Alternative sources of tissue

Abstract

Provided herein are methods of producing engineered target organs (e.g., a pancreas) and / or cells therefrom (e.g., islets) using a non-human mammal host. In some embodiments, the methods relate to injecting hypoimmunogenic human pluripotent stem cells (HIP-hPSC) into a blastocyst of a surrogate non-human mammal to produce a chimeric blastocyst and implanting the chimeric blastocyst into the uterus of the surrogate non-human mammal, wherein after implantation the chimeric blastocyst develops into a non-human mammal host comprising a target organ with chimeric contribution from the HIP-hPSCs. In further embodiments, the target organ and / or cells therefrom are transplanted into a human subject having a disease or condition. In some embodiments, the HIP-hPSCs comprise one or more modifications that reduce or eliminate expression of one or more MHC class I and / or MHC class II human leukocyte antigens and also increase expression of one or more tolerogenic factors.

Description

ALTERNATIVE SOURCES OF TISSUE Cross-Reference to Related Applications

[0001] This application claims priority to U.S. Provisional Patent Application No.63 / 699,379 filed on September 26, 2024 and U.S. Provisional Patent Application No. 63 / 712,588 filed on October 28, 2024, the contents of each of which are herein incorporated be reference in their entireties for all purposes. Incorporation of Sequence Listing

[0002] The instant application contains a Sequence Listing XML which has been submittedelectronically and is hereby incorporated by reference in its entirety. Said XML copy, created on September 24, 2025, is named Sana1160 PCT, and is 77,961 bytes in size. Field

[0003] In certain aspects, the present disclosure is directed to methods of producingengineered target organs (e.g., a pancreas) and / or cells therefrom (e.g., islets), and related compositions, uses and articles of manufacture. Summary

[0004] The current disclosure is directed to the methods relate to injecting hypoimmunogenichuman pluripotent stem cells (HIP-hPSC) into a blastocyst of a non-human mammal donor to produce a chimeric blastocyst and implanting the chimeric blastocyst into the uterus of the non- human mammal surrogate, wherein after implantation the chimeric blastocyst develops into a non-human mammal host comprising a target organ with chimeric contribution from the HIP- hPSCs. In further embodiments, the target organ and / or cells therefrom are transplanted into a human subject having a disease or condition (e.g., type I diabetes). In some embodiments, the HIP-hPSCs comprise one or more modifications that reduce or eliminate expression of one or more MHC class I and / or MHC class II human leukocyte antigens and also increase expression of one or more tolerogenic factors. In another aspect, the present disclosure is directed to chimeric mammals or genetically-modified animals that are hypoimmunogenic, where the hypoimmunogenic animal can serve as a universal donor to a human.

[0005] Although humanized animals are an attractive source of donor cells and organs, thereremains much room for improvement before immunosuppression-free xenotransplantation strategies become widely available. This disclosure provides improved methods for generating humanized animals where the resulting target organ and / or cells derived therefrom can evadeimmune rejection once transplanted into a human. In one aspect, the disclosure provides methods relate to injecting hypoimmunogenic human pluripotent stem cells (HIP-hPSC) into a blastocyst of a non-human mammal donor to produce a chimeric blastocyst and implanting the chimeric blastocyst into the uterus of the non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into a non-human mammal host comprising a target organ with chimeric contribution from the HIP-hPSCs, thereby generating a chimeric mammal comprising both non-human mammal and human cells. The resulting target organ and / or cells therefrom are transplanted into a human subject having a disease or condition (e.g., type I diabetes).

[0006] In one aspect, the current disclosure provides a method for producing a target organincluding human cells in a non-human mammal host, including: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst into an uterus of a non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non-human mammal host including the target organ; c) obtaining the target organ from the non-human mammal host, thereby producing the target organ including human cells in the non-human mammal host.

[0007] In another aspect, the current disclosure provides a method for generating a targetorgan including human cells in a non-human mammal host, including implanting a chimeric blastocyst including a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host including the target organ, thereby generating the target organ including human cells in the non-human mammal host.

[0008] In an additional aspect, the current disclosure provides a method for producing ahuman cell from a target organ in a non-human mammal host, including: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst to an uterus of a non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non-human mammal host including the target organ; c) obtaining the target organ from the non-human mammal host; and d) isolating the human cell from the target organ, thereby producing the human cell from the target organ in the non-human mammal host.

[0009] In a further aspect, the current disclosure provides a method for generating a humancell from a target organ in a non-human mammal host, including implanting a chimericblastocyst including a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host including the target organ, wherein the target organ includes the human cell, thereby generating the human cell from the target organ in the non-human mammal host.

[0010] In another aspect, the current disclosure provides a method for producing a pancreasincluding human islet cells in a non-human mammal host, including: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst into an uterus of a non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non-human mammal host including the pancreas; c) obtaining the pancreas from the non-human mammal host, thereby producing the pancreas including the human islet cells in the non-human mammal host.

[0011] In one aspect, the current disclosure provides a method for generating a pancreasincluding human islet cells in a non-human mammal host, including implanting a chimeric blastocyst including a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host including the pancreas, thereby generating the pancreas including human islet cells in the non-human mammal host.

[0012] In another aspect, the current disclosure provides a method for producing a humanislet cell from a pancreas in a non-human mammal host, including: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst to an uterus of non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non-human mammal host including the pancreas; c) obtaining the pancreas from the non-human mammal host; and d) isolating the human islet cell from the pancreas, thereby producing the human islet cell from the pancreas in the non-human mammal host.

[0013] In an additional aspect, the current disclosure provides a method for generating ahuman islet cell from a pancreas in a non-human mammal host, including implanting a chimeric blastocyst including a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host including the pancreas, wherein the pancreas includes the human islet cell, thereby generating the human islet cell from the pancreas in the non-human mammal host.

[0014] In some embodiments, the target organ includes pancreas, kidney, liver, heart, heartvalve, lung, muscle, uterus, bone marrow, spleen, skin, cornea, eye, or intestine. In someembodiments, the current disclosure provides a method, wherein the human cell from the target organ includes islet cells, kidney cells, liver cells, heart cells, lung cells, muscle cells, uterine cells, spleen cells, skin cells, corneal cells or intestinal cells. In some embodiments, the non- human mammal donor includes a porcine, bovine, non-human primate, canine, caprine, or ovine. In some embodiments, the non-human mammal surrogate includes a porcine, bovine, non-human primate, canine, caprine, or ovine. In some embodiments, the non-human mammal host includes a porcine, bovine, non-human primate, canine, caprine, or ovine. In some embodiments, the non-human mammal donor, surrogate and host are the same species. In some embodiments, the non-human mammal donor, surrogate and host are the same species but different mammals. In some embodiments, the non-human mammal donor and the non-human mammal surrogate are the same animal.

[0015] In some embodiments, the non-human mammal host includes at least 1% chimericcontribution from the HIP-hPSC. In some embodiments, the non-human mammal host includes at least 2% chimeric contribution, at least 3% chimeric contribution, at least 4% chimeric contribution, at least 5% chimeric contribution, at least 6% chimeric contribution, at least 7% chimeric contribution, at least 8% chimeric contribution, at least 9% chimeric contribution, or at least 10% chimeric contribution from the HIP-hPSC. In some embodiments, the current disclosure provides a method, wherein the pancreas, kidney, liver, heart, heart valve, lung, uterus, spleen, bone marrow, skin, cornea, eye, spinal cord, intestine, bone, cartilage, tendon, ligament, lymphatic vessel, and blood vessel of the non-human mammal host includes at least 1% chimeric contribution from the HIP-hPSC. In some embodiments, the pancreas, kidney, liver, heart, heart valve, lung, uterus, spleen, bone marrow, skin, cornea, eye, spinal cord, intestine, bone, cartilage, tendon, ligament, lymphatic vessel, and blood vessel of the non- human mammal host includes at least 2% chimeric contribution, at least 3% chimeric contribution, at least 4% chimeric contribution, at least 5% chimeric contribution, at least 6% chimeric contribution, at least 7% chimeric contribution, at least 8% chimeric contribution, at least 9% chimeric contribution, or at least 10% chimeric contribution from the HIP-hPSC. In some embodiments, at least 10% of the islets from the pancreas are derived from a HIP-hPSC.

[0016] In one aspect, the current disclosure provides a method, wherein the chimericblastocyst includes at least 10% complementation.

[0017] In some embodiments, prior to the injection the blastocyst is a 2-cell stage blastocyst,a 4-cell stage blastocyst, or an 8-cell stage blastocyst. In some embodiments, prior to the injection the blastocyst includes a blastocoel, an inner cell mass, and / or a trophoblast. In some embodiments, the blastocyst includes a porcine, bovine, non-human primate, canine, caprine,or ovine blastocyst. In some embodiments, the blastocyst includes a porcine blastocyst. In some embodimentst, the blastocyst is a porcine blastocyst.

[0018] In some embodiments, the blastocyst includes a wild type phenotype, aparthenogenetic phenotype, or a gene-edited phenotype. In some embodiments, the gene-edited phenotype includes an organogenesis-disabled phenotype. In some embodiments, the organogenesis-disabled phenotype includes an apancreatic phenotype. In some embodiments, the blastocyst includes one or more genetic modifications. In some embodiments, the one or more genetic modifications includes a mutation.

[0019] In some embodiments, the blastocyst includes a mutation. In some embodiments, themutation results in a blastocyst with an organogenesis-disabled phenotype. In some embodiments, the organo-genesis disabled phenotype includes a pancreatogenesis-disabled phenotype. In some embodiments, the mutation results in a blastocyst with an apancreatic phenotype. In some embodiments, the mutation includes deletion of a duodenal homeobox 1 (Pdx1) gene. In some embodiments, deletion of the Pdx1 gene is monoallelic or biallelic.

[0020] In some embodiments, the current disclosure provides a method, further includingmatching developmental timing of the HIP-hPSC to the blastocyst.

[0021] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 or 20HIP-hPSCs are injected into the blastocyst. In some embodiments, the injection includes depositing the HIP-hPSCs into the blastocoel. In some embodiments, the human pluripotent stem cell (hPSC) is selected from a naïve PSC, a naïve-like PSC, and a primed PSC.

[0022] In some embodiments, the current disclosure provides a method, further includingculturing the HIP-hPSCs under conditions sufficient to induce a naïve state. In some embodiments, the HIP-hPSCs include modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type hPSC that does not include the modifications.

[0023] In some embodiments, the pancreas produced in the non-human mammal hostincludes modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHCclass II molecules; and / or (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type hPSC that does not include the modifications.

[0024] In some embodiments, the isolated human islet cell from the pancreas produced inthe non-human mammal host includes modifications that: a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type hPSC that does not include the modifications. In some embodiments, the one or more molecules that regulate expression regulate cell surface protein expression of the one more MHC Class I molecules. In some embodiments, the one or more molecules that regulate expression regulate cell surface protein expression of the one more MHC Class II molecules. In some embodiments, the one or more molecules that regulate cell surface protein expression of the one or more MHC class I molecules are B2M.

[0025] In some embodiments, the modifications include a modification that regulates cellsurface protein expression of the one or more MHC class I molecules and the modification inactivates or disrupts one or more alleles of B2M. In some embodiments, the modification that inactivates or disrupts one or more alleles of B2M reduces mRNA expression of the B2M gene.

[0026] In some embodiments, the modification that inactivates or disrupts one or more allelesof B2M reduces protein expression of B2M. In some embodiments, the modification that inactivates or disrupts one or more alleles of B2M includes: inactivation or disruption of one allele of the B2M gene; inactivation or disruption of both alleles of the B2M gene; or inactivation or disruption of all B2M coding alleles in the cell. In some embodiments, the inactivation or disruption includes an indel in the B2M gene. In some embodiments, the inactivation or disruption includes a frameshift mutation or a deletion of a contiguous stretch of genomic DNA of the B2M gene. In some embodiments, the modification is a modification that regulates expression of the one or more MHC class II molecules, and the modification inactivates or disrupts one or more alleles of CIITA. In some embodiments, the modification that inactivates or disrupts one or more alleles of CIITA reduces protein expression of CIITA.

[0027] In some embodiments, the modification that inactivates or disrupts one or more allelesof CIITA includes: inactivation or disruption of one allele of the CIITA gene; inactivation or disruption of both alleles of the CIITA gene; or inactivation or disruption of all CIITA codingalleles in the cell. In some embodiments, the inactivation or disruption includes an indel in the CIITA gene. In some embodiments, the inactivation or disruption is a frameshift mutation or a deletion of a contiguous stretch of genomic DNA of the CIITA gene. In some embodiments, expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR are reduced in the engineered hypoimmunogenic islets.

[0028] In some embodiments, the one or more tolerogenic factors is selected from the groupconsisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA- G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, at least one of the one or more tolerogenic factors is CD47. In some embodiments, the one or more tolerogenic factors is CD47.

[0029] In some embodiments, the modification that increases expression of the one or moretolerogenic factors includes an exogenous polynucleotide encoding the one or more tolerogenic factors. In some embodiments, the exogenous polynucleotide encoding the one or more tolerogenic factors is integrated into the genome of the engineered hypoimmunogenic islets.

[0030] In some embodiments, the one or more tolerogenic factors includes CD47 and theengineered hypoimmunogenic islets expresses CD47 at a first level that is greater than at or about 5-fold over a second level expressed by the control or wild-type islet cell. In some embodiments, CD47 is expressed at a first level that is greater than at or about 10-fold, greater than at or about 20-fold, greater than at or about 30-fold, greater than at or about 40-fold, greater than at or about 50-fold, greater than at or about 60-fold, or greater than at or about 70-fold over a second level expressed by the control or wild-type islet cell. In some embodiments, the one or more tolerogenic factors includes CD47 and CD47 is expressed by the HIP-hPSC at greater than at or about 20,000 molecules per cell. In some embodiments, CD47 is expressed by the HIP-hPSC at greater than at or about 30,000 molecules per cell, greater than at or about 50,000 molecules per cell, greater than at or about 100,000 molecules per cell, greater than at or about 200,000 molecules per cell, greater than at or about 300,000 molecules per cell, greater than at or about 400,000 molecules per cell, greater than at or about 500,000 molecules per cell, or greater than at or about 600,000 molecules per cell. In some embodiments, the HIP- hPSC has the phenotype B2Mindel / indel; CIITAindel / indel; CD47tg. In some embodiments, among the HIP-hPSC, at least 85% of the cells have the modifications. In some embodiments, at least 90%, at least 92%, at least 95% or at least 98% of the cells have the modifications. In some embodiments, among the HIP-hPSC, at least 85% of the cells have the phenotype has thephenotype B2Mindel / indel; CIITAindel / indel; CD47tg. In some embodiments, at least 90%, at least 92%, at least 95% or at least 98% of the cells have the phenotype. In some embodiments, the HIP-hPSCs are ABO blood group type O. In some embodiments, the HIP-hPSC are Rhesus factor negative.

[0031] In some embodiments, the HIP-hPSCs include modifications that inactivate or disruptone or more alleles of an ABO blood group type antigen. In some embodiments, the modifications that inactivate or disrupt one or more alleles of an ABO blood group type antigen disrupt expression of A1, A2, and / or B. In some embodiments, the HIP-hPSCs include modifications that inactivate or disrupt one or more alleles of a Rhesus factor (Rh) protein antigen. In some embodiments, the HIP-hPSCs further include a modification for expression of an exogenous safety switch. In some embodiments, the HIP-hPSCs further include a modification to increase expression of an exogenous safety switch. In some embodiments, the HIP-hPSCs include an exogenous polynucleotide encoding a safety switch. In some embodiments, the safety switch is a system wherein upon activation, cells downregulate expression of the one or more tolerogenic factors and / or upregulate expression of one or more immune signaling molecules thereby marking the cell for elimination by the host immune system.

[0032] In some embodiments, the one or more tolerogenic factors are selected from the groupconsisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA- G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

[0033] In some embodiments, the one or more tolerogenic factors is CD47. In someembodiments, the safety switch and the one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified cell. In some embodiments, the bicistronic cassette is integrated at a non-target locus in the genome of the HIP-hPSC. In some embodiments, the bicistronic cassette is integrated into a target genomic locus of the cell. In some embodiments, the safety switch and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified cell. In some embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome of the modified cell, optionally by introduction of the exogenous polynucleotide into the cell using a lentiviral vector. In some embodiments, the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the cell, optionally wherein the targeted insertion is by nuclease-mediated gene editing with homology-directed repair.

[0034] In some embodiments, the target genomic locus is a safe harbor locus, a B2M genelocus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, the safe harbor locus is selected from the group consisting of: a CCR5 gene locus, a CXCR4 gene locus, a PPP1R12C (also known as AAVS1) gene, an albumin gene locus, a SHS231 locus, a CLYBL gene locus, and a ROSA26 gene locus. In some embodiments, the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D. In some embodiments, the safety switch is a suicide gene. In some embodiments, the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), an inducible caspase 9 (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9).

[0035] In some embodiments, the HIP-hPSCs include a modification that inactivates ordisrupts one or more alleles of CD142. In some embodiments, the modification reduces mRNA expression of the CD142 gene. In some embodiments, the modification reduces protein expression of CD142. In some embodiments, the modification that inactivates or disrupts one or more alleles of CD142 includes: inactivation or disruption of one allele of the CD142 gene; inactivation or disruption of both alleles of the CD142 gene; and inactivation or disruption of all CD142 coding alleles in the cell. In some embodiments, the inactivation or disruption includes an indel in the CD142 gene. In some embodiments, the inactivation or disruption is a frameshift mutation or a deletion of a contiguous stretch of genomic DNA of the CD142 gene. In some embodiments, the HIP-hPSCs have the phenotype B2Mindel / indel; CIITAindel / indel; CD47tg; safety switch transgene.

[0036] In some embodiments, the safety switch induces controlled cell death in the presenceof a drug or prodrug, or upon activation by a selective exogenous compound. In some embodiments, the safety switch is an inducible protein capable of inducing apoptosis of the HIP-hPSC. In some embodiments, the inducible protein capable of inducing apoptosis of the HIP-hPSC is a caspase protein. In some embodiments, the caspase protein is caspase 9. In some embodiments, the safety switch is activated to induce controlled cell death after the administration of the one or more immunosuppressive agents to the subject. In some embodiments, the safety switch is activated to induce controlled cell death prior to the administration of the one or more immunosuppressive agents to the subject. In some embodiments, the safety switch is activated to induce controlled cell death after the administration of the HIP-hPSC to the subject. In some embodiments, the safety switch isactivated to induce controlled cell death in the event of cytotoxicity or other negative consequences to the subject.

[0037] In some embodiments, the current disclosure provides a method, includingadministering an agent that allows for depletion of the HIP-hPSC.4 In some embodiments, the agent that allows for depletion of the HIP-hPSC is an antibody that recognizes a protein expressed on the surface of the HIP-hPSC. In some embodiments, the antibody is selected from the group consisting of an antibody that recognizes CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, RQR8, and CD47. In some embodiments, the antibody is selected from the group consisting of mogamulizumab, AFM13, MOR208, obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-Rllb, tomuzotuximab, RO5083945 (GA201), cetuximab, Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-Rllc, magrolimab, and biosimilars thereof.

[0038] In some embodiments, the target organ is harvested between 1 to 365 days after birth.In some embodiments, the pancreas is harvested between days 1 to 365 days after birth. In some embodiments, the human islet from the pancreas is harvested between 1 to 365 days after birth. In some embodiments, isolating the human islet cell from the pancreas includes manual isolation, mechanical isolation, or chemical isolation. In some embodiments, isolating the human islet cell from the pancreas includes perfusion. In some embodiments, perfusion includes inserting a catheter into the pancreatic duct. In some embodiments, perfusion includes inflating the pancreas with an isolation medium. In some embodiments, the isolation medium includes an enzyme. In some embodiments, the enzyme includes a proteolytic enzyme. In some embodiments, the enzyme includes collagenase.

[0039] In some embodiments, after inflating, fat and connective tissue are washed off thepancreas tissue. In some embodiments, the method further includes digesting the pancreas. In some embodiments, the digesting includes incubating the pancreas in the isolation medium. In some embodiments, the isolation medium includes an enzyme. In some embodiments, the enzyme includes a proteolytic enzyme. In some embodiments, the enzyme includes collagenase. In some embodiments, the digesting includes agitating the pancreas in the isolation media. In some embodiments, the method further includes passing the digested pancreas through a filter. In some embodiments, the filter includes a pore size of 500 µm.

[0040] In one aspect, the current disclosure provides a target organ produced by the methodsdescribed in the present disclosure.

[0041] In one aspect, the current disclosure provides a pancreas produced by the methodsdescribed in the present disclosure.

[0042] In one aspect, the current disclosure provides a chimeric pancreas produced by themethods described in the present disclosure.

[0043] In one aspect, the current disclosure provides a chimeric pancreas produced by themethods described in the present disclosure, including cells derived from hypoimmunogenic human pluripotent stem cells (HIP-hPSCs).

[0044] In one aspect, the current disclosure provides a chimeric pancreas produced by themethods described in the present disclosure, including cells derived from hypoimmunogenic human pluripotent stem cells (HIP-hPSCs) and cells derived from non-human mammal host. In some embodiments, the non-human mammal host is a porcine host.

[0045] In one aspect, the current disclosure provides a human islet cell produced by themethods described in the present disclosure.

[0046] In one aspect, the current disclosure provides a chimeric mammal produced by themethods described in the present disclosure.

[0047] In one aspect, the current disclosure provides a chimeric mammal including cellsderived from a non-human mammal and a human, wherein the cells from the non-human mammal include a genetic modification at one or more loci and the cells from the human include cells derived from a hypoimmune modified human pluripotent stem cell (HIP-hPSC) that forms at least one organ or tissue in the chimeric mammal and that includes modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors. In some embodiments, the non- human mammal and human are different species.

[0048] In one aspect, the current disclosure provides a genetically modified animal includingcells derived from a non-human animal and a human, wherein the cells from the non-human mammal include genetic modifications at one or more loci and the cells from the human include a hypoimmune modified human pluripotent stem cell (HIP-hPSC) that forms at least one organ or tissue and that includes modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors. In one aspect, the non-human mammal and human are different species.

[0049] In one aspect, the current disclosure provides a genetically modified mammalincluding cells derived from a hypoimmune modified pluripotent stem cell (HIP-PSC), wherein the HIP-PSC includes modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors. In some embodiments, the chimeric mammal or genetically modified mammal further includes one or more additional modifications. In some embodiments, the one or more additional modifications are cell-type specific, cell-lineage specific, organ specific, or organism specific. In some embodiments, the one or more additional modifications are implicated in an immune response pathway. In some embodiments, the one or more additional modifications include modifications that (i) inactivate or disrupt one or more alleles of: one or more ABO blood group antigen and / or one or more Rh antigens; a NK activating receptor (CD226, NCR1, NCR2, and NCR3, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, or KIR2DS5,); and a NK activating receptor ligand (PVR (gene encoding CD155), MICA, MICB, UL16-binding protein 1, UL16-binding protein 2, UL16-binding protein 3, UL16-binding protein 4, UL16-binding protein 5, UL16-binding protein 6, natural cytotoxicity receptor 3 (NCR3LG1 encoding B7H6), and CD112).

[0050] In some embodiments, the current disclosure provides a chimeric mammal orgenetically modified mammal, wherein (i) the one or more ABO blood group antigens are selected from the group consisting of: an ABO blood group antigen A1 (antigen A1), ABO blood group antigen A2 (antigen A2), and ABO blood group antigen B (antigen B), and (ii) the one or more Rh antigens are selected from the group consisting of: Rh D antigen, Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duffy (FY) Fya antigen, Duffy Fy3 antigen, Kidd (JK) Jkb antigen, MNS antigen U, MNS antigen S, and SLC14A1. In some embodiments, the one or more NK activating receptors are selected from the group consisting of: CD226, NCR1, NCR2, and NCR3, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, and KIR2DS5. In some embodiments, the one or more NK activating receptor ligands are selected from the group consisting of: CD155, MICA, MICB, UL16-binding protein 1, UL16-binding protein 2, UL16- binding protein 3, UL16-binding protein 4, UL16-binding protein 5, UL16-binding protein 6, B7H6, and CD112. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavychain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the one or more tolerogenic factors is CD47.

[0051] In some embodiments, the one or more additional modifications inactive or disruptone or more alleles of a tissue-specific antigen, organ-specific antigen, or a species-specific antigen. In some embodiments, the one or more species-specific antigens include species endogenous antigens. In some embodiments, the one or more species-specific antigens are selected from the group consisting of: an endogenous retrovirus element, α(1,3)- galactosyltransferase (αGT), glycoprotein alpha-galactosyltransferase 1 (GGTA1), beta-1,4-N- acetyl-galactosaminyltransferase 2 (B4GALNT2), and Cytidine monophospho-N- acetylneuraminic acid hydroxylase (CMAH).

[0052] In one aspect, the current disclosure provides a method of treating or preventing abeta cell disorder in a subject in need thereof, the method, including: administering to the subject the human islet cell produced according to the methods of the present disclosure.

[0053] In one aspect, the current disclosure provides a method of treating or preventing abeta cell disorder in a subject in need thereof, the method, including: administering to the subject the pancreas produced according to the methods of the present disclosure. In some embodiments, the beta cell disorder is diabetes. In some embodiments, the diabetes is type I diabetes. In some embodiments, the diabetes is type II diabetes. In some embodiments, the human islet cell or pancreas improves glucose tolerance in the subject.

[0054] In one aspect, the current disclosure provides a method of improving glucosetolerance in a subject in need thereof, the method comprising administering the pancreas produced according to the methods of the present disclosure.

[0055] In one aspect, the current disclosure provides a method for improving glucosetolerance in a subject in need thereof, the method including administering the human islet cell produced according to the methods of the present disclosure.

[0056] In some embodiments, the subject is a diabetic patient. In some embodiments, thediabetic patient has type I diabetes or type II diabetes. In some embodiments, glucose tolerance is improved relative to the subject's glucose tolerance prior to administration of the human islet cells. In some embodiments, glucose tolerance is improved relative to the subject's glucose tolerance prior to administration of the pancreas.

[0057] In some embodiments, administration of the human islet cells reduces exogenousinsulin usage in the subject. In some embodiments, the current disclosure provides a method, wherein administration of the pancreas reduces exogenous insulin usage in the subject. In someembodiments, glucose tolerance is improved as measured by HbA1c levels. In some embodiments, the subject is fasting.

[0058] In some embodiments, administration of the HIP-hPSC improves insulin secretion inthe subject. In some embodiments, insulin secretion is improved relative to the subject's insulin secretion prior to administration of the human islet cells. In some embodiments, insulin secretion is improved relative to the subject's insulin secretion prior to administration of the pancreas. Brief Description of the Drawings

[0059] FIGs.1A-1C show generation and characterization of a HIP mouse. FIG.1A showsMHC class I and II double knockouts of mouse B2m gene and mouse H2-Ab1 gene generated through the mating of B2m mice (MHC class I-deficient) and Abb mice (MHC class II- deficient). FIG. 1B shows Cd47 transgenic mice generated by targeted transgenesis into BALB / c mouse embryonic stem cells. The recombination-mediated cassette exchange (RMCE) vector was constructed by cloning an F3 site, a CAG promoter cassette, the Cd47- P2A-Luc2 transgenes, the human growth hormone (hGH) polyadenylation signal, and an FRT site into a plasmid. For targeted transgenesis, the RMCE vector was transfected together with a CAG-Flpe-pA expression plasmid into a C57BL / 6 embryonic stem cell line equipped with F3 and FRT sites in the Rosa26 locus. Recombinant clones were isolated using positive Neomycin resistance selection and expanded. Correctly targeted clones were injected into BALB / c blastocysts and transferred to pseudopregnant NMRI females for chimera generation. To obtain HIP mice, female Cd47 transgenic mice were intercrossed with Abb / B2m mice andthose were bred with Abb / B2m mice. FIG 1C shows that all cells and organs in the HIP mouseshow the HIP phenotype. Blood was drawn and multiple organs were recovered from HIP mice and organs were dissociated into single cell suspensions. MHC class I and II and CD47 expression were assessed by flow cytometry. Histograms show the sample in red and the corresponding isotype control in grey (representative plots of two independent analyses).

[0060] FIGs.2A-2L show results of parabiosis with two syngeneic parabionts. FIG.2A andFIG. 2B show GFP+ B6 naïve mice are depicted in green with green immune cells and B6 naïve mice are depicted in grey with blue immune cells. Virtually all blood cells in GFP+ animals were positive for GFP (A), while no GFP fluorescence was observed in blood cells of regular B6 animals (B) (mean ^ SD, 3 animals per group). FIG. 2C and FIG. 2D show after two weeks in parabiosis, immune cells from each mouse had crossed over into the other parabiont, creating an immune cell mix in the common blood circulation. The equilibrium ineach mouse was skewed mildly towards an approximate 60%: 40% dominance of the own inherit blood population (mean ^ SD, 8 animals per group). FIG. 2E depicts an immune response analysis in GFP+ B6 mice showed no activation of splenocytes (Elispot) and no killing (Life-Dead assay) against either GFP+ B6 or B6. Total IgM serum levels remained in the norm and no DSAs against either GFP+ B6 or B6 were observed (mean ^ SD, 8 animals per group; the dashed lines in the Elispot and DSA graphs show the background levels of these assays). FIG.2F depict an immune response analysis in B6 mice similarly showed no activation of splenocytes (Elispot) and no killing (Life-Dead assay) against either GFP+ B6 or B6. Total IgM serum levels also remained in the norm and no DSAs against either GFP+ B6 or B6 were observed (mean ^ SD, 8 animals per group; the dashed lines in the Elispot and DSA graphs show the background levels of these assays). FIG.2G shows the site of the surgical connection between the parabionts was resected, cut, and histochemically stained for GFP. Four different levels are shown (one exemplary parabiosis pair is shown of 8 total). FIGs.2H-2I depict GFP histochemistry staining of local lymph nodes in GFP+ B6 (H) and B6 (I) show the composition of GFP-positive and -negative immune cells (one exemplary lymph node is shown per parabiont). FIGs. 2J-2K show the spleens were recovered from the GFP+ B6 (J) and B6 (K) parabiont, cut, and histochemically stained for GFP. Automated image analyses for brown GFP staining were performed and the detected areas are visualized in red pseudocolor (one exemplary spleen per parabiont is shown out of 8 parabiosis pairs). FIG.2L depict the percent covered area by red pseudocolor was quantified and showed an approximately 60%: 40% distribution of own inherit immune cells over those of the other parabiont (mean ^ SD, 8 animals per group).

[0061] FIGs.3A-3L show parabiosis with two allogeneic parabionts. FIG. 3A and FIG.3Bshows GFP+ B6 naïve mice depicted in green with green immune cells and BALB / c naïve mice depicted in white with grey immune cells. Virtually all blood cells in GFP+ animals were positive for GFP (FIG. 3A; the same 3 animals are shown from Fig. 2A), while no GFP fluorescence was observed in blood cells of regular BALB / c animals (FIG.3B) (mean ^ SD, 3 animals per group). IFG. FIG.3C and FIG.3D show that after two weeks in parabiosis, there was minimal mixing of immune cells as only very few immune cells from the other parabiont could be detected in each mouse (mean ^ SD, 8 animals per group). FIG.3E depict an immune response analysis in GFP+ B6 mice showed high IFN-^ spot frequencies in Elispot assays with BALB / c stimulator cells and very effective killing of BALB / c target cells by GFP+ B6 T cells in Life-Dead assays. No response against syngeneic GFP+ B6 cells was observed. Total IgMserum levels were elevated and DSAs against both the own GFP+ B6 strain and BALB / c were detected (mean ^ SD, 8 animals per group; the dashed lines in the Elispot and DSA graphs show the background levels of these assays). FIG. 3F depict an immune response analysis in BALB / c mice similarly showed strong activation of splenocytes (Elispot) against GFP+ B6 immune cells and effective killing of GFP+ B6 cells by BALB / c T cells in Life-Dead assays. Total IgM serum levels were also elevated and, again, DSAs against both the own BALB / c and GFP+ B6 strain were detected (mean ^ SD, 8 animals per group; the dashed lines in the Elispot and DSA graphs show the background levels of these assays). FIG. 3G depict the site of the surgical connection between the parabionts was resected, cut, and histochemically stained for GFP. Four different levels are shown (one exemplary parabiosis pair is shown of 8 total). FIG. 3H and FIG. 3I depict GFP histochemistry staining of local lymph nodes in GFP+ B6 (FIG. 3H) and BALB / c (FIG.3I) show the composition of GFP-positive and -negative immune cells (one exemplary lymph node is shown per parabiont). FIG.3J and FIG. 3K shows the spleens were recovered from the GFP+ B6 (FIG. 3J) and BALB / c (FIG. 3K) parabiont, cut, and histochemically stained for GFP. Automated image analyses for brown GFP staining were performed and the detected areas are visualized in red pseudocolor (one exemplary spleen per parabiont is shown out of 8 parabiosis pairs). FIG. 3L shows the percent covered area by red pseudocolor quantified that showed almost all immune cells were of the own parabiont’s origin with very few crossed over cells from the other parabiont (mean ^ SD, 8 animals per group).

[0062] FIGs. 4A-4F show parabiosis of HIP with allogeneic BALB / c: Testing theimmunogenicity of all HIP blood cells. FIG. 4A shows the phenotype of HIP immune cells includes a depletion of MHC class I and II and high CD47 expression, which has an MFI approximately 45-fold higher than that of the corresponding isotype control. FIG. 4B show BALB / c immune cells are MHC class I positive and approximately 70% are positive for MHC class II. Endogenous CD47 expression has an MFI approximately 2-fold higher than that of the corresponding isotype control and BALB / c have no CD47 high expressing cells. FIG. 4C shows after two weeks in parabiosis, virtually all circulating immune cells in HIP parabionts still showed the HIP phenotype and close to no BALB / c immune could be detected (mean ^ SD, 7 animals). FIG. 4D shows that approximately 40% of all circulating immune cells in BALB / c were of HIP origin, identified by MHC class I negativity and high CD47 expression (mean ^ SD, 7 animals). FIG.4E shows HIP mice had developed a strong and specific immune activation against BALB / c (Elispot) and HIP T cells aggressively killed BALB / c target cells in Life-Dead assays. Total IgM serum levels were elevated compared to syngeneic (FIG.2E) andDSAs only against BALB / c were detected (mean ^ SD, 7 animals; the dashed lines in the Elispot and DSA graphs show the background levels of these assays). FIG.4F shows BALB / c mice showed no immune activation against HIP cells (Elispot) and no killing capacity against HIP cells (Life-Dead assays). Total IgM serum levels were also elevated and only DSAs against its own BALB / c strain were detected (mean ^ SD, 7 animals; the dashed lines in the Elispot and DSA graphs show the background levels of these assays).

[0063] FIGs.5A-5D shows induced immune deficiency with irradiation. FIG.5A shows B6mice were irradiated with 5 Gy and subsequently immunized with intramuscular injection of allogeneic BALB / c splenocytes 1, 7, or 14 days later. Another 7 days after the immunization, the spleen were recovered and splenocytes were isolated for Elispot assays. FIG. 5B depict Elispot assays with the recovered B6 splenocytes and BALB / c stimulator cells that did not show an increase in IFN-^ spot frequencies and thus no signs of immune activation (mean ^ SD, 3 animals). FIG.5C shows that naïve B6 mice were intramuscularly injected with BALB / c splenocytes, and their spleen were recovered after 7 days. FIG. 5D depict Elispot assays showing a very strong IFN-^ response in this allogeneic control group (mean ^ SD, 3 animals).

[0064] FIGs.6A-6F show parabiosis of irradiated HIP with allogeneic BALB / c: Testing theimmunogenicity of all HIP tissues and organs. FIG. 6A and FIG. 6B shows HIP mice and BALB / c mice were again joined in parabiosis, but this time the HIP mice were irradiated with 5 Gy before the surgical connection. FIG.6C show that after 7 days in parabiosis, the majority of circulating immune cells in irradiated HIP mice were MHC class I positive with a minority of cells showing the inherit HIP phenotype (mean ^ SD, 5 animals). Most immune cells in Hip were therefore of BALB / c origin. FIG. 6D shows that the vast majority of immune cells in BALB / c were still MHC class I-positive with only a very small fraction of CD47 high- expressing HIP cells (mean ^ SD, 5 animals). FIG. 6E show the few remaining HIP immune cells in irradiated HIP mice were unable to get activated by (Elispot) or respond against BALB / c (Life-Dead assays). Total IgM serum levels remained in the normal range and no DSAs were detected (mean ^ SD, 5 animals; the dashed lines in the Elispot and DSA graphs show the background levels of these assays). FIG. 6F show that despite circulating freely through irradiated HIP mice, BALB / c immune cells showed no activation against HIP cells (Elispot) and no killing capacity against HIP cells (Life-Dead assays). Total IgM serum levels were normal and no DSAs were detected (mean ^ SD, 5 animals; the dashed lines in the Elispot and DSA graphs show the background levels of these assays).

[0065] FIGs. 7A-7S show islets from HIP mice treat diabetes in fully allogeneic, diabeticBALB / c mice. FIG.7A shows in vitro immunofluorescence stainings of B6 islets or HIP islets for somatostatin, insulin, and glucagon are shown (representative pictures of two independent experiments). FIG.7B depict immunofluorescence stainings for CD47, HLA class I, and DAPI show the differences in immune phenotype between B6 and HIP islets (representative pictures of two independent experiments). FIG.7C shows the study groups included the transplantation of B6 wild-type (WT) islets and HIP islets into allogeneic, diabetic BALB / c mice. Syngeneic transplants of B6 islets into diabetic B6 recipients served as controls. FIG. 7D shows that six days after islet transplantation, serum and splenocytes were recovered from the recipient mice and splenocytes were used for Elispot assays against the transplanted islet cell population. There was a strong immune activation against the allogeneic WT islets, but not the HIP islets. No immune activation was seen in the syngeneic control group (Mann-Whitney test, 5 animals per group). IgM DSAs were quantified by flow cytometry in the recovered serum. DSAs could only be detected after the transplantation of WT islets, but not HIP islets and not in the syngeneic control group (Mann-Whitney test, 5 animals per group). FIG. 7E shows T cells were isolated from the recovered spleens and used in cytotoxicity assays against the transplanted islet cell population. There was very effective killing of WT islets, but no killing of allogeneic HIP islets or syngeneic control islets. ADCC with recovered serum and allogeneic NK cells showed effective antibody-mediated killing of WT islets but not HIP or syngeneic control islets (Mann-Whitney test, 5 animals per group). FIG.7F and FIG.7G shows Luc+ B6 islets were transplanted into allogeneic, diabetic BALB / c mice (BLI pictures (FIG. 7F) and signals (FIG. 7G) for all 4 animals are shown) and vanished quickly. FIG. 7H demonstrates fasting blood glucose levels and 30-minute glucose challenge levels showed continuation of the diabetic hyperglycemia after WT islet transplantation (mean ± SD, 4 animals). FIG.7I and FIG.7J depicts Luc+ HIP islets were transplanted into allogeneic, diabetic BALB / c mice (BLI pictures (I) and signals (FIG.7J) for all 5 animals are shown) and showed stable engraftment. FIG. 7K demonstrate fasting blood glucose levels and 30-minute glucose challenge levels showed a reduction of hyperglycemia with successful treatment of diabetes after 29 days (mean ± SD, 5 animals). FIG. 7L and FIG. 7M demonstrate Luc+ B6 islets were transplanted into syngeneic, diabetic B6 mice (BLI pictures (FIG. 7L) and signals (FIG. 7M) for all 5 animals are shown) and showed stable engraftment. FIG.7N demonstrates fasting blood glucose levels and 30-minute glucose challenge levels showed a reduction of hyperglycemia with successful treatment of diabetes after 29 days (mean ± SD, 5 animals). FIG. 7O shows blood c-peptide levels were measured after 29 days (mean ± SD, 4 WT animals and 5 HIP and syngeneic controlanimals) and showed restoration with allogeneic HIP and syngeneic B6 islet transplants. FIG. 7P and FIG.7S shows the recipient immune response was assessed again at 29 days. The IFN- ^ spot frequency was lower against WT islets (FIG. 7P) and DSAs had switched to the IgG isotype (FIG.7Q). T cell killing (FIG.7R) and ADCC against WT islets was still very effective, and no killing of the other islet populations was seen (Mann-Whitney test, mean ± SD, 4 WT animals and 5 HIP and syngeneic control animals).

[0066] FIG. 8 depicts a schematic of an implantation time course experiment to beperformed. Detailed Description

[0067] Provided herein are methods involving producing a target organ (e.g., pancreas)comprising human cells in a non-human mammal host. In some embodiments, the method comprises injecting pluripotent stem cells (PSCs) into a blastocyst of a non-human mammal donor to produce a chimeric blastocyst and implanting the chimeric blastocyst into the uterus of a non-human mammal donor. After implantation, the chimeric blastocyst will develop into a non-human mammal host comprising the target organ. The target organ and / or cells therefrom can be obtained from the non-human mammal host and used in the methods described herein.

[0068] Patients with type 1 diabetes mellitus (T1DM) or impaired awareness ofhypoglycemia (IAH) lack basic hypoglycemia-induced defense mechanisms, and are thus at increased risk for severe hypoglycemic events (Hwang et al., J Clin Invest (2018) 128:1485- 195; Lin et al., J Diabetes Investig (2020) 11:1388-1402). Current therapies for T1DM patients include intensive insulin treatment. However, these treatments can lead to sever hypoglycemia, which is associated with altered mental state, seizures, cardiac arrhythmias and even death (Bornstein et al., Nat Rev Endocrinol (2022) 18:389-390).

[0069] Pancreatic islet transplantation has been shown to be superior to insulin therapies,with improved patient survival and quality of life (Boughton et al., Diabetes Obes Metab (2021) 23:1389-1396). However, there is a donor shortage. One solution to the donor shortage problem includes transplantation of non-human animal pancreas into human patients in a procedure known as xenotransplantation. Non-human animals are typically chosen based on their anatomical and physiological similarities to humans. One drawback to xenotransplantation is that unmodified wild-type non-human animal organs and cells are typically rejected by the immune system of human recipients. An alternative approach to solve the organ donor shortage and rejection observed in xenotransplantation involves generating a human organ from human pluripotent stem cells (hPSCs) in a non-human animal with blastocyst complementation (BC).BC combined with gene editing is an emerging approach in the field of regenerative medicine that could potentially solve the worldwide problem of organ shortages for transplantation. In theory, BC can generate fully functional human organs, tissues or cells grown within genetically engineered livestock animals. Targeted deletion of a specific gene(s) using gene editing to cause deficiencies in organ development can open a niche for human stem cells to occupy, thus generating human tissues. In specific embodiments, a human subject’s PSCs are injected into a blastocyst followed by blastocyst implantation into the uterus of a non-human animal from which the blastocyst was originally derived. After implantation, the blastocyst can develop into a non-human animal donor with an organ completely replaced by the PSCs, resulting in an organ and / or cells that are functional and resistant to rejection in the human subject from which the PSCs were derived.

[0070] In some embodiments, the PSCs are engineered to evade the immune system (alsoreferred to herein as a hypoimmune, also referred to as hypoimmunogenic or HIP pluripotent stem cells (HIP-PSCs)). In some embodiments, the HIP-PSC comprises HIP human PSCs (HIP-hPSC). In some embodiments, the HIP-hPSCs exhibit features that allow them to evade immune recognition.

[0071] In some embodiments, HIP-hPSCs are not subject to an innate immune cell rejection.In some embodiments, the HIP-hPSCs provided herein exhibit reduced innate immune cell rejection and / or adaptive immune cell rejection. For example, in some embodiments, the HIP- hPSCs exhibit reduced susceptibility to NK cell-mediated lysis and / or macrophage engulfment. In some embodiments, the HIP-hPSCs are useful as a source of universally compatible cells or tissues (e.g. universal donor cells or tissues) that can be used in genetic complementation, such as blastocyst complementation. Such HIP-hPSCs retain cell-specific characteristics and features upon injection into a blastocyst. In some embodiments, the HIP-hPSCs can form an effective organ (e.g., a pancreas) when injected into a target-organ deficient blastocyst (e.g., apancreatic) and the blastocyst allowed to develop to birth. In some embodiments, an organ produced according to the disclosed method provides stable endocrine function via production and secretion of insulin, thereby enabling insulin independence when transplanted into a subject. In some embodiments, stable endocrine function and insulin independence occurs in the absence of immunosuppression. In some embodiments, the HIP-hPSCs can be used as a source of cells for allogeneic therapy regardless of the subject’s genetic make-up.

[0072] In some embodiments, the HIP-hPSCs, contain modifications that (a) reduceexpression of one or more major histocompatibility complex (MHC) class I molecules and / or one or more of MHC class II molecules; and (b) increase expression of one or more tolerogenicfactors in the HIP-hPSCs relative to a control or a wild-type hPSC. In some embodiments, the modifications make the cells hypoimmune, which in some aspects allow the cells to evade immune rejections compared to control or wild-type hPSCs.

[0073] The HIP-hPSCs utilize expression of tolerogenic factors and are also modulated (e.g.reduced or eliminated) for expression (e.g. surface expression) of one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, the modification that reduces expression of one or more MHC class I molecules is a modification that reduces expression of β-2 microglobulin (B2M). In some embodiments, the modification that reduces expression of one or more MHC class II molecules is a modification that reduces expression of CIITA.

[0074] In some embodiments, genome editing technologies utilizing rare-cuttingendonucleases (e.g. the CRISPR / Cas, TALEN, zinc finger nuclease, meganuclease, and homing endonuclease systems) are used to reduce or eliminate expression of immune genes (e.g. by deleting genomic DNA of critical immune genes) as described herein, such as genes involved in regulating expression of MHC class I molecules or MHC class II molecules. In certain embodiments, genome editing technologies or other gene modulation technologies are used to insert tolerance-inducing (tolerogenic) factors (e.g. CD47) into a target genomic locus of HIP-hPSCs, thus producing an organ such as a pancreas and / or islet cells thereof that can evade immune recognition upon transplanting into a recipient subject. Therefore, the HIP- hPSCs exhibit modulated expression (e.g. reduced or eliminated expression) of one or more genes and factors that affect expression of MHC class I molecules and / or MHC class II molecules, modulated expression (e.g. reduced or and modulated expression (e.g. overexpression) of tolerogenic factors, such as CD47, and provide for reduced recognition by the recipient subject’s immune system. In some embodiments, the HIP-hPSCs can also exhibit modulated expression (e.g. reduced expression) of CD142, which, in some aspects, can also be reduced by genome editing technologies (e.g. the CRISPR / Cas, TALEN, zinc finger nuclease, meganuclease, and homing endonuclease systems) to reduce or eliminate expression of CD142 (e.g. by deleting genomic DNA of critical immune genes). In some embodiments, the HIP- hPSCs can exhibit modulated expression (e.g. increased expression) of one or more complement inhibitors selected from CD46, CD59, CD55 and CD35, which, in some aspects, can also be increased by genome editing technologies to insert or integrate an exogenous polynucleotide encoding the one or more complement inhibitors into a genomic locus in the HIP-hPSCs.

[0075] In some aspects, provided herein are methods of producing a target organ, such as apancreas and / or islet cells therefrom, for use in subjects with a disease or condition. In some embodiments, the disease or condition comprises a beta cell related disorder. In some embodiments, the beta cell related disorder is a metabolic disorder. In some embodiments, the metabolic disorder is familial hypercholesterolemia, Gaucher disease, Hunter syndrome, Krabbe disease, maple syrup urine disease, metachromatic leukodystrophy, mitochondrial encephalopathy, lactic acidosis, stroke-like episodes (MELAS), Niemann-Pick disease, phenylketonuria (PKU), porphyria, Tay-Sachs disease, Wilson’s disease, Type I diabetes, Type II diabetes, obesity, hypertension, dyslipidemia, or carbohydrate intolerance. In some embodiments, the beta cell related disorder is Type I diabetes.

[0076] In some embodiments, the provided methods are for treating a beta cell relateddisorder (e.g. diabetes) in a subject, such as to improve glucose tolerance in the subject. In particular embodiments, the methods are for treating Type I diabetes in a subject, such as to improve glucose tolerance in the subject. In other embodiments, the methods improve graft function of the provided islet cells. In some embodiments, the methods restore glucose metabolism in a subject.

[0077] The practice of the particular embodiments will employ, unless indicated specificallyto the contrary, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA techniques, genetics, immunology, and cell biology that are within the skill of the art, many of which are described below for the purpose of illustration. Such techniques are explained fully in the literature. See e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rdEdition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2ndEdition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Glover, DNA Cloning: A Practical Approach, vol. I & II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex genomes, (academic Press, New York, 1992); Transcription and Translation (B. Hames & S. Higgins, Eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998) Current Protocols in Immunology Q. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991); Annual Review of Immunology; as well as monographs in journals such as Advances in Immunology.

[0078] All publications, including patent documents, scientific articles, and databases,referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0079] The section headings used herein are for organizational purposes only and are not tobe construed as limiting the subject matter described. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description illustrates the disclosure and, of course, should not be construed in any way as limiting the scope of the inventions described herein. I. DEFINITIONS

[0080] Unless defined otherwise, all terms of art, notations and other technical and scientificterms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.

[0081] The term “about” as used herein when referring to a measurable value, such as anamount or concentration and the like, is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount. As used herein, including in the appended claims, the singular forms “a,” “or,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a” or “an” means “at least one” or “one or more.” It is understood that aspects and variations described herein include embodiments “consisting” and / or “consisting essentially of” such aspects and variations.

[0082] As used herein, the term “and / or” includes any and all combinations of one or moreof the associated listed items.

[0083] As used herein, the term “blastocyst” is used broadly herein to refer to a cluster ofdividing cells that result from a fertilized egg. Three days after fertilization, a healthy fertilized egg contains about 6 to 10 cells. Five to six days after fertilization, the fertilized egg is referred to as a blastocyst. The blastocyst comprises the early stage of an embryo.

[0084] As used herein, the term “embryo” is an unborn or unhatched offspring in the processof development.

[0085] As used herein, the term “blastocyst complementation” or “BC” refers to a processthat uses a host developmental program to incorporate donor pluripotent stem cells (PSCs) into the host. When the donor PSCs are injected into a recipient blastocyst or morula lacking critical genes for organogenesis, the PSCs can replace the defective organ niche and compensate for functional defects of recipient cells. BC can be used in a donor and recipient of the same species or a donor and recipient of different species.

[0086] As used herein, the term “exogenous” with reference to a polypeptide or apolynucleotide is intended to mean that the referenced molecule is introduced into the cell of interest. The exogenous molecule, such as exogenous polynucleotide, can be introduced, for example, by introduction of an exogenous encoding nucleic acid into the genetic material of the cells such as by integration into a chromosome or as non-chromosomal genetic material such as a plasmid or expression vector. Therefore, the term as it is used in reference to expression of an encoding nucleic acid refers to introduction of the encoding nucleic acid in an expressible form into the cell. In some cases, an "exogenous" molecule is a molecule, construct, factor and the like that is not normally present in a cell, but can be introduced into a cell by one or more genetic, biochemical or other methods.

[0087] The term “endogenous” refers to a referenced molecule, such as a polynucleotide (e.g.gene), or polypeptide, that is present in a native or unmodified cell. For instance, the term when used in reference to expression of an endogenous gene refers to expression of a gene encoded by an endogenous nucleic acid contained within the cell and not exogenously introduced. A "gene,” includes a DNA region encoding a gene product, as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions. The sequence of a gene is typically present at a fixed chromosomal position or locus on a chromosome in the cell.

[0088] The term “locus” refers to a fixed position on a chromosome where a particular geneor genetic marker is located. Reference to a “target locus” refers to a particular locus of a desired gene in which it is desired to target a genetic modification, such as a gene edit or integration of an exogenous polynucleotide.

[0089] The term “expression” with reference to a gene or "gene expression" refers to theconversion of the information, contained in a gene, into a gene product. A gene product can be the direct transcriptional product of a gene (e.g. mRNA, tRNA, rRNA, antisense RNA, ribozyme, structural RNA or any other type of RNA) or can be a protein produced by translation of an mRNA. Gene products also include RNAs which are modified, by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristoylation, and glycosylation. Hence, reference to expression or gene expression includes protein (or polypeptide) expression or expression of a transcribable product of or a gene such as mRNA. The protein expression may include intracellular expression or surface expression of a protein. Typically, expression of a gene product, such as mRNA or protein, is at a level that is detectable in the cell.

[0090] As used herein, a “detectable” expression level, means a level that is detectable bystandard techniques known to a skilled artisan, and include for example, differential display, RT (reverse transcriptase)-coupled polymerase chain reaction (PCR), Northern Blot, and / or rNase protection analyses as well as immunoaffinity-based methods for protein detection, such as flow cytometry, ELISA, or western blot. The degree of expression levels need only be large enough to be visualized or measured via standard characterization techniques.

[0091] As used herein, the term “differentiation” or “differentiated” refers to a process bywhich an unspecialized (“uncommitted”) or less specialized cell acquires the features of a specialized cell such as, for example, a pancreatic cell. A differentiated cell is one that has taken on a more specialized (“committed”) position within the lineage of a cell. The term “committed”, when applied to the process of differentiation, refers to a cell that has proceeded in the differentiation pathway to a point where, under normal circumstances, it will continue to differentiate into a specific cell type or subset of cell types, and cannot, under normal circumstances, differentiate into a different cell type or revert to a less differentiated cell type. As used herein, the lineage of a cell defines the heredity of the cell, i.e., which cells it came from and to what cells it can give rise. The lineage of a cell places the cell within a hereditary scheme of development and differentiation. A lineage-specific marker refers to a characteristic specifically associated with the phenotype of cells of a lineage of interest and can be used to assess the differentiation of an uncommitted cell to the lineage of interest.

[0092] As used herein, the term “increased expression”, “enhanced expression” or“overexpression” means any form of expression that is additional to the expression in an original or source cell that does not contain the modification for modulating a particular geneexpression, for instance a wild-type expression level (which can be absence of expression or immeasurable expression as well). Reference herein to “increased expression,” “enhanced expression” or “overexpression” is taken to mean an increase in gene expression and / or, as far as referring to polypeptides, increased polypeptide levels and / or increased polypeptide activity, relative to the level in a cell that does not contain the modification, such as the original source cell prior to the engineering to introduce the modification, such as an unmodified cell or a wild- type cell. The increase in expression, polypeptide levels or polypeptide activity can be at least 5%, 10%, 20%, 30%, 40% or 50%, 60%, 70%, 80%, 85%, 90%, or 100% or even more. In some cases, the increase in expression, polypeptide levels or polypeptide activity can be at least 2-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold or more.

[0093] The term “hypoimmunogenic” or “hypoimmune” refers to a cell that is less prone toimmune rejection by a subject to which such cells are transplanted. For example, relative to a similar cell that does not contain modifications, such as an unaltered or unmodified wild-type cell, such a hypoimmunogenic cell may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99% or more less prone to immune rejection by a subject into which such cells are transplanted. Typically, the hypoimmunogenic cells are allogenic to the subject and a hypoimmunogenic cell evades immune rejection in an MHC-mismatched allogeneic recipient. In some embodiments, a hypoimmunogenic cell is protected from T cell- mediated adaptive immune rejection and / or innate immune cell rejection.

[0094] Hypoimmunogenecity of a cell can be determined by evaluating the immunogenicityof the cell such as the cell’s ability to elicit adaptive and / or innate immune responses. Such immune response can be measured using assays recognized by those skilled in the art.

[0095] The term “tolerogenic factor” as used herein include immunosuppressive factors orimmune-regulatory factors that modulate or affect the ability of a cell to be recognized by the immune system of a host or recipient subject upon administration, transplantation, or engraftment. Typically a tolerogenic factor is a factor that induces immunological tolerance to an engineered islets so that the engineered islets is not targeted, such as rejected, by the host immune system of a recipient. Hence, a tolerogenic factor may be a hypoimmunity factor. Examples of tolerogenic factors include immune cell inhibitory receptors (e.g. CD47), proteins that engage immune cell inhibitory receptors, checkpoint inhibitors and other molecules that reduce innate or adaptive immune recognition.

[0096] The terms “decrease,” “reduced,” “reduction,” and “decrease” are all used hereingenerally to mean a decrease by a statistically significant amount. However, for avoidance ofdoubt, “decrease,” “reduced,” “reduction,” “decrease” means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (i.e. absent level as compared to a reference sample), or any decrease between 10-100% as compared to a reference level.

[0097] The terms “increased”, “increase” or “enhance” or “activate” are all used herein togenerally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms “increased”, “increase” or “enhance” or “activate” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10- fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.

[0098] As used herein, the term “modification” with reference to a cell refers to any changeor alteration of a nucleic acid in the genome of a cell, which may impact gene expression in the cell. For example, a modification includes a genetic modification that results in alterations, additions, and / or deletion of genes or portions of genes or other nucleic acid sequences. A modified cell, such as a genetically modified cell, can also refer to a cell with an added, deleted and / or altered gene or portion of a gene. In some embodiments, the modification is a genetic modification that directly changes the gene or regulatory elements thereof encoding a protein product in a cell, such as by gene editing, mutagenesis or by genetic engineering of an exogenous polynucleotide or transgene. Genetic modifications include, for example, both transient knock-in or knock-down mechanisms, and mechanisms that result in permanent knock-in, knock-down, or knock-out of target genes or portions of genes or nucleic acid sequences Genetic modifications include, for example, both transient knock-in and mechanisms that result in permanent knock-in of nucleic acids sequences Genetic modifications also include, for example, reduced or increased transcription, reduced or increased mRNA stability, reduced or increased translation, and reduced or increased protein stability.

[0099] As used herein, “indel” refers to a mutation resulting from an insertion, deletion, or acombination thereof, of nucleotide bases in the genome. Thus, an indel typically inserts ordeletes nucleotides from a sequence. As will be appreciated by those skilled in the art, an indel in a coding region of a genomic sequence will result in a frameshift mutation, unless the length of the indel is a multiple of three. A CRISPR / Cas system of the present disclosure can be used to induce an indel of any length in a target polynucleotide sequence.

[0100] In some embodiments, the alteration is a point mutation. As used herein, “pointmutation” refers to a substitution that replaces one of the nucleotides. A CRISPR / Cas system of the present disclosure can be used to induce an indel of any length or a point mutation in a target polynucleotide sequence.

[0101] As used herein, “knock out” includes deleting all or a portion of the targetpolynucleotide sequence in a way that interferes with the function of the target polynucleotide sequence. For example, a knock out can be achieved by altering a target polynucleotide sequence by inducing an indel in the target polynucleotide sequence in a functional domain of the target polynucleotide sequence (e.g. a DNA binding domain). Those skilled in the art will readily appreciate how to use the CRISPR / Cas systems of the present disclosure to knock out a target polynucleotide sequence or a portion thereof based upon the details described herein.

[0102] In some embodiments, the alteration results in a knock out of the targetpolynucleotide sequence or a portion thereof. Knocking out a target polynucleotide sequence or a portion thereof using a CRISPR / Cas system of the present disclosure can be useful for a variety of applications. For example, knocking out a target polynucleotide sequence in a cell can be performed in vitro for research purposes. For ex vivo purposes, knocking out a target polynucleotide sequence in a cell can be useful for treating or preventing a disorder associated with expression of the target polynucleotide sequence (e.g. by knocking out a mutant allele in a cell ex vivo and introducing those cells comprising the knocked out mutant allele into a subject).

[0103] By “knock in” herein is meant a process that adds a genetic function to a host cell.This causes increased levels of the knocked in gene product, e.g. an RNA or encoded protein. As will be appreciated by those in the art, this can be accomplished in several ways, including adding one or more additional copies of the gene to the host cell or altering a regulatory component of the endogenous gene increasing expression of the protein is made. This may be accomplished by modifying the promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.

[0104] In some embodiments, an alteration or modification described herein results inreduced expression of a target or selected polynucleotide sequence. In some embodiments, analteration or modification described herein results in reduced expression of a target or selected polypeptide sequence.

[0105] In some embodiments, an alteration or modification described herein results inincreased expression of a target or selected polynucleotide sequence. In some embodiments, an alteration or modification described herein results in increased expression of a target or selected polypeptide sequence. “Modulation” of gene expression refers to a change in the expression level of a gene. Modulation of expression can include, but is not limited to, gene activation and gene repression. Modulation may also be complete, i.e. wherein gene expression is totally inactivated or is activated to wild type levels or beyond; or it may be partial, wherein gene expression is partially reduced, or partially activated to some fraction of wild type levels.

[0106] The term “operatively linked” or “operably linked” are used interchangeably withreference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.

[0107] As used herein, “pluripotent stem cell” have the potential to differentiate into any ofthe three germ layers: endoderm (e.g. the stomach linking, gastrointestinal tract, lungs, etc.), mesoderm (e.g. muscle, bone, blood, urogenital tissue, etc.) or ectoderm (e.g. epidermal tissues and nervous system tissues). The term “pluripotent stem cells” as used herein, also encompasses “induced pluripotent stem cells”, or “iPSCs”, or a type of pluripotent stem cell derived from a non-pluripotent cell. In some embodiments, a pluripotent stem cell is produced or generated from a cell that is not a pluripotent cell. In other words, pluripotent stem cells can be direct or indirect progeny of a non-pluripotent cell. Examples of parent cells include somatic cells that have been reprogrammed to induce a pluripotent, undifferentiated phenotype by various means. Such “iPS” or “iPSC” cells can be created by inducing the expression of certain regulatory genes or by the exogenous application of certain proteins. Methods for the induction of iPS cells are known in the art and are further described below. (See, e.g. Zhou et al., Stem Cells 27 (11): 2667-74 (2009); Huangfu et al., Nature Biotechnol.26 (7): 795 (2008); Woltjenet al., Nature 458 (7239): 766-770 (2009); and Zhou et al., Cell Stem Cell 8:381-384 (2009); each of which is incorporated by reference herein in their entirety.) As used herein, “hiPSCs” are human induced pluripotent stem cells. In some embodiments, “pluripotent stem cells,” as used herein, also encompasses mesenchymal stem cells (MSCs), and / or embryonic stem cells (ESCs).

[0108] The terms “polypeptide” and “protein,” as used herein, may be used interchangeablyto refer to a series of amino acid residues joined by peptide bonds (i.e. a polymer of amino acid residues), and are not limited to a minimum length. Such polymers may contain natural or non- natural amino acid residues, or combinations thereof, and include, but are not limited to, peptides, polypeptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Thus, a protein or polypeptide includes those with modified amino acids (e.g. phosphorylated, glycated, glycosylated, etc.) and amino acid analogs. Full-length polypeptides or proteins, and fragments thereof, are encompassed by this definition. The terms also include modified species thereof, e.g. post-translational modifications of one or more residues, for example, methylation, phosphorylation glycosylation, sialylation, or acetylation.

[0109] Throughout this disclosure, various aspects of the claimed subject matter arepresented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For instance, where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictate otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure. In some embodiments, two opposing and open ended ranges are provided for a feature, and in such description it is envisioned that combinations of those two ranges are provided herein. For example, in some embodiments, it is described that a feature is greater than about 10 units, and it is described (such as in another sentence) that the feature is less than about 20 units, and thus, the range of about 10 units to about 20 units is described herein.

[0110] As used herein, “safe harbor locus” refers to a gene locus that allows expression of atransgene or an exogenous gene in a manner that enables the newly inserted genetic elements to function predictably and that also may not cause alterations of the host genome in a mannerthat poses a risk to the host cell. Exemplary “safe harbor” loci include, but are not limited to, a CCR5 gene, a PPP1R12C (also known as AAVS1) gene, a CLYBL gene, and / or a Rosa gene (e.g. ROSA26).

[0111] As used herein, a “target locus” refers to a gene locus that allows expression of atransgene or an exogenous gene. Exemplary “target loci” include, but are not limited to, a CXCR4 gene, an albumin gene, a SHS231 locus, an F3 gene (also known as CD142), a MICA gene, a MICB gene, a LRP1 gene (also known as CD91), a HMGB1 gene, an ABO gene, a RHD gene, a FUT1 gene, and / or a KDM5D gene (also known as HY). The exogenous polynucleotide encoding the exogenous gene can be inserted in the CDS region for B2M, CIITA, CCR5, F3 (i.e., CD142), MICA, MICB, LRP1, HMGB1, ABO, RHD, FUT1, KDM5D (i.e., HY), PDGFRa, OLIG2, and / or GFAP. The exogenous polynucleotide encoding the exogenous gene can be inserted in introns 1 or 2 for PPP1R12C (i.e., AAVS1) or CCR5. The exogenous polynucleotide encoding the exogenous gene can be inserted in exons 1 or 2 or 3 for CCR5. The exogenous polynucleotide encoding the exogenous gene can be inserted in intron 2 for CLYBL. The exogenous polynucleotide encoding the exogenous gene can be inserted in a 500 bp window in Ch-4:58,976,613 (i.e., SHS231). The exogenous polynucleotide encoding the exogenous gene can be insert in any suitable region of the aforementioned safe harbor or target loci that allows for expression of the exogenous gene, including, for example, an intron, an exon or a coding sequence region in a safe harbor or target locus.

[0112] As used herein, a “target” can refer to a gene, a portion of a gene, a portion of thegenome, or a protein that is subject to regulatable reduced expression by the methods described herein.

[0113] As used herein, a “subject” or an “individual,” which are terms that are usedinterchangeably, is a mammal. In some embodiments, a “mammal” includes humans, non- human primates, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, rabbits, cattle, pigs, hamsters, gerbils, mice, ferrets, rats, cats, monkeys, etc. In some embodiments, the subject or individual is human. In some embodiments, the subject is a patient that is known or suspected of having a disease, disorder or condition.

[0114] As used herein, “therapeutically effective amount” refers to an amount sufficient toprovide a therapeutic benefit in the treatment and / or management of a disease, disorder, or condition. In some embodiments, a therapeutically effective amount is an amount sufficient to ameliorate, palliate, stabilize, reverse, slow, attenuate or delay the progression of a disease, disorder, or condition, or of a symptom or side effect of the disease, disorder, or condition. Insome embodiments, the therapeutically effective amount is also a clinically effective amount. In other embodiments, the therapeutically effective amount is not a clinically effective amount.

[0115] As used herein, the term “treating” and “treatment” includes administering to asubject an effective amount of cells described herein so that the subject has a reduction in at least one symptom of the disease or an improvement in the disease, for example, beneficial or desired clinical results. For purposes of this technology, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treating can refer to prolonging survival as compared to expected survival if not receiving treatment. Thus, one of skill in the art realizes that a treatment may improve the disease condition, but may not be a complete cure for the disease. In some embodiments, one or more symptoms of a disease or disorder are alleviated by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% upon treatment of the disease.

[0116] For purposes of this technology, beneficial or desired clinical results of diseasetreatment include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.

[0117] A “vector” or “construct” is capable of transferring gene sequences to target cells.Typically, “vector construct,” “expression vector,” and “gene transfer vector,” mean any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells. Thus, the term includes cloning, and expression vehicles, as well as integrating vectors. Methods for the introduction of vectors or constructs into cells are known to those of skill in the art and include, but are not limited to, lipid-mediated transfer (i.e., liposomes, including neutral and cationic lipids), electroporation, direct injection, cell fusion, particle bombardment, calcium phosphate co-precipitation, DEAE-dextran- mediated transfer and viral vector-mediated transfer. II. METHODS OF PRODUCING A TARGET ORGAN AND / OR CELLTHEREOF

[0118] Provided herein are methods of producing a target organ (e.g., a pancreas) and / or cellstherefrom (e.g., islet cells), comprising human cells in a non-human mammal host. Themethods disclosed herein provide for rapid creation of animals to serve as sources of organs, tissues and cellular products for use in human subjects. In the context of personalized medicine, a skilled artisan can appreciate that the methods provided herein allow for a patient to provide his or her own stem cells for complementation and production of human or humanized “self” organs, tissues or cells.

[0119] In some aspects, the method comprises injecting pluripotent stem cell (PSC) into anembryo of a non-human mammal donor thereby producing a chimeric embryo, implanting the chimeric embryo into the uterus of a non-human mammal surrogate and obtaining the target organ (e.g., a pancreas) and / or cells therefrom (e.g., islet cells). In some embodiments, the PSC comprises any of the cells described herein. In some embodiments, the cells are injected into the blastocyst of the embryo. In some embodiments, the methods described herein can provide cells, tissues or organs for transplanting to a recipient or subject in need thereof.

[0120] Also provided herein are compositions and methods relating to the target organ (e.g.,pancreas, lung, kidney, heart, heart valve, lung, muscle, uterus, thymus, bone marrow, spleen, skin, cornea, eye, or intestine) and / or cells therefrom (e.g., islet cells). In some aspects, the target organ (e.g., pancreas, lung, kidney, heart, heart valve, lung, muscle, uterus, thymus, bone marrow, spleen, skin, cornea, eye, or intestine) and / or cells therefrom (e.g., islet cells) are for use in methods of treating a disease or condition in a subject. In some embodiments, the disease or condition comprises a beta cell related disorder. In particular embodiments, provided herein is a method of treating or preventing a beta cell related disorder in a subject in need thereof comprising administering the target organ (e.g., pancreas) and / or cells isolated therefrom (e.g., islet cells) provided herein. In some embodiments, the beta cell related disorder comprises diabetes. In some embodiments, the diabetes is type I or type II diabetes. In other aspects, provided herein is a method of improving glucose tolerance in a subject in need thereof comprising administering the target organ (e.g., pancreas) and / or cells isolated therefrom (e.g., islet cells), as provided herein. In some embodiments, the subject is administered the pancreas provided herein. In some embodiments, the subject is administered the whole pancreas. In some embodiments, the subject is administered a segment or portion of the pancreas. In some embodiments, the subject is administered islet cells derived from the pancreas. A. Pluripotent Stem Cells (PSCs)

[0121] In some aspects, provided herein is a stem cell (SC) for use in a method of producinga target organ (e.g., pancreas, lung, kidney, heart, heart valve, lung, muscle, uterus, thymus, bone marrow, spleen, skin, cornea, eye, or intestine) and cells derived therefrom (e.g., isletcells). In some embodiments, the SC comprises a pluripotent stem cell (PSC), a multipotent stem cell or a totipotent stem cell. In some embodiments, the SC is a PSC, which is able to give rise to all cell types in an adult. In some embodiments, the SC is a multipotent stem cell, which is able to give rise to multiple cells within a lineage. In some embodiments, the SC is a totipotent stem cell, which is able to give rise to all embryonic and adult lineages.

[0122] In some embodiments, the PSCs are mammalian. In some embodiments, the PSCs arehuman. In some embodiments, the PSCs are non-human mammalian. In some embodiments, the non-human mammalian PSCs are non-human primate PSCs.

[0123] In some embodiments, the PSC comprises a human embryonic stem cell (hESC). Insome embodiments, the PSC comprises an induced pluripotent stem cell (iPSC). The generation of mammalian (e.g., mouse and human) pluripotent stem cells (generally referred to as iPSCs; miPSCs for murine cells or hiPSCs for human cells) is generally known in the art. As will be appreciated by those in the art, there are a variety of different methods for the generation of iPSC. The original induction was done from mouse embryonic or adult fibroblasts using the viral introduction of four transcription factors, Oct3 / 4, Sox2, c-Myc and Klf4; see Takahashi and Yamanaka Cell 126:663-676 (2006), hereby incorporated by reference in its entirety and specifically for the techniques outlined therein. Since then, a number of methods have been developed; see Seki et al, World J. Stem Cells 7(1): 116-125 (2015) for a review, and Lakshmipathy and Vermuri, editors, Methods in Molecular Biology: Pluripotent Stem Cells, Methods and Protocols, Springer 2013, both of which are hereby expressly incorporated by reference in their entirety, and in particular for the methods for generating hiPSCs (see for example Chapter 3 of the latter reference).

[0124] Generally, iPSCs are generated by the transient expression of one or morereprogramming factors” in the host cell, usually introduced using episomal vectors. Under these conditions, small amounts of the cells are induced to become iPSCs (in general, the efficiency of this step is low, as no selection markers are used). Without wishing to be bound by theory, it is believed that once the cells are “reprogrammed”, and become pluripotent, they lose the episomal vector(s) and produce the factors using the endogenous genes.

[0125] As is also appreciated by those of skill in the art, the number of reprogramming factorsthat can be used or are used can vary. Commonly, when fewer reprogramming factors are used, the efficiency of the transformation of the cells to a pluripotent state goes down, as well as the “pluripotency”, e.g., fewer reprogramming factors may result in cells that are not fully pluripotent but may only be able to differentiate into fewer cell types.

[0126] In some embodiments, a single reprogramming factor, OCT4, is used. In otherembodiments, two reprogramming factors, OCT4 and KLF4, are used. In other embodiments, three reprogramming factors, OCT4, KLF4 and SOX2, are used. In other embodiments, four reprogramming factors, OCT4, KLF4, SOX2 and c-Myc, are used. In other embodiments, 5, 6 or 7 reprogramming factors can be used selected from SOKMNLT; SOX2, OCT4 (POU5F1), KLF4, MYC, NANOG, LIN28, and SV40L T antigen. In general, these reprogramming factor genes are provided on episomal vectors such as are known in the art and commercially available.

[0127] In some embodiments, the host cells used for transfecting the one or morereprogramming factors are non-pluripotent stem cells. In general, as is known in the art, iPSCs are made from non-pluripotent cells such as, but not limited to, blood cells, fibroblasts, etc., by transiently expressing the reprogramming factors as described herein. In some embodiments, the non-pluripotent cells, such as fibroblasts, are obtained or isolated from one or more individual subjects or donors prior to reprogramming the cells. In some embodiments, iPSCs are made from a pool of isolated non-pluripotent stems cells, e.g., fibroblasts, obtained from one or more (e.g. two or more, three or more, four or more, five or more, ten or more, twenty or more, fifty or more, or one hundred or more) different donor subjects. In some embodiments, the non-pluripotent cells, such as fibroblasts, are isolated or obtained from a plurality of different donor subjects (e.g., two or more, three or more, four or more, five or more, ten or more, twenty or more, fifty or more, or one hundred or more), pooled together in a batch, reprogrammed as iPSCs, and are optionally modified in accord with the provided methods. In some embodiments, the non-pluripotent cells, such as fibroblasts, are isolated or obtained from a plurality of different donor subjects (e.g., two or more, three or more, four or more, five or more, ten or more, twenty or more, fifty or more, or one hundred or more), pooled together in a batch, reprogrammed as iPSCs, and differentiated into SC-beta cells, which are then modified in accord with the provided methods.

[0128] In some embodiments, the iPSCs are derived from, such as by transiently transfectingone or more reprogramming factors into cells from a pool of non-pluripotent cells (e.g., fibroblasts) from one or more donor subjects that are different than the recipient subject (e.g., the patient administered the cells). The non-pluripotent cells (e.g., fibroblasts) to be induced to iPSCs can be obtained from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100 or more donor subjects and pooled together. The non-pluripotent cells (e.g., fibroblasts) can be obtained from 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10, or more 20 or more, 50 or more, or 100 or more donor subjects and pooled together. In someembodiments, the non-pluripotent cells (e.g., fibroblasts) are harvested from one or a plurality of individuals, and in some instances, the non-pluripotent cells (e.g., fibroblasts) or the pool of non-pluripotent cells (e.g., fibroblasts) are cultured in vitro and transfected with one or more reprogramming factors to induce generation of iPSCs. In some embodiments, the non- pluripotent cells (e.g., fibroblasts) or the pool of non-pluripotent cells (e.g., fibroblasts) are modified in accord with the methods provided herein. In some embodiments, the iPSCs (e.g., modified iPSCs) or a pool of iPSCs (e.g., a pool of modified iPSCs) are then subjected to a differentiation process for differentiation into any cells of an organism and tissue. B. Modified Pluripotent Stem Cells (PSCs)

[0129] In some aspects, provided herein is a modified stem cell (SC) for use in a method ofproducing a target organ (e.g., pancreas, lung, kidney, heart, heart valve, lung, muscle, uterus, thymus, bone marrow, spleen, skin, cornea, eye, or intestine) and cells derived therefrom (e.g., islet cells). In some embodiments, the PSCs (e.g., iPSCs or ESCs) comprise one or more modifications that modulate or regulate the expression of one or more target polynucleotide sequences involved in evading or alleviating an immune response. Thus, in some embodiments, the PSCs (e.g., iPSCs or ESCs) are hypoimmune (HIP). In some embodiments, the HIP-hPSC comprises one or more genetic modifications as described herein. In some embodiments, HIP-hPSC comprises modifications that inactivate or disrupt one or more alleles of one or more major histocompatibility complex (MHC) class I molecules or MHC class II molecules. In some embodiments, the HIP-hPSC comprises modifications that inactivate or disrupt one or more molecules that regulate expression of the one or more MHC class I molecules or MHC class II molecules. In some embodiments, the HIP-hPSC comprises modifications that increase expression of one or more tolerogenic factors. In some embodiments, increased expression of the one or more tolerogenic factors is relative to a control or wild-type hPSC that does not comprise the modifications disclosed herein.

[0130] In some embodiments, the one or more modifications modulate or regulate (e.g.,reduce or eliminate) the expression of MHC class I molecules, MHC class II molecules, or MHC class I and MHC class II molecules. In some embodiments, the one or more modifications modulate or regulate (e.g., increase) the expression of a tolerogenic factor, such as CD47. In some embodiments, one or more other modifications that modulate or regulate expression of other immune molecules also can be present in the HIP-PSC (e.g., HIP-iPSC or HIP-ESC), such as a modification that regulates (e.g., reduces or eliminates) the expression ofCD142 or a modification that regulates (e.g., increases) the expression of one or more complement inhibitor.

[0131] In some embodiments, the provided HIP-PSC (e.g., HIP-iPSC or HIP-ESC) may alsoinclude a modification to increase expression of one or more tolerogenic factors. In some embodiments, the tolerogenic factor is one or more of DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4- Ig, Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3, or any combination thereof. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15- RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of CD47. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of PD-L1. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of HLA-E. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of HLA-G. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or includes increased expression of CCL21, PD-L1, FasL, Serpinb9, H2-M3 (HLA-G), CD47, CD200, and Mfge8.

[0132] In some embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) includes one ormore genomic modifications that reduce expression of MHC class I molecules and a modification that increases expression of CD47. In other words, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) comprises exogenous CD47 proteins and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells include one or more genomic modifications that reduce expression of MHC class II molecules and a modification that increases expression of CD47. In some instances, the modified cells comprise exogenous CD47 nucleic acids and proteins, and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells include one or more genomic modifications that reduce or eliminate expression of MHC class II molecules, one or more genomic modifications that reduce or eliminate expression of MHC class II molecules, and a modification that increases expression of CD47. In some embodiments, the HIP-PSC(e.g., HIP-iPSC or HIP-ESC) comprises exogenous CD47 proteins, exhibit reduced or silenced surface expression of one or more MHC class I molecules and exhibit reduced or lack surface expression of one or more MHC class II molecules. In many embodiments, the cells are B2Mindel / indel, CIITAindel / indel, CD47tgcells.

[0133] In certain embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) may comprise amodification that modulates or regulates the expression of CD142. In some embodiments, the modification reduces or eliminates expression of CD142. In some embodiments, the modification that reduces expression of CD142 reduces CD142 protein expression. In some embodiments, the modification eliminates CD142 gene activity. In some embodiments, the modification comprises inactivation or disruption of both alleles of the CD142 gene. In some embodiments, the modification comprises inactivation or disruption of all CD142 coding sequences in the cell. In some embodiments, the inactivation or disruption comprises an indel in the CD142 gene. In some embodiments, the modification is a frameshift mutation or a deletion of a contiguous stretch of genomic DNA of the CD142 gene. In some embodiments, the CD142 gene is knocked out.

[0134] In some embodiments, the provided HIP-PSC (e.g., HIP-iPSC or HIP-ESC) cells mayalso contain one or more modifications that increase expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, CD35 and combinations thereof. In some embodiments, the modification(s) that increase expression comprise increased surface expression, and / or the modifications that reduce expression comprise reduced surface expression. In some embodiments, the modification(s) that increase expression of the one or more complement inhibitor comprises an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55 and / or an exogenous polynucleotide encoding CD35. In some embodiments, the one or more complement inhibitor is CD46 and CD59, optionally wherein the modification comprises an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59.the one or more complement inhibitor is CD46, CD59 and CD55, optionally wherein the modification comprises an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59 and an exogenous polynucleotide encoding CD55. In some embodiments, the modified cell comprises a multi-cistronic vector comprising two or more exogenous polypeptides selected from the group consisting of one or more exogenous polynucleotide encoding the one or more tolerogenic factors, an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenouspolynucleotide encoding CD55 polypeptide. In some embodiments, each of the polynucleotides are separated by an IRES or a self-cleaving peptide.

[0135] In some embodiments, modulation of expression of the one or more target immunemolecules, e.g. tolerogenic factor (e.g., increased expression), and the modulation of expression of the MHC class I molecules and / or MHC class II molecules (e.g., reduced or eliminated expression), is relative to the amount of expression of said molecule(s) in a pluripotent stem cell that does not comprise the modification(s) (i.e., unmodified pluripotent stem cell). In some embodiments, the cells are engineered or modified to have reduced or increased expression of one or more targets relative to an unaltered or unmodified wild-type cell. In some embodiments, the cells are engineered or modified to have constitutive reduced or increased expression of one or more targets relative to an unaltered or unmodified cell. In some embodiments, the cells are engineered or modified to have regulatable reduced or increased expression of one or more targets relative to an unaltered or unmodified cell. In some embodiments, the cells comprise increased expression of a tolerogenic factor (e.g., CD47) and reduced expression of the MHC class I molecules and / or MHC class II molecules relative to a wild-type cell or a control cell of the same cell type. Examples of wild type or control cells include pluripotent cells (e.g., ESCs or iPSCs). However, by way of example, in the context of an engineered cell, as used herein, “wild-type” or “control” can also mean an engineered cell that may contain nucleic acid changes resulting in reduced expression of MHC I and / or II, but did not undergo the gene editing procedures to result in overexpression of CD47 proteins. In the context of an iPSC or a progeny thereof, “wild-type” or “control” also means an iPSC or progeny thereof that may contain nucleic acid changes resulting in pluripotency but did not undergo the gene editing procedures of the present disclosure to achieve reduced expression of MHC I and / or II, and / or overexpression of CD47 proteins. In the context of an ESC or a progeny thereof, “wild-type” or “control” also means an ESC or progeny thereof that may contain nucleic acid changes resulting in pluripotency but did not undergo the gene editing procedures of the present disclosure to achieve reduced expression of MHC I and / or II, and / or overexpression of CD47 proteins. In some embodiments, the wild-type cell or the control cell is a starting material. In some embodiments, an iPSC cell line starting material is a starting material that is considered a wild-type or control cell as contemplated herein. In some embodiments, an ESC cell line starting material is a starting material that is considered a wild- type or control cell as contemplated herein. In some embodiments, the starting material is otherwise modified or engineered to have altered expression of one or more genes to generate the engineered cell. Hence, it is understood that reference to an “unmodified cell” can be acontrol cell that has been engineered in some aspects but does not contain all of the modifications by the gene editing procedures of the present disclosure to achieve reduced expression of MHC I and / or II, and / or overexpression of a tolerogenic protein (e.g., CD47).

[0136] In some embodiments, the unmodified cell or wildtype cell expresses the tolerogenicfactor, the MHC class I molecules, and / or the MHC class II molecules. In some embodiments, the unmodified cell or wildtype cell does not express the one or more tolerogenic factors, the MHC class I molecules, and / or the MHC class II molecules. In some embodiments wherein the unmodified cell or wildtype cell does not express the tolerogenic factor is used to generate the engineered primary cell, the provided engineered primary cells include a modification to overexpress the one or more tolerogenic factors or increase the expression of the one or more tolerogenic factors from 0%. It is understood that if the cell prior to the engineering does not express a detectable amount of the tolerogenic factor, then a modification that results in any detectable amount of an expression of the tolerogenic factor is an increase in the expression compared to the similar cell that does not contain the modifications.

[0137] In some embodiments, the population of HIP-PSC (e.g., HIP-iPSC or HIP-ESC)described herein elicits a reduced level of immune activation or no immune activation upon administration to a recipient subject. In some embodiments, the cells elicit a reduced level of systemic TH1 activation or no systemic TH1 activation in a recipient subject. In some embodiments, the cells elicit a reduced level of immune activation of peripheral blood mononuclear cells (PBMCs) or no immune activation of PBMCs in a recipient subject. In some embodiments, the cells elicit a reduced level of donor-specific IgG antibodies or no donor specific IgG antibodies against the cells upon administration to a recipient subject. In some embodiments, the cells elicit a reduced level of IgM and IgG antibody production or no IgM and IgG antibody production against the cells in a recipient subject. In some embodiments, the cells elicit a reduced level of cytotoxic T cell killing of the cells upon administration to a recipient subject.

[0138] In some embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) provided hereincomprises a “suicide gene” or “suicide switch.” A suicide gene or suicide switch can be incorporated to function as a “safety switch” that can cause the death of the cell, such as after the engineered organ (e.g., pancreas) and / or cells derived therefrom (e.g., islet cells) are administered to a subject and if the cells should grow and divide in an undesired manner. The “suicide gene” ablation approach includes a suicide gene in a gene transfer vector encoding a protein that results in cell killing only when activated by a specific compound. A suicide gene may encode an enzyme that selectively converts a nontoxic compound into highly toxicmetabolites. The result is specifically eliminating cells expressing the enzyme. In some embodiments, the suicide gene is the herpesvirus thymidine kinase (HSV-tk) gene and the trigger is ganciclovir. In other embodiments, the suicide gene is a cytosine deaminase (e.g., the Escherichia coli cytosine deaminase (EC-CD)) gene and the trigger is 5-fluorocytosine (5-FC) (Barese et al, Mol. Therap.20(10): 1932-1943 (2012), Xu et al, Cell Res.8:73-8 (1998), both incorporated herein by reference in their entirety).

[0139] In some aspects, provided are HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) having (1)reduced expression of MHC I and / or MHC II; and (2) a transgene comprising CD47 and a safety switch inserted at a safe harbor locus, wherein the safe harbor locus is selected from the group consisting of an AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 locus. In some aspects, provided are HIP- PSCs (e.g., HIP-iPSC or HIP-ESC) having (1) reduced expression of MHC I and / or MHC II; and (2) a transgene comprising CD47 and HSVtk flanked by CLYBL homology arms, wherein the transgene is inserted at the CLYBL locus. In some embodiments, the modified pluripotent stem cell has B2M and / or CIITA knockout. In some embodiments, the B2M and / or CIITA knockout occur in both alleles.

[0140] In other embodiments, the suicide gene is an inducible Caspase protein. An inducibleCaspase protein comprises at least a portion of a Caspase protein capable of inducing apoptosis. In preferred embodiments, the inducible Caspase protein is iCasp9. It comprises the sequence of the human FK506-binding protein, FKBP12, with an F36V mutation, connected through a series of amino acids to the gene encoding human caspase 9. FKBP12-F36V binds with high affinity to a small-molecule dimerizing agent, API 903. Thus, the suicide function of iCasp9 in the instant invention is triggered by the administration of a chemical inducer of dimerization (CID). In some embodiments, the CID is the small molecule drug API 903. Dimerization causes the rapid induction of apoptosis. (See WO2011146862; Stasi et al, N. Engl. J. Med 365; 18 (2011); Tey et al, Biol. Blood Marrow Transplant. 13:913-924 (2007), each of which are incorporated by reference herein in their entirety.)

[0141] Inclusion of a safety switch or suicide gene allows for controlled killing of the cellsin the event of cytotoxicity or other negative consequences to the recipient, thus increasing the safety of cell-based therapies, including those using tolerogenic factors.

[0142] In some embodiments, a safety switch can be incorporated into, such as introduced,into the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) provided herein to provide the ability to induce death or apoptosis of modified cells containing the safety switch, for example if the cells grow and divide in an undesired manner or cause excessive toxicity to the host. Thus, the use ofsafety switches enables one to conditionally eliminate aberrant cells in vivo and can be a critical step for the application of cell therapies in the clinic. Safety switches and their uses thereof are described in, for example, Duzgune§, Origins of Suicide Gene Therapy (2019); Duzgune§ (eds), Suicide Gene Therapy. Methods in Molecular Biology, vol.1895 (Humana Press, New York, NY) (for HSV-tk, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, and horseradish peroxidase); Zhou and Brenner, Exp Hematol 44(11):1013-1019 (2016) (for iCaspase9); Wang et al., Blood 18(5):1255-1263 (2001) (for huEGFR); U.S. Patent Application Publication No. 20180002397 (for HER1); and Philip et al., Blood124(8):1277-1287 (2014) (for RQR8).

[0143] In some embodiments, the safety switch can cause cell death in a controlled manner,for example, in the presence of a drug or prodrug or upon activation by a selective exogenous compound. In some embodiments, the safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.

[0144] In some embodiments, the safety switch may be a transgene encoding a product withcell killing capabilities when activated by a drug or prodrug, for example, by turning a non- toxic prodrug to a toxic metabolite inside the cell. In these embodiments, cell killing is activated by contacting a modified cell with the drug or prodrug. In some cases, the safety switch is HSV-tk, which converts ganciclovir (GCV) to GCV-triphosphate, thereby interfering with DNA synthesis and killing dividing cells. In some cases, the safety switch is CyD or a variant thereof, which converts the antifungal drug 5-fluorocytosine (5-FC) to cytotoxic 5-fluorouracil (5-FU) by catalyzing the hydrolytic deamination of cytosine into uracil. 5-FU is further converted to potent anti-metabolites (5- FdUMP, 5-FdUTP, 5-FUTP) by cellular enzymes. These compounds inhibit thymidylate synthase and the production of RNA and DNA, resulting in cell death. In some cases, the safety switch is NTR or a variant thereof, which can act on the prodrug CB 1954 via reduction of the nitro groups to reactive N-hydroxylamine intermediates that are toxic in proliferating and nonproliferating cells. In some cases, the safety switch is PNP or a variant thereof, which can turn prodrug 6-methylpurine deoxyriboside or fludarabine into toxic metabolites to both proliferating and nonproliferating cells. In some cases, the safety switch is horseradish peroxidase or a variant thereof, which can catalyze indole-3-acetic acid (IAA) to a potent cytotoxin and thus achieve cell killing.

[0145] In some embodiments, the safety switch may be an iCasp9. Caspase 9 is a componentof the intrinsic mitochondrial apoptotic pathway which, under physiological conditions, is activated by the release of cytochrome C from damaged mitochondria. Activated caspase 9 then activates caspase 3, which triggers terminal effector molecules leading to apoptosis. The iCasp9 may be generated by fusing a truncated caspase 9 (without its physiological dimerization domain or caspase activation domain) to a FK506 binding protein (FKBP), FKBP12-F36V, via a peptide linker. The iCasp9 has low dimer-independent basal activity and can be stably expressed in host cells (e.g., human T cells) without impairing their phenotype, function, or antigen specificity. However, in the presence of chemical inducer of dimerization (CID), such as 43ubconjun (AP1903), AP20187, and rapamycin, iCasp9 can undergo inducible dimerization and activate the downstream caspase molecules, resulting in apoptosis of cells expressing the iCasp9. See, e.g., PCT Application Publication No. WO2011 / 146862; Stasi et al., N. Engl. J. Med. 365;18 (2011); Tey et al., Biol. Blood Marrow Transplant 13:913-924 (2007). In particular, the rapamycin inducible caspase 9 variant is called rapaCasp9. See Stavrou et al., Mal. Ther.26(5):1266- 1276 (2018). Thus, iCasp9 can be used as a safety switch to achieve controlled killing of the host cells.

[0146] In some embodiments, the safety switch may be a membrane-expressed protein whichallows for cell depletion after administration of a specific antibody to that protein. Safety switches of this category may include, for example, one or more transgene encoding CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, or RQR8 for surface expression thereof. These proteins may have surface epitopes that can be targeted by specific antibodies. In some embodiments, the safety switch comprises CCR4, which can be recognized by an anti-CCR4 antibody. Non-limiting examples of suitable anti-CCR4 antibodies include mogamulizumab and biosimilars thereof. In some embodiments, the safety switch comprises CD16 or CD30, which can be recognized by an anti-CD16 or anti-CD30 antibody. Non- limiting examples of such antiCD16 or anti-CD30 antibody include AFM13 and biosimilars thereof. In some embodiments, the safety switch comprises CD19, which can be recognized by an anti-CD19 antibody. Non-limiting examples of such anti-CD19 antibody include MOR208 and biosimilars thereof. In some embodiments, the safety switch comprises CD20, which can be recognized by an anti-CD20 antibody. Non-limiting examples of such anti-CD20 antibody include obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-Rllb, and biosimilars thereof. Cells that express the safety switch are thus CD20-positive and can be targeted for killing through administration of an anti-CD20 antibody as described. In some embodiments, the safety switch comprises EGFR, which can be recognized by an anti-EGFRantibody. Non-limiting examples of such anti-EGFR antibody include tomuzotuximab, RO5083945 (GA201), cetuximab, and biosimilars thereof. In some embodiments, the safety switch comprises GD2, which can be recognized by an anti-GD2 antibody. Non-limiting examples of such anti-GD2 antibody include Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-Rllc, and biosimilars thereof.

[0147] In some embodiments, the safety switch may be an exogenously administered agentthat recognizes one or more tolerogenic factors on the surface of the modified cell. In some embodiments, the exogenously administered agent is an antibody directed against or specific to a tolerogenic agent, e.g., an anti-CD47 antibody. By recognizing and blocking a tolerogenic factor on the modified cell, an exogenously administered antibody may block the immune inhibitory functions of the tolerogenic factor thereby re-sensitizing the immune system to the modified cells. For instance, for a modified cell that overexpresses CD47 an exogenously administered anti-CD47 antibody may be administered to the subject, resulting in masking of CD47 on the modified cell and triggering of an immune response to the HIP-PSCs (e.g., HIP- iPSC or HIP-ESC).

[0148] In some embodiments, the safety switch can include any of the strategies as describedin WO2021146627A1, which is incorporated by reference in its entirety.

[0149] In some embodiments, the method further comprises introducing an expression vectorcomprising an inducible suicide switch into the cell.

[0150] In some embodiments, the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) are derived froma source cell already comprising one or more of the desired modifications. In some embodiments, in view of the teachings provided herein one of ordinary skill in the art will readily appreciate how to assess what modifications are required to arrive at the desired final form of a HIP-PSC (e.g., HIP-iPSC or HIP-ESC), and that not all reduced or increased levels of target components are achieved via active engineering. In some embodiments, the modifications of the modified cell may be in any order, and not necessarily the order listed in the descriptive language provided herein.

[0151] In some embodiments, provided herein is a method of generating a HIP-PSC (e.g.,HIP-iPSC or HIP-ESC), comprising: (a) reducing or eliminating the expression of MHC class I and / or MHC class II human leukocyte antigens in the cell; and (b) increasing the expression of a tolerogenic factor in the cell. In some embodiments, the one or more tolerogenic factors is selected from DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3. In someembodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the one or more tolerogenic factors is CD47. In some embodiments, the method comprises reducing or eliminating the expression of MHC class I and MHC class II human leukocyte antigens. In some embodiments, the reducing or increasing expression comprise performing one or more modifications to the cell using a guided nuclease (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing an expression vector comprising an inducible suicide switch into the cell. In some embodiments, the method further comprises increasing the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, and CD55 in said cell.

[0152] In some embodiments, provided herein is a method of generating a HIP-PSC (e.g.,HIP-iPSC or HIP-ESC), comprising: (a) increasing the expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8 in the cell, and (b) reducing expression of CD142 in the cell. In some embodiments, the reducing or increasing expression comprise performing one or more modifications to the cell using a guided nuclease (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing an expression vector comprising an inducible suicide switch into the cell. In some embodiments, the method further comprises increasing the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, and CD55 in said cell.

[0153] Once the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) have been generated, they may beassayed for their hypoimmunogenicity and / or retention of pluripotency as is described in WO2016183041 and WO2018132783. In some embodiments, hypoimmunogenicity is assayed using a number of techniques as exemplified in Figure 13 and Figure 15 of WO2018132783. These techniques include transplantation into allogeneic hosts and monitoring for hypoimmunogenic pluripotent cell growth (e.g., teratomas) that escape the host immune system. In some instances, hypoimmunogenic pluripotent cell derivatives are transduced to express luciferase and can then followed using bioluminescence imaging. Similarly, the T cell and / or B cell response of the host animal to such cells are tested to confirm that the cells do not cause an immune reaction in the host animal. T cell responses can be assessed by Elispot, ELISA, FACS, PCR, or mass cytometry (CYTOF). B cell responses or antibody responses are assessed using FACS or Luminex. Additionally or alternatively, the cells may be assayed fortheir ability to avoid innate immune responses, e.g., NK cell killing, as is generally shown in Figures 14 and 15 of WO2018132783.

[0154] In some embodiments, the immunogenicity of the cells is evaluated using T cellimmunoassays such as T cell proliferation assays, T cell activation assays, and T cell killing assays recognized by those skilled in the art. In some cases, the T cell proliferation assay includes pretreating the cells with interferon-gamma and coculturing the cells with labelled T cells and assaying the presence of the T cell population (or the proliferating T cell population) after a preselected amount of time. In some cases, the T cell activation assay includes coculturing T cells with the cells outlined herein and determining the expression levels of T cell activation markers in the T cells.

[0155] In vivo assays can be performed to assess the immunogenicity of the cells outlinedherein. In some embodiments, the survival and immunogenicity of HIP-hPSCs is determined using an allogeneic humanized immunodeficient mouse model. In some instances, the modified iPSCs or ESCs are transplanted into an allogeneic humanized NSG-SGM3 mouse and assayed for cell rejection, cell survival, and teratoma formation. In some instances, grafted modified iPSCs, ESCs or differentiated cells thereof display long-term survival in the mouse model.

[0156] Additional techniques for determining immunogenicity includinghypoimmunogenicity of the cells are described in, for example, Deuse et al., Nature Biotechnology, 2019, 37, 252-258 and Han et al., Proc Natl Acad Sci USA, 2019, 116(21), 10441-10446, the disclosures including the figures, figure legends, and description of methods are incorporated herein by reference in their entirety.

[0157] Similarly, the retention of pluripotency may be tested in a number of ways. In oneembodiment, pluripotency is assayed by the expression of certain pluripotency-specific factors as generally described herein and shown in Figure 29 of WO2018132783. Additionally or alternatively, the pluripotent cells are differentiated into one or more cell types as an indication of pluripotency.

[0158] Once the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) have been generated, they can bemaintained in an undifferentiated state as is known for maintaining iPSCs or ESCs. For example, the cells can be cultured on Matrigel using culture media that prevents differentiation and maintains pluripotency. In addition, they can be in culture medium under conditions to maintain pluripotency.

[0159] Once altered, the presence of expression of any of the molecule described herein canbe assayed using known techniques, such as Western blots, ELISA assays, FACS assays, and the like.

[0160] In some embodiments, the modified PSCs are HIP-iPSCs. In some embodiments, themodified PSCs are HIP-ESCs. In some embodiments, the modified PSCs are of human origin. In some embodiments, the HIP-iPSCs are human HIP-iPSCs (HIP-hiPSCs). In some embodiments, the HIP-ESCs are human HIP-ESCs (HIP-hESCs). 1. Inactivation or Disruption of Target Genesa. Target Genes1) MHC Class I and / or MHC Class II

[0161] In some embodiments, the provided HIP-PSC (e.g., HIP-iPSC or HIP-ESC)comprises a modification (e.g., genetic modifications) of one or more target polynucleotide or protein sequences (also interchangeably referred to as a target gene) that regulate (e.g., reduce or eliminate) the expression of either MHC class I molecules, MHC class II molecules, or MHC class I and MHC class II molecules. In some embodiments, the cell to be modified is an unmodified cell that has not previously been introduced with the one or more modifications. In some embodiments, a genetic editing system is used to modify one or more target polynucleotide sequences that regulate (e.g., reduce or eliminate) the expression of either MHC class I molecules, MHC class II molecules, or MHC class I and MHC class II molecules. In certain embodiments, the genome of the cell has been altered to reduce or delete components required or involved in facilitating HLA expression, such as expression of MHC class I and / or MHC class II molecules on the surface of the cell. For instance, in some embodiments, expression of a beta-2-microgloublin (B2M), a component of MHC class I molecules, is reduced or eliminated in the cell, thereby reducing or elimination the protein expression (e.g., cell surface expression) of MHC class I by the HIP-PSC (e.g., HIP-iPSC or HIP-ESC).

[0162] In some embodiments, any of the described modifications in the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) that regulate (e.g., reduce or eliminate) expression of one or more target polynucleotide or protein in the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) may be combined with one or more modifications to overexpress a polynucleotide (e.g., tolerogenic factor, such as CD47).

[0163] In some embodiments, reduction of MHC class I and / or MHC class II expression canbe accomplished, for example, by one or more of the following: (1) directly targeting the MHCclass I genes such as the polymorphic HLA alleles (HLA-A, HLA-B, HLA -C) and / or the MHC class II genes such as HLA-DP, HLA-DQ, and / or HLA-DR; (2) removal of B2M, which will reduce surface trafficking of all MHC class I molecules; and / or (3) deletion of one or more components of the MHC enhanceosomes, such as LRC5, RFX-5, RFXANK, RFXAP, IRFl, NF-Y (including NFY-A, NFY-B, NFY-C), and CIITA that are critical for HLA expression. In some embodiments, reduction of MHC class II also may be accomplished by reducing expression, such as by knocking out the gene encoding CD47 in a cell, which is involved in the formation and transport of MHC class II.

[0164] In certain embodiments, HLA expression is interfered with. In some embodiments,HLA expression is interfered with by targeting individual HLAs (e.g., knocking out expression of one or more HLA class I molecules such as HLA-A, HLA-B and / or HLA-C and / or knocking out expression of one or more HLA class I molecules such as HLA-DP, HLA-DQ, and / or HLA- DR), targeting transcriptional regulators of HLA expression (e.g., knocking out expression of NLRC5, CIITA, RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C and / or IRF-1), blocking surface trafficking of MHC class I molecules (e.g., knocking out expression of B2M and / or TAP1), and / or targeting with HLA-Razor (see, e.g., WO2016183041). In some embodiments, reduction of HLA class II also may be accomplished by reducing expression, such as by knocking out, the gene encoding CD47 in a human cell, which is involved in the formation and transport of HLA class II molecules.

[0165] In certain aspects, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) disclosed herein do notexpress one or more human leukocyte antigens corresponding to MHC class I (e.g., HLA-A, HLA-B and / or HLA-C) and / or MHC class II (e.g., HLA-DP, HLA-DQ, and / or HLA-DR) and are thus characterized as being hypoimmunogenic. For example, in certain aspects, the HIP- PSC (e.g., HIP-iPSC or HIP-ESC) disclosed herein have been modified such that the cells, including any stem cell or a differentiated stem cell prepared therefrom, do not express or exhibit reduced expression of one or more of the following MHC class I molecules: HLA-A, HLA-B and HLA-C. In some embodiments, one or more of HLA-A, HLA-B and HLA-C may be “knocked-out” of a cell. A cell that has a knocked-out HLA-A gene, HLA-B gene, and / or HLA-C gene may exhibit reduced or eliminated expression of each knocked-out gene. In some aspects, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) disclosed herein has been modified such that the cells, including any stem cell or a differentiated stem cell prepared therefrom, do not express or exhibit reduced expression of one or more of the following MHC class II molecules: HLA-DP, HLA-DQ, and HLA-DR. In some embodiments, one or more of HLA-DP, HLA- DQ, and HLA-DR may be “knocked-out” of a cell. A cell that has a knocked-out HLA-DPgene, HLA-DQ gene and / or HLA-DR gene may exhibit reduced or eliminated expression of each knocked-out gene.

[0166] In certain embodiments, the expression of MHC class I molecules and / or MHC classII molecules is modulated by targeting and deleting a contiguous stretch of genomic DNA, thereby reducing or eliminating expression of a target gene selected from the group consisting of B2M, CIITA, and NLRC5. In some embodiments, MHC class I molecules can alternatively or additionally be modulated by reducing or eliminating expression of TAP1. In some embodiments, MHC class II molecules can alternatively or additionally be modulated by reducing or eliminating expression of CD47.

[0167] In some embodiments, the provided HIP-PSC (e.g., HIP-iPSC or HIP-ESC) cancomprise a modification of one or more target polynucleotide sequence that regulate MHC class I. Exemplary methods for reducing expression of MHC class I are described in sections below. In some embodiments, the targeted polynucleotide sequence is one or both of B2M and NLRC5. In some embodiments, the cell comprises a genetic editing modification (e.g., an indel) to the B2M gene. In some embodiments, the cell comprises a genetic editing modification (e.g., an indel) to the NLRC5 gene. In some embodiments, the cell comprises a genetic editing modification (e.g., an indel) to the TAP1 gene. In some embodiments, the cell comprises genetic editing modifications (e.g., indels) to the B2M and CIITA genes.

[0168] In some embodiments, a modification that reduces expression of an MHC class Imolecule is a modification that reduces expression of B2M. In some embodiments, the modification that reduces B2M expression reduces B2M mRNA expression. In some embodiments, the reduced mRNA expression of B2M is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of B2M is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of B2M is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of B2M is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the mRNA expression of B2M is eliminated (e.g., 0% expression of B2M mRNA). In some embodiments, the modification that reduces B2M mRNA expression eliminates B2M gene activity.

[0169] In some embodiments, the modification that reduces B2M expression reduces B2Mprotein expression. In some embodiments, the reduced protein expression of B2M is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification.In some embodiments, the protein expression of B2M is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of B2M is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of B2M is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of B2M is eliminated (e.g., no detectable expression of B2M protein). In some embodiments, the modification that reduces B2M protein expression eliminates B2M gene activity.

[0170] In some embodiments, the modification that reduces B2M expression comprisesinactivation or disruption of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption of one allele of the B2M gene. In some embodiments, the modification that reduces B2M expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the B2M gene.

[0171] In some embodiments, the modification comprises inactivation or disruption of oneor more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the B2M gene. In some embodiments, the B2M gene is knocked out.

[0172] In some embodiments, a modification that reduces expression of an MHC class Imolecule is a modification that reduces expression of NLRC5. In some embodiments, decreased or eliminated expression of NLRC5 reduces or eliminates expression of one or more of the following MHC I molecules – HLA-A, HLA-B, and HLA-C. In some embodiments, the modification that reduces NLRC5 expression reduces NLRC5 mRNA expression. In some embodiments, the reduced mRNA expression of NLRC5 is relative to an unmodified or wild- type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of NLRC5 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of NLRC5 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of NLRC5 is reduced by any of about 5%, 10%,20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the mRNA expression of NLRC5 is eliminated (e.g., 0% expression of NLRC5 mRNA). In some embodiments, the modification that reduces NLRC5 mRNA expression eliminates NLRC5 gene activity.

[0173] In some embodiments, the modification that reduces NLRC5 expression reducesNLRC5 protein expression. In some embodiments, the reduced protein expression of NLRC5 is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of NLRC5 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of NLRC5 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of NLRC5 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of NLRC5 is eliminated (e.g., no detectable expression of NLRC5 protein). In some embodiments, the modification that reduces NLRC5 protein expression eliminates NLRC5 gene activity.

[0174] In some embodiments, the modification that reduces NLRC5 expression comprisesinactivation or disruption of the NLRC5 gene. In some embodiments, the modification that reduces NLCR5 expression comprises inactivation or disruption of one allele of the NLRC5 gene. In some embodiments, the modification that reduces NLRC5 expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the NLRC5 gene.

[0175] In some embodiments, the modification comprises inactivation or disruption of oneor more NLRC5 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all NLRC5 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the NLRC5 gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the NLRC5 gene. In some embodiments, the modification is a deletion of genomic DNA of the NLRC5 gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the NLRC5 gene. In some embodiments, the NLRC5 gene is knocked out.

[0176] In some embodiments, a modification that reduces expression of an MHC class Imolecule is a modification that reduces expression of TAP1. In some embodiments, decreased or eliminated expression of TAP1 reduces or eliminates expression of one or more of thefollowing MHC I molecules – HLA-A, HLA-B, and HLA-C. In some embodiments, the modification that reduces TAP1 expression reduces TAP1 mRNA expression. In some embodiments, the reduced mRNA expression of TAP1 is relative to an unmodified or wild- type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of TAP1 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of TAP1 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of TAP1 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the mRNA expression of TAP1 is eliminated (e.g., 0% expression of TAP1 mRNA). In some embodiments, the modification that reduces TAP1 mRNA expression eliminates TAP1 gene activity.

[0177] In some embodiments, the modification that reduces TAP1 expression reduces TAP1protein expression. In some embodiments, the reduced protein expression of TAP1 is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of TAP1 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of TAP1 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of TAP1 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of TAP1 is eliminated (e.g., no detectable expression of TAP1 protein). In some embodiments, the modification that reduces TAP1 protein expression eliminates TAP1 gene activity.

[0178] In some embodiments, the modification that reduces TAP1 expression comprisesinactivation or disruption of the TAP1 gene. In some embodiments, the modification that reduces TAP1 expression comprises inactivation or disruption of one allele of the TAP1 gene. In some embodiments, the modification that reduces TAP1 expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the TAP1 gene.

[0179] In some embodiments, the modification comprises inactivation or disruption of oneor more TAP1 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all TAP1 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the TAP1 gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the TAP1gene. In some embodiments, the modification is a deletion of genomic DNA of the TAP1 gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the TAP1 gene. In some embodiments, the TAP1 gene is knocked out.

[0180] In some embodiments, the provided HIP-PSCs (e.g., HIP-iPSC or HIP-ESC)comprise a modification of one or more target polynucleotide sequence that regulate MHC class II molecule expression. Exemplary methods for reducing expression of MHC class II are described in sections below. In some embodiments, the cell comprises a genetic editing modification to the CIITA gene. In some embodiments, the cell comprises a genetic editing modification to the CD47 gene.

[0181] In some embodiments, a modification that reduces expression of an MHC class IImolecule is a modification that reduces expression of CIITA. In some embodiments, the modification that reduces CIITA expression reduces CIITA mRNA expression. In some embodiments, the reduced mRNA expression of CIITA is relative to an unmodified or wild- type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of CIITA is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of CIITA is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of CIITA is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the mRNA expression of CIITA is eliminated (e.g., 0% expression of CIITA mRNA). In some embodiments, the modification that reduces CIITA mRNA expression eliminates CIITA gene activity.

[0182] In some embodiments, the modification that reduces CIITA expression reducesCIITA protein expression. In some embodiments, the reduced protein expression of CIITA is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of CIITA is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of CIITA is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of CIITA is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of CIITA is eliminated (e.g., 0% expression of CIITA protein). In some embodiments, the modification that reduces CIITA protein expression eliminates CIITA gene activity.

[0183] In some embodiments, the modification that reduces CIITA expression comprisesinactivation or disruption of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption of one allele of the CIITA gene. In some embodiments, the modification that reduces CIITA expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the CIITA gene.

[0184] In some embodiments, the modification comprises inactivation or disruption of oneor more CIITA coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CIITA coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the CIITA gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the CIITA gene. In some embodiments, the modification is a deletion of genomic DNA of the CIITA gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the CIITA gene. In some embodiments, the CIITA gene is knocked out.

[0185] In some embodiments, a modification that reduces expression of an MHC class IImolecule is a modification that reduces expression of CD47. In some embodiments, the modification that reduces CD47 expression reduces CD47 mRNA expression. In some embodiments, the reduced mRNA expression of CD47 is relative to an unmodified or wild- type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of CD47 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of CD47 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of CD47 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the mRNA expression of CD47 is eliminated (e.g., 0% expression of CD47 mRNA). In some embodiments, the modification that reduces CD47 mRNA expression eliminates CD47 gene activity.

[0186] In some embodiments, the modification that reduces CD47 expression reduces CD47protein expression. In some embodiments, the reduced protein expression of CD47 is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of CD47 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of CD47 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of CD47 is reduced by any of about 5%,10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of CD47 is eliminated (e.g., 0% expression of CD47 protein). In some embodiments, the modification that reduces CD47 protein expression eliminates CD47 gene activity.

[0187] In some embodiments, the modification that reduces CD47 expression comprisesinactivation or disruption of the CD47 gene. In some embodiments, the modification that reduces CD47 expression comprises inactivation or disruption of one allele of the CD47 gene. In some embodiments, the modification that reduces CD47 expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the CD47 gene.

[0188] In some embodiments, the modification comprises inactivation or disruption of oneor more CD47 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CD47 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in the CD47 gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the CD47 gene. In some embodiments, the modification is a deletion of genomic DNA of the CD47 gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the CD47 gene. In some embodiments, the CD47 gene is knocked out.

[0189] In some embodiments, the provided modified cells comprise a modification of one ormore target polynucleotide sequence that regulate expression of MHC class I molecules and MHC class II molecules. Exemplary methods for reducing expression of MHC class I molecules and MHC class II molecules including any as described in sections below. In some embodiments, the cell comprises genetic editing modifications to the B2M and NLRC5 genes. In some embodiments, the cell comprises genetic editing modifications to the CIITA and NLRC5 genes. In some embodiments, the cell comprises genetic editing modifications to the B2M and CIITA genes. In particular embodiments, the cell comprises genetic editing modifications to the B2M, CIITA and NLRC5 genes. 2) CD142

[0190] In certain aspects, the technology disclosed herein modulate (e.g., reduce oreliminate) the expression of CD142, which is also known as tissue factor, factor III, and F3. In some embodiments, the modulation occurs using a CRISPR / Cas system.

[0191] In some embodiments, the target polynucleotide sequence is CD142 or a variant ofCD142. In some embodiments, the target polynucleotide sequence is a homolog of CD142. In some embodiments, the target polynucleotide sequence is an ortholog of CD142.

[0192] In some embodiments, the cells outlined herein comprise a modification targeting theCD142 gene. In some embodiments, the modification targeting the CD142 gene by the rare- cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid (gRNA) sequence for specifically targeting the CD142 gene. Useful methods for identifying gRNA sequences to target CD142 are described below.

[0193] Assays to test whether the CD142 gene has been inactivated are known and describedherein. In one embodiment, the resulting modification of the CD142 gene by PCR and the reduction of CD142 expression can be assays by FACS analysis. In another embodiment, CD142 protein expression is detected using a Western blot of cells lysates probed with antibodies to the CD142 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating modification.

[0194] Useful genomic, polynucleotide and polypeptide information about the humanCD142 are provided in, for example, the GeneCard Identifier GC01M094530, HGNC No. 3541, NCBI Gene ID 2152, NCBI RefSeq Nos. NM_001178096.1, NM_001993.4, NP_001171567.1, and NP_001984.1, UniProt No. P13726, and the like. 3) PD-1

[0195] In some embodiments, the target polynucleotide sequence is PD-1 or a variant of PD-1. In some embodiments, the target polynucleotide sequence is a homolog of PD-1. In some embodiments, the target polynucleotide sequence is an ortholog of PD-1.

[0196] In some embodiments, the cells outlined herein comprise a genetic modificationtargeting the gene encoding the programmed cell death protein 1 (PD-1) protein or the PDCD1 gene. In certain embodiments, primary T cells comprise a genetic modification targeting the PDCD1 gene. The genetic modification can reduce expression of PD-1 polynucleotides and PD-1 polypeptides in T cells includes primary T cells and CAR-T cells. In some embodiments, the genetic modification targeting the PDCD1 gene by the rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid (gRNA) sequence for specifically targeting the PDCD1 gene. Useful methods for identifying gRNA sequences to target PD-1 are described below.

[0197] Assays to test whether the PDCD1 gene has been inactivated are known and describedherein. In some embodiments, the resulting genetic modification of the PDCD1 gene by PCR and the reduction of PD-1 expression can be assays by FACS analysis. In another embodiment, PD-1 protein expression is detected using a Western blot of cells lysates probed with antibodiesto the PD-1 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating genetic modification.

[0198] Useful genomic, polynucleotide and polypeptide information about human PD-1including the PDCD1 gene are provided in, for example, the GeneCard Identifier GC02M241849, HGNC No. 8760, NCBI Gene ID 5133, Uniprot No. Q15116, and NCBI RefSeq Nos. NM_005018.2 and NP_005009.2. b. Methods of Inactivating or Disrupting Genes (e.g., to ReduceExpression)

[0199] In some embodiments, the cells provided herein are modified (e.g., geneticallymodified) to inactivate or disrupt one or more target polynucleotides or proteins as described. In some embodiments, the cells provided herein are modified (e.g., genetically modified) to reduce expression of the one or more target polynucleotides or proteins as described. In some embodiments, the cell that is modified with the one or more modification to reduce (e.g., eliminate) expression of a polynucleotide or protein is any source cell as described herein. In certain embodiments, the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) (e.g., differentiated cells such as beta islet cells) disclosed herein comprise one or more modifications to reduce expression of one or more target polynucleotides. Non-limiting examples of the one or more target polynucleotides include any as described above, such as CIITA, B2M, CD142, NLRC5, HLA-A, HLA-B, HLA-C, LRC5, RFX-ANK, RFX5, RFX-AP, NFY-A, NFY-B, NFY-C, IRF1, and TAP1. In some embodiment, the target polynucleotide may be CD47. In some embodiments, the modifications to reduce expression of the one or more target polynucleotides is combined with one or more modifications to increase expression of a desired transgene. In some embodiments, the modifications create modified cells that are immune-privileged or hypoimmunogenic cells. By modulating (e.g., reducing or deleting) expression of one or a plurality of the target polynucleotides, such cells exhibit decreased immune activation when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0200] Any method for reducing expression of a target polynucleotide may be used. In someembodiments, the modifications result in permanent elimination or reduction in expression of the target polynucleotide. For instance, in some embodiments, the target polynucleotide or gene is disrupted by introducing a DNA break in the target polynucleotide, such as by using a targeting endonuclease. In other embodiments, the modifications result in transient reduction in expression of the target polynucleotide. For instance, in some embodiments gene repressionis achieved using an inhibitory nucleic acid that is complementary to the target polynucleotide to selectively suppress or repress expression of the gene, for instance using antisense techniques, such as by RNA interference (RNAi), short interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes.

[0201] In some embodiments, the target polynucleotide sequence is a genomic sequence. Insome embodiments, the target polynucleotide sequence is a human genomic sequence. In some embodiments, the target polynucleotide sequence is a mammalian genomic sequence. In some embodiments, the target polynucleotide sequence is a vertebrate genomic sequence.

[0202] In some embodiments, gene disruption is carried out by induction of one or moredouble-stranded breaks and / or one or more single-stranded breaks in the gene, typically in a targeted manner. In some embodiments, the double-stranded or single-stranded breaks are made by a nuclease, e.g., an endonuclease, such as a gene-targeted nuclease. In some embodiments, the targeted nuclease is selected from zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases such as a CRISPR- associated nuclease (Cas), specifically designed to be targeted to the sequence of a gene or a portion thereof. In some embodiments, the targeted nuclease generates double-stranded or single-stranded breaks that then undergo repair through error prone non-homologous end joining (NHEJ) or, in some cases, precise homology directed repair (HDR) in which a template is used. In some embodiments, the targeted nuclease generates DNA double strand breaks (DSBs). In some embodiments, the process of producing and repairing the breaks is typically error prone and results in insertions and deletions (indels) of DNA bases from NHEJ repair. In some embodiments, the modification may induce a deletion, insertion, or mutation of the nucleotide sequence of the target gene. In some cases, the modification may result in a frameshift mutation, which can result in a premature stop codon. In examples of nuclease- mediated gene editing the targeted edits occur on both alleles of the gene resulting in a biallelic disruption or edit of the gene. In some embodiments, all alleles of the gene are targeted by the gene editing. In some embodiments, modification with a targeted nuclease, such as using a CRISPR / Cas system, leads to complete knockout of the gene. In some embodiments, the nuclease, such as a rare-cutting endonuclease, is introduced into a cell containing the target polynucleotide sequence. The nuclease may be introduced into the cell in the form of a nucleic acid encoding the nuclease. The process of introducing the nucleic acids into cells can be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid- mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid that is introduced into the cell is DNA. In someembodiments, the nuclease is introduced into the cell in the form of a protein. For instance, in the case of a CRISPR / Cas system a ribonucleoprotein (RNP) may be introduced into the cell.

[0203] In some embodiments, the modification occurs using a CRISPR / Cas system. AnyCRISPR / Cas system that is capable of altering a target polynucleotide sequence in a cell can be used. Such CRISPR-Cas systems can employ a variety of Cas proteins (Haft et al. PloS Comput Biol. 2005; 1(6)e60). The molecular machinery of such Cas proteins that allows the CRISPR / Cas system to alter target polynucleotide sequences in cells include RNA binding proteins, endo- and exo-nucleases, helicases, and polymerases. In some embodiments, the CRISPR / Cas system is a CRISPR type I system. In some embodiments, the CRISPR / Cas system is a CRISPR type II system. In some embodiments, the CRISPR / Cas system is a CRISPR type V system.

[0204] The CRISPR / Cas systems include targeted systems that can be used to alter any targetpolynucleotide sequence in a cell. In some embodiments, a CRISPR / Cas system provided herein includes a Cas protein and one or more, such as at least one to two, ribonucleic acids (e.g., guide RNA (gRNA)) that are capable of directing the Cas protein to and hybridizing to a target motif of a target polynucleotide sequence.

[0205] In some embodiments, a Cas protein comprises one or more amino acid substitutionsor modifications. In some embodiments, the one or more amino acid substitutions comprises a conservative amino acid substitution. In some instances, substitutions and / or modifications can prevent or reduce proteolytic degradation and / or extend the half-life of the polypeptide in a cell. In some embodiments, the Cas protein can comprise a peptide bond replacement (e.g., urea, thiourea, carbamate, sulfonyl urea, etc.). In some embodiments, the Cas protein can comprise a naturally occurring amino acid. In some embodiments, the Cas protein can comprise an alternative amino acid (e.g., D-amino acids, beta-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, a Cas protein can comprise a modification to include a moiety (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0206] In some embodiments, a Cas protein comprises a core Cas protein. Exemplary Cascore proteins include, but are not limited to Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8 and Cas9. In some embodiments, a Cas protein comprises a Cas protein of an E. coli subtype (also known as CASS2). Exemplary Cas proteins of the E. Coli subtype include, but are not limited to Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, a Cas protein comprises a Cas protein of the Ypest subtype (also known as CASS3). Exemplary Cas proteins of the Ypest subtype include, but are not limited to Csy1, Csy2, Csy3, and Csy4. In some embodiments, a Cas protein comprises a Cas protein of the Nmeni subtype (also known asCASS4). Exemplary Cas proteins of the Nmeni subtype include, but are not limited to Csn1 and Csn2. In some embodiments, a Cas protein comprises a Cas protein of the Dvulg subtype (also known as CASS1). Exemplary Cas proteins of the Dvulg subtype include Csd1, Csd2, and Cas5d. In some embodiments, a Cas protein comprises a Cas protein of the Tneap subtype (also known as CASS7). Exemplary Cas proteins of the Tneap subtype include, but are not limited to, Cst1, Cst2, Cas5t. In some embodiments, a Cas protein comprises a Cas protein of the Hmari subtype. Exemplary Cas proteins of the Hmari subtype include, but are not limited to Csh1, Csh2, and Cas5h. In some embodiments, a Cas protein comprises a Cas protein of the Apern subtype (also known as CASS5). Exemplary Cas proteins of the Apern subtype include, but are not limited to Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, a Cas protein comprises a Cas protein of the Mtube subtype (also known as CASS6). Exemplary Cas proteins of the Mtube subtype include, but are not limited to Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, a Cas protein comprises a RAMP module Cas protein. Exemplary RAMP module Cas proteins include, but are not limited to, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, e.g., Klompe et al., Nature 571, 219–225 (2019); Strecker et al., Science 365, 48–53 (2019).

[0207] In some embodiments, CRISPR systems of the present disclosure comprise TnpBpolypeptides. In some embodiments, TnpB polypeptides may comprise a Ruv-C-like domain. The RuvC domain may be a split RuvC domain comprising RuvC-I, RuvC-II, and RuvC-III subdomains. In some embodiments, a TnpB may further comprise one or more of a HTH domain, a bridge helix domain, and a zinc finger domain. TnpB polypeptides do not comprise an HNH domain. In some embodiments, a TnpB protein comprises, starting at the N-terminus: a HTH domain, a RuvC-I subdomain, a bridge helix domain, a RuvC-II sub-domain, a zinger finger domain, and a RuvC-III sub-domain. In some embodiments, a RuvC-III sub-domain forms the C-terminus of a TnpB polypeptide. In some embodiments, a TnpB polypeptide is from Epsilonproteobacteria bacterium, Actinoplanes lobatus strain DSM 43150, Actinomadura celluolosilytica strain DSM 45823, Actinomadura namibiensis strain DSM 44197, Alicyclobacillus macrosprangiidus strain DSM 17980, Lipingzhangella halophila strain DSM 102030, or Ktedonobacter recemifer. In some embodiments, a TnpB polypeptide is from Ktedonobacter racemifer, or comprises a conserved RNA region with similarity to the 5’ ITR of K. racemifer TnpB loci. In some embodiments, a TnpB may comprise a Fanzor protein, a TnpB homolog found in eukaryotic genomes. In some embodiments, a CRISPR system comprising a TnpB polypeptide binds a target adjacent motif (TAM) sequence 5’ of a target polynucleotide. In some embodiments, a TAM is a transposon-associated motif. In someembodiments, a TAM sequence comprises TCA. In some embodiments, a TAM sequence comprises TTCAN. In some embodiments, a TAM sequence comprises TTGAT. In some embodiments, a TAM sequence comprises ATAAA.

[0208] In some embodiments, the methods for genetically modifying cells to knock out,knock down, or otherwise modify one or more genes comprise using a site-directed nuclease, including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeat (CRISPR) / Cas systems

[0209] ZFNs are fusion proteins comprising an array of site-specific DNA binding domainsadapted from zinc finger-containing transcription factors attached to the endonuclease domain of the bacterial FokI restriction enzyme. A ZFN may have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) of the DNA binding domains or zinc finger domains. See, e.g., Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and usually recognizes a 3- to 4-bp DNA sequence. Tandem domains can thus potentially bind to an extended nucleotide sequence that is unique within a cell’s genome.

[0210] Various zinc fingers of known specificity can be combined to produce multi-fingerpolypeptides which recognize about 6, 9, 12, 15, or 18-bp sequences. Various selection and modular assembly techniques are available to generate zinc fingers (and combinations thereof) recognizing specific sequences, including phage display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind a predetermined nucleic acid sequence. Criteria to engineer a zinc finger to bind to a predetermined nucleic acid sequence are known in the art. See, e.g., Sera et al., Biochemistry (2002) 41:7074-7081; Liu et al., Bioinformatics (2008) 24:1850-1857.

[0211] ZFNs containing FokI nuclease domains or other dimeric nuclease domains functionas a dimer. Thus, a pair of ZFNs are required to target non-palindromic DNA sites. The two individual ZFNs must bind opposite strands of the DNA with their nucleases properly spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs are designed to recognize two sequences flanking the site, one on the forward strand and the other on the reverse strand. Upon binding of the ZFNs on either side of the site, the nuclease domains dimerize and cleave the DNA at the site, generating a DSB with 5′ overhangs. HDR can then be utilized to introduce a specific mutation, with the help of a repair template containing the desired mutation flanked by homology arms.The repair template is usually an exogenous double-stranded DNA vector introduced to the cell. See Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734.

[0212] TALENs are another example of an artificial nuclease which can be used to edit atarget gene. TALENs are derived from DNA binding domains termed TALE repeats, which usually comprise tandem arrays with 10 to 30 repeats that bind and recognize extended DNA sequences. Each repeat is 33 to 35 amino acids in length, with two adjacent amino acids (termed the repeat-variable di-residue, or RVD) conferring specificity for one of the four DNA base pairs. Thus, there is a one-to-one correspondence between the repeats and the base pairs in the target DNA sequences.

[0213] TALENs are produced artificially by fusing one or more TALE DNA bindingdomains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) to a nuclease domain, for example, a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations to FokI have been made for its use in TALENs; these, for example, improve cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39:e82; Miller et al., Nature Biotech. (2011) 29:143-148; Hockemeyer et al., Nature Biotech. (2011) 29:731-734; Wood et al., Science (2011) 333:307; Doyon et al., Nature Methods (2010) 8:74-79; Szczepek et al., Nature Biotech (2007) 25:786-793; Guo et al., J. Mol. Biol. (2010) 200:96. The FokI domain functions as a dimer, requiring two constructs with unique DNA binding domains for sites in the target genome with proper orientation and spacing. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain and the number of bases between the two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29:143-148.

[0214] By combining engineered TALE repeats with a nuclease domain, a site-specificnuclease can be produced specific to any desired DNA sequence. Similar to ZFNs, TALENs can be introduced into a cell to generate DSBs at a desired target site in the genome, and so can be used to knock out genes or knock in mutations in similar, HDR-mediated pathways. See Boch, Nature Biotech. (2011) 29:135-136; Boch et al., Science (2009) 326:1509-1512; Moscou et al., Science (2009) 326:3501.

[0215] Meganucleases are enzymes in the endonuclease family which are characterized bytheir capacity to recognize and cut large DNA sequences (from 14 to 40 base pairs). Meganucleases are grouped into families based on their structural motifs which affect nuclease activity and / or DNA recognition. The most widespread and best known meganucleases are the proteins in the LAGLIDADG family, which owe their name to a conserved amino acidsequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18): 3757-3774. On the other hand, the GIY-YIG family members have a GIY-YIG module, which is 70-100 residues long and includes four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., nature Struct. Biol. (2002) 9:806-811. The His- Cys family meganucleases are characterized by a highly conserved series of histidines and cysteines over a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by motifs containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.

[0216] Because the chance of identifying a natural meganuclease for a particular target DNAsequence is low due to the high specificity requirement, various methods including mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. Strategies for engineering a meganuclease with altered DNA- binding specificity, e.g., to bind to a predetermined nucleic acid sequence are known in the art. See, e.g., Chevalier et al., Mol. Cell. (2002) 10:895-905; Epinat et al., Nucleic Acids Res (2003) 31:2952-2962; Silva et al., J Mol. Biol. (2006) 361:744-754; Seligman et al., Nucleic Acids Res (2002) 30:3870-3879; Sussman et al., J Mol Biol (2004) 342:31-41; Doyon et al., J Am Chem Soc (2006) 128:2477-2484; Chen et al., Protein Eng Des Sel (2009) 22:249-256; Arnould et al., J Mol Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.

[0217] Like ZFNs and TALENs, Meganucleases can create DSBs in the genomic DNA,which can create a frame-shift mutation if improperly repaired, e.g., via NHEJ, leading to a decrease in the expression of a target gene in a cell. Alternatively, foreign DNA can be introduced into the cell along with the meganuclease. Depending on the sequences of the foreign DNA and chromosomal sequence, this process can be used to modify the target gene. See Silva et al., Current Gene Therapy (2011) 11:11-27.

[0218] Transposases are enzymes that bind to the end of a transposon and catalyze itsmovement to another part of the genome by a cut and paste mechanism or a replicative transposition mechanism. By linking transposases to other systems such as the CRISPR / Cas system, new gene editing tools can be developed to enable site specific insertions or manipulations of the genomic DNA. There are two known DNA integration methods using transposons which use a catalytically inactive Cas effector protein and Tn7-like transposons. The transposase-dependent DNA integration does not provoke DSBs in the genome, which may guarantee safer and more specific DNA integration.

[0219] The CRISPR system was originally discovered in prokaryotic organisms (e.g.,bacteria and archaea) as a system involved in defense against invading phages and plasmids that provides a form of acquired immunity. Now it has been adapted and used as a popular gene editing tool in research and clinical applications.

[0220] CRISPR / Cas systems generally comprise at least two components: one or more guideRNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces a DSB into the target site. CRISPR-Cas systems fall into two major classes: class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids; class 2 systems use a single large Cas protein for the same purpose. Class 1 is divided into types I, III, and IV; class 2 is divided into types II, V, and VI. Different Cas proteins adapted for gene editing applications include, but are not limited to, Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. The most widely used Cas9 is a type II Cas protein and is described herein as illustrative. These Cas proteins may be originated from different source species. For example, Cas9 can be derived from S. pyogenes or S. aureus.

[0221] In the original microbial genome, the type II CRISPR system incorporates sequencesfrom invading DNA between CRISPR repeat sequences encoded as arrays within the host genome. Transcripts from the CRISPR repeat arrays are processed into CRISPR RNAs (crRNAs) each harboring a variable sequence transcribed from the invading DNA, known as the “protospacer” sequence, as well as part of the CRISPR repeat. Each crRNA hybridizes with a second transactivating CRISPR RNA (tracrRNA), and these two RNAs form a complex with the Cas9 nuclease. The protospacer-encoded portion of the crRNA directs the Cas9 complex to cleave complementary target DNA sequences, provided that they are adjacent to short sequences known as “protospacer adjacent motifs” (PAMs).

[0222] Since its discovery, the CRISPR system has been adapted for inducing sequencespecific DSBs and targeted genome editing in a wide range of cells and organisms spanning from bacteria to eukaryotic cells including human cells. In its use in gene editing applications, artificially designed, synthetic gRNAs have replaced the original crRNA:tracrRNA complex. For example, the gRNAs can be single guide RNAs (sgRNAs) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA usually comprises a complementary region (also called a spacer, usually about 20 nucleotides in length) that is user-designed to recognize a target DNA of interest. The tracrRNA sequence comprises a scaffold region for Cas nucleasebinding. The crRNA sequence and the tracrRNA sequence are linked by the tetraloop and each have a short repeat sequence for hybridization with each other, thus generating a chimeric sgRNA. One can change the genomic target of the Cas nuclease by simply changing the spacer or complementary region sequence present in the gRNA. The complementary region will direct the Cas nuclease to the target DNA site through standard RNA-DNA complementary base pairing rules.

[0223] In order for the Cas nuclease to function, there must be a PAM immediatelydownstream of the target sequence in the genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing interrogation of the sequence by the gRNA and resulting in gRNA-DNA pairing when a matching sequence is present. The specific sequence of PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease derived from S. pyogenes recognizes a PAM sequence of 5’-NGG-3’ or, at less efficient rates, 5’-NAG-3’, where “N” can be any nucleotide. Other Cas nuclease variants with alternative PAMs have also been characterized and successfully used for genome editing, which are summarized in Table 1a below. Table 1a. Exemplary Cas nuclease variants and their PAM sequencesR = A or G; Y = C or T; W = A or T; V = A or C or G; N = any base

[0224] In some embodiments, Cas nucleases may comprise one or more mutations to altertheir activity, specificity, recognition, and / or other characteristics. For example, the Cas nuclease may have one or more mutations that alter its fidelity to mitigate off-target effects (e.g., eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9 high-fidelity variantsof SpCas9). For another example the Cas nuclease may have one or more mutations that alter its PAM specificity.

[0225] In some embodiments, a Cas protein comprises any one of the Cas proteins describedherein or a functional portion thereof. As used herein, “functional portion” refers to a portion of a peptide which retains its ability to complex with at least one ribonucleic acid (e.g., guide RNA (gRNA)) and cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of operably linked Cas9 protein functional domains selected from the group consisting of a DNA binding domain, at least one RNA binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of operably linked Cas12a (also known as Cpf1) protein functional domains selected from the group consisting of a DNA binding domain, at least one RNA binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, a functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, a functional portion of the Cas9 protein comprises a functional portion of the HNH nuclease domain. In some embodiments, a functional portion of the Cas12a protein comprises a functional portion of a RuvC-like domain.

[0226] In some embodiments, suitable Cas proteins include, but are not limited to, Cas0,Cas12a (i.e., Cpf1), Cas12b, Cas12i, CasX, and Mad7.

[0227] In some embodiments, exogenous Cas protein can be introduced into the cell inpolypeptide form. In certain embodiments, Cas proteins can be conjugated to or fused to a cell- penetrating polypeptide or cell-penetrating peptide. As used herein, “cell-penetrating polypeptide” and “cell-penetrating peptide” refers to a polypeptide or peptide, respectively, which facilitates the uptake of molecule into a cell. The cell-penetrating polypeptides can contain a detectable label.

[0228] In certain embodiments, Cas proteins can be conjugated to or fused to a chargedprotein (e.g., that carries a positive, negative or overall neutral electric charge). Such linkage may be covalent. In some embodiments, the Cas protein can be fused to a superpositively charged GFP to significantly increase the ability of the Cas protein to penetrate a cell (Cronican et al. ACS Chem Biol. 2010; 5(8):747-52). In certain embodiments, the Cas protein can be fused to a protein transduction domain (PTD) to facilitate its entry into a cell. Exemplary PTDs include Tat, oligoarginine, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 proteincomprises a Cas9 polypeptide fused to a tat domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a penetrating domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a superpositively charged GFP. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a cell-penetrating peptide. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a PTD. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a tat domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to an oligoarginine domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a penetrating domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a superpositively charged GFP.

[0229] In some embodiments, the Cas protein can be introduced into a cell containing thetarget polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acids into cells can be achieved by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises a modified DNA, as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises a modified mRNA, as described herein (e.g., a synthetic, modified mRNA).

[0230] In provided embodiments, a CRISPR / Cas system generally includes two components:one or more guide RNA (gRNA) and a Cas protein. In some embodiments, the Cas protein is complexed with the one or more, such as one to two, ribonucleic acids (e.g., guide RNA (gRNA)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid, as described herein (e.g., a synthetic, modified mRNA).

[0231] In some embodiments, gRNAs are short synthetic RNAs composed of a scaffoldsequence for Cas binding and a user-designed spacer or complementary portion designated crRNA. The cRNA is composed of a crRNA targeting sequence (herein after also called a gRNA targeting sequence; usually about 20 nucleotides in length) that defines the genomic target to be modified and a region of crRNA repeat (e.g. GUUUUAGAGCUA; SEQ ID NO:19). One can change the genomic target of the Cas protein by simply changing the complementary portion sequence (e.g., gRNA targeting sequence) present in the gRNA. Insome embodiments the scaffold sequence for Cas binding is made up of a tracrRNA sequence (e.g. UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUU; SEQ ID NO: 20) that hybridizes to the crRNA through its anti-repeat sequence. The complex between crRNA: tracrRNA recruits the Cas nuclease (e.g., Cas9) and cleaves upstream of a protospacer-adjacent motif (PAM). For the Cas protein to function, there must be a PAM immediately downstream of the target sequence in the genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing interrogation of the sequence by the gRNA and resulting in gRNA-DNA pairing when a matching sequence is present. The specific sequence of PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease, derived from S. pyogenes, recognizes a PAM sequence of NGG. Other Cas9 variants and other nucleases with alternative PAMs have also been characterized and successfully used for genome editing. Thus, the CRISPR / Cas system can be used to create targeted DSBs at specified genomic loci that are complementary to the gRNA designed for the target loci. The crRNA and tracrRNA can be linked together with a loop sequence (e.g., a tetraloop; GAAA, SEQ ID NO:21) for generation of a gRNA that is a chimeric single guide RNA (sgRNA; Hsu et al. 2013). sgRNA can be generated for DNA-based expression or by chemical synthesis.

[0232] In some embodiments, the complementary portion sequences (e.g., gRNA targetingsequence) of the gRNA will vary depending on the target site of interest. In some embodiments, the gRNAs comprise complementary portions specific to a sequence of a gene set forth in Table 1b or Table 1c. In some embodiments, the genomic locus targeted by the gRNAs is located within 4000 bp, within 3500 bp, within 3000 bp, within 2500 bp, within 2000 bp, within 1500 bp, within 1000 bp, or within 500 bp of any of the loci as described.

[0233] The methods disclosed herein contemplate the use of any ribonucleic acid that iscapable of directing a Cas protein to and hybridizing to a target motif of a target polynucleotide sequence.

[0234] In some embodiments, the Cas protein is complexed with one to two ribonucleic acids(e.g., guide RNA (gRNA)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid, as described herein (e.g., a synthetic, modified mRNA).

[0235] The methods disclosed herein contemplate the use of any ribonucleic acid that iscapable of directing a Cas protein to and hybridizing to a target motif of a target polynucleotidesequence. In some embodiments, at least one of the ribonucleic acids comprises tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises CRISPR RNA (crRNA). In some embodiments, a single ribonucleic acid comprises a guide RNA that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids comprises a guide RNA that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell. In some embodiments, both of the one to two ribonucleic acids comprise a guide RNA that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell. The ribonucleic acids provided herein can be selected to hybridize to a variety of different target motifs, depending on the particular CRISPR / Cas system employed, and the sequence of the target polynucleotide, as will be appreciated by those skilled in the art. The one to two ribonucleic acids can also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least two mismatches when compared with all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least one mismatch when compared with all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids are designed to hybridize to a target motif immediately adjacent to a deoxyribonucleic acid motif recognized by the Cas protein. In some embodiments, each of the one to two ribonucleic acids are designed to hybridize to target motifs immediately adjacent to deoxyribonucleic acid motifs recognized by the Cas protein which flank a mutant allele located between the target motifs.

[0236] In some embodiments, each of the one to two ribonucleic acids comprises guideRNAs that directs the Cas protein to and hybridizes to a target motif of the target polynucleotide sequence in a cell.

[0237] In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) arecomplementary to and / or hybridize to sequences on the same strand of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on the opposite strands of a target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids (e.g., guide RNAs) are not complementary to and / or do not hybridize to sequences on the opposite strands of a target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to overlapping target motifs of a target polynucleotide sequence. In some embodiments, the one or two ribonucleic acids (e.g.,guide RNAs) are complementary to and / or hybridize to offset target motifs of a target polynucleotide sequence.

[0238] In some embodiments, nucleic acids encoding Cas protein and nucleic acids encodingthe at least one to two ribonucleic acids are introduced into a cell via viral transduction (e.g., lentiviral transduction). In some embodiments, the Cas protein is complexed with 1-2 ribonucleic acids. In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein is encoded by a modified nucleic acid, as described herein (e.g., a synthetic, modified mRNA).

[0239] Exemplary gRNA targeting sequences useful for CRISPR / Cas-based targeting ofgenes described herein are provided in Table 1b or Table 1c.

[0240] The sequences can be found in WO2016183041 filed May 9, 2016, the disclosureincluding the Tables, Appendices, and Sequence Listing is incorporated herein by reference in its entirety. Table 1b. Exemplary gRNA targeting sequences useful for targeting genes

[0241] Additional exemplary Cas9 guide RNA sequences useful for CRISPR / Cas-basedtargeting of genes described herein are provided in Table 1c. It will be understood by one of ordinary skill in the art that uracil and thymine can both be represented by ‘t’, instead of ‘u’ for uracil and ‘t’ for thymine; in the context of a ribonucleic acid, it will be understood that ‘t’ is used to represent uracil unless otherwise indicated. Table 1c. Additional exemplary Cas9 guide RNA sequences useful for targeting genes

[0242] In some embodiments, it is within the level of a skilled artisan to identify new lociand / or gRNA targeting sequences for use in methods of genetic disruption to reduce or eliminate expression of a gene as described. For example, for CRISPR / Cas systems, when an existing gRNA targeting sequence for a particular locus (e.g., within a target gene, e.g. set forth in Table 1b or 1c) is known, an “inch worming” approach can be used to identify additional loci for targeted insertion of transgenes by scanning the flanking regions on either side of the locus for PAM sequences, which usually occurs about every 100 base pairs (bp) across the genome. The PAM sequence will depend on the particular Cas nuclease used because different nucleases usually have different corresponding PAM sequences. The flanking regions on either side of the locus can be between about 500 to 4000 bp long, for example, about 500 bp, about 1000 bp, about 1500 bp, about 2000 bp, about 2500 bp, about 3000 bp, about 3500 bp, or about 4000 bp long. When a PAM sequence is identified within the search range, a new guide can be designed according to the sequence of that locus for use in genetic disruption methods. Although the CRISPR / Cas system is described as illustrative, any gene-editing approaches as described can be used in this method of identifying new loci, including those using ZFNs, TALENS, meganucleases and transposases.

[0243] In some embodiments, the cells described herein are made using TranscriptionActivator-Like Effector Nucleases (TALEN) methodologies. By a “TALE-nuclease” (TALEN) is intended a fusion protein consisting of a nucleic acid-binding domain typically derived from a Transcription Activator Like Effector (TALE) and one nuclease catalytic domain to cleave a nucleic acid target sequence. The catalytic domain is preferably a nuclease domain and more preferably a domain having endonuclease activity, like for instance I-TevI, ColE7, NucA and Fok-I. In a particular embodiment, the TALE domain can be fused to a meganuclease like for instance I-CreI and I-OnuI or functional variant thereof. In a morepreferred embodiment, said nuclease is a monomeric TALE-Nuclease. A monomeric TALE- Nuclease is a TALE-Nuclease that does not require dimerization for specific recognition and cleavage, such as the fusions of engineered TAL repeats with the catalytic domain of I-TevI described in WO2012138927. Transcription Activator like Effector (TALE) are proteins from the bacterial species Xanthomonas comprise a plurality of repeated sequences, each repeat comprising di-residues in position 12 and 13 (RVD) that are specific to each nucleotide base of the nucleic acid targeted sequence. Binding domains with similar modular base-per-base nucleic acid binding properties (MBBBD) can also be derived from new modular proteins recently discovered by the applicant in a different bacterial species. The new modular proteins have the advantage of displaying more sequence variability than TAL repeats. Preferably, RVDs associated with recognition of the different nucleotides are HD for recognizing C, NG for recognizing T, NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A and YG for recognizing T, TL for recognizing A, VT for recognizing A or G and SW for recognizing A. In another embodiment, critical amino acids 12 and 13 can be mutated towards other amino acid residues in order to modulate their specificity towards nucleotides A, T, C and G and in particular to enhance this specificity. TALEN kits are sold commercially.

[0244] In some embodiments, the cells are manipulated using zinc finger nuclease (ZFN). A“zinc finger binding protein” is a protein or polypeptide that binds DNA, RNA and / or protein, preferably in a sequence-specific manner, as a result of stabilization of protein structure through coordination of a zinc ion. The term zinc finger binding protein is often abbreviated as zinc finger protein or ZFP. The individual DNA binding domains are typically referred to as “fingers.” A ZFP has least one finger, typically two fingers, three fingers, or six fingers. Each finger binds from two to four base pairs of DNA, typically three or four base pairs of DNA. A ZFP binds to a nucleic acid sequence called a target site or target segment. Each finger typically comprises an approximately 30 amino acid, zinc-chelating, DNA-binding subdomain. Studies have demonstrated that a single zinc finger of this class consists of an alpha helix containing the two invariant histidine residues coordinated with zinc along with the two cysteine residues of a single beta turn (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).

[0245] In some embodiments, the cells described herein are made using a homingendonuclease. Such homing endonucleases are well-known to the art (Stoddard 2005). Homing endonucleases recognize a DNA target sequence and generate a single- or double-strand break.Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in length. The homing endonuclease may for example correspond to a LAGLIDADG endonuclease, to an HNH endonuclease, or to a GIY-YIG endonuclease. In some embodiments, the homing endonuclease can be an I-CreI variant.

[0246] In some embodiments, the cells described herein are made using a meganuclease.Meganucleases are by definition sequence-specific endonucleases recognizing large sequences (Chevalier, B. S. and B. L. Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). They can cleave unique sites in living cells, thereby enhancing gene targeting by 1000-fold or more in the vicinity of the cleavage site (Puchta et al., Nucleic Acids Res., 1993, 21, 5034-5040; Rouet et al., Mol. Cell. Biol., 1994, 14, 8096-8106; Choulika et al., Mol. Cell. Biol., 1995, 15, 1968- 1973; Puchta et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-5060; Sargent et al., Mol. Cell. Biol., 1997, 17, 267-77; Donoho et al., Mol. Cell. Biol, 1998, 18, 4070-4078; Elliott et al., Mol. Cell. Biol., 1998, 18, 93-101; Cohen-Tannoudji et al., Mol. Cell. Biol., 1998, 18, 1444-1448).

[0247] In some embodiments, the cells provided herein are made using RNA silencing orRNA interference (RNAi) to knockdown (e.g., decrease, eliminate, or inhibit) the expression of a polypeptide. Useful RNAi methods include those that utilize synthetic RNAi molecules, short interfering RNAs (siRNAs), PIWI-interacting NRAs (piRNAs), short hairpin RNAs (shRNAs), microRNAs (miRNAs), and other transient knockdown methods recognized by those skilled in the art. Reagents for RNAi including sequence specific shRNAs, siRNA, miRNAs and the like are commercially available. For instance, a target polynucleotide, such as any described above, e.g., CIITA, B2M, or NLRC5, can be knocked down in a cell by RNA interference by introducing an inhibitory nucleic acid complementary to a target motif of the target polynucleotide, such as an siRNA, into the cells. In some embodiments, a target polynucleotide, such as any described above, e.g., CIITA, B2M, or NLRC5, can be knocked down in a cell by transducing a shRNA-expressing virus into the cell. In some embodiments, RNA interference is employed to reduce or inhibit the expression of at least one selected from the group consisting of CIITA, B2M, and NLRC5. c. Exemplary Target Polynucleotides and Methods for ReducingExpression 1) MHC Class I

[0248] In certain embodiments, the modification reduces or eliminates, such as knocks out,the expression of MHC class I molecules (e.g., MHC class I genes encoding MHC class Imolecules) by targeting the accessory chain B2M. In some embodiments, the modification occurs using a CRISPR / Cas system. By reducing or eliminating, such as knocking out, expression of B2M, surface trafficking of MHC class I molecules is blocked, and such cells exhibit immune tolerance when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0249] In some embodiments, the target polynucleotide sequence provided herein is a variantof B2M. In some embodiments, the target polynucleotide sequence is a homolog of B2M. In some embodiments, the target polynucleotide sequence is an ortholog of B2M.

[0250] In some embodiments, decreased or eliminated expression of B2M reduces oreliminates expression of one or more of the following MHC class I molecules – HLA-A, HLA- B, and HLA-C.

[0251] In some embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) comprises amodification targeting the B2M gene. In some embodiments, the modification targeting the B2M gene is by using a targeted nuclease system that comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the B2M gene. In some embodiments, the at least one guide ribonucleic acid sequence (e.g., gRNA targeting sequence) for specifically targeting the B2M gene is selected from the group consisting of SEQ ID NOS:81240-85644 of Appendix 2 or Table 15 of WO2016 / 183041, the disclosure of which is herein incorporated by reference in its entirety.

[0252] In some embodiments, an exogenous nucleic acid or transgene encoding apolypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted at the B2M gene. Exemplary transgenes for targeted insertion at the B2M locus include any as described herein.

[0253] Assays to test whether the B2M gene has been inactivated are known and describedherein. In one embodiment, the resulting modification of the B2M gene by PCR and the reduction of HLA-I expression can be assays by flow cytometry, such as by FACS analysis. In another embodiment, B2M protein expression is detected using a Western blot of cells lysates probed with antibodies to the B2M protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating modification.

[0254] In some embodiments, the technologies disclosed herein modulate (e.g., reduce oreliminate) the expression of MHC-I genes by targeting and modulating (e.g., reducing or eliminating) expression of the NLR family, CARD domain containing 5 / NOD27 / CLR16.1 (NLRC5). In some embodiments, the modulation occurs using a CRISPR / Cas system. NLRC5is a critical regulator of MHC-I-mediated immune responses and, similar to CIITA, NLRC5 is highly inducible by IFN-γ and can translocate into the nucleus. NLRC5 activates the promoters of MHC-I genes and induces the transcription of MHC-I as well as related genes involved in MHC-I antigen presentation.

[0255] In some embodiments, the target polynucleotide sequence is a variant of NLRC5. Insome embodiments, the target polynucleotide sequence is a homolog of NLRC5. In some embodiments, the target polynucleotide sequence is an ortholog of NLRC5.

[0256] In some embodiments, the cells outlined herein comprise a genetic modificationtargeting the NLRC5 gene. In some embodiments, the genetic modification targeting the NLRC5 gene by the rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the NLRC5 gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the NLRC5 gene is selected from the group consisting of SEQ ID NOS:36353-81239 of Appendix 3 or Table 14 of WO2016183041, the disclosure is incorporated by reference in its entirety.

[0257] Assays to test whether the NLRC5 gene has been inactivated are known and describedherein. In some embodiments, the resulting genetic modification of the NLRC5 gene by PCR and the reduction of HLA-I expression can be assays by FACS analysis. In another embodiment, NLRC5 protein expression is detected using a Western blot of cells lysates probed with antibodies to the NLRC5 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating genetic modification.

[0258] In some embodiments, the reduction of the MHC class I expression or function (HLAI when the cells are derived from human cells) in the modified cells can be measured using techniques known in the art; for example, FACS techniques using labeled antibodies that bind the HLA complex; for example, using commercially available HLA-A, B, C antibodies that bind to the alpha chain of the human major histocompatibility HLA Class I antigens. In addition, the cells can be tested to confirm that the HLA I complex is not expressed on the cell surface. This may be assayed by FACS analysis using antibodies to one or more HLA cell surface components as discussed above. In addition to the reduction of HLA I (or MHC class I), the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) provided herein has a reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods to assay for hypoimmunogenic phenotypes of the modified cells are described further below.2) MHC Class II

[0259] In certain aspects, the modification reduces or eliminates, such as knocks out, theexpression of MHC class II genes by targeting Class II transactivator (CIITA) expression. In some embodiments, the modification occurs using a CRISPR / Cas system. CIITA is a member of the LR or nucleotide binding domain (NBD) leucine-rich repeat (LRR) family of proteins and regulates the transcription of MHC class II by associating with the MHC 76ubconjunctiv. By reducing or eliminating, such as knocking out, expression of CIITA, expression of MHC class II molecules is reduced thereby also reducing surface expression. In some cases, such cells exhibit immune tolerance when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0260] In some embodiments, the target polynucleotide sequence is a variant of CIITA. Insome embodiments, the target polynucleotide sequence is a homolog of CIITA. In some embodiments, the target polynucleotide sequence is an ortholog of CIITA.

[0261] In some embodiments, reduced or eliminated expression of CIITA reduces oreliminates expression of one or more of the following MHC class II are HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.

[0262] In some embodiments, the modified cell comprises a modification targeting theCIITA gene. In some embodiments, the modification targeting the CIITA gene is by a targeted nuclease system that comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene. In some embodiments, the at least one guide ribonucleic acid sequence (e.g., gRNA targeting sequence) for specifically targeting the CIITA gene is selected from the group consisting of SEQ ID NOS:5184-36352 of Appendix 1 or Table 12 of WO2016183041, the disclosure is incorporated by reference in its entirety.

[0263] In some embodiments, an exogenous nucleic acid or transgene encoding apolypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted at the CIITA gene. Exemplary transgenes for targeted insertion at the B2M locus include any as described herein.

[0264] Assays to test whether the CIITA gene has been inactivated are known and describedherein. In one embodiment, the resulting modification of the CIITA gene by PCR and the reduction of HLA-II expression can be assays by flow cytometry, such as by FACS analysis. In another embodiment, CIITA protein expression is detected using a Western blot of cellslysates probed with antibodies to the CIITA protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating modification.

[0265] In some embodiments, the reduction of the MHC class II expression or function (HLAII when the cells are derived from human cells) in the modified cells can be measured using techniques known in the art, such as Western blotting using antibodies to the protein, FACS techniques, RT-PCR techniques, etc. In some embodiments, the modified cells can be tested to confirm that the HLA II complex is not expressed on the cell surface. Methods to assess surface expression include methods known in the art (See Figure 21 of WO2018132783, for example) and generally is done using either Western Blots or FACS analysis based on commercial antibodies that bind to human HLA Class II HLA-DR, DP and most DQ antigens. In addition to the reduction of HLA II (or MHC class II), the HIP-PSC (e.g., HIP-iPSC or HIP- ESC) provided herein has a reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods to assay for hypoimmunogenic phenotypes of the modified cells are described further below. 3) CD142

[0266] In certain aspects, the modification reduces or eliminates, such as knocks out, theexpression of CD142. In some embodiments, the modification occurs using a CRISPR / Cas system. CD142, also known as tissue factor (F3) is a membrane-bound protein that initiates blood coagulation by forming a complex with circulating factor VII or factor VIIa. The CD142(TF):VIIa complex activates factors IX or X by specific limited proteolysis. CD142 (TF) plays a role in normal hemostasis by initiating the cell-surface assembly and propagation of the coagulation protease cascade. By reducing or eliminating, such as knocking out, expression of CD142, expression of MHC class II molecules is reduced thereby also reducing surface expression. In some cases, such cells exhibit immune tolerance when engrafted into a recipient subject. In some embodiments, the cell is considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0267] In some embodiments, the target polynucleotide sequence is a variant of CD142. Insome embodiments, the target polynucleotide sequence is a homolog of CD142. In some embodiments, the target polynucleotide sequence is an ortholog of CD142.

[0268] In some embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) comprises amodification targeting the CD142 gene. In some embodiments, the modification targeting the CD142 gene is by a targeted nuclease system that comprises a Cas protein or a polynucleotideencoding a Cas protein, and at least one guide ribonucleic acid sequence for specifically targeting the CD142 gene. In some embodiments, the target polynucleotide sequence is CD142 or a variant of CD142. In some embodiments, the target polynucleotide sequence is a homolog of CD142. In some embodiments, the target polynucleotide sequence is an ortholog of CD142.

[0269] In some embodiments, the cells outlined herein may comprise a modificationtargeting the CD142 gene. In some embodiments, the modification targeting the CD142 gene by the rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein, and at least one guide ribonucleic acid (gRNA) sequence for specifically targeting the CD142 gene. Useful methods for identifying gRNA sequences to target CD142 are described below.

[0270] Assays to test whether the CD142 gene has been inactivated are known and describedherein. In one embodiment, the resulting modification of the CD142 gene by PCR and the reduction of CD142 expression can be assays by FACS analysis. In another embodiment, CD142 protein expression is detected using a Western blot of cells lysates probed with antibodies to the CD142 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the inactivating modification. Useful genomic, polynucleotide and polypeptide information about the human CD142 are provided in, for example, the GeneCard Identifier GC01M094530, HGNC No. 3541, NCBI Gene ID 2152, NCBI RefSeq Nos. NM_001178096.1, NM_001993.4, NP_001171567.1, and NP_001984.1, UniProt No. P13726, and the like.

[0271] In some embodiments, an exogenous nucleic acid or transgene encoding apolypeptide as disclosed herein (e.g., a chimeric antigen receptor, CD46, CD59, CD55, or CD47 or another tolerogenic factor disclosed herein) is inserted at the CD142 gene. Exemplary transgenes for targeted insertion at the CD142 locus include any as described herein.

[0272] In some embodiments, the reduction of the CD142 expression or function in themodified cells can be measured using techniques known in the art, such as Western blotting using antibodies to the protein, FACS techniques, RT-PCR techniques, etc. In some embodiments, the modified cells can be tested to confirm that CD142 is not expressed on the cell surface. Methods to assess surface expression include methods known in the art (See Figure 21 of WO2018132783, for example) and generally is done using either Western Blots or FACS analysis based on commercial antibodies that bind to human CD142. In addition to the reduction of CD142, the modified cells provided herein have a reduced susceptibility to IBMIR. Methods to assay for hypoimmunogenic phenotypes of the modified cells are described further below.

[0273] In some embodiments, the modification that reduces CD142 expression reducesCD142 mRNA expression. In some embodiments, the reduced mRNA expression of CD142 is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the mRNA expression of CD142 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the mRNA expression of CD142 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the mRNA expression of CD142 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the mRNA expression of CD142 is eliminated (e.g., 0% expression of CD142 mRNA). In some embodiments, the modification that reduces CD142 mRNA expression eliminates CD142 gene activity.

[0274] In some embodiments, the modification that reduces CD142 expression reducesCD142 protein expression. In some embodiments, the reduced protein expression of CD142 is relative to an unmodified or wild-type cell of the same cell type that does not comprise the modification. In some embodiments, the protein expression of CD142 is reduced by more than about 5%, such as reduced by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the protein expression of CD142 is reduced by up to about 100%, such as reduced by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, the protein expression of CD142 is reduced by any of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, the protein expression of CD142 is eliminated (e.g., 0% expression of CD142 protein). In some embodiments, the modification that reduces CD142 protein expression eliminates CD142 gene activity.

[0275] In some embodiments, the modification that reduces CD142 expression comprisesinactivation or disruption of the CD142 gene. In some embodiments, the modification that reduces CD142 expression comprises inactivation or disruption of one allele of the CD142 gene. In some embodiments, the modification that reduces CD142 expression comprises inactivation or disruption comprises inactivation or disruption of both alleles of the CD142 gene.

[0276] In some embodiments, the modification comprises inactivation or disruption of oneor more CD142 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CD142 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption comprises an indel in theCD142 gene. In some embodiments, the modification is a frameshift mutation of genomic DNA of the CD142 gene. In some embodiments, the modification is a deletion of genomic DNA of the CD142 gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the CD142 gene. Exemplary guide target sequences for CD142 are known and shown in Table 2. Table 2: Exemplary guide target sequences for CD142 are known, for example:2. Overexpression of Polynucleotides

[0277] In some embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) provided hereinare genetically modified, such as by introduction of one or more modifications into a cell to overexpress a desired polynucleotide in the cell. In some embodiments, the cell to be modified is an unmodified cell that has not previously been introduced with the one or more modifications. In some embodiments, the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) provided herein are genetically modified to include one or more exogenous polynucleotides encoding an exogenous protein (also interchangeably used with the term “transgene”). As described, in some embodiments, the cells are modified to increase expression of certain genes that are tolerogenic (e.g., immune) factors that affect immune recognition and tolerance in a recipient. In some embodiments, the provided modified cells, such as T cells or NK cells, also express a chimeric antigen receptor (CAR). The one or more polynucleotides, e.g., exogenous polynucleotides, may be expressed (e.g. overexpressed) in the HIP-PSC (e.g., HIP-iPSC or HIP-ESC) together with one or more genetic modifications to reduce expression of a target polynucleotide described above, such as an MHC class I and / or MHC class II molecule or CD142. In some embodiments, the provided HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) do not trigger or activate an immune response upon administration to a recipient subject.

[0278] In some embodiments, the modified pluripotent stem cell includes 1, 2, 3, 4, 5, 6, 7,8, 9, 10 or more different overexpressed polynucleotides. In some embodiments, the overexpressed polynucleotide is an exogenous polynucleotide. In some embodiments, the modified pluripotent stem cell includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different exogenous polynucleotides. In some embodiments, the overexpressed polynucleotide is an exogenous polynucleotide that is expressed episomally in the cells. In some embodiments, the overexpressed polynucleotide is an exogenous polynucleotide that is inserted or integrated into one or more genomic loci of the modified cell.

[0279] In some embodiments, expression of a polynucleotide is increased, i.e., thepolynucleotide is overexpressed, using a fusion protein containing a DNA-targeting domain and a transcriptional activator. Targeted methods of increasing expression using transactivator domains are known to a skilled artisan.

[0280] In some embodiments, the modified pluripotent stem cell contains one or moreexogenous polynucleotides in which the one or more exogenous polynucleotides are inserted or integrated into a genomic locus of the cell by non-targeted insertion methods, such as by transduction with a lentiviral vector. In some embodiments, the one or more exogenous polynucleotides are inserted or integrated into the genome of the cell by targeted insertion methods, such as by using homology directed repair (HDR). Any suitable method can be used to insert the exogenous polynucleotide into the genomic locus of the modified cell by HDR including the gene editing methods described herein (e.g., a CRISPR / Cas system). In some embodiments, the one or more exogenous polynucleotides are inserted into one or more genomic locus, such as any genomic locus described herein (e.g., Table 2). In some embodiments, the exogenous polynucleotides are inserted into the same genomic loci. In some embodiments, the exogenous polynucleotides are inserted into different genomic loci. In some embodiments, the two or more of the exogenous polynucleotides are inserted into the same genomic loci, such as any genomic locus described herein (e.g., Table 2). In some embodiments, two or more exogenous polynucleotides are inserted into a different genomic loci, such as two or more genomic loci as described herein (e.g., Table 2).

[0281] Exemplary polynucleotides or overexpression, and methods for overexpressing thesame, are described in the following subsections.a. Target Genes1) Tolerogenic Factor

[0282] In some embodiments, expression of a tolerogenic factor is overexpressed orincreased in the cell. In some embodiments, the modified pluripotent stem cell includes increased expression, i.e., overexpression, of at least one tolerogenic factor. In some embodiments, the tolerogenic factor is any factor that promotes or contributes to promoting or inducing tolerance to the modified cell by the immune system (e.g., innate or adaptive immune system). In some embodiments, the tolerogenic factor is DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4- Ig, Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factor is CD47, PD- L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200 or Mfge8, or any combination thereof. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA- G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the cell includes at least one exogenous polynucleotide that includes a polynucleotide that encodes for a tolerogenic factor. For instance, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide that encodes CD47. Provided herein are cells that do not trigger or activate an immune response upon administration to a recipient subject. As described above, in some embodiments, the cells are modified to increase expression of genes and tolerogenic (e.g., immune) factors that affect immune recognition and tolerance in a recipient.

[0283] In some embodiments, the present disclosure provides a cell or population thereofthat has been modified to express the tolerogenic factor (e.g., immunomodulatory polypeptide), such as CD47. In some embodiments, the present disclosure provides a method for altering a cell genome to express the tolerogenic factor (e.g., immunomodulatory polypeptide), such as CD47. In some embodiments, the modified cell expresses an exogenous tolerogenic factor (e.g., immunomodulatory polypeptide), such as an exogenous CD47. In some instances, overexpression or increasing expression of the exogenous polynucleotide is achieved by introducing into the cell (e.g., transducing the cell) within expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide. In some embodiments, theexpression vector may be a viral vector, such as a lentiviral vector) or may be a non-viral vector. In some embodiments, the cell is modified to contain one or more exogenous polynucleotides in which at least one of the exogenous polynucleotides includes a polynucleotide that encodes for a tolerogenic factor. In some of any embodiments, the tolerogenic factor is DUX4, B2M- HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factor is selected from CD47, PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200 or Mfge8, or any combination thereof (e.g., all thereof). In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. For instance, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide that encodes CD47.

[0284] In some embodiments, the tolerogenic factor is CD47. In some embodiments, themodified pluripotent stem cell contains an exogenous polynucleotide that encodes CD47, such as human CD47. In some embodiments, CD47 is overexpressed in the cell. In some embodiments, the expression of CD47 is overexpressed or increased in the modified cell compared to a similar cell of the same cell type that has not been modified with the modification, such as a reference or unmodified cell, e.g. a cell not modified with an exogenous polynucleotide encoding CD47. CD47 is a leukocyte surface antigen and has a role in cell adhesion and modulation of integrins. It is normally expressed on the surface of a cell and signals to circulating macrophages not to eat the cell. Useful genomic, polynucleotide and polypeptide information about human CD47 are provided in, for example, the NP_001768.1, NP_942088.1, NM_001777.3 and NM_198793.2.

[0285] In some embodiments, the modified pluripotent stem cell includes increasedexpression, i.e. overexpression, of at least one tolerogenic factor. In some embodiments, the cell includes at least one exogenous polynucleotide that includes a polynucleotide that encodes for a tolerogenic factor. In some embodiments, tolerogenic factors include DUX4, B2M-HLA- E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD- L1, IDO1, CTLA4-Ig, Cl-Inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc Receptor, IL15-RF, and H2-M3, or any combination thereof. In some embodiments, the one or more tolerogenic factors are selected from the group consisting ofCD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. For instance, in some embodiments, at least one of the overexpressed (e.g., exogenous) polynucleotides is a polynucleotide that encodes CD47.

[0286] In some embodiments, the present disclosure provides a cell or population thereofthat has been modified to express the tolerogenic factor (e.g., immunomodulatory polypeptide), such as CD47. In some embodiments, the present disclosure provides a method for altering a cell genome to express the tolerogenic factor (e.g., immunomodulatory polypeptide), such as CD47. In some embodiments, the modified pluripotent stem cell expresses an exogenous tolerogenic factor (e.g., immunomodulatory polypeptide), such as an exogenous CD47. In some instances, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide.

[0287] In some embodiments, the modified pluripotent stem cell contains an overexpressedpolynucleotide that encodes CD47, such as human CD47. In some embodiments, the modified pluripotent stem cell contains an exogenous polynucleotide that encodes CD47, such as human CD47. In some embodiments, CD47 is overexpressed in the cell. In some embodiments, the expression of CD47 is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CD47.

[0288] In some embodiments, the cell outlined herein comprises an exogenous nucleotidesequence encoding a CD47 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_001768.1 and NP_942088.1. In some embodiments, the cell outlined herein comprises an exogenous nucleotide sequence encoding a CD47 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_001768.1 and NP_942088.1. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD47 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_001777.3 and NM_198793.2. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD47 as set forth in NCBI Ref. Sequence Nos. NM_001777.3 and NM_198793.2.

[0289] In some embodiments, the cell outlined herein comprises an exogenous nucleotidesequence encoding a CD47 polypeptide has at least 95% sequence identity (e.g., 95%, 96%,97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_001768.1 and NP_942088.1. In some embodiments, the cell outlined herein comprises an exogenous nucleotide sequence encoding a CD47 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_001768.1 and NP_942088.1. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD47 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_001777.3 and NM_198793.2. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD47 as set forth in NCBI Ref. Sequence Nos. NM_001777.3 and NM_198793.2.

[0290] In some embodiments, the cell comprises an exogenous CD47 polypeptide having atleast 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_001768.1 and NP_942088.1. In some embodiments, the cell outlined herein comprises an exogenous CD47 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_001768.1 and NP_942088.1.

[0291] In some embodiments, the cell comprises an overexpressed polynucleotide encodinga CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an exogenous polynucleotide encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an overexpressed polynucleotide encoding a CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an exogenous polynucleotide encoding a CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO: 1.

[0292] In some embodiments, the cell comprises an overexpressed CD47 polypeptide havingat least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an exogenous CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an overexpressed CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an exogenous CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the exogenous nucleotide sequence encoding the CD59 polypeptide is operably linked to a sequence encoding a heterologous signal peptide. In some embodiments, an exogenous polynucleotide encoding CD47 is integrated into the genome of the cell by targeted or non-targeted methods of insertion, such as described further below. In some embodiments, targeted insertion is by homology-dependent insertion into a target locus, such as by insertion into any one of the gene loci depicted in Table 2, e.g. a B2M gene or a CIITA gene. In some embodiments, targeted insertion is by homology-independent insertion, such as by insertion into a safe harbor locus. In some cases, the polynucleotide encoding CD47 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CD47 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus.

[0293] In some embodiments, all or a functional portion of CD47 can be linked to othercomponents such as a signal peptide, a leader sequence, a secretory signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding a signal peptide of CD47 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRa), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as IgG heavy chain or IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2), or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, a luciferase, a trypsinogen (e.g. chymotrypsinogen or trypsinogen) or other signal peptide able to efficiently express a protein by or on a cell.

[0294] In certain embodiments, the exogenous polynucleotide encoding CD47 is operablylinked to a promoter.

[0295] In some embodiments, the exogenous polynucleotide encoding CD47 is inserted intoany one of the gene loci depicted in Table 2. In some cases, the exogenous polynucleotide encoding CD47 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the exogenous polynucleotide encoding CD47 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the exogenous polynucleotide encoding CD47 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD47, into a genomic locus of the cell.

[0296] In some embodiments, CD47 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CD47 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD47 mRNA.

[0297] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes CD200, such as human CD200. In some embodiments, CD200 is overexpressed in the cell. In some embodiments, the expression of CD200 is increased in the modified cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CD200. Useful genomic, polynucleotide and polypeptide information about human CD200 are provided in, for example, the GeneCard Identifier GC03P112332, HGNC No. 7203, NCBI Gene ID 4345, Uniprot No. P41217, and NCBI RefSeq Nos. NP_001004196.2, NM_001004196.3, NP_001305757.1, NM_001318828.1, NP_005935.4, NM_005944.6, XP_005247539.1, and XM_005247482.2. In certain embodiments, the polynucleotide encoding CD200 is operably linked to a promoter.

[0298] In some embodiments, the polynucleotide encoding CD200 is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding CD200 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CD200 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD200 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD200, into a genomic locus of the cell.

[0299] In some embodiments, CD200 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CD200 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD200 mRNA.

[0300] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes HLA-E, such as human HLA-E. In some embodiments, HLA-E is overexpressed in the cell. In some embodiments, the expression of HLA-E is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does notinclude the exogenous polynucleotide encoding HLA-E. Useful genomic, polynucleotide and polypeptide information about human HLA-E are provided in, for example, the GeneCard Identifier GC06P047281, HGNC No. 4962, NCBI Gene ID 3133, Uniprot No. P13747, and NCBI RefSeq Nos. NP_005507.3 and NM_005516.5. In certain embodiments, the polynucleotide encoding HLA-E is operably linked to a promoter.

[0301] In some embodiments, the polynucleotide encoding HLA-E is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding HLA-E is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding HLA-E is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding HLA-E is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding HLA-E, into a genomic locus of the cell.

[0302] In some embodiments, HLA-E protein expression is detected using a Western blot ofcell lysates probed with antibodies against the HLA-E protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous HLA-E mRNA.

[0303] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes HLA-G, such as human HLA-G. In some embodiments, HLA-G is overexpressed in the cell. In some embodiments, the expression of HLA-G is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding HLA-G. Useful genomic, polynucleotide and polypeptide information about human HLA-G are provided in, for example, the GeneCard Identifier GC06P047256, HGNC No. 4964, NCBI Gene ID 3135, Uniprot No. P17693, and NCBI RefSeq Nos. NP_002118.1 and NM_002127.5. In certain embodiments, the polynucleotide encoding HLA-G is operably linked to a promoter.

[0304] In some embodiments, the polynucleotide encoding HLA-G is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding HLA-G is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding HLA-G is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1)gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding HLA-G is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding HLA-G, into a genomic locus of the cell.

[0305] In some embodiments, HLA-G protein expression is detected using a Western blot ofcell lysates probed with antibodies against the HLA-G protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous HLA-G mRNA.

[0306] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes PD-L1, such as human PD-L1. In some embodiments, PD-L1 is overexpressed in the cell. In some embodiments, the expression of PD-L1 is increased in the modified cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding PD-L1. Useful genomic, polynucleotide and polypeptide information about human PD-L1 or CD274 are provided in, for example, the GeneCard Identifier GC09P005450, HGNC No. 17635, NCBI Gene ID 29126, Uniprot No. Q9NZQ7, and NCBI RefSeq Nos. NP_001254635.1, NM_001267706.1, NP_054862.1, and NM_014143.3. In certain embodiments, the polynucleotide encoding PD-L1 is operably linked to a promoter.

[0307] In some embodiments, the polynucleotide encoding PD-L1 is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding PD-L1 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding PD-L1 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding PD- L1 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding PD-L1, into a genomic locus of the cell.

[0308] In some embodiments, PD-L1 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the PD-L1 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous PD-L1 mRNA.

[0309] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes FasL, such as human FasL. In some embodiments, FasL is overexpressed in the cell. In some embodiments, the expression of FasL is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding FasL. Useful genomic, polynucleotide and polypeptide information about human Fas ligand (which is known as FasL, FASLG, CD178, TNFSF6, and the like) are provided in, for example, the GeneCard Identifier GC01P172628, HGNC No. 11936, NCBI Gene ID 356, Uniprot No. P48023, and NCBI RefSeq Nos. NP_000630.1, NM_000639.2, NP_001289675.1, and NM_001302746.1. In certain embodiments, the polynucleotide encoding Fas-L is operably linked to a promoter.

[0310] In some embodiments, the polynucleotide encoding Fas-L is inserted into any one ofthe gene loci depicted in Table 2. In some cases, the polynucleotide encoding Fas-L is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding Fas- L is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding Fas-L is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding Fas-L, into a genomic locus of the cell.

[0311] In some embodiments, Fas-L protein expression is detected using a Western blot ofcell lysates probed with antibodies against the Fas-L protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous Fas-L mRNA.

[0312] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes CCL21, such as human CCL21. In some embodiments, CCL21 is overexpressed in the cell. In some embodiments, the expression of CCL21 is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CCL21. Useful genomic, polynucleotide and polypeptide information about human CCL21 are provided in, for example, the GeneCard Identifier GC09M034709, HGNC No. 10620, NCBI Gene ID 6366, Uniprot No. O00585, and NCBIRefSeq Nos. NP_002980.1 and NM_002989.3. In certain embodiments, the polynucleotide encoding CCL21 is operably linked to a promoter.

[0313] In some embodiments, the polynucleotide encoding CCL21 is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding CCL21 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CCL21 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CCL21 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CCL21, into a genomic locus of the cell.

[0314] In some embodiments, CCL21 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CCL21 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CCL21 mRNA.

[0315] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes CCL22, such as human CCL22. In some embodiments, CCL22 is overexpressed in the cell. In some embodiments, the expression of CCL22 is increased in the modified cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CCL22. Useful genomic, polynucleotide and polypeptide information about human CCL22 are provided in, for example, the GeneCard Identifier GC16P057359, HGNC No. 10621, NCBI Gene ID 6367, Uniprot No. O00626, and NCBI RefSeq Nos. NP_002981.2, NM_002990.4, XP_016879020.1, and XM_017023531.1. In certain embodiments, the polynucleotide encoding CCL22 is operably linked to a promoter.

[0316] In some embodiments, the polynucleotide encoding CCL22 is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding CCL22 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CCL22 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CCL22 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of thegene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CCL22, into a genomic locus of the cell.

[0317] In some embodiments, CCL22 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CCL22 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CCL22 mRNA.

[0318] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes Mfge8, such as human Mfge8. In some embodiments, Mfge8 is overexpressed in the cell. In some embodiments, the expression of Mfge8 is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding Mfge8. Useful genomic, polynucleotide and polypeptide information about human Mfge8 are provided in, for example, the GeneCard Identifier GC15M088898, HGNC No. 7036, NCBI Gene ID 4240, Uniprot No. Q08431, and NCBI RefSeq Nos. NP_001108086.1, NM_001114614.2, NP_001297248.1, NM_001310319.1, NP_001297249.1, NM_001310320.1, NP_001297250.1, NM_001310321.1, NP_005919.2, and NM_005928.3. In certain embodiments, the polynucleotide encoding Mfge8 is operably linked to a promoter.

[0319] In some embodiments, the polynucleotide encoding Mfge8 is inserted into any one ofthe gene loci depicted in Table 2. In some cases, the polynucleotide encoding Mfge8 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding Mfge8 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding Mfge8 is inserted into a B2M gene locus, a CIITA gene locus, a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding Mfge8, into a genomic locus of the cell.

[0320] In some embodiments, Mfge8 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the Mfge8 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous Mfge8 mRNA.

[0321] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes SerpinB9, such as human SerpinB9. In some embodiments,SerpinB9 is overexpressed in the cell. In some embodiments, the expression of SerpinB9 is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding SerpinB9. Useful genomic, polynucleotide and polypeptide information about human SerpinB9 are provided in, for example, the GeneCard Identifier GC06M002887, HGNC No. 8955, NCBI Gene ID 5272, Uniprot No. P50453, and NCBI RefSeq Nos. NP_004146.1, NM_004155.5, XP_005249241.1, and XM_005249184.4. In certain embodiments, the polynucleotide encoding SerpinB9 is operably linked to a promoter.

[0322] In some embodiments, the polynucleotide encoding SerpinB9 is inserted into any oneof the gene loci depicted in Table 2. In some cases, the polynucleotide encoding SerpinB9 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding SerpinB9 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding SerpinB9 is Inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding SerpinB9, into a genomic locus of the cell.

[0323] In some embodiments, SerpinB9 protein expression is detected using a Western blotof cell lysates probed with antibodies against the SerpinB9 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous SerpinB9 mRNA.

[0324] In some embodiments, the tolerogenic factor is CD47 and the cell includes anexogenous polynucleotide encoding a CD47 protein. In some embodiments, the cell expresses an exogenous CD47 polypeptide.

[0325] In some embodiments, a method disclosed herein comprises administering to asubject in need thereof a CD47-SIRPα blockade agent, wherein the subject was previously administered a population of cells engineered to express an exogenous CD47 polypeptide. In some embodiments, the CD47-SIRPα blockade agent comprises a CD47-binding domain. In some embodiments, the CD47-binding domain comprises signal regulatory protein alpha (SIRPα) or a fragment thereof. In some embodiments, the CD47-SIRPα blockade agent comprises an immunoglobulin G (IgG) Fc domain. In some embodiments, the IgG Fc domain comprises an IgG1 Fc domain. In some embodiments, the IgG1 Fc domain comprises afragment of a human antibody. In some embodiments, the CD47-SIRPα blockade agent is selected from the group consisting of TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPα blockade agent is TTI-621, TTI-622, and ALX148. In some embodiments, the CD47-SIRPα blockade agent is TTI-622. In some embodiments, the CD47-SIRPα blockade agent is ALX148. In some embodiments, the IgG Fc domain comprises an IgG4 Fc domain. In some embodiments, the CD47-SIRPα blockade agent is an antibody. In some embodiments, the antibody is selected from the group consisting of MIAP410, B6H12, and Magrolimab. In some embodiments, the antibody is MIAP410. In some embodiments, the antibody is B6H12. In some embodiments, the antibody is Magrolimab. In some embodiments, the antibody is selected from the group consisting of AO-176, IBI188 (letaplimab), STI-6643, and ZL-1201. In some embodiments, the antibody is AO-176 (Arch). In some embodiments, the antibody is IBI188 (letaplimab) (Innovent). In some embodiments, the antibody is STI-6643 (Sorrento). In some embodiments, the antibody is ZL-1201 (Zai).

[0326] In some embodiments, useful antibodies or fragments thereof that bind CD47 can beselected from a group that includes magrolimab ((Hu5F9-G4)) (Forty Seven, Inc.; Gilead Sciences, Inc.), urabrelimab, CC-90002 (Celgene; Bristol-Myers Squibb), IBI-188 (Innovent Biologics), IBI-322 (Innovent Biologics), TG-1801 (TG Therapeutics; also known as NI-1701, Novimmune SA), ALX148 (ALX Oncology), TJ011133 (also known as TJC4, I-Mab Biopharma), FA3M3, ZL-1201 (Zai Lab Co., Ltd), AK117 (Akesbio Australia Pty, Ltd.), AO- 176 (Arch Oncology), SRF231 (Surface Oncology), GenSci-059 (GeneScience), C47B157 (Janssen Research and Development), C47B161 (Janssen Research and Development), C47B167 (Janssen Research and Development), C47B222 (Janssen Research and Development), C47B227 (Janssen Research and Development), Vx-1004 (Corvus Pharmaceuticals), HMBD004 (Hummingbird Bioscience Pte Ltd), SHR-1603 (Hengrui), AMMS4-G4 (Beijing Institute of Biotechnology), RTX-CD47 (University of Groningen), and IMC-002. (Samsung Biologics; ImmuneOncia Therapeutics). In some embodiments, the antibody or fragment thereof does not compete for CD47 binding with an antibody selected from a group that includes magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof competes for CD47 binding with an antibody selected from magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227,Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002. In some embodiments, the antibody or fragment thereof that binds CD47 is selected from a group that includes a single-chain Fv fragment (scFv) against CD47, a Fab against CD47, a VHH nanobody against CD47, a DARPin against CD47, and variants thereof. In some embodiments, the scFv against CD47, a Fab against CD47, and variants thereof are based on the antigen binding domains of any of the antibodies selected from a group that includes magrolimab, urabrelimab, CC-90002, IBI-188, IBI-322, TG-1801 (NI-1701), ALX148, TJ011133, FA3M3, ZL1201, AK117, AO-176, SRF231, GenSci-059, C47B157, C47B161, C47B167, C47B222, C47B227, Vx-1004, HMBD004, SHR-1603, AMMS4-G4, RTX-CD47, and IMC-002.

[0327] In some embodiments, the CD47 antagonist provides CD47 blockade. Methods andagents for CD47 blockade are described in PCT / US2021 / 054326, which is incorporated by reference in its entirety.

[0328] In some embodiments, the tolerogenic factor (e.g., CD47) is overexpressed in themodified PSC relative to the control or wild-type PSC. In some embodiments, the tolerogenic factor (e.g. CD47) is expressed at a first level that is greater than at or about 3-fold, greater than at or about 5-fold, greater than at or about 10-fold, greater than at or about 20-fold, greater than at or about 30-fold, greater than at or about 40-fold, greater than at or about 50-fold, greater than at or about 60-fold, or greater than at or about 70-fold over a second level expressed by the control or wild-type PSC. In some embodiments, the tolerogenic factor (e.g. CD47) is expressed by the modified PSC at greater than at or about 20,000 molecules per cell, at greater than at or about 30,000 molecules per cell, greater than at or about 50,000 molecules per cell, greater than at or about 100,000 molecules per cell, greater than at or about 200,000 molecules per cell, greater than at or about 300,000 molecules per cell, greater than at or about 400,000 molecules per cell, greater than at or about 500,000 molecules per cell, or greater than at or about 600,000 molecules per cell.

[0329] In some embodiments, the tolerogenic factor (e.g., CD47) is overexpressed in theHIP-hPSC relative to the control or wild-type hPSC. In some embodiments, the tolerogenic factor (e.g. CD47) is expressed at a first level that is greater than at or about 3-fold, greater than at or about 5-fold, greater than at or about 10-fold, greater than at or about 20-fold, greater than at or about 30-fold, greater than at or about 40-fold, greater than at or about 50-fold, greater than at or about 60-fold, or greater than at or about 70-fold over a second level expressed by the control or wild-type beta cell. In some embodiments, the tolerogenic factor (e.g. CD47) is expressed by the HIP-hPSC at greater than at or about 20,000 molecules per cell, at greater than at or about 30,000 molecules per cell, greater than at or about 50,000 molecules per cell,greater than at or about 100,000 molecules per cell, greater than at or about 200,000 molecules per cell, greater than at or about 300,000 molecules per cell, greater than at or about 400,000 molecules per cell, greater than at or about 500,000 molecules per cell, or greater than at or about 600,000 molecules per cell. 2) Complement Inhibitors

[0330] In some embodiments, expression of one or more complement inhibitor is increasedin the cell. In some embodiments, the one or more complement inhibitor is one or more membrane-bound complement inhibitor. In some embodiments, at least one of the exogenous polynucleotides includes a polynucleotide that encodes for a complement inhibitor. In some embodiments, the one or more complement inhibitor is CD46, CD59, CD55, or CD35 or any combination thereof.

[0331] In some embodiments, the one or more complement inhibitor is CD46, CD59, CD55,or any combination thereof. For instance, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide that encodes one or more complement inhibitors, such as CD46. In some embodiments, the one or more complement inhibitors are CD46 and CD59, or CD46, CD59, and CD55. In some embodiments, expression of CD46 and CD59 or CD46, CD59, and CD55 protects a cell or population thereof from complement-dependent cytotoxicity, including in the presence of antibodies against cell surface antigens expressed by the cell.

[0332] In some embodiments, the present disclosure provides a cell or population thereofthat has been modified to express the one or more complement inhibitor, such as CD46, CD59, CD55, or any combination thereof. In some embodiments, the one or more complement inhibitor is CD46 and CD59. In some embodiments, the one or more complement inhibitor is CD46, CD59, and CD55. In some embodiments, the present disclosure provides a method for altering a cell genome to express one or more complement inhibitor. In some embodiments, the modified cell expresses one or more exogenous complement inhibitor, such as exogenous CD46 and CD59 or CD46, CD59, and CD55. In some instances, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD46 polypeptide. In some instances, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD59 polypeptide. In some instances, the cell expresses an expression vector comprising a nucleotide sequence encoding a human CD55 polypeptide. In some embodiments, the expression vector comprises nucleotide sequences encoding two or more complement inhibitors in any combination. In some embodiments, the expression vectorcomprises nucleotide sequences encoding CD46 and CD59. In some embodiments, the expression vector comprises nucleotide sequences encoding CD46, CD59, and CD55. A) CD46

[0333] In some embodiments, the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) contain anoverexpressed polynucleotide that encodes CD46, such as human CD46. In some embodiments, the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) contain an exogenous polynucleotide that encodes CD46, such as human CD46. In some embodiments, CD46 is overexpressed in the cell. In some embodiments, the expression of CD46 is increased in the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CD46. CD46 is a membrane-bound complement inhibitor. It acts as a cofactor for complement factor I, a serine protease which protects autologous cells against complement-mediated injury by cleaving C3b and C4b. Useful genomic, polynucleotide and polypeptide information about human CD46 are provided in, for example, the GeneCard Identifier GC01P207752, HGNC No. 6953, NCBI Gene ID 4179, Uniprot No. P15529, and NCBI Ref Seq Nos. NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2 NP_758860.1, NM_172353.2, NM_172359.2, NM_172361.2, NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1.

[0334] In some embodiments, the cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD46 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD46 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD46 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2 NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD46 as set forth in NCBI Ref. Sequence Nos.NM_001777.3 and NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2 NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2.

[0335] In some embodiments, the cell outlined herein comprises an exogenous nucleotidesequence encoding a CD46 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell outlined herein comprises an exogenous nucleotide sequence encoding a CD46 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_002380.3, NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD46 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2 NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD46 as set forth in NCBI Ref. Sequence Nos. NM_001777.3 and NM_002389.4, NM_153826.3, NM_172350.2, NM_172351.2, NM_172352.2 NP_758860.1, NM_172353.2, NM_172359.2, and NM_172361.2.

[0336] In some embodiments, the cell comprises an overexpressed CD46 polypeptide havingat least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell comprises an exogenous CD46 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell outlined herein comprises an overexpressed CD46 polypeptide having an amino acid sequence as set forth In NCBI Ref. Sequence Nos. NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1. In some embodiments, the cell outlined herein comprises an exogenous CD46 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_722548.1, NP_758860.1, NP_758861.1, NP_758862.1, NP_758863.1, NP_758869.1, and NP_758871.1.

[0337] In some embodiments, a cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD46 polypeptide that has at least 85% sequence identity (e.g., 85%,90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 4. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD46 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 4. In some embodiments, a cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD46 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 4. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD46 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 4.

[0338] In some embodiments, a cell outlined herein comprises an exogenous nucleotidesequence encoding a CD46 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD46 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 3. In some embodiments, the exogenous nucleotide sequence encoding the CD46 polypeptide is operably linked to a sequence encoding a heterologous signal peptide.

[0339] In some embodiments, all or a functional portion of CD46 can be linked to othercomponents such as a signal peptide, a leader sequence, a secretory signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding a signal peptide of CD46 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRa), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as IgG heavy chain or IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2), or CD33), a serum albumin protein (e.g. HSA or albumin), a human azurocidin preprotein signal sequence, a luciferase, a trypsinogen (e.g., chymotrypsinogen or trypsinogen) or other signal peptide able to efficiently express a protein by or on a cell.

[0340] In certain embodiments, the exogenous polynucleotide encoding CD46 is operablylinked to a promoter.

[0341] In some embodiments, the polynucleotide encoding CD46 is inserted into any one ofthe gene loci depicted in Table 2. In some cases, the polynucleotide encoding CD46 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, SHS231. In particular embodiments, the polynucleotide encoding CD46is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD46 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD46, into a genomic locus of the cell.

[0342] In some embodiments, CD46 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CD46 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD46 mRNA. B) CD59

[0343] In some embodiments, the modified pluripotent stem cell contains an overexpressedpolynucleotide that encodes CD59, such as human CD59. In some embodiments, the modified pluripotent stem cell contains an exogenous polynucleotide that encodes CD59, such as human CD59. In some embodiments, CD59 is overexpressed in the cell. In some embodiments, the expression of CD59 is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CD59. CD59 is a membrane-bound complement inhibitor. More specifically, CD59 is an inhibitor of complement membrane attack complex (MAC) activity. CD59 acts by binding to the C8 and / or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. Useful genomic, polynucleotide and polypeptide information about human CD59 are provided in, for example, the GeneCard Identifier GC11M033704, HGNC No. 1689, NCBI Gene ID 966, Uniprot No. P13987, and NCBI RefSeq Nos. NP_000602.1, NM_000611.5, NP_001120695.1, NM_001127223.1, NP_001120697.1, NM_001127225.1, NP_001120698.1, NM_001127226.1, NP_001120699.1, NM_001127227.1, NP_976074.1, NM_203329.2, NP_976075.1, NM_203330.2, NP_976076.1, and NM_203331.2.

[0344] In some embodiments, the cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD59 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, thecell outlined herein comprises an overexpressed nucleotide sequence encoding a CD59 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD59 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD59 as set forth in NCBI Ref. Sequence Nos. NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2.

[0345] In some embodiments, the cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD59 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell outlined herein comprises an exogenous nucleotide sequence encoding a CD59 polypeptide has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD59 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell outlined herein comprises an exogenous nucleotide sequence encoding a CD59 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD59 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cell comprises an exogenous nucleotide sequencefor CD59 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD59 as set forth in NCBI Ref. Sequence Nos. NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD59 as set forth in NCBI Ref. Sequence Nos. NM_000611.5, NM_001127223.1, NM_001127225.1, NM_001127226.1, NM_001127227.1, NM_203329.2, NM_203330.2, and NM_203331.2.

[0346] In some embodiments, the cell comprises an overexpressed CD59 polypeptide havingat least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell comprises an exogenous CD59 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell outlined herein comprises an overexpressed CD59 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1. In some embodiments, the cell outlined herein comprises an exogenous CD59 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000602.1, NP_001120695.1, NP_001120697.1, NP_001120698.1, NP_001120699.1, NP_976074.1, NP_976075.1, and NP_976076.1.

[0347] In some embodiments, a cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD59 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 6. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD59 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 6. In some embodiments, a cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD59 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 6. In some embodiments, a cell outlined herein comprises an exogenous nucleotidesequence encoding a CD59 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 6.

[0348] In some embodiments, a cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD59 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD59 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, a cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD59 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD59 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, the exogenous nucleotide sequence encoding the CD59 polypeptide is operably linked to a sequence encoding a heterologous signal peptide.

[0349] In some embodiments, all or a functional portion of CD59 can be linked to othercomponents such as a signal peptide, a leader sequence, a secretory signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding a signal peptide of CD59 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRa), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as IgG heavy chain or IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2), or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, a luciferase, a trypsinogen (e.g. chymotrypsinogen or trypsinogen) or other signal peptide able to efficiently express a protein by or on a cell.

[0350] In certain embodiments, the exogenous polynucleotide encoding CD59 is operablylinked to a promoter.

[0351] In some embodiments, the polynucleotide encoding CD59 is inserted into any one ofthe gene loci depicted in Table 2. In some cases, the polynucleotide encoding CD59 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CD59 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD59 isinserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD59, into a genomic locus of the cell.

[0352] In some embodiments, CD59 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CD59 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD59 mRNA. C) CD55

[0353] In some embodiments, the modified pluripotent stem cell contains an overexpressedpolynucleotide that encodes CD55, such as human CD55. In some embodiments, the modified pluripotent stem cell contains an exogenous polynucleotide that encodes CD55, such as human CD55. In some embodiments, CD55 is overexpressed in the cell. In some embodiments, the expression of CD55 is increased in the modified pluripotent stem cell compared to a similar reference or unmodified cell (including with any other modifications) except that the reference or unmodified cell does not include the exogenous polynucleotide encoding CD55. CD55 is a membrane-bound complement inhibitor. In some embodiments, interaction of CD55 with cell- associated C4b and C3b polypeptides interferes with their ability to catalyze the conversion of C2 and factor B to enzymatically active C2a and Bb and thereby prevents the formation of C4b2a and C3bBb, the amplification convertases of the complement cascade. In some embodiments, CD55 inhibits complement activation by destabilizing and preventing the formation of C3 and C5 convertases. Useful genomic, polynucleotide and polypeptide information about human CD55 (also known as complement decay-accelerating factor) are provided in, for example, the GeneCard Identifier GC01P207321, HGNC No. 2665, NCBI Gene ID 1604, Uniprot No. P08174, and NCBI RefSeq Nos. NM_000574.4, NM_001114752.2, NM_001300903.1, NM_001300904.1, NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1.

[0354] In some embodiments, the cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD55 polypeptide that has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD55 polypeptide having an amino acid sequence as set forth in NCBI Ref.Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD55 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_001777.3 and NM_198793.2. In some embodiments, the cell comprises an overexpressed nucleotide sequence for CD55 as set forth in NCBI Ref. Sequence Nos. NM_000574.4, NM_001114752.2, NM_001300903.1, and NM_001300904.1.

[0355] In some embodiments, the cell outlined herein comprises an exogenous nucleotidesequence encoding a CD55 polypeptide that has at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell outlined herein comprises an exogenous nucleotide sequence encoding a CD55 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD55 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) to the sequence set forth in NCBI Ref. Nos. NM_001777.3 and NM_198793.2. In some embodiments, the cell comprises an exogenous nucleotide sequence for CD55 as set forth in NCBI Ref. Sequence Nos. NM_000574.4, NM_001114752.2, NM_001300903.1, and NM_001300904.1.

[0356] In some embodiments, the cell comprises an overexpressed CD55 polypeptide havingat least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell comprises an exogenous CD55 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell outlined herein comprises an overexpressed CD55 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1. In some embodiments, the cell outlined herein comprises an exogenous CD55 polypeptide having an amino acid sequence as set forth in NCBI Ref. Sequence Nos. NP_000565.1, NP_001108224.1, NP_001287832.1, and NP_001287833.1.

[0357] In some embodiments, a cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD55 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 9. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD55 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 9. In some embodiments, a cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD55 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 9. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD55 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 9.

[0358] In some embodiments, a cell outlined herein comprises an overexpressed nucleotidesequence encoding a CD55 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 8. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD55 polypeptide that has at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) to an amino acid sequence as set forth in SEQ ID NO: 8. In some embodiments, a cell outlined herein comprises an overexpressed nucleotide sequence encoding a CD55 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 8. In some embodiments, a cell outlined herein comprises an exogenous nucleotide sequence encoding a CD55 polypeptide comprising an amino acid sequence as set forth in SEQ ID NO: 8. In some embodiments, the exogenous nucleotide sequence encoding the CD59 polypeptide is operably linked to a sequence encoding a heterologous signal peptide.

[0359] In some embodiments, all or a functional portion of CD55 can be linked to othercomponents such as a signal peptide, a leader sequence, a secretory signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding a signal peptide of CD55 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRa), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide from an immunoglobulin (such as IgG heavy chain or IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2), or CD33), a serum albumin protein (e.g. HSA or albumin), a humanazurocidin preprotein signal sequence, a luciferase, a trypsinogen (e.g., chymotrypsinogen or trypsinogen) or other signal peptide able to efficiently express a protein by or on a cell.

[0360] In certain embodiments, the exogenous polynucleotide encoding CD55 is operablylinked to a promoter.

[0361] In some embodiments, the polynucleotide encoding CD55 is inserted into any one ofthe gene loci depicted in Table 2. In some cases, the polynucleotide encoding CD55 is inserted into a safe harbor locus, such as but not limited to, a gene locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding CD55 is inserted into the CCR5 gene locus, the PPP1R12C (also known as AAVS1) gene locus or the CLYBL gene locus. In some embodiments, the polynucleotide encoding CD55 is inserted into a B2M gene locus, a CIITA gene locus, or a CD142 gene locus. In some embodiments, a suitable gene editing system (e.g., CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate the insertion of a polynucleotide encoding CD55, into a genomic locus of the cell.

[0362] In some embodiments, CD55 protein expression is detected using a Western blot ofcell lysates probed with antibodies against the CD55 protein. In another embodiment, reverse transcriptase polymerase chain reactions (RT-PCR) are used to confirm the presence of the exogenous CD55 mRNA. D) Combinations of Complement Inhibitors

[0363] In some embodiments, the cell comprises increased expression of none, one, two, ormore complement inhibitors selected from the group consisting of CD46, CD59, and CD55, in any combination.

[0364] In some embodiments, the modified pluripotent stem cell contains an overexpressedpolynucleotide that encodes CD46, such as any described above, and an overexpressed polynucleotide that encodes CD59, such as any described above.

[0365] In some embodiments, the modified pluripotent stem cell contains an exogenouspolynucleotide that encodes CD46, such as any described above, and an exogenous polynucleotide that encodes CD59, such as any described above.

[0366] In some embodiments, the modified cell (comprising one or more modifications thatincrease expression of CD46 and CD59) comprises increased expression of CD46 and CD59 relative to a cell that does not comprise the modifications (e.g., relative to endogenous expression of CD46 and CD59). In some embodiments, the modified pluripotent stem cell comprises between 1.5-fold and 2-fold, between 2-fold and 3-fold, between 3-fold and 4-fold,between 4-fold and 5-fold, between 5-fold and 10-fold, between 10-fold and 15-fold, between 15-fold and 20-fold, between 20-fold and 40-fold, between 40-fold and 60-fold, between 60- fold and 80-fold, between 80-fold and 100-fold, or between 100-fold and 200-fold increased expression of CD46 and CD59 compared to a cell that does not have the modifications (e.g., compared to endogenous expression of CD46 and CD59). In some embodiments, the cell without the modification(s) does not have endogenous expression of CD46 and CD59 or does not have detectable expression of CD46 and CD59. In some embodiments, the fold increase in expression compared to a cell lacking the modifications is greater than 200-fold.

[0367] In some embodiments, the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) (comprising oneor more modifications that increase expression of CD46 and CD59) comprises between 2-fold and 200-fold, between 2-fold and 100-fold, between 2-fold and 50-fold, or between 2-fold and 20-fold increased expression of CD46 and CD59 compared to a cell that does not have the modifications (e.g., compared to endogenous expression of CD46 and CD59). In some embodiments, the modified pluripotent stem cell (comprising one or more modifications that increase expression of CD46 and CD59) comprises between 5-fold and 200-fold, between 5- fold and 100-fold, between 5-fold and 50-fold, or between 5-fold and 20-fold increased expression of CD46 and CD59 compared to a cell that does not have the modifications (e.g., compared to endogenous expression of CD46 and CD59).

[0368] In some embodiments, the HIP-PSCs (e.g., HIP-iPSC or HIP-ESC) (comprising oneor more modifications that increase expression of CD46 and CD59) comprises increased expression of CD46 and CD59 relative to a cell that does not comprise the modifications (e.g., relative to endogenous expression of CD46 and CD59). In some embodiments, the modified pl...

Claims

Claims What is Claimed:

1. A method for producing a target organ comprising human cells in a non-human mammalhost, comprising: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst into an uterus of a non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non- human mammal host comprising the target organ; c) obtaining the target organ from the non-human mammal host, thereby producing the target organ comprising human cells in the non-human mammal host.

2. A method for generating a target organ comprising human cells in a non-human mammalhost, comprising implanting a chimeric blastocyst comprising a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host comprising the target organ, thereby generating the target organ comprising human cells in the non- human mammal host.

3. A method for producing a human cell from a target organ in a non-human mammal host,comprising: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst to an uterus of a non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non-human mammal host comprising the target organ; c) obtaining the target organ from the non-human mammal host; and d) isolating the human cell from the target organ, thereby producing the human cell from the target organ in the non-human mammal host.

4. A method for generating a human cell from a target organ in a non-human mammal host,comprising implanting a chimeric blastocyst comprising a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host comprisingthe target organ, wherein the target organ comprises the human cell, thereby generating the human cell from the target organ in the non-human mammal host.

5. A method for producing a pancreas comprising human islet cells in a non-humanmammal host, comprising: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst into an uterus of a non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non- human mammal host comprising the pancreas; c) obtaining the pancreas from the non-human mammal host, thereby producing the pancreas comprising the human islet cells in the non-human mammal host.

6. A method for generating a pancreas comprising human islet cells in a non-humanmammal host, comprising implanting a chimeric blastocyst comprising a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host comprising the pancreas, thereby generating the pancreas comprising human islet cells in the non-human mammal host.

7. A method for producing a human islet cell from a pancreas in a non-human mammal host,comprising: a) injecting a hypoimmune human pluripotent stem cell (HIP-hPSC) into a blastocyst of a non-human mammal donor, thereby producing a chimeric blastocyst; b) implanting the chimeric blastocyst to an uterus of non-human mammal surrogate, wherein after implantation the chimeric blastocyst develops into the non-human mammal host comprising the pancreas; c) obtaining the pancreas from the non-human mammal host; and d) isolating the human islet cell from the pancreas, thereby producing the human islet cell from the pancreas in the non-human mammal host.

8. A method for generating a human islet cell from a pancreas in a non-human mammalhost, comprising implanting a chimeric blastocyst comprising a hypoimmune human pluripotent stem cell (HIP-hPSC) into an uterus of a non-human mammal surrogate, wherein the chimeric blastocyst develops into the non-human mammal host comprising the pancreas, wherein the pancreas comprises the human islet cell, thereby generating the human islet cell from the pancreas in the non-human mammal host.

9. The method of any one of claims 1-8, wherein the target organ comprises pancreas,kidney, liver, heart, heart valve, lung, muscle, uterus, bone marrow, spleen, skin, cornea, eye, or intestine.

10. The method of any one of claims 1-9, wherein the human cell from the target organcomprises islet cells, kidney cells, liver cells, heart cells, lung cells, muscle cells, uterine cells, spleen cells, skin cells, corneal cells or intestinal cells.

11. The method of any one of claims 1-10, wherein the non-human mammal donor comprisesa porcine, bovine, non-human primate, canine, caprine, or ovine.

12. The method of any one of claims 1-11, wherein the non-human mammal surrogatecomprises a porcine, bovine, non-human primate, canine, caprine, or ovine.

13. The method of any one of claims 1-12, wherein the non-human mammal host comprises aporcine, bovine, non-human primate, canine, caprine, or ovine.

14. The method of any one of claims 1-13, wherein the non-human mammal donor, surrogateand host are the same species.

15. The method of any one of claims 1-14, wherein the non-human mammal donor, surrogateand host are the same species but different mammals.

16. The method of any one of claims 1-15, wherein the non-human mammal donor and thenon-human mammal surrogate are the same animal.

17. The method of any one of claims 1-16, wherein the non-human mammal host comprisesat least 1% chimeric contribution from the HIP-hPSC.

18. The method of any one of claims 1-17, wherein the non-human mammal host comprisesat least 2% chimeric contribution, at least 3% chimeric contribution, at least 4% chimeric contribution, at least 5% chimeric contribution, at least 6% chimeric contribution, at least 7% chimeric contribution, at least 8% chimeric contribution, at least 9% chimeric contribution, or at least 10% chimeric contribution from the HIP-hPSC.

19. The method of any one of claims 1-18, wherein the pancreas, kidney, liver, heart, heartvalve, lung, uterus, spleen, bone marrow, skin, cornea, eye, spinal cord, intestine, bone, cartilage, tendon, ligament, lymphatic vessel, and blood vessel of the non-human mammal host comprises at least 1% chimeric contribution from the HIP-hPSC.

20. The method of any one of claims 1-19, wherein the pancreas, kidney, liver, heart, heartvalve, lung, uterus, spleen, bone marrow, skin, cornea, eye, spinal cord, intestine, bone, cartilage, tendon, ligament, lymphatic vessel, and blood vessel of the non-human mammal host comprises at least 2% chimeric contribution, at least 3% chimeric contribution, at least 4% chimeric contribution, at least 5% chimeric contribution, at least6% chimeric contribution, at least 7% chimeric contribution, at least 8% chimeric contribution, at least 9% chimeric contribution, or at least 10% chimeric contribution from the HIP-hPSC.

21. The method of any one of claims 1-20, wherein at least 10% of the islets from thepancreas are derived from a HIP-hPSC.

22. The method of any one of claims 1-21, wherein the chimeric blastocyst comprises at least10% complementation.

23. The method of any one of claims 1-22, wherein prior to the injection the blastocyst is a 2-cell stage blastocyst, a 4-cell stage blastocyst, or an 8-cell stage blastocyst.

24. The method of any one of claims 1-23, wherein prior to the injection the blastocystcomprises a blastocoel, an inner cell mass, and / or a trophoblast.

25. The method of any one of claims 1-24, wherein the blastocyst comprises a porcine,bovine, non-human primate, canine, caprine, or ovine blastocyst.

26. The method of any one of claims 1-25, wherein the blastocyst comprises a porcineblastocyst.

27. The method of any one of claims 1-26, wherein the blastocyst is a porcine blastocyst.

28. The method of any one of claims 1-27, wherein the blastocyst comprises a wild typephenotype, a parthenogenetic phenotype, or a gene-edited phenotype.

29. The method of claim 28, wherein the gene-edited phenotype comprises an organogenesis-disabled phenotype.

30. The method of claim 29, wherein the organogenesis-disabled phenotype comprises anapancreatic phenotype.

31. The method of any one of claims 1-30, wherein the blastocyst comprises one or moregenetic modifications.

32. The method of any one of claims 1-31, wherein the one or more genetic modificationscomprises a mutation.

33. The method of any one of claims 1-32, wherein the blastocyst comprises a mutation.

34. The method of claim 33, wherein the mutation results in a blastocyst with anorganogenesis-disabled phenotype.

35. The method of claim 34, wherein the organo-genesis disabled phenotype comprises apancreatogenesis-disabled phenotype.

36. The method of claim 33, wherein the mutation results in a blastocyst with an apancreaticphenotype.

37. The method of any one of claims 33-36, wherein the mutation comprises deletion of aduodenal homeobox 1 (Pdx1) gene.

38. The method of claim 37, wherein deletion of the Pdx1 gene is monoallelic or biallelic.

39. The method of any one of claims 1-38, further comprising matching developmentaltiming of the HIP-hPSC to the blastocyst.

40. The method of any one of claims 1-39, wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 17, 18, 19 or 20 HIP-hPSCs are injected into the blastocyst.

41. The method of any one of claims 1-40, wherein the injection comprises depositing theHIP-hPSCs into the blastocoel.

42. The method of any one of claims 1-41, wherein the human pluripotent stem cell (hPSC) isselected from a naïve PSC, a naïve-like PSC, and a primed PSC.

43. The method of any one of claims 1-42, further comprising culturing the HIP-hPSCs underconditions sufficient to induce a naïve state.

44. The method of any one of claims 1-43, wherein the HIP-hPSCs comprise modificationsthat: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type hPSC that does not comprise the modifications.

45. The method of any one of claims 5-43, wherein the pancreas produced in the non-humanmammal host comprises modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type hPSC that does not comprise the modifications.

46. The method of any one of claims 7-43, wherein the isolated human islet cell from thepancreas produced in the non-human mammal host comprises modifications that: a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or b) increase expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type hPSC that does not comprise the modifications.

47. The method of any one of claims 44-46, wherein the one or more molecules that regulateexpression regulate cell surface protein expression of the one more MHC Class I molecules.

48. The method of any one of claims 44-47, wherein the one or more molecules that regulateexpression regulate cell surface protein expression of the one more MHC Class II molecules.

49. The method of any one of claims 44-48, wherein the one or more molecules that regulatecell surface protein expression of the one or more MHC class I molecules are B2M.

50. The method of any one of claims 44-49, wherein the modifications comprise amodification that regulates cell surface protein expression of the one or more MHC class I molecules and the modification inactivates or disrupts one or more alleles of B2M.

51. The method of any one of claims 44-50, wherein the modification that inactivates ordisrupts one or more alleles of B2M reduces mRNA expression of the B2M gene.

52. The method of any one of claims 44-51, wherein the modification that inactivates ordisrupts one or more alleles of B2M reduces protein expression of B2M.

53. The method of any one of claims 44-52, wherein the modification that inactivates ordisrupts one or more alleles of B2M comprises: inactivation or disruption of one allele of the B2M gene; inactivation or disruption of both alleles of the B2M gene; or inactivation or disruption of all B2M coding alleles in the cell.

54. The method of any one of claims 44-53, wherein the inactivation or disruption comprisesan indel in the B2M gene.

55. The method of any one of claims 44-54, wherein the inactivation or disruption comprisesa frameshift mutation or a deletion of a contiguous stretch of genomic DNA of the B2M gene.

56. The method of any one of claims 44-55, wherein the modification is a modification thatregulates expression of the one or more MHC class II molecules, and the modification inactivates or disrupts one or more alleles of CIITA.

57. The method of claim 56, wherein the modification that inactivates or disrupts one or morealleles of CIITA reduces protein expression of CIITA.

58. The method of claim 56 or claim 57, wherein the modification that inactivates or disruptsone or more alleles of CIITA comprises: inactivation or disruption of one allele of the CIITA gene; inactivation or disruption of both alleles of the CIITA gene; or inactivation or disruption of all CIITA coding alleles in the cell.

59. The method of any of claims 56-58, wherein the inactivation or disruption comprises anindel in the CIITA gene.

60. The method of any of claims 56-59, wherein the inactivation or disruption is a frameshiftmutation or a deletion of a contiguous stretch of genomic DNA of the CIITA gene.

61. The method of any one of claims 44-60, wherein expression of HLA-A, HLA-B, HLA-C,HLA-DP, HLA-DQ, and HLA-DR are reduced in the engineered hypoimmunogenic islets.

62. The method of any one of claims 44-61, wherein the one or more tolerogenic factors isselected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

63. The method of any one of claims 44-62, wherein at least one of the one or moretolerogenic factors is CD47.

64. The method of any one of claims 44-63, wherein the one or more tolerogenic factors isCD47.

65. The method of any one of claims 44-64, wherein the modification that increasesexpression of the one or more tolerogenic factors comprises an exogenous polynucleotide encoding the one or more tolerogenic factors.

66. The method of claim 65, wherein the exogenous polynucleotide encoding the one or moretolerogenic factors is integrated into the genome of the engineered hypoimmunogenic islets.

67. The method of any one of claims 44-66, wherein the one or more tolerogenic factorscomprises CD47 and the engineered hypoimmunogenic islets expresses CD47 at a first level that is greater than at or about 5-fold over a second level expressed by the control or wild-type islet cell.

68. The method of claim 67, wherein CD47 is expressed at a first level that is greater than ator about 10-fold, greater than at or about 20-fold, greater than at or about 30-fold, greater than at or about 40-fold, greater than at or about 50-fold, greater than at or about 60-fold, or greater than at or about 70-fold over a second level expressed by the control or wild- type islet cell.

69. The method of any one of claims 44-68, wherein the one or more tolerogenic factorscomprises CD47 and CD47 is expressed by the HIP-hPSC at greater than at or about 20,000 molecules per cell.

70. The method of claim 69, wherein CD47 is expressed by the HIP-hPSC at greater than ator about 30,000 molecules per cell, greater than at or about 50,000 molecules per cell, greater than at or about 100,000 molecules per cell, greater than at or about 200,000 molecules per cell, greater than at or about 300,000 molecules per cell, greater than at or about 400,000 molecules per cell, greater than at or about 500,000 molecules per cell, or greater than at or about 600,000 molecules per cell.

71. The method of any one of claims 44-70, wherein the HIP-hPSC has the phenotypeB2Mindel / indel; CIITAindel / indel; CD47tg.

72. The method of any one of claims 44-71, wherein among the HIP-hPSC, at least 85% ofthe cells have the modifications.

73. The method of claim 72, wherein at least 90%, at least 92%, at least 95% or at least 98%of the cells have the modifications.

74. The method of any one of claims 44-73, wherein among the HIP-hPSC, at least 85% ofthe cells have the phenotype has the phenotype B2Mindel / indel; CIITAindel / indel; CD47tg.

75. The method of claim 74, wherein at least 90%, at least 92%, at least 95% or at least 98%of the cells have the phenotype.

76. The method of any one of claims 1-75, wherein the HIP-hPSCs are ABO blood grouptype O.

77. The method of any one of claims 1-76, wherein the HIP-hPSC are Rhesus factor negative.

78. The method of any one of claims 1-77, wherein the HIP-hPSCs comprise modificationsthat inactivate or disrupt one or more alleles of an ABO blood group type antigen.

79. The method of claim 78, wherein the modifications that inactivate or disrupt one or morealleles of an ABO blood group type antigen disrupt expression of A1, A2, and / or B.

80. The method of any one of claims 1-77, wherein the HIP-hPSCs comprise modificationsthat inactivate or disrupt one or more alleles of a Rhesus factor (Rh) protein antigen.

81. The method of any one of claims 1-80, wherein the HIP-hPSCs further comprise amodification for expression of an exogenous safety switch.

82. The method of any one of claims 1-81, wherein the HIP-hPSCs further comprise amodification to increase expression of an exogenous safety switch.

83. The method of any one of claims 1-82, wherein the HIP-hPSCs comprise an exogenouspolynucleotide encoding a safety switch.

84. The method of any one of claims 81-83, wherein the safety switch is a system whereinupon activation, cells downregulate expression of the one or more tolerogenic factors and / or upregulate expression of one or more immune signaling molecules thereby marking the cell for elimination by the host immune system.

85. The method of claim 84, wherein the one or more tolerogenic factors are selected fromthe group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M- HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

86. The method of claim 84 or 85, wherein the one or more tolerogenic factors is CD47.

87. The method of any one of claims 81-85, wherein the safety switch and the one or moretolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified cell.

88. The method of claim 87, wherein the bicistronic cassette is integrated at a non-targetlocus in the genome of the HIP-hPSC.

89. The method of claim 87, wherein the bicistronic cassette is integrated into a targetgenomic locus of the cell.

90. The method of any one of claims 81-87, wherein the safety switch and CD47 areexpressed from a bicistronic cassette integrated into the genome of the modified cell.

91. The method of claim 87, wherein the bicistronic cassette is integrated by non-targetedinsertion into the genome of the modified cell, optionally by introduction of the exogenous polynucleotide into the cell using a lentiviral vector.

92. The method of claim 87, wherein the bicistronic cassette is integrated by targetedinsertion into a target genomic locus of the cell, optionally wherein the targeted insertion is by nuclease-mediated gene editing with homology-directed repair.

93. The method of any one of claim 89-92, wherein the target genomic locus is a safe harborlocus, a B2M gene locus, a CIITA gene locus, or a CD142 gene locus.

94. The method of claim 93, wherein the safe harbor locus is selected from the groupconsisting of: a CCR5 gene locus, a CXCR4 gene locus, a PPP1R12C (also known as AAVS1) gene, an albumin gene locus, a SHS231 locus, a CLYBL gene locus, and a ROSA26 gene locus.

95. The method of any one of claims 84-94, wherein the one or more immune signalingmolecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

96. The method of any one of claims 81-95, wherein the safety switch is a suicide gene.

97. The method of claim 96, wherein the suicide gene is selected from the group consisting ofcytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), an inducible caspase 9 (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9).

98. The method of any one of claims 1-97, wherein the HIP-hPSCs comprise a modificationthat inactivates or disrupts one or more alleles of CD142.

99. The method of claim 98, wherein the modification reduces mRNA expression of theCD142 gene.

100. The method of claim 98, wherein the modification reduces protein expression ofCD142.

101. The method of claim 98, wherein the modification that inactivates or disrupts one ormore alleles of CD142 comprises: inactivation or disruption of one allele of the CD142 gene; inactivation or disruption of both alleles of the CD142 gene; and inactivation or disruption of all CD142 coding alleles in the cell.

102. The method of any one of claims 98-101, wherein the inactivation or disruptioncomprises an indel in the CD142 gene.

103. The method of any one of claims 98-101, wherein the inactivation or disruption is aframeshift mutation or a deletion of a contiguous stretch of genomic DNA of the CD142 gene.

104. The method of any one of claims 1-103, wherein the HIP-hPSCs have the phenotypeB2Mindel / indel; CIITAindel / indel; CD47tg; safety switch transgene.

105. The method of any one of claims 81-104, wherein the safety switch induces controlledcell death in the presence of a drug or prodrug, or upon activation by a selective exogenous compound.

106. The method of any one of claims 81-105, wherein the safety switch is an inducibleprotein capable of inducing apoptosis of the HIP-hPSC.

107. The method of claim 106, wherein the inducible protein capable of inducing apoptosisof the HIP-hPSC is a caspase protein.

108. The method of claim 107, wherein the caspase protein is caspase 9.

109. The method of any one of claims 81-108, wherein the safety switch is activated toinduce controlled cell death after the administration of the one or more immunosuppressive agents to the subject.

110. The method of any one of claims 81-108, wherein the safety switch is activated toinduce controlled cell death prior to the administration of the one or more immunosuppressive agents to the subject.

111. The method of any one of claims 81-108, wherein the safety switch is activated toinduce controlled cell death after the administration of the HIP-hPSC to the subject.

112. The method of any one of claims 81-108, wherein the safety switch is activated toinduce controlled cell death in the event of cytotoxicity or other negative consequences to the subject.

113. The method of any one of claims 1-112, comprising administering an agent thatallows for depletion of the HIP-hPSC.

114. The method of claim 113, wherein the agent that allows for depletion of the HIP-hPSC is an antibody that recognizes a protein expressed on the surface of the HIP-hPSC.

115. The method of claim 114, wherein the antibody is selected from the group consistingof an antibody that recognizes CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, RQR8, and CD47.

116. The method of claim 114 or 115, wherein the antibody is selected from the groupconsisting of mogamulizumab, AFM13, MOR208, obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-Rllb, tomuzotuximab, RO5083945 (GA201),cetuximab, Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-Rllc, magrolimab, and biosimilars thereof.

117. The method of any one of claims 1-116, wherein the target organ is harvestedbetween 1 to 365 days after birth.

118. The method of any one of claims 1-117, wherein the pancreas is harvested betweendays 1 to 365 days after birth.

119. The method of any one of claims 1-118, wherein the human islet from the pancreas isharvested between 1 to 365 days after birth.

120. The method of any one of claims 5-119, wherein isolating the human islet cell fromthe pancreas comprises manual isolation, mechanical isolation, or chemical isolation.

121. The method of any one of claims 5-119, wherein isolating the human islet cell fromthe pancreas comprises perfusion.

122. The method of claim 121, wherein perfusion comprises inserting a catheter into thepancreatic duct.

123. The method of claim 121 or 122, wherein perfusion comprises inflating the pancreaswith an isolation medium.

124. The method of claim 123, wherein the isolation medium comprises an enzyme.

125. The method of claim 124, wherein the enzyme comprises a proteolytic enzyme.

126. The method of claim 125, wherein the enzyme comprises collagenase.

127. The method of any one of claims 123-126, wherein after inflating, fat and connectivetissue are washed off the pancreas tissue.

128. The method of any one of claims 5-127, further comprising digesting the pancreas.

129. The method of claim 128, wherein the digesting comprises incubating the pancreas inthe isolation medium.

130. The method of claim 129, wherein the isolation medium comprises an enzyme.

131. The method of claim 130, wherein the enzyme comprises a proteolytic enzyme.

132. The method of claim 131, wherein the enzyme comprises collagenase.

133. The method of any one of claims 128-132, wherein the digesting comprises agitatingthe pancreas in the isolation media.

134. The method of any one of claims 128-133, further comprising passing the digestedpancreas through a filter.

135. The method of claim 134, wherein the filter comprises a pore size of 500 µm.

136. A target organ produced according to the method of any one of claims 1-135.

137. A pancreas produced according to the method of any one of claims 5-135.

138. A chimeric pancreas produced according to the method of any one of claims 5-135.

139. A chimeric pancreas produced according to the method of any one of claims 5-135,comprising cells derived from hypoimmunogenic human pluripotent stem cells (HIP- hPSCs).

140. A chimeric pancreas produced according to the method of any one of claims 5-135,comprising cells derived from hypoimmunogenic human pluripotent stem cells (HIP- hPSCs) and cells derived from non-human mammal host.

141. The chimeric pancreas of claim 140, wherein the non-human mammal host is aporcine host.

142. A human islet cell produced according to the method of any one of claims 7-135.

143. A chimeric mammal produced using the method of any one of claims 1-135.

144. A chimeric mammal comprising cells derived from a non-human mammal and ahuman, wherein the cells from the non-human mammal comprise a genetic modification at one or more loci and the cells from the human comprise cells derived from a hypoimmune modified human pluripotent stem cell (HIP-hPSC) that forms at least one organ or tissue in the chimeric mammal and that comprises modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors.

145. The chimeric mammal of claim 143 or 144, wherein the non-human mammal andhuman are different species.

146. A genetically modified animal comprising cells derived from a non-human animaland a human, wherein the cells from the non-human mammal comprise genetic modifications at one or more loci and the cells from the human comprise a hypoimmune modified human pluripotent stem cell (HIP-hPSC) that forms at least one organ or tissue and that comprises modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or(b) increase expression of one or more tolerogenic factors.

147. The genetically modified mammal of claim 146, wherein the non-human mammal andhuman are different species.

148. A genetically modified mammal comprising cells derived from a hypoimmunemodified pluripotent stem cell (HIP-PSC), wherein the HIP-PSC comprises modifications that: (a) inactivate or disrupt one or more alleles of: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate expression of the one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that regulate expression of the one or more MHC class II molecules; and / or (b) increase expression of one or more tolerogenic factors.

149. The chimeric mammal or genetically modified mammal of any one of claims 143-148, further comprises one or more additional modifications.

150. The chimeric mammal or genetically modified mammal of claim 149, wherein the oneor more additional modifications are cell-type specific, cell-lineage specific, organ specific, or organism specific.

151. The chimeric mammal or genetically modified mammal of claim 149 or 150, whereinthe one or more additional modifications are implicated in an immune response pathway.

152. The chimeric mammal or genetically modified mammal of any one of claims 143-148, wherein the one or more additional modifications include modifications that (i) inactivate or disrupt one or more alleles of: one or more ABO blood group antigen and / or one or more Rh antigens; a NK activating receptor (CD226, NCR1, NCR2, and NCR3, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, or KIR2DS5,); and a NK activating receptor ligand (PVR (gene encoding CD155), MICA, MICB, UL16- binding protein 1, UL16-binding protein 2, UL16-binding protein 3, UL16-binding protein 4, UL16-binding protein 5, UL16-binding protein 6, natural cytotoxicity receptor 3 (NCR3LG1 encoding B7H6), and CD112).

153. The chimeric mammal or genetically modified mammal of any one of claims 143-152, wherein (i) the one or more ABO blood group antigens are selected from the group consisting of: an ABO blood group antigen A1 (antigen A1), ABO blood group antigen A2 (antigen A2), and ABO blood group antigen B (antigen B), and (ii) the one or more Rh antigens are selected from the group consisting of: Rh D antigen, Rh C antigen, Rh Eantigen, Kell K antigen (KEL), Duffy (FY) Fya antigen, Duffy Fy3 antigen, Kidd (JK) Jkb antigen, MNS antigen U, MNS antigen S, and SLC14A1.

154. The chimeric mammal or genetically modified mammal of any one of claims 143-153, wherein the one or more NK activating receptors are selected from the group consisting of: CD226, NCR1, NCR2, and NCR3, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, and KIR2DS5.

155. The chimeric mammal or genetically modified mammal of any one of claims 143-154, wherein the one or more NK activating receptor ligands are selected from the group consisting of: CD155, MICA, MICB, UL16-binding protein 1, UL16-binding protein 2, UL16-binding protein 3, UL16-binding protein 4, UL16-binding protein 5, UL16-binding protein 6, B7H6, and CD112.

156. The chimeric mammal or genetically modified mammal of any one of claims 143-155, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc Receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

157. The chimeric mammal or genetically modified mammal of any one of claims 143-156, wherein the one or more tolerogenic factors is CD47.

158. The chimeric mammal or genetically modified mammal of any one of claims 143-157, wherein the one or more additional modifications inactive or disrupt one or more alleles of a tissue-specific antigen, organ-specific antigen, or a species-specific antigen.

159. The chimeric mammal or genetically modified mammal of claim 158, wherein the oneor more species-specific antigens comprise species endogenous antigens.

160. The chimeric mammal or genetically modified mammal of claim 159, wherein the oneor more species-specific antigens are selected from the group consisting of: an endogenous retrovirus element, α(1,3)-galactosyltransferase (αGT), glycoprotein alpha- galactosyltransferase 1 (GGTA1), beta-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2), and Cytidine monophospho-N-acetylneuraminic acid hydroxylase (CMAH).

161. A method of treating or preventing a beta cell disorder in a subject in need thereof, themethod comprising:administering to the subject the human islet cell produced according to the method of any one of claims 7-135.

162. A method of treating or preventing a beta cell disorder in a subject in need thereof, themethod comprising: administering to the subject the pancreas produced according to the method of any one of claims 5-135.

163. The method of claim 161 or 162, wherein the beta cell disorder is diabetes.

164. The method of claim 163, wherein the diabetes is type I diabetes.

165. The method of claim 163, wherein the diabetes is type II diabetes.

166. The method of any one of claims 161-165, wherein the human islet cell or pancreasimprove glucose tolerance in the subject.

167. A method for improving glucose tolerance in a subject in need thereof, the methodcomprising administering the pancreas produced according to the method of any one of claims 5-135.

168. A method for improving glucose tolerance in a subject in need thereof, the methodcomprising administering the human islet cell produced according to the method of any one of claims 7-135.

169. The method of 167 or 168, wherein the subject is a diabetic patient.

170. The method of 169, wherein the diabetic patient has type I diabetes or type IIdiabetes.

171. The method of any one of claims 167-170, wherein glucose tolerance is improvedrelative to the subject’s glucose tolerance prior to administration of the human islet cells.

172. The method of any one of claims 167-171, wherein glucose tolerance is improvedrelative to the subject’s glucose tolerance prior to administration of the pancreas.

173. The method of any one of claims 167-172, wherein administration of the human isletcells reduces exogenous insulin usage in the subject.

174. The method of any one of claims 167-173, wherein administration of the pancreasreduces exogenous insulin usage in the subject.

175. The method of any one of claims 167-174, wherein glucose tolerance is improved asmeasured by HbA1c levels.

176. The method of any one of claims 167-175, wherein the subject is fasting.

177. The method of any one of claims 167-176, wherein administration of the HIP-hPSCimproves insulin secretion in the subject.

178. The method of any one of claims 167-177, wherein insulin secretion is improvedrelative to the subject’s insulin secretion prior to administration of the human islet cells.

179. The method of any one of claims 167-178, wherein insulin secretion is improvedrelative to the subject’s insulin secretion prior to administration of the pancreas.

Images