequence identity to the respective wild-type amino acid sequence, for example comprising one or more point mutations e.g., only 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 point mutations in the amino acid sequence.

[0079] Specifically, SAMHD1 is inactivated by modulating expression or the levels of the SAMHD1 protein, which includes e.g., down-modulating the transcription of the mRNA from the gene encoding SAMHD1 and / or the translation of mRNA into SAMHD1 protein from the mRNA; or inhibiting the activity of the SAMHD1 protein, or deleting, knockingout, or otherwise mutating the gene encoding SAMHD1 for its inactivation. AE007P

[0080] -9-

[0081] According to a specific aspect, SAMHD1 can be inactivated using an inhibitor that targets said SAMHD1 , preferably an siRNA, antisense oligonucleotide or small molecule inhibitor.

[0082] Specific SAMHD1 gene silencers can be used as SAMHD1 inactivator.

[0083] Typically, gene silencers that are antisense oligonucleotides are one or more antisense oligonucleotides such as e.g., one, two, three, four or five different single stranded oligonucleotides, each being about 19-25 nt long and complementary to a specific region of the SAMHD1 gene.

[0084] Specifically, gene silencers which are effective by RNA interference (RNAi) can be achieved by using siRNA targeting SAMHD1 , or by intracellular expression of a short hairpin RNA (shRNA) that is processed into the effective small interfering RNA (siRNA) inhibitor by the RNAi machinery (Qiagen Cat. No. SI04243673, Franzolin et al., 2013), (siSAMHDI , L-013950-01 , ON-TARGETplus Human SAMHD1 siRNA Smartpool, Dharmacon, Gutierrez-Chamorro et al., 2023), SEQ ID NO:15 and SEQ ID NO: 6 (Daddacha et al., 2017)

[0085] Specifically, a selective small molecule inhibitor can be used as SAMHD1 inactivator. Suitable inhibitors can be identified by a biochemical screening campaign and complementary biochemical, biophysical, and cell-based readouts for further characterization of the screen output. Exemplary inhibitors are TH6342 and analogs thereof (Zhang et al., 2024), (ProbeChem, Catalog no: PC-21770) [and ribonucleotide reductase inhibitors such as gemcitabine and hydroxyurea. Specifically, a SAMHD1 inactivator could be a PROTAC or a molecular glue, which, upon binding to SAMHD1 , triggers the degradation of SAMHD1 .

[0086] According to a specific aspect, SAMHD1 can be inactivated using a SAMHD1 inactivating CRISPR tool comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

[0087] CRISPR tools as further described herein can be used for the purpose of inactivating SAMHD1. As a respective SAMHD1-gRNA any one of the following can be used: SEQ ID NO: 17-20

[0088] According to a specific aspect, the MDDCs are transduced with said lentiviruses bearing the CRISPR tools for genomic perturbation. Specifically, said transduction step is carried out after said SAMHD1 inactivation step, or said SAMHD1 inactivation and transduction steps are carried out simultaneously. AE007P

[0089] -10-

[0090] Specifically, the SAMHD1 inactivation step is performed using suitable amounts of the SAMHD1 inactivator or the respective inactivating tools thereby reducing the protein level or protein activity of the SAMHD1 dNTPase to less than 25% (w / w)

[0091] According to a specific aspect, the lentiviruses used for infection and transduction of the monocytes are of primate lentivirus origin, such as the simian immunodeficiency virus (SIV), the human immunodeficiency virus, type 2 (HIV-2), or the human immunodeficiency virus, type 1 (HIV-1). Further suitable lentiviruses are FIV (Feline Immunodeficiency Virus), BIV (Bovine Immunodeficiency Virus), EIAV (Equine Infectious Anemia Virus), Visna-Maedi Virus (VMV).

[0092] Specifically, the lentiviral transduction of the CRPSR tools provides for the CRISPR machinery to effect genomic perturbation of the MDDCs.

[0093] Specifically, each stage of the consecutive lentiviral transduction is performed in the presence of the SAMHD1 inactivator or the respective inactivating tools.

[0094] Specifically, lentiviruses can be used to deliver a CRISPR tool and the Vpx at the same time. This can be achieved by transducing the cells with a mixture of three components: VLP containing VPX, a lentivirus encoding Cas9, and a lentivirus encoding sgRNA. Alternatively, this can be achieved through an 'all-in-one strategy' where a lentivirus encodes for both- Cas9 and sgRNA and is loaded with VPX as an accessory protein.

[0095] According to a specific aspect, a Vpx expression cassette may be included in the lentiviral donor sequence. Specifically, the Vpx coding sequence may be fused to a component of the lentivirus, such as Gag or Pol or the Envelope protein. Specifically, Vpx may be indirectly linked to the lentiviral particle.

[0096] According to a specific aspect, a library of different gRNAs is used to provide said at least one gRNA, for editing corresponding different genomic sequences of the MDDCs by said CRISPR tools, thereby obtaining a variety of transduced MDDCs comprising different genomic perturbations. Specifically, the transduced MDDCs are considered perturbed MDDCs of the CRISPR screen.

[0097] Specifically, the transduced MDDCs can be enriched before screening. Preferably, the enrichment of transduced MDDCs is without antibiotic selection such as a Puromycin enrichment which has been proven to be less effective with perturbed MDDCs. Alternative methods of enrichment involve the use of fluorescent marker proteins, such as eGFP, RFP, CFP or BFP, which can be utilized for enrichment by flow cytometry-assisted cell sorting (FACS). Alternatively, methods of enrichment involve the AE007P

[0098] -11- use of cell surface markers that are not endogenously present in MDDCs that can be exploited for magnetic cell sorting (MACS), Specific methods are fluorescence-activated cell sorting (FACS) and magnetic-activated cell sorting (MACS). Typically, a genomic sequence of interest (GOI) is a gene or target region of DNA that is associated with a gene. The approach is not limited to coding genes, but can be used to perturb other genetic elements such as non-coding RNA as well as promoters, enhancers and any other DNA elements.

[0099] Specifically, the gRNA library comprises a repertoire or variety of different gRNAs.

[0100] Specifically, the gRNA library is a library of different gRNAs, whereby corresponding different genomic sequences of said MDDCs that are targeted by said gRNA library are edited by said CRISPR tools, thereby obtaining a variety of transduced MDDCs comprising different genomic perturbations, preferably wherein the variety of transduced MDDCs is obtained in a pool of differently perturbed MDDCs in the same containment, or in an array that comprises differently perturbed MDDCs in separate containments.

[0101] Specifically, the variety of target genomic sequences includes any one or more of promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0102] Specifically, at least one of said gRNAs (or repertoire of said gRNAs) is targeting a regulatory region selected from promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0103] Specifically, the variety of target genomic sequences includes any one or more of a non-coding or untranslated region (UTR) of a gene within the MDDC genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene.

[0104] Specifically, at least one of said gRNAs (or repertoire of said gRNAs) is targeting a non-coding or untranslated region (UTR) of a gene within the MDDC genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene. AE007P

[0105] -12-

[0106] Specifically, the gRNA library comprises a plurality of different gRNAs. Specifically, the plurality comprises at least 3 different gRNAs to target one or more different genomic sequences of interest.

[0107] In particular, the gRNA library comprises a number of gRNAs to target multiple genes of interest in a CRISPR screen, such as a pooled CRISPR screen or arrayed CRISPR screen. Specifically, one or more gRNAs are targeting the same genomic sequence of interest such as a gene or target region of DNA that is associated with the same gene. For example, at least one, two or three different gRNAs are targeting the same genomic sequence of interest.

[0108] For a plurality of target GOIs such as a plurality of genes or respective target regions of DNA, a respective number of gRNAs is suitably used.

[0109] Specifically, the number of different gRNAs in the gRNA library is at least 3 (preferably at least 10) to target at least one GOI (preferably at least 3 different GOIs). Preferably, the number of different gRNAs in the gRNA library is at least any one of 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or even more e.g., up to 1.000, 2.000, 3.000, 4.000, 5.000, 6.000, 7.000, 8.000, 9.000, 10.000, 20.000, 30.000, 40.000, 50.000, 60.000, 70.000, 80.000, 90.000, 100.000, 200.000, or 300.000.

[0110] Specifically, a number of gRNAs is suitably used to target at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or even more e.g., up to 1.000, 10.000, or 100.000 different GOIs, preferably wherein each GOI is targeted by at least one, two or three different gRNAs.

[0111] In particular, a genome-scale gRNA library can be created using a large repertoire of corresponding gRNAs.

[0112] Specifically, the library of gRNAs is provided as a library of expression constructs wherein the members of the library encode the respective gRNA sequences.

[0113] Specifically, a library of gRNAs is delivered to the MDDCs, such that individual cells receive one or more single gRNAs. For example, each cell of a perturbed MDDC repertoire receives a different gRNA, or a different set of gRNAs.

[0114] Specifically, the gRNA library can be administered using a wide range of multiplicities of infection (MOIs). In particular, a lower MOI can be used to encourage delivery of only one gRNA per cell. Alternatively, a plurality of gRNAs can be introduced into the MDDCs, which plurality comprises gRNAs that target a unique (different) genomic sequence of interest, it is possible to perturb multiple factors in a single cell.

[0115] Specifically, the gRNAs are perturbation gRNAs. AE007P

[0116] -13-

[0117] Specifically, the genomic perturbation results in perturbed MDDCs, wherein MDDCs are perturbed e.g., for the silencing, knock-down or knockout of a target GOI, or otherwise for activating a GOI.

[0118] According to a specific aspect, a variety of transduced MDDCs is obtained in a pool of differently perturbed MDDCs in the same containment. Specifically, the MDDC pool is obtained in only one containment.

[0119] For producing a pool of differently perturbed MDDCs, a pool of gRNA lentiviruses targeting a number of different genomic sequences of interest is used. Such pooled approach allows pooled CRISPR screens.

[0120] According to a specific aspect, the RPN comprises or consists of a) a CRISPR nuclease, preferably any one of a type II or type V CRISPR nucleases, preferably Cas9 or Cas12a; or b) a CRISPR protein containing fusion or complex with an effector, preferably a transcription-modulating domain, or an editor such as a base editor or prime editor, and optionally one or more accessory proteins, or c) a nucleic acid encoding any of the foregoing.

[0121] Specifically, the RPN is delivered as a nucleic acid encoding said RPN.

[0122] Specifically, the RPN is a CRISPR nuclease such as a Cas nuclease.

[0123] Specifically, the RPN is a CRISPR protein that is catalytically inactive.

[0124] Specifically, the DNA-targeting protein is an RNA-guided catalytically inactive nuclease comprising a guide RNA (gRNA) having a targeting domain that is complementary to the target of modulation, preferably a nuclease-dead CRISPR protein (dCRISPR), in particular a nuclease-dead Cas9 (dCas9) protein.

[0125] For example, the Cas9 protein can be mutated so that the nuclease activity is reduced or inactivated. An inactivated Cas9 protein (“iCas9”, also referred to as “dCas9”) with no endonuclease activity has been targeted to genes in bacteria, yeast, and human cells by gRNAs to silence gene expression through steric hindrance. Exemplary mutations with reference to the S. pyogenes Cas9 sequence (UniProtKB - Q99ZW2) to inactivate the nuclease activity include: D10A, E762A, H840A, N854A, N-863A, and / or D986A. Exemplary mutations with reference to the S. aureus Cas9 sequence (UniProtKB - J7RUA5) to inactivate the nuclease activity include D10A and N580A. Specifically, the Cas9 protein is a mutant S. aureus Cas9 protein. Specifically, CRISPRi can be based on Acidaminococcus sp. (strain BV3L6) Cas12a / Cpf1 (UniProtKB - AE007P

[0126] -14-

[0127] U2UMQ6). Exemplary mutations with reference to the Acidaminococcus sp. (strain BV3L6) Cas12a sequence include D908A.

[0128] A variety of different Cas nucleases, such as Cas9 (from Streptococcus pyogenes), Cas14, CasX, CasY, Cas12a, Cas13a, Cas13b, Cas13d, Cas14a, etc. can be used. Variant forms of such Cas nucleases are also contemplated, e.g., High-Fidelity Cas9, eSpCas9, SpCas9-HF1 , HypaCas9, Fokl-Fused dCas9, xCas9, dCas9, etc.

[0129] Specifically, the RPN is a CRISPR-Cas complex, preferably selected from the group consisting of a Cas9, Cas12a, Cas12f.

[0130] Specifically, the RPN is a fusion of a CRISPR protein (such as a Cas nuclease e.g., Cas9) with cytidine deaminase, also referred to as base editor, and optionally one or more accessory proteins. A base editor combines a catalytically impaired Cas protein with a nucleotide deaminase to convert one base to another at a target genomic region of interest. Thereby, specific nucleotide changes, such as transition and transversion mutations can be introduced in the targeted region.

[0131] Specifically, the RPN is a fusion of a CRISPR protein (such as a Cas nickase e.g., nCas9, in particular with a H840A mutation) with a prime editor such as reverse transcriptase, and optionally one or more accessory proteins. Prime editing can create precise insertions, deletions, and all 12 types of point mutations using the “search-and- replace” method without requiring double stranded breaks or donor DNA templates. A prime editor is typically a versatile, precise genome editing tool that is composed of a Cas9 nickase fused to an engineered reverse transcriptase (RT) and a prime editing guide RNA (pegRNA) containing a primer binding site (PBS) and an RT template.

[0132] Specifically, the RPN is a fusion which is a direct or indirect fusion. Specifically, the fusion is by tethering or translationally fusing a transcriptional modulator with the DNA-targeting protein, such as a dCRISPR protein ( / .e., through the use of a fusion construct).

[0133] In particular, the RPN fusion can be a CRISPR protein that is directly fused to the effector, or an unaltered CRISPR protein which is indirectly bound (“fused”) to the effector, by a gRNA vector that harbors an RNA aptamer that recruits the effector such as a transcriptional modulator domain, or a combination of the foregoing.

[0134] Specifically, the present disclosure teaches modified guide RNAs with RNA aptamers capable of recruiting one or more transcriptional modulator domain. The RNA aptamers may be operably linked to the 5' or 3' end of a guide RNA, and are designed so as to not affect the DNA-targeting protein (e.g., the dCRISPR protein) binding to a AE007P

[0135] -15-

[0136] DNA target site. Instead, the RNA aptamers provide an additional tether from which to recruit one or more transcriptional modulators.

[0137] Specifically, a CRISPR system is used employing a targeted repressor or activator. Regulatory factors appended to a CRISPR protein may affect histone methylation or acetylation, DNA methylation or heterochromatin status. They may also aid in the recruitment of active transcription factors. Specifically, CRISPR-mediated gene silencing may occur using an CRISPRoff approach. Compact multipartite transactivation modules (MSN, NMS and eN3x9) can be used to build a CRISPR-dCas9 recruited enhanced activation module (CRISPR-DREAM) platform (Mahata etal., 2023).

[0138] According to a specific aspect, a transcriptional effector is used as a modulator of gene expression. Specifically, transcriptional effectors are chosen based on their ability to further repress, or alternatively, to activate the expression of a gene targeted by the DNA-targeting protein. Specifically, CRISPR modulation (CRISPRmod) is used, which includes either one or both of CRISPR interference (CRISPRi) and CRISPR activation (CRISPRa). CRISPR interference (CRISPRi) and activation (CRISPRa) are widely used to modulate gene expression. For the purpose of CRISPRi or CRISPRa, guide RNA designs in proximity to the gene’s promoter region or the transcriptional start site (TSS) are used, to result in silencing or activation, respectively.

[0139] Specifically, an effector is used that is selected from: a) a transcriptional repressor peptide for gene silencing, preferably a Kruppel- associated box (KRAB) domain, such as selected from the group consisting of ZIM3, or the KRAB domain of KOX1 ; or b) a transcriptional effector for gene activation, preferably a single transcriptional activation domain or combinatorial activation system, preferably selected from the group consisting of VP64, VPR (VP64, p65 and Rta), the SAM domain (consisting of p65 and HS1), the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as CRISPR DREAM (MSN, NMS or eN3x9); preferably wherein the RPN fused to the effector is any one of a dCas9-KRAB (repressor), dCas9-VP64 (activator), dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, or dCas9-Tet1c, dCas9-EZH2, dCas9-NMS.

[0140] According to a specific aspect, the MDDCs are derived from human CD14+ monocytes, in particular monocytes originating from human peripheral blood.

[0141] Blood-derived CD14+ monocytes can be obtained using standard protocols. Suitable sources of CD14+ monocytes are peripheral blood mononuclear cells isolated AE007P

[0142] -16- from healthy donors obtained from Red cross or commercial vendors like BiolVT, LLC; Research Donors Ltd (UK), Discovery Life Sciences, Lonza.

[0143] According to a specific aspect, the monocytes cells are autologous in relation to a subject (e.g., a patient) who is concerned when identifying one or more suitable targets of cell therapy using the method and tools as described herein.

[0144] Specifically, the MDDCs are obtained through (in vitro) differentiation by incubating the monocytes in the presence of an MDDC differentiating factor, preferably a cytokine or a combination of cytokines, such as GM-CSF and IL-4, optionally followed by incubating with one or more polarization stimuli, such as LPS, IFN-gamma, IL-4, IL- 13, or TGF-beta. Specifically, a combination of cytokines composed of 80-120 ng / mL (preferably about 100 ng / mL) GM-CSF and 10-30 ng / mL (preferably about 20 ng / mL) IL-4 can be used.

[0145] Specifically, the incubation time for MDDC differentiation is at least 3 days, preferably at least 3, 4, 5, 6, 7, 8, 9, or 10 days.

[0146] Various protocols exist to differentiate MDDCs such as incubating the monocytes with GM-CSF and IL-4 in a suitable buffer, such as RPMI GM-CSF, Mac-SFM GM-CSF, e.g., for at least 3 days.

[0147] Typically, infection with the lentiviruses and consecutive delivery of the CRISPR tools to the monocytes is carried out within 3-10 days, preferably within 10, 9, 8, 7, 6, or 5 days following addition of said MDDC differentiation factor(s) to the monocytes, and perturbed MDDCs can then be stimulated and / or harvested.

[0148] According to a specific aspect, a first method step of infecting the monocytes with lentiviruses to deliver one of the CRISPR tools (i.e., one of the RPN or the gRNA library) in the presence of an MDDC differentiating factor. Following a specific recovery time which is preferably at least 1 day, preferably any one of at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 days. This can be followed by a second method step of infecting the monocytes with lentiviruses to deliver the other one of the CRISPR tools, while the MDDC differentiating factor is still present. Preferably, the RPN is delivered in the first method step, and the gRNA library is delivered in the second method step.

[0149] Specifically, the MDDCs can be further treated for tolerogenic or activating stimulation.

[0150] Specifically, the MDDCs can be stimulated by a polarization stimulus following genomic perturbation. Typically, polarization is carried out within 24 hours. In particular, AE007P

[0151] -17- the gRNA-perturbed cells can be stimulated by different conditions, or treated with various small molecules, such as LPS, IFN-gamma, IL-4, IL-13, or TGF-beta.

[0152] According to a specific aspect, the MDDC pool is analyzed for an effect of one or more of said genomic perturbations, by screening the MDDCs for at least one phenotypic characteristic.

[0153] Specifically, the methods and kit described herein are used for a CRISPR screen, in particular a pooled CRISPR screen, or an arrayed CRISPR screen.

[0154] The effect of genomic perturbation is determined by screening the MDDCs for at least one phenotypic characteristic of said genomic perturbation. Specifically, said at least one phenotypic characteristic is related to the respective genomic perturbation.

[0155] Specifically, said at least one phenotypic characteristic is determined upon singularization of said MDDCs, or in a pool of the MDDCs.

[0156] Specifically, at least one phenotypic characteristic is determined by measuring cellular fitness, or expression of one or more markers. Specifically, cellular fitness is determined by analyzing the number of gRNAs targeting a specific gene at different time points following perturbation by next generation sequencing. gRNAs targeting genes that support growth or survival of MDMs will disappear over time, whereas gRNAs targeting genes that limit growth or survival of MDMs will become over-abundant.

[0157] One or more suitable assays can be used such as selected from: MTT (3-(4, 5- dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) assay, Trypan blue staining, membrane integrity assays, ATP assays like Cell Titer Blue / Glow, live-dead cellular stainings, proliferation markers (e.g. Ki67), or mitochondrial RNA content measurement.

[0158] Specifically, marker expression is determined at the RNA or protein level, preferably by flow-cytometry, immunohistochemistry, RNA-Seq (in particular single cell (sc) RNA-Seq, qRT-PCR, proteomics, ELISA, or microscopic imaging.

[0159] In particular, one read-out for the pooled CRISPR screen is single-cell RNA sequencing. This procedure is referred to as CROP-seq or Perturb-seq or CRISP-seq. Perturb-seq analysis elucidates the genotype-to-phenotype relations in perturbed MDDCs by linking the transcriptomic phenotype to the CRISPR perturbation that triggered it.

[0160] In particular, for arrayed read-outs, ELISA, qPCR, or microscopic imaging is conveniently used.

[0161] High-throughput methods can be used for determining (or tracking) perturbations in a plurality of single cells. Specifically, a high-throughput method for determining AE007P

[0162] -18- perturbations in a plurality of single cells comprises expressing in each of a plurality of single cells one or more perturbation gRNAs, with or without a barcode nucleic acid sequence (of e.g., 3-400 nucleotides) that allows identifying the gRNA that is responsible for the specific perturbation. Specifically, the transduced MDDCs are annotated with sgRNA-specific barcodes. Specifically, the gRNAs can be detected directly and can be utilized to decode which perturbation was present in the respective cell.

[0163] Specifically, a gRNA and a barcode sequence can be operatively linked to cisacting transcriptional regulatory elements. Such elements may include promoter sequences, polyA signals and enhancer elements.

[0164] Specifically, a gRNA may comprise a barcode which is a unique identifiable nucleotide sequence that is indicative for the respective perturbation of the host cell induced by the gRNA. In such case, the gRNA-barcode can be conveniently determined by sequencing the gRNA sequence.

[0165] Specifically, the gRNA sequence itself is a unique identifiable nucleotide sequence and can thus be used as a gRNA-barcode.

[0166] The amount of the gRNA-barcode within a perturbed MDDC pool can be conveniently determined by any method of determining RNA or a corresponding nucleic acid sequence, such as e.g., described herein.

[0167] For example, a sequencing analysis of the gRNA-barcode library can be performed, which allows for a quantitative assessment of the gRNA-barcodes in the perturbed MDDC pool. By comparing the read counts of the gRNA-barcode to a known standard, such as a reference or a control sample, the absolute amount of the gRNA- barcode in the MDDC pool can be estimated. Specifically, gRNA-barcodes may also be detected by hybridization to suitable (e.g., complementary) DNA or RNA probes.

[0168] Specifically, the lentiviral expression constructs may also encode a detectable or selectable moiety. These moieties serve to provide information regarding which cells have been successfully infected or transfected and express the gRNA.

[0169] The detectable moiety can be a reporter polypeptide which is directly visualized or a member of a binding pair, which is identifiable via its interaction with an additional member of the binding pair.

[0170] Specifically, the reporter polypeptide can be a fluorescent protein. Exemplary fluorescent proteins include, but are not limited to green fluorescent protein (Genbank Accession No. AAL33912), Fluorescein isothiocyanate (Genbank Accession No. AE007P

[0171] -19-

[0172] AAF22695), orange fluorescent protein (Genbank Accession No. AAL33917) and blue fluorescent protein (e.g. Uniprot No. D6NKF4).

[0173] Additional reporter polypeptides may include products of bacterial luciferase genes, e.g., the luciferase genes encoded by Vibrio harveyi, Vibrio fischeri, and Xenorhabdus luminescens, the firefly luciferase gene FFlux, and the like.

[0174] In another example, the detectable moiety can be an enzyme producing a colorimetric reaction.), alkaline phosphatase (Genbank Accession No. AAK73766), peroxidase (Genbank Accession No. NP_568674), histidine tag (Genbank Accession No. AAK09208), Myc tag (Genbank Accession No. AF329457), biotin ligase tag (Genbank Accession No. NP 561589), beta galactosidase (Genbank Accession No. NM_1 25776), and strepavidin (Genbank Accession No. S 11540).

[0175] Methods of measuring a reporter polypeptide are well-known to those of skill in the art and the selection of the particular method is dependent upon the detectable moiety which is used in the system. For example, the reporter polypeptide may be detected using standard techniques (e.g., radioimmunoassay, radio-labeling, immunoassay, assay for enzymatic activity, absorbance, fluorescence, luminescence, and Western blot). More preferably, the level of the reporter protein is easily quantifiable using standard techniques even at low levels. Specifically, the reporter polypeptide is measured using a fluorescence-activated cell sorter (FACS).

[0176] According to a specific aspect, the invention provides for the use of the method described herein in a method of studying single gene or epistatic effects in MDDCs. Specifically, epistatic effects are explored to determine the interaction of the effect of a gene mutation that is dependent on the presence or absence of mutations in one or more other genes.

[0177] According to another specific aspect, the invention provides for the use of the method described herein in a method of identifying or validating a therapeutic target.

[0178] Specifically, the target is identified or validated, if its perturbation induces a desired effect of said MDDCs. Specifically, the target is identified or validated for the development a drug, a cell therapy, a cellular vaccine, or gene therapy.

[0179] Specifically, the method described herein can be used for developing dendritic cell vaccines based on MDDCs.

[0180] Specifically, the method described herein can be used in a method for engineering MDDCs for developing dendritic cell vaccines. AE007P

[0181] -20-

[0182] Specifically, the MDDCs originate from a patient for which the target is identified or validated, in particular to develop a respective targeted therapy.

[0183] According to another specific aspect, the invention provides for the use of the method described herein in a method for improving dendritic cell therapy, preferably wherein the dendritic cell therapy is improved as compared to a method using MDDCs that are not engineered for said genomic perturbation.

[0184] Specifically, the dendritic cell therapy is improved by using MDDCs that are engineered for a specific genomic perturbation.

[0185] Specifically, the dendritic cell therapy is improved by using MDDCs that are engineered and selected for perturbing one or more target GOIs.

[0186] Improvements can relate to activity, stability, longevity, or reduced side effects. The cell therapy can be improved as compared to MDDCs that are not engineered for said genomic perturbation.

[0187] Specifically, the improvement is caused by at least one phenotypic characteristic of the engineered MDDCs, such as cellular fitness, or expression of one or more marker.

[0188] According to a specific aspect, a library of perturbed MDDCs is obtained from the perturbation screen described herein, wherein the library covers perturbation of a diversity of at least 10 different genes, preferably wherein the diversity of genes is as further described herein.

[0189] Specifically, the MDDC library comprises a repertoire of perturbed MDDCs which covers perturbation of a diversity of at least 10 different genes.

[0190] Specifically, the perturbation is directed to the MDDCs genome, in particular the genome of a wild-type MDDC.

[0191] Specifically, the diversity is at least any one of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 different genes, in specific cases up to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or all of the endogenous genes comprised the MDDC genome, in particular the wild-type MDDC genome.

[0192] The MDDC library may be suitably contained as a pool ( / .e., mixture) in one containment, which allows the pooled CRISPR screen as described herein.

[0193] FIGURES

[0194] Figure 1 : Lentiviral transduction efficiency in MoDCs. Cells were either left untransduced, or transduced with lentivirus encoding sgRNA-NTC, VLP-Vpx, or a combination of sgRNA-NTC and VLP-Vpx. Transduction efficiency is read out in terms of %GFP+ cells AE007P

[0195] -21-

[0196] Figure 2: A. B2M and CD81 levels in inactivated and activated MoDCs transduced with sgRNA against B2M or CD81. Histograms depict the distribution of fluorescence levels for antibodies targeting B2M or CD81 proteins

[0197] B. Bar graphs indicating the median fluorescence intensity (MFI) of cells transduced with sgRNAs against B2M or CD81. Values have been normalized to the MFI of untransduced cells.

[0198] Figure 3: B2M levels measured in MoDCs on Day 7 and Day 11 post transduction with sgRNA against B2M and KRAB-dCas9 transduced with sgRNA against B2M. Left column represents transduction efficiency measured in terms of %GFP+ cells. Right column represents distribution of fluorescence levels for antibodies targeting B2M.

[0199] Figure 4: Flow cytometry analysis of MoDCs transduced with sgRNA-NTC and KRAB-dCas9 and selected with indicated concentrations of puromycin. Transduction efficiency is read out in terms of %GFP+ cells

[0200] Figure 5: A. Lentiviral transduction efficiency in MoDCs. Cells were either left cotransduced with lentiviruses encoding sgRNA-B2M and KRAB-dCas9 on day 0 or alternatively, were seguentially transduced with KRAB-dCAs9 on Day 0 and with sgRNA-B2M on Day2. Transduction efficiency is read out in terms of %GFP+ cells B. B2M levels measured cells from (A). Histograms depict the distribution of fluorescence levels for antibodies targeting B2M.

[0201] Figure 6: A. Forward / side scatter profiles of MDDCs that were either untransduced or transduced with lentiviruses encoding cas9 nuclease and sgRNA against NTC, B2M, or CD81. B. B2M and CD81 levels measured cells from (A). Histograms depict the distribution of fluorescence levels for antibodies targeting B2M (left panel) and CD81 (right panel).

[0202] Figure 7: Seguences provided herein

[0203] Figure 8: (A). Uniform manifold approximation and projection (UMAP) plot of 53,200 perturbed MDDCs post guality control, KRAB-dCas9, and gRNA assignment, shaded by stimulation condition. (B) and (C). Contour density plots of MDDCs assigned to indicated sgRNA targets in UMAP space. The total perturbed cells contour is shown in greyscale underneath.

[0204] Figure 9: Heatmap summarizing the effects of CRISPRi targeting 78 individual genes, with each gene perturbation labeled along the x-axis and the normalized gene expression values measured along the y-axis. The log2fold changes in gene expression AE007P

[0205] -22- are measured and indicated as the grey tiles. The bar graph on the right represents the expression levels of target genes in human MDDCs.

[0206] Figure 10: Transcriptome comparison of MDDCs transduced with gRNA for the indicated genes versus those transduced with NTC. Each knockdown is represented as a dot. The dots on the left represent knockdowns that impair IFNy mediated MDDC activation and those on the right represent knockdowns that promote activation. X-axis shows shift on an LDA scale; Y-axis shows the statistical significance.

[0207] Figure 11 :

[0208] A. Primary CD14-positive monocytes were thawed, transduced with a lentivirus encoding KRAB-dCas9 on day 0 and another lentivirus encoding the gRNA against a non-targeting control (NTC) or B2M on day 2. The cells were differentiated to monocyte- derived dendritic cells (MDDCs) by addition of human 100 ng / ml GM-CSF and 20 ng / ml IL-4 on day 0. B2M levels measured in MDDCs on day 14. Figure represents the distribution of fluorescence levels for antibodies targeting B2M.

[0209] B. Primary CD14-positive monocytes were thawed and first fully differentiated into MDDCs by addition of human 100 ng / ml GM-CSF and 20 ng / ml IL-4. MDDCs were transduced with a lentivirus encoding KRAB-dCas9 on day 5 and another lentivirus encoding the gRNA against a non-targeting control (NTC) or B2M on day 7. B2M were levels measured in MDDCs on day 14. Figure represents the distribution of fluorescence levels for antibodies targeting B2M.

[0210] DETAILED DESCRIPTION OF THE INVENTION

[0211] Unless indicated or defined otherwise, all terms used herein have their usual meaning in the art, which will be clear to the skilled person. Reference is for example made to the standard handbooks. Genetic modifications described herein may employ tools, methods and technigues known in the art, such as described by J. Sambrook et al., Molecular Cloning: A Laboratory Manual(3rdedition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2001), Lewin “Genes ”V”, Oxford University Press, New York, (1990), and Janeway et al. “Immunobiology” (5thEd., or more recent editions), Garland Science, New York, 2001.

[0212] The terms “comprise”, “contain”, “have” and “include” as used herein can be used synonymously and shall be understood as an open definition, allowing further members or parts or elements. “Consisting” is considered as a closest definition without further elements of the consisting definition feature. Thus “comprising” is broader and contains the “consisting” definition. AE007P

[0213] -23-

[0214] The subject matter of the claims specifically refers to artificial products or methods employing or producing such artificial products, which may be variants of native (wildtype) products, such as MDDCs. Though there can be a certain degree of sequence identity to the native structure, it is well understood that the materials, methods and uses of the invention, e.g., specifically referring to isolated nucleic acid sequences, amino acid sequences, fusion constructs, expression constructs, perturbed MDDCs and modified proteins, are “man-made” or synthetic, and are therefore not considered as a result of “laws of nature”.

[0215] The term “about” as used herein refers to the same value or a value differing by + / -10% or + / -5% of the given value.

[0216] Specific terms as used throughout the specification have the following meaning:

[0217] The term “CRIPSR screen” is herein understood as RPN-mediated perturbation screen which employs CRISPR tools.

[0218] CRISPR technology allows functional genetic screens for understanding the genetic underpinnings of biological pathways at a systems level. Typically, CRISPR screening is a large-scale experimental approach used to screen a population of mutant cells to discover genes involved in a specific phenotype. Instead of modulating expression of genes at the post-transcriptional level, CRISPR introduces mutations to genes for a specific genetic perturbation by editing genetic sequences of interest using the CRISPR gene editing machinery ( / .e. the CRISPR system).

[0219] These screens employ a genetics approach, in which cellular phenotypes arising from genetic perturbations, in particular genome-wide perturbations, are analyzed. Causal relationships between the genes and phenotypes can then be validated through further screening and experimentation. In principle, there are two modalities of genetic perturbations used in screens: gain-of-function or loss-of-function. The former involves driving the expression of a gene so that more mRNA / protein is produced. The latter method involves reducing the amount of or terminating mRNA / protein associated with genes of interest. For both types of manipulation, changes in resulting phenotypes indicate the involvement of a gene in the pathway or disease state of interest.

[0220] Loss-of-function screens play an important role in drug discovery, the process through which new drugs are developed to treat diseases. In the target-based approach to drug discovery, a target gene (or gene product) that is associated with a disease is first identified and target-specific therapies or chemical compounds can then be screened for a desired therapeutic effect. AE007P

[0221] -24-

[0222] The first step of a drug discovery pipeline, called target identification, aims to identify genes (or mRNA or proteins) that are associated with a disease of interest. Loss- of-function screens often play a pivotal role in identifying putative targets. Large-scale screens systematically perturb large sets of genes in order to discover targets in an unbiased fashion. For instance, gene disruptions in healthy cells that recapitulate a disease phenotype implicates the gene’s association with the disease. Alternatively, genetic disruptions in diseased cells (e.g., cancer) that revert the disease phenotype and cause a normal or healthy phenotype can mimic the therapeutic effect of a drug.

[0223] In addition to discovering novel drug targets, loss-of-function screens can also be used to improve existing therapies. For instance, genes can be identified that confer resistance or increase sensitivity to an existing therapy or drug.

[0224] CRISPR screens can further be used to develop potent combinations of therapies or drugs. Combinatorial screens, in which multiple genes are knocked out, can uncover genetic interactions that can be leveraged for therapy development. Using such screens helps researchers gain insights on the complexities of different diseases and enable the development of more personalized medicines.

[0225] Genes identified in a primary screen typically undergo a process of target validation to confidently determine whether an identified gene is directly linked to the phenotypic effect. Ways to increase confidence in gene-disease relationships include reproducing the results in biologically relevant cell types. Another approach is to design different gRNA sequences for the same gene targets and observe whether the same change in phenotype occurs. Another strategy is to choose an orthogonal method of gene perturbation. For instance, if RNAi was used in a primary screen, CRISPR can be used in a secondary screen, or vice versa. Another strategy is to engineer monoclonal cell lines bearing the gene perturbation and assessing the phenotypic consequences in these monoclonal cells.

[0226] Specific expression products described herein are CRISPR expression products such as CRISPR enzymes or CRISPR proteins (including e.g., protein fusions) which are used in methods of genomic perturbation of a cell that expresses such CRISPR expression product in conjunction with a guiding element to target genomic site of interest. A specific expression system herein described is referred to as CRISPR system or CRISPR machinery.

[0227] The term “expression” of a coding DNA or of a gene product of the coding DNA, such as expression of a respective polypeptide, protein or nucleic acid encoded by the AE007P

[0228] -25-

[0229] DNA, in particular RNA, is herein meant to encompass at least one step selected from the group consisting of DNA transcription into mRNA, mRNA processing, mRNA splicing, mRNA maturation, mRNA export, mRNA translation, protein folding and / or protein transport.

[0230] The term “expression cassette” is herein understood to refer to nucleic acid molecules (herein also referred to as polynucleotides), which contain a desired coding sequence (herein referred to as a gene), and control sequences in operable linkage, so that host cells transformed or transfected with these molecules incorporate the respective sequences and are capable of producing the encoded proteins.

[0231] One or more expression cassettes are herein also understood as “expression system”. The expression system may be included in an expression construct, such as an artificial expression cassette, a vector and in particular a plasmid. The relevant DNA of an expression cassette or construct may also be integrated into a host cell chromosome.

[0232] Expression cassettes are conveniently provided as expression constructs e.g., in the form of “vectors”, which are typically DNA sequences that are required for the transcription of cloned recombinant nucleotide sequences i.e., of recombinant genes and the translation of their mRNA in a suitable host organism. The term “vector” as used herein specifically includes lentiviral vectors which comprise genome integrating nucleotide sequences.

[0233] Preferred expression vectors described herein are expression vectors suitable for expressing a recombinant gene in eukaryotic host cells such as human MDDCs. Appropriate expression vectors typically comprise regulatory sequences suitable for expressing DNA encoding a polypeptide or protein of interest in the host cells. Examples of regulatory sequences include promoter, operators, enhancers, ribosomal binding sites, polyadenylation sites and sequences that control transcription and translation initiation and termination. The regulatory sequences are typically operably linked to the DNA sequence to be expressed.

[0234] To allow expression of a recombinant nucleotide sequence in a host cell, a promoter sequence is typically regulating and initiating transcription of the downstream nucleotide sequence, with which it is operably linked. An expression cassette or vector typically comprises a promoter nucleotide sequence which is adjacent to the 5’ end of a coding sequence, e.g., upstream from and adjacent to the coding sequence (e.g., gene of interest) or if a signal or leader sequence is used, upstream from and adjacent to said AE007P

[0235] -26- signal and leader sequence, respectively, to facilitate translation initiation and expression of coding sequences to obtain the expression product.

[0236] The term “genetic region of interest” or “genomic region of interest” (GOI) as used herein shall mean a genomic DNA region encoding a gene product of a specific gene, or one or more (or all) DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a GOI is understood to not only include genes, but also to include promoter sequences, exons and introns, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0237] The term “lentivirus” (LV) as used herein shall refer to a retrovirus of the genus lentivirus that express reverse transcriptase and optionally integrase. These two enzymes are used to integrate viral RNA into host DNA, allowing for the exploitation of host machinery to express viral genes. Lentiviruses can convert viral RNA into complementary DNA (cDNA) and may integrate a significant amount of viral cDNA into the DNA of a host cell. Lentiviruses can efficiently infect nondividing cells, so they are one of the most efficient methods of gene delivery and are broadly applicable across proliferating and non-proliferating cell types. They can become endogenous, integrating their genome into the host germline genome, so that the virus is henceforth inherited by the host’s descendants. According to the classification of the International Committee on Taxonomy of Viruses (ICTV), the genus lentivirus belongs to the family Retroviridae and currently comprise of nine species: seven animal lentiviruses and two human lentiviruses. Animal lentiviruses are bovine immunodeficiency virus (BIV), caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), puma lentivirus (PLV), simian immunodeficiency virus (SIV) and visna / maedi virus (VMV). Human species are well-known human immunodeficiency virus 1 (HIV-1) and human immunodeficiency virus 2 (HIV-2).

[0238] As used herein, the term “lentivirus”, shall also encompass lentiviral particles, and in particular replication-incompetent lentiviral particles.

[0239] Using lentiviral vectors to deliver genes into targeted cells has proven to be a dependable, efficient, and safe method for research. Typically, lentiviral vectors are modified from a wild-type lentivirus, with many of the viral genes removed. Such lentiviral vectors are referred to as “lentiviral particles” or “lentivirus particles”. AE007P

[0240] -27-

[0241] LV are commonly used as a vector (or plasmid) for delivery of a nucleic acid molecule (or gene) into the host cell’s genome. Such nucleic acid molecule is herein referred to as a “transgene”. LV can be packaged with a transgene for transgene delivery.

[0242] A transgene sequence is typically flanked by long terminal repeat (LTR) sequences, which facilitate integration of the transfer plasmid sequences into the host genome. In particular, it is the sequences between and including the LTRs that is integrated into the host genome upon viral transduction.

[0243] Upon infection of a cell, a LV may or may not replicate, depending on whether the virus is replication-incompetent or replication-competent. For safety reasons, commonly used lentiviral transfer plasmids are replication incompetent. In particular, the lentiviral transfer plasmids may contain an additional deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN) after integration. Specifically, a lentiviral vector only contains the LTRs and the packaging signal, 4. In addition, lentiviral packaging genes can be provided on separate plasmids (one or more “packaging plasmids”), so the pseudo lentiviral particles are replication-incompetent, with a deficiency to replicate.

[0244] The term “monocyte-derived dendritic cell” or “MDDC” as used herein shall refer to immune cells that originate from the differentiation of monocytes, in particular blood monocytes, such as CD14positive(CD14+) monocytes (including CD14 high or low expressors). The term “MDDC” shall particularly refer to a differentiated, immature or mature blood monocyte-derived dendritic cells, or mixtures thereof.

[0245] Immature dendritic cells are defined by their inefficiency to present antigens to MHC receptors, but they do secrete few cytokines and express some ligands characteristic for DCs. Mature dendritic cells are antigen-presenting cells which are immunologically competent dendritic cells. They can evolve from immature, antigencapturing cells to mature, antigen-presenting, T cell priming cells; converting antigens into immunogens and expressing molecules such as cytokines, chemokines, costimulatory molecules and proteases to initiate an immune response.

[0246] The term not only refers to wild-type MDDCs as naturally occurring, but also includes perturbed or otherwise engineered MDDCs e.g., dendritic cells engineered for expressing a heterologous antigen which can be used in the development of a cellular DC-based vaccine. MDDCs are the major DC type used in vaccine-based clinical studies for a variety of cancers. AE007P

[0247] -28-

[0248] MDDCs are herein understood as single cell, a plurality of single cells, or a mixture (pool) of a plurality of MDDCs e.g., an MDDC pool of differently perturbed cells.

[0249] MDDCs are typically generated from peripheral blood monocytes and are widely used to model human dendritic cells for in vitro studies.

[0250] MDDCs can present with a spectrum of different phenotypes, Immature DCs (imDCs) take up antigens and present them to naive T cells, a process that induces DC maturation; by contrast, fully mature DCs (mDCs) promote adaptive immune responses by inducing effector T cells. Tolerogenic DCs (tDCs) show anti-inflammatory and immunosuppressive activity against various autoimmune diseases, including rheumatoid arthritis (RA), experimental autoimmune myocarditis (EAM), and acute myocardial infarction (AMI).

[0251] Functional specialization of MDDCs in vitro can be accomplished by stimulation with a suitable stimulus such as lipopolysaccharide (LPS) (mature DCs) and Dexamethasone or Vitamin D3 (tolerogenic DCs). In vitro culture techniques can impact phenotype of the MDDCs.

[0252] Primary monocytes are MDDC precursors and together they constitute part of the mononuclear phagocyte system. Ex vivo monocytes can be divided into three distinct subpopulations based on their expression of CD14 and CD16: classical monocytes with CD14highCD16negexpression, intermediate monocytes with CD14highCD16pos, and non- classical monocytes with CD14|OWCD16high. Ex vivo monocytes purified from donor peripheral blood mononuclear cells (PBMCs e.g., from cryopreserved PBMC) are a key source of monocytes, and MDDCs are the principal source of cells for in vitro studies in human macrophages.

[0253] Different methods can be employed to purify monocytes from PBMCs. Commonly used methods employ plastic adhesion and / or magnetic bead-based immuno-isolation kits (negative and CD14posselection). It is preferred that any such purification method produces pure monocyte / MDDC population or products with low contamination by lymphocytes, granulocytes, and platelets.

[0254] The term “genomic perturbation” and “genomic perturbation screen” as used herein is specifically understood in the following way.

[0255] A host cell can be mutagenized or engineered by genomic perturbation, in particular CRISPR-mediated perturbation, of one or more targets in the genome.

[0256] A genomic target of perturbation is herein also referred to as a “perturbed gene” or “perturbed GOI”. A cell that is undergoing targeted perturbation is also referred to as AE007P

[0257] -29-

[0258] “perturbed cell”. Specifically, the methods described herein produce “perturbed MDDCs”.

[0259] A cell may be engineered for genomic perturbation of one or more genes (i.e., targets(s) of genomic perturbation), thereby modulating the expression of respective gene(s), such as upregulating, downregulating, overexpressing or underexpressing (understood as expressing at higher and lower levels than normal, respectively), or completely inactivating, deleting or knocking out the target(s) of the perturbation.

[0260] Genomic perturbation may lead to a change in expressing a gene or a gene product. Expression of a gene may be upregulated or downregulated. A gene may be overexpressed, such as expressed at higher levels, or underexpressed, such as expressed at lower levels, as compared to a host cell without such engineering. The yield of host cell products may be increased or reduced by genomic perturbation. A gene editing method may be used for host cell engineering. Specifically, the host cell may express a CRISPR enzyme or protein to support engineering the host cell’s genome by CRISPR-mediated perturbation.

[0261] Genomic perturbation of a host cell line or population which targets a variety of different host cell genes or respective regulatory elements, can result in a diversity of host cells with differences in the respective host cell’s genome.

[0262] As described herein, specific perturbed host cells are perturbed MDDCs. A repertoire of host cells (MDDCs) can be produced by genomic perturbation of the host cell. Specifically, host cells originating from the same source are subject to genomic perturbation, which may result in the same type of host cells, but with a difference in their genome that corresponds to the target and type of genomic modulation caused by the perturbation.

[0263] A repertoire of diverse perturbed cells (e.g., MDDCs) can be produced by genomic perturbation of host cells to target different genes in a cell population or in individual cells. For example, a repertoire comprises a diversity of cells, wherein each cell is differently perturbed, and / or perturbed to target a different gene.

[0264] For perturbation of a diversity of genes, a library of targeting molecules can be used, such as e.g., a library of different guide RNAs (e.g., gRNA, sgRNAs), each targeting a different gene.

[0265] In an RPN-mediated perturbation screen (CRISPR screen) described herein, the library of targeting molecules can be used in the presence of an RPN that mediates the genomic perturbation in cells, thereby obtaining a repertoire of diverse cells, wherein the AE007P

[0266] -30- diversity originates from the respective targeting molecules (such as guide RNAs e.g., gRNA, sgRNAs) which cause a variety of perturbations in the cells.

[0267] Perturbation methods and tools are well-known in the art. Specifically, the method comprises (1) introducing single-order or combinatorial perturbations to a population of cells, (2) measuring genomic, genetic, proteomic, epigenetic and / or phenotypic differences in single cells and (3) assigning a perturbation(s) to the single cells. A perturbation may be linked to a phenotypic change, preferably changes in gene or protein expression. Specifically, measured differences that are relevant to the perturbations are determined by applying a model accounting for co-variates to the measured differences. The model may include the capture rate of measured signals, whether the perturbation actually affected the cell (phenotypic impact), the presence of subpopulations of either different cells or cell states, and / or analysis of matched cells without any perturbation. Specifically, the measuring of phenotypic differences and assigning a perturbation to a single host cell can be determined by determining a respective marker (e.g., barcode) in the host cell’s product and / or by determining structure, function or activity of the host cell’s product.

[0268] Specifically, CRISPR systems and respective CRISPR tools may be used for targeted genomic perturbation of MDDCs such as described herein.

[0269] In the context of a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system, a “target”, refers to a genomic sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Where a transcription-modulating domain is employed, upon such hybridization of the guide sequence, the target GOI is typically upregulated or downregulated in terms of its expression level. Typically, the target sequence is a regulatory sequence, such as a promoter or a transcriptional start site, which controls the expression of said GOI.

[0270] A target (in particular, a target GOI) is understood to be “perturbed”, if there is a genomic perturbation that affects the GOI, its expression or respective gene products (e.g., gene transcripts).

[0271] Specifically, genomic perturbation can result in the inactivation, deletion of knockout of a target. Genomic elements are suitably targeted by using a number of guide RNAs, e.g., one, two or three guide RNAs, to delete (or inactivate, or knockout) regions of a defined size. AE007P

[0272] -31-

[0273] The CRISPR-based methods described herein may cause perturbations for silencing, knock-down or knockout of a GOI, or otherwise for activating or knockin of a GOI. Silencing, knock-down or knockout refers to techniques by which the expression of a GOI is reduced. Activating or knockin refers to techniques by which the expression of a GOI is increased. Differential expression of a target GOI may result from its perturbation, such as by interfering (or downregulating) or activating (or upregulating) of the target gene expression.

[0274] Specifically, a gene knockout refers to techniques by which the expression of a gene is fully blocked i.e., the respective gene is inoperative, or even removed. Methodological approaches to achieve this goal are manifold and known to the skilled person. Examples are the production of a knockout mutant which is dominantly negative for the given gene. Other examples refer to gene alteration which may lead to a dysfunctional gene product or to a gene product with reduced activity. This approach involves the introduction of frame shift mutations, nonsense mutations (i.e., introduction of a premature stop codon) or mutations which lead to an amino acid substitution which renders the whole gene product dysfunctional, or causing a reduced activity. Protocols describing the practical application of gene silencing, gene knock-down, gene knockout, delivery of a dominant negative construct, and / or gene alteration are routine and commonly available to the skilled person. The technical teaching provided herein is thus entirely enabled with respect to all conceivable methods leading to an inactivation, inhibition, deletion, knockout, or reduction of gene expression of a gene product, or to the expression of a dysfunctional, inactive gene product, or a gene product with reduced activity.

[0275] Specifically, the gene expression can be downregulated (thereby reducing expression) or upregulated (thereby increasing expression). According to a specific example, the perturbation can occur by introducing a small insertion or deletion into a coding exon, thus partially or completely eliminating the respective functional gene product from the target cell.

[0276] The term “reduce expression” generally refers to any amount less than an expression level exhibited by a reference standard, which is a cell prior to the engineering to reduce expression of a certain gene, or which is otherwise expressed in a cell of the same type or species which is not engineered to downregulate expression of said gene. Typically, a cell is engineered to downregulate expression of a GOI by genetic modification to reduce expression of said gene, thereby obtaining an expression AE007P

[0277] -32- level of a gene product which is less than the expression of the same gene product prior to said genetic modification or in a comparable cell which does not comprise said genetic modification. “Less than” includes, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90% difference, or more. No expression of the gene product is also encompassed by the term “reduction of expression”.

[0278] The term “reduction” in the context of gene expression as used herein refers to an experimental approach leading to reduced expression of a given gene compared to expression in a control cell. Downregulation of expression of a gene can be achieved by various experimental means such as introducing nucleic acid molecules into the cell which hybridize with parts of the gene’s mRNA leading to its degradation (e.g., shRNAs, RNAi, miRNAs) or altering the sequence of the gene in a way that leads to reduced transcription, reduced mRNA stability or diminished mRNA translation. A specific approach uses CRISPRi.

[0279] The term “increase expression” generally refers to any amount higher than an expression level exhibited by a reference standard, which is a cell prior to the engineering to reduce expression of a certain gene, or which is otherwise expressed in a cell of the same type or species which is not engineered to upregulate expression of said gene. Typically, a cell is engineered to upregulate expression of a GOI by genetic modification to increase expression of said gene, thereby obtaining an expression level of a gene product which is higher than the expression of the same gene product prior to said genetic modification or in a comparable cell which does not comprise said genetic modification. “Higher than” includes, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80, 90% difference, or more.

[0280] CRISPR tools described herein may or may not comprise an effector such as a transcription effector. Effectors described herein may be repressors or activators, and typically contain DNA binding domains that recognize and bind recognition sites or sequences in the promoters of transcriptionally active or inactive genes, and also may contain activation or repression domains that activate or suppress gene transcription when the transcription modulator binds to the recognition site or sequence. Transcription effector binding motifs are known in the art. As a specific example, a transcription effector binds to an enhancer and a promoter region of the genome of the cell. Specifically, the enhancer and promoter regions can be both located in the same insulated neighborhood of the genome of the cell. AE007P

[0281] -33-

[0282] The term “sequence identity” of a variant, homologue, paralog or orthologue as compared to a parent nucleotide or amino acid sequence indicates the degree of identity of two or more sequences. Two or more amino acid sequences may have the same or conserved amino acid residues at a corresponding position, to a certain degree, up to 100%. Two or more nucleotide sequences may have the same or conserved base pairs at a corresponding position, to a certain degree, up to 100%. The compared molecules may comprise sequences of different lengths.

[0283] The degree of sequence identity can be determined by comparing similar overlapping sequences, wherein the similar overlapping sequences may have a certain degree of sequence identity. The overlapping sequences may comprise a part or the full-length of one of the compared sequences e.g., the shorter one of the compared sequences, wherein the part is e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of said one the compared sequences. In particular, sequence identity refers to comparing the full-length sequence of one of the compared sequences e.g., the shorter one of the compared sequences.

[0284] The term “comprising or consisting of’ with respect to a certain sequence identity described herein, shall particularly mean the respective sequence identity to the part or the full-length of one of the compared sequences e.g., the shorter one of the compared sequences, wherein the part is e.g., at least any one of 50%, 60%, 70%, 80%, 90%, or 95% of said one the compared sequences.

[0285] In particular, where a molecule comprises a certain sequence identity to a compared molecule, the sequence identity is determined for at least part of said compared molecule e.g., at least any one of 50%, 60%, 70%, 80%, 90%, 95%, or 100% of said compared sequence. Where a molecule consists of a certain sequence identity to a compared molecule, the sequence identity is determined for the full-length of said compared molecule i.e., 100% of said compared sequence.

[0286] Sequence similarity searching is an effective and reliable strategy for identifying homologs with excess (e.g., at least 50%) sequence identity. Sequence similarity search tools frequently used are e.g., BLAST, FASTA, and HMMER.

[0287] Sequence similarity searches can identify such homologous proteins or genes by detecting excess similarity, and statistically significant similarity that reflects common ancestry. Homologues may encompass orthologues, which are herein understood as the same protein in different organisms, e.g., variants of such protein in different organisms or species. AE007P

[0288] -34-

[0289] “Percent (%) amino acid sequence identity” with respect to an amino acid sequence, homologs and orthologues described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0290] For purposes described herein, the sequence identity between two amino acid sequences can be determined using the NCBI BLAST program version BLASTP 2.8.1 with the following exemplary parameters: Program: blastp, Word size: 6, Expect value: 10, Hitlist size: 100, Gapcosts: 11.1 , Matrix: BLOSUM62, Filter string: F, Compositional adjustment: Conditional compositional score matrix adjustment.

[0291] For pairwise protein sequence alignment of two amino acid sequences along their entire length the EMBOSS Needle webserver (https: / / www.ebi.ac.uk / Tools / psa / emboss_needle / ) can be used with default settings (Matrix: EBLOSUM62; Gap open: 10; Gap extend: 0.5; End Gap Penalty: false; End Gap Open: 10; End Gap Extend: 0.5). EMBOSS Needle uses the Needleman-Wunsch alignment algorithm to find the optimum alignment (including gaps) of the two input sequences and writes their optimal global sequence alignment to file.

[0292] "Percent (%) identity" with respect to a nucleotide sequence e.g., of a GOI, a promoter or a gene, is defined as the percentage of nucleotides in a candidate DNA sequence that is identical with the nucleotides in the DNA sequence, after aligning the sequence and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0293] For purposes described herein (unless indicated otherwise), the sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTN 2.8.1 with the following exemplary parameters: Program: AE007P

[0294] -35- blastn, Word size: 11 , Expect threshold: 10, Hitlist size: 100, Gap Costs: 5.2, Match / Mismatch Scores: 2,-3, Filter string: Low complexity regions, Mark for lookup table only.

[0295] Therefore, the present disclosure provides for a workflow that can be used for performing pooled CRISPR screens in monocytes. To do so, cells can be infected with Vpx-containing SIVsm virus-like particles (VLPs), as described by Berger et al. (2011). This allowed transduction with lentiviruses bearing the gRNA and the CRISPR machinery. In the examples described herein, primary CD14-positive monocytes were transduced with a lentivirus encoding the gRNA against a non-targeting control (NTC) and eGFP, with or without the addition of Vpx-containing VLPs. Next, the cells were differentiated to monocyte-derived dendritic cells (MDDCs) by addition of human GM- CSF and IL-4. Differentiation of transduced monocytes into MDDCs was confirmed by flow cytometry-based phenotyping for signature MDDC markers. EGFP was used to assess transduction efficiency in MDDCs. Cells incubated with the lentivirus alone show only 1 % EGFP-positive cells (sgNTC), comparable to the background controls. In contrast, the addition of VLP-Vpx in combination with the lentivirus increased the transduction efficiency to 31 % (sgNTC and VLP-Vpx). This means that the delivery of Vpx supports efficient lentiviral transduction of monocytes.

[0296] The functionality of the CRISPR interference machinery was tested using this approach by targeting two cell surface receptors (B2M and CD81). To this end, primary monocytes were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors, first encoding KRAB-dCas9 and the second encoding suitable gRNAs targeting the transcriptional start sites of B2M or CD81. Cells were differentiated to MDDCs by addition of human GM-CSF and IL-4. On Day 8 post transduction, MDDCs were further activated by addition of LPS (secondary stimulus) or left untreated. CRISPRi efficiency was assessed on Day 9 using flow cytometry. A moderate, yet robust reduction of both surface receptors was observed in both activated and inactive MDDCs.

[0297] As specific examples proves that transduction efficiency significantly increases upon sequential transductions. By the sequential transduction of the two-part lentiviruses delivering the CRISPR tools (thus avoiding co-transduction with the two-part lentiviral vectors), and considering a recovery time of at least 1 day between a first transduction and a second transduction, it was observed that the transduction efficiency was far higher (88%) than co-transduction of the two-part lentiviruses (64%). AE007P

[0298] -36-

[0299] By the present method, a majority of the MDDCs, in particular at least 50, 60, 70, 80, or 90%, or almost all of the cells can receive a gRNA. This enhances the number of cells that can be effectively utilized in a CRISPR screen.

[0300] The subject matter is further described by one or more of the following items:

[0301] 1. A method of producing a pool of human monocyte-derived dendritic cells (MDDCs) that are genetically engineered for a variety of genomic perturbations, by infecting the monocytes with lentiviruses to consecutively deliver an RNA-guided programmable nuclease (RPN) and an gRNA library comprising a repertoire of guide RNAs (gRNAs) that covers a variety of target genomic sequences of the MDDCs, wherein the monocytes are infected with lentiviruses in the presence of at least one MDDC differentiating factor and an inactivator of the cellular SAM domain HD domaincontaining protein 1 (SAMHD1).

[0302] 2. The method of item 1 , wherein a) the monocytes are first delivered with said RPN, and following a recovery time, the monocytes are delivered with said gRNA library; or b) the monocytes are first delivered with said gRNA library, and following a recovery time, the monocytes are delivered with said RPN; preferably wherein the recovery time is at least one day.

[0303] 3. The method of item 1 or 2, wherein said inactivation of SAMHD1 is by the introduction of any one of: a) a lentiviral accessory protein that induces degradation of SAMHD1 , preferably Vpx of simian immunodeficiency virus (SIV) or of human immunodeficiency virus 2 (HIV- 2), or a lentivirus paralog of Vpx, preferably using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs); b) an inhibitor that targets said SAMHD1 , preferably a siRNA, antisense oligonucleotide or small molecule inhibitor; c) another SAMHD1 inactivating CRISPR tools, comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

[0304] 4. The method of any one of items 1 to 3, wherein the MDDC pool is obtained in only one containment.

[0305] 5. The method of any one of items 1 to 4, wherein a) the variety of target genomic sequences includes any one or more of promoter sequences, terminators, translational regulatory sequences such as ribosome binding AE007P

[0306] -37- sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions; b) the variety of target genomic sequences includes any one or more of a noncoding or untranslated region (UTR) of a gene within the MDDC genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene.

[0307] 6. The method of any one of items 1 to 5, wherein said RPN comprises or consists of a) a CRISPR nuclease, preferably any one of a type II or type V CRISPR nucleases, preferably Cas9 or Cas12a; or b) a CRISPR nuclease containing fusion or complex with an effector, preferably a transcription-modulating domain, or an editor such as a base editor or prime editor, and optionally one or more accessory proteins, or a nucleic acid encoding any of the foregoing.

[0308] 7. The method of item 6, wherein the effector is selected from: a) a transcriptional repressor peptide for gene silencing, preferably a Kruppel- associated box (KRAB) domain, such as selected from the group consisting of ZIM3, or the KRAB domain of KOX1 ; or b) a transcriptional effector for gene activation, preferably a single transcriptional activation domain or combinatorial activation system, preferably selected from the group consisting of VP64, VPR (VP64, p65 and Rta), the SAM domain (consisting of p65 and HS1), the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as MSN, NMS or eN3x9; preferably wherein the RPN fused to the endonuclease effector is any one of a dCas9-KRAB (repressor), dCas9-VP64 (activator), dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, or dCas9-Tet1c, dCas9-EZH2.

[0309] 8. The method of any one of items 1 to 7, wherein the human monocytes are CD14+ monocytes of human peripheral blood, which are incubated with said at least one MDDC differentiating factor with an incubation time of at least 3 days.

[0310] 9. The method of any one of items 1 to 8, wherein said at least one MDDC differentiating factor is a cytokine, preferably GM-CSF and / or IL-4.

[0311] 10. The method of any one of items 1 to 9, wherein the MDDCs are further treated for tolerogenic or activating stimulation. AE007P

[0312] -38-

[0313] 11 . The method of any one of items 1 to 10, wherein said MDDC pool is analyzed for an effect of one or more of said genomic perturbations, by screening the MDDCs for at least one phenotypic characteristic, preferably wherein said at least one phenotypic characteristic is determined upon singularization of said MDDCs, or in a pool of the MDDCs.

[0314] 12. The method of item 11 , wherein at least one phenotypic characteristic is determined by measuring cellular fitness, or expression of one or more markers, preferably wherein marker expression is determined at the RNA or protein level, preferably by flow-cytometry, immunohistochemistry, RNA-Seq, qRT-PCR, proteomics, ELISA, or microscopic imaging.

[0315] 13. Use of the method of any one of items 1 to 11 , in a method of studying single gene or epistatic effects in MDDCs.

[0316] 14. Use of the method of any one of items 1 to 11 , in a method of identifying or validating a therapeutic target, preferably wherein the target is identified or validated, if its perturbation induces a desired effect of said MDDCs, preferably wherein the target is identified or validated for the development a drug, a cellular vaccine, a cell therapy, or gene therapy.

[0317] 15. The use of the method of any one of items 1 to 11 , in a method for engineering MDDCs for developing dendritic cell vaccines, preferably wherein the MDDCs originate from a patient for which the target is identified or validated.

[0318] EXAMPLES

[0319] Example 1: SIV-derived VLP-Vpx for transducing monocyte-derived dendritic cells (MDDCs)

[0320] CRISPRi machinery composed of two-part lentiviruses was produced with the 2ndgeneration lentivirus production system comprising the helper plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) and the KRAB-dCas9 cassette (SEQ ID NO: 21) for KRAB-dCas9 virus or sgRNA-EGFP cassette (SEQ ID NO: 22) for sgRNA virus. For VLP-Vpx production, Lenti-X™ 293T cells (632180, Takara) were transfected with SIV VLP-Vpx (Addgene Id #132928) and pMD2.G (Addgene #12259) in 6:1 ratio. 16 h post-transfection, culture medium was refreshed. Viral supernatant was harvested 72 h later, passed through 0.45 pm filter, concentrated using 50% PEG-8000, and frozen at -80°C until further use.

[0321] Primary CD14-positive monocytes (obtained from Research Donors Ltd. (UK)) were transduced with a lentivirus generated from EGFP-NTC cassette (SEQ ID NO:22) AE007P

[0322] -39- encoding the gRNA against a non-targeting control (NTC) (seq: GGCTCGATCCGGTACGCTTA, SEQ ID NO:23) and EGFP, with or without the addition of Vpx-containing VLPs (Addgene, catalog number 132928). Next, the cells were differentiated to monocyte-derived dendritic cells (MDDCs) by addition of 100 ng / ml human GM-CSF and 20 ng / ml human IL-4. Differentiation of transduced monocytes into MDDCs was confirmed by flow cytometry-based phenotyping for signature MDDC markers such as CD86, CD80, HLA-DR, CD40, and PDL1 (data not shown). EGFP was used to assess transduction efficiency in MDDCs. As shown in Figure 1 , cells transduced with the lentivirus alone show only 1 % EGFP-positive cells, comparable to the background controls (UT and VLP-Vpx). In contrast, the addition of VLP-Vpx in combination with the lentivirus increased the transduction efficiency to 31 % (sgNTC and VLP-Vpx). This means that the delivery of Vpx supports efficient lentiviral transduction of monocytes.

[0323] Example 2: CRISPRi in monocyte-derived dendritic cells

[0324] The functionality of the CRISPR interference machinery was tested using this approach by targeting two cell surface receptors (B2M and CD81) (Fig 2A). To this end primary monocytes were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors, first generated from a cassette encoding KRAB-dCas9 (SEQ ID NO:21) and the second encoding suitable gRNAs targeting the transcriptional start sites of B2M (seq: GGCCACGGAGCGAGACATCT, SEQ ID NO:24) or CD81 (seq: GGAGGCCTGGCAGGATGCG, SEQ ID NO:25). As stated before, cells were then differentiated to MDDCs by addition of 100 ng / ml human GM-CSF and 20 ng / ml human IL-4.. On Day 8 post transduction, MDDCs were further activated by addition of 50 ng / ml LPS (secondary stimulus) or left untreated. CRISPRi efficiency was assessed on Day 9 using flow cytometry-based measurements of the surface levels of the respective targets. A moderate, yet significant reduction of both surface receptors was observed in both activated and inactive MDDCs (Figure 2A and B).

[0325] Example 3: CRISPRi efficiency increases with longer incubation period post-transduction

[0326] In this example, it was tested how the stability and efficiency of the transduced CRISPRi machinery is affected upon longer periods of cell culture. CD14+ monocytes were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors, KRAB- dCas9 and sgB2M-EGFP as described before. Cells were cultured in the presence of GM-CSF and IL-4 and were harvested either on Day 7 or Day 11 post-transduction. Flow AE007P

[0327] -40- cytometry assessment of EGFP levels revealed that 59% cells were transduced at Day 7, while 65% cells were transduced at Day 11 (Fig 3, left panel). Since we did not observe a dramatic drop in cell viability and in percentage of EGFP expressing cells (Fig 3, left panel), it was concluded that the MDDCs are stable over prolonged period of cell culture post transduction. Next, these cells were stained with anti-B2M antibody to assess CRISPRi efficacy at the respective timepoints. It was observed that B2M levels dropped significantly on Day 11 where approximately 40% cells were in B2M low gate compared to Day 7, where only 10% cells have low levels of B2M (note the shift of cells to the left of the gate in Fig 3, right panel). Overall, these results indicated the stability of the introduced CRISPRi machinery and an improvement in knockdown efficiency over longer period of cell culture.

[0328] Example 4: Puromycin does not effectively enrich for transduced MDDCs

[0329] For successful CRISPR screens, one seeks to enrich the population of cells that harbor CRISPR machinery. Typically, this can be done using antibiotic selection. Liu et al., 2020 implemented puromycin selection in MDDCs to enrich for transduced cells. Since, the sgRNA lentivirus used herein also encodes a puromycin resistance cassette, a selection procedure on transduced MDDCs was implemented. Primary CD14-positive monocytes were transduced with a lentivirus encoding the gRNA against a non-targeting control (NTC) tagged with EGFP, with the addition of Vpx-containing VLPs and were differentiated to MDDCs as described before. After 4 days, the cells were challenged with 0, 1 , 2, or 3 pg / ml Puromycin. After 48 hours of selection, puromycin was removed by exchange with fresh medium and the cells were cultured further for 24 hours in the absence of puromycin. Transduction and selection efficacy was assessed using EGFP. Ideally, EGFP expressing cells should be resistant while the untransduced (UT) cells should be sensitive to puromycin selection. It was, however, observed that both untransduced and transduced cells were sensitive to puromycin treatments as indicated by the reduction in cellular events both inside and outside the GFP gate (note the reduction in events of cells- both inside and outside the gate in the lower panel of Fig. 4). This indicates that puromycin selection is not an effective method for enrichment of transduced MDDCs suitable for CRISPR screening. This warrants alternative ways for enrichment of transduced cells or optimizing transduction conditions to achieve a high number of transduced cells prior to the screen. AE007P

[0330] -41-

[0331] Example 5: Transduction efficiency increases upon sequential transductions

[0332] The two key modules of the CRISPRi machinery as used in this example are KRAB-dCas9 and sgRNA-EGFP. In the previous examples, these components have been introduced simultaneously, in the presence of VLP-Vpx. In this example, it was tested whether introducing them in a sequential manner would enhance transduction efficiency. To address this, monocytes were thawed and on the same day (day 0), were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors, KRAB-dCas9 and sgRNA-B2M (Fig 5A: co-transduction). On the other hand, monocytes were thawed and transduced only with VLP-Vpx and KRAB-dCAs9 on day 0, and with VLP-Vpx and sgRNA-B2M on day 2 (Fig 5A: sequential transduction, with a 1-day recovery time). For both conditions, the cells were differentiated to MDDCs in the presence of 100 ng / ml GM-CSF and 20 ng / ml IL-4. On day 9, transduction efficiency was assessed using EGFP. It was observed that co-transduction of two-part lentiviruses led to 64% transduction, while sequential transduction led to a surprisingly increased transduction efficiency of 88% (Fig 5A). This significant increase in transduction efficiency upon sequential transduction ensures that almost every cell receives a gRNA and enhances the number of cells that can be effectively utilized in the screen by 1.4-fold. It was confirmed that both simultaneous and sequential transduction methods lead to a knockdown of B2M to similar extent, confirming that introducing the gRNA at a later timepoint after KRAB-dCas9 does not compromise the CRISPRi efficiency (Fig 5B).

[0333] Example 6: Cas9 nuclease-mediated CRISPR knockout of surface markers in monocyte-derived dendritic cells

[0334] Unlike CRISPRi, which leads to sequence specific repression of gene expression, CRISPR KO using Cas9 nuclease induces double-strand breaks at guide RNA-specific loci in the genome. The cell then repairs this DSB via non-homologous end joining (NHEJ), or homology-directed repair (HDR) and in this process creates insertions or deletions that disrupt the coding sequence of the gene. Importantly cell cycle phase plays a key role in activation of these repair pathways. Given that monocytes and monocyte-derived cell types are non-proliferative in nature and are inherently difficult to culture than their robust immortalized cell line counterparts, it was envisaged that these cells would not tolerate DSBs and would thereby be refractory to a Cas9 nuclease- mediated gene knockout. Previous studies have also only alluded to the possibility of CRISPRi in MDDCs (Liu et al., 2020) without mentioning CRISPR nuclease. It was AE007P

[0335] -42- therefore tested whether MDDCs are amenable to Cas9 nuclease-mediated knockouts of two cell surface receptors (B2M and CD81). To this end, primary monocytes were simultaneously transduced with VLP-Vpx and two-part lentiviral vectors, first encoding Cas9 nuclease (SEQ ID NO:26) and the second encoding suitable gRNAs targeting B2M (GGCCACGGAGCGAGACATCT, SEQ ID NO:27) or CD81 (GGAGGCCTGGCAGGATGCG, SEQ ID NO:28). As stated before, cells were then differentiated to MDDCs by addition of human GM-CSF and IL-4. CRISPR efficiency was assessed on Day 14. Surprisingly, flow-cytometry based the scatter plots for cells indicated that cell viability was comparable between untransduced condition and in conditions where cells were transduced with cas9 nuclease and sgRNA (Fig 6A). Flow cytometry-based measurements of the surface levels of the respective targets revealed a robust reduction of 52% in B2M levels and 57% in CD81 levels MDDCs transduced with respective sgRNAs (Fig 6B).

[0336] Example 7: Pooled CRISPRi screen to identify factors influencing activation of monocyte-derived dendritic cells (MDDCs)

[0337] Having established the feasibility of the VLP-Vpx mediated lentiviral transduction of CRISPR machinery to perturb a single target gene, it was tested whether this approach can be upscaled and applied to perform a pooled perturbation screen targeting multiple genes at the same time. To this end 78 genes including potential factors influencing activation of MDDCs and some essential and non-essential control genes were targeted. A lentiviral library was prepared encoding 324 gRNAs targeting the transcriptional start sites of these 78 genes (4 gRNAs per target gene). The sgRNAs were cloned into sgRNA cassette mentioned in Examples 1 and 2. sgRNA representation was validated via next generation sequencing, ensuring that the library displayed a uniform representation of all sgRNAs (data not shown). Primary CD14- positive monocytes (obtained from BiolVT (USA)) were thawed and transduced KRAB- dCas9 assisted by VLP-Vpx on day 0, and the lentiviral-sgRNA library assisted by VLP- Vpx on day 2. Cells were differentiated to MDDCs by addition of 100 ng / ml human GM- CSF and 20 ng / ml human IL-4. On day 14, the differentiated MDDCs were either treated with 10 ng / ml IFNy for 4 h or left untreated. Cells were then washed in PBS and resuspended in BD Pharmingen™ Stain Buffer. To achieve stimulation-specific labeling of cells, cells from each treatment condition were 'hash-tagged' using the BD™ Hu Single Cell Sample Multiplexing Kit (BD Biosciences). Cells were then pooled, and single cells were captured using a BD Rhapsody™ HT Xpress System (BD Biosciences). The AE007P

[0338] -43- captured single cells were lysed, bound RNA was reverse transcribed and gene expression and sample tag libraries targeting were prepared following manufacturer’s instructions. The libraries were subjected to Illumina sequencing using the NovaseqX flowcell (4 billion reads). This generated 53,200 high-quality single-cell profiles after successful assignment to sgRNAs, KRAB-Cas9, and the hash tag assignment, with a median of 1500 cells per genetic perturbation. Uniform manifold approximation and projection (UMAP) dimensionality reduction of cellular mRNA profiles showed a distinct separation between unstimulated and IFNy-stimulated cells (Fig. 8A). A significant knockdown was achieved for 64 out of 78 genes. Out of the remaining 14 genes, three genes were not expressed in human MDDCs, thus making it difficult to diagnose their downregulation. Two of the 14 were control genes essential for MDDC survival, hence sgRNAs targeting them could not be detected during the 14-day screen. The heatmap depicts the effects of CRISPR-Cas9-mediated knockdown across 78 individual genes (Fig. 9). The x-axis indicates the CRISPR perturbation, whereas the y-axis indicates the mRNA levels of the indicated genes. The clear diagonal line (at x = y) represented in dark grey tiles denotes that the expression of a gene was reduced upon CRISPRi- mediated knockdown of the corresponding gene, thus highlighting that CRISPR perturbation was successful across the great majority of the 78 genes perturbed. Notably, the strength of knockdowns directly scaled with the expression levels of the target genes in MDDCs (Fig. 9, right panel).

[0339] Gene expression profiles of cells from each target gene knockdown were analysed with reference to cells harbouring a non-targeting control (NTC) gRNA. The Linear Discriminant Analysis (LDA) was done to distinguish between activated and unstimulated dendritic cell populations based on their gene expression profiles. The corresponding Volcano plot (Fig. 10) shows genes whose knockdown is enriched in the resting condition (left side). For instance, knockdowns of key components of the IFNy signalling pathway (e.g. IFNGR1 , IFNGR2) prevented MDDC activation. On the other hand, LDA analysis of cells subjected to knockdown of certain factors (e.g. HLA-B and HLA-C) induce changes that promote dendritic cell activation. Notably, UMAP projections also indicated that cells with IFNGR1 and IFNGR2 completely partition with the unstimulated cell population regardless of IFNy stimulation (Fig. 8B and C). This indicates that the knockdown of these key receptors makes the cells completely refractory to IFNy stimulation. AE007P

[0340] -44-

[0341] Together, 11 hits were identified that either promote or compromise activation of MDDCs. The volcano plot in Fig. 10 illustrates the effect of CRISPR-Cas9-mediated knockdown of genes that significantly influence the IFNy-mediated MDDC activation.

[0342] Example 8: CRISPRi efficiency in monocyte-derived dendritic cells depends upon the kinetics of introduction of CRISPRi components relative to differentiation

[0343] In the previous examples, lentiviral transduction was performed concurrent to differentiation of monocytes into MDDCs. In this example it was tested whether CRISPRi efficiency changes when lentiviral transduction is performed post-differentiation of monocytes into MDDCs. To address this, primary monocytes were either thawed, on the same day introduced with a differentiation cocktail composed of 100 ng / ml GM-CSF and 20 ng / ml IL-4 and transduced with VLP-Vpx and KRAB-dCas9 (day 0), and with VLP- Vpx and sgRNA-B2M on day 2 or monocytes were thawed and differentiated to MDDCs in the presence of 100 ng / ml GM-CSF and 20 ng / ml IL-4 and then transduced with VLP- Vpx and KRAB-dCas9 on day 5, and with VLP-Vpx and sgRNA-B2M on day 7. CRISPRi efficiency was evaluated for each condition on day 14. As shown in the comparative dataset, when the CRISPR machinery is introduced in the early stages (concurrent to differentiation), a 29% reduction in B2M levels is achieved (Fig 11A). On the other hand, when the CRISPR machinery is introduced post differentiation of monocytes to MDDCs, a minor 5% reduction in B2M level is achieved (Fig 11 B). This emphasizes that the specific kinetics for introduction of the two components, Cas9 / KRAB-dCas9 and sgRNA, is key for an efficient CRISPR editing.

[0344] REFERENCES

[0345] Berger et al. (2011), Nat Protoc. 6(6):806-16.

[0346] Berger et al. (2009), Gene Ther. 16(1): 159-63.

[0347] Hiatt et al. (2021), Cell Rep. 35(6): 109105.

[0348] Hrecka et al. (2011), Nature 474:658.

[0349] Liu et al. (2020), bioRxiv version posted December 24, 2020. 2020.12.23.424242.

[0350] Franzolin et al. (2013), PNAS. 110 (35) 14272-14277

[0351] Gutierrez-Chamorro et al. (2023), Front Immunol. 2023; 14: 1112761 Daddacha et al. (2017), Cell Rep. Volume 20, Issue 8p1921 -1935 Zhang et al. (2024) iScience, Volume 27, Issue 2108907 Mahata et al. (2023), Nat Methods 20, 1716-1728.

Claims

AE007P-45-CLAIMS1. A method of producing a pool of human monocyte-derived dendritic cells (MDDCs) that are genetically engineered for a variety of genomic perturbations, by infecting the monocytes with lentiviruses to consecutively deliver an RNA-guided programmable nuclease (RPN) and an gRNA library comprising a repertoire of guide RNAs (gRNAs) that covers a variety of target genomic sequences of the MDDCs, wherein the monocytes are infected with lentiviruses in the presence of at least one MDDC differentiating factor and an inactivator of the cellular SAM domain HD domaincontaining protein 1 (SAMHD1).

2. The method of claim 1 , wherein a) the monocytes are first delivered with said RPN, and following a recovery time, the monocytes are delivered with said gRNA library; or b) the monocytes are first delivered with said gRNA library, and following a recovery time, the monocytes are delivered with said RPN; preferably wherein the recovery time is at least one day.

3. The method of claim 1 or 2, wherein said inactivation of SAMHD1 is by the introduction of any one of: a) a lentiviral accessory protein that induces degradation of SAMHD1 , preferably Vpx of simian immunodeficiency virus (SIV) or of human immunodeficiency virus 2 (HIV- 2), or a lentivirus paralog of Vpx, preferably using a lentivirus vector expressing said lentiviral accessory protein, preferably a virus-like particle bearing a respective coding sequence, preferably a Vpx-expressing SIVsm virus-like particle (Vpx-VLPs); b) an inhibitor which is a siRNA, antisense oligonucleotide or small molecule inhibitor; c) another SAMHD1 inactivating CRISPR tools, comprising at least one SAMHD1 targeting guide RNA (SAMHD1-gRNA) and an RPN that is inactivating SAMHD1.

4. The method of any one of claims 1 to 3, wherein the MDDC pool is obtained in only one containment.AE007P-46-5. The method of any one of claims 1 to 4, wherein a) the variety of target genomic sequences includes any one or more of promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions; b) the variety of target genomic sequences includes any one or more of a noncoding or untranslated region (UTR) of a gene within the MDDC genome, preferably a target site in proximity to a promoter region, or a transcriptional start site (TSS), a 5’UTR, or 3’UTR of a gene.

6. The method of any one of claims 1 to 5, wherein said RPN comprises or consists of a) a CRISPR nuclease, preferably any one of a type II or type V CRISPR nucleases, preferably Cas9 or Cas12a; or b) a CRISPR nuclease containing fusion or complex with an effector, preferably a transcription-modulating domain, or an editor such as a base editor or prime editor, and optionally one or more accessory proteins, or a nucleic acid encoding any of the foregoing.

7. The method of claim 6, wherein the effector is selected from: a) a transcriptional repressor peptide for gene silencing, preferably a Kruppel- associated box (KRAB) domain, such as selected from the group consisting of ZIM3, or the KRAB domain of KOX1 ; or b) a transcriptional effector for gene activation, preferably a single transcriptional activation domain or combinatorial activation system, preferably selected from the group consisting of VP64, VPR (VP64, p65 and Rta), the SAM domain (consisting of p65 and HS1), the SunTag, the p300 / CBP histone acetyl transferase, SPH, or a transactivation module such as MSN, NMS or eN3x9; preferably wherein the RPN fused to the endonuclease effector is any one of a dCas9-KRAB (repressor), dCas9-VP64 (activator), dCas9-VPR, VP64-dCas9-VP64, dCas9-p300, or dCas9-Tet1c, dCas9-EZH2.AE007P-47-8. The method of any one of claims 1 to 7, wherein the human monocytes are CD14+ monocytes of human peripheral blood, which are incubated with said at least one MDDC differentiating factor with an incubation time of at least 3 days.

9. The method of any one of claims 1 to 8, wherein said at least one MDDC differentiating factor is a cytokine or a combination of cytokines, preferably GM-CSF and IL-4.

10. The method of any one of claims 1 to 9, wherein the MDDCs are further treated for tolerogenic or activating stimulation.11 . The method of any one of claims 1 to 10, wherein said MDDC pool is analyzed for an effect of one or more of said genomic perturbations, by screening the MDDCs for at least one phenotypic characteristic, preferably wherein said at least one phenotypic characteristic is determined upon singularization of said MDDCs, or in a pool of the MDDCs.

12. The method of claim 11 , wherein at least one phenotypic characteristic is determined by measuring cellular fitness, or expression of one or more markers, preferably wherein marker expression is determined at the RNA or protein level, preferably by flow-cytometry, immunohistochemistry, RNA-Seq, qRT-PCR, proteomics, ELISA, or microscopic imaging.

13. Use of the method of any one of claims 1 to 11 , in a method of studying single gene or epistatic effects in MDDCs.

14. Use of the method of any one of claims 1 to 11 , in a method of identifying or validating a therapeutic target, preferably wherein the target is identified or validated, if its perturbation induces a desired effect of said MDDCs, preferably wherein the target is identified or validated for the development a drug, a cellular vaccine, a cell therapy, or gene therapy.AE007P-48-15. The use of the method of any one of claims 1 to 11 , in a method for engineering MDDCs for developing dendritic cell vaccines, preferably wherein the MDDCs originate from a patient for which the target is identified or validated.

Images