Application of glun3b inhibitor in preparation of drug for preventing or treating obesity and related metabolic syndrome

Abstract

Provided are an application of a GluN3B inhibitor in the preparation of a drug for preventing or treating obesity and related metabolic syndrome, and an application of the GluN3B inhibitor in the prevention and treatment of obesity. By means of using a high-fat diet (45% fat)-induced obesity model as a research subject, it has found that GluN3B gene knockout or knockdown can effectively inhibit the weight gain of mice. In vivo animal experiments show that the GluN3B gene knockout or knockdown can activate brown adipose tissue to significantly promote the energy consumption of mice, which is an important reason for the slowed weight gain of mice.

Description

Use of GluN3B inhibitor in preparation of medicine for preventing or treating obesity and related metabolic syndrome

[0001] Cross-reference to Related Applications

[0002] The present application claims priority to the Chinese patent application No. 202411333521.9 filed on September 24, 2024, the contents of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present application belongs to the field of biological medicine, particularly relates to the application of NMDA receptor GluN3B subunit specific inhibitor in obesity and related metabolic syndrome by promoting energy consumption, and specifically relates to the use of GluN3B inhibitor in preparation of medicine for preventing or treating obesity and related metabolic syndrome. BACKGROUND

[0004] Obesity, as a complex and widespread health problem, is scientifically defined as an abnormal increase in body fat tissue, leading to a body weight exceeding the normal range, usually measured by body mass index (BMI), and is considered to be in an obese state when the BMI value exceeds 30. This condition is the result of a combination of multiple factors, including genetic susceptibility, poor eating habits, lack of physical activity, environmental factors, and certain endocrine or metabolic disorders, etc.

[0005] Obesity is not just a problem of appearance and body shape, but also has a profound impact on the physiological functions and health status of the human body. Under the condition of obesity, the accumulation of body fat tissue, especially visceral fat, promotes the release of various inflammatory factors and metabolic products, interferes with the normal function of insulin, leading to insulin resistance, and thus increases the risk of type 2 diabetes. At the same time, obesity is also an important risk factor for cardiovascular diseases, by promoting the occurrence and development of hypertension, hypercholesterolemia and atherosclerosis, increasing the incidence of cardiovascular events such as heart disease and stroke. In addition, obesity also has adverse effects on multiple systems such as the respiratory system, skeletal system, and reproductive system. The burden on the respiratory system is increased, which can easily lead to sleep apnea syndrome and affect sleep quality; the skeletal system is accelerated wear due to long-term bearing of excessive pressure, increasing the risk of degenerative diseases such as osteoarthritis; for the reproductive system, obesity can interfere with the balance of sex hormones and affect the reproductive capacity of men and women. More seriously, obesity is also closely related to the occurrence and development of various cancers. Scientific research shows that the chronic inflammatory environment and metabolic disorder under the condition of obesity provide favorable conditions for the growth of tumor cells, thereby increasing the risk of various cancers such as breast cancer, colorectal cancer, endometrial cancer, etc.

[0006] Therefore, it is important to develop effective prevention and intervention strategies for obesity and related metabolic syndrome. Body weight regulation is a complex process involving multiple metabolic pathways in the central nervous system (CNS) and peripheral tissues. Maintaining normal body weight (BMI≤25 kg / m 2 ) requires a balance between energy intake and energy expenditure. Since multiple biological mechanisms affect the regulation of energy homeostasis, the treatment of obesity and subsequent maintenance of body weight has proven to be very challenging. Behavior modification that promotes healthy eating habits and encourages more exercise is the first-line therapy for obesity, but often fails to produce a sustained effect of weight loss due to the adaptive processes that occur in the body to prevent a state of hunger, such as reduced energy expenditure and increased appetite. In addition, bariatric surgery can reduce the risk of obesity-related complications, but is expensive and risky, which severely limits its widespread application. In the past decade, drug treatment for weight loss has developed rapidly. In particular, the recent emergence of glucagon-like peptide-1 (GLP-1) agonists, such as exenatide, liraglutide, dulaglutide and semaglutide, has shown great potential in the treatment of obesity and diabetes. However, many patients experience severe side effects such as nausea, vomiting and diarrhea, so the development of additional adjunctive drug treatment strategies would be very useful. NMDA receptors are the target of a variety of natural and synthetic drugs, and a small number of studies have shown that different subunits of NMDA receptors have inconsistent effects on body weight and energy homeostasis, which fully demonstrates the feasibility of developing agonists or antagonists targeting different subunits of NMDA receptors as anti-obesity treatment. SUMMARY

[0007] The purpose of the present application is to overcome at least one of the above-mentioned disadvantages of the prior art, and to provide a new therapeutic target and the possibility of using related inhibitors for the prevention and treatment of obesity and related metabolic syndrome.

[0008] To solve the above technical problems, the present application provides a GluN3B inhibitor for use in the preparation of a medicament for preventing or treating obesity and related metabolic syndrome.

[0009] Preferably, the GluN3B inhibitor is a protein molecule, a nucleic acid molecule, a small molecule compound, a viral particle, or any combination of two or more of the foregoing, which inhibits the activity of GluN3B or reduces the expression level of GluN3B. The technical means for knocking out, knocking down or silencing the Grin3b gene include but are not limited to various miRNAs, siRNAs, shRNAs and their modifications targeting GluN3B, as well as siRNA or shRNA fragments carried by various vectors or other technical means for knocking down or knocking out GluN3B using genetic engineering.

[0010] Preferably, the GluN3B inhibitor is a CRISPR / Cas9 gene editing system that knocks out, knocks down, or silences the Grin3b gene.

[0011] Preferably, the GluN3B inhibitor is selected from one or more of the following compounds:

[0012] Preferably, the obesity and related metabolic syndrome is one or more of simple obesity caused by genetic, overeating, lack of exercise factors.

[0013] Preferably, the medicament comprises an active ingredient that is a GluN3B inhibitor and a pharmaceutically acceptable carrier.

[0014] The present application provides the use of a GluN3B inhibitor in the prevention and treatment of obesity. Through an obesity model induced by a high-fat (45% fat) diet, it was found that GluN3B gene knockout or knockdown can effectively inhibit the weight gain of mice. In vivo animal experiments show that GluN3B gene knockout or knockdown can activate brown adipose tissue to significantly promote energy consumption in mice, which is an important reason for the slow weight gain of mice. BRIEF DESCRIPTION OF DRAWINGS

[0015] FIGS. 1A to 1M are graphs showing the effect of Grin3b gene knockout on the weight gain and energy consumption of mice in Example 1.

[0016] FIGS. 2A to 2L are graphs showing the effect of Grin3b gene knockdown in brown adipose tissue (BAT) on the weight gain and energy consumption of mice in Example 2. DETAILED DESCRIPTION

[0017] In order to make the technical means, creative features, purposes and effects achieved by the present application easy to understand, the present application is further described below in conjunction with specific embodiments.

[0018] The present application first discovered that GluN3B (the encoding gene in mice is Grin3b, the latest discovered NMDA receptor subunit) is an important molecule for regulating body weight and energy consumption, and an NMDA receptor GluN3B subunit inhibitor can inhibit weight gain under physiological or pathological conditions. Knockout of the Grin3b gene or local tissue knockdown of the Grin3b gene expression level can significantly increase the energy consumption of mice and significantly inhibit the weight gain of mice under normal diet or high-fat conditions. The above fully demonstrates the application prospect of GluN3B inhibitors in the prevention and treatment of obesity and related metabolic syndromes.

[0019] The application verifies the importance of Grin3b gene for body weight and energy homeostasis through whole knockout, tissue-specific knockout and knockdown experiments of Grin3b gene (coding protein GluN3B). A series of compounds with inhibitory activity of GluN3B have application value for preventing and treating obesity or related metabolic syndrome. Known GluN3B inhibitors are the following compounds:

[0020] The test methods described in the following examples are conventional methods unless otherwise specified; the reagents or consumables involved can be obtained through commercial channels unless otherwise specified.

[0021] Example 1 Influence of Grin3b gene knockout on body weight gain and energy consumption of mice

[0022] Materials:

[0023] Healthy female SPF wild-type and Grin3b knockout C57BL / 6J mice, metabolic cages (Oxymax / CLAMS, Columbus Instruments), Topscan behavioral analysis system (CleverSys).

[0024] Methods:

[0025] CRISPR / Cas9 gene editing technology was used to construct Grin3b knockout mice: double-strand breaks (DSB) were introduced into the target gene by CRISPR-Cas9, and the cells were repaired by non-homologous end joining (NHEJ) repair mechanism, which may introduce indels mutations, resulting in loss of function of the target gene; Grin3b sequence primer (CAGGTCAGGAAGCAGGGGTCATTGT, 636bp amplicon) and wild-type Grin3b site primer (AGCCACTCAGTGTTGGTGCTAGGAA, 531bp amplicon) were used to identify the genotype. The same litter wild-type control was used as the research object, and the body weight of the mice was continuously detected. The energy consumption level and food intake of the mice were monitored by metabolic cages, and the changes in the motor ability of the mice were detected by open field test (OFT), and the specific methods were as follows:

[0026] (1) Core body temperature and body weight measurement

[0027] The core temperature of the mice was measured using a rectal probe thermometer (ALC-ET03, Shanghai Alcott Biotechnology Co., Ltd., China) between 9:00-10:00 am. The body weight of the mice was measured using an electronic scale between 9:00-10:00 am.

[0028] (2) Metabolic cage experiment to monitor energy consumption and other indicators in mice

[0029] Metabolic cage experiments are a common technique used in biological and medical research, primarily for monitoring and assessing physiological metabolic parameters of experimental animals, such as food intake, O2 consumption, CO2 production, energy consumption, and other indicators. Under the premise of ensuring that the laboratory environment meets the requirements for the use of metabolic cages (including appropriate temperature, humidity, and lighting conditions), check that all components of the metabolic cage are intact, including the cage, food and water supply system, sensors, and recording equipment, etc. Assemble the metabolic cage correctly according to the instructions and ensure that all components are tightly connected and there is no leakage. Using 8-10w SPF control group and experimental treatment group C57BL / 6J mice as research subjects, place the experimental animals in the metabolic cage for 1-2 days to adapt to the new environment, and observe whether the urine volume is stable under the condition of free water drinking. Use the recording equipment to monitor and record the O2 consumption and CO2 production of mice within the next 48 hours to calculate the energy consumption and respiratory entropy (RER) of mice.

[0030] (3) Open field test (OFT) to detect the autonomous movement ability of mice

[0031] The open field test (OFT) is a commonly used behavioral experiment method, mainly used to monitor and assess the autonomous movement ability of mice, exploration behavior in new and strange environments, and anxiety behavior. The following are the detailed steps for monitoring the autonomous movement of mice in the open field test:

[0032] Experimental equipment: A square open area with a high frame design to prevent mice from escaping. The mouse test box size is 40 cm in diameter, 40 cm in diameter, and 30 cm high. Use a camera system to record the activity of mice in the open field, etc. Track the movement trajectory of mice and analyze the data using Topscan video recording analysis software to assess the effect of Grin3b gene on the autonomous movement ability of mice.

[0033] (4) Brown adipose tissue (BAT) HE staining to analyze cell diameter

[0034] Take the BAT from the interscapular region of the mouse and fix it in 4% PFA overnight. According to the standard protocol of Wuhan Service Biotechnology Co., Ltd. (China), prepare 3-5-μm thick paraffin sections and stain them with hematoxylin and eosin (H&E). Use an Olympus VS200 slide scanner (Olympus Corporation, Japan) to acquire images and analyze the cell diameter in each image.

[0035] (5) Protein extraction and immunoblotting

[0036] After adding M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, 78501, USA) containing protease and phosphatase inhibitor cocktail (Sigma-Aldrich, A32959, UK) into BAT tissue, grinding was performed with a tissue homogenizer (Servicebio, KZ-II, China), lysis, and then centrifugation at 13200g for 10 minutes at 4°C. The protein concentration of each sample was determined by bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific, 23225, USA). For immunoblotting, 15-20 μg of protein sample was separated by 4%-12% / 15% SDS-PAGE gel. The protein signal was imaged and analyzed using the Bio-Rad ChemiDoc system. The antibodies used are as follows: TH (Cell Signaling Technology, 13106, 1:2000, USA), UCP1 (Abeam, ab10983, 1:3000, USA), β-actin (Bioworld technology, AP0060, 1:5000, China).

[0037] As shown in FIGS. 1A-1M, specifically, as shown in FIG. 1A, knockout of Grin3b in mice can significantly inhibit weight gain, while food intake (as shown in FIG. IB) and exercise (as shown in FIG. 1C) do not change significantly. As shown in FIGS. 1D and 1E, the basal heat production of Grin3b-KO mice increases. As shown in FIGS. 1H and 1I, histological analysis shows that there are smaller lipid droplets in the BAT adipocytes of Grin3b-KO mice. As shown in FIGS. 1J-1L, the expression of UCP1 and TH proteins responsible for heat production-related proteins in the BAT of Grin3b-KO mice is significantly increased.

[0038] Therefore, after knockout of Grin3b gene, the weight gain of mice shows a significant slowing trend, while the food intake and exercise level of mice do not change significantly. Further, the metabolic cage data shows that after knockout of Grin3b gene, the energy consumption of mice is significantly enhanced, accompanied by an increase in core body temperature, a decrease in the average cell size of BAT, and an increase in the expression of TH and UCP1 in BAT.

[0039] To further confirm the role of Grin3b gene deletion in the high-fat diet-induced obesity model, the following experiments were performed: 8 wild-type mice and 8 Grin3b-KO mice were prepared, and after normal diet feeding for eight weeks in the same feeding environment, 45% high-fat (Jiangsu Union Pharmaceutical Biotechnology, XTHF45) food was fed, and the high-fat food was replaced twice a week. Body weight measurement was performed every Tuesday at 10:00 am.

[0040] As shown in FIG. 1M, the body weight of Grin3b-KO mice was significantly reduced compared with wild-type mice when the mice were given 45% high-fat diet. It was found that the body weight of Grin3b knockout group mice was significantly reduced under high-fat diet. The above fully demonstrates that the GluN3B molecular inhibitor has great potential in the treatment of obesity and other diseases.

[0041] Example 1 demonstrates that the whole-body knockout of Grin3b in mice significantly inhibits body weight gain and changes the metabolism and thermogenic effect of brown adipose tissue.

[0042] Example 2

[0043] Knockdown of Grin3b gene in brown adipose tissue (BAT) inhibits body weight gain and promotes energy consumption in mice

[0044] The experimental design of Example 2 is shown in FIG. 2A.

[0045] Materials:

[0046] Healthy female SPF C57BL / 6J mice, metabolic cages (Oxymax / CLAMS, Columbus Instruments), Topscan behavioral analysis system (CleverSys).

[0047] Methods:

[0048] AAV2 / 8 serotype virus was used to locally knock down Grin3b gene in BAT to reduce the expression level of Grin3b gene in BAT. Specifically, eight-week-old mice were divided into a control group and an experimental group, and AAV2 / 8 serotype virus was injected into the BAT of both sides of the mice. After recovery for one week after the operation, the mice were fed with high-fat diet, and the high-fat food was replaced twice a week. Body weight was measured at the same time every week. As in Example 1, the energy consumption level and food intake of the mice were monitored using metabolic cages, and the change in motor ability of the mice was detected using the open field test (OFT).

[0049] As shown in FIGS. 2B to 2L, with the knockdown of Grin3b in the BAT of the mice (as shown in FIG. 2B), the body weight of the mice was significantly reduced (as shown in FIG. 2C), and there was no significant change in food intake (as shown in FIG. 2D) and exercise (as shown in FIG. 2E). The basal heat production of Grin3b knockout mice during the active period was significantly increased (as shown in FIG. 2F), and there was no significant change in rectal temperature (as shown in FIG. 2G). Histological analysis showed that there were smaller lipid droplets in the BAT adipocytes of Grin3b knockout mice (as shown in FIGS. 2H and 2I), accompanied by increased expression of UCP1 and TH proteins (as shown in FIGS. 2J to 2K).

[0050] From the above, after the Grin3b gene was knocked down in BAT, the expression level of Grin3b mRNA in the tissue was significantly reduced, the weight gain of the mice showed a significant slowing trend, and the food intake and exercise level of the mice did not change significantly. Further, the metabolic cage data showed that after the Grin3b gene was knocked out, the energy consumption of the mouse body was significantly enhanced, accompanied by an increase in core body temperature, a decrease in the average cell size of BAT, and an increase in the expression of TH and UCP1 in BAT.

[0051] To further confirm the role of Grin3b gene deletion in the high-fat diet-induced obesity model, the steps are the same as those in Example 1 to confirm the role of Grin3b gene deletion in the high-fat diet-induced obesity model. Compared with the control group of mice, the weight gain of the Grin3b knockdown mice in BAT under high-fat diet was significantly reduced (as shown in Figure 2L). It was found that after the Grin3b gene was knocked down in BAT, the weight gain of the mice was significantly slowed down. The above fully demonstrates that inhibiting the function of GluN3B molecules in the periphery can effectively reduce the weight gain of mice.

[0052] Example 2 demonstrates that the knockdown of Grin3b in BAT significantly inhibits the weight gain of mice, promotes the metabolism and thermogenic function of adipose tissue, and functional sympathetic innervation.

[0053] In summary, overweight and obesity are an important public health problem in developed countries, leading to a large number of mortality and morbidity. The invention of GluN3b specific inhibitors provides new possibilities for the clinical application of obese and metabolic disorder patients. GluN3b provides a new target for the treatment of obesity and other related metabolic disorders by regulating the function of brown adipose tissue and the mechanism of energy consumption.

[0054] In this specification, the application has been described with reference to its specific embodiments. However, it is obvious that various modifications and changes can be made without departing from the spirit and scope of the application. Therefore, the specification should be considered as illustrative rather than limiting.

Claims

1. Use of a GluN3B inhibitor in the preparation of a medicament for preventing or treating obesity and related metabolic syndrome.

2. Use according to claim 1, characterized in that, The GluN3B inhibitor is a protein molecule, a nucleic acid molecule, a small compound molecule, a virus particle, or any combination of two or more of the foregoing, which inhibits the activity of GluN3B or reduces the expression level of GluN3B.

3. Use according to claim 1, characterized in that, The GluN3B inhibitor is a CRISPR / Cas9 gene editing system which knocks out, knocks down, or silences the Grin3b gene.

4. Use according to claim 1, characterized in that, The GluN3B inhibitor is selected from one or more of the following compounds:

5. The use according to claim 1, characterized in that, The obesity and related metabolic syndrome is simple obesity caused by one or more factors selected from the group consisting of heredity, overeating, and lack of exercise.

6. Use according to claim 1, characterized in that, The medicament comprises an active ingredient which is the GluN3B inhibitor and a pharmaceutically acceptable carrier.

Images