Method for mass-producing peptide snap-8 derivative

Abstract

The present invention relates to a method for mass-producing a peptide SNAP-8 derivative for reducing skin wrinkles. By using an expression vector for preparing an SNAP-8 derivative and a transformant comprising same, of the present invention, a high-purity SNAP-8 derivative can be mass-produced at low cost. In addition, SNAP-8 derivatives produced according to the present invention have an excellent anti-wrinkle effect, and thus can be widely used in industrial fields for related applications, such as cosmetic materials, quasi-drugs, and medicines.

Description

Mass production method of peptide SNAP-8 derivatives

[0001] The present invention relates to a method for mass production of peptide Snap-8 derivatives.

[0002] The skin covers the entire body and is largely composed of a three-layer structure consisting of the epidermis, dermis, and subcutaneous fat. Among these, the stratum corneum exists within the epidermis, the outermost layer, and acts as a skin barrier that protects the body from various external irritants. While the stratum corneum and the layered structure of the skin enable effective protection against external stress or harmful stimuli, they may also hinder the easy absorption of active ingredients from cosmetics.

[0003] In this technical field, alongside the development of new materials for functional cosmetics with whitening, anti-wrinkle, antioxidant, and anti-aging properties, a critical task is to increase the transdermal absorption rate when actually applied to the skin. Because active ingredients cannot be smoothly absorbed due to the skin's excellent barrier, even ingredients with outstanding efficacy may fail to exert their full effect when applied to the skin.

[0004] Meanwhile, SNARE (Soluble Nethylmaleimide-sensitive factor Attachment Protein Receptor; SNAP Receptor) peptides refer to a specific group of proteins present in all species, and their main role is mediating vesicle fusion. In other words, SNAREs are involved in the binding of synaptic vesicles and presynaptic membranes in neurons.

[0005] A neurotransmitter release pathway is opened by membrane fusion between a synaptic vesicle located at a nerve terminal containing neurotransmitters and the presynaptic membrane. This involves the t-SNARE complex, which is a complex of Syntaxin 1a protein and SNAP-25 protein attached to the target membrane, and v-SNARE attached to the vesicle, and these SNARE peptides are twisted like a pretzel.

[0006] Since biological membranes strongly repel each other, they do not fuse spontaneously; instead, strong external forces must be applied to overcome the repulsive forces between the membranes, and it is known that SNARE peptides provide these forces. As such, the formation of SNARE complexes is a major phenomenon of exocytosis, which includes the release of neurotransmitters.

[0007] The elimination action of SNARE complexes is closely related to skin wrinkles. For example, Botox, which is used to improve skin wrinkles, is a protease that cleaves SNARE peptides involved in the elimination of neurotransmitters. By cleaving SNARE peptides, it blocks neurotransmission and, consequently, paralyzes muscle cells into which Botox has been injected, thereby affecting the improvement of skin wrinkles.

[0008] The inventors of the present invention have made diligent research efforts to develop a peptide with an anti-wrinkle effect that can be economically mass-produced. As a result, the present invention was completed by identifying that economical mass production of SNAP-8 derivatives is possible when using the production method of the present invention.

[0009] The problem that the present invention aims to solve is to provide an expression vector for the production of SNAP-8 derivatives.

[0010] Another problem that the present invention aims to solve is to provide a transformant comprising an expression vector for producing SNAP-8 derivatives.

[0011] Another problem that the present invention aims to solve is to provide a method for manufacturing SNAP-8 derivatives.

[0012] The problems of the present invention are not limited to the technical problems mentioned above, and other unmentioned technical problems will be clearly understood by those skilled in the art from the description below.

[0013] The inventors have made diligent research efforts to develop a peptide with an anti-wrinkle effect that can be economically mass-produced. As a result, it was found that economical mass production of SNAP-8 derivatives is possible when using the production method of the present invention.

[0014] The present invention relates to an expression vector for producing SNAP-8 derivatives, a transformant comprising an expression vector for producing SNAP-8 derivatives, and a method for producing SNAP-8 derivatives using the same.

[0015] The present invention will be described in more detail below.

[0016]

[0017] One aspect of the present invention relates to an expression vector for producing a SNAP-8 derivative comprising a polynucleotide sequence encoding a SNAP-8 (Acetyl octapeptide-3) derivative represented by SEQ ID NO. 1, wherein the polynucleotide sequence is operably linked to a promoter sequence that can be expressed in E. coli, and one or more fusion partner sequences selected from the group consisting of fusion partner BJ001, fusion partner BJ002, and fusion partner BJ003 sequences.

[0018] In the present invention, the term "Acetyl octapeptide-3 (SNAP-8)" refers to a peptide cosmetic ingredient with anti-wrinkle efficacy. It has the disadvantage of being produced by chemical synthesis, which results in a high unit cost and the potential inclusion of various chemical substances. Accordingly, to compensate for this, the inventors have prepared a strain that produces SNAP-8 (short nucleic acid sequence, EEMQRRAD) through gene work and have produced SNAP-8 through microbial fermentation.

[0019] In the present invention, the term "SNAP-8 derivative" refers to a peptide in which P is additionally attached to the front of an existing SNAP-8 sequence, and the peptide produced as a multimer can be converted into a monomer by using a cleavage method that controls the heating temperature and pH of a solution containing the multimer SNAP-8 derivative during the separation and purification process.

[0020] Thus, the present invention is a more economical and efficient peptide purification method that compensates for the disadvantages of existing Ni purification methods, which are inefficient due to cost and time issues, and the high cost of buffer components such as imidazole and guanidine added during Ni purification.

[0021] The term "expression vector" of the present invention may refer to a gene construct comprising an essential regulatory element operably linked to express a target peptide, specifically a SNAP-8 derivative, as a means for efficiently inducing the expression of a target gene by introducing DNA into a host cell.

[0022] Specific examples of the above expression vectors include plasmid vectors, cosmid vectors, bacteriophage vectors, or virus vectors. More specific examples include plasmids derived from Escherichia coli (pBR322, pBR325, pUC118, pUC119, pET30a, pET30c, or pGEX-GST), plasmids derived from Bacillus subtilis (pUB110 or pTP5), plasmids derived from yeast (YEp13, YEp24, YCp50, pPINKα-HC, pPink-HC, or pPink-LC), or Ti plasmids. Additionally, animal viruses such as retroviruses, adenoviruses, or vacciniaviruses, insect viruses such as baculoviruses, or plant viruses may be used, and binary vectors such as pPZP, pGA, and pCAMBIA series may be used, but are not limited thereto as long as the expression cassette of the present invention can be introduced into a host cell.

[0023] In addition, the expression vector may be functionally linked to an expression regulatory sequence. As a specific example, the vector may include, but is not limited to, signal sequences or leader sequences for membrane targeting or secretion in addition to expression regulatory elements such as promoters, operators, start codons, stop codons, polyadenylation signals, and enhancers, and may be manufactured in various ways depending on the purpose of the invention. Additionally, it may include selectivity markers and may self-replicate or be incorporated into host DNA. The vector of the present invention may be manufactured using gene recombination technology well known in the art, and site-specific DNA cleavage and ligation may be performed using enzymes generally known in the art.

[0024] In the present invention, the expression vector may include a polynucleotide sequence encoding the SNAP-8 derivative.

[0025] The nucleotide sequences used in the present invention are interpreted to include sequences that exhibit substantial identity with the sequences listed in the sequence list, provided that variations having biologically equivalent activity are taken into account. The term "substantial identity" refers to a sequence that exhibits at least 60% homology, more specifically 70% homology, even more specifically 80% homology, and most specifically 90% homology when the sequence of the present invention is aligned with any other sequence to correspond as much as possible and the aligned sequence is analyzed using an algorithm commonly used in the art.

[0026] Accordingly, a nucleotide sequence having high homology with the nucleotide sequence represented by SEQ ID NO. 1, for example, a nucleotide sequence having high homology of 70% or more, specifically 80% or more, and more specifically 90% or more, should also be interpreted as being included within the scope of the present invention.

[0027] According to one embodiment of the present invention, the expression vector for producing the SNAP-8 derivative may include a polynucleotide sequence encoding the SNAP-8 derivative represented by SEQ ID NO. 1 repeated multiple times.

[0028] In addition, the expression vector for producing the SNAP-8 derivative may be one in which a polynucleotide sequence encoding the SNAP-8 derivative represented by SEQ ID NO. 1 is operably linked to a promoter sequence and a high-expression / high-secretion signal sequence that can be expressed in E. coli.

[0029] As a specific example, the promoter may be Trc, but is not particularly limited thereto as long as it is a promoter suitable for expression in E. coli. The sequence of the promoter exemplified above may be any sequence known in the art.

[0030] As another specific example, the above-mentioned high-expression / high-secretion signal sequence may be fusion partner BJ001, fusion partner BJ002, and / or fusion partner BJ003, but is not particularly limited thereto as long as it can increase efficiency. The above-mentioned high-expression / high-secretion signal sequence may be any sequence known in the art.

[0031] In the present invention, the term "operably linked" refers to a state in which a nucleic acid expression regulatory sequence and a nucleic acid sequence encoding a target protein or peptide are functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or peptide may be operably linked to influence the expression of the coding sequence. Operatory linkage with an expression vector can be prepared using gene recombination technology well known in the art, and site-specific DNA cleavage and linkage can be performed using enzymes generally known in the art.

[0032] In addition, the expression vector for producing the SNAP-8 derivative may further include a polynucleotide encoding His upstream or downstream of the polynucleotide sequence in the expression cassette to facilitate the purification of the expressed multimer SNAP-8 derivative.

[0033] In addition, the expression vector for producing the SNAP-8 derivative may further include components that regulate the expression of the SNAP-8 derivative, such as transcription enhancers, termination factors, initiators, and other genetic regulatory factors, in addition to sequences such as a promoter, a high-expression / high-secretion signal sequence, a sequence encoding the SNAP-8 derivative, and His.

[0034] In one embodiment of the present invention, an expression vector for producing a SNAP-8 derivative was constructed in which a Trc promoter sequence, a lac operator sequence, a ribosome binding site (RBS) sequence, a fusion partner BJ0O3 sequence, a polynucleotide sequence encoding a SNAP-8 derivative, a T7 terminator sequence, and a rrnB terminator sequence were sequentially inserted (see FIG. 1d).

[0035] Specifically, in the present invention, the expression vector (plasmid) BJY0O3 was finally constructed using an in-fusion cloning method after amplifying the respective gene regions of pTrcHis2A, pET26b, and pGNX4 by PCR. PCR amplification was performed using Pfu DNA polymerase by repeating 30 cycles at 94°C for 5 minutes, followed by 94°C for 1 minute, 55°C for 1 minute, and 72°C for 5 minutes, and finishing at 72°C for 10 minutes. The amplified genes were methylated using DpnI restriction enzyme, and the gene fragments were ligated using T4 DNA polymerase.

[0036] More specifically, a fragment containing the lac repressor, trc promoter, lac operator, ribosome binding site (RBS), and rrn terminator genes was obtained from pTrcHis2A, and a fragment containing the rrnB terminator, kanamycin resistance gene, and pBR322 origin of replication site was obtained from pGNX4, and the two DNA fragments were ligated using T4 DNA polymerase and then transformed into E. coli BL21 cells. Next, a fragment containing the fusion partner BJ0O3 sequence and a multiple cloning site was obtained from pET26b and the multiple cloning site of the aforementioned plasmid was replaced. Finally, a fragment containing genes including the lac operator, ribosome binding site (RBS), fusion partner BJ0O3, and T7 terminator was obtained from pET26, and the BJY0O3 plasmid was finally constructed by inserting it between the multiple cloning site of the aforementioned plasmid and the rrn terminator gene.

[0037]

[0038] Another aspect of the present invention relates to a transformant comprising an expression vector for producing the above-described SNAP-8 derivative.

[0039] The term "transformed organism" in this invention refers to an organism whose genetic traits have been altered by the introduction of foreign genetic material.

[0040] As a specific example, the transformant may be a strain of the genus Escherichia, Pichia, Saccharomyces, Zygosaccharomyces, Kluyveromyces, Candida, Schizosaccharomyces, Issachenkia, Yarrowia, or Hansenula, but is not particularly limited thereto as long as it can express the SNAP-8 derivative.

[0041] More specifically, the transformant may be Escherichia, but is not particularly limited thereto as long as it can express the SNAP-8 derivative.

[0042] In one embodiment of the present invention, the expression vector for producing the SNAP-8 derivative was introduced (transgenic) into an E. coli strain by a conventional method to produce a transformant (see Preparation Example).

[0043]

[0044] Another aspect of the present invention relates to a method for producing a SNAP-8 derivative, comprising the steps of: culturing a transformant comprising the expression vector for producing a SNAP-8 derivative described above; and isolating and purifying a peptide expressed from the cultured transformant.

[0045] The step of culturing the above-mentioned transformant can be performed by taking into account the nutritional requirements of the transformant.

[0046] As a specific example, for the culture of E. coli, Luria Bertani broth (LB) medium, Terrific broth (TB) medium, etc. may be used, but is not limited thereto and may be appropriately selected by those skilled in the art to suit the purpose of the invention.

[0047] In addition, the recovery of SNAP-8 derivatives from the culture of the above-mentioned transformant may be carried out by methods known in the art. Specifically, methods such as centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, fractional dissolution (e.g., ammonium sulfate precipitation), and chromatography (e.g., ion exchange, affinity, hydrophobic, and size exclusion) may be used, but are not particularly limited thereto as long as the SNAP-8 derivatives of the present invention can be recovered.

[0048] In the present invention, the step of isolating and purifying the SNAP-8 derivative expressed from the cultured transformant may further include the step of cleaving the expressed multimer SNAP-8 derivative into a monomer SNAP-8 derivative. At this time, the step of isolating and purifying the SNAP-8 derivative expressed from the cultured transformant may be performed by controlling the heating temperature and pH of the solution containing the multimer SNAP-8 derivative (heating / pH purification).

[0049] In the present invention, the heating temperature may be 40 to 100°C, and the pH may be 1 to 8.

[0050] In one embodiment of the present invention, an E. coli transformant containing the expression vector for producing the SNAP-8 derivative was cultured, collected, and lysed to isolate the SNAP-8 derivative. In addition, the multimer SNAP-8 derivative was separated and purified into a monomer SNAP-8 derivative using the heating / pH purification method described above, and the SNAP-8 derivative product was confirmed through HPLC analysis (see Preparation Example).

[0051]

[0052] Another aspect of the present invention relates to a pharmaceutical composition for preventing or treating skin wrinkles comprising a SNAP-8 derivative prepared by the method described above.

[0053] The pharmaceutical composition of the present invention includes all formulations, not necessarily limited to a specific formulation, and specific examples of formulations include plasters, granules, lotions, liniments, lemonades, aromatic waters, powders, syrups, liquids and solutions, aerosols, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, tablets, suppositories, injections, spirits, cataplasmas, capsules, creams, and troches. It may be any one selected from tinctures, pastes, pills, or soft or hard gelatin capsules.

[0054] Additionally, the pharmaceutical composition of the present invention may further comprise pharmaceutically acceptable carriers, diluents, or excipients. Available carriers, excipients, or diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, and one or more selected from these may be used.

[0055] Meanwhile, the content of the active ingredient peptide of the present invention included in the pharmaceutical composition of the present invention is preferably adjusted according to the method of use and the condition of the user. Preferably, it may be added to the pharmaceutical composition in an amount of 0.000001 to 50% by weight based on dry weight, but is not necessarily limited to this amount. However, if the content is less than 0.000001% by weight, the pharmacological effect may be negligible, and if it exceeds 50% by weight, the rate of increase in pharmacological effect relative to the amount used may be low, making it uneconomical. However, the dosage of the pharmaceutical composition of the present invention should be determined by considering the method of administration, the age, gender, and body weight of the user. For example, the composition of the present invention may be administered one or more times per day at a rate of 0.000001 to 1 g / kg (body weight). However, the above dosage is merely an example for illustrative purposes and may vary depending on the condition of the user.

[0056]

[0057] Another aspect of the present invention relates to a cosmetic composition for preventing or improving skin wrinkles comprising a SNAP-8 derivative prepared by the method described above.

[0058] The cosmetic composition of the present invention is not limited to a specific form (formulation) and can be prepared in a formulation selected from the group consisting of solutions, topical ointments, creams, foams, nourishing lotions, softening lotions, packs, softening waters, emulsions, makeup bases, essences, soaps, liquid cleansers, bath additives, sunscreen creams, sun oils, suspensions, emulsions, pastes, gels, lotions, powders, soaps, surfactant-containing cleansing products, oils, powder foundations, emulsion foundations, wax foundations, patches, and sprays, but is not limited thereto.

[0059] The cosmetic composition of the present invention may additionally include one or more cosmetically acceptable carriers that are incorporated into general skin cosmetics, and may appropriately incorporate, for example, oils, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, pigments, preservatives, fragrances, etc., as conventional ingredients, but is not limited thereto.

[0060] The cosmetically acceptable carriers included in the cosmetic composition of the present invention vary depending on the formulation of the cosmetic composition.

[0061] When the formulation of the present invention is an ointment, paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more types.

[0062] When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, etc. may be used as a carrier component, and in particular, in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether may be additionally included, but is not limited thereto. These may be used alone or in a mixture of two or more types.

[0063] When the formulation of the present invention is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, etc., may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan may be used, but are not limited thereto. These may be used alone or in a mixture of two or more.

[0064] When the formulation of the present invention is a suspension, liquid diluents such as water, ethanol, or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more.

[0065] When the formulation of the present invention is a soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolysates, isethionates, lanolin derivatives, aliphatic alcohols, vegetable oils, glycerol, sugars, etc. may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more types.

[0066] In the case where the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfates, aliphatic alcohol ether sulfates, sulfosuccinic acid monoesters, isethionates, imidazolinium derivatives, methyl taurate, sarcocitates, fatty acid amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters may be used as carrier components, but are not limited thereto. These may be used alone or in a mixture of two or more types.

[0067] In addition, the cosmetic composition of the present invention may contain auxiliary agents commonly used in the cosmetic field, such as hydrophilic or lipophilic gelling agents, hydrophilic or lipophilic active agents, preservatives, antioxidants, solvents, fragrances, fillers, blockers, pigments, absorbents, and dyes.

[0068]

[0069] Another aspect of the present invention relates to a quasi-drug composition for preventing or improving skin wrinkles, comprising a SNAP-8 derivative prepared by the method described above.

[0070] The quasi-drug composition of the present invention may be prepared in a formulation selected from the group consisting of body cleansers, soaps, and hand washes, but is not limited thereto.

[0071]

[0072] Meanwhile, the terms 'peptide' and 'protein' used in this specification are distinguished by length or molecular weight, but may be used interchangeably as necessary for the purposes of the present invention.

[0073] The present invention relates to a method for mass-producing peptide Snap-8 derivatives for improving skin wrinkles. By using the expression cassette, expression vector, and transformant containing the same for producing SNAP-8 derivatives according to the present invention, high-purity SNAP-8 derivatives can be produced in large quantities at a low cost. Furthermore, since the SNAP-8 derivatives produced according to the present invention have excellent anti-wrinkle effects, they can be widely used throughout the industry, such as cosmetic materials, quasi-drugs, and pharmaceuticals for related applications.

[0074] The effects according to the embodiments of the present invention are not limited to those exemplified above, and a wider variety of effects are included in this specification.

[0075] FIGS. 1a to 1d are vector maps manufactured according to an embodiment of the present invention, where FIG. 1a is BJY000, FIG. 2b is BJY001, FIG. 2c is BJY002, and FIG. 2d is BJY003 vector map.

[0076] Figure 2 is a figure confirming the amount of protein expression produced in a strain for producing SNAP-8 derivatives produced according to one embodiment of the present invention.

[0077] FIGS. 3a and 3b are figures showing the amount of protein expression produced according to culture conditions for a strain for producing SNAP-8 derivatives prepared according to one embodiment of the present invention.

[0078] Figure 4 is a figure showing the point where the production yield is maximum according to the culture time for a strain for producing SNAP-8 derivatives produced according to one embodiment of the present invention.

[0079] FIG. 5 is a figure confirming the separation and purification results of a SNAP-8 derivative produced according to one embodiment of the present invention.

[0080] Figures 6a and 6b are figures confirming the production volume of a SNAP-8 derivative produced according to one embodiment of the present invention.

[0081] The present invention will be described in more detail below through examples. These examples are intended solely to explain the invention more specifically, and it will be obvious to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the invention.

[0082]

[0083] Preparation Example. Preparation of SNAP-8 derivative (PEEMQRRAD, PSNAP-8, SEQ ID No. 1) peptide

[0084] 1) Strain preparation

[0085] To construct a strain capable of producing high concentrations of PSNAP-8 as a multimer, a strain was constructed by inserting the PSNAP-8 sequence into a vector. An Escherichia coli strain recognized for safety as a production strain was used.

[0086] First, 12 PSNAP-8 multimers were inserted without an added fusion partner (BJY000). Specifically, 12 PSNAP-8 sequences were inserted into a backbone vector (see Fig. 1a) using the in-fusion method with NdeI and XhoI enzymes, followed by transformation and selection on an LBK plate to construct a strain (E. coli). Subsequently, the sequence of the constructed strain (Sequence No. 2) was verified through colony PCR.

[0087] Primers used: Forward(taagaaggagatatacatatggatccggaagaaatgcagcgc, SEQ ID 9), Reverse(gtggtggtggtgctcgagttaccacggatcagcccgacgctg, SEQ ID 10)

[0088] The expression levels of proteins produced by the synthesized strains were verified. Specifically, the insoluble fraction separated through a pretreatment process (cell lysis -> centrifugation -> pH precipitation) was diluted in 5x SDS sample buffer and heated at 95°C for 10 minutes. Subsequently, electrophoresis was performed using a 4–12% gradient gel (Invitrogen). Proteins separated by size were stained with Coomassie blue and washed with distilled water to identify the stained proteins.

[0089] As a result, as can be seen in Figure 2, the amount of protein expression was minimal, so we intended to increase the amount of expression by replacing the fusion partner.

[0090] Next, a strain was constructed by adding 113 fusion partner sequences selected through screening in front of 12 PSNAP-8 multimer sequences (BJY001). Specifically, 12 PSNAP-8 sequences containing 113 fusion partner BJ001 (MNIRPLHDRVIVKRKEVETKSAGGIVLTGSAAAKSTRGEVLAVGNGRILENGEVKPLDVKVGDIVIFNDGYGVKSEKIDNEEVLIMSESDILAIVEAHHHHHHENLYFQHMMD, SEQ No. 6) were inserted into a backbone vector (see Fig. 1b) using the in-fusion method with NdeI enzyme, followed by transformation and selection on an LBK plate to construct a strain (E. coli). Subsequently, the constructed strain sequence (SEQ No. 3) was verified through colony PCR.

[0091] Primers used: Forward(taagaaggagatatacatatg, SEQ ID 11), Reverse(ttccggatccatcatatgctggaaatacaggttttcgtggtg, SEQ ID 12)

[0092] As a result of checking the protein expression amount using the same method as BJY000, it was found that the expression amount was significantly increased, as can be seen in Figure 2.

[0093] Accordingly, changes in target peptide expression levels were confirmed when the number of multimers was increased to 24 (BJY002). Considering the increasing target peptide sequence, the number of fusion partner sequences was adjusted to add 25 fusion partner sequences to the front to construct a strain. Specifically, a PSNAP-8 sequence containing fusion partner BJ002 (MNIRPLHPWHHHHHHENLYFQHMMD, SEQ No. 7) was inserted into a backbone vector (see Fig. 1c) using the in-fusion method with NcoI enzymes, followed by transformation and selection on an LBK plate to construct a strain (E. coli). Subsequently, the sequence of the constructed strain (SEQ No. 4) was confirmed through colony PCR.

[0094] Primers used: Forward(aatccatggcatcatcatcaccaccacgaaaac, SEQ ID 13), Reverse(gtgccatggatgcaatggacgaatattcatatg, SEQ ID 14)

[0095] Finally, a BJY003 strain with unnecessary TEV sites removed was constructed. Specifically, 19 PSNAP-8 sequences containing (A) 8 Fusion partner BJ003 (MNIRPLHD, SEQ ID NO. 8) and (B) MNIRPLHD sequences for removing H6TEV sites were inserted into a backbone vector (see Fig. 1d) using the in-fusion method with the DpnI enzyme, followed by transformation and selection on an LBK plate to construct a strain (E. coli). Subsequently, the sequence of the constructed strain (SEQ ID NO. 5) was verified through colony PCR.

[0096] primer used:

[0097] (A) Forward(aatattcgtccattgcatgatccggaagaaatgcagcgccgc, sequence number 15), Reverse(cagcgtcgggctgattaatggtaactcgagcaccaccaccac, sequence number 16)

[0098] (B) Forward(ctcgagcaccaccaccaccaccactga, sequence number 17), Reverse(atgcaatggacgaatattcatatg, sequence number 18)

[0099] As a result of verifying the production of multimer peptides using the same method as BJY000, the highest production was confirmed in the BJY003 strain, as shown in Figure 2.

[0100] Plasmid Sequence Reference Sequence Trac PromoterAGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT(Sequence No. 19)Lac operatorAATTGTGAGCGGATAACAATT(Sequence No. 20)RBSAGGAGGFfusion partner BJ001MNIRPLHDRVIVKRKEVETKSAGGIVLTGSAAAKSTRGEVLAVGNGRILENGEVKPLDVKVGDIVIFNDGYGVKSEKIDNEEVLIMSESDILAIVEAHHHHHHENLYFQHMMD(Sequence No. 6)His-tagHHHHHHTEV protease siteENLYFQGFfusion partner BJ002MNIRPLHPWHHHHHHENLYFQHMMD(Sequence No. 7)Fusion partner BJ003MNIRPLHD(Sequence No. 8)T7 terminatorCTCGCTGAGTTAATTAA(Sequence No. 21)rrnB terminatorCAGCGGATAAAACCCCTCGTGCCTTTCGTTTTATAGTATGGATTTTGTTTATGTTTTT(Sequence No. 22)

[0101] 2) E. coli culture into which SNAP-8 derivative expression vector was introduced

[0102] The expression level of the finally produced BJY003 strain was optimized through flask testing.

[0103]

[0104] [flask test]

[0105] After thawing 1 mL of E. coli culture transformed with a target peptide expression plasmid stored at -80°C, it was inoculated into a flask containing 100 mL of LB medium with a kanamycin concentration of 50 μg / mL. This inoculated culture was incubated with shaking at 37°C at 250 rpm for 24 hours. To induce target peptide expression, the OD of E. coli 600 After incubating for about 4 to 6 hours until the value reached 1, 100 μL of 0.5 M IPTG was added to induce expression.

[0106] To optimize the culture conditions of the BJY0003 strain, Terrific Broth (TB) was used as the base medium, and optimal concentrations for medium components such as carbon sources, nitrogen sources, minerals, and vitamins were established. Additionally, the selection and concentration optimization of inducers such as IPTG and lactose were performed.

[0107] As a result, as can be seen in Figures 3a and 3b, maximum protein expression was confirmed under conditions of glucose 0.1% and lactose 0.4%.

[0108]

[0109] [Optimized for 5L Jar Culture]

[0110] Cell growth was monitored at time intervals to identify the point of maximum yield. After optimizing medium and temperature conditions through flask testing, the concentration and timing of the inducer, lactose, were optimized in 5L jar culture. Additionally, productivity was maximized by determining the concentrations and timing of the feeding medium components, including carbon sources, nitrogen sources, and trace elements. 0.1% glucose was added to the initial culture medium, and the glucose concentration in the feeding medium was optimized to 40%, 50%, and 60%. The concentration of the inducer, lactose, was optimized through testing at 1%, 5%, and 10%. Furthermore, the point of maximum growth was identified by monitoring growth at different fermentation time intervals.

[0111] As a result, as can be seen in Figure 4, maximum growth was reached 18 hours after inoculation, and OD 600 The value was confirmed to be 64.2. Cell growth of more than 6 times compared to the existing level was achieved through the optimization of culture conditions.

[0112]

[0113] 3) Method for isolating and purifying SNAP-8 derivative peptides

[0114] [5L Jar Fed-batch Culture]

[0115] 1. Activation Step

[0116] After thawing 1 mL of E. coli culture transformed with a target peptide expression plasmid stored at -80℃, inoculate it into a test tube containing 10 mL of LB medium containing kanamycin at a concentration of 50 μg / mL. After inoculation, prepare a starter culture by shaking at 37℃ at 250 rpm for 4 hours.

[0117] 2. Pre-culture stage

[0118] 1 mL of the culture obtained from the activation step is inoculated into a flask containing 100 mL of LB medium with a kanamycin concentration of 50 μg / mL. After inoculation, the flask is shaken and incubated at 37°C and 250 rpm for 3 hours.

[0119] 3. Main culture stage

[0120] 100 mL of the culture medium obtained from the pre-culture stage is inoculated into a fermenter containing 2 L of initial medium containing 50 μg / mL of kanamycin. The culture medium is cultured in the fermenter at 37°C for 20 to 24 hours, and the stirring speed and air injection amount are adjusted so that the dissolved oxygen (DO) level is maintained at 30% or higher during culture. In addition, additional medium is continuously supplied at the point when the carbon source in the initial medium is depleted.

[0121] Medium Composition Initial Medium Composition (g / L) Additional Medium Composition (g / L) Glucose 1 Glucose 200 Triptone 12 Triptone 30 Yeast extract 24 Yeast extract 60 Sodium phosphate 7.1 Lactose 2 Potassium phosphate 6.8 Ammonium sulfate 3.3 Magnesium sulfate 0.15 Lactose 4

[0122] [Separation and Purification]

[0123] The cultured fermentation medium is centrifuged to recover the cells, and the centrifuged cells are uniformly suspended in purified water equivalent to 10 times the cell weight (g). Subsequently, the entire suspension is heated (80°C, 30 min) to lyse the cells. After heating, DNase is added at a ratio of 1 / 1000 of the total volume and reacted at 37°C for 1 hour. Afterward, the supernatant is recovered by centrifugation and SDS-PAGE is performed.

[0124] The recovered solution is filtered using a 0.2 μm bottle-top filter unit. The filtrate is concentrated by 10K ultrafiltration (UF), and the reternate pressure is maintained at less than 1.0 bar to selectively purify only the SNAP-8 derivative multimer. The purified SNAP-8 derivative multimer concentrate is freeze-dried to produce a powder. 25 mL of stock formic acid is added per 1 g to the freeze-dried multimer powder, and acid cleavage is performed at 50°C for 24 hours to convert it into a monomer form.

[0125] The converted monomer is freeze-dried to form a powder. 10 mL of triple-distilled water is added per 1 g of freeze-dried powder to create a hydrated state, and the mixture is filtered. The filtered solution is freeze-dried again to obtain the final powder. As a result, as can be seen in Figure 5, it can be seen that purification is achieved without loss of the target peptide compared to the initial total cell lysate.

[0126] Thus, a more economical and efficient peptide purification method was developed that overcomes the inefficiency caused by cost and time issues in existing Ni purification methods and reduces the use of buffers such as imidazole and guanidine added during Ni purification.

[0127]

[0128] Experimental Example. Confirmation of the yield of SNAP-8 derivative peptides

[0129] In order to confirm the accurate production concentration by converting the multimer produced after isolation / purification into a monomer through the above preparation example, the production amount was determined by comparing the PSNAP-8 production amounts of strains BJY002 and BJY003, after isolating and purifying the target peptides according to the respective preparation examples and analyzing the amount via HPLC.

[0130] First, the strain was cultured under optimized culture conditions, and the cells were recovered by centrifuging the culture medium. Purified water equivalent to 10 times the weight of the recovered cells was added to create a uniform suspension. The suspension was then heated at 80°C for 30 minutes to lyse the cells, and DNase was added at a volume of 1 / 1000 of the suspension volume and reacted at 37°C for 1 hour. Subsequently, centrifugation was performed (8,000 rpm, 30 minutes) to remove the cells, and the supernatant was recovered and subjected to 10K ultrafiltration (UF). During this process, the filtration was performed while adjusting the reternate pressure to be less than 1.0 bar. The filtrate was freeze-dried to form a powder; then, 25 mL of stock formic acid was added per 1 g of powder, and acid cleavage was carried out at 50°C for 24 hours to convert it into monomers. The converted monomer was freeze-dried again to form a powder, and then 10 mL of triple-distilled water was added per 1 g of powder to make it hydrated, filtered, and freeze-dried to recover the final powder. The final powder was analyzed by HPLC under the conditions of Table 3.

[0131] Freeze-drying Conditions Step 01 Step 02 Step 03 Step 04 Step 05 Step 06 Step 07 Step 08 Step 09 Step 10 Temperature (°C) -40 -35 -5 -55 15 15 25 25 4 Pressure (torr) 0 7 0 7 0 7 0 10 0 10 10 10 10 0 Hours (min) 1 20 13 0 6 48 0 5 0 20 36 0 20 6 0 0 99 99

[0132] HPLC analysis conditionsEquipmentWaters 2695e seriesColumnDIKMA C18 column(5μm, 25mm*250mm)DetectorPDA detectorWavelength220 nmMobile PhaseA0.05% TFA in DWB0.05% TFA in ACNGradient programTime (min.)A%B%010003070303159536595371000451000Flow1 ml / min.

[0133] As a result of comparing the peptide production of the BJY002 strain and the BJY002 strain with the TEV site deleted (Figs. 6a and 6b), it was confirmed that the BJY003 strain showed approximately 1.9 to 2 times the peptide production compared to the BJY002 strain, and the PSNAP-8 monomer production of the BJY003 strain was approximately 1.6 g / L.

Claims

1. A polynucleotide sequence comprising a SNAP-8 (Acetyl octapeptide-3) derivative represented by SEQ ID NO. 1, and The above polynucleotide sequence is operably linked to a promoter sequence that can be expressed in E. coli and a fusion partner BJ003 sequence represented by SEQ ID NO. 8, Expression vector for the production of SNAP-8 derivatives.

2. A transformant comprising the expression vector of claim 1.

3. In Paragraph 2, The transformant is selected from the group consisting of strains of the genera Escherichia, Pichia, Saccharomyces, Zygosaccharomyces, Kluyveromyces, Candida, Schizosaccharomyces, Issachenkia, Yarrowia, and Hansenula.

4. A step of culturing the transformant of paragraph 2; and A method for preparing a SNAP-8 derivative, comprising the step of isolating and purifying a peptide expressed from a cultured transformant.

5. In Paragraph 4, A method for preparing a SNAP-8 derivative, wherein the above separation and purification steps are performed by controlling the heating temperature and pH of a solution containing a multimer SNAP-8 derivative to cleave the multimer SNAP-8 derivative into a monomer SNAP-8 derivative.

Images