CNOT9 binding RNA degraders

Bifunctional compounds targeting RNA transcripts through RNA binders and decay factors enhance RNA modulation, addressing the need for selective RNA degradation to treat diseases by reducing aberrant protein levels.

WO2026072885A1PCT designated stage Publication Date: 2026-04-02ARRAKIS THERAPEUTICS INC
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-26
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current RNA modulation technologies lack agents that can selectively inhibit or eradicate disease-causing RNA targets by harnessing RNA quality control mechanisms, such as mRNA decay pathways, to treat various diseases.

Method used

Development of bifunctional compounds comprising an RNA binder and a decay factor-recruiting ligand, connected by a linker, to specifically target and degrade disease-related RNA transcripts.

Benefits of technology

The compounds effectively modulate RNA activity and degradation, offering transformative disease treatment options by selectively degrading target RNAs, thereby reducing aberrant protein levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000003_0001
    Figure IMGF000003_0001
  • Figure IMGF000004_0001
    Figure IMGF000004_0001
  • Figure IMGF000004_0002
    Figure IMGF000004_0002
Patent Text Reader

Abstract

The present invention includes compounds and compositions, and methods of use thereof for modulating an RNA transcript, or a precursor, isoform, fragment, or mutant thereof by degradation of the RNA transcript via recruitment or binding of one or more decay factors (e.g., an RNA binding protein).
Need to check novelty before this filing date? Find Prior Art

Description

CNOT9 BINDING RNA DEGRADERS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. US 63 / 700,384, filed September 27, 2024; the contents of which are incorporated herein by reference. TECHNICAL FIELD OF THE INVENTION

[0002] The present invention relates to compounds and methods of use thereof for modulatingthe activity of RNA transcripts, as well as isoforms, mutants, and fragments thereof, viamodulating their degradation and / or otherwise modulating their activity. The invention also provides methods of treating various diseases and conditions mediated by a target RNA transcript, such as those described herein. SEQUENCE LISTING

[0003] This application contains a Sequence Listing which has been submitted in .xml format and is hereby incorporated by reference. The ST.26 copy, created on September 23, 2025, is named394457-019WO _221640_SL.xml, and is 68,686 bytes in size.BACKGROUND OF THE INVENTION

[0004] RNA, both coding and messenger RNA (mRNA), as well as non-coding RNA(ncRNA), play a multitude of critical regulatory roles in the cell. The total of all RNAs transcribed from DNA – both coding and non-coding – comprise the transcriptome and all cellular biology flows from the transcriptome. All endogenous mammalian diseases are ultimately derived from or modulated by the transcriptome, either directly by RNA or through expressed proteins. Thus, there is the potential to intervene in all human diseases that are protein-mediated or RNA-mediated by modulating the translation or regulatory function of the corresponding mRNAs or ncRNAs.

[0005] RNA quality control (QC) mechanisms are varied and ubiquitous. After transcription, RNAs must undergo processing to produce their active forms. RNA processing includes a variety of endo- and exonucleolytic cleavage of sequences at either end of the initial transcript, cleavage of internal sequences (e.g., internal transcribed spacers and introns), nucleotide editing, and various types of . Notably, most cellular RNAs 1undergo multiple processing reactions, with alternate pathways (e.g., alternative splicing) leading to distinct products. Multiple RNAs from otherwise similar or identical RNA primary transcriptsresult in an increase in the functional diversity of RNA and protein species encoded by individualgenes.

[0006] mRNA decay is the process that causes programmed nucleolytic degradation of themRNA. The process is enabled by the association of mRNAs with specific RNA-binding proteins(RBPs). Thus, mRNA decay has the potential to directly influence the steady state levels of a translatable pool of mRNAs in vivo. Eukaryotic mRNA decay occurs primarily by enzymaticremoval of nucleotides in the 5 -3 direction and is catalyzed by Xrn1. mRNAs are also degradedin the 3 -5 direction by the multi-subunit protein complex called the exosome, the catalytic subunitof which is Rrp44. The contribution of 3 -5 decay to global mRNA turnover is higher in metazoansas compared to lower eukaryotes.

[0007] RNA QC mechanisms normally operate to eliminate incorrectly or incompletelyprocessed RNAs. However, if the normal activity of these nucleases and QC pathways could beharnessed to selectively degrade (or not degrade) a disease-causing (or disease-treating) RNA target, it would lead to novel and indeed transformative modes of treating a variety of diseases.

[0008] Thus, there is a broad need for agents that selectively inhibit or eradicate target RNAs. The present invention achieves this using bifunctional or chimeric molecules and compositions that both (i) bind to target RNA transcripts and (ii) recruit decay factors, such as RNA-binding proteins (RBPs), that activate an RNA degradation mechanism to degrade the target RNAs orotherwise abrogate the function of the target RNAs (e.g., the availability of the RNA for translationinto an active protein). The compounds of this invention and pharmaceutically acceptablecompositions thereof meet these requirements and provide other related benefits, as described herein. SUMMARY OF THE INVENTION

[0009] In one aspect, the present invention provides a compound of Formula A: RNAor a pharmaceutically acceptable salt thereof, wherein:RNA Binder is a moiety that binds to a target RNA transcript;DFL is a Decay Factor-recruiting Ligand; and -L1- is a bivalent linker group that covalently connects the RNA Binder to the DFL; wherein the DFL binds to or recruits a decay factor; wherein the DFL binds to or recruits one ormore decay factors that degrade the target RNA transcript.

[0010] In some embodiments, the RNA Binder is an oligonucleotide, a polypeptide or an RNA-binding small molecule (rSM). In some embodiments, the RNA Binder is an oligonucleotide. In some embodiments, the RNA Binder is an rSM.

[0011] In one aspect, the present invention provides a compound of Formula B: rSM L1DFLor a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and L1is a bivalent linker group that covalently connects the rSM to the DFL; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. DFL Ib:pa or a pharmaceutically acceptable salt thereof, wherein:Ring A is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; Ring B is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; Ring C is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; X is NR8, CR9R10, O or S; Y is CH2 or C=O; each occurrence of R1, R2and R3is independently H, optionally substituted C1-6 aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturatedmonocyclic carbocyclic ring, halogen, -CN, -C(O)OR, -OC(O)R, -C(O)N(R)2, -N(R)C(O)R, - N(R)C(O)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -OR, -N(R)2, -NO2, -SR, -S(O)R, -S(O)2R, - S(O)2N(R)2, or -NRS(O)2R; R4is H, optionally substituted C1-6aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, -OR, or -N(R)2; R5is H, or optionally substituted C1-6 aliphatic; R6and R7are each independently H, or optionally substituted C1-6aliphatic; R8is H, or optionally substituted C1-6 aliphatic; R9and R10are each independently H; optionally substituted C1-6 aliphatic; or R9and R10, taken together with the carbon to which they are attached, form a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; -L2- is a covalent bond or a C1-8bivalent optionally substituted straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; each R is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partiallyunsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; m is 0, 1, 2, or 3; n is 0, 1, 2, or 3; and p is 0, 1, 2, or 3; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of FormulaIa or Ib.N

[0013] In some embodiments, Ring A is selected fro NHN .

[0014] In some embodiments, Ring B is selected fro, NO N .N N

[0015] In some embodiments, Ring C is selected fromNN N N NN N N N N H . S.

[0017] In some embodiments, Y is selected from CH2or C=O.

[0018] In some embodiments, R1is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, and i- Pr.

[0019] In some embodiments, R2is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, and i- Pr.

[0020] In some embodiments, R3is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, i-Pr odiments, R4is selected from H, NHCH3, CH2OMe, OH, -OMe, Me, Et, .odiments, R5is H or Me.

[0023] In some embodiments, R6is H.

[0024] In some embodiments, R7is H.

[0025] In some embodiments, R8is selected from H, Me, and CH2OMe.

[0026] In some embodiments, R9is H.

[0027] In some embodiments, R10is H.

[0028] In some embodiments, R9and R10, taken together with the carbon to which they are attached, form a cyclopropane or an oxetane ring.

[0029] In some embodiments, -L2- is selected from ,OH OH OH , H , H , andO L2or a pharmaceutically acceptable salt thereof; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula II.

[0031] In some embodiments, the compound is of Formula III:O N L2or a pharmaceutically acceptwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula III.

[0032] In some embodiments, the compound is of Formula IV: O L2or a pharmaceutically accepwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula IV.

[0033] In some embodiments, the compound is of Formula V: OV or a pharmaceutically acceptable salt thereof; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula V.

[0034] In some embodiments, the compound is of Formula VI: O 2 N L or a pharmaceutically acceptwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VI.

[0035] In some embodiments, the compound is of Formula VII: O L2or a pharmaceutically acceptable salt thereof; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VII.

[0036] In some embodiments, the compound is of Formula VIII:O N L2or a pharmaceutically acceptabwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VIII.

[0037] In some embodiments, the compound is of Formula IX: O L2or a pharmaceutically acceptablwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula IX.

[0038] In some embodiments, the compound is of Formula X: OX or a pharmaceutically acceptable salt thereof; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula X.

[0039] In some embodiments, -L1- is a covalent bond or a bivalent C1-20 straight or branchedhydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH2CH2O-; each R is independently hydrogen or an optionally substituted group selected from C1-6aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 memberedbicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0040] In some embodiments, -L1- is a covalent bond or a C1-8 bivalent straight or branchedhydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionallyreplaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; each R is independently hydrogen or an optionally substituted group selected from C1-6aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0041] In some embodiments, -L1- is a covalent bond or a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L1- are independently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, - Si(OH)(R)-, -Si(OH)2-, -P(O)(OR)-, -P(O)(R)-, -P(O)(N(R)2)-, an amino acid q ,N O O N in: ected from C1-6aliphatic,a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 memberedbicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy2- is independently an optionally substituted bivalent ring selected from phenylenyl, an 8-12 membered bicyclic arylenyl, a 3-8 membered saturated or partially unsaturated carbocyclylenyl, an 8-12 membered bicyclic saturated or partially unsaturated carbocyclylenyl, a 3-8 membered saturated or partially unsaturated heterocyclylenyl having 1- 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-12 membered bicyclic saturated or partially unsaturated heterocyclylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered heteroarylenyl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10membered bicyclic heteroarylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; and each q is independently 1, 2, or 3.

[0042] In some embodiments, the decay factor is a protein that binds or interacts with RNA(an RBP) and wherein the interaction of the RBP with the RNA leads to modulation of the targetRNA transcript in vivo.

[0043] In some embodiments, the RBP is part of the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex.

[0044] In some embodiments, the target RNA transcript is an mRNA or a precursor, isoform,unspliced isoform, splicing intermediate, fragment, or mutant thereof.

[0045] In some embodiments, the target RNA transcript is selected from one of those listed in Table C or D; or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof.

[0046] In some embodiments, the rSM is selected from any one of those described in the disclosure under the heading RNA-Binding Small Molecules (rSMs).

[0047] In some embodiments, the rSM is one of those shown in Table 2.

[0048] In some embodiments, the present invention provides a pharmaceutical composition comprising the compound described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0049] Another aspect of the present invention provides a method of modifying the amount of a protein in a cell, the method comprising administering the compound or composition described herein, or a pharmaceutically acceptable salt thereof, that acts on a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, in an amount sufficient to modify the amount of the protein in the cell.

[0050] In some embodiments, modifying the amount of a protein in a cell is reducing the amount of protein in the cell.

[0051] Another aspect of the present invention provides a method of modulating the availability for protein translation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition described herein, or a pharmaceutically acceptable salt thereof, that binds to the target RNA transcript or an isoform, fragment, or mutantthereof.

[0052] Another aspect of the present invention provides a method of modulating the translationof a target protein or mutant thereof, comprising contacting a target RNA transcript or a precursor,isoform, fragment, or mutant thereof with the compound or composition described herein, or apharmaceutically acceptable salt thereof.

[0053] Another aspect of the present invention provides a method of decreasing the half-lifeor increasing degradation of a target RNA transcript or a precursor, isoform, fragment, or mutantthereof, comprising contacting the target RNA transcript or the precursor, isoform, fragment, ormutant thereof with the compound or composition described herein, or a pharmaceutically acceptable salt thereof.

[0054] Another aspect of the present invention provides a method of treating a disease, comprising administering to a subject in need thereof the compound or composition described herein, or a pharmaceutically acceptable salt thereof.

[0055] In some embodiments, the disease is characterized by an aberrant level of a protein in a cell.

[0056] In some embodiments, the disease is one of those listed in Table C or D.

[0057] In some embodiments, the disease is a cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] FIG. 1 shows a schematic of the CCR4-NOT complex, including CNOT9, a major mediator of RNA deadenylation.

[0059] FIG. 2A shows the structure of selected compounds that bind CNOT9 and the CNOT9:1 complex.

[0060] FIG. 2B shows the structures of selected compounds consisting of a CNOT9 binding moiety, a linker and an RNA binding moiety that bind CNOT9 and the CNOT9:1 complex.

[0061] FIG.3 shows the binding of selected compounds to CNOT9 and the CNOT9:1 complex as evaluated by SPR.

[0062] FIG. 4 shows that bifunctional compounds (HBFs) can accelerate the degradation of RNA, as shown in a biochemical assay.

[0063] FIG. 5 shows that the non-conjugated RNA binding moiety and the non-conjugated CNOT9 binding moiety compete with the bifunctional molecules (HBFs).DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS 1. General Description of Certain Embodiments of the Invention; Definitions

[0064] In one aspect, the present invention provides a bifunctional compound of Formula A: RNA1BinderLDFLor a pharmaceutically acceptable salt thereof, wherein:RNA Binder is a moiety that binds to a target RNA transcript;DFL is a Decay Factor-recruiting Ligand; andL1is a bivalent linker group that covalently connects the RNA Binder to the DFL; wherein the DFL binds to or recruits a decay factor; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript.

[0065] In some embodiments, the RNA binder is an oligonucleotide, peptide, oligosaccharide or an RNA-binding small molecule (rSM). In some embodiments, the RNA binder is an oligonucleotide. In some embodiments, the RNA binder is an rSM. In some embodiments, the DFL binds an RBP. In some embodiments, the present invention provides a bifunctional composition comprising an RNA binder and a DFL useful as a modulator of targeted degradation of a variety of target RNA transcripts, which are then degraded and / or otherwise inhibited by the bifunctional composition as described herein. An advantage of the composition provided herein is that a broad range of pharmacological activities is possible, consistent with the degradation / inhibition of a target RNA transcript from virtually any RNA class or family.

[0066] In some embodiments, the composition includes an RNA binder, such as an oligonucleotide, and the composition binds the RNA through its oligonucleotide. Oligonucleotides that bind RNA are well known. Generally, the oligonucleotide that binds the target RNA will have a nucleic acid sequence that is complementary to a nucleic acid sequence in the target RNA. The binding of an oligonucleotide with a complimentary sequence to a target RNA sequence is stable and highly specific. In some embodiments, the composition including an RNA binder, such as an oligonucleotide, is optimized for intracellular delivery. Optimization ofoligonucleotides and compositions comprising oligonucleotides for intracellular delivery is well established.

[0067] In some embodiments, the composition comprises an RNA binder. In some embodiments, the RNA binder is an oligonucleotide. In some embodiments, the oligonucleotide can specifically bind an RNA target. In some embodiments, the oligonucleotide comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. In some embodiments, the oligonucleotide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more than 30 nucleotides. In some embodiments, the oligonucleotide has been modified for therapeutic delivery.

[0068] In some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO). In some embodiments, the ASO is a therapeutic ASO. Non-limiting examples of therapeutic ASOs include Mipomersen, Custirsen, Fomivirsen, Oblimersen, Eteplirsen, Nusinersen, Inotersen, Givosiran, Golodirsen and Viltolarsen.

[0069] In some embodiments, the DFL binds to or recruits CCR4-NOT (Carbon CataboliteRepression-Negative On TATA-less) complex. In some embodiments, the DFL activates CCR4-NOT complex. In some embodiments, the DFL increases the activity of CCR4-NOT complex. In some embodiments, the DFL binds to or recruits one or more components of the CCR4-NOTcomplex, such as CNOT1, CNOT2, CNOT3, CNOT6, CNOT6L, CNOT7, CNOT8, CNOT9,CNOT10 and CNOT11. In some embodiments, the DFL binds to or recruits CNOT1. In some embodiments, the DFL binds to or recruits CNOT2. In some embodiments, the DFL binds to or recruits CNOT3. In some embodiments, the DFL binds to or recruits CNOT6. In some embodiments, the DFL binds to or recruits CNOT6L. In some embodiments, the DFL binds to or recruits CNOT7. In some embodiments, the DFL binds to or recruits CNOT8. In some embodiments, the DFL binds to or recruits CNOT9. In some embodiments, the DFL binds to or recruits CNOT10. In some embodiments, the DFL binds to or recruits CNOT11.

[0070] In one aspect, the present invention provides a bifunctional compound of Formula B:or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L1- is a bivalent linker group that covalently connects the rSM to the DFL;wherein the DFL binds to or recruits one or more decay factors that degrade the target RNAtranscript. DFL

[0071] In some embodimentsis a compound of Formula Ia or Formula Ib:O OR4L2R4L23p or aRing A is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; Ring B is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; Ring C is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; X is NR8, CR9R10, O or S; Y is CH2 or C=O; each occurrence of R1, R2and R3is independently H, optionally substituted C1-6aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, halogen, -CN, -C(O)OR, -OC(O)R, -C(O)N(R)2, -N(R)C(O)R, - N(R)C(O)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -OR, -N(R)2, -NO2, -SR, -S(O)R, -S(O)2R, - S(O)2N(R)2, or -NRS(O)2R;R4is H, optionally substituted C1-6aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, -OR, or -N(R)2; R5is H, or optionally substituted C1-6 aliphatic; R6and R7are each independently H, or optionally substituted C1-6aliphatic; R8is H, or optionally substituted C1-6 aliphatic; R9and R10are each independently H; optionally substituted C1-6 aliphatic; or R9and R10, taken together with the carbon to which they are attached, form a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; -L2- is a covalent bond or a C1-8bivalent optionally substituted straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; each R is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 memberedbicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur;each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partiallyunsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatomsindependently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ringhaving 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; m is 0, 1, 2, or 3; n is 0, 1, 2, or 3; and p is 0, 1, 2, or 3; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula Ia or Ib.

[0072] As defined generally above, Ring A is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0073] In some embodiments, Ring A is phenyl. In some embodiments, Ring A is a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. N

[0074] In some embodiments, Ring A is selected fro NHN S .e depicted in Table 1, below.

[0076] As defined generally above, Ring B is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0077] In some embodiments, Ring B is phenyl. In some embodiments, Ring B is a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. ,[00 9 I s m e b NN 7] n o e m odiments, Ring B is selected from, N ON N N N . selected from those depicted in Table 1, below.

[0081] As defined generally above, Ring C is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0082] In some embodiments, Ring C is phenyl. In some embodiments, Ring C is a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur. N NN,N

[0084] In some embodiments, Ring C is selected fro N N N NN N N N .in Table 1, below.

[0086] As defined generally above, X is NR8, CR9R10, O or S.

[0087] In some embodiments, X is NR8. In some embodiments, X is CR9R10. In some embodiments, X is O. In some embodiments, X is S.

[0088] In some embodiments, X is selected from those depicted in Table 1, below.

[0089] As defined generally above, Y is CH2 or C=O.

[0090] In some embodiments, Y is CH2. In some embodiments, Y is C=O.

[0091] In some embodiments, Y is selected from those depicted in Table 1, below.

[0092] As defined generally above, each R1is independently H, optionally substituted C1-6 aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partiallyunsaturated monocyclic carbocyclic ring, halogen, -CN, -C(O)OR, -OC(O)R, -C(O)N(R)2, - N(R)C(O)R, -N(R)C(O)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -OR, -N(R)2, -NO2, -SR, -S(O)R, - S(O)2R, -S(O)2N(R)2, or -NRS(O)2R.

[0093] In some embodiments, R1is H. In some embodiments, R1is an unsubstituted C1-6aliphatic. In some embodiments, R1is a substituted C1-6 aliphatic. In some embodiments, R1is anunsubstituted ring selected from a 3-6 membered saturated or partially unsaturated monocycliccarbocyclic ring. In some embodiments, R1is a substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R1is halogen. In some embodiments, R1is -CN. In some embodiments, R1is -C(O)OR. In some embodiments, R1is -OC(O)R. In some embodiments, R1is -C(O)N(R)2. In some embodiments,R1 is -N(R)C(O)R. In some embodiments, R1 is -N(R)C(O)N(R)2. In some embodiments, R1 is -OC(O)N(R)2. In some embodiments, R1is -N(R)C(O)OR. In some embodiments, R1is -OR. In some embodiments, R1is -N(R)2. In some embodiments, R1is -NO2. In some embodiments, R1is -SR. In some embodiments, R1is -S(O)R. In some embodiments, R1is -S(O)2R. In some embodiments, R1is -S(O)2N(R)2. In some embodiments, R1is -NRS(O)2R.

[0094] In some embodiments, R1is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, and i- Pr.

[0095] In some embodiments, R1is selected from those depicted in Table 1, below.

[0096] As defined generally above, each R2is independently H, optionally substituted C1-6 aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, halogen, -CN, -C(O)OR, -OC(O)R, -C(O)N(R)2, - N(R)C(O)R, -N(R)C(O)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -OR, -N(R)2, -NO2, -SR, -S(O)R, - S(O)2R, -S(O)2N(R)2, or -NRS(O)2R.

[0097] In some embodiments, R2is H. In some embodiments, R2is an unsubstituted C1-6aliphatic. In some embodiments, R2is a substituted C1-6 aliphatic. In some embodiments, R2is an unsubstituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R2is a substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R2is halogen. In some embodiments, R2is -CN. In some embodiments, R2is -C(O)OR. In some embodiments, R2is -OC(O)R. In some embodiments, R2is -C(O)N(R)2. In some embodiments,R2 is -N(R)C(O)R. In some embodiments, R2 is -N(R)C(O)N(R)2. In some embodiments, R2 is -OC(O)N(R)2.In some embodiments, R2is -N(R)C(O)OR.In some embodiments, R2is -OR. In some embodiments, R2is -N(R)2. In some embodiments, R2is -NO2. In some embodiments, R2is -SR. In some embodiments, R2is -S(O)R. In some embodiments, R2is -S(O)2R. In some embodiments, R2is -S(O)2N(R)2. In some embodiments, R2is -NRS(O)2R.

[0098] In some embodiments, R2is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, and i- Pr.

[0099] In some embodiments, R2is selected from those depicted in Table 1, below.

[0100] As defined generally above, each R3is independently H, optionally substituted C1-6 aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, halogen, -CN, -C(O)OR, -OC(O)R, -C(O)N(R)2, - N(R)C(O)R, -N(R)C(O)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -OR, -N(R)2, -NO2, -SR, -S(O)R, - S(O)2R, -S(O)2N(R)2, or -NRS(O)2R.

[0101] In some embodiments, R3is H. In some embodiments, R3is an unsubstituted C1-6 aliphatic. In some embodiments, R3is a substituted C1-6aliphatic. In some embodiments, R3is an unsubstituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R3is a substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R3is halogen. In some embodiments, R3is -CN. In some embodiments, R3is -C(O)OR. In some embodiments, R3is -OC(O)R. In some embodiments, R3is -C(O)N(R)2. In some embodiments,R3 is -N(R)C(O)R. In some embodiments, R3 is -N(R)C(O)N(R)2. In some embodiments, R3 is -OC(O)N(R)2.In some embodiments, R3is -N(R)C(O)OR.In some embodiments, R3is -OR. In some embodiments, R3is -N(R)2. In some embodiments, R3is -NO2. In some embodiments, R3is -SR. In some embodiments, R3is -S(O)R. In some embodiments, R3is -S(O)2R. In some embodiments, R3is -S(O)2N(R)2. In some embodiments, R3is -NRS(O)2R.

[0102] In some embodiments, R3is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, i-Pr .In some embodiments, R3is selected from those depicted in Table 1, below.

[0104] As defined generally above, R4is H, an optionally substituted C1-6aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, -OR, or -N(R)2.

[0105] In some embodiments, R4is H. In some embodiments, R4is an unsubstituted C1-6aliphatic. In some embodiments, R4is a substituted C1-6 aliphatic. In some embodiments, R4is an unsubstituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R4is a substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R4is -OR. In some embodiments, R4is -N(R)2.

[0106] In some embodiments, R4is selected from H, NHCH3, CH2OMe, OH, -OMe, Me, Et, N H . odiments, R4is selected from those depicted in Table 1, below.

[0108] As defined generally above, R5is H or optionally substituted C1-6aliphatic.

[0109] In some embodiments, R5is H. In some embodiments, R5is an unsubstituted C1-6 aliphatic. In some embodiments, R5is a substituted C1-6 aliphatic.

[0110] In some embodiments, R5is H or Me.

[0111] In some embodiments, R5is selected from those depicted in Table 1, below.

[0112] As defined generally above, R6is H or optionally substituted C1-6 aliphatic.

[0113] In some embodiments, R6is H. In some embodiments, R6is an unsubstituted C1-6aliphatic. In some embodiments, R6is a substituted C1-6aliphatic.

[0114] In some embodiments, R6is H.

[0115] In some embodiments, R6is selected from those depicted in Table 1, below.

[0116] As defined generally above, R7is H or optionally substituted C1-6aliphatic.

[0117] In some embodiments, R7is H. In some embodiments, R7is an unsubstituted C1-6 aliphatic. In some embodiments, R7is a substituted C1-6 aliphatic.

[0118] In some embodiments, R7is H.

[0119] In some embodiments, R7is selected from those depicted in Table 1, below.

[0120] As defined generally above, R8is H or optionally substituted C1-6 aliphatic.

[0121] In some embodiments, R8is H. In some embodiments, R8is an unsubstituted C1-6aliphatic. In some embodiments, R8is a substituted C1-6aliphatic.

[0122] In some embodiments, R8is selected from H, Me, and CH2OMe.

[0123] In some embodiments, R8is selected from those depicted in Table 1, below.

[0124] As defined generally above, R9and R10are each independently H, an optionally substituted C1-6 aliphatic, or R9and R10, taken together with the carbon to which they are attached, form a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0125] In some embodiments, R9is H. In some embodiments, R9is an unsubstituted C1-6 aliphatic. In some embodiments, R9is a substituted C1-6aliphatic. In some embodiments, R10is H. In some embodiments, R10is an unsubstituted C1-6 aliphatic. In some embodiments, R10is a substituted C1-6 aliphatic. In some embodiments, R9and R10, taken together with the carbon to which they are attached, form a 3-6 membered saturated monocyclic carbocyclic ring. In some embodiments, R9and R10, taken together with the carbon to which they are attached, form a 3-6 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R9and R10, taken together with the carbon to which they are attached, form a 4-6 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R9and R10, taken together with the carbon to which they are attached, form a 4-6 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0126] In some embodiments, R9is H. In some embodiments, R10is H. In some embodiments, R9and R10are both H.

[0127] In some embodiments, R9and R10, taken together with the carbon to which they are attached, form a cyclopropane or an oxetane ring.

[0128] In some embodiments, R9is selected from those depicted in Table 1, below.

[0129] In some embodiments, R10is selected from those depicted in Table 1, below.

[0130] As defined generally above, -L2- is a covalent bond or a C1-8 bivalent optionallysubstituted straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, - C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, - SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or - Cy-.

[0131] In some embodiments, -L2- is a covalent bond. In some embodiments, -L2- is a C1-8bivalent straight or branched hydrocarbon chain. In some embodiments, -L2- is a C1-8 bivalentstraight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, - (R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-.

[0132] In some embodiments, one methylene unit of -L2- is optionally replaced by a 3-8membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0133] In some embodiments, one methylene unit of -L2- is optionally replaced by a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, one methylene unit of -L2- is optionally replaced by phenyl. In some embodiments, one methyleneunit of -L2- is optionally replaced by an 8-10 membered bicyclic aromatic carbocyclic ring. Insome embodiments, one methylene unit of -L2- is optionally replaced by a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independentlyselected from nitrogen, oxygen, and sulfur. In some embodiments, one methylene unit of -L2- isoptionally replaced by a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, one methyleneunit of -L2- is optionally replaced by an 8-10 membered bicyclic or bridged bicyclic saturated orpartially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, one methylene unit of -L2- is optionally replaced by an 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0134] In some embodiments, one methylene unit of -L2- is optionally replaced ,NNN rN, H , H , H , and

[0036] n some embodments, - - s seected rom tose depcted n abe , beow.

[0137] In some embodiments, R is hydrogen. In some embodiments, R is an optionally substituted C1-6 aliphatic group. In some embodiments, R is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments,R is an optionally substituted phenyl. In some embodiments, R is an optionally substituted 8-10membered bicyclic aromatic carbocyclic ring. In some embodiments, R is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0138] As defined generally above, m is 0, 1, 2, or 3. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3.

[0139] As defined generally above, n is 0, 1, 2, or 3. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 0, 1, or 2. In some embodiments, n is 1, 2, or 3.

[0140] As defined generally above, p is 0, 1, 2, or 3. In some embodiments, p is 0. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 0, 1, 2, or 3. In some embodiments, p is 0, 1, or 2. In some embodiments, p is 1, 2, or 3.

[0141] As defined generally above, a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula Ia or Ib, and in the various Formulas described below. For example, one or two hydrogen atoms are replaced by a covalent bond to -L1-. In some embodiments, one covalent bond replaces one hydrogen atom. In some embodiments, one hydrogen atom of any available modifiable C, N, or O atom is replaced by a covalent bond to -L1-.

[0142] Exemplar compounds of the invention are set forth in Table 1, below.

[0143] In some emo ments, the present invention provides a compound of Formula II:O N L2or a pharmaceutically acceptable salt thereof, wherein: each of Ring A, R1, R2, -L2-, m and n is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula II.

[0144] In some embodiments, the present invention provides a compound of Formula III: O L2or a pharmaceutically acceptable salt thereof, wherein: each of Ring A, R1, R2, -L2-, m and n is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula III.

[0145] In some embodiments, the present invention provides a compound of Formula IV:O N L2or a pharmaceutically acceptable salt thereof, wherein:each of R1, R2, -L2-, m and n is as defined above and described in embodiments herein, both singlyand in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula IV.

[0146] In some embodiments, the present invention provides a compound of Formula V: O L2or a pharmaceutically accepeach of R1, R2, -L2-, m and n is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula V.

[0147] In some embodiments, the present invention provides a compound of Formula VI:O N L2or a pharmaceutically accepteach of R1, R2, -L2-, m and n is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VI.

[0148] In some embodiments, the present invention provides a compound of Formula VII: O L2or a pharmaceutically acceptabl-L2- is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VII.

[0149] In some embodiments, the present invention provides a compound of Formula VIII:O N L2or a pharmaceutically acceptab-L2- is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VIII.

[0150] In some embodiments, the present invention provides a compound of Formula IX: O L2or a pharmaceutically acceptabl-L2- is as defined above and described in embodiments herein, both singly and in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula IX. 0151] In some embodiments, the present invention provides a compound of Formula X:O N L2or a pharmaceutically accepteach of R1, R2, -L2-, m and n is as defined above and described in embodiments herein, both singlyand in combination; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula X.

[0152] In another aspect, the present invention provides a compound of Formula Ia or Formula Ib wherein the variables are described as above. In some embodiments, the compound is selected from those depicted in Table 1, below. Table 1. Exemplary CompoundsO I-2 NO I-6 NO I-10 NO I-14 NO I-18 NO I-22 NO I-26 NO I-30 NO I-34 NO I-38 NO I-42 NO I-46 NO I-50 NO I-54 NO I-58NO I-62 NO I-66 NO I-70 NO I-74 NNHOHI-78 OO I-83 NO I-87 NO I-91 NOI-95 H NO I-99 NO I-103NH NO I-107 NO I-111 N

[00153] In some embodiments, the compound is selected from one of those shown in Table 1, above. In some embodiments, the compound is selected from one of those shown in Table 1, above, or a pharmaceutically acceptable salt thereof. Table 1a. Exemplary Compounds Chemical structure Compound NumberS O NH I-1a N NHS NH I-3a O N NHS NH I-5a O N NHS NH I-7a O N NHS NH I-9a O N NHS NH I-11a O N NHS NH I-13a O N NHS NH I-15a O N NHS NH I-17a O N NHS NH I-19a O N NHS NH I-21a O N NHS NH I-23a O N NHS NH I-25a O N NHS NH I-27a O N NHS NH I-29a O N NHS NH I-31a O N NHS NH I-33a O N NHS NH I-35a O N NHS NH I-37a O N NHS NH I-39a O N NHS NH I-41a O N NHS NH I-43a O N NHS NH I-45a O N NHS NH I-47a O N NHS NH I-49a O N NHS NH I-51a O N NHS NH I-53a O N NHS NH I-55a O N NHS O NH I-57a N NHS NH I-59a O N NHS O NH I-61a N NHS NH I-63a O N NHS NH I-65a O N NHS NH I-67a O N NHS NH I-69a O N NHS NH I-71a O N NHS O NH I-73a N NHS O NH I-75a N NHS O NH I-77a N NHS O NH I-79a N NHS O NH I-81a N NHS NH I-83a O N NHS NH I-85a O N NHS O NH I-87a N NHS O NH I-89a N NHS O NH I-91a N NHS NH I-93a O N NHS O NH I-95a N NHS O NH I-97a N NHS O NH I-99a N NHS O NH I-101a N NHS NH I-103a O N NHS O NH I-105a N NHS NH I-107a O N NHS NH I-109a O N NHS NH I-111a O N NHS O NH I-1b N NHS NH I-3b O N NHS NH I-5b O N NHS NH I-7b O N NHS NH I-9b O N NHS NH I-11b O N NHS NH I-13b O N NHS NH I-15b O N NHS NH I-17b O N NHS NH I-19b O N NHS NH I-21b O N NHS NH I-23b O N NHS NH I-25b O N NHS NH I-27b O N NHS NH I-29b O N NHS NH I-31b O N NHS NH I-33b O N NHS NH I-35b O N NHS NH I-37b O N NHS NH I-39b O N NHS NH I-41b O N NHS NH I-43b O N NHS NH I-45b O N NHS NH I-47b O N NHS NH I-49b O N NHS NH I-51b O N NHS NH I-53b O N NHS NH I-55b O N NHS O NH I-57b N NHS NH I-59b O N NHS O NH I-61b N NHS NH I-63b O N NHS NH I-65b O N NHS NH I-67b O N NHS NH I-69b O N NHS NH I-71b O N NHS O NH I-73b N NHS O NH I-75b N NHS O NH I-77b N NHS O NH I-79b N NHS O NH I-81b N NHS NH I-83b O N NHS NH I-85b O N NHS O NH I-87b N NHS O NH I-89b N NHS O NH I-91b N NHS NH I-93b O N NHS O NH I-95b N NHS O NH I-97b N NHS O NH I-99b N NHS O NH I-101b N NHS NH I-103b O N NHS O NH I-105b N NHS NH I-107b O N NHS NH I-109b O N NHS NH I-111b O N NH

[0154] In some embodiments, the compound is selected from one of those shown in Table 1a, above. In some embodiments, the compound is selected from one of those shown in Table 1a, above, or a pharmaceutically acceptable salt thereof.

[0155] In some embodiments, the compound of the present invention can be used as a CCR4-NOT binder or recruiter. In some embodiments, the compound of the present invention can beused to modulate the activity of CCR4-NOT. In some embodiments, the compound of the present invention can be used to inhibit the activity of CCR4-NOT. In some embodiments, the compound can be used to increase the activity of CCR4-NOT. In some embodiments, the compound activates the CCR4-NOT complex. In some embodiments, the compound increases the activity of the CCR4-NOT complex. In some embodiments, the compound binds to or recruits one or more components of the CCR4-NOT complex, such as CNOT1, CNOT2, CNOT3, CNOT6, CNOT6L, CNOT7, CNOT8, CNOT9, CNOT10 and CNOT11. In some embodiments, the compound binds to or recruits CNOT1. In some embodiments, the compound binds to or recruits CNOT2. In some embodiments, the compound binds to or recruits CNOT3. In some embodiments, the compound binds to or recruits CNOT6. In some embodiments, the compound binds to or recruits CNOT6L. In some embodiments, the compound binds to or recruits CNOT7. In some embodiments, the compound binds to or recruits CNOT8. In some embodiments, the compound binds to or recruits CNOT9. In some embodiments, the compound binds to or recruits CNOT10. In some embodiments, the compound binds to or recruits CNOT11.

[0156] In some embodiments, the compound increases degradation of a target RNA transcript. In some embodiments, the compound increases degradation of a target RNA transcript by bringing the CCR4-NOT complex in proximity of the target RNA. In some embodiments, the compound increases deadenylation of a target RNA transcript, for example a target mRNA transcript. In some embodiments, the compound increases deadenylation of a target RNA transcript by bringing the CCR4-NOT complex in proximity of the target RNA. 2. Compounds and Related Definitions

[0157] As described generally above, the present invention provides a bifunctional compound of Formula B:B or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript;DFL is a Decay Factor-recruiting Ligand; and-L1- is a bivalent linker group that covalently connects the rSM to the DFL;wherein the DFL binds to or recruits one or more decay factors that degrade the target RNAtranscript. RNA-Binding Small Molecules (rSMs)

[0158] In one aspect, the disclosure provides bifunctional compounds of Formula B whereinthe compound includes an rSM. A variety of rSMs known in the art may be used in accordance with the present invention. In some embodiments, the rSM is modified from its known structure in order to covalently attach the rSM to the linker, L1, at any available and modifiable C atom or a heteroatom such as an N, O, S, or P atom of the rSM. In the context of a C atom, “modifiable” refers to a C atom having 1) an attached H atom that can be replaced by a bond to L1via a chemical reaction such as an oxidation, reduction, nucleophilic substitution, or cross-coupling reaction; or 2) a C atom that can participate in a chemical reaction such as oxidation, reduction, nucleophilic substitution, or cross-couple reaction due to unsaturation or the presence of a leaving group attached to the C atom. For example, a C=O group, C=N group, or C-Br group is “modifiable.” Similarly, a modifiable heteroatom may be attached to an H atom capable of being replaced by a bond to L1, or is modifiable due to unsaturation or the presence of a leaving group attached to the heteroatom.

[0159] In some embodiments, the rSM is a small molecule or pharmaceutically acceptable saltthereof. In some embodiments, the rSM has a molecular weight (MW) of 1000 or less. In some embodiments, the rSM has a MW of about 750 or less. In some embodiments, the rSM has a MW of about 600 or less. In some embodiments, the rSM has a MW of about 500 or less. In some embodiments, the rSM has a MW of between about 100 and about 1000. In some embodiments, the rSM has a MW of between about 150 and about 800, about 150 and about 600, about 150 and about 400, about 150 and about 350, about 200 and about 350, or between about 200 and about 450.

[0160] In some embodiments, the rSM or compound of Formula B binds to the target RNAtranscript, or an isoform, fragment, or mutant thereof, with a Kd of 1 µM, 500 nM, 100 nM, 50nM, 10 nM, 1 nM, 500 pM, 10 pM, or 1 pM or lower affinity under biological conditions. In someembodiments, the rSM or compound binds to the target RNA transcript, or an isoform, fragment, or mutant thereof, with a Kdof 0.1 nm to 500 nm, 10 nm to 250 nm, 0.001-25 µM, 0.01-25 µM, 0.1-25 µM, 0.1-15 µM, 0.01-10 µM, 0.001-1 µM, 0.001-0.1 µM, or 0.001-0.01 µM. Exemplary rSMs N S N O N

[0161] In some embodiments , wherein the rSM is covalently rSM isN S N O toN or a pharmy p ; y d to L1at any available modifiable C, N, or O atom.

[0163] In some embodiments, the rSM is selected from one of those described in U.S.provisional application 63 / 700,384, which is hereby incorporated by reference.

[0164] In some embodiments, the rSM is a G-quadruplex binder, such as one of thosedescribed in Peng, W. et al., J. Med. Chem. 2018, 61, 6629-6646, which is hereby incorporated byreference.

[0165] In some embodiments, the rSM is a compound disclosed in Shi, Y. et al., Cell Chem.Biol. 2019, 26, 319-330, which is hereby incorporated by reference.wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom.

[0166] In some embodiments, the rSM is a compound disclosed in Velagapudi, S.P. et al. (2014), “Sequence-based design of bioactive small molecules that target precursor microRNAs,” Nat. Chem. Biol.10, 291, hereby incorporated by reference, for example the following: or a pharmaceutically accepta1M is covalently bound to L at any available modifiable C, N, or O atom.

[0167] In some embodiments, the rSM is a MALAT-1 binder such as the following: HN N or a pharmaceuty bound to L1at any available modifiable C, N, or O atom.

[0168] In some embodiments, the rSM is a G-quadruplex binder such as the following:or a pharmaceutically1lently bound to L at any available modifiable C or N atom.

[0169] In some embodiments, the rSM is one of the following compounds:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, S, or O atom.

[0170] In some embodiments, the rSM is selected from one of those described in J. Med.Chem. 2018, 61(15), 6501-6517, or U.S. 8,729,263, each of which is hereby incorporated by reference. For example, the rSM is selected from a compound according to Formula I from U.S. 8,729,263:or a pharmaceutically acceptable salt thereof, wherein each variable is as defined therein; and wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom.

[0171] In some embodiments, the rSM is selected from one of those described in U.S. 9,040,712, which is hereby incorporated by reference. For example, in some embodiments, the rSM is selected from a compound according to Formula X from U.S.9,040,712: or a pharmaceutically acceptable sach variable is as defined therein; and wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom.

[0172] In some embodiments, the rSM is selected from one of those described in Angelbello, A. J., et al., “Small molecule targeting of RNA structures in neurological disorders, ”Annals of theNew York Academy of Sciences, 2020 Jul;1471(1):57-71, hereby incorporated by reference, or apharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom. In some embodiments, the rSM is one of the following:N Hor a p armaceutca y accepta e sat tereo; w eren te r s covaenty ound to L1at any available modifiable C, N, O, S, or P atom.R R

[0173] In some embodiments, the rSM is selected from one of those depicted in Table 2A, below; or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom.

[0174] In some embodiments, the rSM is a compound according to Formula IX:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,150,612, the entirety of which is hereby incorporated by reference.

[0175] In some embodiments, the rSM is a compound according to Formula X:or a pharmnd to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,550,769, the entirety of which is hereby incorporated by reference. In some embodiments, variable L1above iswherein each variable is as defined in U.S.9,550,769.

[0176] In some embodiments, the rSM is selected from one of those disclosed in U.S. 10,157,261, the entirety of which is hereby incorporated by reference; and wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom.

[0177] In some embodiments, the rSM is a compound according to Formula XI:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,586,944, the entirety of which is hereby incorporated by reference.

[0178] In some embodiments, the rSM is a compound according to Formula XII: H-Y-H XII wherein H is a group of the structureor a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; andwherein each variable is as defined in U.S.9,795,687, the entirety of which is hereby incorporated by reference.

[0179] In some embodiments, the rSM is a compound selected from one of the following: or a pharmd to L1at any available modifiable C, N, O, S, or P atom; or another compound disclosed in WO 2018 / 151810, the entirety of which is hereby incorporated by reference.

[0180] In some embodiments, the rSM is a compound of the following structure:or a ph L1at anyavailable modifiable C, N, O, S, or P atom; or another compound disclosed in in WO 2018 / 152414, the entirety of which is hereby incorporated by reference.

[0181] In some embodiments, the rSM is a compound of the following structure:or a phar d to L1at anyavailable modifiable C, N, O, S, or P atom; or another compound disclosed in US 2018 / 0334678, the entirety of which is hereby incorporated by reference.

[0182] In some embodiments, the rSM is a compound according to Formula XIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2018 / 0296532, the entirety of which is hereby incorporated by reference.

[0183] In some embodiments, the rSM is a compound according to Formula XIV:O O L1RNn Het or a pharmaceutic ly boun1d to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 098297, the entirety of which is hereby incorporated by reference.

[0184] In some embodiments, the rSM is a compound according to Formula XV, XVI, or XVII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019 / 0152924, the entirety of which is hereby incorporated by reference.

[0185] In some embodiments, the rSM is a compound according to Formula XVIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 005993, the entirety of which is herebyincorporated by reference.

[0186] In some embodiments, the rSM is a compound according to Formula XIX:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 232039, the entirety of which is hereby incorporated by reference.

[0187] In some embodiments, the rSM is a compound according to Formula XX:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 005980, the entirety of which is hereby incorporated by reference.

[0188] In some embodiments, the rSM is a compound according to Formula XXI: or a pharmaceutically acceptabe sa e eo ; w e e e M is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 226622, the entirety of which is herebyincorporated by reference.

[0189] In some embodiments, the rSM is a compound according to Formula XXII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and

[0190] wherein each variable is as defined in WO 2018 / 098446, the entirety of which is hereby incorporated by reference.

[0191] In some embodiments, the rSM is a compound according to Formula XXIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2017 / 087364, the entirety of which is hereby incorporated by reference.

[0192] In some embodiments, the rSM is ataluren:or a deuterated analog thsalt thereof, disclosed in US 2018 / 0333397 or WO 2017 / 087364, each of which is hereby incorporated by reference.

[0193] In some embodiments, the rSM is a compound of the following structure:or a pharmaceuund to L1at any available modifiable C, N, O, S, or P atom; as described in US 2018 / 147228, the entirety of which is hereby incorporated by reference.

[0194] In some embodiments, the rSM is a compound according to Formula XXIV:XXIV or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,969,754, the entirety of which is hereby incorporated by reference.

[0195] In some embodiments, the rSM is a compound according to Formula XXV-i:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,371,336, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S. 9,371,336, or a pharmaceutically acceptable salt thereof.

[0196] In some embodiments, the rSM is a compound according to Formula XXV-ii:- or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,617,268, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S. 9,617,268, or apharmaceutically acceptable salt thereof.

[0197] In some embodiments, the rSM is a compound according to Formula XXVI:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019 / 0000844, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in US 2019 / 0000844, or a pharmaceutically acceptable salt thereof.

[0198] In some embodiments, the rSM is a compound according to Formula XXVII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2018 / 0161456, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in US 2018 / 0161456, or a pharmaceutically acceptable salt thereof.

[0199] In some embodiments, the rSM is a compound according to Formula XXVIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.10,195,202, the entirety of which is hereby incorporatedby reference. In some embodiments, the rSM is a compound disclosed in U.S. 10,195,202, or apharmaceutically acceptable salt thereof.

[0200] In some embodiments, the rSM is a compound according to one of Formulae XXIX- XXXIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 028440, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in WO 2019 / 028440, or a pharmaceutically acceptable salt thereof.

[0201] In some embodiments, the rSM is a compound according to one of Formulae XXXIV- XLXI:XLVor a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 060917, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in WO 2019 / 060917, or a pharmaceutically acceptable salt thereof.

[0202] In some embodiments, the rSM is a compound according to Formula XLXII orXLXIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 9,879,007, the entirety of which is hereby incorporated by reference.

[0203] In some embodiments, the rSM is a compound according to Formula XLXIV or XLXV:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 191229, the entirety of which is hereby incorporated by reference.

[0204] In some embodiments, the rSM is a compound according to Formula XLXVI:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 191092, the entirety of which is hereby incorporated by reference.

[0205] In some embodiments, the rSM is a compound according to Formula XLXVII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019 / 315773, the entirety of which is hereby incorporated by reference.

[0206] In some embodiments, the rSM is a compound according to Formula LVIII, LIX, or LX:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 199972, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in modulating splicing of the FOXM1 gene for use in the treatment of cancer.

[0207] In some embodiments, the rSM is a compound according to Formula LXI:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined for Formula (I) in WO 2020 / 005873, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in modulating RNA targets that mediate Huntington’s disease. In some embodiments, the compound is of formula (Ibb1) described therein:wherein or a pharmaceutically acce erein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined therein.

[0208] In some embodiments, the rSM is a compound according to Formula LXII or LXIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2020 / 005877, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in binding to HTT RNAtranscripts for use in the treatment of diseases such as Huntington’s.

[0209] In some embodiments, the rSM is a compound according to Formula LXIV, LXV, LXVI, or LXVII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at anyavailable modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO2020 / 005882, the entirety of which is hereby incorporated by reference. Such compounds areuseful, for example, in binding to HTT RNA transcripts for use in the treatment of diseases suchas Huntington’s.

[0210] In some embodiments, the rSM is selected from one of those depicted in US Patents 8,729,263, 9,545,404, 9,856,474, or 7,838,657, each of which is hereby incorporated by reference.

[0211] In some embodiments, the rSM is selected from one of those depicted in Table 2, below; or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L1at any available modifiable C, N, O, S, or P atom. Table 2: Additional rSMs O NH2dreference. NH24,. ):.O O N -O N . H2.Engl. 2016, 55, 8258–8261; herebyincorporated by reference. 9,Orac, C. M., et al., J. Med. Chem. 2011, 54,6786–6795; hereby incorporated byVelagapudi, et al., 2018 Velagapudi, et al., 20182NH2H 2HHONNH2H H2H2N N H N N N N NH N NH N N H22l 3H N H2N NH2N NO O HO FO OHO NS ONBrNO NSS H2N 222F O N NFO NOON OFNOHN OHF O ON O NOH FOF FO NOHON OCl NO NOF ON ONO N OHN N. by . H . .Warner, K. D. Nat Rev Drug Discov.2018. . . .NH2Decay Factors and RNA-Binding Proteins (RBPs)

[0212] In one aspect, the disclosure provides a composition comprising an RNA binder thatbinds to a target RNA transcript and a Decay Factor-recruiting Ligand (DFL), wherein the DFL binds to or recruits a decay factor.

[0213] In one aspect, the disclosure provides compositions that comprise a decay factor ligandthat binds decay factors, and wherein the decay factor is a protein that binds or interacts with RNA(an RBP) and wherein the interaction of the RBP with the RNA leads to modulation of the targetRNA transcript in vivo.

[0214] A decay factor as provided herein is any protein, polypeptide or biological molecule present in a cell that when brought in the proximity of a target RNA modulates that RNA. Modulating an RNA as provided herein includes, destabilizing the RNA, stabilizing the RNA, degrading the RNA, or acting on the RNA in any other capacity. Decay factors include any protein that interferes with the stability and / or activity of the RNA. In some embodiments, the decay factor is an RNA destabilizing protein, a nuclease, or an RNA-binding protein. It should be appreciated that nucleases and RNA-binding proteins are not mutually exclusive and that, for instance, some RNA-binding proteins also have nuclease activity. In some embodiments, the present disclosure provides a bifunctional compound or composition that effects recruitment to a target RNA to a nuclease capable of degrading the target RNA, or to an RNA-binding protein (RBP) that destabilizes the target RNA towards degradation by any of a cell’s or tissue’s mechanisms of RNA degradation.

[0215] In some embodiments, the DFL binds or attracts a complex of proteins that can degrade or otherwise modulate the RNA function (e.g., the availability for protein translation). In some embodiments, the protein complex is the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex. CCR4-NOT complex

[0216] In some embodiments, the DFL binds or attracts a complex of proteins that can degrade or otherwise modulate the RNA function. In some embodiments, the DFL binds the protein complex. In some embodiments, the DFL binds one or more RBPs that are part of the protein complex. Binding of one or more RBPs is expected to bring the complete protein complex in proximity to the target RNA. In some embodiments, the DFL binds the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex, or an RBP that is a member of theCCR4-NOT complex. The CCR4-NOT complex is a large and highly conserved multifunctional assembly of proteins involved in different aspects of mRNA metabolism. Without wishing to be bound by theory, it is believed that the CCR4-NOT complex plays a role in deadenylation- dependent mRNA turnover. RBPs that are part of the CCR4-NOT complex include CNOT1, CNOT2, CNOT3, CNOT6, CNOT6L, CNOT7, CNOT8, CNOT9, CNOT10 and CNOT11. The function of the CCR4-NOT complex and each of the RBPs that make up the complex is discussed for instance in Shirai et al. Multifunctional roles of the mammalian CCR4-NOT complex in physiological phenomena, Frontiers in Genetics, 2014, 5, Article 286, which is incorporated by reference. CNOT9

[0217] In some embodiments, the DFL binds to or recruits CNOT9. In some embodiments, a disclosed compound or composition comprises a small molecule CNOT9 ligand as the DFL. Without wishing to be bound by theory, it is believed that CNOT9 is a core protein of the CCR4- NOT complex. It is thought to either directly, or in conjunction with other members of the CCR4- NOT complex, induce degradation of the target RNA (e.g., through deadenylation). CNOT9 is widely expressed in the human body.

[0218] In some embodiments, the disclosure provides compounds that bind CNOT9, but that do not bind the active site of CNOT9 or a site of CNOT9 that allows CNOT9 to bind to other members of the CCR4-NOT complex. In some embodiments, the disclosure provides compounds and compositions thereof, wherein the DFL binds CNOT9 without abrogating the enzymatic activity of the CNOT9 and / or the CCR4-NOT complex. By binding CNOT9 on a site other thanthe active site, or site that allows CNOT9 to bind to other members of the CCR4-NOT complex,the bound CNOT9 and the CCR4-NOT will maintain its capacity to act and / or degrade RNA.Thus, the compositions provided herein, in one embodiment, can bring CNOT9 in the proximityof the target RNA, by binding both the target RNA and CNOT9, and allow the CNOT9 to act onthe Target RNA (e.g., degrade it), through its ability to bring the CCR4-NOT complex in close proximity to the target RNA.

[0219] In any of the compositions, compounds and methods provided herein, in someembodiments, the compositions or compounds bind or interact with target RNA, and the targetRNA transcript is an mRNA or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. In any of the compositions, compounds and methods provided herein,in some embodiments, the compositions or compounds bind or interact with target RNA, and the target RNA transcript is selected from one of those listed in Table C or D; or a precursor, isoform,unspliced isoform, splicing intermediate, fragment, or mutant thereof. In any of the compositions,compounds and methods provided herein, in some embodiments, the compositions and compounds include an rSM that binds a target RNA. In any of the compositions, compounds and methods provided herein, in some embodiments, the rSM is selected from any one of those described in thesection entitled exemplary rSMs. In any of the compositions, compounds and methods providedherein, in some embodiments, the rSM is one of those shown in Table 2.

[0220] In any of the compositions, compounds and methods provided herein, in some embodiments, the composition is a pharmaceutical composition. In any of the compositions,compounds and methods provided herein, in some embodiments, the pharmaceutical compositionincludes any of the compounds or compositions provided herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0221] In one aspect, the present invention provides methods and compositions for the diagnosis and prognosis of cellular proliferative disorders (e.g., cancer) and the treatment of these disorders by modulating (e.g., degrading) a target RNA transcript. Cellular proliferative disorders described herein include, e.g., cancer, obesity, and proliferation-dependent diseases. Such disorders may be diagnosed using methods known in the art.

[0222] In one aspect, the present invention provides methods and compositions for the treatment of cancer by modulating (e.g., degrading) a target RNA transcript. In some embodiments, the cancer is driven or characterized by the overexpression of a protein (e.g. an oncogenic protein) and the cancer is treated by modulating (e.g. degrading) a target RNA transcriptthat corresponds to the overexpressed protein. In one aspect, the present invention providesmethods and compositions for the treatment of cancer.

[0223] It should be appreciated that the compositions, compounds and methods provided herein allow for the modulation of the amount of target RNA and thereby the modulation of the amount of protein, or levels of protein that are expressed from the target RNA. Thus, in someembodiments, the disclosure provides compositions and compounds for methods of modifying theamount of a protein in a cell. In some embodiment, those methods include administering any ofthe compositions or compounds provided herein, or a pharmaceutically acceptable salt thereof,that acts on a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, in anamount sufficient to modify the amount of the protein in the cell. In some embodiments, modifyingthe amount of a protein in a cell includes or equals reducing the amount of protein in the cell.

[0224] It should be appreciated that the compositions, compounds and methods providedherein allow for modulating the availability for protein translation of a target RNA transcript or aprecursor, isoform, fragment, or mutant thereof. Thus, in some embodiments, the disclosureprovides compositions and compounds for methods of modulating the availability for proteintranslation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof. In someembodiment, those methods include contacting the target RNA transcript or a precursor, isoform,fragment, or mutant thereof with any of the compounds or compositions provided herein or a pharmaceutically acceptable salt thereof, that binds to the target RNA transcript or an isoform, fragment, or mutant thereof.

[0225] It should be appreciated that the compositions, compounds and methods provided herein allow for modulating the translation of a target protein or mutant thereof. Thus, in some embodiments, the disclosure provides compositions and compounds for methods that include contacting a target RNA transcript or a precursor, isoform, fragment, or mutant thereof with any of the compounds or compositions provided herein or a pharmaceutically acceptable salt thereof.

[0226] It should be appreciated that the compositions, compounds and methods provided herein allow for decreasing the half-life or increasing degradation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof. Thus, in some embodiments, the disclosure provides compositions and compounds for methods that include contacting the target RNA transcript or the precursor, isoform, fragment, or mutant thereof with any of the compounds or compositions provided herein or a pharmaceutically acceptable salt thereof. Linkers

[0227] As defined generally above, the linker, -L1-, in the formulae described herein is abivalent group that connects the rSM, or RNA Binder to the ligand for the decay factor ligand(DFL). In some embodiments, e.g., for compounds of Formula I and embodiments thereof, -L1- isa covalent bond or a bivalent C1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O- , -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH2CH2O-.

[0228] In some embodiments, -L1- is a covalent bond. In some embodiments, -L1- is a C1-20straight or branched hydrocarbon chain. In some embodiments, -L1- is a C1-20 straight or branchedhydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, -L1- is a C1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, - (R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH2CH2O-.

[0229] In some embodiments, -L1- is a C1-18, C1-16, C1-14, C1-12, C1-10, C1-8, C1-6, C1-4, C1-2, C2-18, C2-16, C2-14, C2-12, C2-10, C2-8, C2-6, C2-4, C3-18, C3-16, C3-14, C3-12, C3-10, C3-8, C3-6, C3-4, C4-18, C4-16, C4-14, C4-12, C4-10, C4-8, C4-6, C4-5, C5-18, C5-16, C5-14, C5-12, C5-10, C5-8, C5-6, or C18, C17, C16, C15,C14, C13, C12, C11, C10, C9, C8, C7, C6, C5, C4, C3, or C2 straight or branched hydrocarbon chain. Insome embodiments, -L1- is a C1-18, C1-16, C1-14, C1-12, C1-10, C1-8, C1-6, C1-4, C1-2, C2-18, C2-16, C2-14,C2-12, C2-10, C2-8, C2-6, C2-4, C3-18, C3-16, C3-14, C3-12, C3-10, C3-8, C3-6, C3-4, C4-18, C4-16, C4-14, C4-12,C4-10, C4-8, C4-6, C4-5, C5-18, C5-16, C5-14, C5-12, C5-10, C5-8, C5-6, or C18, C17, C16, C15, C14, C13, C12,C11, C10, C9, C8, C7, C6, C5, C4, C3, or C2 straight or branched hydrocarbon chain wherein 1, 2, or3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH2CH2O-.

[0230] In some embodiments, one methylene unit of -L1- is replaced with -CH2CH2O-. Insome embodiments, two methylene units of -L1- are replaced with -CH2CH2O-. In someembodiments, three methylene units of -L1- are replaced with -CH2CH2O-. In some embodiments,four, five, six, seven, eight, nine, or ten methylene units of -L1- are replaced with -CH2CH2O-.H O N N O O isN isrSMLom .

[0233] In some embodiments, -L1- is a covalent bond or a C1-8bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-. In some embodiments, -L1- is a covalent bond or a bivalent, saturated or unsaturated, straight or branched, optionally substitutedC1-50 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L1- areindependently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, - O q ,, an 8-12 membered bicyclic arylenyl, a 3-8 membered saturated or partially unsaturated carbocyclylenyl, an 8-12 membered bicyclic saturated or partially unsaturated carbocyclylenyl, a 3-8 membered saturated or partially unsaturated heterocyclylenyl having 1- 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-12 membered bicyclic saturated or partially unsaturated heterocyclylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered heteroarylenyl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroarylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; wherein each q is independently 1, 2, or 3.

[0234] In some embodiments, -L1- is a covalent bond. In some embodiments, -L1- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L1- are independently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, - S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, - N(R)C(S)N(R)-, -Si(R)2-, -Si(OH)(R)-, -Si(OH)2-, -P(O)(OR)-, -P(O)(R)-, -P(O)(N(R)2)-, anN O O N amino acid, q .

[0235] ched,optionally substituted C1-50, C1-40, C1-30, C1-20, C1-15, C1-10, C1-5, C2-50, C2-40, C2-30, C2-20, C2-15, C2- 10, C3-50, C3-40, C3-30, C3-20, C3-15, C3-10, C4-50, C4-40, C4-30, C4-20, C4-15, C4-10, C5-50, C5-40, C5-30, C5-20, C5-15, C5-10, C6-50, C6-40, C6-30, C6-20, C6-15, C7-50, C7-40, C7-30, C7-20, C7-15, C8-50, C8-40, C8-30, C8-20, C8-15, C10-50, C10-40, C10-30, C10-20, C10-15, C12-50, C12-40, C12-30, C12-20, C15-50, C15-40, C15-30, C15-20, C20-50, C20-40, or C20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of L1are independently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, - N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, -Si(OH)(R)-, -Si(OH)2-, -P(O)(OR)-, -P(O)(R)-, - N , or, , , g ed, optionally substituted C1-50, C1-40, C1-30, C1-20, C1-15, C1-10, C1-5, C2-50, C2-40, C2-30, C2-20, C2-15, C2-10, C3-50, C3-40, C3-30, C3-20, C3-15, C3-10, C4-50, C4-40, C4-30, C4-20, C4-15, C4-10, C5-50, C5-40, C5-30, C5-20, C5-15, C5-10, C6-50, C6-40, C6-30, C6-20, C6-15, C7-50, C7-40, C7-30, C7-20, C7-15, C8-50, C8-40, C8-30, C8-20, C8-15, C10-50, C10-40, C10-30, C10-20, C10-15, C12-50, C12-40, C12-30, C12-20, C15-50, C15-40, C15-30, C15-20, C20-50, C20-40, or C20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L1- are independently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, - Si(OH)(R)-, -Si(OH)2-, -P(O)(OR)-, -P(O)(R)-, -P(O)(NR2)-, an amino acid q ,N O O N N N q ed,optionally substituted C1-50, C1-40, C1-30, C1-20, C1-15, C1-10, C1-5, C2-50, C2-40, C2-30, C2-20, C2-15, C2- 10, C3-50, C3-40, C3-30, C3-20, C3-15, C3-10, C4-50, C4-40, C4-30, C4-20, C4-15, C4-10, C5-50, C5-40, C5-30, C5-20, C5-15, C5-10, C6-50, C6-40, C6-30, C6-20, C6-15, C7-50, C7-40, C7-30, C7-20, C7-15, C8-50, C8-40, C8-30, C8-20, C8-15, C10-50, C10-40, C10-30, C10-20, C10-15, C12-50, C12-40, C12-30, C12-20, C15-50, C15-40, C15-30, C15-20, C20-50,C20-40, or C20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, or 8 methylene units of -L1- areindependently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)C(O)-, O O q , or 14, nts,N N N N N O . s, -L1- comprisesat least one unsaturated pair of carbon atoms, i.e., at least one double or triple carbon-carbon bond. In some embodiments, -L1- comprises 1, 2, 3, 4, or 5 double or triple carbon-carbon bonds. In some embodiments, -L1- is a straight hydrocarbon chain wherein methylene units of -L1- areoptionally replaced or substituted as described above. In some embodiments, -L1- is a saturated,straight hydrocarbon chain wherein methylene units of -L1- are optionally replaced or substituted as described above.

[0240] In some embodiments, -L1- is substituted with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 “optional substituents” as defined herein. In some embodiments, each substituent is independently selected from deuterium, halogen, -CN, -OR, -N(R)2, -SR, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl optionally substituted with one or more C1-4alkyl, -CO2R, -OR, -CON(R)2, -N(R)2, or halogen, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen,oxygen, or sulfur, an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatomsindependently selected from nitrogen, oxygen, or sulfur, or a C1-6aliphatic group optionally substituted with -CN, -OR, -N(R)2, -SR, a 3-8 membered saturated or partially unsaturatedmonocyclic carbocyclic ring, phenyl optionally substituted with one or more C1-4 alkyl, -CO2R, -OR, -CON(R)2, -N(R)2, or halogen, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or the C1-6 aliphatic is optionally substituted with 1, 2, 3, 4, 5, or 6 deuterium or halogen atoms; or two substituents attached to the same carbon atom, taken together with the carbon atom to which they are attached, form a 3-6 membered saturated monocyclic carbocyclic ring or 3-6 membered saturated heterocyclic ring having 1-2 heteroatomsindependently selected from nitrogen, oxygen, or sulfur.

[0241] As described above, in some embodiments, a methylene unit of L1is replaced with an amino acid. The amino acid may be naturally-occurring or non-naturally occurring. In some embodiments, the amino acid is selected from a non-polar or branched chain amino acid (BCAA). In some embodiments, the amino acid is selected from valine, isoleucine, leucine, methionine, alanine, proline, glycine, phenylalanine, tyrosine, tryptophan, histidine, asparagine, glutamine, serine threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, cysteine, selenocysteine, or tyrosine. In some embodiments, the amino acid is an L-amino acid. In some embodiments, the amino acid is a D-amino acid. O O or

[0243] In some embodiments, -L - is selected from one of those depicted in Table 3, below. Table 3: Exemplary Linkers H H N O O NH H N O N O O OH N N OO H N N OF O H N O O O O NH N O O OO H N OO O O O OO H NH H N N O O O N HH F N O O N NH F N O O O O O OO O N HH NNNNNHH NH N OH N HO H N O O O O O OH N O OH O N N O HO NNN NO NNNO N N H HHNOO O OH NSiO NN NN ONO O N N N NO H N O OO NNO NNH O O N O O

[0244] , p , hown above. Definitions

[0245] As used herein, a “nucleoside” refers to a molecule consisting of a guanine (G), adenine (A), thymine (T), uridine (U), or cytidine (C) base covalently linked to a pentose sugar, whereas “nucleotide” or “mononucleotide” refers to a nucleoside phosphorylated at one of the hydroxyl groups of the pentose sugar. “Nucleoside” also encompasses analogs of G, A, T, C, or U and natural or non-natural nucleic acid components wherein the base, sugar, and / or phosphatebackbone have been modified or replaced. Nucleoside analogs are known in the art and includethose described herein. Also included are endogenous, post-transcriptionally modified nucleosides, such as methylated nucleosides.

[0246] - -end) because, except with respect to adenylation (as described elsewhere herein), mononucleotides are joined in one direction via a phosphodiester linkage (or analog thereof) to mononucleotide. Therefore, an end of an oli subsequent mononucleotide sugar. A “terminal nucleotide,” as used herein, is the nucleotide at or 5 terminus may alternatively end in a -OH or5 -OH if the terminal nucleotide is not phosphorylated.

[0247] As used herein, the term “nucleic acid” refers to a covalently linked sequence ofin which the nucleotides are linked in specific sequence; i.e., a linear order of nucleotides. “Nucleic acid” includes analogs of the foregoing wherein one or more nucleotides are modified at the base, sugar, or phosphodiester. Such analogs are known in the art and include those describedelsewhere herein. As used herein, “polynucleotide” or “polynucleic acid” refers to a long nucleicacid sequence (or analog thereof) of many nucleotides. For example, but without limitation, a polynucleotide (or polynucleic acid) may be greater than 60, 61-1,000, or 201-1,000, or greaterthan 1,000 nucleotides in length. As used herein, an “oligonucleotide” or “oligonucleic acid” is ashort polynucleotide or a portion of a polynucleotide. For example, but without limitation, an oligonucleotide may be between 5-10, 10-60, or 10-200 nucleotides in length.

[0248] In some embodiments, a nucleic acid, oligonucleotide, or polynucleotide consists of, -deoxyribonucleotides (DNA) or ribonucleotides (RNA). In -deoxyribonucleotides (DNA). In some embodiments, the oligonucleotide consists of or comprises ribonucleotides (RNA). In some embodiments, the oligonucleotide is a DNA-RNA hybrid, such as a DNA sequence ofcontiguous nucleotides linked to an RNA sequence of contiguous nucleotides, or with someregions of RNA and some regions of DNA.

[0249] As used herein, the term “RNA-mediated” in reference to RNA-mediated disorders,diseases, and / or conditions means any disease or other deleterious condition in which RNA, such as an overexpressed, underexpressed, mutant, misfolded, expanded, pathogenic, or oncogenic RNA, is known to play a role.

[0250] Compounds of the present invention include those described generally herein, and are further illustrated by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this invention, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd. Additionally, general principles of organic chemistry are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999, and March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons: 2013; the entire contents of each of which are hereby incorporated by reference.

[0251] The term “aliphatic” or “aliphatic group,” as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle,” “cycloaliphatic” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic C3-C6hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Suitablealiphatic groups include, but are not limited to, linear or branched, substituted or unsubstitutedalkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0252] As used herein, the term “bicyclic ring” or “bicyclic ring system” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, having one or more atoms in common between the two rings of the ring system. Thus, the term includes any permissible ring fusion, such as ortho-fused or spirocyclic. As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring membersand 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, theterm “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one bridge. As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ringmembers and 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups. Additionally, or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bicyclic rings include: O HNNH NH NH

[0254] y - g y g up. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0255] The term “lower haloalkyl” refers to a C1-4straight or branched alkyl group that is substituted with one or more halogen atoms.

[0256] The term “heteroatom” means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternizedform of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR+(as in N-substituted pyrrolidinyl)).

[0257] The term “unsaturated,” as used herein, means that a moiety has one or more units of unsaturation.

[0258] As used herein, the term “bivalent C1-8(or C1-6) saturated or unsaturated, straight or branched, hydrocarbon chain,” refers to bivalent alkylene, alkenylene, and alkynylene chains that are straight or branched as defined herein.

[0259] The term “alkylene” refers to a bivalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., –(CH2)n–, wherein n is a positive integer, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.

[0260] The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.

[0261] The term “halogen” means F, Cl, Br, or I.

[0262] The term “aryl” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic or bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present invention, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.

[0263] The terms “heteroaryl” and “heteroar–,” used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 electrons shared in a cyclic array; and having, in addition tocarbon atoms, from one to five heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms “heteroaryl” and “heteroar–,” as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H–quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted with a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0264] As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are used interchangeably and refer to a stable 5– to 7-membered monocyclic or 7–10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term “nitrogen” includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0–3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4– dihydro–2H–pyrrolyl), NH (as in pyrrolidinyl), or+NR (as in N–substituted pyrrolidinyl).

[0265] A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclicmoiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H–indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl groupmay be mono– or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted witha heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.

[0266] As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass ringshaving multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, asherein defined.

[0267] As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent (“optional substituent”) at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are preferably those that result in the formation ofstable or chemically feasible compounds. The term “stable,” as used herein, refers to compoundsthat are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

[0268] Suitable monovalent substituents on a substitutable carbon atom of an “optionallysubstituted” group are independently halogen; –(CH2)0–4R ; –(CH2)0–4OR ; -O(CH2)0-4Ro, –O–(CH2)0–4C(O)OR°; –(CH2)0–4CH(OR )2; –(CH2)0–4SR ; –(CH2)0–4Ph, which may be substitutedwith R°; –(CH2)0–4O(CH2)0–1Ph which may be substituted with R°; –CH=CHPh, which may be substituted with R°; –(CH2)0–4O(CH2)0–1-pyridyl which may be substituted with R°; –NO2; –CN;–N3; -(CH2)0–4N(R )2; –(CH2)0–4N(R )C(O)R ; –N(R )C(S)R ; –(CH2)0–4N(R )C(O)NR 2; -N(R )C(S)NR 2; –(CH2)0–4N(R )C(O)OR ; –N(R )N(R )C(O)R ; -N(R )N(R )C(O)NR 2; -N(R )N(R )C(O)OR ; –(CH2)0–4C(O)R ; –C(S)R ; –(CH2)0–4C(O)OR ; –(CH2)0–4C(O)SR ; -(CH2)0–4C(O)OSiR 3; –(CH2)0–4OC(O)R ; –OC(O)(CH2)0–4SR–, SC(S)SR°; –(CH2)0–4SC(O)R ; –(CH2)0–4C(O)NR 2; –C(S)NR 2; –C(S)SR°;–SC(S)SR°, -(CH2)0–4OC(O)NR 2; -C(O)N(OR )R ; –C(O)C(O)R ; –C(O)CH2C(O)R ; –C(NOR )R ; -(CH2)0–4SSR ; –(CH2)0–4S(O)2R ; –(CH2)0–4S(O)2OR ; –(CH2)0–4OS(O)2R ; –S(O)2NR 2; -(CH2)0–4S(O)R ; -N(R )S(O)2NR 2; –N(R )S(O)2R ; –N(OR )R ; –C(NH)NR 2; –P(O)2R ; -P(O)R 2; -OP(O)R 2; –OP(O)(OR )2; SiR 3; –(C1–4 straight or branched alkylene)O–N(R )2; or –(C1–4 straight or branched alkylene)C(O)O–N(R )2, wherein each R may besubstituted as defined below and is independently hydrogen, C1–6 aliphatic, –CH2Ph, –O(CH2)0–1Ph, -CH2-(5-6 membered heteroaryl ring), or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or,notwithstanding the definition above, two independent occurrences of R , taken together with theirintervening atom(s), form a 3–12–membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, which may be substituted as defined below.

[0269] Suitable monovalent substituents on R (or the ring formed by taking two independentoccurrences of R together with their intervening atoms), are independently halogen, –(CH2)0–2R ,–(haloR ), –(CH2)0–2OH, –(CH2)0–2OR , –(CH2)0–2CH(OR )2; -O(haloR ), –CN, –N3, –(CH2)0–2C(O)R , –(CH2)0–2C(O)OH, –(CH2)0–2C(O)OR , –(CH2)0–2SR , –(CH2)0–2SH, –(CH2)0–2NH2, –(CH2)0–2NHR , –(CH2)0–2NR 2, –NO2, –SiR 3, –OSiR 3, -C(O)SR , –(C1–4 straight or branchedalkylene)C(O)OR , or –SSR wherein each R is unsubstituted or where preceded by “halo” issubstituted only with one or more halogens, and is independently selected from C1–4 aliphatic, – CH2Ph, –O(CH2)0–1Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0– 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalentsubstituents on a saturated carbon atom of R include =O and =S.

[0270] Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =O, =S, =NNR*2, =NNHC(O)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =NOR*, –O(C(R*2))2–3O–, or –S(C(R*2))2–3S–, wherein each independent occurrence of R*is selected from hydrogen, C1–6 aliphatic which may be substituted as defined below, or an unsubstituted 5–6-membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: –O(CR*2)2–3O–, wherein each independent occurrence of R*is selected from hydrogen, C1–6aliphatic which may be substituted as defined below, or an unsubstituted 5–6-membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0271] Suitable substituents on the aliphatic group of R* include halogen, –R , -(haloR ), -OH,–OR , –O(haloR ), –CN, –C(O)OH, –C(O)OR , –NH2, –NHR , –NR 2, or –NO2, wherein eachR is unsubstituted or where preceded by “halo” is substituted only with one or more halogens,and is independently C1–4 aliphatic, –CH2Ph, –O(CH2)0–1Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0272] Suitable substituents on a substitutable nitrogen of an “optionally substituted” group include –R†, –NR†2, –C(O)R†, –C(O)OR†, –C(O)C(O)R†, – C(O)CH2 R†R†R†– R†– H R†– R†R†; wherein each R†ined below,unsubstituted –OPh, or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R†, taken together with their intervening atom(s) form an unsubstituted 3–12-membered saturated, partially unsaturated, or arylmono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, andsulfur.

[0273] Suitable substituents on the aliphatic group of R†are independently halogen, –R , -(haloR ), –OH, –OR , –O(haloR ), –CN, –C(O)OH, –C(O)OR , –NH2, –NHR , –NR 2,or -NO2, wherein each R is unsubstituted or where preceded by “halo” is substituted only withone or more halogens, and is independently C1–4aliphatic, –CH2Ph, –O(CH2)0–1Ph, or a 5–6- membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0274] As used herein, the term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describe pharmaceutically acceptable salts indetail in J. Pharmaceutical Sciences, 1977, 66, 1–19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acidssuch as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acidor by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2– naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3–phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p–toluenesulfonate, undecanoate, valerate salts, and the like.

[0275] Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C1–4alkyl)4salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, andamine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate,nitrate, loweralkyl sulfonate and aryl sulfonate.

[0276] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of thestructure; for example, the R and S configurations for each asymmetric center, Z and E doublebond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or thereplacement of a carbon by a13C- or14C-enriched carbon are within the scope of this invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention.

[0277] As used herein, the term “binder” or “ligand” is defined as a compound that binds to atarget RNA transcript or decay factor (e.g., nuclease) or RBP with measurable affinity. In certainembodiments, a binder has an IC50 and / or binding constant of less than about 50 M, less thanabout 1 M, less than about 500 nM, less than about 100 nM, less than about 10 nM, or less than about 1 nM.

[0278] A compound of the present invention may be tethered to a detectable moiety. It will be appreciated that such compounds are useful as imaging agents. One of ordinary skill in the art willrecognize that a detectable moiety may be attached to a provided compound via a suitablesubstituent. As used herein, the term “suitable substituent” refers to a moiety that is capable of covalent attachment to a detectable moiety. Such moieties are well known to one of ordinary skill in the art and include groups containing, e.g., a carboxylate moiety, an amino moiety, a thiol moiety, or a hydroxyl moiety, to name but a few. It will be appreciated that such moieties may be directly attached to a provided compound or via a tethering group, such as a bivalent saturated or unsaturated hydrocarbon chain. In some embodiments, such moieties may be attached via click chemistry. In some embodiments, such moieties may be attached via a 1,3-cycloaddition of an azide with an alkyne, optionally in the presence of a copper catalyst. Methods of using click chemistry are known in the art and include those described by Rostovtsev et al., Angew. Chem. Int. Ed.2002, 41, 2596-99 and Sun et al., Bioconjugate Chem., 2006, 17, 52-57.

[0279] As used herein, the term “detectable moiety” is used interchangeably with the term “label” and relates to any moiety capable of being detected, e.g., primary labels and secondary labels. Primary labels, such as radioisotopes (e.g., tritium,32P,33P,35S, or14C), mass-tags, and fluorescent labels are signal generating reporter groups which can be detected without further modifications. Detectable moieties also include luminescent and phosphorescent groups.

[0280] The term “secondary label” as used herein refers to moieties such as biotin and various protein antigens that require the presence of a second intermediate for production of a detectable signal. For biotin, the secondary intermediate may include streptavidin-enzyme conjugates. For antigen labels, secondary intermediates may include antibody-enzyme conjugates. Some fluorescent groups act as secondary labels because they transfer energy to another group in theprocess of nonradiative fluorescent resonance energy transfer (FRET), and the second group produces the detected signal.

[0281] The terms “fluorescent label,” “fluorescent dye”, and “fluorophore” as used herein refer to moieties that absorb light energy at a defined excitation wavelength and emit light energy at a different wavelength. Examples of fluorescent labels include, but are not limited to: Alexa Fluor dyes (Alexa Fluor 350, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 660 and Alexa Fluor 680), AMCA, AMCA-S, BODIPY dyes (BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR, BODIPY 530 / 550, BODIPY 558 / 568, BODIPY 564 / 570, BODIPY 576 / 589, BODIPY 581 / 591, BODIPY 630 / 650, BODIPY 650 / 665), Carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), Cascade Blue, Cascade Yellow, Coumarin 343, Cyanine dyes (Cy3, Cy5, Cy3.5, Cy5.5), Dansyl, Dapoxyl, Dialkylaminocoumarin, 4’,5’-Dichloro-2’,7’-dimethoxy-fluorescein, DM-NERF, Eosin, Erythrosin, Fluorescein, FAM, Hydroxycoumarin, IRDyes (IRD40, IRD 700, IRD 800), JOE, Lissamine rhodamine B, Marina Blue, Methoxycoumarin, Naphthofluorescein, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, PyMPO, Pyrene, Rhodamine B, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Rhodol Green, 2’,4’,5’,7’-Tetra-bromosulfone- fluorescein, Tetramethyl-rhodamine (TMR), Carboxytetramethylrhodamine (TAMRA), Texas Red, Texas Red-X.

[0282] The term “mass-tag” as used herein refers to any moiety that is capable of being uniquely detected by virtue of its mass using mass spectrometry (MS) detection techniques. Examples of mass-tags include electrophore release tags such as N-[3-[4’-[(p- Methoxytetrafluorobenzyl)oxy]phenyl]-3-methylglyceronyl]isonipecotic Acid, 4’-[2,3,5,6- Tetrafluoro-4-(pentafluorophenoxyl)]methyl acetophenone, and their derivatives. The synthesis and utility of these mass-tags is described in United States Patents 4,650,750, 4,709,016, 5,360,8191, 5,516,931, 5,602,273, 5,604,104, 5,610,020, and 5,650,270. Other examples of mass- tags include, but are not limited to, nucleotides, dideoxynucleotides, oligonucleotides of varying length and base composition, oligopeptides, oligosaccharides, and other synthetic polymers of varying length and monomer composition. A large variety of organic molecules, both neutral and charged (biomolecules or synthetic compounds) of an appropriate mass range (100-2000 Daltons) may also be used as mass-tags.

[0283] The term “RNA” (ribonucleic acid) as used herein, means a naturally-occurring or synthetic oligo- or polyribonucleotide independent of source (e.g., the RNA may be produced by a human, animal, plant, virus, or bacterium, or may be synthetic in origin), biological context (e.g., the RNA may be in the nucleus, circulating in the blood, in vitro, cell lysate, or isolated or pure form), or physical form (e.g., the RNA may be in single-, double-, or triple-stranded form (including RNA-DNA hybrids), may include epigenetic modifications, native post-transcriptionalmodifications, artificial modifications (e.g., obtained by chemical or in vitro modification), orother modifications, may be bound to, e.g., metal ions, small molecules, protein chaperones, or co- factors, or may be in a denatured, partially denatured, or folded state including any native or unnatural secondary or tertiary structure such as junctions (e.g., cis or trans three-way junctions (3WJ)), quadruplexes, hairpins, triplexes, hairpins, bulge loops, pseudoknots, and internal loops, etc., and any transient forms or structures adopted by the RNA). In some embodiments, the RNA is 100 or more nucleotides in length. In some embodiments, the RNA is 250 or more nucleotides in length. In some embodiments, the RNA is 350, 450, 500, 600, 750, or 1,000, 2,000, 3,000, 4,000, 5,000, 7,500, 10,000, 15,000, 25,000, 50,000, or more nucleotides in length. In some embodiments, the RNA is between 250 and 1,000 nucleotides in length. In some embodiments, the RNA is a pre- RNA, pre-miRNA, or pretranscript. In some embodiments, the RNA is a non-coding RNA (ncRNA), messenger RNA (mRNA), micro-RNA (miRNA), a ribozyme, riboswitch, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, pseudo-gene, viral RNA, or bacterial RNA. The term “target RNA” as used herein, means any type of RNA having or capable of adopting a secondary or tertiary structure that is capable of binding a small molecule ligand described herein. The target RNA may be inside a cell, in a cell lysate, or in isolated form prior to contacting the small molecule. Targeting RNA Transcripts with Compounds of the Present Invention

[0284] In one aspect, the present invention provides a method of modulating the activity of a target RNA transcript or an isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or an isoform, fragment, or mutant thereof with a disclosed compound or a pharmaceutically acceptable salt thereof that binds to the target RNA transcript or an isoform, fragment, or mutant thereof.

[0285] In another aspect, the present invention provides a method of modulating the activityof a target protein or mutant thereof, comprising contacting a corresponding target RNA transcriptor an isoform, fragment, or mutant thereof with a disclosed compound or a pharmaceuticallyacceptable salt thereof that binds to the target RNA transcript or an isoform, fragment, or mutant thereof.

[0286] In one aspect, the present invention provides a method of decreasing the half-life orincreasing degradation of a target RNA transcript or an isoform, fragment, or mutant thereof,comprising contacting the target RNA transcript or an isoform, fragment, or mutant thereof with adisclosed compound that binds to the target RNA transcript or an isoform, fragment, or mutantthereof.

[0287] In some embodiments, translation of the target RNA transcript is decreased or inhibited, e.g., by decreasing the half-life of the transcript. In some embodiments, production of the corresponding functional protein or a mutant thereof is decreased or inhibited.

[0288] In some embodiments, the administration of a compound or composition provided herein results in decrease or inhibition of the production of a functional protein or a mutant thereof. In some embodiments, the production of a functional protein or a mutant thereof is decreased by at least 10%, at least 20%, at least 30%, at least 40%, at least 25%, at least 60%, at least 70%, at least 80%, at least 90%, or is no longer produced at detectable levels.

[0289] In some embodiments, the activity of the target RNA transcript or an isoform, fragment, or mutant thereof is inhibited or decreased. In some embodiments, processing or splicing of thetarget RNA transcript or an isoform, fragment, or mutant thereof is inhibited.

[0290] In some embodiments, the target RNA is an mRNA, or a precursor, isoform, fragment, or mutant thereof. In some embodiments, inhibition of processing or splicing results in a decrease in levels of mature mRNA and / or protein. In some embodiments, the activity of the protein or mutant thereof is inhibited or decreased, e.g., due to a decreased level of the protein in a cell.

[0291] In some embodiments, the target RNA transcript comprises a functionally relevant fragment of a disease-causing RNA. A target RNA transcript or an isoform, fragment, or mutant thereof is “functionally relevant” if it includes at least a portion of a target RNA transcript that is ultimately transcribed and that is essential to producing a corresponding, disease-causing functional protein or mutant thereof.

[0292] In some embodiments, the target RNA transcript is a pre-mRNA, mature mRNA, or partially processed mRNA, or an isoform, fragment, or mutant thereof.

[0293] In some embodiments, the

[0294] In some embodiments, the RNA transcript comprises an open reading frame (ORF).

[0295] In some embodiments, the RNA transcript comprises

[0296] In some embodiments, the RNA transcript comprises tail).

[0297] In some embodiments, UTR, or an intron present in the RNA transcript.

[0298] In some embodiments, translation of the RNA transcript is reduced. In some embodiments, levels of protein encoded by the RNA transcript are decreased in a biological sample contacted with a disclosed compound or composition, such as a cell culture, or decreased in apatient treated with a disclosed compound or composition. In some embodiments, degradation ofthe RNA transcript is increased. In some embodiments, degradation of the RNA transcript is increased due to binding of the disclosed compound.

[0299] In one aspect, the present invention provides a method of identifying a compound that binds to a target RNA transcript or an isoform, fragment, or mutant thereof, comprising i) contacting the target RNA transcript or an isoform, fragment, or mutant thereof with a disclosed compound and ii) analyzing the results by an assay disclosed herein, optionally in combination with a computational method. In some embodiments, the method comprises the use of an SEC- MS, SPR, or DEL screen to identify the compound.

[0300] In another aspect, the present invention provides a method of treating an RNA- mediated disease, disorder, or condition (which includes any protein-mediated disease, disorder or condition) in a patient in need thereof, comprising administering to the patient an effective amount of a disclosed compound or a pharmaceutically acceptable salt thereof. In some embodiments, the disease, disorder, or condition is a proliferative disorder, such as a cancer.

[0301] A variety of RNA transcripts are appropriate as target RNA transcripts for use in the present invention. In some embodiments, the target RNA transcript is selected from one of those in Table A, Table B, Table C, or Table D below, or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof.

[0302] In some embodiments, the target RNA transcript is single-stranded. In some embodiments, the target RNA transcript is double-stranded or partially double-stranded. In some embodiments, the target RNA is a pair of nucleic acids engaged in an interaction, such as amiRNA-mRNA hybridized (or partially hybridized) pair. In some embodiments, the target RNA comprises one, two, or more miRNAs bound to an mRNA. In some embodiments, the target RNA is an mRNA, miRNA, premiRNA, or a viral or fungal RNA.

[0303] In some embodiments, the target RNA transcript includes structural features such as atleast some intramolecular base pairing, a junction (e.g., cis or trans three-way junctions (3WJ)),quadruplex, hairpin, triplex, bulge loop, pseudoknot, or internal loop, etc., and any transient forms or structures adopted by the nucleic acid. In some embodiments, the target RNA transcript includes a bound protein, such as a chaperone, RNA-binding protein (RBP), or other nucleic acid- binding protein.

[0304] Target RNA transcripts of various lengths are target RNA transcripts within the scope of the present invention. For example, the target RNA may be from 20-10,000 nucleotides in length. In some embodiments, the target RNA is a relatively short sequence of, e.g., less than 250, less than 100, or less than 50 nucleotides in length. In some embodiments, the target RNA is 100 or more nucleotides in length. In some embodiments, the target RNA is 250 or more nucleotides in length. In some embodiments, the target RNA is up to about 350, 450, 500, 600, 750, or 1,000, 2,000, 3,000, 4,000, 5,000, 7,500, 10,000, 15,000, 25,000, 50,000, or more than 50,000 nucleotides in length. In some embodiments, the target RNA is between about 30 and about 500 nucleotides in length. In some embodiments, the target RNA is between about 250 and about 1,000 nucleotides in length. In some embodiments, the target RNA is between about 20-50, 30-60, 40-70, 50-80,20-100, 30-100, 40-100, 50-100, 20-200, 30-200, 40-200, 50-200, 20-300, 50-300, 75-300, 100-300, 20-400, 50-400, 100-400, 200-400, 20-500, 50-500, 100-500, 250-500, 20-750, 50-750, 100- 750, 250-750, 500-750, 20-1,000, 100-1,000, 250-1,000, 500-1,000, 20-2,000, 100-2,000, 500- 2,000, 1,000-2,000, 20-5,000, 100-5,000, 1,000-5,000, 20-10,000, 100-10,000, 1,000-10,000, or 20-25,000 nucleotides in length.

[0305] Where the target or other referenced nucleic acid is an RNA, “nucleotides” refers to ribonucleotides. Where the target or other referenced nucleic acid is DNA, “nucleotides” refers to -deoxyribonucleotides. In some embodiments, a target RNA comprises one or more nucleotide analogs (modified nucleotides) as defined herein and as known in the art.

[0306] In some embodiments, the target RNA is a pre-mRNA, pre-miRNA, pretranscript, partially spliced mRNA, fully spliced mRNA, fully spliced and partially processed mRNA, or a mature mRNA (i.e., fully spliced and processed mRNA).

[0307] In some embodiments, the RNA is a non-coding RNA (ncRNA), messenger RNA (mRNA), micro-RNA (miRNA), a ribozyme, riboswitch, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, rRNA, ceRNA, or pseudo-gene, wherein each of the foregoing may be selected from a human or non-human RNA, such as viral RNA, fungal RNA, or bacterial RNA. Targeting mRNA

[0308] In some embodiments, the target RNA transcript is an mRNA or a precursor to a mature mRNA; or an isoform, fragment, or mutant thereof. Within mRNAs, noncoding regions can affect the level of mRNA and protein expression. Briefly, these include internal ribosome entry sites(IRES) and upstream open reading frames (uORF) that affect translation efficiency, intronicaffect mRNA and protein localization, and elements that control mRNA decay and half-life. Therapeutic modulation of these RNA elements can have beneficial effects. Also, mRNAs may contain expansions of simple repeat sequences such as trinucleotide repeats. These repeat expansion containing RNAs can be toxic and have been observed to drive disease pathology, particularly in certain neurological and musculoskeletal diseases (see Gatchel & Zoghbi, NatureRev. Gen. 2005, 6, 743-755). Accordingly, in some embodiments, the present invention providesa method of degrading an mRNA that contains a toxic repeat expansion, or an isoform, fragment, or mutant thereof, comprising contacting the mRNA with a disclosed compound. The present invention further provides a method of treating a disease, disorder, or condition mediated by an mRNA that contains a toxic repeat expansion, or an isoform, fragment, or mutant thereof.

[0309] Additionally, in some embodiments, the expression of a target mRNA and its translation products is modulated structures are believed to play a critical role in translation of mRNA. One example of these are internal ribosome entry sites (IRES), which can affect the level of translation of the main open reading frame (Komar and Hatzoglou, Frontiers Oncol.5:233, 2015; Weingarten-Gabbay et al., Science 351, 4939, 2016; Calvo et al., Proc. Natl. Acad. Sci. USA 106:7507-7512; Le Quesne et al., J. Pathol. 220:140-151, 2010; Barbosa et al., PLOS Genetics 9:e10035529, 2013). Small molecules targeting these RNAs could be used to modulate specific protein levels for therapeuticbenefit. In some embodiments, the small molecule rSMentry site, or upstream open reading frame. Non-Coding RNA Transcripts

[0310] Non-coding RNAs regulate cellular biology directly through function of RNAstructures (e.g., ribonucleoproteins) as well as via regulating protein expression. These ncRNAs include (but are not limited to) miRNA, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA,ceRNA, and pseudo-genes. Drugs that intervene at this level have the potential of modulating anycellular process.

[0311] In some embodiments, the target RNA transcript is an RNA that is transcribed but not translated into protein, termed “non-coding RNA” or “ncRNA.” Non-coding RNA is highly conserved, and the many varieties of non-coding RNA play a wide range of regulatory functions. The term “non-coding RNA,” as used herein, includes but is not limited to micro-RNA (miRNA), long non-coding RNA (lncRNA), long intergenic non-coding RNA (lincRNA), Piwi-interacting RNA (piRNA), competing endogenous RNA (ceRNA), and pseudo-genes. Each of these sub- categories of non-coding RNA offers a large number of RNA targets with significant therapeutic potential. Accordingly, in some embodiments, the present invention provides methods of treating a disease mediated by a non-coding transcript. In some embodiments, the disease is caused by alncRNA, lincRNA, ceRNA, or pseudo-gene. In another aspect, the present invention provides amethod of producing a small molecule that modulates the activity of a target non-coding transcriptto treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to or degradation of the target non-coding transcript; and analyzing the results by anRNA binding assay disclosed herein. In some embodiments, the target non-coding transcript is alncRNA, lincRNA, ceRNA, or pseudo-gene.

[0312] In some embodiments, the target RNA transcript is an miRNA. miRNA are short double-strand RNAs that regulate gene expression (see Elliott & Ladomery, Molecular Biology of RNA, 2ndEd.). Each miRNA can affect the expression of many human genes. There are nearly 2,000 miRNAs in humans. These RNAs regulate many biological processes, including cell differentiation, cell fate, motility, survival, and function. miRNA expression levels vary between different tissues, cell types, and disease settings. They are frequently aberrantly expressed in tumors versus normal tissue, and their activity may play significant roles in cancer (for reviews,see Croce, Nature Rev. Genet. 10:704-714, 2009; Dykxhoorn Cancer Res. 70:6401-6406, 2010).miRNAs have been shown to regulate oncogenes and tumor suppressors and themselves can act as oncogenes or tumor suppressors. Some have been shown to promote epithelial-mesenchymaltransition (EMT) and cancer cell invasiveness and metastasis. In the case of oncogenic miRNAs,their inhibition could be an effective anti-cancer treatment. Accordingly, in one aspect, the present invention provides a method of producing a small molecule that modulates the activity of a targetmiRNA to treat a disease or disorder, comprising the steps of: screening one or more disclosedcompounds for binding to or degradation of the target miRNA; and analyzing the results by anRNA binding assay disclosed herein. In some embodiments, the miRNA regulates an oncogene or tumor suppressor, or acts as an oncogene or tumor suppressor. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor.

[0313] Beyond oncology, miRNAs play roles in many other diseases including cardiovascular and metabolic diseases (Quiant and Olson, J. Clin. Invest.123:11-18, 2013; Olson, Science Trans. Med.6: 239ps3, 2014; Baffy, J. Clin. Med.4:1977-1988, 2015).

[0314] Many mature miRNAs are relatively short in length and thus may lack sufficient folded, three-dimensional structure to be targeted by small molecules. However, it is believed that the levels of such miRNA could be reduced by small molecules that bind the primary transcript or the pre-miRNA to block the biogenesis of the mature miRNA. Accordingly, in some embodiments of the methods described above, the target miRNA is a primary transcript or pre-miRNA whose corresponding mature miRNA affects an oncogene or tumor suppressor, or which affects the levels or activity of a disease-causing RNA transcript or protein.

[0315] In some embodiments, the target RNA transcript is an lncRNA. lncRNA are RNAs of over 200 nucleotides (nt) that do not encode proteins (see Rinn & Chang, Ann. Rev. Biochem. 2012, 81, 145-166; (for reviews, see Morris and Mattick, Nature Reviews Genetics 15:423-437,2014; Mattick and Rinn, Nature Structural & Mol. Biol. 22:5-7, 2015; Iyer et al., Nature Genetics47(:199-208, 2015)). They can affect the expression of the protein-encoding mRNAs at the level of transcription, splicing and mRNA decay. Considerable research has shown that lncRNA can regulate transcription by recruiting epigenetic regulators that increase or decrease transcription by altering chromatin structure (e.g., Holoch and Moazed, Nature Reviews Genetics 16:71-84, 2015). lncRNAs are associated with human diseases including cancer, inflammatory diseases, neurological diseases and cardiovascular disease (for instance, Presner and Chinnaiyan, CancerDiscovery 1:391-407, 2011; Johnson, Neurobiology of Disease 46:245-254, 2012; Gutscher andDiederichs, RNA Biology 9:703-719, 2012; Kumar et al., PLOS Genetics 9:e1003201, 2013; vande Vondervoort et al., Frontiers in Molecular Neuroscience, 2013; Li et al., Int. J. Mol. Sci.14:18790-18808, 2013). In general, lncRNA are expressed at a lower level relative to mRNAs.Many lncRNAs are physically associated with chromatin (Werner et al., Cell Reports 12, 1-10,2015) and are transcribed in close proximity to protein-encoding genes. They often remainphysically associated at their site of transcription and act locally, in cis, to regulate the expression of a neighboring mRNA.

[0316] lncRNAs regulate the expression of protein-encoding genes, acting at multiple different levels to affect transcription, alternative splicing and mRNA decay. For example, lncRNA has been shown to bind to the epigenetic regulator PRC2 to promote its recruitment to genes whose transcription is then repressed via chromatin modification. lncRNA may form complex structures that mediate their association with various regulatory proteins. A small molecule that binds to these lncRNA structures could be used to modulate the expression of genes that are normally regulated by an individual lncRNA. Targeting Toxic RNA (Repeat RNA)

[0317] Simple repeats in mRNA often are associated with human disease. These are often, but not exclusively, repeats of three nucleotides such as CAG (“triplet repeats”) (for reviews, see Gatchel and Zoghbi, Nature Reviews Genetics 6:743-755, 2005; Krzyzosiak et al., Nucleic AcidsRes. 40:11-26, 2012; Budworth and McMurray, Methods Mol. Biol. 1010:3-17, 2013, herebyincorporated by reference). Triplet repeats are abundant in the human genome, and they tend toundergo expansion over generations. Approximately 40 human diseases are associated with theexpansion of repeat sequences. Diseases caused by triplet expansions are known as Triplet Repeat Expansion Diseases (TRED). Healthy individuals have a variable number of triplet repeats, but there is a threshold beyond which a higher repeat number causes disease. The threshold varies in different disorders. The triplet repeat can be unstable. As the gene is inherited, the number of repeats may increase, and the condition may be more severe or have an earlier onset from generation to generation. When an individual has a number of repeats in the normal range, it is not expected to expand when passed to the next generation. When the repeat number is in the premutation range (a normal, but unstable repeat number), then the repeats may or may not expandupon transmission to the next generation. Normal individuals who carry a premutation do not have the condition but are at risk of having a child who has inherited a triplet repeat in the full mutation range and who will be affected. TREDs can be autosomal dominant, autosomal recessive or X- linked. The more common triplet repeat disorders are autosomal dominant.

[0318] The repeats can be in the coding or noncoding portions of the mRNA. In the case of , Some examples of diseases caused by repeat sequences within coding regions are shown in Table A. Table A: Repeat Expansion Diseases in Which the Repeat Resides in the Coding Regions of mRNA SEQ ID Normal SEQ ID Disease Disease Gene Repeat NO: repeat NO: repeat

[0319] In some embodiments, the target RNA is one of those listed in Table A, or a precursor, isoform, fragment, or mutant thereof.

[0320] Some examples of diseases caused by repeat sequences within noncoding regions of mRNA are shown in Table B.Table B: Repeat Expansion Diseases in Which the Repeat Resides in the Noncoding Regions of mRNA SEQ ID Normal SEQ ID Disease Disease Gene RepeatRepeat NO: repeat NO: repeat location r 0 0

[0321] In some embodiments, the target RNA is one of those listed in Table B, or a precursor, isoform, fragment, or mutant thereof.

[0322] The toxicity that results from the repeat sequence can be direct consequence of the action of the toxic RNA itself, or, in cases in which the repeat expansion is in the coding sequence, due to the toxicity of the RNA and / or the aberrant protein. The repeat expansion RNA can act by sequestering critical RNA-binding proteins (RBP) into foci. One example of a sequestered RBP is the Muscleblind family protein MBNL1. Sequestration of RBPs leads to defects in splicing as well as defects in nuclear-cytoplasmic transport of RNA and proteins. Sequestration of RBPs also can affect miRNA biogenesis. These perturbations in RNA biology can profoundly affect neuronal function and survival, leading to a variety of neurological diseases.

[0323] Repeat sequences in RNA form secondary and tertiary structures that bind RBPs and affect normal RNA biology. One specific example disease is myotonic dystrophy (DM1; dystrophia myotonica), a common inherited form of muscle disease characterized by muscleweakness and slow relaxation of the muscles after contraction (Machuca-Tzili et al., Muscle Nerve32:1-18, 2005, hereby incorporated by reference) of the dystrophia myotonica protein kinase (DMPK) gene. This repeat-containing RNA causes the misregulation of alternative splicing of several developmentally regulated transcripts through effects on the splicing regulators MBNL1 and the CUG repeat binding protein (CELF1) (Wheeler et al., Science 325:336-339, 2009, hereby incorporated by reference). Small molecules that bindthe CUG repeat within the DMPK transcript would alter the RNA structure and prevent focus formation and alleviate the effects on these spicing regulators. Fragile X Syndrome (FXS), the most common inherited form of mental retardation, is the consequence of a CGG repeat expansion of the FMR1 gene (Lozano et al., Intractable Rare Dis. Res. 3:134-146, 2014,hereby incorporated by reference). FMRP is critical for the regulation of translation of manymRNAs and for protein trafficking, and it is an essential protein for synaptic development andneural plasticity. Thus, its deficiency leads to neuropathology. A small molecule targeting this CGG repeat RNA may alleviate the suppression of FMR1 mRNA and FMRP protein expression. Another TRED having a very high unmet medical need is Huntington’s disease (HD). HD is a progressive neurological disorder with motor, cognitive, and psychiatric changes (Zuccato et al., Physiol Rev.90:905-981, 2010, hereby incorporated by reference). It is characterized as a poly- glutamine or polyQ disorder since the CAG repeat within the coding sequence of the HTT gene leads to a protein having a poly-glutamine repeat that appears to have detrimental effects ontranscription, vesicle trafficking, mitochondrial function, and proteasome activity. However, theHTT CAG repeat RNA itself also demonstrates toxicity, including the sequestration of MBNL1 protein into nuclear inclusions. One other specific example is the GGGGCC repeat expansion in the C9orf72 (chromosome 9 open reading frame 72) gene that is prevalent in both familial frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS) (Ling et al., Neuron 79:416-438, 2013; Haeusler et al., Nature 507:195-200, 2014, hereby incorporated by reference). The repeat RNA structures form nuclear foci that sequester critical RNA binding proteins. The GGGGCC repeat RNA also binds and sequesters RanGAP1 to impair nucleocytoplasmic transport of RNA and proteins (Zhang et al., Nature 525:56-61, 2015, hereby incorporated by reference). Selectively targeting any of these repeat expansion RNAs could add therapeutic benefit in these neurological diseases.

[0324] The present invention includes a method of treating a disease or disorder wherein aberrant RNAs themselves cause pathogenic effects, rather than acting through the agency of protein expression or regulation of protein expression. In some embodiments, the target RNA is a repeat RNA, such as those described herein or in Table A or Table B. In some embodiments, the repeat RNA mediates or is implicated in a repeat expansion disease in which the repeat resides in the coding regions of mRNA. In some embodiments, the disease or disorder is a repeat expansion disease in which the repeat resides in the noncoding regions of mRNA. In some embodiments, thedisease or disorder is selected from Huntington’s disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), spinal-bulbar muscular atrophy (SBMA), or a spinocerebellar ataxia (SCA) selected from SCA1, SCA2, SCA3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, myotonic dystrophy (DM1 or dystrophiamyotonica), Friedreich’s Ataxia (FRDA), a spinocerebellar ataxia (SCA) selected from SCA8,SCA10, or SCA12, or C9FTD (amyotrophic lateral sclerosis or ALS).

[0325] In some embodiments, the disease is amyotrophic lateral sclerosis (ALS), Huntington’s disease (HD), frontotemporal dementia (FTD), myotonic dystrophy (DM1 or dystrophia myotonica), or Fragile X Syndrome.

[0326] Also provided is a method of producing a small molecule that modulates the activity of a target repeat expansion RNA to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to the target repeat expansion RNA; and analyzing the results by an RNA binding assay disclosed herein. In some embodiments, the repeat expansion RNA causes a disease or disorder selected from HD, DRPLA, SBMA, SCA1, SCA2, SCA3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, DM1, FRDA, SCA8, SCA10, SCA12, or C9FTD. Target RNAs and Diseases / Conditions

[0327] An association is known to exist between a large number of RNAs and diseases orconditions, some of which are shown below in Table C or Table D. Accordingly, in someembodiments of the methods described above, the target RNA transcript is selected from one ofthose in Table C or Table D. In some embodiments, the target RNA mediates or is implicated ina disease or disorder selected from one of those in Table C or Table D. Accordingly, the presentinvention further provides a method of treating a disease, disorder, or condition selected from oneof those in Table C or Table D, comprising the step of administering to a patient in need thereofan effective amount of a disclosed compound. In some embodiments, the method up- or down-regulates the target RNA transcript as shown in the “UP / DOWN REGULATION DESIRABLE?”column in Table C or Table D, below, thus treating the disease, disorder, or condition.Table C: Exemplary Target RNA Transcripts and Associated DiseasesUP / DOWN Therapeutic GENE CLASS REGULATION INDICATION(S) AreaUP / DOWN Therapeutic GENE CLASS REGULATION INDICATION(S) Area DESIRABLE?UP / DOWN Therapeutic GENE CLASS REGULATION INDICATION(S) Area DESIRABLE?UP / DOWN Therapeutic GENE CLASS REGULATION INDICATION(S) Area DESIRABLE?UP / DOWN Therapeutic GENE CLASS REGULATION INDICATION(S) Area DESIRABLE? aUP / DOWN Therapeutic GENE CLASS REGULATION INDICATION(S) Area DESIRABLE?Table D: Additional Target RNA Transcripts UP / DOWN COMMON E E LA RE LATI TA I DI ATISOX10 SOX10 HNF1B TCF2.

[0328] The compounds of this invention may be prepared or isolated in general by synthetic and / or semi-synthetic methods known to those skilled in the art for analogous compounds and bymethods described in detail in the Examples and Figures, herein.

[0329] In the schemes and chemical reactions depicted in the detailed description, Examples, and Figures, where a particular protecting group (“PG”), leaving group (“LG”), or transformation condition is depicted, one of ordinary skill in the art will appreciate that other protecting groups, leaving groups, and transformation conditions are also suitable and are contemplated. Such groups and transformations are described in detail in March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3rdEdition, John Wiley & Sons, 2018, and Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, the entirety of each of which is hereby incorporated herein by reference.

[0330] As used herein, the phrase “leaving group” (LG) includes, but is not limited to, halogens (e.g., fluoride, chloride, bromide, iodide), sulfonates (e.g., mesylate, tosylate, benzenesulfonate, brosylate, nosylate, triflate), diazonium, and the like.

[0331] As used herein, the phrase “oxygen protecting group” includes, for example, carbonyl protecting groups, hydroxyl protecting groups, etc. Hydroxyl protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, and Philip Kocienski, in Protecting Groups, Georg Thieme Verlag Stuttgart, New York, 1994, the entireties of which are incorporated herein by reference. Examples of suitable hydroxyl protecting groups include, but are not limited to, esters, allyl ethers, ethers, silyl ethers, alkyl ethers, arylalkyl ethers, and alkoxyalkyl ethers. Examples of such esters include formate, acetates, carbonates, and sulfonates. Specific examples include formate, benzoyl formate, chloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate, 4,4-(ethylenedithio)pentanoate, pivaloate (trimethylacetyl), crotonate, 4-methoxy-crotonate, benzoate, p-benzylbenzoate, 2,4,6-trimethylbenzoate, carbonates such as methyl, 9-fluorenylmethyl, ethyl, 2,2,2-trichloroethyl, 2-(trimethylsilyl)ethyl, 2-(phenylsulfonyl)ethyl, vinyl, allyl, and p- nitrobenzyl. Examples of such silyl ethers include trimethylsilyl, triethylsilyl, t- butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and other trialkylsilyl ethers. Alkyl ethers include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, allyl, and allyloxycarbonyl ethers or derivatives. Alkoxyalkyl ethers include acetals such as methoxymethyl, methylthiomethyl, (2-methoxyethoxy)methyl, benzyloxymethyl, beta- (trimethylsilyl)ethoxymethyl, and tetrahydropyranyl ethers. Examples of arylalkyl ethers include benzyl, p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, and 2- and 4-picolyl.

[0332] Amino protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, and Philip Kocienski, in Protecting Groups, Georg Thieme Verlag Stuttgart, New York, 1994, the entireties of which are incorporated herein by reference. Suitable amino protecting groups include, but are not limited to, aralkylamines, carbamates, cyclic imides, allyl amines, amides, and the like. Examples of such groups include t-butyloxycarbonyl (Boc), ethyloxycarbonyl, methyloxycarbonyl, trichloroethyloxycarbonyl, allyloxycarbonyl (Alloc), benzyloxocarbonyl (Cbz), allyl, phthalimide, benzyl (Bn), fluorenylmethylcarbonyl (Fmoc), formyl, acetyl, chloroacetyl, dichloroacetyl, trichloroacetyl, phenylacetyl, trifluoroacetyl, benzoyl, and the like.

[0333] One of skill in the art will appreciate that various functional groups present in compounds of the invention such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens and nitriles can be interconverted by techniques well known in the art including, but not limited to reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. See, for example, March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3rdEdition, John Wiley & Sons, 2018, the entirety of each of which is incorporated herein by reference. Such interconversions may require one or more of the aforementioned techniques, and certain methods for synthesizing compounds of the invention are described below.

[0334] One of skill in the art will appreciate that various functional groups present in compounds of the invention such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens and nitriles can be interconverted by techniques well known in the art including, but not limited to reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. Such groups and transformations are described in detail in March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3rdEdition, John Wiley & Sons, 2018, and Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014,the entirety of each of which is hereby incorporated herein by reference. Such interconversionsmay require one or more of the aforementioned techniques, and certain methods for synthesizingcompounds of the invention are described below in the Exemplification and Figures.EXEMPLIFICATION

[0335] As depicted in the Examples below, exemplary compounds are prepared according to the following general procedures and used in biological assays and other procedures described generally herein. It will be appreciated that, although the general methods depict the synthesis of certain compounds of the present invention, the following general methods, and other methods known to one of ordinary skill in the art, can be applied to all compounds and subclasses and species of each of these compounds, as described herein. Similarly, assays and other analyses can be adapted according to the knowledge of one of ordinary skill in the art. Example 1: Binding of selected compounds to CNOT9 and CNOT9:1 complex

[0336] Selected compounds (See FIGs.2A and 2B) were evaluated for binding to CNOT9 and a CNOT9:1 complex. The CNOT1 protein used in the CNOT9:1 complex is CNOT1 (1356-1607), which is not the full CNOT1 protein as it does not include the Heat domains of CNOT1. The CNOT9 used separately or in the complex CNOT9:1 complex was CNOT9 (19-285). Surface plasmon resonance (SPR) was used to evaluate the binding of compounds to either CNOT9 (19- 285) alone or to the CNOT1(1356-1607):CNOT9(19-285) complex. Experiments were performed on a Biacore 8K (Cytiva) with a running buffer consisting of 20mM HEPES pH7.5, l00mM KCl, 3mM MgC12, lmM TCEP, 0.05% tween-20, 2% DMSO. For binding to CNOT9, biotinylatedCNOT9 (19-285) (Helix Biostructures) at a concentration of 70µg / ml was immobilized to a streptavidin coated chip (Cytiva sensor chip SA) for 1200 sec at a flow rate of 5µl / min (typical immobilization level 13,000 RU). For binding to the CNOT1:CNOT9 complex, a complex consisting of CNOT1(1356-1607) and N-terminally His tagged CNOT9 (19-285) (Proteros) at a concentration of 70ug / ml was immobilized to a NiNTA coated chip (Cytiva NiNTA) for 1200 secat a flow rate of 5ul / min (typical immobilization level 16,000 RU). For compound bindingexperiments, various concentrations of analyte were flowed over the chip with 120sec association phase, 120sec dissociation phase, at a flow rate of 30ul / min and collection rate of l0Hz. Reference channel subtraction, blank subtraction and solvent correction were applied to all sensorgrams prior to data analysis. Sensorgrams were fit to 1: 1 steady state affinity model. The data are provided in FIG.3. Example 2: Evaluating the deadenylation / degradation of RNA by CCR4-NOT core complex and the acceleration of deadenylation / degradation by bifunctional molecules

[0337] An assay was established that showed the ability of CCR4-NOT core complex to deadenylate / degrade RNA, and the acceleration of such deadenylation / degradation by bifunctional molecules. Fluorescently labeled RNA substrates were synthesized (Integrated DNA Technologies) with the following sequences: 5’ FAM– AGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACUCUUUUCUAAAA AAAAAA (SEQ ID NO:1)

[0338] 5’ FAM– AGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACUCUUUUCU (SEQ ID NO:2).

[0339] SEQ ID NO:2 corresponds to RNA Sequence X, while SEQ ID NO:1 corresponds to SEQ ID NO:2 with a poly-A tail. RNA Substrates (500 nM) were prepared in the following buffer conditions: 50 mM HEPES pH 7.3, 10 mM KCl, 45 mM NaCl, 2 mM MgCl2, 0.1 mM TCEP, 0.5% glycerol.

[0340] The CCR4-NOT core complex consists of a minimal unit of CNOT9, the CNOT1 scaffold (consisting of amino acids 1356-1607) and the CNOT6 and CNOT7 exonucleases (See e.g., Raisch et al., Nature Communications 2019). CNOT7 exonuclease is also tagged with C-terminal FKBP(F36V) (FKBPV) to allow for the use of positive control heterobifunctionals (HBFs) if desired. In this biochemical assay, the core complex is therefore recruited to the RNA substrate via compound interactions with CNOT9 and / or the CNOT9:CNOT1 scaffold, and then the exonucleases can deadenylate / degrade the RNA substrate. The proteins of the core complex were expressed as separate heterodimers (CNOT6:CNOT7-FKBPV and CNOT9:CNOT1),purified, and combined to form a reconstituted core complex. The core complex is depicted inFIG.4.

[0341] FIG. 2B shows bifunctional molecules (HBFs) that were evaluated for their ability toaccelerate degradation of RNA by the CCR4-NOT core complex. The bifunctional molecules consist of a CNOT9 binding moiety coupled to a linker and the following rSM: S N N O which binds to the RNA sefunctional compound consists of the rSM conjugated to a CBM peptide that is a known binder to CNOT9 (Keskeny et al., 2019, Genes Dev 33: 236).

[0342] The assay that was used to evaluate the bifunctional molecules was performed as follows: Fluorescently labeled RNA substrates were refolded in the presence of Mg2+and incubated with increasing concentrations of bifunctional molecules before the enzymatic reaction was initiated with the addition of the CCR4-NOT core complex, including CNOT9. The reactionswere incubated at 37 °C for 30 minutes and then quenched by the additional of formamide loadingdye including 10 mM EDTA. RNA was then separated by PAGE and visualized using the fluorescent label. As shown in FIG. 4, the heterobifunctional compounds (HBFs) can deadenylate / degrade the RNA in 30 minutes with as little as 10 nM HBF. The HBFs do not accelerate deadenylation when only the CNOT6:7 proteins are added (data not shown).

[0343] FIG. 5 shows that the degrader activity of the bifunctional molecules can be outcompeted with unconjugated (“free”) rSM and the unconjugated (“free”) CNOT9 bindingcompound (“bait”, e.g., I-2). A 50X amount of competitor is required for strong competition.Competition is stronger with rSM than with the CNOT9 binding compound.

Claims

CLAIMS 1. A compound of Formula A: RNA1BinderLDFL or a pharmaceutically acceptablRNA Binder is a moiety that binds to a target RNA transcript;DFL is a Decay Factor-recruiting Ligand; and-L1- is a bivalent linker group that covalently connects the RNA Binder to the DFL; wherein the DFL binds to or recruits a decay factor; wherein the DFL binds to or recruits one ormore decay factors that degrade the target RNA transcript.

2. The compound of claim 1, wherein the RNA Binder is an oligonucleotide, a polypeptide or an RNA-binding small molecule (rSM).

3. The compound of claim 1, wherein the RNA Binder is an oligonucleotide.

4. The compound of claim 1, wherein the RNA Binder is an rSM.

5. A compound of Formula B: 1or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L1- is a bivalent linker group that covalently connects the rSM to the DFL; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript.DFL 6. The compound of claim 5, whereiis a compound of Formula Ia or FormulaIb:O O R4L2R4L23por a pharmaceutically acceptable salt thereof, wherein: Ring A is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; Ring B is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; Ring C is phenyl, or a 5-6 membered monocyclic heteroaromatic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; X is NR8, CR9R10, O or S; Y is CH2 or C=O; each occurrence of R1, R2and R3is independently H, optionally substituted C1-6aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, halogen, -CN, -C(O)OR, -OC(O)R, -C(O)N(R)2, -N(R)C(O)R, - N(R)C(O)N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -OR, -N(R)2, -NO2, -SR, -S(O)R, -S(O)2R, - S(O)2N(R)2, or -NRS(O)2R; R4is H, optionally substituted C1-6 aliphatic, an optionally substituted ring selected from a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, -OR, or -N(R)2; R5is H, or optionally substituted C1-6aliphatic; R6and R7are each independently H, or optionally substituted C1-6aliphatic; R8is H, or optionally substituted C1-6 aliphatic;R9and R10are each independently H; optionally substituted C1-6aliphatic; or R9and R10, taken together with the carbon to which they are attached, form a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; -L2- is a covalent bond or a C1-8 bivalent optionally substituted straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; each R is independently hydrogen or an optionally substituted group selected from C1-6aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 memberedbicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatomsindependently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; m is 0, 1, 2, or 3; n is 0, 1, 2, or 3; andp is 0, 1, 2, or 3; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of FormulaIa or Ib.

7. The compound of claim 5 or 6, wherein Ring A is selected froO , N NN HN S .

8. The compound of any one of claims 5 to 7, wherein Ring B is selected fro ,N ON N N O .

9. The compound of any one of claims 5 to 8, wherein Ring C is selected fro ,N N N N NN and10. The compound of any one of claims 5 to 9, wherein X is selected from NR8, CR9R10, O and S.

11. The compound of any one of claims 5 to 10, wherein Y is selected from CH2 or C=O.

12. The compound of any one of claims 5 to 11, wherein R1is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, and i-Pr.

13. The compound of any one of claims 5 to 12, wherein R2is selected from H, F, Cl, CN, Br, OH, -OMe, Me, Et, and i-Pr.

14. The compound of any one of claims 5 to 13, wherein R3is selected from H, F, Cl, CN, Br, OH -OMe Me Et i-Pr and .

15. The compound of any one of claims 5 to 14, wherein R4is selected from H, NHCH3, N .

16. The compound of any one of claims 5 to 15, wherein R5is H or Me.

17. The compound of any one of claims 5 to 16, wherein R6is H.

18. The compound of any one of claims 5 to 17, wherein R7is H.

19. The compound of any one of claims 5 to 18, wherein R8is selected from H, Me, and CH2OMe.

20. The compound of any one of claims 5 to 19, wherein R9is H.

21. The compound of any one of claims 5 to 20, wherein R10is H.

22. The compound of any one of claims 5 to 19, wherein R9and R10, taken together with the carbon to which they are attached, form a cyclopropane or an oxetane ring.

23. The compound of any one of claims 5 to 22, wherein -L2- is selected fro , OH, H , H , ,24. The compound of any one of claims 5 to 23, wherein the compound is of Formula II:O N L2or a pharmaceutically acceptawherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula II.

25. The compound of any one of claims 5 to 23, wherein the compound is of Formula III: O L2or a pharmaceutically acceptawherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula III.

26. The compound of any one of claims 5 to 23, wherein the compound is of Formula IV:O N L2or a pharmaceutically acceptable salt thereof; wherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula IV.

27. The compound of any one of claims 5 to 23, wherein the compound is of Formula V: O L2or a pharmaceutically acceptwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula V.

28. The compound of any one of claims 5 to 23, wherein the compound is of Formula VI:O N L2or a pharmaceutically acceptwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VI.

29. The compound of any one of claims 5 to 23, wherein the compound is of Formula VII: O L2or a pharmaceutically acceptablwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VII.

30. The compound of any one of claims 5 to 23, wherein the compound is of Formula VIII:O N L2or a pharmaceutically acceptabwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula VIII.

31. The compound of any one of claims 5 to 23, wherein the compound is of Formula IX: O L2or a pharmaceutically acceptablwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula IX.

32. The compound of any one of claims 5 to 23, wherein the compound is of Formula X:O N L2or a pharmaceutically acceptwherein a covalent bond to -L1- replaces a hydrogen at any position of the compound of Formula X.

33. The compound of any one of claims 1-32, wherein -L1- is a covalent bond or a bivalent C1-20straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, - (R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH2CH2O-; each R is independently hydrogen or an optionally substituted group selected from C1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

34. The compound of any one of claims 1-32, wherein -L1- is a covalent bond or a C1-8 bivalentstraight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, - (R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; each R is independently hydrogen or an optionally substituted group selected from C1-6aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; and each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatomsindependently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or anoptionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

35. The compound of any one of claims 1-32, wherein -L1- is a covalent bond or a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50 hydrocarbon chain,wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L1- are independently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, - O q ,atic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy- is independently a bivalent optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ringhaving 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur;each -Cy2- is independently an optionally substituted bivalent ring selected from phenylenyl, an8-12 membered bicyclic arylenyl, a 3-8 membered saturated or partially unsaturated carbocyclylenyl, an 8-12 membered bicyclic saturated or partially unsaturated carbocyclylenyl, a 3-8 membered saturated or partially unsaturated heterocyclylenyl having 1- 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-12 membered bicyclic saturated or partially unsaturated heterocyclylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered heteroarylenyl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroarylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; and each q is independently 1, 2, or 3.

36. A compound of any of the preceding claims, wherein the decay factor is a protein that binds or interacts with RNA (an RBP) and wherein the interaction of the RBP with the RNA leads to modulation of the target RNA transcript in vivo.

37. The compound of claim 36, wherein the RBP is part of the CCR4-NOT (Carbon CataboliteRepression-Negative On TATA-less) complex.

38. The compound of any one of the preceding claims, wherein the target RNA transcript is anmRNA or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof.

39. The compound of any one of the preceding claims, wherein the target RNA transcript is selected from one of those listed in Table C or D; or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof.

40. The compound of any one of the preceding claims, wherein the rSM is selected from anyone of those described in the disclosure under the heading RNA-Binding Small Molecules (rSMs).

41. The compound of any one of the preceding claims, wherein the rSM is one of those shownin Table 2.

42. A pharmaceutical composition comprising the compound of any one of the precedingclaims, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

43. A method of modifying the amount of a protein in a cell, the method comprising administering the compound or composition of any of the preceding claims, or a pharmaceuticallyacceptable salt thereof, that acts on a target RNA transcript or a precursor, isoform, fragment, ormutant thereof, in an amount sufficient to modify the amount of the protein in the cell.

44. The method of claim 43, wherein modifying the amount of a protein in a cell is reducing the amount of protein in the cell.

45. A method of modulating the availability for protein translation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, that binds to the target RNA transcript or an isoform, fragment, or mutant thereof.

46. A method of modulating the translation of a target protein or mutant thereof, comprising contacting a target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition of any one of preceding claims, or a pharmaceutically acceptable salt thereof.

47. A method of decreasing the half-life or increasing degradation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNAtranscript or the precursor, isoform, fragment, or mutant thereof with the compound or compositionof any one of the preceding claims, or a pharmaceutically acceptable salt thereof.

48. A method of treating a disease, comprising administering to a subject in need thereof thecompound or composition of any one of preceding claims, or a pharmaceutically acceptable salt thereof.

49. The method of claim 48, wherein the disease is characterized by an aberrant level of aprotein in a cell.

50. The method of claim 49, wherein the disease is one of those listed in Table C or D.

51. The method of claim 50, wherein the disease is a cancer.

Citation Information

Patent Citations

  • Systems and methods for modulating RNA

    US20220048962A1

  • Bifunctional molecules and methods of using thereof

    US20230167450A1

  • RNA degraders and uses thereof

    WO2024112918A1