Nucleic acid molecule comprising chemical modification pattern

Abstract

A nucleic acid molecule comprising a sense strand and an antisense strand and being capable of inhibiting the expression of a target protein or a target gene, or a salt of the nucleic acid molecule, or a solvate of the nucleic acid molecule or the salt, wherein the sense strand is 21 nucleotides long, the antisense strand is 21, 22, or 23 nucleotides long, the sense strand comprises 2'-deoxy-2'-fluoro-modified nucleotides and modified nucleotides, the 2'-deoxy-2'-fluoro-modified nucleotides are located at positions 7, 9, 10, 11, and 15 from the 5' end of the sense strand, and the modified nucleotides independently comprise: a nucleotide in which the 2' position is substituted with a group selected from the group consisting of 2'-OR1, 2'-R1, 2'-R2OR1, 2'-SH, 2'-SR1, 2'-NH2, 2'-NHR1, 2'-NR1 2, 2'-NHAc, 2'-N3, 2'-CN, 2'-Cl, 2'-Br, 2'-I, and 2'-R2C(O)XR3 (in each group, R1 is alkyl or aryl; R2 is alkylene; X is an oxygen atom, NH, or NR1; and R3 is alkyl); a deoxynucleotide; or a bicyclic sugar.

Description

Nucleic acid molecules containing chemical modification patterns

[0001] This invention relates to nucleic acid molecules containing chemical modification patterns.

[0002] Nucleic acids are essential molecules that carry genetic information in living organisms and are widely applied in the fields of medicine and biotechnology. In recent years, with the development of nucleic acid drugs, modification techniques to improve the stability and cell permeability of nucleic acids have attracted attention. For example, phosphorothioate formation, modification of sugar moieties, and chemical modification of bases have been developed, making it possible to improve nuclease resistance and adjust target specificity. Against this backdrop, various nucleic acid drugs with diverse chemical modification patterns (chemical modification designs) have been reported.

[0003] Non-patent document 1 provides an overview of siRNA development trends. It discloses siRNA modification patterns combining 2'-OMe modification and 2'-F modification, and also discloses siRNA called AdvancedESC, which can enhance stability without impairing siRNA activity.

[0004] Patent Document 1 discloses a novel siRNA molecule containing patterns of chemically modified ribonucleotides, patterns of chemically modified nucleoside bonds, etc. Patent Document 2 discloses specific modification patterns of siRNA to reduce off-target effects. Patent Document 3 discloses a double-stranded nucleic acid that enables both maintenance of antisense effects and reduction of side effects such as toxicity by constructing an optimal phosphorothioate modification pattern for the antisense strand. Patent Document 4 discloses a double-stranded nucleic acid containing modified nucleotides to facilitate nucleic acid processing by RISC. Patent Document 5 discloses a double-stranded RNAi agent having one or more motifs consisting of three identical modifications.

[0005] Non-patent document 2 discloses the study of the persistence of pharmacodynamic effects in GalNAc-siRNA conjugates.

[0006] Japanese Patent Publication No. 2024-511473, Japanese Patent Publication No. 2024-543963, International Publication No. 2020 / 171149, Japanese Patent Publication No. 2020-516312, Japanese Patent Publication No. 2021-152023

[0007] Signal Transduction and Targeted Therapy (2020) 5:101Nucleic Acids Research, 2020, Vol. 48, No. 21 11827-11844

[0008] In this context, the present invention aims to optimize the modification patterns of nucleic acid molecules that are less susceptible to degradation in vivo and have high stability. The present invention also aims to optimize the chemical modification patterns of nucleic acid molecules that have or can enhance inhibitory activity against target proteins or target genes through modification. The present invention also aims to optimize the chemical modification patterns of nucleic acid molecules that are less susceptible to degradation in vivo, have high stability, and have or can enhance inhibitory activity against target proteins or target genes.

[0009] Unmodified nucleic acid molecules (e.g., siRNA) have several known drawbacks, including (1) insufficient stability and poor pharmacokinetics, and (2) the potential to induce off-target effects. Therefore, chemical modifications of each nucleotide in the oligonucleotides constituting nucleic acid molecules (e.g., phosphonate modifications including modifications of the phosphate backbone, ribose modifications, base modifications, etc.) are known. For example, ribose modifications involve modifications of the 2' site of the nucleotide, such as 2'-OMe modifications, 2'-F modifications, and combinations thereof. These chemical modifications are expected to improve the stability and binding affinity of nucleic acid molecules.

[0010] The inventors, through trial and error, experimented with various combinations of the above-mentioned chemical modifications and discovered a chemical modification pattern that can solve the aforementioned problems, thus completing the present invention. Specifically, the present invention discloses the following embodiments [1] to

[23] . Note that the chemical modification pattern of the present invention may be referred to as Optimized Knockdown Chemistry: OKC.

[0011] [1] A nucleic acid molecule or a salt thereof comprising a sense strand and an antisense strand, or a solvate thereof, wherein the sense strand and the antisense strand form a double-stranded region, the sense strand is 21 nucleotides long, and the antisense strand is 23 nucleotides long and contains 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides. [1-1] The nucleic acid molecule or a salt thereof according to [1], or a solvate thereof, wherein the antisense strand contains 7 to 10 2'-deoxy-2'-fluoro-modified nucleotides. [1-2] The nucleic acid molecule or a salt thereof according to [1], or a solvate thereof, wherein the antisense strand contains 7 to 9 2'-deoxy-2'-fluoro-modified nucleotides. [1-3] The nucleic acid molecule or a salt thereof according to [1], or a solvate thereof, wherein the antisense strand contains 7 to 8 2'-deoxy-2'-fluoro-modified nucleotides. [1-4] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the antisense chain comprises seven 2'-deoxy-2'-fluoromodified nucleotides. [1-5] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the 1st and 21st positions of the sense chain and the 21st and 1st positions of the antisense chain are complementary, respectively.

[0012] [2] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the sense strand comprises five 2'-deoxy-2'-fluoro-modified nucleotides. [2-1] The nucleic acid molecule or salt thereof according to [2], or a solvate thereof, wherein the sense strand comprises 2'-deoxy-2'-fluoro-modified nucleotides at positions 9, 10, 11 and 15 in the 5'→3' direction of its sequence.

[0013] [3] The nucleic acid molecule or a salt thereof according to [1], or a solvate thereof, wherein the sense strand comprises five 2'-deoxy-2'-fluoro-modified nucleotides and sixteen 2'-O-methyl (2'OMe)-modified nucleotides. [3-1] The nucleic acid molecule or a salt thereof according to [3], or a solvate thereof, wherein the sense strand comprises nucleotides at positions 9, 10, 11 and 15 in the 5'→3' direction of its sequence, comprising 2'-deoxy-2'-fluoro-modified nucleotides.

[0014] [4] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence are 2'-deoxy-2'-fluoro-modified nucleotides. [4-1] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein in the sense strand, only the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence are 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides are not 2'-deoxy-2'-fluoro-modified nucleotides. [4-2] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the sense strand comprises a 2'-deoxy-2'-fluoromodified nucleotide at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 are 2'-O-methyl (2'OMe) modified nucleotides.

[0015] [5] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the antisense chain comprises 2 to 16 2'-O-methyl (2'OMe) modified nucleotides.

[0016] [6] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the antisense chain comprises 2'-deoxy-2'-fluoro-modified nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence, and any nucleotide at positions 4, 8, 9, 10, 12, 18, 20 or 22 may be a 2'-deoxy-2'-fluoro-modified nucleotide, and the antisense chain comprises 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides. [6-1] The nucleic acid molecule or salt thereof according to [6], or a solvate thereof, wherein the antisense chain comprises 2'-deoxy-2'-fluoro-modified nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence, and two or more nucleotides selected from positions 4, 8, 9, 10 and 12 comprises a 2'-deoxy-2'-fluoro-modified nucleotide.

[0017] [6-2-1] The nucleic acid molecule or salt thereof according to [6], or a solvate thereof, wherein in the antisense chain, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence contain a 2'-deoxy-2'-fluoro-modified nucleotide, and three or more nucleotides selected from positions 4, 8, 9, 10 and 12 contain a 2'-deoxy-2'-fluoro-modified nucleotide, and the antisense chain contains 7 to 10 2'-deoxy-2'-fluoro-modified nucleotides. [6-2-1] The nucleic acid molecule or salt thereof according to [6], or a solvate thereof, wherein in the antisense chain, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence contain a 2'-deoxy-2'-fluoro-modified nucleotide, and three nucleotides selected from positions 4, 8, 9, 10 and 12 contain a 2'-deoxy-2'-fluoro-modified nucleotide, and the antisense chain contains 7 2'-deoxy-2'-fluoro-modified nucleotides.

[0018] [6-3-1] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [6-3-2] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [6-3-3] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.

[0019] [6-3-4] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [6-3-5] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [6-3-6] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [6-3-7] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [6-3-8] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein in the antisense chain, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.

[0020] [6-4-1] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein the antisense chain contains nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence, and nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [6-4-2] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence, and nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [6-4-3] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence, and nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [6-4-4] The nucleic acid molecule or salt thereof, or solvates thereof, according to [6], wherein the antisense chain comprises nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, nucleotides at positions 3-5, 7, 11-13, 15 and 17-23, and nucleotides at positions 3-5, 7, 11-13, 15 and 17-23, and 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides, the nucleotides at position 2' being modified with any group.

[0021] [6-4-5] The nucleic acid molecule or salt thereof, or solvates thereof, as described in [6], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [6-4-6] The nucleic acid molecule or salt thereof, or solvates thereof, described in [6], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [6-4-7] The nucleic acid molecule or salt thereof, or solvates thereof, as described in [6], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides contain nucleotides in which the 2' position is modified with any group.[6-4-8] The nucleic acid molecule or salt thereof, or solvates thereof, described in [6], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides contain nucleotides in which the 2' position is modified with any group.

[0022] [6-4-9] A nucleic acid molecule or salt thereof according to any of [6-4-1] to [6-4-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. [6-4-10] A nucleic acid molecule or salt thereof according to any of [6-4-1] to [6-4-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or a thymidine-3'-phosphate (dT). [6-4-11] A nucleic acid molecule or salt thereof according to any of [6-4-1] to [6-4-8], or a solvate thereof, wherein the antisense chain further comprises a 5'-phosphorus-stabilizing moiety at the 5' end. [6-4-12] The nucleic acid molecule or salt thereof according to [6-4-11], or a solvate thereof, wherein the 5'-phosphorus stabilizing portion is a 5'-vinylphosphonate modified nucleotide.

[0023] [7] The nucleic acid molecule or salt thereof, or solvates thereof, according to [1], wherein the antisense chain comprises a nucleotide at position 7 in the 5'→3' direction of its sequence, which comprises a 2'-O-methyl (2'OMe) modified nucleotide, and the sense chain comprises a 2'-deoxy-2'-fluoro modified nucleotide complementary to the nucleotide at position 7 in the 5'→3' direction of the sequence of the antisense chain. [7-1] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain comprises a nucleotide at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence, which comprises a 2'-deoxy-2'-fluoro modified nucleotide, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 comprises a 2'-O-methyl (2'OMe) modified nucleotide, and 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides may be nucleotides in which the 2' position is modified with any group. [7-2] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence, and nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [7-3] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence, and nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group.[7-4] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain contains nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, and nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group.

[0024] [7-5] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [7-6] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [7-7] The nucleic acid molecule or salt thereof, or solvates thereof, according to [7], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group. [7-8] The nucleic acid molecule or salt thereof, or solvates thereof, as described in [7], wherein the antisense chain contains nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 contain nucleotides with 2'-O-methyl (2'OMe) modification, and 0 to 3 of the 2'-O-methyl (2'OMe) modification nucleotides have their 2' position modified with any group.

[0025] [7-9] A nucleic acid molecule or salt thereof according to any one of [7-1] to [7-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. [7-10] A nucleic acid molecule or salt thereof according to any one of [7-1] to [7-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or a thymidine-3'-phosphate (dT). [7-11] A nucleic acid molecule or salt thereof according to any one of [7-1] to [7-8], or a solvate thereof, wherein the antisense chain further comprises a 5'-phosphorus-stabilizing moiety at the 5' end. [7-12] The nucleic acid molecule according to [7-11], or a salt thereof, or a solvate thereof, wherein the 5'-phosphorus stabilizing portion is a 5'-vinylphosphonate modified nucleotide.

[0026] [8] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the sense strand comprises nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 1-6, 8, 12-14 and 16-21 comprises 2'-O-methyl (2'OMe)-modified nucleotides, and the antisense strand comprises nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence, 2'-deoxy-2'-fluoro-modified nucleotides, and any nucleotide at positions 4, 8-10, 12, 18, 20 or 22 may be a 2'-deoxy-2'-fluoro-modified nucleotide, and the antisense strand comprises 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides. [8-1-1] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [8-1-2] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.[8-1-3] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [8-1-4] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.

[0027] [8-1-5] The nucleic acid molecule or salt thereof according to [8], or a solvate thereof, wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain a 2'-deoxy-2'-fluoro-modified nucleotide, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain a 2'-O-methyl (2'OMe)-modified nucleotide, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain a 2'-deoxy-2'-fluoro-modified nucleotide, and the other nucleotides do not contain a 2'-deoxy-2'-fluoro-modified nucleotide. [8-1-6] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [8-1-7] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.[8-1-8] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.

[0028] [8-2-1] The sense strand comprises nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, which comprises 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 1-6, 8, 12-14 and 16-21 comprises 2'-O-methyl (2'OMe)-modified nucleotides, and the antisense strand comprises nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence, which comprises 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 comprises 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may be nucleotides in which the 2' position is modified with any group, as described in [8], or a salt thereof, or a solvate thereof. [8-2-2] The sense strand comprises nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, comprising 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 1-6, 8, 12-14 and 16-21 comprising 2'-O-methyl (2'OMe)-modified nucleotides, and the antisense strand comprises nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence, comprising 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 comprising 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may be nucleotides in which the 2' position is modified with any group, as described in [8], or a salt thereof, or a solvate thereof.[8-2-3] The sense strand comprises nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, comprising 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 1-6, 8, 12-14 and 16-21 comprising 2'-O-methyl (2'OMe)-modified nucleotides, and the antisense strand comprises nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence, comprising 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 comprising 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may be nucleotides in which the 2' position is modified with any group, as described in [8], or a salt thereof, or a solvate thereof. [8-2-4] The sense strand comprises nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence, which comprises 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 1-6, 8, 12-14 and 16-21 comprises 2'-O-methyl (2'OMe)-modified nucleotides, and the antisense strand comprises nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, which comprises 2'-deoxy-2'-fluoro-modified nucleotides, and nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 comprises 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may be nucleotides in which the 2' position is modified with any group, as described in [8], or a salt thereof, or a solvate thereof.

[0029] [8-2-5] In the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe) modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 contain 2'-O-methyl (2'OMe) modified nucleotides, The nucleic acid molecule or salt thereof, or solvates thereof, described in [8], which may include 0 to 3 nucleotides in which the 2'-O-methyl (2'OMe) modified nucleotides are modified with any group at the 2' position. [8-2-6] In the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe) modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 contain 2'-O-methyl (2'OMe) modified nucleotides, The nucleic acid molecule or salt thereof, or solvates thereof, described in [8], which may include 0 to 3 nucleotides in which the 2'-O-methyl (2'OMe) modified nucleotides are modified with any group at the 2' position.[8-2-7] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group. [8-2-8] The nucleic acid molecule or salt thereof, or solvates thereof, according to [8], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group.

[0030] [8-2-9] A nucleic acid molecule or salt thereof according to any of [8-2-1] to [8-2-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. [8-2-10] A nucleic acid molecule or salt thereof according to any of [8-2-1] to [8-2-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or a thymidine-3'-phosphate (dT). [8-2-11] A nucleic acid molecule or salt thereof according to any of [8-2-1] to [8-2-8], or a solvate thereof, wherein the antisense chain further comprises a 5'-phosphorus-stabilizing moiety at the 5' end. [8-2-12] A nucleic acid molecule or a salt thereof according to [8-2-11], or a solvate thereof, wherein the 5'-phosphorus stabilizing portion is a 5'-vinylphosphonate modified nucleotide.

[0031] [9] The sense strand comprises an oligonucleotide unit consisting of, in order from the 3' side to the 5' side of the sense strand, 3'-A-B-C-D-E-F-G-H-5', a 2'-deoxy-2'-fluoro modified nucleotide A, three consecutive 2'-O-methyl (2'OMe) modified nucleotides B to D, three consecutive 2'-deoxy-2'-fluoro modified nucleotides E to G, a 2'-O-methyl (2'OMe) modified nucleotide H, and a 2'-deoxy-2'-fluoro modified nucleotide I; the antisense strand comprises a 2'-O-methyl (2'OMe) modified nucleotide complementary to 2'-deoxy-2'-fluoro modified nucleotide A, a 2'-O-methyl (2'OMe) modified nucleotide complementary to 2'-deoxy-2'-fluoro modified nucleotide E, A nucleic acid molecule or salt thereof according to [1], or a solvate thereof, comprising: a 2'-O-methyl (2'OMe) modified nucleotide complementary to a 2'-deoxy-2'-fluoro modified nucleotide G; a 2'-deoxy-2'-fluoro modified nucleotide complementary to a 2'-O-methyl (2'OMe) modified nucleotide H; and a 2'-O-methyl (2'OMe) modified nucleotide complementary to a 2'-deoxy-2'-fluoro modified nucleotide I; wherein the sense strand and the antisense strand may each independently contain nucleotides in which the 2' position is modified with any group instead of 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides. [9-1] A nucleic acid molecule or salt thereof according to [9], or a solvate thereof, comprising a 2'-deoxy-2'-fluoro modified nucleotide complementary to the 2'-deoxy-2'-fluoro modified nucleotide F of the sense strand.

[0032]

[10] The antisense chain comprises alternating units in which 2'-deoxy-2'-fluoro-modified nucleotides and 2'-O-methyl (2'OMe)-modified nucleotides are arranged alternately, with three or more of the alternating units being consecutive, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may contain nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof.

[11] The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense chain, in the 5'→3' direction of its sequence, comprises alternating repeats of 2'-deoxy-2'-fluoro-modified nucleotides and 2'-O-methyl (2'OMe)-modified nucleotides at positions 12 to 21, the 22nd position comprises a 2'-deoxy-2'-fluoro-modified nucleotide or a 2'-O-methyl (2'OMe)-modified nucleotide, the 23rd position comprises a 2'-O-methyl (2'OMe)-modified nucleotide, 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may contain nucleotides in which the 2' position is modified with any group, and the 22nd and 23rd positions are overhang regions.

[0033] [12-1] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein the sense strand and the antisense strand each contain one or more, two or more, four or more, or four phosphorothioate bonds. [12-2] The nucleic acid molecule or salt thereof according to [1], or a solvate thereof, wherein in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence.

[0034] [13-1] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [13-2] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [13-3] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.[13-4] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.

[0035] [13-5] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [13-6] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides. [13-7] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.[13-8] The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-deoxy-2'-fluoro-modified nucleotides, and the other nucleotides do not contain 2'-deoxy-2'-fluoro-modified nucleotides.

[0036] [14-1] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O-methyl (2'OMe) modified nucleotides, in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 contain 2'-O-methyl (2'OMe) modified nucleotides. The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], where 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-2] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe) modified nucleotides. In the antisense chain, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof.[14-3] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. In the antisense chain, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof. [14-4] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe) modified nucleotides, in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-O-methyl (2'OMe) modified nucleotides. The nucleic acid molecule or salt thereof, or solvates thereof, described in [1], which may include 0 to 3 nucleotides in which the 2'-O-methyl (2'OMe) modified nucleotides are modified with any group at the 2' position.

[0037] [14-5] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. In the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof. [14-6] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. In the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof.[14-7] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. In the antisense chain, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof. [14-8] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. In the antisense chain, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-O-methyl (2'OMe)-modified nucleotides, and 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, as described in [1], or a salt thereof, or a solvate thereof.

[0038] [14-8-1] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense chain comprises nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23, including a 2'-O-methyl (2'OMe)-modified nucleotide. [14-8-2] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense chain comprises nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23, including a 2'-O-methyl (2'OMe)-modified nucleotide.[14-8-3] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense chain comprises nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23, including a 2'-O-methyl (2'OMe)-modified nucleotide. [14-8-4] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense strand comprises nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3-5, 7, 11-13, 15 and 17-23, including a 2'-O-methyl (2'OMe)-modified nucleotide.

[0039] [14-8-5] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, described in [1], wherein the antisense chain comprises nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23, comprising nucleotides with 2'-O-methyl (2'OMe) modification. [14-8-6] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense strand comprises nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23, including a 2'-O-methyl (2'OMe)-modified nucleotide.[14-8-7] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense chain comprises nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21, including a 2'-O-methyl (2'OMe)-modified nucleotide. [14-8-8] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-deoxy-2'-fluoro-modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-O-methyl (2'OMe)-modified nucleotides. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to [1], wherein the antisense strand comprises nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, including a 2'-deoxy-2'-fluoro-modified nucleotide, and nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21, including a 2'-O-methyl (2'OMe)-modified nucleotide.

[0040] [14-9] A nucleic acid molecule or salt thereof according to any one of [14-1] to [14-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a nucleotide other than a 2'-deoxy-2'-fluoro-modified nucleotide. [14-10] A nucleic acid molecule or salt thereof according to any one of [14-1] to [14-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a 2'-O-methyl (2'OMe)-modified nucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or a thymidine-3'-phosphate. [14-10-1] A nucleic acid molecule or salt thereof according to any one of [14-8-1] to [14-8-8], or a solvate thereof, wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain is a 2'-O-methyl (2'OMe) modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or a thymidine-3'-phosphate. [14-11] A nucleic acid molecule or salt thereof according to any one of [14-1] to [14-8-8], or a solvate thereof, wherein the antisense chain further comprises a 5'-phosphate stabilizing moiety at the 5' end. [14-12] A nucleic acid molecule or salt thereof according to [14-11], or a solvate thereof, wherein the 5'-phosphate stabilizing moiety is a 5'-vinylphosphonate modified nucleotide.

[0041]

[15] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense chain and an antisense chain complementary to the sense chain, wherein the sense chain comprises the sequence of formula I below in the 5'→3' direction of its sequence, and the antisense chain comprises the sequence of formula II-(1) below in the 5'→3' direction of its sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-M Formula II-(1): A1-B1-C1-D1 In formula II-(1), A1 is represented by X-F-M-Y-M-F, and B1 is represented by M-F-F-M, M-M-F-F, M-F-M-F, or M-M-M-M, C1 is represented as M-Y-M-F-M-F, D1 is represented as M-Y-M-Y-M-Y-M, in each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, M is a 2'-O-methyl (2'OMe) modified nucleotide, X is independently a nucleotide modified with any group, Y is independently F or M, and 0 to 3 of the 2'-O-methyl (2'OMe) modified nucleotides may include nucleotides whose 2' position is modified with any group. [15-1] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand and antisense strand each contain 4 phosphorothioate bonds. [15-2] The nucleic acid molecule or salt thereof, or a solvate thereof, according to

[15] , wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence.

[0042]

[16] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F or X-F-M-F-M-F, B2 is represented as M-F-F-M, M-M-F-F, M-F-M-F, or M-M-M-M, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-F-M-M-M-M-M, M-F-M-F-M-M-M, or M-F-M-F-M-F-M, where F is a 2'-deoxy-2'-fluoro modified nucleotide, M is a 2'-O-methyl (2'OMe) modified nucleotide, and X is independently any modified nucleotide.

[0043] [16-1] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 is represented as M-F-F-M or M-M-F-F, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M or M-F-M-M-M-M-M, in each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0044] [16-2] The nucleic acid molecule or a salt thereof, or a solvate thereof, according to

[15] , wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-F-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0045] [16-3] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-F-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0046] [16-4] The nucleic acid molecule or a salt thereof, or a solvate thereof, according to

[15] , wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-M-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0047] [16-5] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-M-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0048] [16-6] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-F-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0049] [16-7] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-F-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0050] [16-8] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-M-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0051] [16-9] The nucleic acid molecule or salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-M-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0052] [16-10] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 is represented as M-F-M-F or M-M-M-M, C2 is represented as M-F-M-F-M-F, D2 is represented as M-F-M-F-M-M-M or M-F-M-F-M-F-M, in each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0053] [16-11] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-M-M-M, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0054] [16-12] The nucleic acid molecule or a salt thereof, or a solvate thereof, according to

[15] , wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-M-M-M, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-F-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0055] [16-13] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-F-M-F, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-M-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0056] [16-14] The nucleic acid molecule or a salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) below in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M Formula II-(2): A2-B2-C2-D2 In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-F-M-F, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-F-M. In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, and M is a 2'-O-methyl (2'OMe) modified nucleotide.

[0057]

[17] The nucleic acid molecule or salt thereof according to

[15] , or a solvate thereof, wherein the sense strand contains the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula III below in the 5'→3' direction of its sequence, the 22nd and 23rd positions being overhang regions, and the antisense strand comprises 10 or fewer 2'-O-methyl (2'OMe) modified nucleotides; Formula I: M-M-M-M-M-M-F-M-F-F-F-M-M-F-M-M-M-M-M-M Formula III: X-F-M-Y-M-F-M-Y-Y-Y-M-Y-M-F-M-F-M-Y-M-Y-M-Y-M In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, M is a 2'-O-methyl (2'OMe) modified nucleotide, X is independently any modified nucleotide, and Y is independently F or M.

[0058] [18-1] A nucleic acid molecule or salt thereof according to any one of

[15] to

[17] , or a solvate thereof, wherein the antisense chain comprises any modified nucleotide other than F. [18-2] A nucleic acid molecule or salt thereof according to any one of

[15] to

[17] , or a solvate thereof, wherein the antisense chain comprises a 2'-O-methyl (2'OMe) modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate.

[0059]

[19] A nucleic acid molecule comprising a sense strand and an antisense strand, or a salt thereof, or a solvate thereof, wherein the sense strand and the antisense strand form a double-stranded region, the sense strand is 21 nucleotides long and contains five 2'-deoxy-2'-fluoro-modified nucleotides, and the antisense strand is 23 nucleotides long and contains seven to eleven 2'-deoxy-2'-fluoro-modified nucleotides, wherein in the sense strand, the nucleotide at position 15 in the 5'→3' direction of its sequence is represented by F, and in the antisense strand, the nucleotide at position 7 in the 5'→3' direction of its sequence is represented by M, where F is a 2'-deoxy-2'-fluoro-modified nucleotide, and M is a 2'-O-methyl (2'OMe)-modified nucleotide, wherein 0 to 3 of the 2'-O-methyl (2'OMe)-modified nucleotides may include nucleotides in which the 2' position is modified with any group, and positions 1 and 21 of the sense strand and positions 21 and 1 of the antisense strand are complementary, Nucleic acid molecules or their salts, or solvates thereof.

[0060] [19-1] The nucleic acid molecule or salt thereof according to

[19] , or a solvate thereof, wherein in the antisense strand, the nucleotides at positions 6 to 8 in the 5'→3' direction of the sequence are represented as F-M-M or F-M-F. [19-2] The nucleic acid molecule or salt thereof according to

[19] , or a solvate thereof, wherein in the sense strand, the nucleotides at positions 14 to 18 in the 5'→3' direction of the sequence are represented as M-F-M-M-M, and in the antisense strand, the nucleotides at positions 6 to 8 in the 5'→3' direction of the sequence are represented as F-M-M or F-M-F. [19-3] The nucleic acid molecule or salt thereof according to

[19] , or a solvate thereof, wherein in the sense strand, the nucleotides at positions 13 to 20 in the 5'→3' direction of its sequence are represented as M-M-F-M-M-M-M-M, and in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of its sequence are represented as F-M-M-F-M-M-F, F-M-M-F-M-F-F, F-M-F-M-F-M-M-M, or F-M-F-M-F-M-F-M.

[0061] [19-3-1] The nucleic acid molecule or a salt thereof according to [19-3], or a solvate thereof, wherein in the antisense chain, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-M-F-M-M-F, and the antisense chain contains seven 2'-deoxy-2'-fluoro-modified nucleotides. [19-3-2] The nucleic acid molecule or a salt thereof according to [19-3], or a solvate thereof, wherein in the antisense chain, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-M-F-M-F-F, and the antisense chain contains seven 2'-deoxy-2'-fluoro-modified nucleotides. [19-3-3] The nucleic acid molecule or salt thereof according to [19-3], or a solvate thereof, wherein in the antisense chain, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-F-M-F-M-M-M, and the antisense chain contains 8 or 9 2'-deoxy-2'-fluoro-modified nucleotides. [19-3-4] The nucleic acid molecule or salt thereof according to [19-3], or a solvate thereof, wherein in the antisense chain, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-F-M-F-M-F-M, and the antisense chain contains 10 or 11 2'-deoxy-2'-fluoro-modified nucleotides.

[0062] [20-1] A nucleic acid molecule or salt thereof according to any of [6-4-1] to [6-4-12], [7-1] to [7-12], [8-2-1] to [8-2-12], [9] to [9-1],

[15] to [19-3-4], or a solvate thereof, wherein the nucleotide modified at the 2' position with any group is independently a 2'-deoxyribonucleotide or a 2'-O-alkyl-modified nucleotide (for example, including a 2'-O-alkyl-modified nucleotide in which the alkyl is an alkyl group of the carbon chain C1-18). [20-2] A nucleic acid molecule or salt thereof according to any of [6-4-1] to [6-4-12], [7-1] to [7-12], [8-2-1] to [8-2-12], [9] to [9-1],

[15] to [19-3-4], or a solvate thereof. [20-2-1] A nucleic acid molecule or salt thereof according to [20-2], or a solvate thereof, wherein the nucleotide having a 2' position modified with an arbitrary group present in the sense chain is independently a 2'-O-alkyl modified nucleotide (for example, a 2'-O-alkyl modified nucleotide in which the alkyl is an alkyl group of the carbon chain C1-18). [20-3] A nucleic acid molecule or salt thereof according to any of [6-4-1] to [6-4-12], [7-1] to [7-12], [8-2-1] to [8-2-12], [9] to [9-1],

[15] to [19-3-4], or a solvate thereof, wherein the nucleotide having its 2' position modified with any group present in the antisense chain is independently a 2'-deoxyribonucleotide, according to [20-3], or a salt thereof, or a solvate thereof. [20-4] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any of [6-4-1] to [6-4-12], [7-1] to [7-12], [8-2-1] to [8-2-12], [9] to [9-1], or

[15] to [19-3-4], wherein there are zero nucleotides in which the 2' position is modified with any group.

[0063] A nucleic acid molecule or a salt thereof, or a solvate thereof, which can inhibit the expression of a target protein or a target gene and contains a sense strand and an antisense strand, wherein the sense strand has a length of 21 nucleotides, the antisense strand has a length of 21, 22 or 23 nucleotides, the sense strand contains 2'-deoxy-2'-fluoro modified nucleotides and modified nucleotides, the 2'-deoxy-2'-fluoro modified nucleotides are located at positions 7, 9, 10, 11, and 15 from the 5'-end of the sense strand, and the modified nucleotides are independently such that the 2'-position of the nucleotide is 2'-OR １ , 2'-R １ , 2'-R ２ OR １ , 2'-SH, 2'-SR １ , 2'-NH ２ , 2'-NHR 1 , 2'-NHAc, 2'-NR １ ２ , 2'-N ３ , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R ２ C(O)XR ３ (In each group, R １ is alkyl or aryl; R ２ is alkylene; X is an oxygen atom, NH or NR １ ; R ３A nucleic acid molecule or salt thereof, or a solvate thereof, comprising a nucleotide, deoxynucleotide, or bicyclic sugar substituted with a group selected from the group consisting of (where is alkyl). [21-1] The nucleic acid molecule or salt thereof, or a solvate thereof, according to

[21] , wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the sense strand are 2'-O-alkyl modified nucleotides. [21-2] The nucleic acid molecule or salt thereof, or a solvate thereof, according to

[21] , wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the sense strand are 2'-O-methyl (2'OMe) modified nucleotides. [21-3] The sense strand and the antisense strand each have a double-stranded region with a blunt end at the 3' end of the sense strand, wherein, when the antisense strand is 21 nucleotides long, the sequence of formula IV-(1-1) is as follows in the 5'→3' direction of the antisense strand; when the antisense strand is 22 nucleotides long, the sequence of formula IV-(1-2) is as follows in the 5'→3' direction of the antisense strand; and when the antisense strand is 23 nucleotides long, the sequence of formula IV-(1-3) is as follows in the 5'→3' direction of the antisense strand; the nucleic acid molecule or a salt thereof according to claim 1, or a solvate thereof; Formula IV-(1-1): (5')Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z(3') Formula IV-(1-2): (5')Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'(3') Formula IV-(1-3): (5')Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z'-Z-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'(3') In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, Z' and Z are modified nucleotides, and Z' independently has a 2'-OR at the 2' position of the nucleotide １ , 2'-R １ , 2'-R ２ OR １ , 2'-SH, 2'-SR １ , 2'-NH２ , 2'-NHR 1 , 2'-NHAc, 2'-NR １ ２ , 2'- N ３ , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R ２ C (O)XR ３ (In each group, R １ R is alkyl or aryl; ２ is an alkylene; X is an oxygen atom, NH or NR １ And; R ３ A modified nucleotide comprising a nucleotide, deoxynucleotide, or bicyclic sugar substituted with a group selected from the group consisting of (where is alkyl), wherein Z is independently the 2' position of the nucleotide is 2'-OR １ , 2'-R １ , 2'-R ２ OR １ , 2'-SH, 2'-SR １ , 2'-NH ２ , 2'-NHR 1 , 2'-NHAc, 2'-NR １ ２ , 2'- N ３ , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R ２ C (O)XR ３ (In each group, R １ R is alkyl or aryl; ２ is an alkylene; X is an oxygen atom, NH or NR １ And; R ３A modified nucleotide comprising a nucleotide, deoxynucleotide, or bicyclic sugar substituted with a group selected from the group consisting of (where is alkyl). [21-3-1] The sense strand and antisense strand are complementary at positions 1-8, 2-8, 3-8, 4-8, 5-8, 6-8, or 7-8, according to [21-3], the nucleic acid molecule or salt thereof, or solvates thereof: position 1 from the 3' end of the sense strand and position 1 from the 5' end of the antisense strand; position 2 from the 3' end of the sense strand and position 2 from the 5' end of the antisense strand; position 3 from the 3' end of the sense strand and position 3 from the 5' end of the antisense strand; position 4 from the 3' end of the sense strand and position 4 from the 5' end of the antisense strand; position 5 from the 3' end of the sense strand and position 5 from the 5' end of the antisense strand; position 6 from the 3' end of the sense strand and position 6 from the 5' end of the antisense strand; position 7 from the 3' end of the sense strand and position 7 from the 5' end of the antisense strand; position 8 from the 3' end of the sense strand and position 8 from the 5' end of the antisense strand. [21-4] A nucleic acid molecule or a salt thereof according to [21-3], or a solvate thereof, wherein the Z' at position 12 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [21-5] A nucleic acid molecule or a salt thereof according to [21-3], or a solvate thereof, wherein the Z' at positions 9 and 10 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [21-6] A nucleic acid molecule or a salt thereof according to [21-3], or a solvate thereof, wherein the Z' at positions 8 and 9 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [21-7] A nucleic acid molecule or a salt thereof according to [21-3], or a solvate thereof, wherein the Z' at positions 8, 9 and 10 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [21-8] The above Z' is a dehydronucleotide, or a nucleotide whose 2' position is 2'-OR １ A nucleotide modified with a group selected from the group consisting of , and 2'-F, wherein Z is a dehydronucleotide, or the 2' position of the nucleotide is 2'-OR １A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of [21-3] to [21-7], which is a nucleotide modified with . [21-9] The antisense strand comprises a sequence represented by any one of the following formulas IV-(2-1) to (2-3) in its 5'→3' direction, according to any one of [21-3] to [21-8], a nucleic acid molecule or salt thereof, or a solvate thereof; Formula IV-(2-1): (5')Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z(3') Formula IV-(2-2): (5')Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z(3') Formula IV-(2-3): (5')Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-Z(3') [21-10] The antisense strand comprises the sequence of Formula IV-(3-1) to (3-3) below in the 5'→3' direction of its sequence, as a nucleic acid molecule or salt thereof, or a solvate thereof, as described in any of [21-3] to [21-8]; Formula IV-(3-1): (5')Z-F-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-F-Z-Z-Z-Z(3') Formula IV-(3-2): (5')Z-F-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-Z-Z-Z(3') Formula IV-(3-3): (5')Z-F-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-Z(3') [21-11] The antisense strand contains the sequence of Formula IV-(4-1) to (4-3) below in the 5'→3' direction of its sequence, and is a nucleic acid molecule or a salt thereof, or a solvate thereof, as described in any of [21-3] to [21-8];Formula IV-(4-1): (5') Z-F-Z-Z-Z-F-Z-Z-F-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z (3') Formula IV-(4-2): (5') Z-F-Z-Z-Z-F-Z-Z-F-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z (3') Formula IV-(4-3): (5') Z-F-Z-Z-Z-F-Z-Z-F-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z (3') [21-12] The antisense strand contains sequences of the following formulas IV-(5-1) to (5-3) in the 5'→3' direction of the sequence, [21-3] to [21-8], the nucleic acid molecule or a salt thereof, or a solvate thereof; Formula IV-(5-1): (5') Z-F-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-F-Z-F-Z-Z-Z-Z-Z (3') Formula IV-(5-2): (5') Z-F-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-F-Z-F-Z-Z-Z-Z-Z-Z (3') Formula IV-(5-3): (5') Z-F-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z (3') [21-13] The antisense chain contains the sequence of formulas IV-(6-1) to (6-3) below in the 5'→3' direction of its sequence, such that the nucleic acid molecule or salt thereof, or a solvate thereof, is one of those described in any of [21-3] to [21-8]; Formula IV-(6-1): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3') Formula IV-(6-2): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F(3') Formula IV-(6-3): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3') [21-14] The antisense strand comprises the sequence of Formula IV-(7-1) to (7-3) in the 5'→3' direction of its sequence, a nucleic acid molecule or salt thereof, or a solvate thereof, as described in any of [21-3] to [21-8];Formula IV-(7-1): (5') Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z (3') Formula IV-(7-2): (5') Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F (3') Formula IV-(7-3): (5') Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z (3') [21-15] The antisense chain includes the following sequences of Formula IV-(8-1) to (8-3) in the 5'→3' direction of its arrangement, A nucleic acid molecule or a salt thereof, or a solvate thereof, as described in any of [21-3] to [21-8]; Formula IV-(8-1): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3') Formula IV-(8-2): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z(3') Formula IV-(8-3): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-F-Z-Z(3') [21-16] The antisense strand contains the sequence of formula IV-(9-1) to (9-3) in the 5'→3' direction of its sequence, and is a nucleic acid molecule or salt thereof, or a solvate thereof, as described in any of [21-3] to [21-8];Formula IV-(9-1): (5') Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z (3') Formula IV-(9-2): (5') Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z (3') Formula IV-(9-3): (5') Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z (3') [21-16-1] A nucleic acid molecule or salt thereof according to any one of [21-3] to [21-8], or a solvate thereof, wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the antisense chain are 2'-O-alkyl modified nucleotides. [21-16-2] A nucleic acid molecule or salt thereof according to any one of [21-3] to [21-8], or a solvate thereof, wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the antisense chain are 2'-O-methyl (2'OMe) modified nucleotides. [21-17] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of

[21] to [21-16-2], wherein the modified nucleotide comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds. [21-18] A phosphate group (P(O)(OH)) is attached to the hydroxyl groups at the 3' and / or 5' positions of the nucleotides at the 3' and / or 5' terminals of the sense strand and / or antisense strand; ２ ) or thiophosphate group (P(S)(OH) ２

[21] to [21-17], a nucleic acid molecule or salt thereof, or a solvate thereof, comprising a nucleotide substituted with ) [21-19], wherein the nucleotide at position 1 from the 5' and / or 3' ends of the sense strand and / or antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or a thymidine-3'-phosphate, according to any one of

[21] to [21-18], or a solvate thereof. [21-20] A nucleic acid molecule or salt thereof, or a solvate thereof, wherein a functional molecule, a debasalized nucleotide (invAb), a nucleotide, a modified nucleotide, or a combination thereof is bound to the nucleotide at the 5' or 3' end of the sense strand and / or antisense strand of the nucleic acid molecule according to any one of

[21] to [21-19]. [21-20-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, wherein one or two functional molecules are bonded to the nucleotides at the 5' and / or 3' ends of the antisense strand of the nucleic acid molecule described in any of

[21] to [21-19] above. [21-20-1-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, wherein one or two functional molecules are bonded to the nucleotides at the 5' and / or 3' ends of the sense strand of the nucleic acid molecule described in any of

[21] to [21-19] above. [21-20-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, wherein one to ten, one to eight, one to five, one to four, one to three, one to two, or one debasalized nucleotide is bonded to the nucleotides at the 5' and / or 3' ends of the sense strand of the nucleic acid molecule described in any of

[21] to [21-19] above. [21-20-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, wherein nucleotides are bonded to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule described in any of

[21] to [21-19] above, in the order of

[21] to [21-19]] to [21-19], in the order of

[21] to

[21] to [21-19], in the order of

[21] to

[21] to [21-19], in the order of

[21] to

[21] to [21-19], in the order of

[21] to

[21] to [21-[21-20-4] A nucleic acid molecule or a salt thereof, or a solvate thereof, wherein the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule described in any of

[21] to [21-19] are bonded in units of 1 to 10, 1 to 8, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 modified nucleotide. [21-20-4-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, described in any of [21-20] to [21-20-4], wherein the sense strand and / or antisense strand comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds. [21-20-4-2] A phosphate group (P(O)(OH)) is attached to the hydroxyl groups at the 3' and / or 5' positions of the nucleotides at the 3' and / or 5' ends of the sense strand and / or antisense strand. ２ ) or thiophosphate group (P(S)(OH) ２ A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of [21-20] to [21-20-4-1], comprising a nucleotide substituted with ). [21-20-4-3] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of [21-20] to [21-20-4-2], wherein the nucleotide at position 1 from the 5' end and / or 3' end of the sense strand and / or antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate.

[0064]

[22] A nucleic acid molecule or a salt thereof according to any one of [1] to [21-20-4-3], wherein the nucleic acid molecule is siRNA, or a solvate thereof.

[23] A pharmaceutical composition comprising a nucleic acid molecule or a salt thereof according to any one of [1] to

[22] , or a solvate thereof, and a pharmaceutically acceptable carrier.

[0065] The present invention provides nucleic acid molecules or salts thereof, or solvates thereof, which are less susceptible to degradation in vivo due to modification and have high stability, and a pharmaceutical composition containing one or more thereof. Furthermore, the present invention provides nucleic acid molecules or salts thereof, or solvates thereof, which have or have improved inhibitory activity against the expression of target proteins or target genes, and a pharmaceutical composition containing one or more thereof.

[0066] Due to the characteristics described above, the nucleic acid molecules of the present invention may be useful in preventing or treating various diseases and symptoms in humans or non-human mammals in which various targets are presumed to be involved.

[0067] The embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described below, and can be implemented in any form without departing from the spirit of the invention. Furthermore, preferred and more preferred embodiments exemplified below can be combined with each other as appropriate, regardless of expressions such as "for example," "preferred," and "more preferred." In addition, the numerical ranges are described as examples, and the upper or lower limits of each range can be combined with the numerical values ​​described in the examples as appropriate.

[0068] Definitions: "Nucleic acid" refers to a molecule composed of monomeric nucleotides. "Nucleic acid molecule" is not particularly limited, but may include, for example, oligonucleotides, ASOs, siRNA, shRNA, miRNA, single-stranded nucleic acid molecules, double-stranded nucleic acid molecules, RNA, DNA, etc. Preferably, it is siRNA. "Target protein" refers to a protein whose regulation is desired.

[0069] A "target gene" (sometimes called a "target sequence") refers to a gene that can be targeted by a nucleic acid molecule.

[0070] "Target segment" refers to the nucleotide sequence of a target gene that is targeted by the nucleic acid molecule of the present invention.

[0071] "Nucleic acid base sequence" refers to a continuous sequence of nucleic acid bases independent of any sugar moiety, binding site, or modified nucleic acid base. "Nucleoside" refers to a compound in which a nucleic acid base and a sugar moiety are bonded. "Ribonucleoside" refers to a nucleoside in which the sugar moiety is ribose. "Deoxyribonucleoside" refers to a nucleoside in which the sugar moiety is D-2-deoxyribose. "Nucleotide" refers to a compound in which n is bonded to the sugar moiety of a nucleoside. "Oligononucleotide" refers to a compound having a structure in which nucleotides are polymerized by phosphodiester bonds or modified phosphodiester bonds. Naturally occurring oligonucleotides include, for example, 2'-deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and oligonucleotides in which the sugar moiety, phosphate moiety, or nucleic acid base moiety are modified independently of each other.

[0072] RNA interference (RNAi) refers to sequence-specific post-transcriptional gene silencing in animals mediated by small interfering RNA (siRNA). It has been reported that intracellular RNAi responses are induced by double-stranded RNA (dsRNA). Certain intracellular dsRNAs are affected by the enzymes Dicer and ribonuclease III. Dicer can cleave dsRNA into short fragments, producing siRNA.

[0073] siRNA is known to be involved in the endonuclease complex, which is part of the RNA-induced silencing complex (RISC). siRNA possesses an AS (also called the guide strand) that is incorporated into the RISC, and this AS mediates the cleavage of target mRNA with a complementary sequence. The other strand of the AS in siRNA is called the SS (also called the passenger strand). Cleavage of the target gene occurs near the region complementary to the AS of the siRNA. siRNA has been reported to downregulate or knock down gene expression by mediating sequence-specific RNA interference.

[0074] A "double-stranded region (dsRNA)" refers to a region having a double-stranded structure containing two complementary, antiparallel nucleic acid strands (sense strand / antisense strand). In this specification, a portion of a double-stranded region may contain zero or more, one or less, two or less, three or less, or four or less mismatched bases.

[0075] The "sense strand" (sometimes abbreviated as SS) refers to the nucleotide sequence of a nucleic acid molecule (for example, siRNA; the same applies to the following explanation of "nucleic acid molecule") that is partially or completely complementary to at least a portion of the corresponding antisense strand. The sense strand of a nucleic acid molecule may include a nucleic acid sequence that has homology to the base sequence of the target gene.

[0076] An "antisense strand (sometimes abbreviated as AS)" refers to a nucleotide sequence of a nucleic acid molecule that is partially or completely complementary to at least a portion of the base sequence of the target gene. The antisense strand of a nucleic acid molecule may include a nucleic acid sequence that is at least partially or completely complementary to the corresponding sense strand of the nucleic acid molecule. If the complementary region is not completely complementary to the target sequence ("mismatch"), such mismatch may be located, for example, within the 10, 9, 8, 7, 6, 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.

[0077] "Complementarity" refers to the ability of an oligonucleotide or polynucleotide containing a second nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing a first nucleotide sequence to form a double-stranded structure under specific conditions (specifically, stringent conditions). Examples include the ability to form base pairs (hybridization) between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the corresponding nucleic acid bases in a target gene, and the ability to form base pairs between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the nucleic acid bases of the sense strand. Base pairs are formed by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between corresponding nucleic acid bases. Methods for determining whether the antisense strand and sense strand of a nucleic acid molecule, or the antisense strand of a nucleic acid molecule and a target gene, are specifically capable of hybridization are well known in the art. "Complementarity" is sometimes also called "base complementarity."

[0078] "Complementary" nucleotide sequences may include base pairs formed from non-Watson-Crick base pairs, non-natural and modified nucleotides, as long as the requirements for hybridization are met. Examples of such non-Watson-Crick base pairs include, but are not limited to, G-U fluctuations and Hoogsteen-type base pairs.

[0079] The "subject" may include, but is not limited to, humans, non-human mammals (e.g., dogs, cats, rats, mice, rabbits, monkeys, chimpanzees, cows, horses, pigs, sheep, goats, etc.), birds (e.g., chickens), etc. The "subject" is preferably humans.

[0080] A "mismatched base (non-complementary nucleic acid base)" refers to a nucleic acid base in a first nucleic acid that cannot pair with the corresponding nucleic acid base in a second nucleic acid or target gene. Introducing a mismatched base into the antisense strand of a nucleic acid molecule includes: (i) some nucleic acid bases in the antisense strand are replaced with nucleic acid bases that cannot pair with the target gene; (ii) some nucleic acid bases in the antisense strand contain nucleic acid bases that cannot pair with the target gene, increasing the length of the consecutive nucleotide by that amount (insertion); and (iii) in the complementary portion of the antisense strand and the target gene, the oligonucleotides of the antisense strand lack nucleic acid bases that can pair with the target gene, reducing the length of the consecutive nucleotide by that amount (deletion).

[0081] The term "equal-length portion" refers to the region where the antisense strand of a nucleic acid molecule and the corresponding nucleic acid base of the target gene hybridize. If the mismatched base described above is not introduced into the antisense strand of siRNA, the length (number of nucleosides) of the nucleotides in the antisense strand and the target segment are the same. If the mismatched base described in (i) above is introduced into the antisense strand of a nucleic acid molecule, the length (number of nucleosides) of the nucleotides in the antisense strand and the target segment are the same. If the insertion described in (ii) above is introduced into the antisense strand of a nucleic acid molecule, the equal-length portion of the target gene is shorter than the nucleotides in the antisense strand by the amount of the insertion base (also referred to as having a reduced number of nucleosides). If the deletion described in (iii) above is introduced into the antisense strand of a nucleic acid molecule, the equal-length portion of the target gene is longer than the nucleotides in the antisense strand by the amount of the deletion base (also referred to as having an increased number of nucleosides).

[0082] "Expression" may refer to gene expression or target protein expression. The presence or level of such expression can be measured by the methods described in the examples of this specification, or by methods known to those skilled in the art. Expression includes all functions by which the information encoded by a gene is converted into structures that exist and function within the cell. Such structures may include, but are not limited to, the products of transcription and translation.

[0083] "Inhibition" means that a certain event is reduced compared to a control condition. For example, it means that the level of gene expression or mRNA encoding one or more proteins, or the activity of one or more encoded proteins, measured in the presence of nucleic acid molecules, is lower than the activity measured in the absence of nucleic acid molecules.

[0084] For example, the level of expression, mRNA level, or encoded protein activity level is reduced by at least approximately 5%, at least approximately 10%, at least approximately 30%, at least approximately 50%, at least approximately 70%, at least approximately 90%, and at least approximately 95% compared to the activity level observed in the absence of the nucleic acid molecule. Note that "inhibit" can also be expressed as "suppress" or "downregulate."

[0085] When describing a product as "inhibiting the expression of a target gene," it may also include "inhibiting the expression of a target protein." Conversely, it may also include the reverse.

[0086] The nucleic acid molecule of the present invention is a compound capable of regulating the expression of a target protein or target gene.

[0087] "Regulation of expression" refers to the ability of an oligonucleotide to alter the amount of a target protein or target gene compared to the amount of the target protein or target gene before administration of the nucleic acid molecule. Regulation of expression is determined by comparison with a control. One form of "regulation" is understood as the ability of an oligonucleotide to inhibit, downregulate, reduce, suppress, remove, stop, block, prevent, decrease, reduce, avoid, or terminate the expression of a target protein, for example, by degrading the mRNA of the target gene or blocking the translation.

[0088] "Modified nucleotides" refer to nucleotides having modifications to the sugar group of a nucleotide, modifications to the internucleoside bond, modifications to the nucleic acid base of a nucleotide, and / or modifications to the structure of one or more nucleotides at the end of a nucleic acid molecule, or combinations thereof. "Modification of sugar group" refers to substitution, conversion, etc., from the natural sugar portion.

[0089] A "modified oligonucleotide" refers to an oligonucleotide containing at least one modified nucleoside bond, modified sugar, modified nucleic acid base, etc.

[0090] A nucleotide is a nucleoside containing a phosphate group covalently bonded to the sugar portion of the nucleoside. In nucleosides containing pentofuranosyl sugars, the phosphate group can be bonded to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed through covalent bonds between adjacent nucleosides, forming linear polymer oligonucleotides. Within the oligonucleotide structure, the phosphate group typically forms internucleoside bonds. "Internucleoside bond" refers to a chemical bond between nucleosides. The natural internucleoside bond in RNA or DNA is a 3'-to-5' phosphodiester bond. Oligonucleotides having one or more modified internucleoside bonds may be used to obtain desirable properties such as high intracellular uptake, high affinity for target genes, and high stability in the presence of nucleases.

[0091] "Effective dose" refers to the amount of siRNA that is effective in achieving the desired pharmacological, prophylactic, therapeutic, or inhibitory effect.

[0092] "Pharmacologically acceptable carrier" refers to a carrier for administering a prophylactic or therapeutic drug.

[0093] Unless otherwise specified, "improvement" means a change in the symptoms or condition of a disease, prevention or delay of the worsening of symptoms or condition, reversal, prevention or delay of the progression of symptoms, or treatment of the disease.

[0094] Unless otherwise specified, "prevention" means preventing or delaying the onset of a disease in the subject, or reducing the risk of developing a disease.

[0095] Unless otherwise specified, "treatment" refers to any treatment of the disease in the subject (e.g., improvement of the disease, reduction of the disease, recovery from the disease, alleviation of the disease, suppression of the disease's progression, etc.). It may also include preventing the onset and / or progression of the disease in the subject.

[0096] The term "approximately" may include values ​​up to ±20% of the given value, preferably up to ±10%. For example, when stating "the expression of the target protein or target gene was inhibited by approximately 80%", the level of inhibition may include inhibition within the range of 64% to 96%, preferably within the range of 72% to 88%.

[0097] "Substantially" means that the scope or degree of what is being covered is complete or nearly complete. For example, "substantially all" means 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0098] In this specification, "alkyl" means a linear or branched alkyl group having 1 to 30 carbon atoms, and may be expressed as "C1-30 alkyl". "C1-25 alkyl" means an alkyl group having 1 to 25 carbon atoms, "C1-20 alkyl" means an alkyl group having 1 to 20 carbon atoms, "C1-18 alkyl" means an alkyl group having 1 to 18 carbon atoms, "C1-16 alkyl" means an alkyl group having 1 to 16 carbon atoms, "C1-15 alkyl" means an alkyl group having 1 to 15 carbon atoms, "C1-10 alkyl" means an alkyl group having 1 to 10 carbon atoms, and "C1-6 alkyl" means an alkyl group having 1 to 6 carbon atoms. The alkyl group is preferably a "C1-16 alkyl group," and specifically, examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, isohexyl, heptyl (C7), octyl (C8), nonyl (C9), decyl (C10), undecyl (C11), dodecyl (C12), tridecyl (C13), tetradecyl (C14), pentadecyl (C15), hexadecyl (C16), etc. The alkyl group may be substituted with, for example, one to three halogen atoms, alkoxy, cyano, nitro, etc.

[0099] In this specification, "alkylene" means a group represented by the formula -(CH2)n- (for example, n = 1 to 30). "C2-30 alkylene" means alkylene with n = 2 to 30, "C2-25 alkylene" means alkylene with n = 2 to 25, "C2-20 alkylene" means alkylene with n = 2 to 20, "C2-18 alkylene" means alkylene with n = 2 to 18, "C2-16 alkylene" means alkylene with n = 2 to 16, "C2-10 alkylene" means alkylene with n = 2 to 10, "C2-6 alkylene" means alkylene with n = 2 to 6, and "C2-3 alkylene" means alkylene with n = 2 to 3. The alkylene is preferably a "C1-16 alkylene," specifically, for example, methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-(ethyl)trimethylene, 1-(methyl)tetramethylene, heptylene, octylene, nonylene, decylene, undecylene, dodecylene, tridecylene, tetradecylene, pentadecylene, etc. The hydrogen atoms of the alkylene may be substituted in groups of 1 to 3, for example, with halogen atoms, alkoxy, cyano, nitro, etc. "Aryl" means an aryl group having 6 to 10 carbon atoms. Specifically, for example, phenyl, α-naphthyl, and β-naphthyl are examples, preferably phenyl. The aryl group may be substituted in groups of 1 to 3, for example, with halogen atoms, alkyl, alkoxy, cyano, nitro, etc.

[0100] "5'-vinylphosphonate modified nucleotide" is a nucleotide with -CH at the 4' position. ２ The OH group is -CH=CH-P(O)(OH) ２This refers to a modified nucleotide with a substitution at the base. Furthermore, "2'-acetamide-5'-vinylphosphonate modified nucleotide" refers to a modified nucleotide where the substituent at the 2' position of "5'-vinylphosphonate modified nucleotide" is 2'-NHAc. "5'-phosphorus stabilization moiety" refers to a nucleotide structure in which a phosphate residue containing a phosphate ester or modified phosphate ester (e.g., phosphorothioate, phosphodiester, etc.) is substituted at the 5' end. An example of the structure of the 5'-phosphorus stabilization moiety is shown in the following formula: Examples of substructures represented by the formula [wherein Base represents a nucleic acid base; X represents any substituent; Y represents a hydrogen atom, alkyl group, hydroxyl group protecting group, etc.] (excluding the dashed line and the part to the right of the dashed line) are, but are not limited to, these.

[0101] In the specification, the "~" symbol, which indicates a range of values, means that the range includes the upper and lower limits of the numerical range, as well as the values ​​between the upper and lower limits. For example, if it is written as "1 to 8", it means that the numerical range includes the values ​​1, 2, 3, 4, 5, 6, 7, and 8, and that any value can be selected from these values ​​as appropriate.

[0102] 1. Nucleic Acid Molecules The nucleic acid molecules of the present invention have inhibitory activity against the expression of a target protein or target gene and contain a nucleic acid base sequence complementary to the gene encoding the target protein. Furthermore, the nucleic acid molecules of the present invention can downregulate the expression of the gene encoding the target protein. Furthermore, the nucleic acid molecules of the present invention contain a nucleotide sequence that can mediate the silencing of the gene expression of the target gene. In some embodiments, a nucleic acid molecule comprising a sense strand and an antisense strand has a sense strand of 21 nucleotides in length and an antisense strand of 21, 22, 23 or less nucleotides in length. In some embodiments, the nucleic acid molecule of the present invention has a double-stranded region (dsRNA) of 21 nucleotides in length and includes a 21-nucleotide antisense strand and a 21-nucleotide sense strand. In some embodiments, the nucleic acid molecule of the present invention has a double-stranded region (dsRNA) of 21 nucleotides in length and includes a 22-nucleotide antisense strand and a 21-nucleotide sense strand. In some embodiments, the nucleic acid molecule of the present invention has a double-stranded region (dsRNA) of 21 nucleotides in length, comprising a 23-nucleotide antisense strand and a 21-nucleotide sense strand. One embodiment of the nucleic acid molecule of the present invention is siRNA, and the description of nucleic acid molecules herein also applies to siRNA.

[0103] In some embodiments, the double-stranded region of the nucleic acid molecule of the present invention may contain 17 or more, 18 or more, 19 or more, 20 or more, 21 or more; 21 or less, 20 or less, 19 or less; or 19, 20, 21 base pairs.

[0104] Generally, the majority of nucleotides in the sense and antisense strands are ribonucleotides, but in some embodiments of the present invention, one or both of these strands may contain at least one non-ribonucleotide, such as a deoxyribonucleotide and / or a modified nucleotide.

[0105] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 19 to 23 nucleotides in length of antisense strands in its double-stranded region, which is complementary to the sequence of the gene encoding the target protein.

[0106] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 19 to 23 nucleotides in length of antisense strand that is complementary to the sequence of the gene encoding the target protein.

[0107] In some embodiments, the nucleic acid molecule of the present invention comprises a sensor strand of 21 nucleotides and an antisense strand of 23 nucleotides, and includes a double-stranded region of 21 nucleotides. This double-stranded region may have a region of the antisense strand with a length of 19 to 23 nucleotides that is complementary to the sequence of the gene encoding the target protein.

[0108] In some embodiments, the nucleic acid molecule of the present invention comprises a sense strand selected from the sequences shown in Tables 1 to 39, or 19, 20, or 21 nucleotide fragments thereof, and an antisense strand selected from the sequences shown in Tables 1 to 39, or 19, 20, 21, 22, or 23 nucleotide fragments thereof.

[0109] The nucleic acid molecule of the present invention may include one or more overhangs in the double-stranded region formed from the antisense strand and the sense strand. An overhang is a single-stranded region in which no base pairs are formed. In some embodiments, the length of the overhang may be, for example, 1 to 8 nucleotide lengths, 1 to 5 nucleotide lengths, 1 to 3 nucleotide lengths, or 1 to 2 nucleotide lengths. The overhang may be a 3' or 5' terminal overhang where the 3' or 5' end of the antisense strand or sense strand has a single-stranded region of, for example, 1 to 8 nucleotide lengths, 1 to 5 nucleotide lengths, 1 to 3 nucleotide lengths, or 1 to 2 nucleotide lengths. Furthermore, the lengths of each overhang may be the same or different.

[0110] The nucleic acid molecule of the present invention may have one or more blunt ends, where the double-stranded region ends without an overhang, and the antisense and sense strands base-pair to the ends of the double-stranded region. The nucleic acid molecule of the present invention may have one or more blunt ends, or one or more overhangs, or a combination of blunt ends and overhangs. For example, the nucleic acid molecule of the present invention may have a blunt end at the 5' end of the antisense strand (the 3' end of the sense strand).

[0111] The nucleic acid molecule of the present invention may have additional nucleotides attached to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand, in relation to the nucleic acid sequence having the chemical modification pattern described later. Such nucleotides may be attached to the sense strand and / or antisense strand independently in the form of 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 8, or 1 to 10 nucleotides. The nucleic acid molecule of the present invention may have additional nucleotides attached to form new blunt ends or to add or extend overhangs.

[0112] The nucleic acid molecule of the present invention may have further modified nucleotides attached to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand, in addition to the nucleic acid sequence having the chemical modification pattern described later. Such modified nucleotides may be attached to the sense strand and / or antisense strand independently in the form of 1 to 2, 1 to 3, 1 to 5, 1 to 8, or 1 to 10 nucleotides. The nucleic acid molecule of the present invention may have further nucleotides attached to form new blunt ends or to add or extend overhangs.

[0113] The nucleic acid molecule of the present invention may have further combinations of nucleotides and / or modified nucleotides attached to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand, respectively, in addition to the nucleic acid sequence having the chemical modification pattern described later. Such combinations may be attached to the sense strand and / or antisense strand independently in quantities of 1 to 2, 1 to 3, 1 to 5, 1 to 8, or 1 to 10.

[0114] The nucleic acid molecule of the present invention is a compound that, when administered to a target, can inhibit the expression of a target protein or the expression of a gene encoding a target protein in the target cells, tissues, organs, etc. Therefore, as a result of administration, the expression of the target protein in the target cells, tissues, organs, etc. can be inhibited, thereby inhibiting the action of said protein.

[0115] In some embodiments, the nucleic acid base sequence of the antisense strand of the nucleic acid molecule of the present invention has complementarity to the isolength portion of the gene encoding the target protein (e.g., the mRNA sequences shown in SEQ ID NOs. 444-450) of, for example, at least 80%, at least 85%, at least 90%, at least 95%, or 100%; preferably at least 85%, at least 90%, at least 95%, or 100%; more preferably at least 90%, at least 95%, or 100%.

[0116] The antisense or sense strand of a nucleic acid molecule can have its continuous nucleotide length increased or decreased, and it is also possible to introduce mismatched bases (non-complementary nucleic acid bases) while maintaining activity.

[0117] In some embodiments, the nucleic acid molecules of the present invention can inhibit the expression of a target gene by, for example, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, and about 95% or more. The degree of inhibition of target gene expression can be considered as the inhibition rate of target protein expression.

[0118] In some embodiments, the nucleic acid molecule of the present invention is, for example, a highly active IC at less than about 1000 pM, less than about 500 pM, less than about 300 pM, or less than about 100 pM. ５０ It possesses a value that can inhibit the expression of target genes.

[0119] The target protein may be derived from any species. Examples of species include humans or non-human mammals (dogs, cats, rats, mice, monkeys, cattle, horses, pigs, sheep, etc.), preferably humans or non-human mammals (rats or mice), and more preferably humans.

[0120] 2. Chemical Modification The antisense strand and sense strand of the nucleic acid molecule of the present invention may each independently contain at least one modified nucleotide (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23). Such modifications may yield properties such as increased gene silencing activity and potency. Specifically, it may be possible to obtain nucleic acid molecules with excellent serum stability without loss of siRNA activity (potency), or nucleic acid molecules with reduced off-target effects.

[0121] The nucleic acid molecule of the present invention may be chemically modified in the antisense and / or sense strand, such as "modification of the sugar group of the nucleotide," "modification of the internucleoside bond," "modification of the nucleic acid base of the nucleotide," or "modification of the structure of one or more nucleotides at the end of the nucleic acid molecule." In some embodiments, the chemical modifications in the nucleic acid molecule can be included in all nucleotides of the nucleic acid molecule.

[0122] In some embodiments, the nucleic acid molecule of the present invention may contain at least one modified nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23, etc.) within the double-stranded region formed by the antisense and sense strands.

[0123] The nucleic acid molecules of the present invention include nucleotides having modifications to their sugar groups. The nucleic acid molecules of the present invention include nucleotides in which the group at the 2' position of the nucleotide is substituted, deoxynucleotides, or nucleotides containing a bicyclic sugar. In some embodiments, the nucleotides in which the group at the 2' position of the nucleotide is substituted are 2'-OR １ , 2'-R １ , 2'-R ２ OR １ , 2'-SH, 2'-SR １ , 2'-NH ２ , 2'-NHR 1 , 2'-NHAc, 2'-NR １ ２, 2'-N ３ , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R ２ C(O)XR ３ (In each group, R １ is alkyl or aryl, C １ -C ３０ alkyl, C １ -C ２５ alkyl, C １ -C ２０ alkyl, C １ -C １８ alkyl, C １ -C １６ alkyl, C １ -C １５ alkyl, C １ -C １０ alkyl, C １ -C ６ alkyl, or C １ -C ３ alkyl may also be; R ２ is alkylene, C ２ -C ３０ alkylene, C ２ -C ２５ alkylene, C ２ -C ２０ alkylene, C ２ -C １８ alkylene, C ２ -C １５ alkylene, C ２ -C １０ alkylene, C ２ -C ６ alkylene 、 or, C ２ -C ３ alkylene may also be; X is an oxygen atom, NH or NR １ ; R ３ is alkyl, C １ -C ３０ alkyl, C １ -C ２５ alkyl, C １ -C ２０ alkyl, C １ -C １８ alkyl, C １ -C １５ alkyl, C １ -C１６ Alkyl, C １ -C １０ Alkyl, C １ -C ６ Alkyl, or C １ -C ３ The nucleotide may be substituted with a group selected from the group consisting of alkyl groups. The bicyclic sugar may be selected from the group consisting of LNA, ENA, cEt, GuNA, GuNA(t-Bu), and scpBNA, but is not limited to these. In one embodiment, the bicyclic sugar is preferably LNA.

[0124] Modification of the sugar group of a nucleotide can, in some embodiments, be a 2'-deoxynucleotide, a 2'-O-alkyl modified nucleotide (e.g., a 2'-O-methyl (2'OMe) modified nucleotide, a 2'-O-C １６ H ３３ Examples include, but are not limited to, modified nucleotides, 2'-deoxy-2'-fluoro-modified nucleotides, 2'-acetaamide-modified nucleotides, or any combination thereof. The modification of the sugar group of the nucleotide is preferably 2'-deoxy nucleotide, 2'-O-methyl (2'OMe)-modified nucleotide, 2'-fluoro (2'F)-modified nucleotide, or any combination thereof.

[0125] Modification of nucleoside bonds includes, but is not limited to, phosphorothioate bonds or phosphorodithioate bonds. Preferably, the modification of nucleoside bonds is a phosphorothioate bond.

[0126] In some embodiments, the nucleic acid molecule of the present invention may have phosphorothioate bonds attached to the 1-2 and / or 2-3 positions from the 5' end of the antisense strand and / or the 1-2 and / or 2-3 positions from the 3' end of the antisense strand, and may also have phosphorothioate bonds attached to the 1-2 and / or 2-3 positions from the 5' end of the sense strand and / or the 1-2 and / or 2-3 positions from the 3' end of the sense strand. In some embodiments, a phosphate group (P(O)(OH)) is attached to the hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or antisense strand of the nucleic acid molecule. ２ ) or thiophosphate group (P(S)(OH) ２ It may contain nucleotides in which the ) is substituted.

[0127] The nucleic acid bases of the nucleotides constituting the oligonucleotide are not particularly limited, but for example, adenine (A), guanine (G), thymine (T), cytosine (C), uracil (U), hypoxanthine, or modified nucleic acid bases thereof can be used.

[0128] Modifications of the nucleic acid bases of nucleotides include, but are not limited to, 5-alkylcytosine, 5-alkyluracil, or any combination thereof.

[0129] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications at the 5' end, 3' end, or both ends of the antisense strand and / or sense strand.

[0130] In some embodiments, the nucleic acid molecule of the present invention may have multiple deoxynucleotides (e.g., deoxythymidine (dT)) bound to the 3' end of the antisense strand and / or sense strand.

[0131] In some embodiments, the nucleic acid molecule of the present invention has a double-stranded region (dsRNA) of 21 nucleotides in length, and includes an antisense strand of 21 nucleotides in length and a sense strand of 21 nucleotides in length, in which case the overhang is 2 nucleotides in length. However, the 3' end of the antisense strand may have further overhangs of, for example, 1 to 3 nucleotides in length, 1 to 2 nucleotides in length, or 1 nucleotide in length.

[0132] 3. Chemical Modification Patterns The nucleic acid molecule of the present invention may be able to improve the degree of inhibition of target protein or target gene expression and serum stability by having nucleotides at specific positions on the antisense strand and sense strand having the chemical modifications described above. Furthermore, the nucleic acid molecule of the present invention can have various patterns of chemical modifications on the antisense strand and sense strand. Examples of such patterns include continuous patterns, alternating patterns, and repeating patterns.

[0133] A consecutive pattern is, specifically, a pattern in which a particular chemical modification (e.g., 2'F modification (F)) appears multiple times in a row, such as -F-F-F-, and may also be called a block pattern. An alternating pattern is, specifically, a pattern in which two or more chemical modifications (e.g., 2'F modification (F) and 2'OMe modification (M)) are arranged alternately, such as -F-M-F-M-. A repeating pattern is, specifically, a pattern in which a specific sequence of two or more chemical modifications (e.g., 2'F modification (F) and 2'OMe modification (M)) is repeated, such as -F-F-M-F-F-M-.

[0134] Furthermore, the chemical modification pattern may not be limited to the regular sequence described above, but may also be a sequence in which complementary nucleotides at specific positions on the sense strand and antisense strand each have a specific chemical modification. Specifically, for example, in the 5'→3' direction, the nucleotide at position 10 of the sense strand may be 2'F modified, and the complementary nucleotide on the antisense strand may be 2'OMe modified.

[0135] These chemical modification patterns may exist in multiples (for example, two or more, three or more, four or more, five or more, etc.) on the sense and antisense chains, or they may exist as combinations of multiple patterns.

[0136] In some embodiments, the antisense chain of the nucleic acid molecule of the present invention may contain 7 or more, 8 or more, 9 or more, 10 or more, or 11 or more 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, the antisense chain of the nucleic acid molecule of the present invention may contain 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, or 7 or fewer 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, the antisense chain of the nucleic acid molecule of the present invention may contain 7, 8, 9, 10, or 11 2'-deoxy-2'-fluoro-modified nucleotides.

[0137] In some embodiments, the sense strand of the nucleic acid molecule of the present invention may contain one or more, two or more, three or more, four or more, or five or more 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, the sense strand of the nucleic acid molecule of the present invention may contain five or fewer, four or fewer, three or fewer, two or fewer, or one or fewer 2'-deoxy-2'-fluoro-modified nucleotides. In some embodiments, the sense strand of the nucleic acid molecule of the present invention may contain five 2'-deoxy-2'-fluoro-modified nucleotides.

[0138] In some embodiments, the antisense chain of the nucleic acid molecule of the present invention may contain 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, or 16 or more 2'-O-methyl (2'OMe) modified nucleotides. In some embodiments, the antisense chain of the nucleic acid molecule of the present invention may contain 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, or 2 or fewer 2'-O-methyl (2'OMe) modified nucleotides.

[0139] In some embodiments, the sense strand of the nucleic acid molecule of the present invention may contain 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, or 16 or more 2'-O-methyl (2'OMe) modified nucleotides. In some embodiments, the sense strand of the nucleic acid molecule of the present invention may contain 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, or 2 or fewer 2'-O-methyl (2'OMe) modified nucleotides.

[0140] In some embodiments, the antisense chain of the nucleic acid molecule of the present invention contains one or more, two or more, three or more, or four or more phosphorothioate-modified phosphodiester bonds (e.g., phosphorothioate bonds). In some embodiments, the antisense chain of the nucleic acid molecule of the present invention contains four or fewer, three or fewer, two or fewer, or one or fewer modified phosphodiester bonds (e.g., phosphorothioate bonds) phosphorothioates.

[0141] In some embodiments, the sense or antisense strand of the nucleic acid molecule of the present invention contains one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or twenty or more consecutive phosphodiester bonds (preferably phosphorothioate bonds). In some embodiments, the sense or antisense strand of the nucleic acid molecule of the present invention contains 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, two or fewer, or one consecutive phosphodiester bonds (preferably phosphorothioate bonds). In some embodiments, phosphodiester bonds (preferably phosphorothioate bonds) in the sense strand or antisense strand are preferably present between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of the sense strand. In some embodiments, phosphodiester bonds (preferably phosphorothioate bonds) may be present, for example, in the sequences of formulas I to III showing the chemical modification patterns of the sense strand and antisense strand exemplified below, between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of the sense strand and antisense strand.

[0142] More specifically, the chemical modification patterns of the sense strand of the nucleic acid molecule of the present invention include, for example, those shown in formulas I to IV above. In some embodiments, the sense strand may have nucleotides containing 2'-deoxy-2'-fluoro modifications at positions complementary to the 7th, 11th, 12th, 13th, and 15th positions from the 5' end of the antisense strand. In some embodiments, the sense strand may have nucleotides containing 2'-deoxy-2'-fluoro modifications at positions complementary to the 7th, 11th, 12th, 13th, and 15th positions from the 5' end of the antisense strand, with the cleavage site of the antisense strand counted as the 10th base from the 5' end. In some embodiments, when the sense strand is 21 nucleotides long and the nucleotide at the 5' end of the antisense strand and the nucleotide at the 3' end of the sense strand are in complementary positions, the sense strand may have nucleotides containing 2'-deoxy-2'-fluoro modifications at positions 7th, 9th, 10th, 11th, and 15th positions from the 5' end of the sense strand.

[0143] In some embodiments, nucleotides modified with any 2' group refer to structures other than the 2' hydroxyl portion of the sugar of the nucleotide, and known structures can be selected. Examples include 2'-deoxyribonucleotides (deoxyadenine, deoxyguanosine, deoxycytidine, deoxythymidine), 2'-O-alkyl-modified nucleotides selected from C3 to C18, etc., but do not include 2'-deoxy-2'-fluoro-modified nucleotides and 2'-O-methyl (2'OMe)-modified nucleotides. In some embodiments, nucleotides modified with any 2' group can be included in place of the 2'-O-methyl (2'OMe)-modified nucleotides in the chemical modification pattern of the present invention. In some embodiments, the nucleic acid molecule of the present invention may contain, for example, 0 to 3, 0 to 2, or 0 to 1 nucleotides modified with any 2' group, or may not contain any.

[0144] In some embodiments, the nucleic acid molecule of the present invention may include a nucleotide modified with any 2' group in the sense strand. Examples of nucleotides modified with any 2' group included in the sense strand include 2'-deoxyribonucleotides (deoxyadenine, deoxyguanosine, deoxycytidine, deoxythymidine), 2'-O-alkyl-modified nucleotides selected from C3 to C18, and so on, with 2'-O-alkyl-modified nucleotides selected from C3 to C18 being preferred. When nucleotides modified with any 2' group are included in the sense strand, for example, 1 to 3, 1 to 2, or 1 may be included.

[0145] In some embodiments, the nucleic acid molecule of the present invention may contain a nucleotide modified with any 2' group in the antisense chain. Examples of nucleotides modified with any 2' group in the antisense chain include 2'-deoxyribonucleotides (deoxyadenine, deoxyguanosine, deoxycytidine, deoxythymidine (thymidine-3'-phosphate)), 2'-O-alkyl-modified nucleotides selected from C3 to C18, etc., with C2'-deoxyribonucleotides being preferred and deoxythymidine being more preferred. When nucleotides modified with any 2' group are included in the antisense chain, for example, it may contain 1 to 3, 1 to 2, or 1.

[0146] In some embodiments, the nucleotide at position 1 in the 5'→3' direction of the antisense chain may include a nucleotide modified with any group. The nucleotide modified with any group may include known modified nucleotides other than 2'-deoxy-2'-fluoro-modified nucleotides (see, for example, International Publication No. 2022 / 204430). Examples include 2'-O-methyl (2'OMe)-modified nucleotides, 2'-deoxyribonucleotides (deoxyadenine, deoxyguanosine, deoxycytidine, deoxythymidine (thymidine-3'-phosphate)), 5'-vinylphosphonate-modified nucleotides, 2'-acetamide-5'-vinylphosphonate-modified nucleotides, thymidine-3'-phosphate, and the like.

[0147] In some embodiments, the antisense chain may further include a 5'-phosphate stabilizing moiety at its 5' terminus. Modified nucleotides containing a 5'-phosphate stabilizing moiety at their 5' terminus may include known modified nucleotides other than 2'-deoxy-2'-fluoro-modified nucleotides (see, for example, International Publication No. 2022 / 204430). Examples include 5'-vinylphosphonate-modified nucleotides, etc.

[0148] 4. Salts and Solvates The nucleic acid molecules of the present invention may form salts. Such salts are not particularly limited as long as they are pharmaceutically acceptable, but examples include alkali metal salts such as sodium salts, potassium salts, and lithium salts; alkaline earth metal salts such as calcium salts and magnesium salts; metal salts such as aluminum salts, iron salts, zinc salts, copper salts, nickel salts, and cobalt salts; ammonium salts; t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucamine salts, guanidine salts, diethylamine salts, triethylamine salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, procaine salts, diethanolamine salts, and N-benzylphenethylamine salts. Examples include organic amine salts such as piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salt; hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, and hydroiodide; inorganic salts such as nitrates, perchlorates, sulfates, and phosphates; lower alkanesulfonates such as methanesulfonates, trifluoromethanesulfonates, and ethanesulfonates; arylsulfonates such as benzenesulfonates and p-toluenesulfonates; organic salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, and maleates; and amino acid salts such as glycine salts, lysine salts, arginine salts, ornithine salts, glutamates, and aspartates. These salts can be produced by known methods.

[0149] The nucleic acid molecules of the present invention, or salts thereof, may exist in non-solvated or solvated forms. In this specification, "solvate" means a molecular complex comprising the nucleic acid molecule of the present invention, or a salt thereof, and one or more pharmaceutically acceptable solvent molecules (e.g., water, ethanol, etc.). When the solvent molecule is water, it is specifically referred to as a "hydrate." These solvates can be prepared by known methods.

[0150] The description of nucleic acid molecules in this invention may include descriptions of salts of nucleic acid molecules, solvates of nucleic acid molecules, and solvates of salts of nucleic acid molecules.

[0151] 5. Nucleic acid molecules can also be bound with any functional molecule to enhance their activity, intracellular distribution, intracellular uptake, delivery to specific organs (target sites), etc. The functional molecule may be directly bound to the oxygen atom at the 3' position of the nucleotide at the 3' end of the oligonucleotide in the sense strand of the nucleic acid molecule, or to the oxygen atom at the 5' position of the nucleotide at the 5' end, or the functional molecule may be bound to the aforementioned site of the oligonucleotide in the sense strand via a binding group (e.g., a degradable group, a non-degradable group, etc.), or via a binding group and an optional linker. Methods for binding functional molecules to oligonucleotides can be found in known literature, etc.

[0152] Functional molecules are not particularly limited, but they are molecules that, when bound, impart a desired function to nucleic acid molecules. Desired functions include, for example, delivery to target sites (various organs, tissues, cells, etc.). Functional molecules are not particularly limited, but include a wide variety of molecules such as lipids, proteins, peptides, antibodies, glycans, and small molecule compounds.

[0153] 6. Targets The nucleic acid molecules of the present invention can target genes encoding endothelin A receptor, thymic stromal lymphocyte necrotizing factor (TSLP), or IL-33. Genes encoding endothelin A receptor, thymic stromal lymphocyte necrotizing factor (TSLP), or IL-33 from species such as humans, rats, mice, and cynomolgus monkeys have been cloned and sequenced and are available from GenBank. The sequences of these genes are not limited to those listed below. Since reported sequences may change over time, those skilled in the art can incorporate the necessary changes into the nucleic acid molecules described herein accordingly.

[0154] As a nucleotide sequence encoding human ETAR, for example, the nucleic acid sequence of human ETAR mRNA (Genbank accession number: NM_001957.4, GI: 1519313402 [Homo sapiens endothelin receptor type A (EDNRA), transcript variant 1, mRNA]) (incorporated herein as SEQ ID NO: 444) is available, as a nucleotide sequence encoding rat ETAR, for example, the nucleic acid sequence of rat ETAR mRNA (Genbank accession number: NM_012550.2, GI: 164565423 [Rattus norvegicus endothelin receptor type A (Ednra), mRNA]) (incorporated herein as SEQ ID NO: 445) is available, as a nucleotide sequence encoding mouse ETAR, for example, the nucleic acid sequence of mouse ETAR mRNA (Genbank Accession number: NM_010332.2, GI: 93102407 (Mus musculus endothelin receptor type A (Ednra), mRNA), etc. are available.

[0155] Nucleic acid sequences encoding human TSLP are available, such as the nucleic acid sequence of human TSLP mRNA (GenBank accession number: NM_033035.5 [Homo sapiens thymic stromal lymphopoietin (TSLP), transcript variant 1, mRNA NCBI Reference Sequence]) (incorporated herein as SEQ ID NO: 446), and nucleotide sequences encoding cynomolgus monkey TSLP are available, such as the nucleic acid sequence of cynomolgus monkey TSLP mRNA (GenBank accession number: XM_005557498.3 [Macaca fascicularis thymic stromal lymphopoietin (TSLP), mRNA NCBI Reference Sequence]) (incorporated herein as SEQ ID NO: 447).

[0156] Nucleic acid sequences encoding human IL-33 are available, such as the nucleic acid sequence of human IL-33 mRNA (GenBank accession number: NM_033439.4 [Homo sapiens interleukin 33 (IL33), transcript variant 1, mRNA]) (incorporated herein as SEQ ID NO: 448). Nucleic acid sequences encoding cynomolgus monkey IL-33 are available, such as the nucleic acid sequence of cynomolgus monkey IL-33 mRNA (GenBank accession number: XM_005581767.3 [Macaca fascicularis interleukin 33 (IL33), transcript variant X1, mRNA]) (incorporated herein as SEQ ID NO: 449). Nucleic acid sequences encoding mouse IL-33 are available, such as the nucleic acid sequence of mouse IL-33 mRNA (GenBank accession number: NM_133775.3 [Mus musculus interleukin 33 (Il33), transcript variant 2, mRNA) (incorporated herein as sequence number 450), etc., are available.

[0157] The nucleic acid molecule of the present invention is sequenced such that its antisense strand can complement (hybridize) at least one target region of a target gene in order to obtain the desired effect.

[0158] In some embodiments, the desired effect is, for example, a decrease in the expression levels of endothelin A receptor, thymic interstitial lymphocyte necrotizing factor (TSLP), or IL-33; or a decrease in the expression levels of mRNA encoding endothelin A receptor, thymic interstitial lymphocyte necrotizing factor (TSLP), or IL-33, but is not limited to these.

[0159] The target region may contain one or more target segments. The antisense strand of a nucleic acid molecule can complement at least one target segment within the target region. Furthermore, the antisense strand of a nucleic acid molecule may complement multiple target segments.

[0160] In some embodiments, the target segment within the target region may consist of, for example, 10-20, 15-25, 19-29, or 20-30 nucleotides on the target gene, and may be the same length as or different from the nucleotide length of the antisense strand.

[0161] 7. Complementarity with Target Genes The antisense strand of the nucleic acid molecule of the present invention specifically hybridizes with target genes, such as endothelin A receptor, thymic stromal lymphocyte necrosis factor (TSLP), or mRNA encoding IL-33, to form a double-stranded structure. The antisense strands of the nucleic acid molecules of the present invention become fully complementary or substantially complementary to each other if a sufficient number of their nucleic acid bases can form hydrogen bonds with the corresponding nucleic acid bases of the target genes. As a result, the desired effects described above are obtained.

[0162] In some embodiments, the complementary region of the antisense strand of the nucleic acid molecule of the present invention has a nucleotide length of at least 19, 20, 21, 22, or 23 nucleotides.

[0163] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention or a particular portion thereof is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a target gene, its target region, target segment, or particular portion.

[0164] The complementarity (%) between the antisense strand of the nucleic acid molecule of the present invention and a certain region of the target gene can be calculated using a method known in the art. For example, if 18 of the 20 nucleic acid bases of the oligonucleotide contained in the antisense strand complement the target region of the target gene and the antisense strand can specifically hybridize, then the complementarity will be 90%.

[0165] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention or a specific portion thereof may be completely complementary (i.e., 100% complementary) to the target gene or a specific portion thereof. "Completely complementary (100% complementary)" means that each nucleic acid base of the antisense strand can form a complete base pair with the corresponding nucleic acid base of the target gene.

[0166] Non-complementary nucleic acid bases (mismatched bases) may be located at the 5' or 3' end of the antisense strand, or they may be located within the antisense strand. If two or more non-complementary nucleic acid bases are present, they may be contiguous or discontinuous.

[0167] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention may contain, for example, four or fewer, three or fewer, two or fewer, or one or fewer non-complementary nucleic acid bases relative to the target gene or a specific portion thereof.

[0168] 8. Design and Manufacturing Method of Nucleic Acid Molecules When the nucleic acid molecule of the present invention is siRNA, the sequence of the target gene can be obtained from GenBank. For example, siRNA can be designed so that it contains an antisense strand with approximately 80% to 100% homology to a portion of the target gene.

[0169] siRNA according to one aspect of the present invention can be prepared by appropriately selecting a method known to those skilled in the art. For example, after synthesizing the antisense strand and sense strand according to the method described in the examples below, siRNA can be obtained by performing annealing according to a known method. Even when the nucleic acid molecule of the present invention is something other than siRNA, it can be prepared by appropriately selecting a method known to those skilled in the art.

[0170] 9. Composition The present invention provides a pharmaceutical composition comprising the modified nucleic acid of the present invention, and a pharmaceutical composition comprising the nucleic acid molecule of the present invention (hereinafter collectively referred to as "the pharmaceutical composition of the present invention").

[0171] In some embodiments, the pharmaceutical compositions of the present invention are useful for the prevention or treatment of diseases or symptoms related to endothelin A receptor, thymic interstitial lymphocyte necrotizing factor (TSLP), or IL-33. In some embodiments, the pharmaceutical compositions of the present invention may be administered to a subject requiring such treatment in a sufficiently effective amount (therapeutic effective dose) to inhibit the expression of mRNA encoding endothelin A receptor, thymic interstitial lymphocyte necrotizing factor (TSLP), or IL-33.

[0172] In some embodiments, the use of the modified nucleic acid or nucleic acid molecule of the present invention as a pharmaceutical is provided.

[0173] In some embodiments, modified nucleic acids or nucleic acid molecules of the present invention are provided for use as pharmaceuticals.

[0174] In some embodiments, the use of at least one of the nucleic acid molecules or salts thereof of the present invention, or solvates thereof, as an inhibitor of endothelin A receptor, thymic interstitial lymphocyte genesis factor (TSLP), or IL-33 expression is provided.

[0175] Examples of "pharmaceutically acceptable carriers" include, but are not limited to, sterile water, physiological saline, PBS, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, flavoring agents, fragrances, excipients, vehicles, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffering agents, coating agents, lubricants, colorants, sweeteners, viscosity modifiers, flavor and odor modifiers, solubilizers, and other additives, as well as combinations thereof. Furthermore, such carriers may include, for example, inert solid diluents or fillers, sterile aqueous solutions, and various organic solvents.

[0176] The administration method of the composition containing the nucleic acid molecule of the present invention is not particularly limited as long as it is a pharmaceutically acceptable administration method, and examples include oral administration, intravenous administration, intra-arterial administration, intramuscular administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intratissue administration, transdermal administration, intra-airway administration, transpulmonary administration, rectal administration, administration by intravenous fluid, and transnasal administration, which can be selected according to the treatment method.

[0177] The composition containing nucleic acid molecules of the present invention can be formulated by known pharmaceutical methods. The dosage form is not particularly limited and includes, for example, tablets, capsules, granules, fine granules, powders, pills, aerosols, inhalants, ointments, patches, topical preparations, transdermal preparations, lotions, suppositories, injections, lozenges, liquids, alcoholic preparations, suspensions, extracts, elixirs, lyophilized preparations, etc., which can be selected according to the method of administration.

[0178] The aqueous solvent that can be used to dissolve the nucleic acid molecules of the present invention is not particularly limited as long as it is an aqueous solvent, and examples include aqueous solvents such as water for injection, distilled water for injection, electrolyte solutions such as PBS and physiological saline, glucose solution and maltose solution.

[0179] The dosage of the composition of the present invention should preferably be adjusted considering the type of nucleic acid molecule contained in the present invention, the dosage form, the age, weight, and condition of the recipient, the route of administration, and the nature and severity of the disease. The dosage will also vary depending on the type of disease being targeted, the form of administration, and the target molecule. Furthermore, the number of administrations will be appropriately selected depending on whether it is for prevention or treatment.

[0180] The nucleic acid molecule of the present invention is expected to be a nucleic acid molecule that can improve, for example, activity level, stability, toxicity, resistance to enzymatic degradation, target tissue targeting, intracellular distribution, cytoplasmic distribution, pharmacokinetics, and administration method.

[0181] The present invention will be described in more detail below with reference to examples, but the embodiments of the present invention are not limited to the following examples.

[0182] (Example of siRNA production) Single-chain RNA was produced by solid-phase synthesis on a scale of 1 μmol using an NTS-M8 synthesizer (Nippon Techno Service Co., Ltd.), the corresponding phosphoramidite, and controlled-pore glass (Glen UnySupport® 1000, Glen Research) as a solid support. For solid-phase synthesis, a standard nucleoside phosphoramidite chemical reaction, as described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, was used. Furthermore, the iodine oxidizing agent solution was replaced with a solution of DDTT (CAS: 1192027-04-5) (pyridine / acetonitrile = 6 / 4) to introduce a phosphorothioate bond.

[0183] Crude oligoribonucleotides were purified and deprotected using the Presep® DNA / RNA Type A reverse-phase solid-phase extraction column, following established procedures. Yield and concentration were determined by UV absorption of each RNA solution at a wavelength of 260 nm using a spectrophotometer (NanoDrop 1000, Thermo Fisher Scientific Inc.). Double-stranded RNA was generated by mixing equimolar solutions of complementary strands in water (0.1 mM), heating at 90°C for 5 minutes, and cooling to room temperature over approximately 30 minutes. The annealed RNA solutions were freeze-dried and stored in a freezer.

[0184] The manufactured siRNAs are shown in Tables 1 to 39 below, along with the sequence information of their sense and antisense strands. In the tables, chemically modified sense strands (5'→3') or chemically modified antisense strands (5'→3') indicate the modification of the sugar portion, nucleoside bond, or nucleic acid base portion of the oligonucleotide. The nucleic acid base sequence and the modified nucleic acid base sequence are described in the 5' to 3' direction. Also, "U" in the tables is represented as "T" in the sequence listings attached to this specification.

[0185] In the notation of nucleic acid base sequences and chemical structures in the examples, the nucleotide monomers used are represented by the following abbreviations. A: Adenosine-3'-phosphate; C: Cytidine-3'-phosphate; G: Guanosine-3'-phosphate; U: Uridine-3'-phosphate; t: Thymidine-3'-phosphate; p: Phosphate; A(M): 2'-O-methyl-adenosine-3'-phosphate; C(M): 2'-O-methyl-cytidine-3'-phosphate; G(M): 2'-O-methyl-guanosine-3'-phosphate; U(M): 2'-O-methyl-uridine-3'-phosphate; A(F): 2'-fluoro-adenosine-3'-phosphate; C(F): 2'-fluoro-cytidine-3'-phosphate; G(F): 2'-fluoro-guanosine-3'-phosphate; U(F): 2'-fluoro-uridine-3'-phosphate;

[0186] U(Vp): 5'-vinylphosphonate-modified uridine-3'-phosphate represented by the following formula (excluding the part outside the dashed line in the formula);

[0187] U(NAcVp): A 2'-acetamide-5'-vinylphosphonate modified uridine-3'-phosphate (excluding the part outside the dashed line in the formula) that includes a 2'-acetamide modification and a 5'-vinylphosphonate modification, represented by the following formula;

[0188] r: invAb as a debasic nucleotide that binds in inverse position as shown in the following formula (excluding the part outside the dashed line in the formula);

[0189] ^: phosphorothioate bond (5'-3' bond); \: phosphorodithioate bond (5'-3' bond). Note that in the chemical structure notation in the examples, when "^" (phosphorothioate bond) or "\" (phosphorodithioate bond) is not indicated between two adjacent nucleosides, the internucleoside bond (5'-3' bond) between those two nucleosides represents a phosphodiester bond.

[0190] The introduction of U(Vp) can be carried out using the following amidide compound (CAS No. 2172373-55-4) in accordance with methods known in the literature.

[0191] The introduction of U(NAcVp) can be carried out using the following amidide compound (CAS No. 3079526-33-0) in accordance with methods known in the literature.

[0192] The introduction of r can be carried out using the following amidide compound (CAS No. 401813-16-9) in accordance with methods known in the literature.

[0193]

[0194] (In vitro activity evaluation) 1. Evaluation of ETAR mRNA expression suppression in human cells HEK293 cells were used. Using Opti-MEM (registered trademark) (Thermo Fisher Scientific, catalog number 31985) as a medium, siRNA and LipofectamineRNAiMax (Thermo Fisher Scientific, catalog number 13778) were mixed and incubated at room temperature for 5 minutes, then added to a 96-well plate at a volume of 20 μL per well. Next, 100 μL of HEK293 cells suspended in DMEM (high-glucose) medium containing 10% inactivated FBS, 100 U / mL penicillin, and 0.1 mg / mL streptomycin was added to 3.0 x 10⁶ wells. ４ Transfection was performed by adding the siRNA to form cells. Dose-response experiments were conducted at final siRNA concentrations ranging from 0.002 to 10 nM or 0.01 to 40 nM. 37°C, 5% CO2 ２After culturing the cells for approximately 24 hours under these conditions, RNA was isolated from the cells, and the human ETAR mRNA expression level was measured by real-time PCR. RNA was extracted from the cells using RNeasy® Mini Kit (QIAGEN, catalog number 74106), and cDNA was obtained by DNase treatment and reverse transcription reaction using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500). Using the obtained cDNA as a template, real-time PCR was performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). Human ETAR, human B2M, or human ACTB were measured using TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) as the real-time PCR reagent and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, one of catalog numbers 4331182, 4351372, 4351370, or 4351368) as the primer-probe set. The measurement results were analyzed using the ΔΔCt method with human B2M or human ACTB as the reference gene. The expression level (%) (ii) and expression inhibition rate (%) (100%-ii) were calculated, with the expression level (i) of human ETAR mRNA in siRNA-untreated cells with only the transfection reagent added set to 100%. The expression level (%) (expression inhibition rate (%)) and IC of human ETAR at 10 nM obtained by this method using each of the above compounds were calculated. ５０ The values ​​are listed in Tables 1 to 39.

[0195] 2. Evaluation of TSLP mRNA expression suppression in human cells. Normal airway epithelial cells (NHBE, LONZA, catalog number CC-2540) were used. siRNA and LipofectamineRNAiMax (Thermo Fisher Scientific, catalog numbers 13778075 or 13778150) were mixed using Opti-MEM (registered trademark) (Thermo Fisher Scientific, catalog numbers 31985062 or 31985070) as a medium. After incubation at room temperature for 5 minutes, the mixture was added to a 96-well plate at a concentration of 20 μL per well. Next, 100 μL of NHBE cells suspended in bronchial epithelial growth medium (LONZA, catalog number CC-3170) is added to each well in a 1.5 x 10⁶ ４ Transfection was performed by adding the siRNA to form cells. Dose-response experiments were conducted at final siRNA concentrations ranging from 0.002 to 10 nM. (37°C, 5% CO2) ２After culturing for two days under these conditions, culture was restarted by adding 20 μL of bronchial epithelial growth medium containing Poly(I:C) (Tocris Bioscience, catalog number 4287 / 10) per well, and 10 μg / mL Poly(I:C) stimulation was initiated. Four hours after Poly(I:C) stimulation, RNA was isolated from the cells, and the human TSLP mRNA expression level was measured by real-time PCR. RNA was extracted from the cells using RNeasy® Mini Kit (QIAGEN, catalog number 74106), and cDNA was obtained by DNase treatment and reverse transcription reaction using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500). Using the obtained cDNA as a template, real-time PCR was performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) was used as the real-time PCR reagent, and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, one of catalog numbers 4331182, 4351372, 4351370, or 4351368) was used as the primer-probe set to measure human TSLP and human B2M. The measurement results were analyzed using the ΔΔCt method with human B2M as the reference gene. The expression level (%) (ii) and expression inhibition rate (%) (100%-ii) were calculated, with the expression level (i) of human TSLP mRNA in siRNA-untreated cells with only the transfection reagent added set to 100%. The expression level (%) (expression inhibition rate (%)) and IC of human TSLP at 10 nM obtained by this method using each of the above compounds were calculated. ５０ The values ​​are listed in Tables 1 to 39.

[0196] 3. Evaluation of IL33 mRNA expression suppression in human cells. U-87 cells were used. Using Opti-MEM® (Thermo Fisher Scientific, catalog number 31985) as the medium, siRNA and LipofectamineRNAiMax (Thermo Fisher Scientific, catalog number 13778) were mixed and incubated at room temperature for 5 minutes, then added to a 96-well plate at a volume of 20 μL per well. Next, 100 μL of U-87 cells suspended in DMEM (high-glucose) medium containing 10% inactivated FBS, 100 U / mL penicillin, and 0.1 mg / mL streptomycin was added to 3.0 × 10⁶ wells per well. ４ Transfection was performed by adding the siRNA to form cells. Single-concentration experiments were conducted at 10 nM, and dose-response experiments were conducted at final siRNA concentrations ranging from 0.0002 to 1 nM. (37°C, 5% CO2) ２After culturing the cells for approximately 24 hours under these conditions, RNA was isolated from the cells, and the human IL-33 mRNA expression level was measured by real-time PCR. RNA was extracted from the cells using RNeasy® Mini Kit (QIAGEN, catalog number 74106), and cDNA was obtained by DNase treatment and reverse transcription reaction using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500). Using the obtained cDNA as a template, real-time PCR was performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). Human IL-33 and human B2M were measured using TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) as the real-time PCR reagent and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, one of catalog numbers 4331182, 4351372, 4351370, or 4351368) as the primer-probe set. The measurement results were analyzed using the ΔΔCt method with human B2M as the reference gene. The expression level (%) (ii) and expression inhibition rate (%) (100%-ii) were calculated, with the expression level (i) of human IL-33 mRNA in siRNA-untreated cells with only the transfection reagent added set to 100%. The expression level (%) (expression inhibition rate (%)) and IC of human IL-33 obtained by this method using each of the above compounds were calculated. ５０ The values ​​are listed in Tables 1 to 39. Note that the expression inhibition rates are based on the expression level at 1 nm for Examples 1-4 to 1-23 and Comparative Examples 19 to 38, and on the expression level at 10 nm for Examples 1-24 to 1-26, Examples 2-4 to 2-6, Examples 3-4 to 3-6, Examples 4-4 to 4-6, Examples 6-1 to 6-3, and Examples 7-1 to 7-18.

[0197] 3. Stability Evaluation Mouse lung homogenate (final concentration: 40 mg protein / mL) was prepared by adding siRNA to a final siRNA concentration of 1 μM. The resulting homogenate solution was incubated at 37°C, and samples were taken at the following time points (30 minutes, 1 day, 3 or 4 days, and 7 days). Each sample was immediately frozen after collection. After all sampling was completed, each frozen sample was thawed, and liquid-liquid extraction was performed using a phenol / chloroform / isoamyl alcohol mixture (Nippon Gene Co., Ltd., catalog number: 311-90151). The amount of remaining siRNA in the extracted samples was measured by LC / MS analysis using ion-pair reverse-phase chromatography. The amount of siRNA at 30 minutes after the start of incubation was set to 100%, and the half-life of siRNA at each time point was calculated. For samples evaluated multiple times, the average half-life was used.

[0198] Accession Number 444: Nucleic Acid Sequence of Human ETAR mRNA 1 agtcatcccg ctggtctgac gattgtggag aggcggtgga gaggcttcat ccatcccacc 61 cggtcgtcgc cggggattgg ggtcccagcg agacctcccc gggagaagca gtgcccagga 121 ggttttctga agccggggaa gctgtgcagc cgaagccgcc gccgcgccgg agcccgggac 181 accggccacc ctccgcgcca cccaccctcg ccggctccgg cttcctctgg cccaggcgcc 241 gcgcggaccc ggcagctgtc tgcgcacgcc gagctccacg gtgaaaaaaa agtgaaggtg 301 taaaagcagc acaagtgcaa taagagatat ttcctcaaat ttgcctcaag atggaaaccc 361 tttgcctcag ggcatccttt tggctggcac tggttggatg tgtaatcagt gataatcctg 421 agagatacag cacaaatcta agcaatcatg tggatgattt caccactttt cgtggcacag 481 agctcagctt cctggttacc actcatcaac ccactaattt ggtcctaccc agcaatggct 541 caatgcacaa ctattgccca cagcagacta aaattacttc agctttcaaa tacattaaca 601 ctgtgatatc ttgtactatt ttcatcgtgg gaatggtggg gaatgcaact ctgctcagga 661 tcatttacca gaacaaatgt atgaggaatg gccccaacgc gctgatagcc agtcttgccc 721 ttggagacct tatctatgtg gtcattgatc tccctatcaa tgtatttaagctgctggctg 781 ggcgctggcc ttttgatcac aatgactttg gcgtatttct ttgcaagctg ttcccctttt 841 tgcagaagtc ctcggtgggg atcaccgtcc tcaacctctg cgctcttagt gttgacaggt 901 acagagcagt tgcctcctgg agtcgtgttc agggaattgg gattcctttg gtaactgcca 961 ttgaaattgt ctccatctgg atcctgtcct ttatcctggc cattcctgaa gcgattggct 1021 tcgtcatggt accctttgaa tataggggtg aacagcataa aacctgtatg ctcaatgcca 1081 catcaaaatt catggagttc taccaagatg taaaggactg gtggctcttc gggttctatt 1141 tctgtatgcc cttggtgtgc actgcgatct tctacaccct catgacttgt gagatgttga 1201 acagaaggaa tggcagcttg agaattgccc tcagtgaaca tcttaagcag cgtcgagaag 1261 tggcaaaaac agttttctgc ttggttgtaa tttttgctct ttgctggttc cctcttcatt 1321 taagccgtat attgaagaaa actgtgtata acgagatgga caagaaccga tgtgaattac 1381 ttagtttctt actgctcatg gattacatcg gtattaactt ggcaaccatg aattcatgta 1441 taaaccccat agctctgtat tttgtgagca agaaatttaa aaattgtttc cagtcatgcc 1501 tctgctgctg ctgttaccag tccaaaagtc tgatgacctc ggtccccatg aacggaacaa1561 gcatccagtg gagaaccac gatcaaaaca accacacac agaccggagc agccatagg 1621 acagcatgaa ctgaccaccc ttagagcac tcctcggtac tcccataatc ctctcggaga 1681 aaaaatcac tga aagctcccactcg ttccttaatt 1741 cactcccaca cccaagaga aatgctttcc aaaaccgcaa gggtagactg gtttatccac 1801 ccacacacatc tacgaatcgt acttctttaa ttgatctaat ttacatattc tgcgtgttgt 1861 atggaatgactggcag aaggatcaggct aa gactgttaaa tgaaaccaga 1921 aggatattta ctactttgc atgaaatag agctttcaag tacatggcta gcttttatgg 1981 cagttctggt gatgttcaa tgggaactgg tcaccatgaa actttagaga ttaacgacaa 2041 ttcattttttttcttag caaacacaat atgggctcaa 2101 gtcacttta tttgaaatgt cattggtgc cagtatttt taactgcata atagcctaac 2161 atgattttt gaacttattt acacatagtt tgaaaaaaaa aagacaaaaa tagtattcag agagttacttca 2221 actgtttatt ttttaaac acaaattcta 2281 aagctacaac aaatactaca ggccttaa gcacagtctg atgacacatt tggcagttta 2341atagatgtta ctcaaagaat tttcaaa ctgtatttta ttttgttttaat ggtgttttat 2401 tacaagggac cttgaacatg tttgtagt taaattcaa agtaatgctt caatcagata 2461 gttcttttc acagttcaa tctgattttca tgtatgaatttca tgtatgaatttc atcatgaattaa agtaccaaaa tgttaatgta tgtgtcattt aactctgcct gagactttca gtgcactgta 2581 tatagaagtc taaaacacac ctaagagaaa aagatcgaat tttcagatg attcagaat 2641 ttcattcag gtatcatttacatt tatactgaat 2701 cttaatttt cttaaaatgt taactggcag taagtcttt ttgatcattc cctttccat 2761 ataggaaaca taatttgaa gtggccagat gagtttaca tgtcagtgaa aaatattac 2821 ccacaatgc caccattcattgactat cattgact tactact 2881 ctcccacccc siacatctcc ctcccacatt gtcaccattt caaagggcccc acagtgactt 2941 ttgctgggca tttcccaga tgtttacaga ctgtgagtac agcagaaaat cttttactag 3001 tgtgttagtatatcaatttcattg tattatcattgtg tctagactgt 3061 ctctgtggaa tatattgtg tgtgtgatat atgcatgtgt gtgatgtat gtatggattt 3121 aatctaatctaataattgtg ccccgcagtt gtgccaaagt gcatagtctg agtaaaatct 3181 aggtgattgt tcatcatgac aacctgcctc agtccatttt aacctgtagc aaccttctgc 3241 attcataaat cttgtaatca tgttaccatt acaaatggga301 gtggactagc aatatagggt tttgtttggt tggttggttt gataaagcag 3361 tatttggggt catattgttt cctgtgctgg agcaaaagtc attacacttt gaagtattat 3421 attgttctta tcctcaattc aatgtggtga tgaaattgcc aggctgtt attactgttc cagacagatt gctgataata aattaggtaa gataatttgt tgggccatat 3541 tttaggacag gtaaaataac atcaggttcc agttgcttga attgcaaggc taagaagtac 3601 tgccctttg tgtgttagca gtcaaatcta ttattccact ggcgcat atcagatgat136 acctatg6 ataggttcac accattttgt ttagacaatt gtcttttttt 3721 caagatgctt tgtttctttc atatgaaaaa aatgcattttt ataaattcag aaagtcatag 3781 atttctgaag gcgtcaacgt gcattttatt tatggactgg taagtaactg tggtttac14atc tacctttact acatcttttc aacaagtaac tttgtagaaa 3901 tgagccagaa gccaaggccctgagttggca gtggcccata agtgtaaaat aaaagtttac 3961 agaaaccttg

[0199] Accession No. 445: Nucleotide Sequence of Rat ETAR mRNA 1 ctctggtctg gcagctgtgt ctaaagaggt ggggagcctc tctctgatcc aacggaccat 61 cgcaggagct tgcaggctga gcgagatctc ctctagagaa gccgggccgt cctgggaagt 121 ttcctccagc cgagactggg ctgcagccct ggtcgcgcgc caccctcgaa ctccagctca 181 ggctccgtct ggctccggcg cggacctggc gctgtctgcg tccgaggagc tctaagggga 241 aggaaaggtg tgagaccaac ataacaggac gtttcttcag atccacatta agatgggtgt 301 cctttgcttt ctggcgtcct tttggctggc cctggtggga ggcgcaatcg ctgacaatgc 361 tgagagatac agtgctaatc taagcagcca cgtggaggac ttcacccctt ttccagggac 421 agagttcgac tttctgggca ccacccttcg accccctaat ttggccctgc ctagcaatgg 481 ctcaatgcat ggctattgcc cacagcagac aaaaatcacg acggctttca aatatatcaa 541 cactgtgata tcctgtacca ttttcatcgt gggaatggtg gggaacgcca ctctcctaag 601 aatcatttac caaaacaagt gtatgaggaa cggccccaat gcgctcatag ccagcctggc 661 ccttggagac cttatctacg tggtcattga tctccccatc aatgtgttta agctgttggc 721 ggggcgctgg ccttttgacc acaatgattt tggagtgttt ctctgcaagctgttcccctt 781 tttgcagaag tcgtccgtgg gcatcactgt cctgaatctc tgcgctctca gtgtggacag 841 gtacagagca gtggcttcct ggagccgggt tcaaggaatc gggatcccct tgattaccgc 901 cattgaaatt gtctccatct ggatcctttc ctttatcttg gccatcccag aagcaatcgg 961 cttcgtcatg gtacccttcg aatacaaggg cgagcagcac aggacctgca tgctcaacgc 1021 cacgaccaag ttcatggagt tttaccaaga cgtgaaggac tggtggctct ttggattcta 1081 cttctgcatg cccttggtgt gcacagcaat cttctatacc ctcatgacct gtgagatgct 1141 caacagaagg aatgggagct tgcggattgc cctcagcgaa cacctcaagc agcgtcgaga 1201 ggtggcaaag accgtcttct gcttggttgt catcttcgcc ctgtgctggt tccctcttca 1261 cttaagccga attttgaaga aaaccgtcta tgatgagatg gataagaacc ggtgtgaact 1321 gctcagcttc ttgctgctca tggattacat tggcattaac ctggcaacca tgaactcttg 1381 cataaaccca atagctctgt attttgtgag caagaaattc aaaaattgtt ttcagtcatg 1441 cctctgttgc tgttgtcacc agtccaaaag cctcatgacc tcggtcccca tgaatggaac 1501 gagtatccag tggaagaacc aggagcagaa ccacaacaca gaacggagca gccacaagga1561 cagcatgaac taaccctgtg cagaagcacc gagcagtgtg ccttcgagtc ccaggatgaa 1621 acggtcacgc agcagctgc ctcccaaaac ctcccaggtc tctccctgc ttttgtcta 1681 agtccagcct aagagaagaa atgctctcct gccctcccaa cagcacatga cggaccggtt 1741 ccactcacag ccatgggtct ttcctgagta ctgtccatga tttgcatacc gtgcctgtca 1801 tttccaacac ttgaaaatca ggacaactga gggggaaggt gacagttcaa ggaaaccatg 1861 tgtctgccac ctttgcttga acacagagtt tgcacgttca tttccagctt ccgtgcagtt 1921 ctatggaaca gccagtgggc actgttcatc ctaagattct agagcagtgg ttctcaacct 1981 tcccaatgct gcagcccctt aatacagttc cttatttccc agtgactccc caaccataaa 2041 attttgttgc tacttcataa ctataatttt gcaactgtta tgacttgttt tatctatctg 2101 atatttctga tagtcttagt ctgccctggt gaaagggcca ttcaattcga aaggggtcac 2161 aacctacaag ttgagaacta cagctctaga aattatgttg aatttgaagc cccgtgtcta 2221 aaatcctata actggagagg tgagggaaga tgatcaggtg ttcaaggaca gactcattta 2281 cagagttcag aaaagccagg gctacataag attctcacaa aaatacaaac agaaaaag 2341tgtttaaaag ttatgacaag attcattatt ttttacaac caaacacatt gtgaggttga 2401 agtattcttt tggaaatgac attcagtgtt gggattttat aactgcgtgg caccttagaa 2461 atgattgttt cctctctat acatgcactt tgaaagagaa 2525 gaggaggagg aggaagagga agaggaggag gaaagggagg gcatctgata aggaactagg 2581 ttctgtttct agggtactgc tttgtttgga aaagatgatt tccaaaggtg accaattacc 2641 accagtcagt ctaataactg ttagccaaag aatttttaag aacctgtatt 27cttttt gggtttt tttgcttgag gctggccttg aattcacaga ggtcttcctg 2761 cttctgcctc caagggctgg gattgaggac acgtgcctag tactctagct tgggtatatg 2821 tttatgctaa attaaaaata atataatac ttaggagcta ggcaaggtgg cgcatcg 2881cctactag acct ctcttaacat cctgaggctg aagcaggggg ctgtgagtgg gcgagtgccc 2941 acactaacta gaggtacttg cctccaaata ataataatta ataataatac ttagggccaa 3001 tggttctctc tttcataagc ccagtccttt gtaatgtgtt tttaatatg agcacattg 360gcgtc catgtcactg aagtatggcg agacttccag ccctacgtca gaagcattcc 3121 taggaaaaacatgctggctg gttctggagg gcctggacat ctcgtacaag ctccacagta 3181 gtagcacata tataatgcat gcttcctcct acgctctcag gtcctcctac tgtgaggact 3241 ggctacactc ctgcccatgc cttcttccag acactgaaaactgaagtga301 gctgattgtg tcaggcgaaa tggacaccac cggccatgaa cctttaactc tttgctcctc 3361 tatgattgtg agacgaactt aaatttcat cctgtcccca actcctcagt ggtcactatt 3421 tcaaagggcc catggtaagt tactactgg cagtc acaacaaatg tcttttattt tgtgtgtata taaatatata aataattgta catttcttttt 3541 agccaaattt tctgtggtta tctctatgga gtgtgtgtgt gtgtgtgtgt gtgtgtgtgt 3601 gtgtgtgtgt gtgtgtgtgt tgtggtacat atagatctgg tgtaccct gtttg6 aaaacacata ttgggagtgg attctaggtg attactcatt atactaccca 3721 ctttggtcag ttcttacaca taagaatctc aagcctccca cacttgctac ttagctacta 3781 ttacagatct gagagctgcc atgcaaggga aagtgactgc aggagggatt tgttaggatt gat3844 ccaagtagga ttccgtcata gccttgtcct tgctggagca ggattccctg 3901 tcatagcctt gtccttgctggagccaagag tcctatactt ggaagtatta cactttttctc 3961 tttactccct tgggtgttct ttttgtttct gttttttact gtttgctctg gggattaagc 4021 ccaggacctc tgctatgcta ggcaagtgct ccacaacccc aaggagtttat tacc401gcgtcg actgacaagt cacctggagt ttctgtcaga taatcggtgg 4141 aaaactagct atcttaattt ttgcatcata ttttaataca gttaaaaatg aatcaaatat 4201 caaaatcaag attaaaaagt gcatcaagtt gcagttgctt gaatttcagg gctgagaaat accccc ccactgagta acacacaccc atacatgcct 4321 agagtaagac atagatgcaa acagttttgt ttattagacc attatcttgt aaaagatgct 4381 ttgtttttta tatataaaat gtatttttta ttcagaacat cgtaggtctg aatacacagg 4441 cttcagt cattttgttgtt atgactta catgaaaaca gttcaccaca 4501 tttccgacaa ggaactttgt agaaatgatc cagaagctaa gggcctgtgt tggcagtggc 4561 ccattaaaca gaaaataaaa gtttacagaa gcttt

[0200] Accession No. 446: Nucleic Acid Sequence of Human TSLP mRNA 1 atcagggaga ctccaactta aggcaacagc atgggtgaat aagggcttcc tgtggactgg 61 caatgagagg caaaacctgg tgcttgagca ctggccccta aggcaggcct tacagatctc 121 ttacactcgt ggtgggaaga gtttagtgtg aaactggggt ggaattgggt gtccacgtat 181 gttccctttt gccttactat atgttctgtc agtttctttc aggaaaatct tcatcttaca 241 acttgtaggg ctggtgttaa cttacgactt cactaactgt gactttgaga agattaaagc 301 agcctatctc agtactattt ctaaagacct gattacatat atgagtggga ccaaaagtac 361 cgagttcaac aacaccgtct cttgtagcaa tcggccacat tgccttactg aaatccagag 421 cctaaccttc aatcccaccg ccggctgcgc gtcgctcgcc aaagaaatgt tcgccatgaa 481 aactaaggct gccttagcta tctggtgccc aggctattcg gaaactcaga taaatgctac 541 tcaggcaatg aagaagagga gaaaaaggaa agtcacaacc aataaatgtc tggaacaagt 601 gtcacaatta caaggattgt ggcgtcgctt caatcgacct ttactgaaac aacagtaaac 661 catctttatt atggtcatat ttcacagcac caaaataaat catctttatt aagtagatga 721 aacattaact ctaactgtga caaagaagac cacaaatagt tatcttttaa ttacagaaga 781 gtttcttaac ttacttttgt aagtttttat tgtgtaagtt tataatgcaggggaagtact 841 actcctcaa tgttgaggga agctccata acatgatga ctggcttcat ggcagtaatt 901 ctcggctgta gttgcataag cattgctca gaggaaatc gcaaagtgca gcaggagaac 961 tcttactagattaccc aacataactca gaccataaaaa ttacattaa 1021 aagacagaca ttccttctac atgtaatgac acttcttgtg ttaaactaaa atttacaag 1081 agaagaagt gaaagcaat ggggttcac aaatagttgt aaagtgtg aagcaatttg 1141 aaataacttt tattgctagaag atattatcta 1201 acatgttcta gtgtatata caagtagatc ctgagaagta cctttgttac agctactata 1261 atatacata taaattatag atctactt atttattt gtgaacactt ttgaaaattgt 1321 acatgttttacct aattagttattacttac ttgatattatcttga 1381 cttatgaatc atctctcaa tctagttaga caatttgcac acatactttt ctaagggaca 1441 ttatctcct tcaggtttt acctccactc atccttagag cccactgact gctccttt 1501 cacctgttg gccctgccta tacagtggatgagagaa 1561 tgcaatcatc cttttcttta attatgtcac tagtcttta tttttccc tcttgaactt 1621 tctcacacc tggagaaac aaagtaggaa aaagtgaaca ggggatgtcaaatcgattct 1681 tgaattcccg ctgcaagcta gagccgcagg caccctctca ctcaatttcc actcagaacc 1741 ctataaacac cagtgggaag ggcaacccac tgcacgtggg aatgcactga tttttcctag 1801 gagtagacat gttcctctaa ttactccctg agggttagtt ggggctaaac catgacagaa 1861 gtggggaagt tcaatgtcct taaatccatc ttacttgcca acaggtaaga ggaagcttac 1921 attacatgtc cagtccacat ttaaagagca cttactgtgg aacaagcctt cagccaaaca 1981 atggggatag aaaagtaggt aagactcagc ctttgtccag agaagctcag ggtatagctg 2041 aataggcagt ttcttttgtc ctgaggaaaa tcaggacatg cctgctttct aaaaatcttc 2101 ctctgaagac ctgacccaag ctcttaaatg ctattgtaag agaaatttct ttgtctatta 2161 actccatttt agtagggatt cactgactag attttactga actatgaaaa taaatacaca 2221 taatttttca caaaattttg ggcccaattc ccctaaaaga attgaggatt agggagaaag 2281 gagacaactc aaagtcatcc cattaagtgc agtttctttg aatcttctgc tttatcttta 2341 aaaatttgta taatttatat attttattct atgtgttcca tagatatctt aatgtaaaat 2401 tagtcattta aattacactg tcaattaaaa gtaatgggca agagattgca tcatactaat 2461 ttagtaagaa cgttcccaaa tgttgtaaca atgtggatca tacatctctggttttttaaa 2521 tgtattgagg ctttcttggt ggactagtat agtatacggt cagttatgtc aatgttcat 2581 gttcataaa aaggaagttg caaattgtga

[0201] Accession Number 447: Nucleic Acid Sequence of Cynomolgus Monkey TSLP mRNA 1 agaatagact tctttttcaa tgaatgctgt ggtgacttga gtacaacaca tgaagaattc 61 cagaaaagag ccacttttga agtcagcggt gaatcagagg ttttctgact ctctccagtg 121 ccttctatga aaaagagttc aactctggct tcagtttgtc ccttacgctt ttccggaatc 181 cctcgacatt tcctgctctt tttcccgggc actgtatggc ctgtgacatt tgctgggact 241 cacacacggc gtccaacctc cttgctccga gcgatgactc ctaggaactt ccctagtacc 301 agagcgatgc aggctctgac acgcgagggc ggggggcggg gtgggggagg gggtggggga 361 tgaacgggga agcggaaggg aaggagagag aaaggggacc tgggtgtaga gagggcccag 421 ggcagcatga gccaagctag ggcggagcag ggggttcgtc tcagcaacgt gatcagtgtc 481 agcctttccc tcccttcaac gctccattgg tgctgctgga actcggaaga ctgctagaca 541 gacatcctcc agggagctct ccctgactgc ccttttaagc actcttttct ggatcaacaa 601 tagtttgcta gcacaaatct gagcccgcca tctcgttgct tctcctgtct ctaaaacctg 661 tgcccgcgct caggccccag gtgacagacg ttttccagtc tatgctgcgc agggctaagc 721 ctctgggagg cagagctcac gaaaacgtgc gccgcctctg ggaaagctga gctcaggaca 781 gcatcctctc cttgcgctca ccgctaggca tccagcagag cggtctcctcaagtttaaca 841 ctggctttaa gagtgggact gtgaaggtgg ctggcactg gatttgtgg ttttaaagt 901 tctgacacc tactagaag tgtagagga cccttcagcc cctaggtgc ccctagtcac 961 caagacttgacctag cgtagtcac aaaagtagga ttttgagaa 1021 caagcacat cagatctttc cccatttatt tcaacctt atcgttcctg cccctaggt 1081 tctgtcacg gttgcacatt taatgcttc acatggaagt gctgttgaag actgagactg ccactaac1cacctac141 caccatact gcacagtttc ttactagcca aggagaaggg 1201 aaagcattag ttgaaggcgg ccacacgaaa ttctcaaaga tgttcaggat gcatgggaca 1261 gtagcaagg actccaatc cttacagtgg gatgctggttt cagaaggtgt 1 ttcaaccaaaa tgaaatgccc tgtgggagaa agacactggt atccatttct 1381 taaaggacat taacacatat gagagttta gggcaagta aaaaggagga agttcttc 1441 aggaattct tcatcttca acttgtaggg ctggtggtaa1cactactacgactt1cactacgactt agattgaagc agactactc cgtactattt ctaaagacct gattacatat 1561 atgagtggga ctaaaagtac cgactcaac aacaccgtct cctgtagca tcggccacac 1621 tgccttactg aaatccagag cctaaccttc aatcccactc ccccgtcgctcgcc 1681 aaggaaatgt tcgccaggaa aacttaggctc tctgtgccc aggtattcg 1741 gaaactcaga taaatgctac tcaggcaatg agagagga gaaaaggaa agtcacaacctg g ataacaacc 1801 ctaggattgt ggcgtcgctt cattcgaact 1861 ttactgaaaa aacagtaaat catctttatt atggtcatat ttcacagcac caataaatc 1921 atctttatta agtagatgaa acattaactc taactgtgac acagagatta1 acaat8tacatagtt tatttttcta agttttatt gtttaataca 2041 aatttataat gcagggaag tactactctt aaatgttga gggaagctc cgtaacattg 2101 atgactggct taattggcag taattccag ccgtattgc ataagcatta ctcaagaat gccaactaggag ccaataactgag 2041 tccttgaaaa aggaaaaata ctgaactaaa 2221 tgatagctcc taaacttaca tttaaaggc agacattcct tctacatgta atgacacttc 2281 ttgtgttaaa ctaaaaattt acagagaag aaagtgaaag caatggtagatata tacaata3 tacaata attttcaagc aaatattgt gaaagtattc 2401 taagctaagt tttaatatt acctacaga CAagagtggt atataatag tagatcctga 2461 gaagtacctt tgttacagct accataata tatatagaga gatgtactttaatttattt 2521 tgtgaatgct tttgaaaatg tatatgttcc tttgtaattg acactatata tttcttaata 2581 aaataattct caaatttg

[0202] Accession No. 448: Human IL-33 mRNA 1 acagagctgc agctcttcag ggaagaaatc aaaacaagat cacaagaata ctgaaaaatg 61 aagcctaaaa tgaagtattc aaccaacaaa atttccacag caaagtggaa gaacacagca 121 agcaaagcct tgtgtttcaa gctgggaaaa tcccaacaga aggccaaaga agtttgcccc 181 atgtacttta tgaagctccg ctctggcctt atgataaaaa aggaggcctg ttactttagg 241 agagaaacca ccaaaaggcc ttcactgaaa acaggtagaa agcacaaaag acatctggta 301 ctcgctgcct gtcaacagca gtctactgtg gagtgctttg cctttggtat atcaggggtc 361 cagaaatata ctagagcact tcatgattca agtatcacag gaatttcacc tattacagag 421 tatcttgctt ctctaagcac atacaatgat caatccatta cttttgcttt ggaggatgaa 481 agttatgaga tatatgttga agacttgaaa aaagatgaaa agaaagataa ggtgttactg 541 agttactatg agtctcaaca cccctcaaat gaatcaggtg acggtgttga tggtaagatg 601 ttaatggtaa ccctgagtcc tacaaaagac ttctggttgc atgccaacaa caaggaacac 661 tctgtggagc tccataagtg tgaaaaacca ctgccagacc aggccttctt tgtccttcat 721 aatatgcact ccaactgtgt ttcatttgaa tgcaagactg atcctggagtgtttataggt 781 gttaaggata atcatcttgc tctgattaaa gtagactctt ctgagaattt gtgtactgaa 841 atatctgt ttaagctctc tgaaacttag ttgatggaaa cctgtgagtc ttgggttgag 901 aaccaatgaggaagtaga ctgtaag c gtgacatcta 961 agggaaatga agagtgctta gcatgtgtgg aatgttcc atattatgta taaaaatatt 1021 tttctaatc ctccagttat tctttatt ccctgtat aactgcatct tcaatacaag 1081 tatttaactaa tatcagcagtata gagatacagt 1141 ctgaccttta ctttctcta gttcagtcc agaaagaact tcatatttag agctaggcc 1201 actgaggaaa gagccatagc ttaagtctct atgtagacag ggatccattt taagagcta 1261 taggtaccactcaccagaaa aaaacactaga gctgctagta 1321 aaaagagac cagatgcttc acagaattat cattttca actggaataa aacaccaggt 1381 ttgttgtag atgtcttagg caacactcag agcagatctc ccttactgtc agggatatg 1441 gaggacagcattcagg tag gtgtgaaaaa gtaagataa 1501 ctaaaaaatt tagaaaaata atccagtat ttgtaagtg ataacttca tttctaattg1561 tttaattttt aaaattctga ttttatata ttgagtttaa gcaaggcatt cttacacgag 1621 gaagtgaagt aaattttagt tcagacataa aatttcactt attaggaata tgtaacatgc 1681 taaaactttt ttttttaa agagtactga gtcattga catataatcc aactatcatg gtaaggccag aaatcttcta acctaccaga gcctagatga 1801 gacaccgaat taacattaaa atttcagtaa ctgactgtcc ctcatgtcca tggcctacca 1861 tcccttctga ccctggcttc cagggaccta tgtcttttaa cacatcagc 1921 aaagttgctt ctaatcctta tttcccatgt gcacaagtct ttttgtattc cagcttcctg 1981 ataacactgc ttactgtgga atattcattt gacatctgtc tcttttcatt tcttttaact 2041 accatgccct tgatatatct tttgcaccttg ctgaacctcttcctcctc1010 tggatgccaa aacgtttatt ctgctttgtc tgttgtagaa ttttagataa agctattaat 2161 ggcaatattt tttgctaaa cgtttttgtt ttttactgtc actagggcaa taaaatttat 2221 actcaaccat atataacat ttttaacta ctaaaggatt agttaact 2828 agcaatttct attacaactt ttcttagact taacacttat gataaatgac taacatagta 2341acagaatctt tatgaaatat gaccttttct gaaaatacat acttttacat ttctacttta 2401 ttgagaccta ttagatgtaa gtgctagtag aatataagat aaaagaggct gagaattacc 2461 atacaagggt attacaactg taaaacaatt tatctttgtt tcattgttct gtcaataatt 2521 gttaccaaag agataaaaat aaaagcagaa tgtatatcat cccatctgaa aaacactaat 2581 tattgacatg tgcatctgta caataaactt aaaatgatta ttaaataatc aaatatatct 2641 actacattgt ttatattatt gaataaagta tattttccaa atgta

[0203] Accession No. 449: Cynomolgus monkey IL-33 mRNA 1 agagctgcag ctcttcaggg aagaaatcaa aacaagacca caagaagcct gaaaaatgaa 61 gcctaaaatg aagtattcaa ccaacaaaat ttccacagca aagcggaaga acacagcaag 121 caaagccttg tgtttcaagc tgggaaaatc ccaacagaag gccaaagaag tttgccacgt 181 gtactttatg aagctccgct ctggccttat gataaaaaag gaggcctgtt actttaggag 241 agaaaccacc aaaaggcctt cactgaaaac aggtggaaac cacaaaggac atctggtact 301 cgctgcctgt caacagcagt ctactgtgga gtgctttgcc tttggtatat caggggtccc 361 gaaatatact agagcacttc atgattcaag tatcacagga atttcaccta ttacagaatc 421 tcttgcttct ctaagcacat acaatgatca atccattact tttgctttgg aggatgaaag 481 ttatgagata tatgttgaag acttgaaaaa agataaaaag aaagataagg tgttactgag 541 ttactatgag tctcaacacc cctcaagtga atcaggtgat ggtgttgatg gtaagatgtt 601 aatggtaacc ctgagtccta caaaagactt ctggttgcaa gccaacaaca aggagcactc 661 tgtggagctc cataagtgtg aaaaaccact gccagaccag gccttctttg tccttcataa 721 taggtccttc aactgtgttt catttgaatg caagactgatcctggagtgt ttataggtgt 781 aaaggataat catcttgctc tgattaaagt agactattct gagaatttgg gtagtgagaa 841 tatcttgttt aagctctctg aaatttagtt gatggaaact tgtgggtctt gggttgagta 901 cccaaatgct accactggag aaaggaatgaa agataaagaa agagacagta acatctaagg 961 gaaacgaaga gtgcttagca tgctgtggaa tgtttcctt attatacata aaaatattt 1021 ttctaatgct tcagttctt tttctttcc ctctgtaa ctgcatattc aatgcaagta 1081 tcagtatatt aaatagggta ttggtaaaga aactgtcaac attctaaaga gatacaatct 1141 gactttcact tttctctagt ttcagtccag aaagaacttc acatttagag ctaaggccac 1201 tgaggagaga cagagccata gcttgtctct ctgtagacag ggatccattt taaagagcta 1261 cttagagaaa taattttccc ccgttccaaa caataggctc aaacactaga gctctagta 1321 aaaacaagac cagatgcttc acagagttat cattttttca actggaataa aacaccagct 1381 ttgtttgtag atgtcttagg caacactcag agcagctgtc cctgtc agggatacgtact 1501tttctaattg 1561 tttaattttt aaaattctga ttcttatata ttgaatttac tttaagcaag gcattcttac 1621 attaggaagt gaattttagt tcagacataa aatttcattt attgggaata tgtaacatgc 1681 taaaactttt tttttttta aagtactaag ccacaacatg ttttagagca tccaggtacc 1741 acataattac aatccatggt aaggccagaa atcctctaac ctactacagc ctagatgaga 1801 caccgaatta acattaacat ttcagtaact gactgtccct catgttcatg gcctaccatc 1861 ccttctgacc ctggcttcca cagacctatg tcttttgata tactcgcagt cacactgggt 1921 gaagttgctt ttaatccttg cttcccatgt gctcaagtct ttttgttgtc cagcttcctg 1981 ataaccctgc ttactgtgga atattcattt gacatctgtc tcttttcatt tcttttaact 2041 accatgtcct tgatatacct tttgcacccc ctgaatttca tttctgtatc acctgacct 2101 tggatgccaa cacatttatt ctgcttttc tattgtagag ttttagataa acctattaat 2161 ggcaatattt tttgctaaac atctttgtt tttactgtca ctagggcaat aacatttata 2221 ctcaaatata taacatttt ttaactacta aaagaatagt ttttaaagtc ttagcaatgt 2281 cttttgcaat tttcttaga cttaatactt atgataaatg actaacatag taacagaata2341 tgaaatatga ccttttctga aagtatgtac ttttaaatt ctactatatt gaaactatt 2401 agatgtaagt gctggtagaa tataagataa aagaggctga gaattactat atcagggtat 2461 tacaattgta aaacaatata tcttgtttc attgttttgt caataattgt taccaaggag 2521 ataaaaataa aagcagaatg tgtatcatcc cttctgaaaa acactaatta ttgatgtgtg 2581 catctgtacg ataaactaa aatgattatt aataaccaa atatatctac tacattgttt 2641 atattattga ataaaatata tttccaaaa gta

[0204] Sequence number 450: Mouse IL-33 mRNA 1 aagaggaact gcagctgcag aagggagaaa tcacggcaga atcatcgaga aacctgaaaa 61 atgagaccta gaatgaagta ttccaactcc aagatttccc cggcaaagtt cagcagcacc 121 gcaggcgaag ccctggtccc gccttgcaaa ataagaagat cccaacagaa gaccaaagaa 181 ttctgccatg tctactgcat gagactccgt tctggcctca ccataagaaa ggagactagt 241 tattttagga aagaacccac gaaaaagatat tcactaaaat cgggtaccaa gcatgaagag 301 aacttctctg cctatccacg ggattctagg aagagatcct tgcttggcag tatccaagca 361 tttgctgcgt ctgttgacac attgagcatc caaggaactt cacttttaac acagtctcct 421 gcctccctga gtacatacaa tgaccaatct gttagtttg ttttggagaa tggatgttat 481 gtgatcaatg ttgacgactc tggaaaagac caagagcaag accaggtgct actacgctac 541 tatgagtctc cctgtcctgc aagtcaatca ggcgacggtg tggatgggaa gaagctgatg 601 gtgaacatga gtcccatcaa agacacagagac atctggctgc atgccaacga caaggactac 661 tccgtggagc ttcaaagggg tgacgtctcg cctccggaac aggccttctt cgtccttcac 721 aaaaagtcct cggactttgt ttcatttgaa tgcaagaatc ttcctggcacttacatagga 781 gtaaaagata accagctggc tctagtggag gagaaagatg agagctgcaa caatattatg 841 tttaagctct cgaaaatcta atgcagtaaa acgcctgtgc gttctgggtt gatgactta 901 atgcttccaa ggtacagagagag cttacgatgt 961 tgtggaatgt tattatgtag aaaacttctt ttatttcctt ttctcagct acatgttcaa 1021 tagactcaca gatatatgac tcagcgttg ggtaagaaa ctgaaggaga ttcagccttg 1081 ctgacttttcctt tgacttgt actcacggac ttcagagag 1141 caggcaccac agtgcatggt ttgctttaga gagggtccat ttcaaaacc ttcataaaa 1201 caatgcaaaa caaaaaaaccgaacaa aaaaccacct atttcctgt tctaaaaccaaa tcattagattgaat 1261 gaccagctag ggggaggatc acctagggga 1321 ggaccagcta gggggac cagctgctgc aagactgac tgtttctcac ttatataaa 1381 atgccaatg cctccgcaga tgccccaggc aaccctcaga tcagcct1tggct4tggctt ctgt4cgattt tggctt tccttcttaa acttccattt tttcttttt aacacattta 1501 acatttaact ttaagcaagc cagcttacat taggagtga aagacatttt agttcccacc1561 cgtgattgaa atcattgact atatctaaca agcttaaagt ctcctgtaag aactgatcag 1621 gatatacact aggacatgcc aatagaatgg gatctcatgg tgcagtctga agccctccaa 1681 ctggagagac gctaacatca tccttctcgc tgatttccaa ggagctatga ctttggatgc 1741 atgcatctgc ttggatgaga tgtctcggct gcttgctttc cttatgcaca cgttctgttc 1801 agcttcacag cagcaatgct cacggtggaa tagcttagct tagcttctgc cccttctttg 1861 gttcttttga ccaccatatc cgtaacggct ctcctactcc ctcagctttc tttctctttg 1921 ctctgacgtc tatatgccaa cacacttatt ccactgtctt taccctgcac tgcagaattt 1981 tacatctacc tactggttac caggttgtcc cctgaacaac cttcctttgt gttttactgt 2041 tattaaagta gtaatatttg tattcaacca tgtagtaata ttttaagcca ctaaaggaat 2101 agttttactt atttagacaa cagcaatttc tactacattt ttataagctt aaaacttaca 2161 tgttttaaaa cttaaaacga taaagacaat aacaacattg atggagtatg atatgacagt 2221 tcagaaaggg ttagctctta tcttccagtc gaggaaacct attgtataca atagctggag 2281 gaatgtatga tcaaagaggc cgggaaccgc cgtgtaggat cgtacggctg taacaggtat 2341aattgtttca ttaatttgtc acagtcttac tgtagaggaa tgtaaaggcg gaatctgcgt 2401 cattcctctg gaaaccacag tgttgactct gtgaatctgt acgatatctt taaagtagta 2461 actacgtagt caaatgtgtt cttgacgttg ttcataactt tgaataaacc atttttcaaa 2521 accacgtgtg accacaaa

Claims

1. A nucleic acid molecule or a salt thereof, or a solvate thereof, which can inhibit the expression of a target protein or a target gene and contains a sense strand and an antisense strand, wherein the sense strand has a length of 21 nucleotides, the antisense strand has a length of 21, 22 or 23 nucleotides, the sense strand contains 2'-deoxy-2'-fluoro modified nucleotides and modified nucleotides, the 2'-deoxy-2'-fluoro modified nucleotides are located at the 7th, 9th, 10th, 11th, and 15th positions from the 5'-end of the sense strand, and the modified nucleotides are independently nucleotides, deoxynucleotides, or bicyclic sugars in which the 2'-position of the nucleotide is 2'-OR ２ , 1 , １ , ３ , ２ , １ , ３ , １ , ３ , ２ 、2'-R １ 、2'-R ２ OR １ 、2'-SH, 2'-SR １ 、2'-NH ２ 、2'-NHR 1 、2'-NR １ ２ 、2'-NHAc、2'-N ３ 、2'-CN、2'-Cl、2'-Br、2'-I、2'-R ２ C(O)XR ３ (in each group, R １ is alkyl or aryl; R ２ is alkylene; X is an oxygen atom, NH or NR １ ; R ３ is alkyl), and a nucleic acid molecule or a salt thereof, or a solvate thereof, which contains a nucleotide, a deoxynucleotide, or a bicyclic sugar substituted with a group selected from the group consisting of.

2. The sense strand and antisense strand each have a double-stranded region with a blunt end at the 3' end of the sense strand, wherein, when the antisense strand is 21 nucleotides long, it has the sequence of formula IV-(1-1) in the 5'→3' direction of the antisense strand; when it is 22 nucleotides long, it has the sequence of formula IV-(1-2) in the 5'→3' direction of the antisense strand; and when it is 23 nucleotides long, it has the sequence of formula IV-(1-3) in the 5'→3' direction of the antisense strand; the nucleic acid molecule or a salt thereof according to claim 1, or a solvate thereof; Formula IV-(1-1): (5')Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z(3') Formula IV-(1-2): (5')Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'(3') Formula IV-(1-3): (5')Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z'-Z-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'(3') In each of the above formulas, F is a 2'-deoxy-2'-fluoro modified nucleotide, Z' and Z are modified nucleotides, and Z' independently has a 2'-OR at the 2' position of the nucleotide １ , 2'-R １ , 2'-R ２ OR １ , 2'-SH, 2'-SR １ , 2'-NH ２ , 2'-NHR 1 , 2'- NR １ ２ , 2'-NHAc, 2'-N ３ , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R ２ C (O)XR ３ (In each group, R １ R is alkyl or aryl; ２ is an alkylene; X is an oxygen atom, NH or NR １ And; R ３ A modified nucleotide containing a bicyclic sugar, which is substituted with a group selected from the group consisting of (where is alkyl), and Z is independently the 2' position of the nucleotide being 2'-OR １ , 2'-R １ , 2'-R ２ OR １ , 2'-SH, 2'-SR １ , 2'-SR １ , 2'-NH ２ , 2'-NHR 1 , 2'- NR １ ２ , 2'-NHAc, 2'-N ３ , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R ２ C (O)XR ３ (In each group, R １ R is alkyl or aryl; ２ is an alkylene; X is an oxygen atom, NH or NR １ And; R ３ A modified nucleotide, deoxynucleotide, or bicyclic sugar substituted with a group selected from the group consisting of (where is alkyl).

3. A nucleic acid molecule or a salt thereof according to claim 2, wherein the Z' at position 12 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F, the Z' at positions 9 and 10 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F, the Z' at positions 8 and 9 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F, or the Z' at positions 8, 9 and 10 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F.

4. The Z' is a deoxyribonucleotide, or a nucleotide whose 2' is 2'-OR １ A nucleotide modified with a group selected from the group consisting of , and 2'-F, wherein Z is a deoxyribonucleotide, or the 2' of the nucleotide is 2'-OR １ A nucleic acid molecule or salt thereof according to claim 2, or a solvate thereof, which is a nucleotide modified with 5. When the antisense strand is 21 nucleotides in length, it consists of any one of the sequences of Formula IV-(2-1) to (9-1) below; when it is 22 nucleotides in length, it consists of any one of the sequences of Formula IV-(2-2) to (9-2) below; when it is 23 nucleotides in length, it consists of any one of the sequences of Formula IV-(2-3) to (9-3) below. The nucleic acid molecule or its salt, or their solvate according to claim 2; Formula IV-(2-1): (5')Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z(3') Formula IV-(2-2): (5')Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z(3') Formula IV-(2-3): (5')Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z(3') Formula IV-(3-1): (5')Z-F-Z-Z-Z-F-Z-Z-F-F-Z-Z-Z-F-Z-F-Z-F-Z-Z-Z(3') Formula IV-(3-2): (5')Z-F-Z-Z-Z-F-Z-Z-F-F-Z-Z-Z-F-Z-F-Z-F-Z-Z-Z-Z(3') Formula IV-(3-3): (5')Z-F-Z-Z-Z-F-Z-Z-F-F-Z-Z-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z(3') Formula IV-(4-1): (5')Z-F-Z-Z-Z-F-Z-Z-F-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z(3') Formula IV-(4-2): (5')Z-F-Z-Z-Z-F-Z-Z-F-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z(3') Formula IV-(4-3): (5')Z-F-Z-Z-Z-F-Z-Z-F-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z(3') Formula IV-(5-1): (5')Z-F-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-F-Z-F-Z-Z-Z-Z-Z(3') Formula IV-(5-2): (5')Z-F-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-F-Z-F-Z-Z-Z-Z-Z-Z(3') Formula IV-(5-3): (5')Z-F-Z-Z-Z-F-Z-F-F-F-Z-Z-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z(3') Formula IV-(6-1): (5')Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3')Formula IV-(6-2): (5′)Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F(3′) Formula IV-(6-3): (5′)Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3′) Formula IV-(7-1): (5′)Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3′) Formula IV-(7-2): (5′)Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F(3′) Formula IV-(7-3): (5′)Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3′) Formula IV-(8-1): (5′)Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3′) Formula IV-(8-2): (5′)Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z(3′) Formula IV-(8-3): (5′)Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z(3′) Formula IV-(9-1): (5′)Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z(3′) Formula IV-(9-2): (5′)Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z(3′) Formula IV-(9-3): (5′)Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z(3′) 6. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of claims 1 to 5, wherein at least 11 of the modified nucleotides of the sense strand are 2'-O-alkyl-modified nucleotides, and at least 11 of the modified nucleotides of the antisense strand are 2'-O-alkyl-modified nucleotides.

7. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of claims 1 to 5, wherein at least 11 of the modified nucleotides of the sense strand are 2'-O-methyl (2'OMe) modified nucleotides, and at least 11 of the modified nucleotides of the antisense strand are 2'-O-methyl (2'OMe) modified nucleotides.

8. The modified nucleotides of the sense strand and / or the antisense strand include one or more nucleoside bond modifications selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds, wherein the hydroxyl groups at the 3' and / or 5' positions of the nucleotides at the 1 position from the 3' and / or 5' ends of the sense strand and / or the antisense strand are phosphate groups (P(O)(OH) ２ ) or thiophosphate group (P(S)(OH) ２ A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of claims 1 to 5, comprising a nucleotide substituted with () and / or the nucleotide at position 1 from the 5' end and / or 3' end of the sense strand and / or the antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate.

9. A nucleic acid molecule or salt thereof, or a solvate thereof, wherein a functional molecule, a debasalized nucleotide, a nucleotide, a modified nucleotide, or a combination thereof is bound to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule or salt thereof according to any one of claims 1 to 5.

10. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of claims 1 to 5, wherein the nucleic acid molecule is siRNA.

Images