Single-laser sequencing method and use of ultra-large stokes shift dye in sequencing

By employing single-laser sequencing and ultra-large Stokes shift dyes, the problems of high sample exposure times and low throughput in multi-laser multi-channel sequencers were solved, achieving efficient and low-cost DNA sequencing while improving resolution and robustness.

WO2026065231A1PCT designated stage Publication Date: 2026-04-02MGI TECH CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-09-29
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Existing multi-laser multi-channel sequencers have drawbacks such as multiple exposure times for samples, multiple light sources, and low throughput, making it difficult to improve resolution and reduce costs.

Method used

A single-laser sequencing method was adopted, using ultra-large Stokes shift dyes. By labeling three bases with three types of dyes and leaving the fourth base unlabeled, the molecular structure of a new dye was designed to realize the single-laser sequencing principle. Fluorescence resonance energy transfer (FRET) was used to achieve efficient fluorescence signal detection.

Benefits of technology

It improves the performance robustness of sequencing systems, reduces light-induced DNA damage, lowers costs, and increases sequencing throughput and resolution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024122288-FTAPPB-I100001
    Figure PCTCN2024122288-FTAPPB-I100001
  • Figure PCTCN2024122288-FTAPPB-I100002
    Figure PCTCN2024122288-FTAPPB-I100002
  • Figure PCTCN2024122288-FTAPPB-I100003
    Figure PCTCN2024122288-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a method for sequencing a target nucleic acid molecule, comprising: incorporating, into a strand complementary to the target nucleic acid molecule, a first type of nucleotide capable of generating a first fluorescence signal, a second type of nucleotide capable of generating a second fluorescence signal, a third type of nucleotide capable of generating a third fluorescence signal, and a fourth type of nucleotide that does not generate a fluorescence signal, to generate an extended strand; and, by means of the different types of fluorescence signals, determining the type of base to be incorporated.
Need to check novelty before this filing date? Find Prior Art

Description

Single laser sequencing method and application of super large stokes shift dye in sequencing TECHNICAL FIELD

[0001] The present disclosure relates to the field of gene sequencing, in particular to a single laser sequencing method and application of super large stokes shift dye in sequencing. BACKGROUND

[0002] DNA nanoballs are the core highlight of Huada sequencing, and in some types of next-generation sequencing technology, adding target polynucleotides can undoubtedly increase sequencing throughput to obtain higher data volume and reduce overall sequencing cost. The mainstream sequencers on the market are biochemical technology sequencers that use 4-color fluorescent dye to label nucleic acids, and the emission wavelength of the dye undoubtedly determines the chip loading capacity of the DNB nanoball.

[0003] According to the Rayleigh criterion, the resolution of an optical system is x = 0.61λ / NA. For example, the wavelength of red light is about 720 nm, and the lens NA is 0.8. It can be known that the theoretical resolution is about 550 nm. Since the NA of the lens is difficult to improve due to production process, reducing the use of longer red light region dyes and reducing the number of fluorescent nucleotide labels can reduce the possibility of fluorescent crosstalk, which is beneficial to improve the resolution.

[0004] Existing DNA sequencing systems and methods, for example, existing sequencing platforms that use two- or four-channel sequencing chemistry, can utilize two or more excitation light sources to excite deoxyribonucleic acid analogs conjugated to fluorescent tags in target polynucleotides. Reducing the number of excitation light sources can reduce costs and increase the performance robustness of such sequencing systems. In addition, reducing the number of excitation light sources can reduce unnecessary light exposure of the sample, thereby reducing light-induced DNA damage.

[0005] SUMMARY

[0006] In order to overcome the defects of the current market multi-laser multi-channel sequencer, such as multiple sample exposure times, multiple light sources, and small throughput, the present disclosure provides a single laser sequencing method and its principle, as well as the synthesis of super large stokes shift dye (such as at least 120 nm) and its application in sequencing. In the single laser sequencing method provided by the present disclosure, three types of dyes are labeled on three bases, and the fourth base is not labeled with dye. The basic principle is shown in Figure 1. In addition, the present inventors have also achieved a super large stokes shift by designing the molecular structure of the new dye, which can realize the aforementioned single laser sequencing principle.

[0007] Specifically, in the first aspect of the present disclosure, the present disclosure provides a compound represented by Formula I or a stereoisomer thereof or a salt thereof,

[0008] wherein:

[0009] The compound of Formula I or a stereoisomer thereof or a salt thereof is capable of a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g. not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm;

[0010] R 1 is a first fluorescent group, R 1 is selected from AF532, Cy3, ATTO532, ROX, or an analogue of each, preferably from AF532, Cy3, or an analogue of each, more preferably is Cy3 or an analogue thereof, most preferably is Cy3;

[0011] R 2 is a second fluorescent group, R 2 is selected from Cy5, AF647, or an analogue of each, preferably is Cy5 or an analogue thereof, more preferably is Cy5;

[0012] L 1 is a linking group for linking the first fluorescent group, the second fluorescent group, and Base;

[0013] R' is a reversible blocking group;

[0014] R 0 is selected from hydrogen, hydroxyl, preferably is hydrogen;

[0015] n is selected from 0, 1, 2, 3, 4, preferably is 3;

[0016] Base is selected from a base, a deazabase, or a tautomer thereof, for example Base is selected from adenine, 7-deazadenine, thymine, uracil, cytosine, guanine, 7-deazaguanine, or a tautomer thereof.

[0017] In some embodiments, the linking group is a cleavable linking group.

[0018] In some embodiments, the cleavable linking group is selected from an electrophilic cleavable linking group, a nucleophilic cleavable linking group, a photolyzable linking group, a linking group cleavable under reducing conditions, a linking group cleavable under oxidizing conditions, a safety- handle type linking group, a linking group cleavable via an elimination mechanism, or any combination thereof.

[0019] In some embodiments, Base is selected from

[0020] In some embodiments, Base is selected from

[0021] In some embodiments, the N-terminus below Base is connected to the parent ring, and the C-terminus or O-terminus or the N-terminus above is connected to L 1 .

[0022] In some embodiments, the compound of formula I has the structural formula of formula I-1,

[0023] wherein:

[0024] R 1 is a first fluorescent group, R 1 is selected from AF532, Cy3, ATTO532, ROX or an analogue of each, preferably from AF532, Cy3 or an analogue of each, more preferably is Cy3 or an analogue thereof, most preferably is Cy3;

[0025] R 2 is a second fluorescent group, R 2 is selected from Cy5, AF647 or an analogue of each, preferably is Cy5 or an analogue thereof, more preferably is Cy5;

[0026] L 1a is -L 1a1 -L 1a2 -L 1a3 -;

[0027] L 1a1 is

[0028] L 1a2 is

[0029] L 1a3 is

[0030] n1, n2 are each independently selected from 1, 2, 3, 4, 5;

[0031] R 3 is selected from N3-, C1-C6alkyl-SS-, NH2O-, R x C(O)O-, R x NHC(O)O-, C1-C6alkyl, phenyl, phenylC1-C6alkylene, C3-C6cycloalkyl, wherein each R x is independently selected from C1-C6alkyl, C3-C6cycloalkyl, phenylC1-C6alkylene;

[0032] R 4 , R 5 , R 6 , R 7each independently selected from H, C1-C6alkyl;

[0033] L 1b is

[0034] each n3is independently selected from 1, 2, 3, 4, 5;

[0035] R 8 , R 9 , R 10 , R 11 each independently selected from H, C1-C6alkyl;

[0036] R' is a reversible blocking group, R' is selected from H, N3-C1-C6alkylene, C1-C6alkyl-SS-C1-C6alkylene, NH2O-, R z C(O)O-, R z NHC(O)O-, wherein each R z is independently selected from C1-C6alkyl, C3-C6cycloalkyl, phenyl C1-C6alkylene;

[0037] R 0 is selected from hydrogen, hydroxyl, preferably hydrogen;

[0038] n is selected from 0, 1, 2, 3, 4, preferably 3;

[0039] Base is selected from a base, a deazabase or a tautomer thereof, for example Base is selected from adenine, 7-deazadenine, thymine, uracil, cytosine, guanine, 7-deazaguanine or a tautomer thereof.

[0040] It needs to be particularly pointed out that in the compound of the present disclosure, the difference in configuration has no influence on the implementation of the technical solution and the realization of the technical effect.

[0041] In some embodiments, L 1a1 is

[0042] In some embodiments, L 1a1 is connected at its C-terminus to Base and at its N-terminus to L 1a2 .

[0043] In some embodiments, L 1a2 is

[0044] In some embodiments, L 1a2 is connected at its left carbonyl group to L 1a1 and at its right carbonyl group to L 1a3 .

[0045] In some embodiments, L 1a3 is

[0046] In some embodiments, L 1a3 is 1a2 is 1b .

[0047] In some embodiments, each of n1, n2 is independently selected from 1, 2, 3.

[0048] In some embodiments, n1 is 1, and n2 is 2.

[0049] In some embodiments, R 3 is -N3.

[0050] In some embodiments, R 4 , R 5 , R 6 , R 7 is H.

[0051] In some embodiments, L 1a is

[0052] In some embodiments, L 1a is 1b .

[0053] In some embodiments, each n3 is independently selected from 1, 2, 3.

[0054] In some embodiments, n3 is 1.

[0055] In some embodiments, R 8 , R 9 , R 10 , R 11 is H.

[0056] In some embodiments, L 1b is

[0057] In some embodiments, L 1b is 1 is 2 is 1a .

[0058] In some embodiments, R' is N3-C1-C6 alkylene.

[0059] In some embodiments, R' is N3-CH2-.

[0060] In some embodiments, Base is selected from

[0061] In some embodiments, Base is selected from

[0062] In some embodiments, the N-terminal below Base is connected to the parent ring, and the C-terminal or O-terminal or the N-terminal above Base is connected to L 1a .

[0063] In some embodiments, the compound is selected from:

[0064] In a second aspect of the present disclosure, the present disclosure provides a method of sequencing a target nucleic acid molecule, comprising:

[0065] - incorporating four different types of nucleotides into a strand complementary to the target nucleic acid molecule to generate an extended strand, wherein:

[0066] the first type of nucleotide can generate a first fluorescent signal,

[0067] the second type of nucleotide can generate a second fluorescent signal,

[0068] the third type of nucleotide can generate a third fluorescent signal,

[0069] the fourth type of nucleotide does not generate a fluorescent signal;

[0070] - determining the type of base incorporated by the different types of fluorescent signals.

[0071] In some embodiments,

[0072] the first type of nucleotide comprises a first fluorescent group and a second fluorescent group,

[0073] the second type of nucleotide comprises a third fluorescent group,

[0074] the third type of nucleotide comprises a fourth fluorescent group,

[0075] the fourth type of nucleotide does not comprise a fluorescent group;

[0076] the first type of nucleotide, the second type of nucleotide, the third type of nucleotide have respectively a first emission wavelength, a second emission wavelength, a third emission wavelength that are different and detectable;

[0077] wherein the first type of nucleotide is capable of undergoing a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g. not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm.

[0078] In some embodiments, the first fluorescent group and the second fluorescent group of the first type of nucleotide form a fluorescence resonance energy transfer (FRET) pair.

[0079] In some embodiments, the method comprises the following steps:

[0080] (i) incorporating the above four different types of nucleotides into a strand complementary to the target nucleic acid molecule to generate an extended strand;

[0081] (ii) providing a single excitation wavelength, and detecting a first fluorescent signal corresponding to the first type of nucleotide at a first emission wavelength, a second fluorescent signal corresponding to the second type of nucleotide at a second emission wavelength, and a third fluorescent signal corresponding to the third type of nucleotide at a third emission wavelength;

[0082] (iii) determining the identity of the incorporated nucleotides according to the detection results of step (ii);

[0083] Preferably, between steps (i) and (ii) comprises removing the non-incorporated nucleotides;

[0084] Preferably, after step (iii) further comprises removing the fluorescent groups from the incorporated nucleotides;

[0085] Optionally, the method comprises repeating the above steps in sequence to determine the sequence of the target nucleic acid molecule.

[0086] In some embodiments, the single excitation wavelength is green light (e.g. 500-560 nm, specifically 532 nm).

[0087] In some embodiments, the first emission wavelength is at least 10 nm (e.g., at least 15 nm, at least 20 nm, at least 25 nm, at least 30 nm, at least 35 nm, at least 40 nm, at least 45 nm, at least 50 nm, at least 55 nm, at least 60 nm, at least 65 nm, at least 70 nm, at least 75 nm, at least 80 nm, at least 85 nm, at least 90 nm, at least 95 nm, or at least 100 nm) longer than the second emission wavelength; the second emission wavelength is at least 10 nm (e.g., at least 15 nm, at least 20 nm, at least 25 nm, at least 30 nm, at least 35 nm, at least 40 nm, at least 45 nm, at least 50 nm, at least 55 nm, at least 60 nm, at least 65 nm, at least 70 nm, at least 75 nm, at least 80 nm, at least 85 nm, at least 90 nm, at least 95 nm, or at least 100 nm) longer than the third emission wavelength.

[0088] In some embodiments, the first fluorescent group and the second fluorescent group of the first type of nucleotide are connected to the base of the first type of nucleotide by a linker.

[0089] In some embodiments, the first fluorescent group is selected from AF532, Cy3, ATTO532, ROX, or an analog of each, preferably from AF532, Cy3, or an analog of each, more preferably Cy3 or an analog thereof, most preferably Cy3.

[0090] In some embodiments, the second fluorescent group is selected from Cy5, AF647, or an analog of each, preferably Cy5 or an analog thereof, more preferably Cy5.

[0091] In some embodiments, the third fluorescent group is ROX or an analog thereof, more preferably ROX.

[0092] In some embodiments, the fourth fluorescent group is AF532 or an analog thereof, more preferably AF532.

[0093] In some embodiments, the first type of nucleotide, the second type of nucleotide, the third type of nucleotide, and the fourth type of nucleotide further comprise a reversible blocking group to ensure that only one nucleotide is extended per incorporation.

[0094] In some embodiments, the method further comprises removing the reversible blocking group from the incorporated nucleotide prior to the next incorporation cycle.

[0095] In some embodiments, the first fluorescent group and the second fluorescent group of the first type of nucleotide are connected to the base of the first type of nucleotide by a linker.

[0096] In some embodiments, the linking group is a cleavable linking group.

[0097] In some embodiments, the cleavable linking group is selected from an electrophilic cleavable linking group, a nucleophilic cleavable linking group, a photolyzable linking group, a linking group cleavable under reducing conditions, a linking group cleavable under oxidizing conditions, a safety- handle type linking group, a linking group cleavable via an elimination mechanism, or any combination thereof.

[0098] In some embodiments, the linking group comprises L 1b , L 1b as described in any one of the technical solutions in the first aspect.

[0099] In some embodiments, the linking group further comprises L 1a , L 1a as described in any one of the technical solutions in the first aspect.

[0100] In some embodiments, L 1a is connected to L 1b .

[0101] In some embodiments, the first type of nucleotide is a compound of Formula I or a stereoisomer thereof or a salt thereof,

[0102] wherein R 0 , R 1 , R 2 , R’, L 1 , Base, and n are each independently described in any one of the technical solutions in the first aspect.

[0103] In some embodiments, the first type of nucleotide is a compound of Formula I-1 or a stereoisomer thereof or a salt thereof,

[0104] wherein R 0 , R 1 , R 2 , R’, L 1a , L 1b , Base, and n are each independently described in any one of the technical solutions in the first aspect.

[0105] In some embodiments, the first type of nucleotide is a compound selected from any one of the following or a stereoisomer thereof or a salt thereof,

[0106] In some embodiments, the second type of nucleotide comprises a third fluorescent group attached to the base of the second type of nucleotide via a linker, and the third type of nucleotide comprises a fourth fluorescent group attached to the base of the third type of nucleotide via a linker.

[0107] In some embodiments, the linker is a cleavable linker.

[0108] In some embodiments, the cleavable linker is selected from a disulfide linker, an acid-labile linker (such as a dialkoxybenzyl linker, a Sieber linker, an indole linker, a t-butyl Sieber linker), a nucleophilic cleavable linker, a photolyzable linker, or a combination thereof.

[0109] In some embodiments, the linker is L 1a , L 1a as described in any of the technical solutions of the first aspect.

[0110] In some embodiments, the first type of nucleotide, the second type of nucleotide, the third type of nucleotide, and the fourth type of nucleotide are selected from A, T, C, G types of nucleotides.

[0111] In some embodiments, the second type of nucleotide, the third type of nucleotide, and the fourth type of nucleotide are selected from A, T, G types of nucleotides.

[0112] In some embodiments, the second type of nucleotide is a T type of nucleotide.

[0113] In some embodiments, the third type of nucleotide is an A type of nucleotide.

[0114] In some embodiments, the fourth type of nucleotide is a G type of nucleotide.

[0115] In some embodiments, the first type of nucleotide, the second type of nucleotide, the third type of nucleotide, and the fourth type of nucleotide are selected from dATP, dTTP, dCTP, dGTP, and non-natural nucleotide analogs thereof.

[0116] In some embodiments, the second type of nucleotide, the third type of nucleotide, and the fourth type of nucleotide are selected from dATP, dTTP, dGTP, and non-natural nucleotide analogs thereof.

[0117] In some embodiments, the second type of nucleotide is selected from dTTP and non-natural nucleotide analogs thereof.

[0118] In some embodiments, the third type of nucleotide is selected from dATP and a non-natural nucleotide analog thereof.

[0119] In some embodiments, the fourth type of nucleotide is selected from dGTP and a non-natural nucleotide analog thereof.

[0120] In some embodiments, the first type of nucleotide is:

[0121] the second type of nucleotide is:

[0122] the third type of nucleotide is:

[0123] the fourth type of nucleotide is

[0124] In some embodiments, the incorporation of the nucleotides is carried out by a polymerase.

[0125] In a third aspect of the present disclosure, the present disclosure provides a kit comprising four different types of nucleotides, wherein:

[0126] the first type of nucleotide comprises a first fluorescent group and a second fluorescent group,

[0127] the second type of nucleotide comprises a third fluorescent group,

[0128] the third type of nucleotide comprises a fourth fluorescent group,

[0129] the fourth type of nucleotide does not comprise a fluorescent group;

[0130] the first type of nucleotide, the second type of nucleotide, the third type of nucleotide, respectively, have a first emission wavelength, a second emission wavelength, a third emission wavelength, which are different and detectable;

[0131] wherein the first type of nucleotide is capable of a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g., not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm.

[0132] In some embodiments, the first fluorescent group and the second fluorescent group of the first type of nucleotide form a fluorescence resonance energy transfer (FRET) pair.

[0133] In some embodiments, the four different types of nucleotides are as described in any of the technical solutions of the second aspect.

[0134] In some embodiments, the kit is used for nucleic acid sequencing.

[0135] In some embodiments, the kit further comprises one or more additional reagents required for nucleic acid sequencing, such as primers, polymerase, buffer solution, wash solution, or any combination thereof.

[0136] In a fourth aspect of the present disclosure, the present disclosure provides use of a compound represented by Formula II or a stereoisomer thereof or a salt thereof as a fluorescent label;

[0137] wherein:

[0138] The compound represented by Formula II or a stereoisomer thereof or a salt thereof is capable of undergoing a Stokes shift, preferably, the Stokes shift is not less than 100 nm (e.g., not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm;

[0139] R 1 is a first fluorescent group, R 1 is selected from AF532, Cy3, ATTO532, ROX, or an analogue of each, preferably selected from AF532, Cy3, or an analogue of each, more preferably is Cy3 or an analogue thereof, most preferably is Cy3;

[0140] R 2 is a second fluorescent group, R 2 is selected from Cy5, AF647, or an analogue of each, preferably is Cy5 or an analogue thereof, more preferably is Cy5;

[0141] L 1’ is a linking group for linking the first fluorescent group and the second fluorescent group.

[0142] In some embodiments, the linking group is a cleavable linking group.

[0143] In some embodiments, the cleavable linking group is selected from an electrophilic cleavable linking group, a nucleophilic cleavable linking group, a photolyzable linking group, a linking group cleavable under reducing conditions, a linking group cleavable under oxidizing conditions, a safety- handle type linking group, a linking group cleavable via an elimination mechanism, or any combination thereof.

[0144] In some embodiments, the compound of Formula II has a structural formula of Formula II-1,

[0145] wherein:

[0146] L 1b’ is

[0147] R 1 , R 2 , n3, R 8 , R 9 , R 10 , R 11 each independently as described in any of the technical solutions of the first aspect.

[0148] In some embodiments, L 1b’ is

[0149] In some embodiments, L 1b’ is connected to R 1 on the left amino terminus and R 2 on the right amino terminus.

[0150] In some embodiments, the compound is:

[0151] In some embodiments, the fluorescent label is used to detect the presence, location, and / or amount of a target molecule.

[0152] In some embodiments, the fluorescent label is attached to a detection reagent that specifically binds to the target molecule, such as a nucleic acid probe, an antibody, an antigen, or an enzyme.

[0153] In some embodiments, the fluorescent label is used for sequencing, expression analysis, hybridization analysis, protein binding assay, in vitro diagnosis, immunoassay, molecular marker technology.

[0154] In some embodiments, the fluorescent label is used for cell imaging, tissue imaging, or bio-imaging.

[0155] In a fifth aspect of the present disclosure, the present disclosure provides a method comprising using a compound of Formula II or a stereoisomer thereof or a salt thereof as a fluorescent label; the compound of Formula II or a stereoisomer thereof or a salt thereof is as described in any of the technical solutions of the fourth aspect.

[0156] In some embodiments, the method is used to detect the presence, location, and / or amount of a target molecule.

[0157] In some embodiments, the method comprises using a detection reagent (e.g., a nucleic acid probe, an antibody, an antigen, or an enzyme) that specifically binds to the target molecule, the detection reagent being linked to the fluorescent label.

[0158] In some embodiments, the method is selected from sequencing, expression analysis, hybridization analysis, protein binding assay, in vitro diagnosis, immunoassay, or molecular marker technique.

[0159] In some embodiments, the method is selected from cell imaging, tissue imaging, or bioimaging.

[0160] Definitions of Terms

[0161] All terms used in the present disclosure, including technical or scientific terms, have the same meanings as those understood by a person having ordinary knowledge in the art to which the present disclosure belongs, unless otherwise specifically defined. It should also be understood that terms such as those defined in commonly used dictionaries should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and not in an idealized or overly formal sense, unless otherwise specifically defined herein.

[0162] The terms "first", "second", and similar terms in the present disclosure do not denote any order, quantity, or importance, but are used to distinguish different parts.

[0163] Unless otherwise specifically stated, groups and substituents in the present disclosure have their ordinary meaning, as understood by a person of ordinary knowledge in the chemical arts.

[0164] Throughout various portions of the specification, substituents of compounds of the present disclosure are disclosed by reference to groups of substituents or substituent ranges. It is specifically intended that the present disclosure include each and every independent combination of the members of the groups or ranges of substituents. For example, the term "C1-C6alkyl" specifically includes methyl, ethyl, C3alkyl, C4alkyl, C5alkyl, and C6alkyl, each disclosed independently.

[0165] In addition, it should be noted that the descriptive modes "each independently is / are / are selected from" and "…each independently is / are / are selected from" used throughout the present disclosure can be interchangeable unless otherwise explicitly indicated, and should be interpreted in a broad sense, which means that the specific options expressed between the same or different symbols in different groups can not affect each other, or the specific options expressed between the same or different symbols in the same group can not affect each other.

[0166] The term "C1-C6alkyl" refers to any straight-chain or branched saturated hydrocarbon radical of from 1 to 6 carbon atoms, such as methyl (Me), ethyl (Et), n-propyl, i-propyl (iPr), n-butyl, i-butyl, t-butyl (t-Bu), sec-butyl, n-pentyl, t-pentyl, n-hexyl, and the like.

[0167] The term "C1-C6alkylene" refers to a divalent radical resulting from the loss of a hydrogen atom from any of the aforementioned C1-C6alkyl groups, such as methylene-CH2- and the like.

[0168] The term "C3-C6cycloalkyl" refers to a hydrocarbon having a saturated ring of a 3-6 membered monocyclic ring system, which can be cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like.

[0169] The term "stereoisomer" refers to isomers that have the same order of connectivity of atoms but differ in the orientation of atoms in space. The stereoisomers of the compounds described in the present disclosure, when specifically designated as (R)- or (S)-isomers, are to be understood as meaning predominantly the (R)-isomer or the (S)-isomer, respectively. Any asymmetric carbon atom can be present in the (R)-, (S)- or (R,S)-configuration, preferably in the (R)- or (S)-configuration.

[0170] The abbreviations of each fluorescent dye / fluorescent group used in the present disclosure and their corresponding structural formulae are shown in Table A below.

[0171] Table A: Abbreviations of each fluorescent dye and their corresponding structural formulae

[0172] The dyes in the present disclosure also include structural analogues of the dyes in the above table as the parent nucleus.

[0173] In addition, in the first type of nucleotide of the present disclosure or in the compound of the present disclosure or its stereoisomer or its salt, the connection site of the above fluorescent dye to the rest of the structure of the first type of nucleotide of the present disclosure or the compound of the present disclosure or its stereoisomer or its salt is shown as a wavy line in Table B below.

[0174] Table B: Connection site of each fluorescent dye to the rest of the structure of the first type of nucleotide or the compound or its stereoisomer or its salt BRIEF DESCRIPTION OF DRAWINGS

[0175] Figure 1: Schematic diagram of the principle of single laser sequencing.

[0176] Figure 2: H NMR spectrum of hot dCTP-V1-Cy3-L1-Cy5. 1

[0177] Figure 3: P NMR spectrum of hot dCTP-V1-Cy3-L1-Cy5. 31 ​​

[0178] Figure 4: Emission spectra of hot dATP-V1-AF532, hot dCTP-V1-Cy3-L1-Cy5 and hot dTTP-V1-ROX.

[0179] Figure 5: Normalized fluorescence emission spectra of hot dATP-V1-AF532, hot dCTP-V1-Cy3-L1-Cy5 and hot dTTP-V1-ROX.

[0180] Figure 6: Channel signal intensities of each dye under 532 nm green light excitation. DETAILED DESCRIPTION

[0181] Various exemplary embodiments of the present disclosure will now be described in detail with reference to the accompanying drawings. The description of the exemplary embodiments is merely illustrative in nature and is in no way intended to limit the disclosure, its application or uses. The disclosure can be implemented in numerous different forms, as will be apparent to one of ordinary skill in the art. The embodiments provided are in the nature of a best mode of the disclosure and are provided to give a full and enabling disclosure as required by the law, and are not intended to limit the scope of the disclosure unless otherwise specifically stated. It should be noted that the relative

[0182] Example 1: Synthesis of compounds

[0183] 1. Reagents and instruments

[0184] 1.1 Instruments:

[0185] DIONEX UltiMate 3000 liquid chromatograph-mass spectrometer (degasser: SRD-3400, binary pump: HPG-3400RS, autosampler: WPS-3000TRS, column oven: TCC-3000SD, detector: DAD-3000, mass spectrometer: ISQ EM-Mass spectrometer, Thermo Fisher Scientific), DIONEX UltiMate 3000 high-pressure liquid chromatograph (binary pump: HPG-3400RS, autosampler: WPS-3000TRS, column oven: TCC-3000SD, detector: DAD-3000, Thermo Fisher Scientific), DIONEX UltiMate 3000 preparative liquid chromatograph (binary pump: HPG-3200BX, autosampler: WPS-3000TSL, detector: DAD-3000, fraction collector: Fraction Collector F, Thermo Fisher Scientific), KQ-300E ultrasonic cleaner (Kunshan Ultrasonic Instruments Co., Ltd.), UV-2700i ultraviolet-visible spectrophotometer (Shimadzu Instruments (Suzhou) Co., Ltd.), RF-6000 fluorescence spectrophotometer (Shimadzu Instruments (Suzhou) Co., Ltd.), electronic balance (model: BCA324I-10CN, Sartorius Scientific Instruments (Beijing) Co., Ltd.), biotage automatic column chromatography machine (Biotage Trading (Shanghai) Co., Ltd.), vacuum freeze dryer (Bio-Medical Kang (Beijing) Instrument Co., Ltd.), pipette (eppendorf, 20 μL; 200 μL; 1000 μL; 5000 μL).

[0186] 1.2 Reagents:

[0187] Acetonitrile (lot: WXBD3817V, 99.9%, Sigma-Aldrich Reagent), ultrapure water, N’N-diisopropyl ethylamine (DIPEA) (lot: C12677270, 99%, Shanghai Macklin Biochemical Technology Co., Ltd.), anhydrous N’N-dimethylformamide (DMF) (lot: C13697247, 99.8%, Shanghai Macklin Biochemical Technology Co., Ltd.), N’N-disuccinimidyl carbonate (DSC) (lot: BCC136748, 95%, Sigma-Aldrich Reagent), 4-dimethylamino pyridine (DMAP) (lot: C12509524, 99%, Shanghai Macklin Biochemical Technology Co., Ltd.), trifluoroacetic acid (TFA) (lot: B2210493, 99%, Arlanza Reagent Shanghai Co., Ltd.), Cy3 NHS ester (97%, Beijing Okenas Technology Co., Ltd.), Cy5 NHS ester (95%, Beijing Okenas Technology Co., Ltd.), dCTP-V1 Linker (lot: WHR036-047-A3, Wuhan Huadaizhi Zao Technology Co., Ltd.), hot dATP-V1-AF532 (lot: HAA002209004, Wuhan Huadaizhi Zao Technology Co., Ltd.), hot dTTP-V1-ROX (lot: HTA002211003, Wuhan Huadaizhi Zao Technology Co., Ltd.), cold dGTP (lot: CGA002004001, Wuhan Huadaizhi Zao Technology Co., Ltd.).

[0188] In which, the structural formula of dCTP-V1 Linker, hot dATP-V1-AF532, hot dTTP-V1-ROX, cold dGTP is as follows:

[0189] 2 Experimental method

[0190] 2.1 Synthesis route

[0191] (1) Synthesis of hot dCTP-V1-Cy3-L1-Cy5:

[0192] Synthesis of compound 2

[0193] Take a 50 mL flask, weigh compound 1 (200 mg), compound Cy3 NHS ester (503 mg), add anhydrous DMF (5 mL) to dissolve, then add N'N-diisopropyl ethylamine (406 mg), nitrogen protection, room temperature, electromagnetic stirring for 5 hours. The reaction solution was purified by biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 80 g, 0.1% formic acid / acetonitrile, acetonitrile content 5-95%), and the preparation solution was concentrated under reduced pressure, freeze-dried to obtain compound 2. LCMS: calcd for C 48 H 58 N4O 11 S2[M-H] - :929.35.Found,m / z,[M-H] - :929.64.

[0194] Synthesis of compound 3

[0195] Take a 100 mL flask, weigh compound 2 (550 mg), add ultrapure water (10 mL) and trifluoroacetic acid (5 mL), room temperature, electromagnetic stirring for 5 hours. The reaction solution was added with ultrapure water (20 mL) and freeze-dried by vacuum freeze dryer to obtain compound 3. LCMS: calcd for C 43 H 50 N4O9S2[M+H] + :831.30.Found,m / z,[M+H] + :831.67.

[0196] Synthesis of compound 4

[0197] Take a 50 mL flask, weigh compound 3 (450 mg), compound Cy5 NHS ester (449 mg), add anhydrous DMF (10 mL) to dissolve, then add N'N-diisopropyl ethylamine (350 mg), nitrogen protection, room temperature, electromagnetic stirring for 5 hours. The reaction solution was purified by biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 80 g, 0.1% formic acid / acetonitrile, acetonitrile content 5-95%), and the preparation solution was concentrated under reduced pressure, freeze-dried to obtain compound 4. LCMS: calcd for C 76 H 88 N6O 16 S4[(M+2) / 2] + :735.25.Found,m / z,[(M+2) / 2] + :735.45.

[0198] Synthesis of compound hot dCTP-V1-Cy3-L1-Cy5:

[0199] Take a 50 mL flask, weigh compound 4 (50 mg), dissolve in anhydrous DMF (4 mL), then add N’N-dissuccinimidyl carbonate (17.4 mg), 4-dimethylaminopyridine (0.8 mg), nitrogen protection, room temperature, electromagnetic stirring for 3 hours. Then add dCTP-V1 Linker (47.2 mg), N’N-diisopropylethylamine (13.2 mg), nitrogen protection, room temperature, electromagnetic stirring for 12 hours. The reaction solution is first purified by biotage automatic column machine (welflash C18-I, regular C18 20-40 μm, 80 g, 0.1 M TEAB / acetonitrile, acetonitrile content 5-95%), then purified by preparative HPLC (HYPERSIL GOLD, 5 μm, 250 mm*10 mm, pre-column, 1PK, 0.1 M TEAB / acetonitrile, acetonitrile content 10-35%, flow rate 5 milliliters per minute, 20 minutes, retention time: 17.5 minutes), and the preparation solution is concentrated under reduced pressure, freeze-dried to obtain compound hot dCTP-V1-Cy3-L1-Cy5, whose characterization spectrum is shown in Figure 2, Figure 3, and the characterization data are as follows.

[0200] 1 H NMR (D2O, 600 MHz): δ 8.32-8.15 (m, 1H), 8.03-7.87 (m, 3H), 7.84-7.77 (m, 7H), 7.37-7.00 (m, 7H), 6.97-6.66 (m, 5H), 6.50-6.36 (m, 1H), 6.27 (dd, J = 12.0, 30.0 Hz, 2H), 6.15-5.95 (m, 3H), 4.69-3.52 (m, 25H), 3.50-3.26 (m, 5H), 3.07-3.04 (m, 1H), 2.97-2.81 (m, 1H), 2.73-2.53 (m, 1H), 2.52-2.40 (m, 1H), 2.18-1.98 (m, 5H), 1.73-1.33 (m, 33H), 1.20-1.08 (m, 8H), 1.06-0.66 (m, 3H).

[0201] 31 P NMR (D2O, 243 MHz): δ -10.76 (d, J = 21.9 Hz), -11.68 (d, J = 19.4 Hz), -23.32 (t, J = 19.4 Hz).

[0202] LCMS: calcd for C 104 H125 N 18 O 33 P3S4[(M- 2) / 2] - :1186.84.Found,m / z,[(M- 2) / 2] - :1186.95.

[0203] Example 2: Fluorescence spectrum test of the compound

[0204] 2.1 Solution preparation method for spectrum test

[0205] 1.2 μmol / L hot dATP-V1-AF532:

[0206] Accurately weigh 4.90 mg of hot dATP-V1-AF532 (2.376 umol), and dissolve in 2.376 mL of DMSO with a pipette to prepare a 1.0 mmol / L solution. Take 12 μL of the above solution with a pipette, and dilute with 10 mL of scanning reagent to prepare a 1.2 μmol / L solution.

[0207] 1.2 μmol / L hot dTTP-V1-ROX:

[0208] Accurately weigh 9.00 mg of hot dTTP-V1-ROX (4.870 umol), and dissolve in 4.870 mL of DMSO with a pipette to prepare a 1.0 mmol / L solution. Take 12 μL of the above solution with a pipette, and dilute with 10 mL of scanning reagent to prepare a 1.2 μmol / L solution.

[0209] 1.2 μmol / L hot dCTP-V1-Cy3-L1-Cy5:

[0210] Accurately weigh 2.50 mg of hot dCTP-V1-Cy3-L1-Cy5 (0.810 umol), and dissolve in 0.810 mL of DMSO with a pipette to prepare a 1.0 mmol / L solution. Take 12 μL of the above solution with a pipette, and dilute with 10 mL of scanning reagent to prepare a 1.2 μmol / L solution.

[0211] 2.2 Fluorescence spectrum test results

[0212] Take 1.2 μmol / L of the sample solution to be tested into a 1 cm quartz cuvette, set the excitation light wavelength to 532 nm, and scan the emission spectrum in the wavelength range of 400-800 nm. The results are shown in Figures 4 and 5.

[0213] Example 3: Application of the dye in gene sequencing

[0214] 1. Experimental materials and reagents:

[0215] PCR instrument, Qubit instrument, standard library V4 reagent, DNBSEQ-G99 sequencing chip, DNBSEQ-G99RS gene sequencer, DNBSEQ-G99RS High-throughput Sequencing Reagent (FCL SE100), hot dATP-V1-AF532, hot dTTP-V1-ROX, hot dCTP-V1-Cy3-L1-Cy5, cold dGTP, fixed sequence sequencing primer Insert Primer-8bp, TE buffer.

[0216] 2. Reagent preparation:

[0217] 2.1 Primer dissolution:

[0218] Fixed sequence sequencing primer Insert Primer-8bp (abbreviated as IP1-8) sequence: CAACTCCTTGGCTCACAGAACGACATGGCTACGA (SEQ ID NO: 1)

[0219] Put the 1.5ml centrifuge tube containing the primer powder in the eppendorf high-speed centrifuge, centrifuge at 5000rpm for 1 minute, then add diethyl pyrocarbonate (DEPC) treated water, and mix the primer well with a vortex mixer to obtain a primer stock solution with a concentration of 100μM. Prepare 1μM fixed sequence sequencing primer IP1-8 working solution according to Table 1.

[0220] Table 1

[0221] 2.2 hot dNTPs mix mixture preparation

[0222] Prepare hot dNTPs mix mixture according to Table 2.

[0223] Table 2

[0224] 3. Sequencing scheme:

[0225] Prepare a set of DNBSEQ-G99RS high-throughput sequencing reagent kit (FCL SE100), melt at room temperature, use a needle to extract the primer from hole No. 4 and replace it with the IP1-8 primer working solution above, use a needle to extract the hot dNTPs mixture from hole No. M1 and replace it with the hot dNTPs mix mixture prepared above, mix well again, select the SE8 sequencing scheme, and see the 532nm excitation channel signal after machine.

[0226] 4. Sequencing results:

[0227] Fixed sequence: TCCGACTT (SEQ ID NO: 2)

[0228] Looking only at the channel signal under 532 nm excitation, as shown in FIG. 6, the hot dCTP-V1-Cy3-L1-Cy5 signal intensity was about 1110, the hot dTTP-V1-ROX signal was about 3000, and the hot dATP-V1-AF532 signal was about 4600.

[0229] Although some specific embodiments of the present disclosure have been described in detail through examples, those skilled in the art should understand that the above examples are only for illustration, and are not intended to limit the scope of the present disclosure. Those skilled in the art should understand that the above embodiments can be modified or some technical features can be replaced equivalently without departing from the scope and spirit of the present disclosure. The scope of the present disclosure is defined by the appended claims.

Claims

1. A compound represented by the formula I, or a stereoisomer thereof, or a salt thereof, wherein: the compound of Formula I or a stereoisomer thereof or a salt thereof is capable of a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g. not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm; R 1 is a first fluorescent group, R 1 is selected from AF532, Cy3, ATTO532, ROX or an analogue of each, preferably from AF532, Cy3 or an analogue of each, more preferably is Cy3 or an analogue thereof, most preferably is Cy3; R 2 is a second fluorescent group, R 2 is selected from Cy5, AF647 or respective analogs, preferably Cy5 or an analog thereof, more preferably Cy5; L 1 a linker group for connecting the first fluorescent group, the second fluorescent group and Base; preferably the linker is a cleavable linker; preferably the cleavable linker is selected from an electrophilic cleavable linker, a nucleophilic cleavable linker, a photolyzable linker, a linker cleavable under reducing conditions, a linker cleavable under oxidizing conditions, a safety- handle type linker, a linker cleavable via an elimination mechanism, or any combination thereof; R' is a reversible blocking group; R 0 is selected from hydrogen, hydroxyl, preferably hydrogen; n is selected from 0, 1, 2, 3, 4, preferably 3; Base is selected from a base, a deazabase, or a tautomer thereof, for example Base is selected from adenine, 7-deazaadenine, thymine, uracil, cytosine, guanine, 7-deazaguanine, or a tautomer thereof; Preferably, Base is selected from More preferably, Base is selected from Preferably, the N-terminal below Base is connected to the parent ring, and the C-terminal or O-terminal or the N-terminal above Base is connected to L 1 .

2. The compound of claim 1, or a stereoisomer thereof or a salt thereof, wherein, The structural formula of the compound of formula I is formula I-1, wherein: R 1 is a first fluorescent group, R 1 is selected from AF532, Cy3, ATTO532, ROX or an analogue of each, preferably from AF532, Cy3 or an analogue of each, more preferably is Cy3 or an analogue thereof, most preferably is Cy3; R 2 is a second fluorescent group, R 2 is selected from Cy5, AF647 or respective analogs, preferably Cy5 or an analog thereof, more preferably Cy5; L 1a -L 1a1 -L 1a2 -L 1a3 -; L 1a1 For Preferably, L 1a1 is Preferably, L 1a1 is C-terminally linked to Base and N-terminally linked to L 1a2 ; L 1a2 for Preferably, L 1a2 is Preferably, L 1a2 The left carbonyl group and L 1a1 Connected, the carbonyl group on the right is connected to L 1a3 Connected; L 1a3 for Preferably, L 1a3 is Preferably, L 1a3 one side of the amino group and L 1a2 Connected, the amino group on the other side is connected to L 1b Connected; n1, n2 are each independently selected from 1, 2, 3, 4, 5; preferably n1, n2 are each independently selected from 1, 2, 3; more preferably n1 is 1 and n2 is 2; R 3 selected from N3-, C1-C6alkyl-SS-, NH2O-, R x C(O)O-, R x NHC(O)O-, C1-C6alkyl, phenyl, phenyl C1-C6alkylene, C3-C6cycloalkyl, wherein each R x is independently selected from C1-C6alkyl, C3-C6cycloalkyl, phenyl C1-C6alkylene; Preferably, R 3 is -N3; R 4 , R 5 , R 6 , R 7 are each independently selected from H, C1-C6alkyl; Preferably, R 4 , R 5 , R 6 , R 7 is H; Preferably, L 1a is Preferably, L 1a is connected to the C-terminus of Base and L 1b is connected to the N-terminus of Base. L 1b For each n3 is independently selected from 1, 2, 3, 4, 5; preferably each n3 is independently selected from 1, 2, 3; more preferably n3 is 1; R 8 , R 9 , R 10 , R 11 are each independently selected from H, C1-C6alkyl; Preferably, R 8 , R 9 , R 10 , R 11 is H; Preferably, L 1b is Preferably, L 1b is attached to the left amino terminus and R 1 is attached to the right amino terminus, and R 2 is attached to the right carbonyl terminus and L 1a is attached to the left carbonyl terminus; R' is a reversible blocking group, R' is selected from the group consisting of H, N3-Ci-C6alkylene, Ci-C6alkyl-SS-Ci-C6alkylene, NH2O-, R z C(O)O-, R z NHC(O)O-, wherein each R z is independently selected from the group consisting of Ci-C6alkyl, C3-C6cycloalkyl, phenyl Ci-C6alkylene; preferably R' is N3-C1-C6 alkylene; more preferably R' is N3-CH2-; R 0 selected from hydrogen, hydroxyl, preferably hydrogen; n is selected from 0, 1, 2, 3, 4, preferably 3; Base is selected from a base, a deazabase, or a tautomer thereof, for example Base is selected from adenine, 7-deazaadenine, thymine, uracil, cytosine, guanine, 7-deazaguanine, or a tautomer thereof; Preferably, Base is selected from More preferably, Base is selected from Preferably, the N-terminal below Base is connected to the parent ring, and the C-terminal or O-terminal or the N-terminal above Base is connected to L 1a .

3. The compound according to any one of claims 1-2, or a stereoisomer thereof, or a salt thereof, wherein, The compound is selected from:

4. A method for sequencing a target nucleic acid molecule, comprising: - incorporating four different types of nucleotides into a strand complementary to the target nucleic acid molecule to produce an extended strand, wherein: a first type of nucleotide can produce a first fluorescent signal, a second type of nucleotide can produce a second fluorescent signal, a third type of nucleotide can produce a third fluorescent signal, a fourth type of nucleotide does not produce a fluorescent signal; - determining the type of incorporated base by the different types of fluorescent signals.

5. The method according to claim 4, wherein: the first type of nucleotide comprises a first fluorescent group and a second fluorescent group, the second type of nucleotide comprises a third fluorescent group, the third type of nucleotide comprises a fourth fluorescent group, the fourth type of nucleotide does not comprise a fluorescent group; the first type of nucleotide, the second type of nucleotide, the third type of nucleotide each have a detectably different first emission wavelength, second emission wavelength, third emission wavelength, respectively; the fourth type of nucleotide does not comprise a fluorescent group; the first type of nucleotide, the second type of nucleotide, the third type of nucleotide each have a detectably different first emission wavelength, second emission wavelength, third emission wavelength, respectively; wherein the first type of nucleotide is capable of undergoing a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g. not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm; preferably the first fluorescent group and the second fluorescent group of the first type of nucleotide form a fluorescence resonance energy transfer (FRET) pair; preferably the method comprises the following steps: (i) incorporating the above four different types of nucleotides into a strand complementary to the target nucleic acid molecule to generate an extended strand; (ii) providing a single excitation wavelength, and detecting a first fluorescent signal corresponding to the first type of nucleotide at a first emission wavelength, a second fluorescent signal corresponding to the second type of nucleotide at a second emission wavelength, and a third fluorescent signal corresponding to the third type of nucleotide at a third emission wavelength; (iii) determining the identity of the incorporated nucleotide based on the detection results of step (ii); preferably between steps (i) and (ii) comprises removing the non-incorporated nucleotides; preferably after step (iii) further comprises removing the fluorescent groups from the incorporated nucleotides; optionally the method comprises repeating the above steps in sequence to determine the sequence of the target nucleic acid molecule.

6. The method of claim 5, wherein, the single excitation wavelength is green light (e.g. 500-560 nm, in particular 532 nm).

7. The method according to any one of claims 5-6, wherein, the first emission wavelength is at least 10 nm (e.g. at least 15 nm, at least 20 nm, at least 25 nm, at least 30 nm, at least 35 nm, at least 40 nm, at least 45 nm, at least 50 nm, at least 55 nm, at least 60 nm, at least 65 nm, at least 70 nm, at least 75 nm, at least 80 nm, at least 85 nm, at least 90 nm, at least 95 nm, or at least 100 nm) longer than the second emission wavelength; the second emission wavelength is at least 10 nm (e.g. at least 15 nm, at least 20 nm, at least 25 nm, at least 30 nm, at least 35 nm, at least 40 nm, at least 45 nm, at least 50 nm, at least 55 nm, at least 60 nm, at least 65 nm, at least 70 nm, at least 75 nm, at least 80 nm, at least 85 nm, at least 90 nm, at least 95 nm, or at least 100 nm) longer than the third emission wavelength.

8. The method according to any one of claims 5-7, wherein, the first fluorescent group of the first type of nucleotide is a FRET donor and the second fluorescent group is a FRET acceptor; preferably the first fluorescent group is selected from AF532, Cy3, ATTO532, ROX, or an analogue of each, preferably from AF532, Cy3, or an analogue of each, more preferably Cy3 or an analogue thereof, most preferably Cy3; preferably the second fluorescent group is selected from Cy5, AF647, or an analogue of each, preferably Cy5 or an analogue thereof, more preferably Cy5.

9. The method according to any one of claims 5-8, wherein, the third fluorescent group is ROX or an analogue thereof, more preferably ROX.

10. The method according to any one of claims 5-9, wherein, the fourth fluorescent group is AF532 or an analogue thereof, more preferably AF532.

11. The method according to any one of claims 4-10, wherein, the first type of nucleotide, the second type of nucleotide, the third type of nucleotide and the fourth type of nucleotide further comprise a reversible blocking group to ensure that only one nucleotide is extended per incorporation; Preferably, the method further comprises removing the reversible blocking group from the incorporated nucleotide prior to the next incorporation cycle.

12. The method of any one of claims 5-11, wherein, the first fluorescent group and the second fluorescent group of the first type of nucleotide are linked to the base of the first type of nucleotide by a linking group; Preferably, the linking group is a cleavable linking group; Preferably, the cleavable linking group is selected from an electrophilic cleavable linking group, a nucleophilic cleavable linking group, a photolyzable linking group, a linking group cleavable under reducing conditions, a linking group cleavable under oxidizing conditions, a safety- handle type linking group, a linking group cleavable via an elimination mechanism, or any combination thereof.

13. The method of claim 12, wherein, the linking group comprises L 1b , L 1b as defined in claim 2; Preferably, the linking group further comprises L 1a , L 1a as defined in claim 2; Preferably, L 1a is connected to L 1b .

14. The method of any one of claims 4-13, wherein, the first type of nucleotide is a compound of Formula I or a stereoisomer thereof or a salt thereof, wherein R 0 , R 1 , R 2 , R', L 1 , Base, n are each independently as defined in claim 1.

15. The method of any one of claims 4-14, wherein, the first type of nucleotide is a compound represented by Formula I-1 or a stereoisomer thereof or a salt thereof, wherein R 0 , R 1 , R 2 , R', L 1a , L 1b , Base, n are each independently as defined in claim 2.

16. The method of any one of claims 4-15, wherein, The first type of nucleotide is a compound selected from any one of the following, or a stereoisomer thereof, or a salt thereof, 17. The method of any one of claims 4-16, wherein, the third fluorescent group comprised by the second type of nucleotide is linked to the base of the second type of nucleotide by a linker, and the fourth fluorescent group comprised by the third type of nucleotide is linked to the base of the third type of nucleotide by a linker; Preferably, the linker is a cleavable linker; Preferably, the cleavable linker is selected from a disulfide linker, an acid-labile linker (such as a dialkoxybenzyl linker, a Sieber linker, an indole linker, a t-butyl Sieber linker), an electrophilic cleavable linker, a nucleophilic cleavable linker, a photolyzable linker, or a combination thereof; Preferably, the linker is L 1a , L 1a As defined in claim 2.

18. The method of any one of claims 4-17, wherein, the first type of nucleotide, the second type of nucleotide, the third type of nucleotide and the fourth type of nucleotide are selected from A, T, C, G; Preferably, the first type of nucleotide, the second type of nucleotide, the third type of nucleotide and the fourth type of nucleotide are selected from dATP, dTTP, dCTP, dGTP and non-natural nucleotide analogues thereof; Preferably, the first type of nucleotide is: The second type of nucleotide is: The third type of nucleotide is: The fourth type of nucleotide is 19. The method of any one of claims 4-18, wherein, the incorporation of the nucleotides is carried out by a polymerase.

20. A kit comprising four different types of nucleotides, wherein: the first type of nucleotide comprises a first fluorescent group and a second fluorescent group, the second type of nucleotide comprises a third fluorescent group, the third type of nucleotide comprises a fourth fluorescent group, the fourth type of nucleotide does not comprise a fluorescent group; the first type of nucleotide, the second type of nucleotide, the third type of nucleotide have respectively a first emission wavelength, a second emission wavelength, a third emission wavelength that are different and detectable; wherein the first type of nucleotide is capable of a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g. not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm. ​ Preferably, the first fluorescent group and the second fluorescent group of the first type of nucleotide form a fluorescence resonance energy transfer (FRET) pair; Preferably, the four different types of nucleotides are as defined in any one of claims 7-18; Preferably, the kit is for nucleic acid sequencing; Preferably, the kit further comprises one or more additional reagents required for nucleic acid sequencing, such as primers, polymerase, buffer solution, wash solution, or any combination thereof.

21. Use of a compound represented by Formula II: ###00019### II or a stereoisomer thereof or a salt thereof as a fluorescent label. wherein: the compound of Formula II or a stereoisomer thereof or a salt thereof is capable of undergoing a Stokes shift, preferably the Stokes shift is not less than 100 nm (e.g. not less than 110 nm, not less than 120 nm, not less than 130 nm, not less than 140 nm, not less than 150 nm, not less than 160 nm, not less than 170 nm, not less than 180 nm, not less than 190 nm, or not less than 200 nm), preferably not less than 120 nm; R 1 is a first fluorescent group, R 1 is selected from AF532, Cy3, ATTO532, ROX or an analogue of each, preferably from AF532, Cy3 or an analogue of each, more preferably is Cy3 or an analogue thereof, most preferably is Cy3; R 2 is a second fluorescent group, R 2 is selected from Cy5, AF647 or an analogue of each, preferably Cy5 or an analogue thereof, more preferably Cy5; L 1’ a linker group for connecting the first fluorescent group and the second fluorescent group; Preferably, the linking group is a cleavable linking group; Preferably, the cleavable linking group is selected from an electrophilic cleavable linking group, a nucleophilic cleavable linking group, a photolyzable linking group, a linking group cleavable under reducing conditions, a linking group cleavable under oxidizing conditions, a safety- handle type linking group, a linking group cleavable via an elimination mechanism, or any combination thereof.

22. The use of claim 21, wherein, The structural formula of the compound shown in formula II is formula II-1, wherein: L 1b’ For R 1 , R 2 , n3, R 8 , R 9 , R 10 , R 11 each independently is as defined in claim 2; Preferably, L 1b’ is Preferably, L 1b’ The left amino terminus of R 1 Connected, the right amino terminus is connected to R 2 Connected.

23. The use of any one of claims 21-22, wherein, The compounds are:

24. The use of any one of claims 21-23, wherein, the fluorescent label is used for detecting the presence, location and / or amount of a target molecule; Preferably, the fluorescent label is attached to a detection reagent that specifically binds to the target molecule, such as a nucleic acid probe, an antibody, an antigen, or an enzyme.

25. The use of any one of claims 21-24, wherein, the fluorescent label is used for sequencing, expression analysis, hybridization analysis, protein binding assay, in vitro diagnostics, immunoassay, molecular labeling technique; Preferably, the fluorescent label is used for cell imaging, tissue imaging, or bioimaging.

26. A method comprising using a compound of Formula II or a stereoisomer thereof or a salt thereof as a fluorescent label; the compound or a stereoisomer thereof or a salt thereof is as defined in any one of claims 21-23; Preferably, the method is used for detecting the presence, location and / or amount of a target molecule; Preferably, the method comprises using a detection reagent (such as a nucleic acid probe, an antibody, an antigen, or an enzyme) that specifically binds to the target molecule, the detection reagent being attached with the fluorescent label; Preferably, the method is selected from sequencing, expression analysis, hybridization analysis, protein binding assay, in vitro diagnostics, immunoassay, or molecular labeling technique; Preferably, the method is selected from cell imaging, tissue imaging, or bioimaging.

Citation Information

Patent Citations

  • Reversibly blocked nucleoside analogues and their use

    CN109790196A

  • Novel nucleotide analogs and methods of use

    CN114981283A

  • Methods, systems, and compositions for nucleic acid sequencing

    CN115803457A

  • Method for sequencing polynucleotides on basis of optical signal dynamics of luminescent label and secondary luminescent signal

    WO2021031109A1